#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRDM2	7799	hgsc.bcm.edu	37	1	14068533	14068533	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr1:14068533G>T	ENST00000235372.7	+	5	1121	c.265G>T	c.(265-267)Gat>Tat	p.D89Y	PRDM2_ENST00000502727.1_3'UTR|PRDM2_ENST00000311066.5_Missense_Mutation_p.D89Y|PRDM2_ENST00000376048.5_Missense_Mutation_p.D89Y	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	89	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GATGTGCATTGATGCCACTGA	0.383																																					p.D89Y		Atlas-SNP	.											.	PRDM2	147	.	0			c.G265T						PASS	.						78.0	72.0	74.0					1																	14068533		2203	4300	6503	SO:0001583	missense	7799	exon5			TGCATTGATGCCA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.265G>T	chr1.hg19:g.14068533G>T	ENSP00000235372:p.Asp89Tyr	76.0	0.0	.		65.0	35.0	.	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	hg19	CCDS150.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160930	0.57368	.	.	ENSG00000116731	ENST00000484063;ENST00000376048;ENST00000235372;ENST00000311066;ENST00000400800	D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4	5.95	5.95	0.96441	SET domain (2);	0.000000	0.85682	D	0.000000	D	0.97826	0.9286	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98389	1.0562	10	0.87932	D	0	.	18.957	0.92662	0.0:0.0:1.0:0.0	.	89;89;89	Q13029;Q13029-2;B1AJZ4	PRDM2_HUMAN;.;.	Y	80;89;89;89;89	ENSP00000423010:D80Y;ENSP00000365216:D89Y;ENSP00000235372:D89Y;ENSP00000312352:D89Y	ENSP00000235372:D89Y	D	+	1	0	PRDM2	13941120	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.957000	0.93082	2.824000	0.97209	0.655000	0.94253	GAT	.	.	.	none		0.383	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
CAPN13	92291	hgsc.bcm.edu	37	2	30966306	30966306	+	Missense_Mutation	SNP	C	C	A	rs372490936	byFrequency	TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr2:30966306C>A	ENST00000295055.8	-	13	1564	c.1388G>T	c.(1387-1389)cGg>cTg	p.R463L	CAPN13_ENST00000534090.2_Missense_Mutation_p.R463L	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	463					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TGATTTTCTCCGTGTCTGTGC	0.438																																					p.R463L		Atlas-SNP	.											.	CAPN13	70	.	0			c.G1388T						PASS	.						256.0	247.0	250.0					2																	30966306		1893	4135	6028	SO:0001583	missense	92291	exon13			TTTCTCCGTGTCT		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1388G>T	chr2.hg19:g.30966306C>A	ENSP00000295055:p.Arg463Leu	446.0	0.0	.		458.0	21.0	.	NM_144575	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	hg19	CCDS46252.1	.	.	.	.	.	.	.	.	.	.	C	9.805	1.181471	0.21787	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	D;D	0.88741	-2.42;-2.42	5.52	-11.0	0.00169	Peptidase C2, calpain, large subunit, domain III (2);	30.332300	0.00166	N	0.000005	T	0.76730	0.4028	N	0.08118	0	0.09310	N	1	B;B	0.33448	0.412;0.412	B;B	0.36030	0.216;0.216	T	0.69855	-0.5032	10	0.38643	T	0.18	.	11.994	0.53191	0.0:0.0951:0.2979:0.607	.	463;463	A8K2N3;Q6MZZ7	.;CAN13_HUMAN	L	463	ENSP00000295055:R463L;ENSP00000431298:R463L	ENSP00000295055:R463L	R	-	2	0	CAPN13	30819810	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.578000	0.02125	-2.242000	0.00708	-1.069000	0.02264	CGG	.	.	.	alt		0.438	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
SRSF7	6432	hgsc.bcm.edu	37	2	38978383	38978384	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr2:38978383_38978384GC>AA	ENST00000313117.6	-	1	252_253	c.15_16GC>TT	c.(13-18)ggGCgg>ggTTgg	p.R6W	GEMIN6_ENST00000409011.1_5'Flank|SRSF7_ENST00000409276.1_Missense_Mutation_p.R6W|SRSF7_ENST00000446327.2_Missense_Mutation_p.R6W	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	6					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCTCCGTACCGCCCGTAACGCG	0.624																																					p.R6W|p.G5G		Atlas-SNP	.											.	SRSF7	29	.	0			c.C16T|c.G15T						PASS	.																																			SO:0001583	missense	6432	exon1			CGTACCGCCCGTA|GTACCGCCCGTAA	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.15_16delinsAA	chr2.hg19:g.38978383_38978384delinsAA	ENSP00000325905:p.Arg6Trp	128.0	0.0	.		88.0|87.0	34.0|32.0	.	NM_001195446	B4DLU6|G5E9M3|Q564D3	Missense_Mutation|Silent	SNP	ENST00000313117.6	hg19	CCDS33183.1																																																																																			.	.	.	none		0.624	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
ANKZF1	55139	hgsc.bcm.edu	37	2	220099828	220099828	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr2:220099828G>T	ENST00000323348.5	+	10	1659	c.1485G>T	c.(1483-1485)tgG>tgT	p.W495C	GLB1L_ENST00000497855.1_5'Flank|ANKZF1_ENST00000409849.1_Missense_Mutation_p.W285C|ANKZF1_ENST00000410034.3_Missense_Mutation_p.W495C	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	495						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGAGCTCTGGAATGCACTGC	0.587																																					p.W495C		Atlas-SNP	.											.	ANKZF1	45	.	0			c.G1485T						PASS	.						51.0	55.0	53.0					2																	220099828		2017	4171	6188	SO:0001583	missense	55139	exon10			GCTCTGGAATGCA	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1485G>T	chr2.hg19:g.220099828G>T	ENSP00000321617:p.Trp495Cys	68.0	0.0	.		57.0	22.0	.	NM_001042410	Q9NVZ4	Missense_Mutation	SNP	ENST00000323348.5	hg19	CCDS42821.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.709332	0.30322	.	.	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.52983	0.64;0.64;0.64	5.41	4.51	0.55191	Ankyrin repeat-containing domain (2);	0.253027	0.37955	N	0.001878	T	0.43942	0.1270	M	0.65975	2.015	0.53005	D	0.999964	B	0.15141	0.012	B	0.17722	0.019	T	0.38265	-0.9669	10	0.37606	T	0.19	-6.7572	8.4061	0.32616	0.0:0.1513:0.5358:0.313	.	495	Q9H8Y5	ANKZ1_HUMAN	C	495;285;495	ENSP00000321617:W495C;ENSP00000386815:W285C;ENSP00000386337:W495C	ENSP00000321617:W495C	W	+	3	0	ANKZF1	219808072	1.000000	0.71417	0.983000	0.44433	0.353000	0.29299	1.765000	0.38481	1.473000	0.48159	0.591000	0.81541	TGG	.	.	.	none		0.587	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
ZBTB11	27107	hgsc.bcm.edu	37	3	101390912	101390912	+	Silent	SNP	C	C	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr3:101390912C>A	ENST00000312938.4	-	2	1036	c.456G>T	c.(454-456)tcG>tcT	p.S152S	ZBTB11_ENST00000461821.1_Silent_p.S152S	NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	152					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S152S(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						GGTCATCTTCCGATTCATTAC	0.413																																					p.S152S		Atlas-SNP	.											.	ZBTB11	77	.	1	Substitution - coding silent(1)	lung(1)	c.G456T						PASS	.						170.0	167.0	168.0					3																	101390912		2203	4300	6503	SO:0001819	synonymous_variant	27107	exon2			ATCTTCCGATTCA	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.456G>T	chr3.hg19:g.101390912C>A		107.0	0.0	.		186.0	11.0	.	NM_014415	Q2NKP9	Silent	SNP	ENST00000312938.4	hg19	CCDS2943.1																																																																																			.	.	.	none		0.413	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
KY	339855	hgsc.bcm.edu	37	3	134323200	134323200	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr3:134323200C>A	ENST00000423778.2	-	11	1268	c.1207G>T	c.(1207-1209)Gag>Tag	p.E403*	KY_ENST00000503669.1_3'UTR|KY_ENST00000508956.1_Nonsense_Mutation_p.E382*	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	403					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						GGGTACACCTCCAACTTCATC	0.542																																					p.E403X		Atlas-SNP	.											.	KY	92	.	0			c.G1207T						PASS	.						87.0	86.0	86.0					3																	134323200		2128	4244	6372	SO:0001587	stop_gained	339855	exon11			ACACCTCCAACTT	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1207G>T	chr3.hg19:g.134323200C>A	ENSP00000397598:p.Glu403*	111.0	0.0	.		143.0	104.0	.	NM_178554	B7Z1S4|Q6ZT15	Nonsense_Mutation	SNP	ENST00000423778.2	hg19	CCDS46920.1	.	.	.	.	.	.	.	.	.	.	C	36	5.846292	0.97016	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000310263	.	.	.	5.48	5.48	0.80851	.	0.368781	0.27393	N	0.019579	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-14.9747	19.3474	0.94370	0.0:1.0:0.0:0.0	.	.	.	.	X	382;403;403	.	ENSP00000309520:E403X	E	-	1	0	KY	135805890	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.042000	0.57347	2.578000	0.87016	0.561000	0.74099	GAG	.	.	.	none		0.542	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554	
PPAT	5471	hgsc.bcm.edu	37	4	57272675	57272675	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr4:57272675G>C	ENST00000264220.2	-	3	525	c.388C>G	c.(388-390)Cga>Gga	p.R130G	PPAT_ENST00000507648.1_5'UTR	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	130	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	TTCCTTAATCGAGCAGCATTT	0.378																																					p.R130G		Atlas-SNP	.											.	PPAT	41	.	0			c.C388G						PASS	.						142.0	123.0	129.0					4																	57272675		2203	4300	6503	SO:0001583	missense	5471	exon3			TTAATCGAGCAGC		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.388C>G	chr4.hg19:g.57272675G>C	ENSP00000264220:p.Arg130Gly	88.0	0.0	.		118.0	5.0	.	NM_002703		Missense_Mutation	SNP	ENST00000264220.2	hg19	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.281110	0.40394	.	.	ENSG00000128059	ENST00000264220	T	0.76316	-1.01	5.62	4.77	0.60923	Glutamine amidotransferase, type II (1);Glutamine amidotransferase, class-II (1);	0.411032	0.27031	N	0.021280	T	0.72471	0.3464	L	0.35854	1.095	0.18873	N	0.999989	B	0.20368	0.044	B	0.27500	0.08	T	0.64550	-0.6381	10	0.51188	T	0.08	-1.2675	16.5121	0.84288	0.0:0.131:0.869:0.0	.	130	Q06203	PUR1_HUMAN	G	130	ENSP00000264220:R130G	ENSP00000264220:R130G	R	-	1	2	PPAT	56967432	0.694000	0.27738	0.732000	0.30844	0.986000	0.74619	5.006000	0.63978	1.352000	0.45808	0.585000	0.79938	CGA	.	.	.	none		0.378	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
PHYKPL	85007	hgsc.bcm.edu	37	5	177632984	177632984	+	IGR	SNP	G	G	A	rs201431713		TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr5:177632984G>A	ENST00000308158.5	-	0	2038				PHYKPL_ENST00000481811.1_5'Flank|HNRNPAB_ENST00000506339.1_Silent_p.L117L|HNRNPAB_ENST00000514633.1_Silent_p.L117L|HNRNPAB_ENST00000355836.5_Silent_p.L117L|HNRNPAB_ENST00000506259.1_Silent_p.L117L|HNRNPAB_ENST00000515193.1_Silent_p.L117L|HNRNPAB_ENST00000358344.3_Silent_p.L117L|HNRNPAB_ENST00000504898.1_Silent_p.L117L	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase							mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	GGTTTATCCTGTTCAAAGATG	0.408																																					p.L117L		Atlas-SNP	.											.	HNRNPAB	24	.	0			c.G351A						PASS	.						129.0	126.0	127.0					5																	177632984		2203	4300	6503	SO:0001628	intergenic_variant	3182	exon3			TATCCTGTTCAAA	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892		chr5.hg19:g.177632984G>A		193.0	0.0	.		198.0	104.0	.	NM_031266	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	ENST00000308158.5	hg19	CCDS4434.1																																																																																			.	G|0.999;C|0.001	.	alt		0.408	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
ICK	22858	hgsc.bcm.edu	37	6	52878690	52878690	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr6:52878690G>C	ENST00000350082.5	-	9	1268	c.922C>G	c.(922-924)Ctg>Gtg	p.L308V	ICK_ENST00000356971.3_Missense_Mutation_p.L308V	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	308					intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					GCCTTTTCCAGGATGCCTTTC	0.512																																					p.L308V		Atlas-SNP	.											.	ICK	62	.	0			c.C922G						PASS	.						137.0	113.0	121.0					6																	52878690		2203	4300	6503	SO:0001583	missense	22858	exon10			TTTCCAGGATGCC	AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.922C>G	chr6.hg19:g.52878690G>C	ENSP00000263043:p.Leu308Val	49.0	0.0	.		48.0	23.0	.	NM_016513	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	ENST00000350082.5	hg19	CCDS4949.1	.	.	.	.	.	.	.	.	.	.	G	3.787	-0.044509	0.07452	.	.	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.72282	-0.64;-0.64	6.06	5.18	0.71444	Protein kinase-like domain (1);	1.200720	0.05905	N	0.630645	T	0.33498	0.0865	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.26677	-1.0096	10	0.15499	T	0.54	5.3033	15.6578	0.77155	0.0661:0.0:0.9339:0.0	.	308	Q9UPZ9	ICK_HUMAN	V	308	ENSP00000263043:L308V;ENSP00000349458:L308V	ENSP00000263043:L308V	L	-	1	2	ICK	52986649	0.844000	0.29557	0.232000	0.24009	0.396000	0.30629	3.921000	0.56454	1.551000	0.49450	0.655000	0.94253	CTG	.	.	.	none		0.512	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040952.1	NM_016513	
CCM2	83605	hgsc.bcm.edu	37	7	45112359	45112359	+	Silent	SNP	C	C	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:45112359C>T	ENST00000258781.6	+	7	929	c.780C>T	c.(778-780)acC>acT	p.T260T	CCM2_ENST00000541586.1_Silent_p.T202T|CCM2_ENST00000381112.3_Silent_p.T281T|CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000474617.1_Silent_p.T163T|CCM2_ENST00000475551.1_Silent_p.T254T|CCM2_ENST00000544363.1_Silent_p.T169T	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	260					blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						TTAAGGAGACCTACGAGGTGG	0.507																																					p.T281T		Atlas-SNP	.											.	CCM2	42	.	0			c.C843T						PASS	.						102.0	87.0	92.0					7																	45112359		2203	4300	6503	SO:0001819	synonymous_variant	83605	exon7			GGAGACCTACGAG	BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.780C>T	chr7.hg19:g.45112359C>T		93.0	0.0	.		174.0	41.0	.	NM_001029835	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Silent	SNP	ENST00000258781.6	hg19	CCDS5500.1	.	.	.	.	.	.	.	.	.	.	C	7.888	0.731770	0.15507	.	.	ENSG00000136280	ENST00000480382	.	.	.	5.55	-2.66	0.06077	.	.	.	.	.	T	0.41328	0.1154	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28235	-1.0050	4	.	.	.	-0.5904	2.9764	0.05939	0.3625:0.1562:0.3533:0.128	.	.	.	.	L	127	.	.	P	+	2	0	CCM2	45078884	0.004000	0.15560	0.000000	0.03702	0.904000	0.53231	-0.395000	0.07287	-0.809000	0.04381	-0.165000	0.13383	CCT	.	.	.	none		0.507	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251348.1	NM_031443	
TBRG4	9238	hgsc.bcm.edu	37	7	45145054	45145054	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:45145054G>T	ENST00000258770.3	-	3	842	c.721C>A	c.(721-723)Cgc>Agc	p.R241S	SNORA5B_ENST00000363786.1_RNA|TBRG4_ENST00000494076.1_Missense_Mutation_p.R241S|SNORA5C_ENST00000364902.1_RNA|SNORA5A_ENST00000384111.1_RNA|TBRG4_ENST00000395655.4_Missense_Mutation_p.R241S|TBRG4_ENST00000471142.1_5'Flank|TBRG4_ENST00000361278.3_Missense_Mutation_p.R241S	NM_004749.3	NP_004740.2	Q969Z0	TBRG4_HUMAN	transforming growth factor beta regulator 4	241					cell cycle arrest (GO:0007050)|cellular respiration (GO:0045333)|positive regulation of cell proliferation (GO:0008284)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(2)	17						TCTTCCAGGCGGTTCATTAGT	0.557																																					p.R252S		Atlas-SNP	.											.	TBRG4	52	.	0			c.C754A						PASS	.						89.0	88.0	88.0					7																	45145054		2203	4300	6503	SO:0001583	missense	9238	exon3			CCAGGCGGTTCAT	AB023165	CCDS5501.1, CCDS5502.1	7p13	2006-07-07			ENSG00000136270	ENSG00000136270			17443	protein-coding gene	gene with protein product	"""FAST kinase domains 4"", ""cell cycle progression 2 protein"""	611325				9383053	Standard	NM_004749		Approved	Cpr2, KIAA0948, H_TD2522F11.8, FASTKD4	uc011kcd.3	Q969Z0	OTTHUMG00000129247	ENST00000258770.3:c.721C>A	chr7.hg19:g.45145054G>T	ENSP00000258770:p.Arg241Ser	195.0	0.0	.		294.0	12.0	.	NM_001261834	A4D2L2|A4D2L3|D3DVL5|D3DVL6|O14710|Q53GI8|Q8NDM4|Q9BUC6|Q9Y2F6	Missense_Mutation	SNP	ENST00000258770.3	hg19	CCDS5501.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095624	0.36952	.	.	ENSG00000136270	ENST00000258770;ENST00000361278;ENST00000395655;ENST00000494076;ENST00000478532;ENST00000461363	T;T;T;T;T;T	0.34859	2.95;1.98;1.98;2.95;1.34;1.34	5.75	4.87	0.63330	.	0.223036	0.46145	D	0.000310	T	0.40247	0.1109	M	0.63843	1.955	0.33015	D	0.528002	P;P;P	0.45240	0.854;0.628;0.605	P;B;B	0.45610	0.487;0.203;0.336	T	0.54529	-0.8280	10	0.28530	T	0.3	.	11.7854	0.52039	0.0815:0.0:0.9185:0.0	.	252;241;241	B4DU42;Q969Z0-2;Q969Z0	.;.;TBRG4_HUMAN	S	241;241;241;241;206;187	ENSP00000258770:R241S;ENSP00000354992:R241S;ENSP00000379016:R241S;ENSP00000420597:R241S;ENSP00000418631:R206S;ENSP00000417743:R187S	ENSP00000258770:R241S	R	-	1	0	TBRG4	45111579	1.000000	0.71417	0.988000	0.46212	0.823000	0.46562	3.043000	0.49823	1.432000	0.47375	-0.136000	0.14681	CGC	.	.	.	none		0.557	TBRG4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251351.1	NM_030900	
PTPN12	5782	hgsc.bcm.edu	37	7	77267951	77267951	+	Silent	SNP	G	G	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:77267951G>T	ENST00000248594.6	+	17	2456	c.2184G>T	c.(2182-2184)gcG>gcT	p.A728A	PTPN12_ENST00000435495.2_Silent_p.A598A|PTPN12_ENST00000415482.2_Silent_p.A609A	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	728					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						ATCATCCAGCGGGAGGTATTC	0.353																																					p.A728A		Atlas-SNP	.											.	PTPN12	83	.	0			c.G2184T						PASS	.						106.0	108.0	107.0					7																	77267951		2203	4300	6503	SO:0001819	synonymous_variant	5782	exon17			TCCAGCGGGAGGT		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.2184G>T	chr7.hg19:g.77267951G>T		178.0	0.0	.		328.0	14.0	.	NM_002835	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Silent	SNP	ENST00000248594.6	hg19	CCDS5592.1																																																																																			.	.	.	none		0.353	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
ZKSCAN1	7586	hgsc.bcm.edu	37	7	99621201	99621201	+	Silent	SNP	A	A	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:99621201A>G	ENST00000324306.6	+	2	306	c.72A>G	c.(70-72)gtA>gtG	p.V24V	ZKSCAN1_ENST00000426572.1_5'UTR|ZKSCAN1_ENST00000535170.1_Intron	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	24					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			ATGGTATCGTAATAGTGAAGG	0.542																																					p.V24V		Atlas-SNP	.											.	ZKSCAN1	59	.	0			c.A72G						PASS	.						94.0	83.0	87.0					7																	99621201		2203	4300	6503	SO:0001819	synonymous_variant	7586	exon2			TATCGTAATAGTG	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.72A>G	chr7.hg19:g.99621201A>G		121.0	0.0	.		191.0	48.0	.	NM_003439	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Silent	SNP	ENST00000324306.6	hg19	CCDS34698.1																																																																																			.	.	.	none		0.542	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439	
CNTNAP2	26047	hgsc.bcm.edu	37	7	147336337	147336337	+	Silent	SNP	C	C	A	rs539741829		TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:147336337C>A	ENST00000361727.3	+	13	2553	c.2037C>A	c.(2035-2037)gcC>gcA	p.A679A		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	679	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTGACAGTGCCGAGTACTGCG	0.478										HNSCC(39;0.1)																											p.A679A		Atlas-SNP	.											.	CNTNAP2	392	.	0			c.C2037A						PASS	.						136.0	109.0	118.0					7																	147336337		2203	4300	6503	SO:0001819	synonymous_variant	26047	exon13			CAGTGCCGAGTAC	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2037C>A	chr7.hg19:g.147336337C>A		84.0	0.0	.		154.0	8.0	.	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	ENST00000361727.3	hg19	CCDS5889.1																																																																																			.	.	.	none		0.478	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
ZBED6CL	113763	hgsc.bcm.edu	37	7	150027695	150027695	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:150027695C>A	ENST00000343855.4	+	1	758	c.202C>A	c.(202-204)Cgc>Agc	p.R68S	LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000359623.4_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	68																	GCTCTTCTACCGCGAGGAGTT	0.622																																					p.R68S		Atlas-SNP	.											.	C7orf29	18	.	0			c.C202A						PASS	.						93.0	93.0	93.0					7																	150027695		2203	4300	6503	SO:0001583	missense	113763	exon1			TTCTACCGCGAGG	BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.202C>A	chr7.hg19:g.150027695C>A	ENSP00000343242:p.Arg68Ser	185.0	0.0	.		239.0	11.0	.	NM_138434		Missense_Mutation	SNP	ENST00000343855.4	hg19	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	C	9.992	1.230972	0.22542	.	.	ENSG00000188707	ENST00000343855	.	.	.	3.75	3.75	0.43078	.	4.453540	0.01642	N	0.024125	T	0.18130	0.0435	N	0.11560	0.145	0.09310	N	0.999999	P	0.41748	0.761	B	0.38954	0.286	T	0.20042	-1.0287	9	0.06757	T	0.87	.	9.3723	0.38261	0.2139:0.7861:0.0:0.0	.	68	Q96FA7	CG029_HUMAN	S	68	.	ENSP00000343242:R68S	R	+	1	0	C7orf29	149658628	0.413000	0.25400	0.588000	0.28705	0.633000	0.38033	1.687000	0.37680	2.057000	0.61298	0.558000	0.71614	CGC	.	.	.	none		0.622	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434	
ASB10	136371	hgsc.bcm.edu	37	7	150878302	150878302	+	Silent	SNP	C	C	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:150878302C>G	ENST00000420175.2	-	3	852	c.828G>C	c.(826-828)ctG>ctC	p.L276L	ASB10_ENST00000422024.1_Silent_p.L321L|ASB10_ENST00000377867.3_Silent_p.L261L|ASB10_ENST00000275838.1_Silent_p.L276L|ASB10_ENST00000434669.1_Silent_p.L321L			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	276					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCAAGCTGCACAGCTGCAGGC	0.682																																					p.L276L		Atlas-SNP	.											.	ASB10	99	.	0			c.G828C						PASS	.						29.0	31.0	30.0					7																	150878302		2202	4297	6499	SO:0001819	synonymous_variant	136371	exon3			GCTGCACAGCTGC	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.828G>C	chr7.hg19:g.150878302C>G		45.0	0.0	.		64.0	17.0	.	NM_001142459	A0AVH0|Q6ZUL6	Silent	SNP	ENST00000420175.2	hg19	CCDS47750.2																																																																																			.	.	.	none		0.682	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871	
ST18	9705	hgsc.bcm.edu	37	8	53077711	53077711	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr8:53077711G>T	ENST00000276480.7	-	12	1962	c.1279C>A	c.(1279-1281)Cgc>Agc	p.R427S		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	427					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGGGTGTTGCGGTTGCTGTTC	0.413																																					p.R427S		Atlas-SNP	.											.	ST18	212	.	0			c.C1279A						PASS	.						202.0	192.0	195.0					8																	53077711		2203	4300	6503	SO:0001583	missense	9705	exon12			TGTTGCGGTTGCT	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1279C>A	chr8.hg19:g.53077711G>T	ENSP00000276480:p.Arg427Ser	339.0	0.0	.		320.0	15.0	.	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	hg19	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	G	33	5.273288	0.95429	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.63096	-0.02;0.6	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.79458	0.4449	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78344	-0.2240	10	0.54805	T	0.06	-19.9477	20.3081	0.98638	0.0:0.0:1.0:0.0	.	427;427	E5RHS3;O60284	.;ST18_HUMAN	S	427	ENSP00000276480:R427S;ENSP00000428521:R427S	ENSP00000276480:R427S	R	-	1	0	ST18	53240264	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.832000	0.86757	2.795000	0.96236	0.655000	0.94253	CGC	.	.	.	none		0.413	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
WISP1	8840	hgsc.bcm.edu	37	8	134225321	134225321	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr8:134225321C>T	ENST00000250160.6	+	2	390	c.284C>T	c.(283-285)cCc>cTc	p.P95L	WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Missense_Mutation_p.P95L|WISP1_ENST00000517423.1_Missense_Mutation_p.P95L	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	95	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			ATCTGTGACCCCCACCGGGGC	0.612																																					p.P95L		Atlas-SNP	.											.	WISP1	64	.	0			c.C284T						PASS	.						57.0	59.0	58.0					8																	134225321		2203	4300	6503	SO:0001583	missense	8840	exon2			GTGACCCCCACCG	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.284C>T	chr8.hg19:g.134225321C>T	ENSP00000250160:p.Pro95Leu	141.0	0.0	.		82.0	41.0	.	NM_003882	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	ENST00000250160.6	hg19	CCDS6371.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895808	0.52121	.	.	ENSG00000104415	ENST00000250160;ENST00000517423;ENST00000220856	T;T;T	0.64618	-0.11;-0.11;-0.11	5.27	4.33	0.51752	Insulin-like growth factor-binding protein, IGFBP (3);	0.467062	0.24962	N	0.034202	T	0.57961	0.2089	M	0.63843	1.955	0.80722	D	1	P;P;B	0.45176	0.852;0.458;0.27	B;B;B	0.42462	0.388;0.137;0.089	T	0.62315	-0.6880	10	0.56958	D	0.05	-27.7812	7.9781	0.30166	0.0:0.7412:0.1659:0.0928	.	95;95;95	E7EMM5;O95388-2;O95388	.;.;WISP1_HUMAN	L	95	ENSP00000250160:P95L;ENSP00000427744:P95L;ENSP00000220856:P95L	ENSP00000220856:P95L	P	+	2	0	WISP1	134294503	0.959000	0.32827	1.000000	0.80357	0.965000	0.64279	1.247000	0.32815	2.460000	0.83146	0.542000	0.68232	CCC	.	.	.	none		0.612	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882	
SLC35D2	11046	hgsc.bcm.edu	37	9	99106263	99106263	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr9:99106263C>A	ENST00000253270.7	-	8	669	c.607G>T	c.(607-609)Gga>Tga	p.G203*	SLC35D2_ENST00000375259.4_Intron	NM_007001.2	NP_008932.2	Q76EJ3	S35D2_HUMAN	solute carrier family 35 (UDP-GlcNAc/UDP-glucose transporter), member D2	203					carbohydrate derivative transport (GO:1901264)|carbohydrate metabolic process (GO:0005975)|carbohydrate transport (GO:0008643)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)	p.G203R(1)		endometrium(3)|large_intestine(3)|lung(4)|skin(2)	12		Acute lymphoblastic leukemia(62;0.0167)				AAAAGTACTCCGTATTTCCCT	0.403																																					p.G203X		Atlas-SNP	.											SLC35D2,rectum,carcinoma,0,1	SLC35D2	20	.	1	Substitution - Missense(1)	large_intestine(1)	c.G607T						PASS	.						121.0	128.0	126.0					9																	99106263		2203	4300	6503	SO:0001587	stop_gained	11046	exon8			GTACTCCGTATTT	AB122077	CCDS6717.1, CCDS69625.1	9q22.33	2013-07-17	2013-07-17		ENSG00000130958	ENSG00000130958		"""Solute carriers"""	20799	protein-coding gene	gene with protein product		609182	"""solute carrier family 35, member D2"""			15607426	Standard	NM_007001		Approved	UGTrel8, SQV7L	uc004awc.3	Q76EJ3	OTTHUMG00000020293	ENST00000253270.7:c.607G>T	chr9.hg19:g.99106263C>A	ENSP00000253270:p.Gly203*	187.0	0.0	.		225.0	9.0	.	NM_007001	O95454|Q498C1|Q75W21|Q7Z5X5	Nonsense_Mutation	SNP	ENST00000253270.7	hg19	CCDS6717.1	.	.	.	.	.	.	.	.	.	.	C	36	5.661516	0.96734	.	.	ENSG00000130958	ENST00000253270	.	.	.	4.94	4.94	0.65067	.	0.055372	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	17.4527	0.87596	0.0:1.0:0.0:0.0	.	.	.	.	X	203	.	ENSP00000253270:G203X	G	-	1	0	SLC35D2	98146084	1.000000	0.71417	0.954000	0.39281	0.868000	0.49771	6.190000	0.72057	2.734000	0.93682	0.650000	0.86243	GGA	.	.	.	none		0.403	SLC35D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053261.1		
COL27A1	85301	hgsc.bcm.edu	37	9	117047026	117047026	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr9:117047026C>G	ENST00000356083.3	+	41	4347	c.3956C>G	c.(3955-3957)cCc>cGc	p.P1319R		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1319	Collagen-like 12.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						ATTGTGGGACCCCTTGGACCT	0.557																																					p.P1319R		Atlas-SNP	.											COL27A1,NS,carcinoma,0,1	COL27A1	200	.	0			c.C3956G						PASS	.						142.0	119.0	127.0					9																	117047026		2203	4300	6503	SO:0001583	missense	85301	exon41			TGGGACCCCTTGG	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3956C>G	chr9.hg19:g.117047026C>G	ENSP00000348385:p.Pro1319Arg	138.0	0.0	.		98.0	35.0	.	NM_032888	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	hg19	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	c	12.60	1.986411	0.35036	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.93366	-3.21	4.71	3.82	0.43975	.	.	.	.	.	D	0.93779	0.8011	L	0.55017	1.72	0.38600	D	0.950644	P	0.52577	0.954	P	0.60012	0.867	D	0.91884	0.5518	9	0.22706	T	0.39	.	10.6899	0.45864	0.0:0.9065:0.0:0.0935	.	1319	Q8IZC6	CORA1_HUMAN	R	1319	ENSP00000348385:P1319R	ENSP00000348385:P1319R	P	+	2	0	COL27A1	116086847	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	5.396000	0.66297	1.205000	0.43262	-0.265000	0.10407	CCC	.	.	.	none		0.557	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
AP3M1	26985	hgsc.bcm.edu	37	10	75898090	75898090	+	Silent	SNP	T	T	C	rs147488745		TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr10:75898090T>C	ENST00000355264.4	-	2	359	c.48A>G	c.(46-48)ctA>ctG	p.L16L	AP3M1_ENST00000487653.1_5'UTR|AP3M1_ENST00000372745.1_Silent_p.L16L	NM_012095.4	NP_036227.1	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	16					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|protein targeting to lysosome (GO:0006622)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	Rab GTPase binding (GO:0017137)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	13	Prostate(51;0.0112)					AGTGCTTCTCTAGAAATATGT	0.358																																					p.L16L		Atlas-SNP	.											.	AP3M1	28	.	0			c.A48G						PASS	.						76.0	76.0	76.0					10																	75898090		2203	4300	6503	SO:0001819	synonymous_variant	26985	exon3			CTTCTCTAGAAAT	AF092092	CCDS7342.1	10q22.1-q22.3	2008-07-07			ENSG00000185009	ENSG00000185009			569	protein-coding gene	gene with protein product		610366				10024875	Standard	NM_207012		Approved		uc001jwh.3	Q9Y2T2	OTTHUMG00000018497	ENST00000355264.4:c.48A>G	chr10.hg19:g.75898090T>C		71.0	0.0	.		93.0	50.0	.	NM_207012	Q5JQ12|Q9H5L2	Silent	SNP	ENST00000355264.4	hg19	CCDS7342.1																																																																																			.	T|1.000;G|0.000	.	alt		0.358	AP3M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048747.1		
PDE6C	5146	hgsc.bcm.edu	37	10	95380726	95380726	+	Silent	SNP	C	C	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr10:95380726C>A	ENST00000371447.3	+	3	850	c.712C>A	c.(712-714)Cga>Aga	p.R238R		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	238					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	TATTGAATCCCGAAGAAGCCA	0.443																																					p.R238R		Atlas-SNP	.											.	PDE6C	97	.	0			c.C712A						PASS	.						261.0	255.0	257.0					10																	95380726		2203	4300	6503	SO:0001819	synonymous_variant	5146	exon3			GAATCCCGAAGAA	U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.712C>A	chr10.hg19:g.95380726C>A		465.0	0.0	.		408.0	17.0	.	NM_006204	A6NCR6|Q5VY29	Silent	SNP	ENST00000371447.3	hg19	CCDS7429.1																																																																																			.	.	.	none		0.443	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204	
OR8I2	120586	hgsc.bcm.edu	37	11	55861472	55861472	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr11:55861472C>G	ENST00000302124.2	+	1	720	c.689C>G	c.(688-690)gCa>gGa	p.A230G		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A230E(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					ATCCAGTCAGCAGCAGGCAGG	0.468																																					p.A230G		Atlas-SNP	.											OR8I2,NS,carcinoma,0,1	OR8I2	119	.	1	Substitution - Missense(1)	lung(1)	c.C689G						PASS	.						148.0	133.0	138.0					11																	55861472		2201	4296	6497	SO:0001583	missense	120586	exon1			AGTCAGCAGCAGG	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.689C>G	chr11.hg19:g.55861472C>G	ENSP00000303864:p.Ala230Gly	101.0	0.0	.		91.0	26.0	.	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	hg19	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	C	7.367	0.625989	0.14257	.	.	ENSG00000172154	ENST00000302124	T	0.00207	8.55	4.33	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.410674	0.17770	U	0.162617	T	0.00241	0.0007	L	0.60904	1.88	0.09310	N	1	B	0.19935	0.04	B	0.25614	0.062	T	0.31613	-0.9937	10	0.62326	D	0.03	-0.4958	11.6945	0.51536	0.0:0.9111:0.0:0.0889	.	230	Q8N0Y5	OR8I2_HUMAN	G	230	ENSP00000303864:A230G	ENSP00000303864:A230G	A	+	2	0	OR8I2	55618048	0.000000	0.05858	0.014000	0.15608	0.555000	0.35460	0.408000	0.21065	0.934000	0.37316	0.440000	0.28878	GCA	.	.	.	none		0.468	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
DSCAML1	57453	hgsc.bcm.edu	37	11	117375681	117375681	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr11:117375681C>T	ENST00000321322.6	-	10	2321	c.2320G>A	c.(2320-2322)Gac>Aac	p.D774N	DSCAML1_ENST00000527706.1_Missense_Mutation_p.D504N	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	714	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGGTAGCCGTCCACCGAGCAG	0.602																																					p.D774N		Atlas-SNP	.											.	DSCAML1	286	.	0			c.G2320A						PASS	.						88.0	77.0	81.0					11																	117375681		2201	4296	6497	SO:0001583	missense	57453	exon10			AGCCGTCCACCGA		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2320G>A	chr11.hg19:g.117375681C>T	ENSP00000315465:p.Asp774Asn	102.0	0.0	.		67.0	27.0	.	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.813851	0.70912	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.66995	-0.24;-0.24	4.32	4.32	0.51571	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54727	0.1876	N	0.21097	0.63	0.58432	D	0.999999	B	0.18013	0.025	B	0.21360	0.034	T	0.52358	-0.8586	9	0.38643	T	0.18	.	16.5931	0.84781	0.0:1.0:0.0:0.0	.	714	Q8TD84	DSCL1_HUMAN	N	504;774;481	ENSP00000434335:D504N;ENSP00000315465:D774N	ENSP00000315465:D774N	D	-	1	0	DSCAML1	116880891	1.000000	0.71417	0.939000	0.37840	0.852000	0.48524	7.559000	0.82265	2.222000	0.72286	0.313000	0.20887	GAC	.	.	.	none		0.602	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
LIMA1	51474	hgsc.bcm.edu	37	12	50571511	50571511	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr12:50571511C>G	ENST00000341247.4	-	11	1765	c.1616G>C	c.(1615-1617)gGa>gCa	p.G539A	LIMA1_ENST00000552823.1_Missense_Mutation_p.G379A|LIMA1_ENST00000394943.3_Missense_Mutation_p.G540A|LIMA1_ENST00000552783.1_Missense_Mutation_p.G380A|LIMA1_ENST00000552909.1_Missense_Mutation_p.G378A|LIMA1_ENST00000547825.1_Missense_Mutation_p.G237A|LIMA1_ENST00000552491.1_Missense_Mutation_p.G236A	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	539					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						TCCTGAACTTCCAAGTTCAGT	0.532																																					p.G540A		Atlas-SNP	.											.	LIMA1	67	.	0			c.G1619C						PASS	.						113.0	118.0	116.0					12																	50571511		2203	4300	6503	SO:0001583	missense	51474	exon11			GAACTTCCAAGTT	AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.1616G>C	chr12.hg19:g.50571511C>G	ENSP00000340184:p.Gly539Ala	213.0	0.0	.		193.0	89.0	.	NM_001113546	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	ENST00000341247.4	hg19	CCDS8802.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467708	0.63625	.	.	ENSG00000050405	ENST00000552491;ENST00000547825;ENST00000552823;ENST00000394943;ENST00000341247;ENST00000552783;ENST00000552909;ENST00000420992	T;T;T;D;T;T;T	0.84800	-1.15;-1.15;-1.49;-1.9;-1.16;-1.49;-1.49	5.73	4.83	0.62350	.	0.635701	0.18245	N	0.147130	D	0.82779	0.5111	L	0.44542	1.39	0.30474	N	0.773064	B;B;P	0.38129	0.072;0.293;0.619	B;B;B	0.39339	0.067;0.078;0.297	T	0.81895	-0.0723	10	0.49607	T	0.09	.	17.0525	0.86523	0.0:0.8729:0.1271:0.0	.	549;539;378	Q59FE8;Q9UHB6;F8VQE1	.;LIMA1_HUMAN;.	A	236;237;379;540;539;380;378;458	ENSP00000448463:G236A;ENSP00000448706:G237A;ENSP00000450266:G379A;ENSP00000378400:G540A;ENSP00000340184:G539A;ENSP00000448779:G380A;ENSP00000450087:G378A	ENSP00000340184:G539A	G	-	2	0	LIMA1	48857778	0.928000	0.31464	0.969000	0.41365	0.973000	0.67179	4.892000	0.63193	1.530000	0.49136	0.655000	0.94253	GGA	.	.	.	none		0.532	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406235.2	NM_016357	
LAMP1	3916	hgsc.bcm.edu	37	13	113964011	113964011	+	Silent	SNP	C	C	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr13:113964011C>T	ENST00000332556.4	+	3	431	c.237C>T	c.(235-237)tcC>tcT	p.S79S	LAMP1_ENST00000397181.3_Silent_p.S79S	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	79	First lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			ACCGCAGCTCCTGTGGAAAAG	0.448																																					p.S79S		Atlas-SNP	.											.	LAMP1	41	.	0			c.C237T						PASS	.						110.0	114.0	113.0					13																	113964011		1968	4157	6125	SO:0001819	synonymous_variant	3916	exon3			CAGCTCCTGTGGA	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.237C>T	chr13.hg19:g.113964011C>T		116.0	0.0	.		117.0	64.0	.	NM_005561	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Silent	SNP	ENST00000332556.4	hg19	CCDS41909.1																																																																																			.	.	.	none		0.448	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2		
BAZ1A	11177	hgsc.bcm.edu	37	14	35242930	35242930	+	Silent	SNP	A	A	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr14:35242930A>G	ENST00000382422.2	-	19	3327	c.3000T>C	c.(2998-3000)gtT>gtC	p.V1000V	BAZ1A_ENST00000358716.4_Silent_p.V968V|BAZ1A_ENST00000360310.1_Silent_p.V1000V			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1000					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GTCGATCTGTAACCTGTAACA	0.323																																					p.V1000V		Atlas-SNP	.											.	BAZ1A	128	.	0			c.T3000C						PASS	.						87.0	78.0	81.0					14																	35242930		2203	4300	6503	SO:0001819	synonymous_variant	11177	exon20			ATCTGTAACCTGT	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.3000T>C	chr14.hg19:g.35242930A>G		43.0	0.0	.		46.0	26.0	.	NM_013448	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Silent	SNP	ENST00000382422.2	hg19	CCDS9651.1																																																																																			.	.	.	none		0.323	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
FANCM	57697	hgsc.bcm.edu	37	14	45636324	45636324	+	Silent	SNP	C	C	A	rs112784867	byFrequency	TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr14:45636324C>A	ENST00000267430.5	+	11	2045	c.1960C>A	c.(1960-1962)Cgg>Agg	p.R654R	FANCM_ENST00000556036.1_Silent_p.R654R|FANCM_ENST00000542564.2_Silent_p.R628R	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	654					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GAAGCCTTCTCGGAACTTGCA	0.393								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R654R		Atlas-SNP	.											.	FANCM	225	.	0			c.C1960A						PASS	.						98.0	102.0	101.0					14																	45636324		2203	4300	6503	SO:0001819	synonymous_variant	57697	exon11	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CCTTCTCGGAACT	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1960C>A	chr14.hg19:g.45636324C>A		118.0	0.0	.		127.0	10.0	.	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	hg19	CCDS32070.1																																																																																			.	C|0.999;T|0.001	.	alt		0.393	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
ESR2	2100	hgsc.bcm.edu	37	14	64746749	64746749	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr14:64746749C>G	ENST00000341099.4	-	3	902	c.485G>C	c.(484-486)gGa>gCa	p.G162A	ESR2_ENST00000353772.3_Missense_Mutation_p.G162A|ESR2_ENST00000542956.1_Missense_Mutation_p.G162A|ESR2_ENST00000555483.1_Intron|ESR2_ENST00000358599.5_Missense_Mutation_p.G162A|ESR2_ENST00000553796.1_Missense_Mutation_p.G162A|ESR2_ENST00000357782.2_Missense_Mutation_p.G162A|ESR2_ENST00000554572.1_Missense_Mutation_p.G162A|ESR2_ENST00000555278.1_Missense_Mutation_p.G162A|ESR2_ENST00000557772.1_Missense_Mutation_p.G162A|ESR2_ENST00000267525.6_Missense_Mutation_p.G162A	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	162					brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CGACCAGACTCCATAGTGATA	0.453																																					p.G162A		Atlas-SNP	.											.	ESR2	82	.	0			c.G485C						PASS	.						236.0	229.0	232.0					14																	64746749		2203	4300	6503	SO:0001583	missense	2100	exon2			CAGACTCCATAGT	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.485G>C	chr14.hg19:g.64746749C>G	ENSP00000343925:p.Gly162Ala	426.0	1.0	.		345.0	152.0	.	NM_001214902	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	hg19	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	C	32	5.148027	0.94603	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44	5.56	5.56	0.83823	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	H	0.99425	4.56	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98376	1.0556	10	0.87932	D	0	.	19.5206	0.95183	0.0:1.0:0.0:0.0	.	162;162;162;162;162	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	A	162	ENSP00000452485:G162A;ENSP00000441792:G162A;ENSP00000450699:G162A;ENSP00000335551:G162A;ENSP00000351412:G162A;ENSP00000450488:G162A;ENSP00000452426:G162A;ENSP00000350427:G162A;ENSP00000451582:G162A;ENSP00000343925:G162A;ENSP00000267525:G162A	ENSP00000267525:G162A	G	-	2	0	ESR2	63816502	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.647000	0.83462	2.623000	0.88846	0.557000	0.71058	GGA	.	.	.	none		0.453	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
CYP46A1	10858	hgsc.bcm.edu	37	14	100165848	100165848	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr14:100165848C>A	ENST00000261835.3	+	4	432	c.328C>A	c.(328-330)Cgt>Agt	p.R110S	CYP46A1_ENST00000423126.2_Missense_Mutation_p.R13S	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	110					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)	p.R110S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				CAAGATGTACCGTGCGCTCCA	0.532																																					p.R110S		Atlas-SNP	.											.	CYP46A1	62	.	1	Substitution - Missense(1)	lung(1)	c.C328A						PASS	.						275.0	262.0	267.0					14																	100165848		2203	4300	6503	SO:0001583	missense	10858	exon4			ATGTACCGTGCGC	AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.328C>A	chr14.hg19:g.100165848C>A	ENSP00000261835:p.Arg110Ser	404.0	0.0	.		299.0	12.0	.	NM_006668	B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	ENST00000261835.3	hg19	CCDS9954.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.951|7.951	0.744820|0.744820	0.15710|0.15710	.|.	.|.	ENSG00000036530|ENSG00000036530	ENST00000380228|ENST00000261835;ENST00000423126	.|T;D	.|0.82433	.|-0.31;-1.61	5.5|5.5	0.356|0.356	0.16074|0.16074	.|.	.|0.633707	.|0.15897	.|N	.|0.239263	T|T	0.62048|0.62048	0.2396|0.2396	N|N	0.16368|0.16368	0.405|0.405	0.27263|0.27263	N|N	0.958571|0.958571	.|B;B	.|0.14012	.|0.004;0.009	.|B;B	.|0.20384	.|0.029;0.01	T|T	0.45425|0.45425	-0.9262|-0.9262	5|10	.|0.08179	.|T	.|0.78	.|.	4.1573|4.1573	0.10266|0.10266	0.0:0.4696:0.1663:0.364|0.0:0.4696:0.1663:0.364	.|.	.|110;81	.|Q9Y6A2;Q59ER2	.|CP46A_HUMAN;.	Q|S	96|110;13	.|ENSP00000261835:R110S;ENSP00000405779:R13S	.|ENSP00000261835:R110S	P|R	+|+	2|1	0|0	CYP46A1|CYP46A1	99235601|99235601	0.968000|0.968000	0.33430|0.33430	0.978000|0.978000	0.43139|0.43139	0.933000|0.933000	0.57130|0.57130	0.329000|0.329000	0.19698|0.19698	0.398000|0.398000	0.25338|0.25338	-0.148000|-0.148000	0.13756|0.13756	CCG|CGT	.	.	.	none		0.532	CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413814.1		
CCP110	9738	hgsc.bcm.edu	37	16	19548870	19548870	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr16:19548870T>A	ENST00000381396.5	+	4	2126	c.1879T>A	c.(1879-1881)Ttc>Atc	p.F627I	CCP110_ENST00000396212.2_Missense_Mutation_p.F627I|CCP110_ENST00000396208.2_Missense_Mutation_p.F627I	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	627					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						GGGATCTGGCTTCGTTAACAA	0.348																																					p.F627I		Atlas-SNP	.											.	CCP110	57	.	0			c.T1879A						PASS	.						40.0	42.0	42.0					16																	19548870		2197	4300	6497	SO:0001583	missense	9738	exon4			TCTGGCTTCGTTA	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1879T>A	chr16.hg19:g.19548870T>A	ENSP00000370803:p.Phe627Ile	51.0	0.0	.		62.0	25.0	.	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	hg19	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.901950	0.33535	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.13307	2.6;2.6;2.6	5.39	1.56	0.23342	.	0.876000	0.09983	N	0.730791	T	0.05318	0.0141	N	0.03608	-0.345	0.22213	N	0.999282	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.39251	-0.9623	10	0.37606	T	0.19	-0.0461	3.164	0.06529	0.1377:0.0766:0.1437:0.642	.	627;627	O43303;O43303-2	CP110_HUMAN;.	I	627	ENSP00000379515:F627I;ENSP00000370803:F627I;ENSP00000379511:F627I	ENSP00000370803:F627I	F	+	1	0	CCP110	19456371	0.389000	0.25205	0.861000	0.33841	0.927000	0.56198	0.910000	0.28571	0.291000	0.22468	0.460000	0.39030	TTC	.	.	.	none		0.348	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
TNRC6A	27327	hgsc.bcm.edu	37	16	24826534	24826534	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr16:24826534G>A	ENST00000395799.3	+	19	4868	c.4739G>A	c.(4738-4740)aGt>aAt	p.S1580N	TNRC6A_ENST00000432286.2_Missense_Mutation_p.S58N|TNRC6A_ENST00000315183.7_Missense_Mutation_p.S1531N|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1580					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ATGAACAGCAGTACTTCACCA	0.458																																					p.S1580N		Atlas-SNP	.											.	TNRC6A	171	.	0			c.G4739A						PASS	.						89.0	87.0	88.0					16																	24826534		2197	4300	6497	SO:0001583	missense	27327	exon19			ACAGCAGTACTTC	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4739G>A	chr16.hg19:g.24826534G>A	ENSP00000379144:p.Ser1580Asn	93.0	0.0	.		136.0	36.0	.	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	hg19	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561278	0.86335	.	.	ENSG00000090905	ENST00000315183;ENST00000395799;ENST00000432286	T;T	0.14022	2.58;2.54	5.92	5.92	0.95590	.	0.042755	0.85682	D	0.000000	T	0.29458	0.0734	L	0.59436	1.845	0.58432	D	0.999998	P;B;B;D	0.63880	0.718;0.427;0.392;0.993	B;B;B;P	0.54629	0.366;0.254;0.315;0.757	T	0.00097	-1.2072	10	0.33141	T	0.24	-13.8994	20.3206	0.98668	0.0:0.0:1.0:0.0	.	247;719;1531;1580	B3KSX2;C9JA83;Q8NDV7-6;Q8NDV7	.;.;.;TNR6A_HUMAN	N	1531;1580;58	ENSP00000326900:S1531N;ENSP00000379144:S1580N	ENSP00000326900:S1531N	S	+	2	0	TNRC6A	24734035	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.423000	0.90264	2.809000	0.96659	0.655000	0.94253	AGT	.	.	.	none		0.458	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
CNOT1	23019	hgsc.bcm.edu	37	16	58585134	58585134	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr16:58585134T>C	ENST00000317147.5	-	24	3576	c.3244A>G	c.(3244-3246)Aca>Gca	p.T1082A	CNOT1_ENST00000569240.1_Missense_Mutation_p.T1077A|CNOT1_ENST00000245138.4_5'UTR|CNOT1_ENST00000569732.1_5'Flank|CNOT1_ENST00000441024.2_Missense_Mutation_p.T1082A|SNORA46_ENST00000384762.1_RNA	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1082					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GTTTGATCTGTGGCCACAAGC	0.323																																					p.T1082A		Atlas-SNP	.											.	CNOT1	359	.	0			c.A3244G						PASS	.						106.0	124.0	118.0					16																	58585134		2197	4300	6497	SO:0001583	missense	23019	exon24			GATCTGTGGCCAC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3244A>G	chr16.hg19:g.58585134T>C	ENSP00000320949:p.Thr1082Ala	226.0	0.0	.		464.0	292.0	.	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.669566	0.88348	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.45668	0.93;0.89	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.51449	0.1675	L	0.37561	1.115	0.80722	D	1	D;P;P	0.56035	0.974;0.851;0.939	D;B;P	0.70487	0.969;0.253;0.625	T	0.39522	-0.9610	10	0.13470	T	0.59	.	15.4218	0.75018	0.0:0.0:0.0:1.0	.	1082;1082;1077	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	A	1082;511;1077;1082	ENSP00000320949:T1082A;ENSP00000413113:T1082A	ENSP00000320949:T1082A	T	-	1	0	CNOT1	57142635	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.051000	0.60960	0.383000	0.25322	ACA	.	.	.	none		0.323	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
LASP1	3927	hgsc.bcm.edu	37	17	37074921	37074921	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:37074921G>T	ENST00000318008.6	+	7	1007	c.676G>T	c.(676-678)Ggg>Tgg	p.G226W	RP1-56K13.3_ENST00000580121.1_RNA|LASP1_ENST00000435347.3_Missense_Mutation_p.G226W|LASP1_ENST00000433206.2_Missense_Mutation_p.G170W	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	226	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						CTTCCAGGACGGGGACACCAT	0.657			T	MLL	AML																																p.G226W		Atlas-SNP	.		Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	.	LASP1	24	.	0			c.G676T						PASS	.						121.0	105.0	111.0					17																	37074921		2203	4300	6503	SO:0001583	missense	3927	exon7			CAGGACGGGGACA		CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.676G>T	chr17.hg19:g.37074921G>T	ENSP00000325240:p.Gly226Trp	182.0	0.0	.		205.0	9.0	.	NM_006148	B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	ENST00000318008.6	hg19	CCDS11331.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839198	0.91117	.	.	ENSG00000002834	ENST00000318008;ENST00000433206;ENST00000435347	T;T;T	0.70045	-0.45;-0.45;-0.45	5.39	5.39	0.77823	Src homology-3 domain (5);	0.476548	0.23146	N	0.051403	D	0.90045	0.6891	H	0.99211	4.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94064	0.7329	10	0.87932	D	0	.	17.7153	0.88335	0.0:0.0:1.0:0.0	.	170;226	B4DGQ0;Q14847	.;LASP1_HUMAN	W	226;170;226	ENSP00000325240:G226W;ENSP00000401048:G170W;ENSP00000392853:G226W	ENSP00000325240:G226W	G	+	1	0	LASP1	34328447	1.000000	0.71417	0.961000	0.40146	0.684000	0.39900	9.779000	0.99018	2.540000	0.85666	0.462000	0.41574	GGG	.	.	.	none		0.657	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256890.3	NM_006148	
MED24	9862	hgsc.bcm.edu	37	17	38182477	38182477	+	Silent	SNP	C	C	T	rs572516214		TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:38182477C>T	ENST00000394128.2	-	19	1998	c.1917G>A	c.(1915-1917)tcG>tcA	p.S639S	MED24_ENST00000501516.3_Silent_p.S658S|SNORD124_ENST00000459577.1_RNA|MED24_ENST00000394126.1_Silent_p.S664S|MED24_ENST00000394127.2_Silent_p.S626S|MED24_ENST00000356271.3_Silent_p.S626S	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	639					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TCATCTGCAGCGACTTCTCAC	0.567																																					p.S639S		Atlas-SNP	.											.	MED24	89	.	0			c.G1917A						PASS	.						143.0	129.0	134.0					17																	38182477		2203	4300	6503	SO:0001819	synonymous_variant	9862	exon19			CTGCAGCGACTTC	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1917G>A	chr17.hg19:g.38182477C>T		203.0	0.0	.		200.0	45.0	.	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	ENST00000394128.2	hg19	CCDS11359.1																																																																																			.	.	.	none		0.567	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
STAT5A	6776	hgsc.bcm.edu	37	17	40459443	40459443	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:40459443C>A	ENST00000345506.4	+	15	2346	c.1704C>A	c.(1702-1704)taC>taA	p.Y568*	STAT5A_ENST00000452307.2_Nonsense_Mutation_p.Y568*|STAT5A_ENST00000546010.2_Nonsense_Mutation_p.Y538*|STAT5A_ENST00000587646.1_Nonsense_Mutation_p.Y56*|STAT5A_ENST00000588868.1_Nonsense_Mutation_p.Y537*|STAT5A_ENST00000590949.1_Nonsense_Mutation_p.Y568*	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	568					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GCTGGAACTACACCTTCTGGC	0.632																																					p.Y568X		Atlas-SNP	.											.	STAT5A	49	.	0			c.C1704A						PASS	.						83.0	76.0	79.0					17																	40459443		2203	4300	6503	SO:0001587	stop_gained	6776	exon15			GAACTACACCTTC	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1704C>A	chr17.hg19:g.40459443C>A	ENSP00000341208:p.Tyr568*	40.0	0.0	.		46.0	7.0	.	NM_003152	Q1KLZ6	Nonsense_Mutation	SNP	ENST00000345506.4	hg19	CCDS11424.1	.	.	.	.	.	.	.	.	.	.	C	37	6.584660	0.97684	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	.	.	.	4.79	1.62	0.23740	.	0.060457	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-36.8444	10.4319	0.44413	0.0:0.7815:0.0:0.2185	.	.	.	.	X	568;538;539;568	.	ENSP00000341208:Y568X	Y	+	3	2	STAT5A	37712969	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.202000	0.32271	0.171000	0.19730	0.491000	0.48974	TAC	.	.	.	none		0.632	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152	
RND2	8153	hgsc.bcm.edu	37	17	41180503	41180503	+	Silent	SNP	C	C	A	rs535296435	byFrequency	TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:41180503C>A	ENST00000587250.2	+	5	597	c.490C>A	c.(490-492)Cgg>Agg	p.R164R	RND2_ENST00000544533.1_Silent_p.R165R|CTD-3199J23.4_ENST00000225973.5_lincRNA			P52198	RND2_HUMAN	Rho family GTPase 2	164					GTP catabolic process (GO:0006184)|positive regulation of collateral sprouting (GO:0048672)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|skin(1)	2		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GTGCTCCTCCCGGTCCTCTGA	0.607																																					p.R164R		Atlas-SNP	.											.	RND2	10	.	0			c.C490A						PASS	.						80.0	75.0	77.0					17																	41180503		2203	4300	6503	SO:0001819	synonymous_variant	8153	exon5			TCCTCCCGGTCCT	X95456	CCDS11452.1	17q21.31	2012-10-02	2005-01-24	2005-01-24	ENSG00000108830	ENSG00000108830			18315	protein-coding gene	gene with protein product		601555	"""ras homolog gene family, member N"""	ARHN			Standard	XM_005257706		Approved	Rho7, RhoN	uc002icn.3	P52198	OTTHUMG00000180817	ENST00000587250.2:c.490C>A	chr17.hg19:g.41180503C>A		136.0	0.0	.		170.0	12.0	.	NM_005440	A8K2D4|O00690|O00734|Q5U0P6|Q99535	Silent	SNP	ENST00000587250.2	hg19	CCDS11452.1																																																																																			.	.	.	none		0.607	RND2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453111.2	NM_005440	
ITGB3	3690	hgsc.bcm.edu	37	17	45369560	45369560	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:45369560C>T	ENST00000559488.1	+	10	1332	c.1316C>T	c.(1315-1317)tCc>tTc	p.S439F	ITGB3_ENST00000435993.2_Missense_Mutation_p.S392F|ITGB3_ENST00000560629.1_Silent_p.V427V	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	439					activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	AAGGAGAAGTCCTTTACCATA	0.522																																					p.S439F		Atlas-SNP	.											.	ITGB3	157	.	0			c.C1316T						PASS	.						94.0	78.0	84.0					17																	45369560		2203	4300	6503	SO:0001583	missense	3690	exon10			AGAAGTCCTTTAC		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.1316C>T	chr17.hg19:g.45369560C>T	ENSP00000452786:p.Ser439Phe	108.0	0.0	.		104.0	67.0	.	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	ENST00000559488.1	hg19	CCDS11511.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558922	0.86231	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	T	0.67171	-0.25	5.4	5.4	0.78164	Integrin beta subunit, N-terminal (2);	0.153255	0.56097	D	0.000025	T	0.78960	0.4366	L	0.60455	1.87	0.51233	D	0.99991	D	0.64830	0.994	D	0.65573	0.936	T	0.80324	-0.1430	10	0.66056	D	0.02	.	17.9137	0.88942	0.0:1.0:0.0:0.0	.	439	P05106	ITB3_HUMAN	F	439;392	ENSP00000407801:S392F	ENSP00000262017:S439F	S	+	2	0	C17orf57	42724559	0.998000	0.40836	1.000000	0.80357	0.953000	0.61014	3.315000	0.51951	2.531000	0.85337	0.462000	0.41574	TCC	.	.	.	none		0.522	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
HSF5	124535	hgsc.bcm.edu	37	17	56540550	56540550	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:56540550C>G	ENST00000323777.3	-	4	1244	c.1135G>C	c.(1135-1137)Gtt>Ctt	p.V379L		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	379					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AACTCATCAACTATCTGAAAG	0.438																																					p.V379L		Atlas-SNP	.											.	HSF5	51	.	0			c.G1135C						PASS	.						101.0	97.0	98.0					17																	56540550		2203	4300	6503	SO:0001583	missense	124535	exon4			CATCAACTATCTG	BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.1135G>C	chr17.hg19:g.56540550C>G	ENSP00000313243:p.Val379Leu	144.0	0.0	.		227.0	69.0	.	NM_001080439	Q08EH7|Q8N7V2	Missense_Mutation	SNP	ENST00000323777.3	hg19	CCDS32690.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396051	0.42512	.	.	ENSG00000176160	ENST00000412540;ENST00000323777	T	0.43294	0.95	5.47	4.49	0.54785	.	0.247257	0.28754	N	0.014249	T	0.30448	0.0765	L	0.27053	0.805	0.38062	D	0.936116	B	0.06786	0.001	B	0.08055	0.003	T	0.11372	-1.0590	10	0.34782	T	0.22	.	12.6737	0.56882	0.1654:0.8346:0.0:0.0	.	379	Q4G112	HSF5_HUMAN	L	279;379	ENSP00000313243:V379L	ENSP00000313243:V379L	V	-	1	0	HSF5	53895549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.377000	0.44300	1.273000	0.44346	0.650000	0.86243	GTT	.	.	.	none		0.438	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1	XM_064190	
METTL2A	339175	hgsc.bcm.edu	37	17	60501296	60501296	+	Silent	SNP	A	A	G			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:60501296A>G	ENST00000311506.5	+	1	69	c.33A>G	c.(31-33)gcA>gcG	p.A11A		NM_181725.3	NP_859076.3	Q96IZ6	MET2A_HUMAN	methyltransferase like 2A	11					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(2)|central_nervous_system(1)|endometrium(1)|upper_aerodigestive_tract(2)	6			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			GTGCACCTGCAGTCCTCGCCG	0.597											OREG0024635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A11A		Atlas-SNP	.											.	METTL2A	31	.	0			c.A33G						PASS	.						57.0	67.0	64.0					17																	60501296		692	1591	2283	SO:0001819	synonymous_variant	339175	exon1			ACCTGCAGTCCTC	AK000991	CCDS45752.1	17q23.3	2012-12-20		2006-02-10	ENSG00000087995	ENSG00000087995			25755	protein-coding gene	gene with protein product						12477932	Standard	NM_181725		Approved	FLJ12760, METTL2	uc002izv.2	Q96IZ6	OTTHUMG00000164527	ENST00000311506.5:c.33A>G	chr17.hg19:g.60501296A>G		51.0	0.0	.	1046	73.0	24.0	.	NM_181725	A6NNC4|Q9H9G9|Q9NUI8|Q9P0B5	Silent	SNP	ENST00000311506.5	hg19	CCDS45752.1																																																																																			.	.	.	none		0.597	METTL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445130.1	NM_181725	
CYB561	1534	hgsc.bcm.edu	37	17	61511913	61511913	+	Silent	SNP	G	G	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:61511913G>A	ENST00000392976.1	-	6	905	c.606C>T	c.(604-606)aaC>aaT	p.N202N	CYB561_ENST00000582997.1_Silent_p.N209N|CYB561_ENST00000542042.1_Silent_p.N269N|CYB561_ENST00000582297.1_Intron|CYB561_ENST00000581163.1_5'UTR|CYB561_ENST00000448884.2_3'UTR|RP11-269G24.4_ENST00000584608.1_lincRNA|CYB561_ENST00000582034.1_Silent_p.N173N|CYB561_ENST00000360793.3_Silent_p.N202N|CYB561_ENST00000392975.2_Silent_p.N202N|CYB561_ENST00000584031.1_3'UTR|CYB561_ENST00000581573.1_Silent_p.N202N	NM_001017916.1	NP_001017916.1	P49447	CY561_HUMAN	cytochrome b561	202	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				electron transport chain (GO:0022900)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|transmembrane electron transfer carrier (GO:0022865)			lung(2)|ovary(1)|prostate(1)	4				READ - Rectum adenocarcinoma(1115;0.0689)		GGCCCAGCACGTTGGCCAGGA	0.642																																					p.N202N		Atlas-SNP	.											.	CYB561	15	.	0			c.C606T						PASS	.						48.0	48.0	48.0					17																	61511913		2203	4300	6503	SO:0001819	synonymous_variant	1534	exon6			CAGCACGTTGGCC		CCDS11636.1	17q23.3	2013-03-14	2013-03-14		ENSG00000008283	ENSG00000008283		"""Cytochrome b genes"""	2571	protein-coding gene	gene with protein product	"""ferric-chelate reductase 2"", ""cytochrome b561 family, member A1"""	600019				7959749, 23249217	Standard	XM_005257091		Approved	FRRS2, CYB561A1	uc002jas.3	P49447		ENST00000392976.1:c.606C>T	chr17.hg19:g.61511913G>A		44.0	0.0	.		50.0	33.0	.	NM_001915	B2RE96|B7Z775|D3DU11|Q5BJG9|Q9BU05|Q9BWR9	Silent	SNP	ENST00000392976.1	hg19	CCDS11636.1																																																																																			.	.	.	none		0.642	CYB561-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444843.1	NM_001915	
ABCA5	23461	hgsc.bcm.edu	37	17	67303077	67303077	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:67303077G>A	ENST00000392676.3	-	6	641	c.577C>T	c.(577-579)Ctt>Ttt	p.L193F	ABCA5_ENST00000392677.2_Missense_Mutation_p.L193F|ABCA5_ENST00000588877.1_Missense_Mutation_p.L193F			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	193					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TCCTTCCAAAGAGAAACATTG	0.348																																					p.L193F		Atlas-SNP	.											.	ABCA5	162	.	0			c.C577T						PASS	.						56.0	60.0	59.0					17																	67303077		2198	4294	6492	SO:0001583	missense	23461	exon5			TCCAAAGAGAAAC	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.577C>T	chr17.hg19:g.67303077G>A	ENSP00000376443:p.Leu193Phe	63.0	0.0	.		113.0	39.0	.	NM_018672	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	hg19	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836993	0.50951	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.87966	-2.32;-2.32	5.22	-9.14	0.00701	.	1.842040	0.03300	N	0.188828	T	0.60625	0.2283	N	0.01352	-0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.57452	-0.7809	9	.	.	.	.	6.752	0.23491	0.1697:0.5331:0.2205:0.0768	.	193;193	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	F	193	ENSP00000376444:L193F;ENSP00000376443:L193F	.	L	-	1	0	ABCA5	64814672	0.090000	0.21635	0.839000	0.33178	0.999000	0.98932	0.440000	0.21592	-1.239000	0.02532	0.650000	0.86243	CTT	.	.	.	none		0.348	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
RIN2	54453	hgsc.bcm.edu	37	20	19955386	19955386	+	Silent	SNP	C	C	T			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr20:19955386C>T	ENST00000255006.6	+	8	1013	c.864C>T	c.(862-864)tcC>tcT	p.S288S	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	239					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						GTCCTGCCTCCCTGCGTCAGC	0.547																																					p.S288S		Atlas-SNP	.											.	RIN2	126	.	0			c.C864T						PASS	.						73.0	77.0	75.0					20																	19955386		1935	4144	6079	SO:0001819	synonymous_variant	54453	exon8			TGCCTCCCTGCGT	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.864C>T	chr20.hg19:g.19955386C>T		105.0	0.0	.		68.0	33.0	.	NM_001242581	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000255006.6	hg19	CCDS56182.1																																																																																			.	.	.	none		0.547	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
KIAA1211L	343990	hgsc.bcm.edu	37	2	99413866	99413867	+	Frame_Shift_Del	DEL	GT	GT	-	rs201196594		TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr2:99413866_99413867delGT	ENST00000397899.2	-	8	2881_2882	c.2550_2551delAC	c.(2548-2553)gcacggfs	p.R851fs		NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	851																	TTCAGGGTCCGTGCCCCAGGCT	0.619																																					p.851_851del		Atlas-INDEL	.											.	.	.	.	0			c.2551_2552del						PASS	.																																			SO:0001589	frameshift_variant	343990	exon8			.	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.2550_2551delAC	chr2.hg19:g.99413866_99413867delGT	ENSP00000380996:p.Arg851fs	181.0	0.0	0		102.0	42.0	0.411765	NM_207362		Frame_Shift_Del	DEL	ENST00000397899.2	hg19	CCDS42720.1																																																																																			.	.	.	none		0.619	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
ARID4A	5926	hgsc.bcm.edu	37	14	58827698	58827698	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr14:58827698delC	ENST00000355431.3	+	19	2391	c.2018delC	c.(2017-2019)tcafs	p.S673fs	ARID4A_ENST00000348476.3_Frame_Shift_Del_p.S673fs|ARID4A_ENST00000431317.2_Frame_Shift_Del_p.S673fs|ARID4A_ENST00000395168.3_Frame_Shift_Del_p.S673fs	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	673					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CCTTTAAAATCAACCCTCTCA	0.433																																					p.S673fs		Atlas-INDEL	.											.	ARID4A	222	.	0			c.2017delT						PASS	.						169.0	155.0	159.0					14																	58827698		2203	4300	6503	SO:0001589	frameshift_variant	5926	exon19			.	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2018delC	chr14.hg19:g.58827698delC	ENSP00000347602:p.Ser673fs	85.0	0.0	0		132.0	59.0	0.44697	NM_002892	Q15991|Q15992|Q15993	Frame_Shift_Del	DEL	ENST00000355431.3	hg19	CCDS9732.1																																																																																			.	.	.	none		0.433	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
KDM6A	7403	hgsc.bcm.edu	37	X	44920581	44920581	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chrX:44920581delA	ENST00000377967.4	+	14	1383	c.1342delA	c.(1342-1344)aatfs	p.N448fs	KDM6A_ENST00000536777.1_Frame_Shift_Del_p.N403fs|KDM6A_ENST00000543216.1_Frame_Shift_Del_p.N403fs|KDM6A_ENST00000382899.4_Frame_Shift_Del_p.N455fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	448	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.0(2)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TACTTCTGACAATTGGAGTGG	0.348			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.D447fs	Colon(129;1273 1667 15230 27352 52914)	Atlas-INDEL	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	8	Whole gene deletion(6)|No detectable mRNA/protein(2)	haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|breast(2)|pancreas(2)	c.1341delC						PASS	.						58.0	47.0	51.0					X																	44920581		2203	4300	6503	SO:0001589	frameshift_variant	7403	exon14			.	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.1342delA	chrX.hg19:g.44920581delA	ENSP00000367203:p.Asn448fs	11.0	0.0	0		15.0	14.0	0.933333	NM_021140	Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	hg19	CCDS14265.1																																																																																			.	.	.	none		0.348	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
EMD	2010	hgsc.bcm.edu	37	X	153609241	153609241	+	Splice_Site	DEL	G	G	-			TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chrX:153609241delG	ENST00000369842.4	+	6	737		c.e6-1		EMD_ENST00000492448.1_Splice_Site|EMD_ENST00000369835.3_Splice_Site	NM_000117.2	NP_000108.1	P50402	EMD_HUMAN	emerin						cellular response to growth factor stimulus (GO:0071363)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of protein export from nucleus (GO:0046827)|regulation of canonical Wnt signaling pathway (GO:0060828)|skeletal muscle cell differentiation (GO:0035914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	actin binding (GO:0003779)|beta-tubulin binding (GO:0048487)			lung(5)	5	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTTTGCCTCAGGGAACGCCCC	0.622																																					.		Atlas-INDEL	.											.	EMD	25	.	0			c.450-2G>-						PASS	.						77.0	67.0	71.0					X																	153609241		2203	4300	6503	SO:0001630	splice_region_variant	2010	exon6			.	X82434	CCDS14745.1	Xq27.3-q28	2014-09-17	2008-07-29		ENSG00000102119	ENSG00000102119			3331	protein-coding gene	gene with protein product	"""LEM domain containing 5"""	300384	"""Emery-Dreifuss muscular dystrophy"""				Standard	NM_000117		Approved	STA, LEMD5	uc004fkl.3	P50402	OTTHUMG00000033186	ENST00000369842.4:c.450-1G>-	chrX.hg19:g.153609241delG		70.0	0.0	0		45.0	40.0	0.888889	NM_000117	Q6FI02	Splice_Site	DEL	ENST00000369842.4	hg19	CCDS14745.1																																																																																			.	.	.	none		0.622	EMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080921.1		Intron
PDK4	5166	hgsc.bcm.edu	37	7	95221864	95221872	+	In_Frame_Del	DEL	CCAATGTGG	CCAATGTGG	-	rs138077797		TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	CCAATGTGG	CCAATGTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr7:95221864_95221872delCCAATGTGG	ENST00000005178.5	-	5	764_772	c.567_575delCCACATTGG	c.(565-576)agccacattgga>aga	p.189_192SHIG>R		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	189	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			ATCAATGCTTCCAATGTGGCTTGGGTTTC	0.321																																					p.190_192del		Atlas-INDEL	.											.	PDK4	42	.	0			c.568_576del						PASS	.																																			SO:0001651	inframe_deletion	5166	exon5			.	U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.567_575delCCACATTGG	chr7.hg19:g.95221864_95221872delCCAATGTGG	ENSP00000005178:p.Ser189_Gly192delinsArg	170.0	0.0	0		204.0	78.0	0.382353	NM_002612		In_Frame_Del	DEL	ENST00000005178.5	hg19	CCDS5643.1																																																																																			.	.	.	none		0.321	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333298.1	NM_002612	
SLC6A4	6532	hgsc.bcm.edu	37	17	28525539	28525565	+	Splice_Site	DEL	TAATAATACGCTATTGGGAAGAAAATA	TAATAATACGCTATTGGGAAGAAAATA	-	rs202181933|rs201520429|rs200015551		TCGA-HE-7129-01A-11D-1961-08	TCGA-HE-7129-10A-01D-1962-08	TAATAATACGCTATTGGGAAGAAAATA	TAATAATACGCTATTGGGAAGAAAATA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c56f3efb-5a25-4967-b817-44b1eb9f440a	3c6e3907-3f31-4a91-825b-87070d603395	g.chr17:28525539_28525565delTAATAATACGCTATTGGGAAGAAAATA	ENST00000401766.2	-	14	2331_2340	c.1819_1828delTATTTTCTTCCCAATAGCGTATTATTA	c.(1819-1830)tattttcttccc>cc	p.YFLP607del	SLC6A4_ENST00000261707.3_Splice_Site_p.YFLP607del			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	607					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	GTAATACTTTTAATAATACGCTATTGGGAAGAAAATACAATGTTATA	0.335																																					p.607_610del		Atlas-INDEL	.											.	SLC6A4	60	.	0			c.1819_1829del						PASS	.																																			SO:0001630	splice_region_variant	6532	exon15			.	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1819-1TATTTTCTTCCCAATAGCGTATTATTA>-	chr17.hg19:g.28525539_28525565delTAATAATACGCTATTGGGAAGAAAATA		81.0	0.0	0		89.0	18.0	0.202247	NM_001045	Q5EE02	Frame_Shift_Del	DEL	ENST00000401766.2	hg19	CCDS11256.1																																																																																			.	.	.	none		0.335	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045	In_Frame_Del
