#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM46B	115572	hgsc.bcm.edu	37	1	27332779	27332779	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:27332779C>T	ENST00000289166.5	-	2	1099	c.934G>A	c.(934-936)Gac>Aac	p.D312N		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	312										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		TCTGGAAAGTCGATGAAGAAG	0.677																																					p.D312N		Atlas-SNP	.											.	FAM46B	44	.	0			c.G934A						PASS	.						20.0	23.0	22.0					1																	27332779		2199	4296	6495	SO:0001583	missense	115572	exon2			GAAAGTCGATGAA	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.934G>A	chr1.hg19:g.27332779C>T	ENSP00000289166:p.Asp312Asn	34.0	0.0	.		91.0	4.0	.	NM_052943		Missense_Mutation	SNP	ENST00000289166.5	hg19	CCDS294.2	.	.	.	.	.	.	.	.	.	.	C	34	5.352046	0.95830	.	.	ENSG00000158246	ENST00000289166	T	0.39406	1.08	5.31	5.31	0.75309	Domain of unknown function DUF1693 (1);	0.178869	0.64402	D	0.000014	T	0.73329	0.3573	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79398	-0.1820	10	0.87932	D	0	-6.0156	19.1626	0.93539	0.0:1.0:0.0:0.0	.	312	Q96A09	FA46B_HUMAN	N	312	ENSP00000289166:D312N	ENSP00000289166:D312N	D	-	1	0	FAM46B	27205366	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.651000	0.83577	2.768000	0.95171	0.561000	0.74099	GAC	.	.	.	none		0.677	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943	
TMEM125	128218	hgsc.bcm.edu	37	1	43739036	43739036	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:43739036A>G	ENST00000432792.2	+	4	1213	c.643A>G	c.(643-645)Att>Gtt	p.I215V	TMEM125_ENST00000439858.1_Missense_Mutation_p.I215V			Q96AQ2	TM125_HUMAN	transmembrane protein 125	215						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CACATCCAGCATTGCCAGCCT	0.627																																					p.I215V		Atlas-SNP	.											.	TMEM125	18	.	0			c.A643G						PASS	.						35.0	29.0	31.0					1																	43739036		2203	4300	6503	SO:0001583	missense	128218	exon4			TCCAGCATTGCCA	BC016858	CCDS480.1	1p34.2	2006-02-16			ENSG00000179178	ENSG00000179178			28275	protein-coding gene	gene with protein product							Standard	NM_144626		Approved	MGC17299	uc021oml.1	Q96AQ2	OTTHUMG00000007288	ENST00000432792.2:c.643A>G	chr1.hg19:g.43739036A>G	ENSP00000429275:p.Ile215Val	205.0	0.0	.		150.0	80.0	.	NM_144626	D3DPX1	Missense_Mutation	SNP	ENST00000432792.2	hg19	CCDS480.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.340390	0.41498	.	.	ENSG00000179178	ENST00000439858;ENST00000432792	T;T	0.44482	0.92;0.92	4.91	4.91	0.64330	.	0.123297	0.53938	D	0.000057	T	0.28599	0.0708	N	0.19112	0.55	0.29819	N	0.830963	P	0.34462	0.454	B	0.31337	0.128	T	0.19844	-1.0293	10	0.36615	T	0.2	.	14.5656	0.68173	1.0:0.0:0.0:0.0	.	215	Q96AQ2	TM125_HUMAN	V	215	ENSP00000429775:I215V;ENSP00000429275:I215V	ENSP00000429275:I215V	I	+	1	0	TMEM125	43511623	1.000000	0.71417	0.997000	0.53966	0.784000	0.44337	2.906000	0.48735	1.842000	0.53543	0.460000	0.39030	ATT	.	.	.	none		0.627	TMEM125-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019032.2	NM_144626	
C1orf185	284546	hgsc.bcm.edu	37	1	51578193	51578193	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:51578193G>C	ENST00000371759.2	+	2	74	c.74G>C	c.(73-75)gGt>gCt	p.G25A	C1orf185_ENST00000467127.1_5'UTR|C1orf185_ENST00000474016.1_3'UTR	NM_001136508.1	NP_001129980.1	Q5T7R7	CA185_HUMAN	chromosome 1 open reading frame 185	25						integral component of membrane (GO:0016021)		p.0?(3)		endometrium(1)	1						TTGGGAATTGGTTTCTTTGCT	0.303																																					p.G25A		Atlas-SNP	.											.	C1orf185	14	.	3	Whole gene deletion(3)	central_nervous_system(2)|thyroid(1)	c.G74C						PASS	.						228.0	187.0	199.0					1																	51578193		692	1591	2283	SO:0001583	missense	284546	exon2			GAATTGGTTTCTT	AK130995	CCDS44142.1	1p32.3	2012-07-27			ENSG00000204006	ENSG00000204006			28096	protein-coding gene	gene with protein product							Standard	NM_001136508		Approved	FLJ27485	uc001csh.3	Q5T7R7	OTTHUMG00000008084	ENST00000371759.2:c.74G>C	chr1.hg19:g.51578193G>C	ENSP00000360824:p.Gly25Ala	26.0	0.0	.		32.0	16.0	.	NM_001136508	A6NHS3	Missense_Mutation	SNP	ENST00000371759.2	hg19	CCDS44142.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220781	0.58560	.	.	ENSG00000204006	ENST00000371759	.	.	.	4.65	2.52	0.30459	.	0.186132	0.26345	N	0.024907	T	0.42698	0.1214	N	0.24115	0.695	0.33357	D	0.571871	D	0.65815	0.995	P	0.55965	0.788	T	0.55988	-0.8053	9	0.87932	D	0	-11.586	6.7794	0.23638	0.0:0.1719:0.4748:0.3532	.	25	Q5T7R7	CA185_HUMAN	A	25	.	ENSP00000360824:G25A	G	+	2	0	C1orf185	51350781	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.006000	0.40874	1.221000	0.43506	0.563000	0.77884	GGT	.	.	.	none		0.303	C1orf185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022123.1	NM_001136508	
RPTN	126638	hgsc.bcm.edu	37	1	152127305	152127305	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:152127305C>T	ENST00000316073.3	-	3	2334	c.2270G>A	c.(2269-2271)cGa>cAa	p.R757Q		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	757	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TTGCCTGTCTCGTCTCTGATG	0.512																																					p.R757Q		Atlas-SNP	.											.	RPTN	123	.	0			c.G2270A						PASS	.						835.0	660.0	713.0					1																	152127305		1568	3582	5150	SO:0001583	missense	126638	exon3			CTGTCTCGTCTCT	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.2270G>A	chr1.hg19:g.152127305C>T	ENSP00000317895:p.Arg757Gln	367.0	1.0	.		399.0	158.0	.	NM_001122965	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	hg19	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	C	4.873	0.162231	0.09287	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.12569	2.67	5.46	-6.92	0.01644	.	1.609200	0.05690	N	0.591997	T	0.02688	0.0081	N	0.25286	0.73	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.25187	-1.0139	10	0.29301	T	0.29	0.289	14.9735	0.71251	0.0:0.6643:0.0:0.3357	.	757	Q6XPR3	RPTN_HUMAN	Q	757;412	ENSP00000317895:R757Q	ENSP00000317895:R757Q	R	-	2	0	RPTN	150393929	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-1.478000	0.02329	-2.128000	0.00818	-1.183000	0.01708	CGA	.	.	.	none		0.512	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
NUP210L	91181	hgsc.bcm.edu	37	1	154108401	154108401	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:154108401T>C	ENST00000368559.3	-	7	969	c.898A>G	c.(898-900)Aga>Gga	p.R300G	NUP210L_ENST00000271854.3_Missense_Mutation_p.R300G	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	300					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AGTGCAACTCTATGGTCTTGC	0.418																																					p.R300G		Atlas-SNP	.											.	NUP210L	181	.	0			c.A898G						PASS	.						108.0	99.0	102.0					1																	154108401		1876	4103	5979	SO:0001583	missense	91181	exon7			CAACTCTATGGTC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.898A>G	chr1.hg19:g.154108401T>C	ENSP00000357547:p.Arg300Gly	90.0	0.0	.		94.0	29.0	.	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	hg19	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	T	10.65	1.410097	0.25465	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.05447	3.44;3.44	5.0	2.53	0.30540	.	0.593551	0.16379	N	0.216995	T	0.01387	0.0045	L	0.44542	1.39	0.09310	N	1	B;B	0.31125	0.201;0.309	B;B	0.21917	0.037;0.037	T	0.48714	-0.9011	10	0.23302	T	0.38	-11.1939	4.5019	0.11869	0.0:0.1237:0.3878:0.4885	.	300;300	E7EP56;Q5VU65	.;P210L_HUMAN	G	300	ENSP00000357547:R300G;ENSP00000271854:R300G	ENSP00000271854:R300G	R	-	1	2	NUP210L	152375025	0.003000	0.15002	0.002000	0.10522	0.896000	0.52359	1.475000	0.35409	0.321000	0.23259	0.533000	0.62120	AGA	.	.	.	none		0.418	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
TMEM9	252839	hgsc.bcm.edu	37	1	201123024	201123024	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:201123024C>T	ENST00000367330.1	-	1	544	c.28G>A	c.(28-30)Gtc>Atc	p.V10I	TMEM9_ENST00000367334.5_Missense_Mutation_p.V10I|TMEM9_ENST00000367332.1_Missense_Mutation_p.V10I|TMEM9_ENST00000485839.2_Missense_Mutation_p.V10I|TMEM9_ENST00000367333.2_Missense_Mutation_p.V10I			Q9P0T7	TMEM9_HUMAN	transmembrane protein 9	10					transport (GO:0006810)	integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)				liver(1)|lung(1)|stomach(1)	3		Breast(1374;0.000301)				AAACACCCGACCACAGCCACC	0.582																																					p.V10I		Atlas-SNP	.											.	TMEM9	12	.	0			c.G28A						PASS	.						70.0	66.0	67.0					1																	201123024		2203	4300	6503	SO:0001583	missense	252839	exon2			ACCCGACCACAGC		CCDS1408.1, CCDS73001.1	1q41	2008-02-05			ENSG00000116857	ENSG00000116857			18823	protein-coding gene	gene with protein product							Standard	NM_001288565		Approved	TMEM9A	uc001gvy.3	Q9P0T7	OTTHUMG00000035831	ENST00000367330.1:c.28G>A	chr1.hg19:g.201123024C>T	ENSP00000356299:p.Val10Ile	275.0	0.0	.		251.0	89.0	.	NM_016456	B1ALM6|Q96NQ9|Q9BQF5	Missense_Mutation	SNP	ENST00000367330.1	hg19	CCDS1408.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.198740	0.58126	.	.	ENSG00000116857	ENST00000367334;ENST00000367332;ENST00000367330;ENST00000367329;ENST00000367333;ENST00000455367;ENST00000435310;ENST00000414605	.	.	.	4.66	3.75	0.43078	.	0.790844	0.10935	N	0.617956	T	0.20210	0.0486	N	0.19112	0.55	0.19300	N	0.999979	B;B;B;B	0.31581	0.329;0.049;0.008;0.003	B;B;B;B	0.25987	0.065;0.039;0.003;0.004	T	0.11641	-1.0579	9	0.08599	T	0.76	-18.4909	9.8146	0.40844	0.0:0.9026:0.0:0.0974	.	10;10;10;10	B4DJZ4;B4E1H4;B1ALM5;Q9P0T7	.;.;.;TMEM9_HUMAN	I	10	.	ENSP00000356298:V10I	V	-	1	0	TMEM9	199389647	0.000000	0.05858	0.772000	0.31596	0.991000	0.79684	0.133000	0.15912	1.175000	0.42826	0.557000	0.71058	GTC	.	.	.	none		0.582	TMEM9-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087160.1	NM_016456	
GPN1	11321	hgsc.bcm.edu	37	2	27858007	27858007	+	Splice_Site	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:27858007G>A	ENST00000610189.1	+	7	437	c.430G>A	c.(430-432)Gca>Aca	p.A144T	RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_3'UTR|GPN1_ENST00000264718.3_Splice_Site_p.A158T|GPN1_ENST00000458167.2_Splice_Site_p.A49T|GPN1_ENST00000461249.1_3'UTR|GPN1_ENST00000503738.1_Splice_Site_p.A49T|GPN1_ENST00000407583.3_Splice_Site_p.A132T|GPN1_ENST00000515877.1_Splice_Site_p.A65T|GPN1_ENST00000424214.1_Splice_Site_p.A65T	NM_007266.3	NP_009197.2			GPN-loop GTPase 1											endometrium(1)|large_intestine(1)|lung(12)	14						GTGGCTTTAGGCATCCTCATT	0.443																																					p.A158T		Atlas-SNP	.											.	GPN1	28	.	0			c.G472A						PASS	.						209.0	190.0	196.0					2																	27858007		2203	4300	6503	SO:0001630	splice_region_variant	11321	exon7			CTTTAGGCATCCT	AB044661	CCDS1760.2, CCDS46248.1, CCDS46249.1, CCDS46250.1	2p23.3	2011-11-04	2008-04-30	2008-04-30	ENSG00000198522	ENSG00000198522		"""GPN-loop GTPases"""	17030	protein-coding gene	gene with protein product	"""RNA polymerase II associated protein 4"""	611479	"""XPA binding protein 1"", ""XPA binding protein 1, GTPase"""	XAB1		11058119, 11124703	Standard	NM_007266		Approved	NTPBP, MBDIN, ATPBD1A, RPAP4	uc010ymc.2	Q9HCN4	OTTHUMG00000097784	ENST00000610189.1:c.430-1G>A	chr2.hg19:g.27858007G>A		209.0	0.0	.		189.0	73.0	.	NM_007266		Missense_Mutation	SNP	ENST00000610189.1	hg19		.	.	.	.	.	.	.	.	.	.	G	36	5.660616	0.96734	.	.	ENSG00000198522	ENST00000515877;ENST00000503738;ENST00000458167;ENST00000424214;ENST00000407583;ENST00000264718	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9	5.96	5.96	0.96718	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.53449	0.1797	M	0.77616	2.38	0.80722	D	1	P;D;D;D	0.89917	0.792;1.0;0.98;0.992	P;D;P;D	0.81914	0.9;0.995;0.876;0.92	T	0.50039	-0.8874	9	.	.	.	-8.5718	17.1122	0.86679	0.0:0.0:1.0:0.0	.	144;158;49;132	Q9HCN4;B4DQM4;B4DXU4;B5MBZ5	GPN1_HUMAN;.;.;.	T	65;49;49;65;132;158	ENSP00000424678:A65T;ENSP00000427269:A49T;ENSP00000412170:A49T;ENSP00000398115:A65T;ENSP00000384255:A132T;ENSP00000264718:A158T	.	A	+	1	0	GPN1	27711511	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.896000	0.92521	2.820000	0.97059	0.655000	0.94253	GCA	.	.	.	none		0.443	GPN1-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000473126.1	NM_007266	Missense_Mutation
ALMS1	7840	hgsc.bcm.edu	37	2	73836707	73836707	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:73836707C>T	ENST00000264448.6	+	23	12583	c.12472C>T	c.(12472-12474)Caa>Taa	p.Q4158*	ALMS1_ENST00000409009.1_Nonsense_Mutation_p.Q4116*	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	4158	ALMS motif.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGTGACCAATCAACTTCTGGG	0.433																																					p.Q4158X		Atlas-SNP	.											.	ALMS1	384	.	0			c.C12472T						PASS	.						117.0	116.0	116.0					2																	73836707		1850	4083	5933	SO:0001587	stop_gained	7840	exon23			ACCAATCAACTTC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.12472C>T	chr2.hg19:g.73836707C>T	ENSP00000264448:p.Gln4158*	54.0	0.0	.		53.0	15.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Nonsense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	53	21.012144	0.99936	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	.	.	.	5.34	5.34	0.76211	.	0.658065	0.14442	N	0.319301	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	14.4071	0.67090	0.0:1.0:0.0:0.0	.	.	.	.	X	4116;4158	.	ENSP00000264448:Q4158X	Q	+	1	0	ALMS1	73690215	0.984000	0.35163	0.996000	0.52242	0.780000	0.44128	2.387000	0.44389	2.779000	0.95612	0.591000	0.81541	CAA	.	.	.	none		0.433	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ACVR2A	92	hgsc.bcm.edu	37	2	148676153	148676153	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:148676153A>G	ENST00000241416.7	+	7	1590	c.954A>G	c.(952-954)atA>atG	p.I318M	ACVR2A_ENST00000535787.1_Missense_Mutation_p.I210M|ACVR2A_ENST00000404590.1_Missense_Mutation_p.I318M	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	318	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		AACCTGCCATATCTCACAGGT	0.348																																					p.I318M		Atlas-SNP	.											.	ACVR2A	125	.	0			c.A954G						PASS	.						42.0	44.0	43.0					2																	148676153		2202	4300	6502	SO:0001583	missense	92	exon7			TGCCATATCTCAC		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.954A>G	chr2.hg19:g.148676153A>G	ENSP00000241416:p.Ile318Met	28.0	0.0	.		56.0	22.0	.	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	hg19	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	A	17.99	3.524183	0.64747	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	T;T;T	0.73789	-0.78;-0.78;-0.78	5.63	0.102	0.14522	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050216	0.85682	D	0.000000	D	0.84465	0.5478	M	0.86178	2.8	0.54753	D	0.999987	P	0.42827	0.791	P	0.56514	0.8	D	0.85693	0.1308	10	0.59425	D	0.04	.	15.9363	0.79712	0.3896:0.6104:0.0:0.0	.	318	P27037	AVR2A_HUMAN	M	318;210;318	ENSP00000241416:I318M;ENSP00000439988:I210M;ENSP00000384338:I318M	ENSP00000241416:I318M	I	+	3	3	ACVR2A	148392623	0.981000	0.34729	0.995000	0.50966	0.986000	0.74619	0.307000	0.19296	-0.207000	0.10187	0.460000	0.39030	ATA	.	.	.	none		0.348	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
SH3BP4	23677	hgsc.bcm.edu	37	2	235949726	235949726	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:235949726C>G	ENST00000409212.1	+	4	820	c.313C>G	c.(313-315)Ccc>Gcc	p.P105A	SH3BP4_ENST00000392011.2_Missense_Mutation_p.P105A|SH3BP4_ENST00000344528.4_Missense_Mutation_p.P105A			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	105	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GGGCTACATCCCCTCCTCCTA	0.537																																					p.P105A		Atlas-SNP	.											.	SH3BP4	109	.	0			c.C313G						PASS	.						171.0	144.0	153.0					2																	235949726		2203	4300	6503	SO:0001583	missense	23677	exon4			TACATCCCCTCCT	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.313C>G	chr2.hg19:g.235949726C>G	ENSP00000386862:p.Pro105Ala	321.0	0.0	.		320.0	127.0	.	NM_014521	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	hg19	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.895268	0.91962	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000416021;ENST00000409212;ENST00000344528;ENST00000446904	D;D;D;D;D	0.99454	-5.92;-5.92;-5.92;-5.92;-5.92	5.24	5.24	0.73138	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.99635	0.9866	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97817	1.0254	10	0.72032	D	0.01	-9.9278	17.3901	0.87427	0.0:1.0:0.0:0.0	.	105;105	A8K594;Q9P0V3	.;SH3B4_HUMAN	A	105	ENSP00000375867:P105A;ENSP00000403251:P105A;ENSP00000386862:P105A;ENSP00000340237:P105A;ENSP00000415391:P105A	ENSP00000340237:P105A	P	+	1	0	SH3BP4	235614465	1.000000	0.71417	0.996000	0.52242	0.940000	0.58332	7.571000	0.82399	2.442000	0.82660	0.655000	0.94253	CCC	.	.	.	none		0.537	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
ITPR1	3708	hgsc.bcm.edu	37	3	4859771	4859771	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:4859771G>A	ENST00000443694.2	+	57	7828	c.7828G>A	c.(7828-7830)Gaa>Aaa	p.E2610K	AC018816.3_ENST00000489771.1_Intron|ITPR1_ENST00000544951.1_Missense_Mutation_p.E588K|AC018816.3_ENST00000441894.1_Intron|ITPR1_ENST00000302640.8_Missense_Mutation_p.E2610K|ITPR1_ENST00000357086.4_Missense_Mutation_p.E2577K|ITPR1_ENST00000456211.2_Missense_Mutation_p.E2562K|ITPR1_ENST00000463980.1_3'UTR|AC018816.3_ENST00000449914.1_Intron|ITPR1_ENST00000423119.2_Missense_Mutation_p.E2577K|ITPR1_ENST00000354582.6_Missense_Mutation_p.E2610K			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2625					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TTTAGGCTTGGAAAGAGACAA	0.448																																					p.E2610K		Atlas-SNP	.											.	ITPR1	659	.	0			c.G7828A						PASS	.						52.0	48.0	49.0					3																	4859771		1897	4121	6018	SO:0001583	missense	3708	exon59			GGCTTGGAAAGAG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.7828G>A	chr3.hg19:g.4859771G>A	ENSP00000401671:p.Glu2610Lys	101.0	0.0	.		126.0	45.0	.	NM_001168272	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	hg19	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	g	32	5.120856	0.94385	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.58581	0.2132	L	0.57536	1.79	0.80722	D	1	D;B;B	0.62365	0.991;0.102;0.226	P;B;B	0.61201	0.885;0.07;0.425	T	0.56147	-0.8027	10	0.35671	T	0.21	.	18.3362	0.90288	0.0:0.0:1.0:0.0	.	588;2625;2577	B7ZMI3;Q14643;G5E9P1	.;ITPR1_HUMAN;.	K	2625;2610;2610;2577;1071;2577;2562;588;2610	ENSP00000306253:E2610K;ENSP00000346595:E2610K;ENSP00000405934:E2577K;ENSP00000349597:E2577K;ENSP00000397885:E2562K;ENSP00000440564:E588K;ENSP00000401671:E2610K	ENSP00000306253:E2610K	E	+	1	0	ITPR1	4834771	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.709000	0.98729	2.311000	0.77944	0.461000	0.40582	GAA	.	.	.	none		0.448	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
THUMPD3	25917	hgsc.bcm.edu	37	3	9406849	9406849	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:9406849G>A	ENST00000345094.3	+	2	431	c.97G>A	c.(97-99)Gaa>Aaa	p.E33K	RP11-380O24.1_ENST00000517687.1_RNA|SETD5-AS1_ENST00000468186.1_RNA|THUMPD3_ENST00000452837.2_Missense_Mutation_p.E33K|RP11-380O24.1_ENST00000466431.2_RNA|THUMPD3_ENST00000515662.2_Missense_Mutation_p.E33K|RP11-380O24.1_ENST00000491930.2_RNA|RP11-380O24.1_ENST00000517846.1_RNA|RP11-380O24.1_ENST00000518331.1_RNA	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	33						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		CCTCGGAAGTGAATCTGAGCT	0.443																																					p.E33K		Atlas-SNP	.											.	THUMPD3	46	.	0			c.G97A						PASS	.						94.0	95.0	94.0					3																	9406849		2203	4300	6503	SO:0001583	missense	25917	exon2			GGAAGTGAATCTG	AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.97G>A	chr3.hg19:g.9406849G>A	ENSP00000339532:p.Glu33Lys	133.0	0.0	.		128.0	51.0	.	NM_001114092	Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	ENST00000345094.3	hg19	CCDS2573.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044109	0.75732	.	.	ENSG00000134077	ENST00000452837;ENST00000417036;ENST00000419437;ENST00000345094;ENST00000515662	T;T;T	0.44083	0.93;0.93;0.93	5.57	4.47	0.54385	.	0.949351	0.08920	N	0.874534	T	0.35595	0.0937	L	0.51422	1.61	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.11494	-1.0585	10	0.40728	T	0.16	.	5.2477	0.15506	0.1312:0.2026:0.6662:0.0	.	33	Q9BV44	THUM3_HUMAN	K	33	ENSP00000395893:E33K;ENSP00000339532:E33K;ENSP00000424064:E33K	ENSP00000339532:E33K	E	+	1	0	THUMPD3	9381849	0.049000	0.20398	0.085000	0.20634	0.888000	0.51559	2.198000	0.42705	2.785000	0.95823	0.655000	0.94253	GAA	.	.	.	none		0.443	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214127.1	NM_015453	
IGSF10	285313	hgsc.bcm.edu	37	3	151155196	151155196	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:151155196T>G	ENST00000282466.3	-	6	7152	c.7153A>C	c.(7153-7155)Agt>Cgt	p.S2385R	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2385	Ig-like C2-type 10.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TACTGATAACTTTGTGGTCCA	0.408																																					p.S2385R		Atlas-SNP	.											.	IGSF10	279	.	0			c.A7153C						PASS	.						125.0	125.0	125.0					3																	151155196		2203	4300	6503	SO:0001583	missense	285313	exon6			GATAACTTTGTGG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7153A>C	chr3.hg19:g.151155196T>G	ENSP00000282466:p.Ser2385Arg	79.0	0.0	.		77.0	41.0	.	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	hg19	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	T	4.176	0.031261	0.08101	.	.	ENSG00000152580	ENST00000282466	T	0.63580	-0.05	5.59	0.331	0.15933	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.945401	0.08716	N	0.904233	T	0.42607	0.1210	L	0.28115	0.83	0.09310	N	1	P;B	0.41080	0.737;0.141	B;B	0.36845	0.234;0.066	T	0.18681	-1.0329	10	0.22706	T	0.39	.	6.415	0.21712	0.0:0.1304:0.2469:0.6227	.	2385;412	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	R	2385	ENSP00000282466:S2385R	ENSP00000282466:S2385R	S	-	1	0	IGSF10	152637886	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	1.061000	0.30542	-0.160000	0.11002	-0.316000	0.08728	AGT	.	.	.	none		0.408	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
ENPEP	2028	hgsc.bcm.edu	37	4	111397929	111397929	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr4:111397929G>A	ENST00000265162.5	+	1	701	c.359G>A	c.(358-360)aGc>aAc	p.S120N		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	120					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GGCACCGTGAGCATCTCCATC	0.627																																					p.S120N		Atlas-SNP	.											.	ENPEP	149	.	0			c.G359A						PASS	.						96.0	100.0	99.0					4																	111397929		2203	4300	6503	SO:0001583	missense	2028	exon1			CCGTGAGCATCTC	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.359G>A	chr4.hg19:g.111397929G>A	ENSP00000265162:p.Ser120Asn	132.0	0.0	.		143.0	38.0	.	NM_001977	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	hg19	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	G	4.521	0.096620	0.08681	.	.	ENSG00000138792	ENST00000265162	T	0.02709	4.19	5.83	-6.19	0.02078	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.193580	0.05705	N	0.594848	T	0.02342	0.0072	N	0.12443	0.215	0.20489	N	0.999897	B	0.09022	0.002	B	0.14023	0.01	T	0.41270	-0.9518	10	0.17832	T	0.49	.	18.7095	0.91651	0.2671:0.1216:0.6113:0.0	.	120	Q07075	AMPE_HUMAN	N	120	ENSP00000265162:S120N	ENSP00000265162:S120N	S	+	2	0	ENPEP	111617378	0.004000	0.15560	0.072000	0.20136	0.026000	0.11368	-0.722000	0.04958	-1.974000	0.00998	-0.305000	0.09177	AGC	.	.	.	none		0.627	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
CCT5	22948	hgsc.bcm.edu	37	5	10263419	10263419	+	Silent	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:10263419G>A	ENST00000280326.4	+	10	1911	c.1491G>A	c.(1489-1491)ggG>ggA	p.G497G	CCT5_ENST00000515676.1_Silent_p.G459G|CCT5_ENST00000503026.1_Silent_p.G476G|CTD-2256P15.4_ENST00000606194.1_RNA|CCT5_ENST00000506600.1_Silent_p.G404G|CCT5_ENST00000515390.1_Silent_p.G442G	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	497					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						TGCACAAGGGGACAAATGGTG	0.512																																					p.G497G		Atlas-SNP	.											.	CCT5	49	.	0			c.G1491A						PASS	.						59.0	55.0	56.0					5																	10263419		2203	4300	6503	SO:0001819	synonymous_variant	22948	exon10			CAAGGGGACAAAT	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.1491G>A	chr5.hg19:g.10263419G>A		97.0	0.0	.		111.0	50.0	.	NM_012073	A8JZY8|A8K2X8|B4DYD8	Silent	SNP	ENST00000280326.4	hg19	CCDS3877.1																																																																																			.	.	.	none		0.512	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2		
ZNF366	167465	hgsc.bcm.edu	37	5	71739709	71739709	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:71739709C>T	ENST00000318442.5	-	5	2599	c.2109G>A	c.(2107-2109)agG>agA	p.R703R	RP11-389C8.2_ENST00000564956.1_RNA	NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	703	Interaction with CTBP1.|Interaction with NRIP1.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TCTGAAAAGCCCTGAGACTGA	0.517																																					p.R703R		Atlas-SNP	.											.	ZNF366	108	.	0			c.G2109A						PASS	.						102.0	107.0	105.0					5																	71739709		2203	4300	6503	SO:0001819	synonymous_variant	167465	exon5			AAAAGCCCTGAGA	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.2109G>A	chr5.hg19:g.71739709C>T		36.0	0.0	.		42.0	13.0	.	NM_152625	Q5HYI9|Q7RTV4	Silent	SNP	ENST00000318442.5	hg19	CCDS4015.1																																																																																			.	.	.	none		0.517	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
SLC12A2	6558	hgsc.bcm.edu	37	5	127477532	127477532	+	Silent	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:127477532T>A	ENST00000262461.2	+	10	1821	c.1632T>A	c.(1630-1632)gtT>gtA	p.V544V	SLC12A2_ENST00000343225.4_Silent_p.V544V	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	544					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	GTTCTTGTGTTGTTCGAGATG	0.308																																					p.V544V		Atlas-SNP	.											.	SLC12A2	119	.	0			c.T1632A						PASS	.						171.0	162.0	165.0					5																	127477532		2203	4300	6503	SO:0001819	synonymous_variant	6558	exon10			TTGTGTTGTTCGA		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1632T>A	chr5.hg19:g.127477532T>A		100.0	0.0	.		74.0	25.0	.	NM_001046	Q8N713|Q8WWH7	Silent	SNP	ENST00000262461.2	hg19	CCDS4144.1																																																																																			.	.	.	none		0.308	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
SLC26A2	1836	hgsc.bcm.edu	37	5	149361289	149361289	+	Silent	SNP	T	T	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:149361289T>C	ENST00000286298.4	+	3	2401	c.2133T>C	c.(2131-2133)agT>agC	p.S711S		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	711	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCTTCTATAGTGTGTATGAAG	0.413																																					p.S711S		Atlas-SNP	.											.	SLC26A2	48	.	0			c.T2133C						PASS	.						57.0	63.0	61.0					5																	149361289		2203	4299	6502	SO:0001819	synonymous_variant	1836	exon3			CTATAGTGTGTAT	U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.2133T>C	chr5.hg19:g.149361289T>C		42.0	0.0	.		41.0	17.0	.	NM_000112	A8K2U3|B2R6J1|Q6N051	Silent	SNP	ENST00000286298.4	hg19	CCDS4300.1																																																																																			.	.	.	none		0.413	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252333.2	NM_000112	
CUL9	23113	hgsc.bcm.edu	37	6	43193768	43193768	+	IGR	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr6:43193768C>A	ENST00000252050.4	+	0	7780				DNPH1_ENST00000230431.6_Intron|DNPH1_ENST00000393987.2_Nonsense_Mutation_p.E127*|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9						microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TTGGGGTGCTCACCGCGGCCA	0.647																																					p.E127X		Atlas-SNP	.											.	.	.	.	0			c.G379T						PASS	.						27.0	26.0	26.0					6																	43193768		2203	4298	6501	SO:0001628	intergenic_variant	10591	exon3			GGTGCTCACCGCG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723		chr6.hg19:g.43193768C>A		76.0	0.0	.		72.0	25.0	.	NM_199184	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Nonsense_Mutation	SNP	ENST00000252050.4	hg19	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539836	0.27563	.	.	ENSG00000112667	ENST00000393987	.	.	.	4.24	2.38	0.29361	.	.	.	.	.	.	.	.	.	.	.	0.53688	D	0.999974	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	6.7563	0.23516	0.0:0.7731:0.0:0.2269	.	.	.	.	X	127	.	ENSP00000377556:E127X	E	-	1	0	C6orf108	43301746	0.036000	0.19791	0.992000	0.48379	0.353000	0.29299	0.002000	0.13061	0.989000	0.38761	0.462000	0.41574	GAG	.	.	.	none		0.647	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
IGF2R	3482	hgsc.bcm.edu	37	6	160467594	160467594	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr6:160467594G>C	ENST00000356956.1	+	15	2116	c.1968G>C	c.(1966-1968)aaG>aaC	p.K656N		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	656					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AGACAAAGAAGTATGACTTTT	0.413																																					p.K656N		Atlas-SNP	.											.	IGF2R	251	.	0			c.G1968C						PASS	.						81.0	88.0	86.0					6																	160467594		2203	4300	6503	SO:0001583	missense	3482	exon15			AAAGAAGTATGAC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1968G>C	chr6.hg19:g.160467594G>C	ENSP00000349437:p.Lys656Asn	22.0	0.0	.		32.0	9.0	.	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	hg19	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287371	0.23478	.	.	ENSG00000197081	ENST00000356956	T	0.11277	2.79	5.07	3.25	0.37280	Mannose-6-phosphate receptor, binding (1);	0.269818	0.41500	D	0.000876	T	0.04770	0.0129	L	0.58354	1.805	0.45995	D	0.998804	P	0.45396	0.857	P	0.45377	0.478	T	0.37798	-0.9690	10	0.19147	T	0.46	-5.8683	3.1762	0.06569	0.2087:0.1255:0.5372:0.1286	.	656	P11717	MPRI_HUMAN	N	656	ENSP00000349437:K656N	ENSP00000349437:K656N	K	+	3	2	IGF2R	160387584	0.158000	0.22850	0.965000	0.40720	0.840000	0.47671	-0.185000	0.09684	1.262000	0.44165	0.655000	0.94253	AAG	.	.	.	none		0.413	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
ISPD	729920	hgsc.bcm.edu	37	7	16255771	16255771	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:16255771G>C	ENST00000407010.2	-	9	1170	c.1171C>G	c.(1171-1173)Cta>Gta	p.L391V	ISPD-AS1_ENST00000579293.1_RNA|ISPD-AS1_ENST00000582683.1_RNA|ISPD_ENST00000399310.3_Missense_Mutation_p.L341V|ISPD-AS1_ENST00000438573.1_RNA|ISPD-AS1_ENST00000457112.1_RNA	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	391					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						ATCTGCATTAGGTTTTCCATT	0.303										Multiple Myeloma(15;0.18)																											p.L391V		Atlas-SNP	.											.	ISPD	63	.	0			c.C1171G						PASS	.						64.0	60.0	61.0					7																	16255771		1786	4057	5843	SO:0001583	missense	729920	exon9			GCATTAGGTTTTC	AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.1171C>G	chr7.hg19:g.16255771G>C	ENSP00000385478:p.Leu391Val	23.0	0.0	.		50.0	28.0	.	NM_001101426	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	hg19		.	.	.	.	.	.	.	.	.	.	G	5.747	0.322274	0.10900	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.87729	-2.23;-2.29	5.22	3.4	0.38934	.	.	.	.	.	T	0.77711	0.4171	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.65857	-0.6066	9	0.48119	T	0.1	-18.4993	7.3675	0.26781	0.0916:0.1697:0.7388:0.0	.	391	A4D126	ISPD_HUMAN	V	391;341	ENSP00000385478:L391V;ENSP00000382249:L341V	ENSP00000382249:L341V	L	-	1	2	ISPD	16222296	0.250000	0.23951	0.038000	0.18304	0.431000	0.31685	0.794000	0.26958	0.685000	0.31468	0.591000	0.81541	CTA	.	.	.	none		0.303	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426	
HIP1	3092	hgsc.bcm.edu	37	7	75183809	75183809	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:75183809C>T	ENST00000336926.6	-	20	2006	c.1980G>A	c.(1978-1980)acG>acA	p.T660T	HIP1_ENST00000434438.2_Silent_p.T660T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	660					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGGATGTGACCGTGGAGAGGA	0.527			T	PDGFRB	CMML																																p.T660T		Atlas-SNP	.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1	91	.	0			c.G1980A						PASS	.						98.0	90.0	92.0					7																	75183809		2203	4300	6503	SO:0001819	synonymous_variant	3092	exon20			TGTGACCGTGGAG	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1980G>A	chr7.hg19:g.75183809C>T		105.0	0.0	.		105.0	63.0	.	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	ENST00000336926.6	hg19	CCDS34669.1																																																																																			.	.	.	none		0.527	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
PAXIP1	22976	hgsc.bcm.edu	37	7	154767474	154767474	+	Missense_Mutation	SNP	G	G	A	rs540417697		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:154767474G>A	ENST00000404141.1	-	6	1160	c.1006C>T	c.(1006-1008)Cgg>Tgg	p.R336W	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.R336W			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	336					adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CTCAGTGTCCGTACAGCTGGA	0.433																																					p.R336W		Atlas-SNP	.											.	PAXIP1	150	.	0			c.C1006T						PASS	.						45.0	44.0	44.0					7																	154767474		1947	4167	6114	SO:0001583	missense	22976	exon6			GTGTCCGTACAGC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1006C>T	chr7.hg19:g.154767474G>A	ENSP00000384048:p.Arg336Trp	101.0	0.0	.		202.0	86.0	.	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	hg19	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486598	0.63962	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.48836	0.8;0.8	5.04	4.16	0.48862	.	0.000000	0.50627	U	0.000119	T	0.63141	0.2486	M	0.68952	2.095	0.40826	D	0.983548	B;D;B;D	0.89917	0.225;1.0;0.333;1.0	B;D;B;D	0.91635	0.028;0.999;0.061;0.998	T	0.66040	-0.6022	10	0.72032	D	0.01	-63.4587	8.8578	0.35238	0.0761:0.0:0.7761:0.1478	.	289;245;302;336	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	W	336;336;284;289	ENSP00000384048:R336W;ENSP00000380376:R336W	ENSP00000319149:R289W	R	-	1	2	PAXIP1	154398407	1.000000	0.71417	0.985000	0.45067	0.878000	0.50629	3.274000	0.51631	1.250000	0.43966	0.305000	0.20034	CGG	.	.	.	none		0.433	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
SGK223	157285	hgsc.bcm.edu	37	8	8235300	8235300	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:8235300A>G	ENST00000520004.1	-	3	883	c.619T>C	c.(619-621)Ttc>Ctc	p.F207L	SGK223_ENST00000330777.4_Missense_Mutation_p.F207L			Q86YV5	SG223_HUMAN		207							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TTCTGGCGGAAGCTCTCCTGG	0.602																																					p.F207L	GBM(34;731 755 10259 33573 33867)	Atlas-SNP	.											.	.	.	.	0			c.T619C						PASS	.						88.0	97.0	94.0					8																	8235300		1951	4139	6090	SO:0001583	missense	0	exon2			GGCGGAAGCTCTC																												ENST00000520004.1:c.619T>C	chr8.hg19:g.8235300A>G	ENSP00000428054:p.Phe207Leu	111.0	0.0	.		94.0	43.0	.	NM_001080826	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	hg19	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	A	10.85	1.466943	0.26335	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.56103	0.48;0.48	5.2	5.2	0.72013	.	0.099877	0.41605	D	0.000844	T	0.38188	0.1031	L	0.32530	0.975	0.30179	N	0.800576	B	0.27351	0.176	B	0.25884	0.064	T	0.37150	-0.9718	10	0.37606	T	0.19	.	7.5573	0.27831	0.8992:0.0:0.1008:0.0	.	207	Q86YV5	SG223_HUMAN	L	207	ENSP00000330930:F207L;ENSP00000428054:F207L	ENSP00000330930:F207L	F	-	1	0	AC068353.1	8272710	0.988000	0.35896	1.000000	0.80357	0.426000	0.31534	1.270000	0.33086	2.089000	0.63090	0.533000	0.62120	TTC	.	.	.	none		0.602	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
PXDNL	137902	hgsc.bcm.edu	37	8	52359698	52359698	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:52359698T>A	ENST00000356297.4	-	12	1491	c.1391A>T	c.(1390-1392)cAg>cTg	p.Q464L	PXDNL_ENST00000543296.1_Missense_Mutation_p.Q464L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	464	Ig-like C2-type 3.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AACTGTATGCTGGCCTTCCAC	0.512																																					p.Q464L		Atlas-SNP	.											.	PXDNL	414	.	0			c.A1391T						PASS	.						109.0	107.0	108.0					8																	52359698		2028	4190	6218	SO:0001583	missense	137902	exon12			GTATGCTGGCCTT		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1391A>T	chr8.hg19:g.52359698T>A	ENSP00000348645:p.Gln464Leu	100.0	0.0	.		108.0	44.0	.	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	hg19	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	T	5.421	0.262910	0.10294	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	D;D	0.81659	-1.52;-1.52	4.02	-7.16	0.01516	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65450	0.2692	L	0.43701	1.375	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.49523	-0.8931	9	0.36615	T	0.2	.	4.0424	0.09758	0.3721:0.1572:0.0:0.4707	.	464	A1KZ92	PXDNL_HUMAN	L	464	ENSP00000348645:Q464L;ENSP00000444865:Q464L	ENSP00000348645:Q464L	Q	-	2	0	PXDNL	52522251	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.100000	0.15231	-1.355000	0.02186	-0.375000	0.07067	CAG	.	.	.	none		0.512	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
RB1CC1	9821	hgsc.bcm.edu	37	8	53555097	53555097	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:53555097T>G	ENST00000025008.5	-	18	4674	c.4151A>C	c.(4150-4152)aAg>aCg	p.K1384T	RB1CC1_ENST00000435644.2_Missense_Mutation_p.K1384T|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Missense_Mutation_p.K1384T	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1384					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTCTTCAAGCTTTTTCTTTTC	0.383																																					p.K1384T	GBM(180;1701 2102 13475 42023 52570)	Atlas-SNP	.											.	RB1CC1	163	.	0			c.A4151C						PASS	.						96.0	91.0	93.0					8																	53555097		2203	4300	6503	SO:0001583	missense	9821	exon18			TCAAGCTTTTTCT	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4151A>C	chr8.hg19:g.53555097T>G	ENSP00000025008:p.Lys1384Thr	85.0	0.0	.		93.0	39.0	.	NM_001083617	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	hg19	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.040807	0.55003	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.18338	2.22;2.22;2.22	5.61	4.46	0.54185	.	0.235291	0.44097	D	0.000482	T	0.12561	0.0305	L	0.27053	0.805	0.34041	D	0.654965	B;B	0.30361	0.277;0.181	B;B	0.33042	0.157;0.075	T	0.22941	-1.0202	10	0.26408	T	0.33	-15.3958	10.1369	0.42712	0.0:0.0806:0.0:0.9194	.	1384;1384	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	T	1384	ENSP00000025008:K1384T;ENSP00000396067:K1384T;ENSP00000445960:K1384T	ENSP00000025008:K1384T	K	-	2	0	RB1CC1	53717650	0.999000	0.42202	0.825000	0.32803	0.998000	0.95712	3.259000	0.51515	0.950000	0.37743	0.533000	0.62120	AAG	.	.	.	none		0.383	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
UTP23	84294	hgsc.bcm.edu	37	8	117782585	117782585	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:117782585C>T	ENST00000309822.2	+	2	444	c.343C>T	c.(343-345)Cat>Tat	p.H115Y	UTP23_ENST00000517820.1_Intron|UTP23_ENST00000357148.3_Missense_Mutation_p.H115Y|UTP23_ENST00000520733.1_Missense_Mutation_p.H9Y	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	115					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						AAATCCTCATCATTATTTTGT	0.353																																					p.H115Y		Atlas-SNP	.											.	UTP23	38	.	0			c.C343T						PASS	.						112.0	105.0	107.0					8																	117782585		2203	4300	6503	SO:0001583	missense	84294	exon2			CCTCATCATTATT		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.343C>T	chr8.hg19:g.117782585C>T	ENSP00000308332:p.His115Tyr	58.0	0.0	.		87.0	30.0	.	NM_032334	B2RE25|Q96NJ8	Missense_Mutation	SNP	ENST00000309822.2	hg19	CCDS6320.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351801	0.82132	.	.	ENSG00000147679	ENST00000309822;ENST00000357148;ENST00000517814;ENST00000520733	T	0.24151	1.87	5.9	5.9	0.94986	.	0.093959	0.64402	D	0.000001	T	0.54935	0.1889	M	0.79011	2.435	0.58432	D	0.999998	D	0.71674	0.998	D	0.69142	0.962	T	0.54662	-0.8260	10	0.62326	D	0.03	-17.3326	20.2789	0.98501	0.0:1.0:0.0:0.0	.	115	Q9BRU9	UTP23_HUMAN	Y	115;115;115;9	ENSP00000308332:H115Y	ENSP00000308332:H115Y	H	+	1	0	UTP23	117851766	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.525000	0.67110	2.788000	0.95919	0.650000	0.86243	CAT	.	.	.	none		0.353	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381173.1	NM_032334	
TONSL	4796	hgsc.bcm.edu	37	8	145668588	145668588	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:145668588C>G	ENST00000409379.3	-	4	410	c.381G>C	c.(379-381)agG>agC	p.R127S		NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	127					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GCAAAGCATCCCTCGACTGGC	0.622																																					p.R127S		Atlas-SNP	.											.	TONSL	128	.	0			c.G381C						PASS	.						78.0	80.0	79.0					8																	145668588		692	1591	2283	SO:0001583	missense	4796	exon4			AGCATCCCTCGAC		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.381G>C	chr8.hg19:g.145668588C>G	ENSP00000386239:p.Arg127Ser	169.0	0.0	.		160.0	50.0	.	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	hg19	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	C	3.081	-0.189045	0.06299	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.75367	-0.93	4.66	2.56	0.30785	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.56630	0.1998	L	0.36672	1.1	0.09310	N	0.999996	B	0.29716	0.255	B	0.19148	0.024	T	0.36040	-0.9764	9	0.10111	T	0.7	.	7.8666	0.29541	0.1718:0.7237:0.0:0.1045	.	127	Q96HA7	TONSL_HUMAN	S	127	ENSP00000386239:R127S	ENSP00000386239:R127S	R	-	3	2	TONSL	145639396	0.079000	0.21365	0.105000	0.21289	0.613000	0.37349	0.816000	0.27267	0.930000	0.37217	0.462000	0.41574	AGG	.	.	.	none		0.622	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
CCDC180	100499483	hgsc.bcm.edu	37	9	100128909	100128909	+	Silent	SNP	C	C	T	rs575555258		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr9:100128909C>T	ENST00000357054.1	+	43	5018	c.4083C>T	c.(4081-4083)tgC>tgT	p.C1361C	CCDC180_ENST00000395220.1_3'UTR|MIR1302-8_ENST00000408342.1_RNA|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Silent_p.C1416C|CCDC180_ENST00000375202.2_Silent_p.C1416C			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1361						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.C1361C(1)									TTGACCAGTGCGCCGAGAACA	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20527	0.0		0.0	False		,,,				2504	0.001				p.C1416C		Atlas-SNP	.											KIAA1529,colon,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4248T						PASS	.						108.0	90.0	96.0					9																	100128909		2203	4300	6503	SO:0001819	synonymous_variant	0	exon31			CCAGTGCGCCGAG	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.4083C>T	chr9.hg19:g.100128909C>T		300.0	2.0	.		336.0	119.0	.	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	ENST00000357054.1	hg19																																																																																				.	.	.	none		0.532	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
IDI2	91734	hgsc.bcm.edu	37	10	1066741	1066741	+	Missense_Mutation	SNP	C	C	T	rs368608756		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr10:1066741C>T	ENST00000277517.1	-	4	396	c.332G>A	c.(331-333)cGt>cAt	p.R111H	IDI2-AS1_ENST00000434470.1_RNA|IDI2-AS1_ENST00000420381.1_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000428780.2_RNA	NM_033261.2	NP_150286.1	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	111	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isopentenyl diphosphate metabolic process (GO:0046490)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		TGCTTGCAGACGCCTCTGGGC	0.572													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16338	0.0		0.0	False		,,,				2504	0.0				p.R111H		Atlas-SNP	.											IDI2,caecum,carcinoma,0,1	IDI2	20	.	0			c.G332A						PASS	.						100.0	86.0	91.0					10																	1066741		2203	4300	6503	SO:0001583	missense	91734	exon4			TGCAGACGCCTCT	AF271725	CCDS7055.1	10p15.3	2003-11-19			ENSG00000148377	ENSG00000148377			23487	protein-coding gene	gene with protein product		615389				12477932	Standard	NM_033261		Approved	IPPI2	uc001ifv.1	Q9BXS1	OTTHUMG00000017537	ENST00000277517.1:c.332G>A	chr10.hg19:g.1066741C>T	ENSP00000277517:p.Arg111His	92.0	0.0	.		90.0	4.0	.	NM_033261		Missense_Mutation	SNP	ENST00000277517.1	hg19	CCDS7055.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673904	0.47781	.	.	ENSG00000148377	ENST00000277517	T	0.08193	3.12	4.09	-1.8	0.07907	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.116280	0.53938	U	0.000051	T	0.25568	0.0622	M	0.88979	2.995	0.20403	N	0.999907	D	0.71674	0.998	D	0.65573	0.936	T	0.05354	-1.0890	10	0.87932	D	0	-4.7047	8.2637	0.31801	0.0:0.6495:0.1046:0.246	.	111	Q9BXS1	IDI2_HUMAN	H	111	ENSP00000277517:R111H	ENSP00000277517:R111H	R	-	2	0	IDI2	1056741	0.103000	0.21917	0.000000	0.03702	0.001000	0.01503	2.002000	0.40835	-1.050000	0.03230	-2.005000	0.00442	CGT	.	.	.	none		0.572	IDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046411.1	NM_033261	
MYPN	84665	hgsc.bcm.edu	37	10	69959137	69959137	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr10:69959137C>T	ENST00000358913.5	+	17	3786	c.3298C>T	c.(3298-3300)Ccg>Tcg	p.P1100S	MYPN_ENST00000540630.1_Missense_Mutation_p.P1100S|MYPN_ENST00000354393.2_Missense_Mutation_p.P825S	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1100	Ig-like 4.|Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GAGTGGTTTACCGCCCCCGGA	0.507																																					p.P1100S		Atlas-SNP	.											.	MYPN	189	.	0			c.C3298T						PASS	.						56.0	48.0	50.0					10																	69959137		2203	4300	6503	SO:0001583	missense	84665	exon17			GGTTTACCGCCCC	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3298C>T	chr10.hg19:g.69959137C>T	ENSP00000351790:p.Pro1100Ser	124.0	0.0	.		129.0	47.0	.	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	hg19	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	C	30	5.053409	0.93793	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.80393	-1.37;-1.37;-1.37	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94072	0.8100	H	0.97806	4.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.95767	0.8805	9	.	.	.	.	19.3311	0.94288	0.0:1.0:0.0:0.0	.	1100;825;1100	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	S	825;825;1100;1100	ENSP00000346369:P825S;ENSP00000351790:P1100S;ENSP00000441668:P1100S	.	P	+	1	0	MYPN	69629143	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	7.595000	0.82710	2.813000	0.96785	0.655000	0.94253	CCG	.	.	.	none		0.507	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
TRIM8	81603	hgsc.bcm.edu	37	10	104416093	104416093	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr10:104416093C>A	ENST00000302424.7	+	5	1121	c.999C>A	c.(997-999)ttC>ttA	p.F333L	TRIM8_ENST00000487927.1_3'UTR	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	333					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCAAGCTCTTCCTGAACGAAG	0.607																																					p.F333L		Atlas-SNP	.											.	TRIM8	35	.	0			c.C999A						PASS	.						59.0	46.0	50.0					10																	104416093		2203	4300	6503	SO:0001583	missense	81603	exon5			GCTCTTCCTGAAC	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.999C>A	chr10.hg19:g.104416093C>A	ENSP00000302120:p.Phe333Leu	170.0	0.0	.		200.0	86.0	.	NM_030912	A6NI31|Q9C028	Missense_Mutation	SNP	ENST00000302424.7	hg19	CCDS31274.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940287	0.52972	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	T	0.77489	-1.1	5.67	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.76205	0.3955	L	0.29908	0.895	0.58432	D	0.99999	P	0.52842	0.956	P	0.62184	0.899	T	0.69525	-0.5122	10	0.08837	T	0.75	.	12.1033	0.53796	0.0:0.8608:0.0:0.1392	.	333	Q9BZR9	TRIM8_HUMAN	L	333;332	ENSP00000302120:F333L	ENSP00000302120:F333L	F	+	3	2	TRIM8	104406083	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.588000	0.36633	0.753000	0.32945	0.555000	0.69702	TTC	.	.	.	none		0.607	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912	
GPR83	10888	hgsc.bcm.edu	37	11	94113422	94113422	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr11:94113422T>A	ENST00000243673.2	-	4	1336	c.1165A>T	c.(1165-1167)Aat>Tat	p.N389Y	GPR83_ENST00000539203.2_Missense_Mutation_p.N347Y	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	389					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGGCCATCATTCTTCTCTGTC	0.562																																					p.N389Y		Atlas-SNP	.											.	GPR83	47	.	0			c.A1165T						PASS	.						83.0	82.0	82.0					11																	94113422		2201	4298	6499	SO:0001583	missense	10888	exon4			CATCATTCTTCTC	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.1165A>T	chr11.hg19:g.94113422T>A	ENSP00000243673:p.Asn389Tyr	152.0	0.0	.		175.0	76.0	.	NM_016540	B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	ENST00000243673.2	hg19	CCDS8297.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.689837	0.00100	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.61392	0.11;0.22	5.75	0.538	0.17150	.	0.659318	0.17607	N	0.168232	T	0.31544	0.0800	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17319	-1.0373	10	0.21014	T	0.42	.	9.6421	0.39846	0.0:0.4117:0.0:0.5883	.	389	Q9NYM4	GPR83_HUMAN	Y	389;347	ENSP00000243673:N389Y;ENSP00000441550:N347Y	ENSP00000243673:N389Y	N	-	1	0	GPR83	93753070	0.772000	0.28567	0.077000	0.20336	0.003000	0.03518	0.384000	0.20668	0.096000	0.17463	-0.250000	0.11733	AAT	.	.	.	none		0.562	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396232.1	NM_016540	
PIWIL4	143689	hgsc.bcm.edu	37	11	94340737	94340737	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr11:94340737A>G	ENST00000299001.6	+	14	1982	c.1771A>G	c.(1771-1773)Atc>Gtc	p.I591V	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	591	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GATGATGAGTATCGCCACCAA	0.453																																					p.I591V		Atlas-SNP	.											.	PIWIL4	70	.	0			c.A1771G						PASS	.						89.0	82.0	84.0					11																	94340737		2201	4298	6499	SO:0001583	missense	143689	exon14			ATGAGTATCGCCA	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1771A>G	chr11.hg19:g.94340737A>G	ENSP00000299001:p.Ile591Val	74.0	0.0	.		95.0	37.0	.	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	hg19	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	A	0.557	-0.846779	0.02671	.	.	ENSG00000134627	ENST00000299001	T	0.30448	1.53	4.75	-9.49	0.00587	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	1.548280	0.03817	N	0.266847	T	0.10337	0.0253	N	0.03881	-0.34	0.40307	D	0.978677	B	0.14438	0.01	B	0.21546	0.035	T	0.24621	-1.0155	10	0.06099	T	0.92	0.1986	8.5103	0.33213	0.4048:0.3269:0.2683:0.0	.	591	Q7Z3Z4	PIWL4_HUMAN	V	591	ENSP00000299001:I591V	ENSP00000299001:I591V	I	+	1	0	PIWIL4	93980385	0.000000	0.05858	0.000000	0.03702	0.135000	0.20990	-0.634000	0.05477	-2.120000	0.00826	-0.472000	0.04984	ATC	.	.	.	none		0.453	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
CD9	928	hgsc.bcm.edu	37	12	6309731	6309731	+	Splice_Site	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:6309731G>A	ENST00000382518.1	+	2	502	c.66G>A	c.(64-66)tgG>tgA	p.W22*	CD9_ENST00000382515.2_5'Flank|CD9_ENST00000009180.4_Splice_Site_p.W22*			P21926	CD9_HUMAN	CD9 molecule	22					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						TCATCTTCTGGGTGAGTGAGC	0.652																																					p.W22X		Atlas-SNP	.											.	CD9	24	.	0			c.G66A						PASS	.						84.0	75.0	78.0					12																	6309731		2203	4300	6503	SO:0001630	splice_region_variant	928	exon1			CTTCTGGGTGAGT	M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.66+1G>A	chr12.hg19:g.6309731G>A		58.0	0.0	.		97.0	4.0	.	NM_001769	D3DUQ9|Q5J7W6|Q96ES4	Nonsense_Mutation	SNP	ENST00000382518.1	hg19	CCDS8540.1	.	.	.	.	.	.	.	.	.	.	G	38	6.691846	0.97768	.	.	ENSG00000010278	ENST00000382518;ENST00000536586;ENST00000382519;ENST00000425469;ENST00000009180	.	.	.	4.21	4.21	0.49690	.	0.298550	0.40302	N	0.001139	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.934	0.52864	0.0:0.0:1.0:0.0	.	.	.	.	X	22	.	ENSP00000009180:W22X	W	+	3	0	CD9	6179992	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.636000	0.67848	2.176000	0.68965	0.544000	0.68410	TGG	.	.	.	none		0.652	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103348.1		Nonsense_Mutation
XPOT	11260	hgsc.bcm.edu	37	12	64827226	64827226	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:64827226C>A	ENST00000332707.5	+	19	2824	c.2295C>A	c.(2293-2295)ttC>ttA	p.F765L		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	765	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		AACAGATGTTCATGCCCCTGC	0.383																																					p.F765L		Atlas-SNP	.											.	XPOT	105	.	0			c.C2295A						PASS	.						142.0	139.0	140.0					12																	64827226		2203	4300	6503	SO:0001583	missense	11260	exon19			GATGTTCATGCCC	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.2295C>A	chr12.hg19:g.64827226C>A	ENSP00000327821:p.Phe765Leu	122.0	0.0	.		126.0	74.0	.	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	hg19	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	C	9.351	1.065624	0.20067	.	.	ENSG00000184575	ENST00000332707	T	0.35048	1.33	4.99	1.1	0.20463	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.25121	0.0610	L	0.43923	1.385	0.58432	D	0.999994	B	0.26483	0.15	B	0.19946	0.027	T	0.05632	-1.0873	9	.	.	.	.	8.7565	0.34648	0.0:0.4567:0.0:0.5433	.	765	O43592	XPOT_HUMAN	L	765	ENSP00000327821:F765L	.	F	+	3	2	XPOT	63113493	1.000000	0.71417	0.998000	0.56505	0.566000	0.35808	0.960000	0.29253	-0.000000	0.14550	0.650000	0.86243	TTC	.	.	.	none		0.383	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
SLC35E3	55508	hgsc.bcm.edu	37	12	69158530	69158530	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:69158530G>T	ENST00000398004.2	+	5	1074	c.802G>T	c.(802-804)Gga>Tga	p.G268*	SLC35E3_ENST00000538043.1_Intron	NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	268						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			TTTATTCGGAGGATATGTTTT	0.348																																					p.G268X		Atlas-SNP	.											.	SLC35E3	23	.	0			c.G802T						PASS	.						193.0	176.0	181.0					12																	69158530		1870	4096	5966	SO:0001587	stop_gained	55508	exon5			TTCGGAGGATATG	AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.802G>T	chr12.hg19:g.69158530G>T	ENSP00000381089:p.Gly268*	72.0	0.0	.		94.0	4.0	.	NM_018656	A8K0T0|Q0P5Y5|Q9P0V1	Nonsense_Mutation	SNP	ENST00000398004.2	hg19	CCDS41808.1	.	.	.	.	.	.	.	.	.	.	G	38	6.908915	0.97928	.	.	ENSG00000175782	ENST00000398004	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.3112	19.4381	0.94806	0.0:0.0:1.0:0.0	.	.	.	.	X	268	.	.	G	+	1	0	SLC35E3	67444797	1.000000	0.71417	0.999000	0.59377	0.697000	0.40408	8.902000	0.92568	2.676000	0.91093	0.561000	0.74099	GGA	.	.	.	none		0.348	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403241.1	NM_018656	
UHRF1BP1L	23074	hgsc.bcm.edu	37	12	100453199	100453199	+	Missense_Mutation	SNP	C	C	G	rs374748413		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:100453199C>G	ENST00000279907.7	-	14	2068	c.1856G>C	c.(1855-1857)cGa>cCa	p.R619P	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.R269P	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	619								p.R619Q(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GTCAGAATGTCGACAGTTTGG	0.353																																					p.R619P		Atlas-SNP	.											UHRF1BP1L,colon,carcinoma,0,1	UHRF1BP1L	144	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1856C						PASS	.						47.0	50.0	49.0					12																	100453199		2203	4300	6503	SO:0001583	missense	23074	exon14			GAATGTCGACAGT		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1856G>C	chr12.hg19:g.100453199C>G	ENSP00000279907:p.Arg619Pro	83.0	0.0	.		103.0	22.0	.	NM_015054	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	hg19	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110310	0.56398	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.10960	2.83;2.82	5.56	5.56	0.83823	.	0.071690	0.56097	D	0.000028	T	0.26159	0.0638	L	0.51422	1.61	0.80722	D	1	D	0.63046	0.992	P	0.59115	0.852	T	0.00102	-1.2063	10	0.48119	T	0.1	-7.7813	19.5255	0.95203	0.0:1.0:0.0:0.0	.	619	A0JNW5	UH1BL_HUMAN	P	619;269	ENSP00000279907:R619P;ENSP00000444824:R269P	ENSP00000279907:R619P	R	-	2	0	UHRF1BP1L	98977330	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	4.740000	0.62087	2.624000	0.88883	0.650000	0.86243	CGA	.	.	.	alt		0.353	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
SCYL2	55681	hgsc.bcm.edu	37	12	100707272	100707272	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:100707272A>T	ENST00000360820.2	+	7	1362	c.925A>T	c.(925-927)Aat>Tat	p.N309Y		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	309	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						GCTACTGTTAAATGTAACTCC	0.363																																					p.N309Y		Atlas-SNP	.											.	SCYL2	99	.	0			c.A925T						PASS	.						94.0	84.0	87.0					12																	100707272		2203	4300	6503	SO:0001583	missense	55681	exon7			CTGTTAAATGTAA	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.925A>T	chr12.hg19:g.100707272A>T	ENSP00000354061:p.Asn309Tyr	54.0	0.0	.		102.0	27.0	.	NM_017988	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	hg19	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	A	29.9	5.046858	0.93740	.	.	ENSG00000136021	ENST00000549687;ENST00000258506;ENST00000360820	T;T	0.66815	-0.23;-0.23	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.039673	0.85682	D	0.000000	T	0.78349	0.4269	M	0.68952	2.095	0.80722	D	1	P	0.45240	0.854	P	0.57009	0.811	T	0.79680	-0.1702	10	0.62326	D	0.03	.	16.2736	0.82632	1.0:0.0:0.0:0.0	.	309	Q6P3W7	SCYL2_HUMAN	Y	309;136;309	ENSP00000448366:N309Y;ENSP00000354061:N309Y	ENSP00000258506:N136Y	N	+	1	0	SCYL2	99231403	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	8.769000	0.91742	2.247000	0.74100	0.477000	0.44152	AAT	.	.	.	none		0.363	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
IFT81	28981	hgsc.bcm.edu	37	12	110565896	110565896	+	Nonsense_Mutation	SNP	C	C	T	rs372027811		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:110565896C>T	ENST00000242591.5	+	3	696	c.190C>T	c.(190-192)Cga>Tga	p.R64*	IFT81_ENST00000552912.1_Nonsense_Mutation_p.R64*|IFT81_ENST00000361948.4_Nonsense_Mutation_p.R64*	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	64	CH (calponin-homology)-like region.				cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						GACAGCCAAACGAATGTTGAG	0.343																																					p.R64X		Atlas-SNP	.											.	IFT81	86	.	0			c.C190T						PASS	.	C	stop/ARG,stop/ARG,stop/ARG	2,4404	4.2+/-10.8	0,2,2201	125.0	120.0	122.0		190,190,190	2.9	1.0	12		122	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained,stop-gained	IFT81	NM_001143779.1,NM_014055.3,NM_031473.3	,,	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	,,	64/677,64/677,64/432	110565896	3,13003	2203	4300	6503	SO:0001587	stop_gained	28981	exon3			GCCAAACGAATGT	AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.190C>T	chr12.hg19:g.110565896C>T	ENSP00000242591:p.Arg64*	71.0	0.0	.		119.0	36.0	.	NM_014055	Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Nonsense_Mutation	SNP	ENST00000242591.5	hg19	CCDS41831.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830743	0.91036	4.54E-4	1.16E-4	ENSG00000122970	ENST00000361948;ENST00000552912;ENST00000242591;ENST00000546374	.	.	.	5.96	2.88	0.33553	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6056	16.1793	0.81889	0.5747:0.4253:0.0:0.0	.	.	.	.	X	64	.	ENSP00000242591:R64X	R	+	1	2	IFT81	109050279	0.998000	0.40836	0.997000	0.53966	0.972000	0.66771	1.423000	0.34837	0.248000	0.21435	0.655000	0.94253	CGA	.	.	.	weak		0.343	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	NM_014055	
OLFM4	10562	hgsc.bcm.edu	37	13	53624827	53624827	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr13:53624827C>A	ENST00000219022.2	+	5	1532	c.1454C>A	c.(1453-1455)cCt>cAt	p.P485H		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	485	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		AACTATAACCCTTTTGACCAG	0.378																																					p.P485H		Atlas-SNP	.											.	OLFM4	94	.	0			c.C1454A						PASS	.						99.0	100.0	100.0					13																	53624827		2203	4300	6503	SO:0001583	missense	10562	exon5			ATAACCCTTTTGA	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1454C>A	chr13.hg19:g.53624827C>A	ENSP00000219022:p.Pro485His	63.0	0.0	.		72.0	43.0	.	NM_006418	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	hg19	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816222	0.90790	.	.	ENSG00000102837	ENST00000219022	T	0.19669	2.13	5.64	5.64	0.86602	Olfactomedin-like (3);	0.049423	0.85682	D	0.000000	T	0.58409	0.2120	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67465	-0.5664	10	0.87932	D	0	.	19.7082	0.96082	0.0:1.0:0.0:0.0	.	485	Q6UX06	OLFM4_HUMAN	H	485	ENSP00000219022:P485H	ENSP00000219022:P485H	P	+	2	0	OLFM4	52522828	1.000000	0.71417	0.882000	0.34594	0.914000	0.54420	6.095000	0.71439	2.651000	0.90000	0.585000	0.79938	CCT	.	.	.	none		0.378	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
C14orf105	55195	hgsc.bcm.edu	37	14	57960296	57960296	+	Silent	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr14:57960296T>A	ENST00000216445.3	-	1	274	c.138A>T	c.(136-138)tcA>tcT	p.S46S	C14orf105_ENST00000534126.1_Silent_p.S46S|C14orf105_ENST00000422976.2_Silent_p.S46S|C14orf105_ENST00000526336.1_Silent_p.S46S	NM_001283057.1|NM_018168.2	NP_001269986.1|NP_060638.2	Q9NVL8	CN105_HUMAN	chromosome 14 open reading frame 105	46										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						GTCTTGCCAGTGAATATGAAG	0.438																																					p.S46S		Atlas-SNP	.											.	C14orf105	26	.	0			c.A138T						PASS	.						126.0	127.0	127.0					14																	57960296		2203	4300	6503	SO:0001819	synonymous_variant	55195	exon1			TGCCAGTGAATAT	AK001512	CCDS9730.1, CCDS61458.1, CCDS61459.1	14q22.2	2012-09-25			ENSG00000100557	ENSG00000100557			20189	protein-coding gene	gene with protein product							Standard	XM_005267806		Approved	FLJ10650	uc001xcy.2	Q9NVL8	OTTHUMG00000140317	ENST00000216445.3:c.138A>T	chr14.hg19:g.57960296T>A		67.0	0.0	.		75.0	35.0	.	NM_018168	Q53G04	Silent	SNP	ENST00000216445.3	hg19	CCDS9730.1																																																																																			.	.	.	none		0.438	C14orf105-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276921.2	NM_018168	
PAPLN	89932	hgsc.bcm.edu	37	14	73712877	73712877	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr14:73712877T>G	ENST00000554301.1	+	4	491	c.328T>G	c.(328-330)Tac>Gac	p.Y110D	RNU6-419P_ENST00000517030.1_RNA|PAPLN_ENST00000555445.1_Missense_Mutation_p.Y110D|PAPLN_ENST00000381166.3_Missense_Mutation_p.Y110D|PAPLN_ENST00000340738.5_Missense_Mutation_p.Y110D|RP4-647C14.2_ENST00000554614.1_RNA|PAPLN_ENST00000427855.1_Missense_Mutation_p.Y110D			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	110						basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GCTGCCCTACTACAGCGGTGA	0.642																																					p.Y110D		Atlas-SNP	.											.	PAPLN	180	.	0			c.T328G						PASS	.						8.0	10.0	10.0					14																	73712877		2163	4255	6418	SO:0001583	missense	89932	exon5			CCCTACTACAGCG	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.328T>G	chr14.hg19:g.73712877T>G	ENSP00000451803:p.Tyr110Asp	28.0	0.0	.		60.0	20.0	.	NM_173462	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	hg19		.	.	.	.	.	.	.	.	.	.	T	23.3	4.398999	0.83120	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000394134;ENST00000554301;ENST00000555445	T;T;T;T;T	0.03441	3.93;3.93;3.93;3.93;3.93	4.26	4.26	0.50523	.	.	.	.	.	T	0.17662	0.0424	M	0.82132	2.575	0.47698	D	0.999491	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.72625	0.978;0.951;0.975	T	0.00593	-1.1654	9	0.62326	D	0.03	.	13.222	0.59894	0.0:0.0:0.0:1.0	.	110;110;110	O95428-5;O95428;O95428-6	.;PPN_HUMAN;.	D	110	ENSP00000345395:Y110D;ENSP00000403403:Y110D;ENSP00000370558:Y110D;ENSP00000451803:Y110D;ENSP00000451729:Y110D	ENSP00000216658:Y110D	Y	+	1	0	PAPLN	72782630	1.000000	0.71417	0.997000	0.53966	0.671000	0.39405	4.002000	0.57053	1.789000	0.52484	0.379000	0.24179	TAC	.	.	.	none		0.642	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462	
ELMSAN1	91748	hgsc.bcm.edu	37	14	74186137	74186137	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr14:74186137G>A	ENST00000286523.5	-	12	3787	c.3005C>T	c.(3004-3006)tCg>tTg	p.S1002L	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.S1002L	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	1002					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TGGCTTCTCCGAGGCCTGGCC	0.527																																					p.S1002L		Atlas-SNP	.											.	.	.	.	0			c.C3005T						PASS	.						66.0	57.0	60.0					14																	74186137		2203	4300	6503	SO:0001583	missense	91748	exon12			TTCTCCGAGGCCT	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.3005C>T	chr14.hg19:g.74186137G>A	ENSP00000286523:p.Ser1002Leu	123.0	0.0	.		115.0	5.0	.	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	hg19	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238379	0.22711	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.16597	2.33;2.33;2.33;2.34	5.78	3.01	0.34805	.	0.864589	0.10001	N	0.728430	T	0.10723	0.0262	N	0.14661	0.345	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.06405	0.002;0.001	T	0.31336	-0.9947	10	0.54805	T	0.06	-0.0033	7.6864	0.28542	0.2049:0.1262:0.6689:0.0	.	1002;1002	A0PJD3;Q6PJG2	.;CN043_HUMAN	L	1002	ENSP00000377634:S1002L;ENSP00000286523:S1002L;ENSP00000407767:S1002L;ENSP00000402380:S1002L	ENSP00000286523:S1002L	S	-	2	0	C14orf43	73255890	0.009000	0.17119	0.019000	0.16419	0.097000	0.18754	0.897000	0.28390	0.389000	0.25086	-0.258000	0.10820	TCG	.	.	.	none		0.527	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
NUSAP1	51203	hgsc.bcm.edu	37	15	41669495	41669495	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr15:41669495C>T	ENST00000559596.1	+	10	1312	c.1225C>T	c.(1225-1227)Cag>Tag	p.Q409*	NUSAP1_ENST00000450592.2_Nonsense_Mutation_p.Q346*|NUSAP1_ENST00000560747.1_Nonsense_Mutation_p.Q407*|NUSAP1_ENST00000558123.1_3'UTR|NUSAP1_ENST00000260359.6_Nonsense_Mutation_p.Q394*|NUSAP1_ENST00000414849.2_Nonsense_Mutation_p.Q408*|NUSAP1_ENST00000450318.1_Nonsense_Mutation_p.Q370*|NUSAP1_ENST00000560177.1_Nonsense_Mutation_p.Q408*			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	409					establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		ACCCCATCTCCAGACAAAGTA	0.333																																					p.Q409X		Atlas-SNP	.											.	NUSAP1	32	.	0			c.C1225T						PASS	.						16.0	14.0	15.0					15																	41669495		1771	4000	5771	SO:0001587	stop_gained	51203	exon10			CATCTCCAGACAA	AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.1225C>T	chr15.hg19:g.41669495C>T	ENSP00000453403:p.Gln409*	40.0	0.0	.		56.0	20.0	.	NM_016359	B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Nonsense_Mutation	SNP	ENST00000559596.1	hg19	CCDS45234.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761477	0.49468	.	.	ENSG00000137804	ENST00000260359;ENST00000414849;ENST00000450318;ENST00000450592	.	.	.	5.65	4.71	0.59529	.	0.367085	0.31922	N	0.006860	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	12.8916	0.58073	0.1626:0.8374:0.0:0.0	.	.	.	.	X	409;408;370;346	.	ENSP00000260359:Q409X	Q	+	1	0	NUSAP1	39456787	1.000000	0.71417	0.756000	0.31282	0.567000	0.35839	2.988000	0.49386	1.561000	0.49584	0.655000	0.94253	CAG	.	.	.	none		0.333	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419427.1	NM_016359	
SHF	90525	hgsc.bcm.edu	37	15	45491143	45491143	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr15:45491143G>T	ENST00000290894.8	-	2	624	c.130C>A	c.(130-132)Cat>Aat	p.H44N	SHF_ENST00000318390.6_Missense_Mutation_p.H101N|RP11-519G16.2_ENST00000560034.1_RNA|CTD-2651B20.7_ENST00000568314.1_RNA|CTD-2651B20.6_ENST00000563103.1_RNA	NM_138356.2	NP_612365			Src homology 2 domain containing F											endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(2)	12		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		ATCCAGGAATGGGGCTGGGCG	0.632											OREG0023105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H44N		Atlas-SNP	.											.	SHF	27	.	0			c.C130A						PASS	.						50.0	54.0	53.0					15																	45491143		1969	4159	6128	SO:0001583	missense	90525	exon2			AGGAATGGGGCTG	BC007586	CCDS10120.2, CCDS73721.1	15q21.1	2013-02-14			ENSG00000138606	ENSG00000138606		"""SH2 domain containing"""	25116	protein-coding gene	gene with protein product						11095946	Standard	NM_138356		Approved		uc001zuy.3	Q7M4L6	OTTHUMG00000131353	ENST00000290894.8:c.130C>A	chr15.hg19:g.45491143G>T	ENSP00000290894:p.His44Asn	123.0	0.0	.	932	137.0	68.0	.	NM_138356		Missense_Mutation	SNP	ENST00000290894.8	hg19	CCDS10120.2	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788761	0.31685	.	.	ENSG00000138606	ENST00000290894;ENST00000361989;ENST00000318390	T;T	0.38240	1.57;1.15	3.04	-6.08	0.02151	.	7739.210000	0.00166	N	0.000000	T	0.23886	0.0578	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15578	-1.0432	10	0.37606	T	0.19	3.8664	8.6801	0.34203	0.0:0.4794:0.1588:0.3618	.	44	Q7M4L6	SHF_HUMAN	N	44;44;101	ENSP00000290894:H44N;ENSP00000315978:H101N	ENSP00000290894:H44N	H	-	1	0	SHF	43278435	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.536000	0.02208	-1.992000	0.00975	0.655000	0.94253	CAT	.	.	.	none		0.632	SHF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254141.2	NM_138356	
C15orf39	56905	hgsc.bcm.edu	37	15	75499667	75499667	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr15:75499667C>T	ENST00000360639.2	+	2	1598	c.1278C>T	c.(1276-1278)tgC>tgT	p.C426C	C15orf39_ENST00000567617.1_Silent_p.C426C|C15orf39_ENST00000394987.4_Silent_p.C426C			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	426						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						GCCAGCCCTGCTCAGAGCCTG	0.642																																					p.C426C		Atlas-SNP	.											.	C15orf39	64	.	0			c.C1278T						PASS	.						37.0	42.0	40.0					15																	75499667		2197	4295	6492	SO:0001819	synonymous_variant	56905	exon2			GCCCTGCTCAGAG	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.1278C>T	chr15.hg19:g.75499667C>T		119.0	0.0	.		150.0	64.0	.	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Silent	SNP	ENST00000360639.2	hg19	CCDS10276.1																																																																																			.	.	.	none		0.642	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
CREBBP	1387	hgsc.bcm.edu	37	16	3901001	3901001	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:3901001G>A	ENST00000262367.5	-	2	904	c.95C>T	c.(94-96)tCa>tTa	p.S32L	CREBBP_ENST00000382070.3_Missense_Mutation_p.S32L	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	32					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTCAAACAATGATCCAAAATC	0.403			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.S32L		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.C95T						PASS	.						55.0	54.0	55.0					16																	3901001		2195	4291	6486	SO:0001583	missense	1387	exon2			AACAATGATCCAA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.95C>T	chr16.hg19:g.3901001G>A	ENSP00000262367:p.Ser32Leu	49.0	0.0	.		78.0	22.0	.	NM_001079846	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	hg19	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054063	0.75960	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.86562	-2.14;-2.12	5.92	5.92	0.95590	.	0.086452	0.49916	D	0.000127	D	0.92172	0.7518	M	0.72894	2.215	0.80722	D	1	P;D	0.58620	0.949;0.983	P;P	0.57101	0.719;0.813	D	0.92259	0.5815	10	0.87932	D	0	-4.3311	20.3206	0.98668	0.0:0.0:1.0:0.0	.	100;32	Q4LE28;Q92793	.;CBP_HUMAN	L	32;100;32	ENSP00000262367:S32L;ENSP00000371502:S32L	ENSP00000262367:S32L	S	-	2	0	CREBBP	3841002	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.390000	0.79816	2.809000	0.96659	0.655000	0.94253	TCA	.	.	.	none		0.403	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
UBN1	29855	hgsc.bcm.edu	37	16	4908004	4908004	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:4908004C>T	ENST00000396658.4	+	2	966	c.263C>T	c.(262-264)tCa>tTa	p.S88L	UBN1_ENST00000590769.1_Missense_Mutation_p.S88L|UBN1_ENST00000545171.1_Missense_Mutation_p.S88L|UBN1_ENST00000262376.6_Missense_Mutation_p.S88L	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	88	Sufficient for interaction with HIRA.				chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						AAAGATCTGTCAGATCCTTTC	0.338																																					p.S88L		Atlas-SNP	.											.	UBN1	88	.	0			c.C263T						PASS	.						70.0	77.0	75.0					16																	4908004		2197	4300	6497	SO:0001583	missense	29855	exon3			ATCTGTCAGATCC	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.263C>T	chr16.hg19:g.4908004C>T	ENSP00000379894:p.Ser88Leu	12.0	0.0	.		32.0	9.0	.	NM_001079514	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	hg19	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	C	10.11	1.260216	0.23051	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.44083	1.51;0.93;1.51	5.37	-2.3	0.06785	.	1.211730	0.05673	N	0.589051	T	0.27313	0.0670	N	0.16266	0.395	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.26258	-1.0108	10	0.27785	T	0.31	1.4387	11.8692	0.52511	0.0:0.4651:0.0:0.5349	.	88;88	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	L	88	ENSP00000262376:S88L;ENSP00000442379:S88L;ENSP00000379894:S88L	ENSP00000262376:S88L	S	+	2	0	UBN1	4848005	0.000000	0.05858	0.017000	0.16124	0.976000	0.68499	-1.157000	0.03157	-0.259000	0.09432	0.655000	0.94253	TCA	.	.	.	none		0.338	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
DNAH3	55567	hgsc.bcm.edu	37	16	21051260	21051260	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:21051260C>A	ENST00000261383.3	-	33	4643	c.4644G>T	c.(4642-4644)ttG>ttT	p.L1548F	DNAH3_ENST00000415178.1_Missense_Mutation_p.L1548F	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1548	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTGTCCGGAACAAGGCCTGGA	0.488																																					p.L1548F		Atlas-SNP	.											.	DNAH3	1142	.	0			c.G4644T						PASS	.						114.0	103.0	107.0					16																	21051260		2201	4300	6501	SO:0001583	missense	55567	exon33			CCGGAACAAGGCC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4644G>T	chr16.hg19:g.21051260C>A	ENSP00000261383:p.Leu1548Phe	177.0	0.0	.		236.0	59.0	.	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	c	19.21	3.783406	0.70222	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.40756	1.02;1.02	5.48	-3.63	0.04529	ATPase, AAA+ type, core (1);	0.000000	0.64402	D	0.000008	T	0.71787	0.3381	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76408	-0.2970	10	0.87932	D	0	.	11.9329	0.52857	0.0:0.4256:0.0:0.5744	.	1548	Q8TD57	DYH3_HUMAN	F	1548	ENSP00000261383:L1548F;ENSP00000394245:L1548F	ENSP00000261383:L1548F	L	-	3	2	DNAH3	20958761	0.014000	0.17966	0.915000	0.36163	0.963000	0.63663	-0.900000	0.04097	-0.896000	0.03915	-0.753000	0.03488	TTG	.	.	.	none		0.488	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
MBTPS1	8720	hgsc.bcm.edu	37	16	84094306	84094306	+	Silent	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:84094306G>C	ENST00000343411.3	-	20	3180	c.2685C>G	c.(2683-2685)gtC>gtG	p.V895V		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	895					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TCTCTGGAGTGACTGAGCCTG	0.592																																					p.V895V		Atlas-SNP	.											.	MBTPS1	85	.	0			c.C2685G						PASS	.						65.0	53.0	57.0					16																	84094306		2200	4300	6500	SO:0001819	synonymous_variant	8720	exon20			TGGAGTGACTGAG	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.2685C>G	chr16.hg19:g.84094306G>C		110.0	0.0	.		126.0	55.0	.	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	hg19	CCDS10941.1																																																																																			.	.	.	none		0.592	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
ZCCHC14	23174	hgsc.bcm.edu	37	16	87445209	87445209	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:87445209T>A	ENST00000268616.4	-	12	2924	c.2707A>T	c.(2707-2709)Agc>Tgc	p.S903C		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	903							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		AGGTTCCCGCTCTTTTTGTGA	0.597																																					p.S903C		Atlas-SNP	.											.	ZCCHC14	87	.	0			c.A2707T						PASS	.						85.0	74.0	78.0					16																	87445209		2198	4300	6498	SO:0001583	missense	23174	exon12			TCCCGCTCTTTTT	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.2707A>T	chr16.hg19:g.87445209T>A	ENSP00000268616:p.Ser903Cys	136.0	0.0	.		165.0	56.0	.	NM_015144	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	hg19	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.654553	0.47467	.	.	ENSG00000140948	ENST00000268616	T	0.76968	-1.06	5.55	5.55	0.83447	.	0.169858	0.53938	D	0.000059	T	0.79375	0.4435	L	0.27053	0.805	0.33555	D	0.596683	D;D	0.67145	0.996;0.993	P;P	0.59288	0.855;0.72	D	0.85907	0.1438	10	0.87932	D	0	-19.183	15.975	0.80057	0.0:0.0:0.0:1.0	.	903;903	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	C	903	ENSP00000268616:S903C	ENSP00000268616:S903C	S	-	1	0	ZCCHC14	86002710	0.998000	0.40836	0.998000	0.56505	0.927000	0.56198	1.668000	0.37481	2.223000	0.72356	0.533000	0.62120	AGC	.	.	.	none		0.597	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144	
FXR2	9513	hgsc.bcm.edu	37	17	7497319	7497319	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:7497319T>G	ENST00000250113.7	-	11	1358	c.1024A>C	c.(1024-1026)Atg>Ctg	p.M342L	FXR2_ENST00000573057.1_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	342						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		AAGGGAACCATTCCCTAGAGA	0.532																																					p.M342L		Atlas-SNP	.											.	FXR2	44	.	0			c.A1024C						PASS	.						60.0	59.0	59.0					17																	7497319		1905	4126	6031	SO:0001583	missense	9513	exon11			GAACCATTCCCTA	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1024A>C	chr17.hg19:g.7497319T>G	ENSP00000250113:p.Met342Leu	46.0	0.0	.		63.0	18.0	.	NM_004860	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	hg19	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	T	9.196	1.027335	0.19512	.	.	ENSG00000129245	ENST00000250113	T	0.27720	1.65	5.52	5.52	0.82312	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.122387	0.64402	D	0.000001	T	0.18299	0.0439	N	0.12746	0.255	0.42425	D	0.992651	B	0.06786	0.001	B	0.09377	0.004	T	0.08932	-1.0698	10	0.22706	T	0.39	1.2613	13.6401	0.62246	0.0:0.0:0.0:1.0	.	342	P51116	FXR2_HUMAN	L	342	ENSP00000250113:M342L	ENSP00000250113:M342L	M	-	1	0	FXR2	7438044	1.000000	0.71417	1.000000	0.80357	0.081000	0.17604	5.842000	0.69417	2.317000	0.78254	0.460000	0.39030	ATG	.	.	.	none		0.532	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		
MYH4	4622	hgsc.bcm.edu	37	17	10366950	10366950	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:10366950T>G	ENST00000255381.2	-	8	769	c.659A>C	c.(658-660)gAa>gCa	p.E220A	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	220	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GATTTGATCTTCAAGGGTCCC	0.448																																					p.E220A		Atlas-SNP	.											.	MYH4	349	.	0			c.A659C						PASS	.						73.0	73.0	73.0					17																	10366950		2203	4300	6503	SO:0001583	missense	4622	exon8			TGATCTTCAAGGG		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.659A>C	chr17.hg19:g.10366950T>G	ENSP00000255381:p.Glu220Ala	58.0	0.0	.		72.0	55.0	.	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567354	0.86439	.	.	ENSG00000141048	ENST00000255381	D	0.89050	-2.46	5.14	5.14	0.70334	Myosin head, motor domain (2);	0.000000	0.38005	U	0.001849	D	0.96503	0.8859	H	0.97707	4.06	0.80722	D	1	D	0.63880	0.993	D	0.77557	0.99	D	0.97990	1.0354	10	0.87932	D	0	.	15.2278	0.73364	0.0:0.0:0.0:1.0	.	220	Q9Y623	MYH4_HUMAN	A	220	ENSP00000255381:E220A	ENSP00000255381:E220A	E	-	2	0	MYH4	10307675	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.966000	0.87956	2.052000	0.61016	0.455000	0.32223	GAA	.	.	.	none		0.448	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
STAC2	342667	hgsc.bcm.edu	37	17	37373422	37373422	+	Silent	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:37373422G>A	ENST00000333461.5	-	3	771	c.402C>T	c.(400-402)aaC>aaT	p.N134N		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	134					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						CCTGTTTGGAGTTTCCTAGGA	0.562																																					p.N134N		Atlas-SNP	.											.	STAC2	47	.	0			c.C402T						PASS	.						59.0	56.0	57.0					17																	37373422		2203	4300	6503	SO:0001819	synonymous_variant	342667	exon3			TTTGGAGTTTCCT	AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.402C>T	chr17.hg19:g.37373422G>A		83.0	0.0	.		115.0	60.0	.	NM_198993	Q32MA3	Silent	SNP	ENST00000333461.5	hg19	CCDS11335.1																																																																																			.	.	.	none		0.562	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444533.2	NM_198993	
PPM1E	22843	hgsc.bcm.edu	37	17	56833454	56833454	+	Silent	SNP	G	G	A	rs77856248		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:56833454G>A	ENST00000308249.2	+	1	225	c.96G>A	c.(94-96)gaG>gaA	p.E32E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			Gcgagccggagccggaacccg	0.667																																					p.E32E		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G96A						PASS	.						14.0	20.0	18.0					17																	56833454		2185	4284	6469	SO:0001819	synonymous_variant	22843	exon1			GCCGGAGCCGGAA	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.96G>A	chr17.hg19:g.56833454G>A		31.0	0.0	.		79.0	11.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.667	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833457	56833457	+	Silent	SNP	G	G	C	rs3834568|rs201186780|rs74256772	byFrequency	TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:56833457G>C	ENST00000308249.2	+	1	228	c.99G>C	c.(97-99)ccG>ccC	p.P33P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			agccggagccggaacccgaac	0.672																																					p.P33P		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G99C						PASS	.						14.0	20.0	18.0					17																	56833457		2188	4284	6472	SO:0001819	synonymous_variant	22843	exon1			GGAGCCGGAACCC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.99G>C	chr17.hg19:g.56833457G>C		28.0	1.0	.		72.0	12.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.672	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
NEDD4L	23327	hgsc.bcm.edu	37	18	56033337	56033337	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr18:56033337G>C	ENST00000400345.3	+	21	2223	c.1940G>C	c.(1939-1941)aGa>aCa	p.R647T	NEDD4L_ENST00000256832.7_Missense_Mutation_p.R507T|NEDD4L_ENST00000356462.6_Missense_Mutation_p.R583T|NEDD4L_ENST00000456986.1_Missense_Mutation_p.R526T|NEDD4L_ENST00000256830.9_Missense_Mutation_p.R543T|NEDD4L_ENST00000431212.2_Missense_Mutation_p.R526T|NEDD4L_ENST00000586263.1_Missense_Mutation_p.R619T|NEDD4L_ENST00000357895.5_Missense_Mutation_p.R639T|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000382850.4_Missense_Mutation_p.R627T|NEDD4L_ENST00000435432.2_Missense_Mutation_p.R506T|NEDD4L_ENST00000456173.2_Missense_Mutation_p.R506T	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	647	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						CTAAAAGCTAGACTGTGGATT	0.408																																					p.R647T		Atlas-SNP	.											.	NEDD4L	126	.	0			c.G1940C						PASS	.						122.0	114.0	117.0					18																	56033337		1867	4102	5969	SO:0001583	missense	23327	exon21			AAGCTAGACTGTG	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1940G>C	chr18.hg19:g.56033337G>C	ENSP00000383199:p.Arg647Thr	93.0	0.0	.		132.0	9.0	.	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	hg19	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	G	30	5.052900	0.93793	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.75938	0.97;0.97;0.97;0.97;-0.98;-0.98;0.97;-0.98;-0.98;-0.98	5.54	5.54	0.83059	HECT (3);	0.000000	0.85682	D	0.000000	D	0.86727	0.6002	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.966;0.985;0.999;0.999	D;D;P;D;D;D	0.77004	0.989;0.985;0.574;0.955;0.977;0.985	D	0.87407	0.2373	10	0.87932	D	0	.	19.8487	0.96730	0.0:0.0:1.0:0.0	.	619;639;506;583;647;627	Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;NED4L_HUMAN;.	T	647;627;583;543;507;526;639;506;506;526	ENSP00000383199:R647T;ENSP00000372301:R627T;ENSP00000348847:R583T;ENSP00000256830:R543T;ENSP00000256832:R507T;ENSP00000411947:R526T;ENSP00000350569:R639T;ENSP00000393395:R506T;ENSP00000405440:R506T;ENSP00000389406:R526T	ENSP00000256830:R543T	R	+	2	0	NEDD4L	54184317	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.748000	0.94277	0.650000	0.86243	AGA	.	.	.	none		0.408	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
PLPPR3	79948	hgsc.bcm.edu	37	19	815207	815207	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:815207G>A	ENST00000520876.3	-	4	460	c.382C>T	c.(382-384)Cgg>Tgg	p.R128W	MIR3187_ENST00000583431.1_RNA|LPPR3_ENST00000359894.2_Missense_Mutation_p.R128W	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		128						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										ACCGTACGCCGCAGGAAGGAG	0.716																																					p.R128W		Atlas-SNP	.											.	.	.	.	0			c.C382T						PASS	.						23.0	28.0	26.0					19																	815207		2181	4286	6467	SO:0001583	missense	0	exon4			TACGCCGCAGGAA																												ENST00000520876.3:c.382C>T	chr19.hg19:g.815207G>A	ENSP00000430297:p.Arg128Trp	0.0	0.0	.		4.0	4.0	.	NM_001270366	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	hg19	CCDS58636.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790052	0.70337	.	.	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876;ENST00000521445	T;T	0.52526	0.66;0.66	4.33	3.27	0.37495	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.68339	0.2990	M	0.82517	2.595	0.52501	D	0.999955	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.71712	-0.4510	10	0.87932	D	0	-9.9087	11.2342	0.48931	0.0:0.0:0.8149:0.1851	.	128;128;128	Q6T4P5-2;Q6T4P5;Q6T4P5-3	.;LPPR3_HUMAN;.	W	128	ENSP00000352962:R128W;ENSP00000430297:R128W	ENSP00000300947:R128W	R	-	1	2	AC006273.1	766207	0.599000	0.26891	0.997000	0.53966	0.459000	0.32528	0.345000	0.19979	0.788000	0.33755	0.462000	0.41574	CGG	.	.	.	none		0.716	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
ZNF57	126295	hgsc.bcm.edu	37	19	2915555	2915555	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:2915555C>T	ENST00000306908.5	+	2	187	c.39C>T	c.(37-39)ttC>ttT	p.F13F	AC006277.2_ENST00000520090.2_RNA|ZNF57_ENST00000523428.1_5'UTR	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	13	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTGGACTTCACCCTGGAGG	0.542																																					p.F13F	NSCLC(150;910 1964 4303 10464 26498)	Atlas-SNP	.											.	ZNF57	57	.	0			c.C39T						PASS	.						160.0	141.0	147.0					19																	2915555		2203	4300	6503	SO:0001819	synonymous_variant	126295	exon2			GGACTTCACCCTG	M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.39C>T	chr19.hg19:g.2915555C>T		174.0	0.0	.		170.0	76.0	.	NM_173480	Q8N6R9	Silent	SNP	ENST00000306908.5	hg19	CCDS12098.1																																																																																			.	.	.	none		0.542	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
C19orf71	100128569	hgsc.bcm.edu	37	19	3543943	3543943	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:3543943C>T	ENST00000329493.5	+	4	589	c.565C>T	c.(565-567)Ctg>Ttg	p.L189L	MFSD12_ENST00000398558.4_Intron|AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000389395.3_Intron	NM_001135580.1	NP_001129052.1	A6NCJ1	CS071_HUMAN	chromosome 19 open reading frame 71	189										endometrium(2)	2						GGAGTGGGTCCTGGAACCATA	0.662																																					p.L189L		Atlas-SNP	.											.	C19orf71	12	.	0			c.C565T						PASS	.						83.0	93.0	90.0					19																	3543943		692	1591	2283	SO:0001819	synonymous_variant	100128569	exon4			TGGGTCCTGGAAC		CCDS45918.1	19p13.3	2012-10-26			ENSG00000183397	ENSG00000183397			34496	protein-coding gene	gene with protein product							Standard	NM_001135580		Approved	LOC100128569	uc010xhm.2	A6NCJ1		ENST00000329493.5:c.565C>T	chr19.hg19:g.3543943C>T		253.0	0.0	.		348.0	126.0	.	NM_001135580		Silent	SNP	ENST00000329493.5	hg19	CCDS45918.1																																																																																			.	.	.	none		0.662	C19orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452943.1	NM_001135580	
ZFR2	23217	hgsc.bcm.edu	37	19	3808936	3808936	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:3808936G>A	ENST00000262961.4	-	17	2489	c.2479C>T	c.(2479-2481)Ccc>Tcc	p.P827S		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	827	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GGGCCCAGGGGCCCAGCCGCA	0.697																																					p.P827S		Atlas-SNP	.											.	ZFR2	63	.	0			c.C2479T						PASS	.						10.0	15.0	14.0					19																	3808936		2017	4182	6199	SO:0001583	missense	23217	exon17			CCAGGGGCCCAGC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.2479C>T	chr19.hg19:g.3808936G>A	ENSP00000262961:p.Pro827Ser	16.0	0.0	.		33.0	15.0	.	NM_015174		Missense_Mutation	SNP	ENST00000262961.4	hg19	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588474	0.46110	.	.	ENSG00000105278	ENST00000262961	T	0.42131	0.98	3.97	3.97	0.46021	DZF (2);	0.084158	0.48767	U	0.000179	T	0.62962	0.2471	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.65668	-0.6112	10	0.48119	T	0.1	-16.1842	11.3964	0.49845	0.0:0.0:1.0:0.0	.	827	Q9UPR6	ZFR2_HUMAN	S	827	ENSP00000262961:P827S	ENSP00000262961:P827S	P	-	1	0	ZFR2	3759936	1.000000	0.71417	0.677000	0.29947	0.009000	0.06853	5.975000	0.70475	2.053000	0.61076	0.484000	0.47621	CCC	.	.	.	none		0.697	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
IL27RA	9466	hgsc.bcm.edu	37	19	14150421	14150421	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:14150421G>A	ENST00000263379.2	+	3	445	c.320G>A	c.(319-321)gGc>gAc	p.G107D		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	107					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						CTTGTCTGGGGCACTAAGGCA	0.612																																					p.G107D	Colon(164;1849 1896 4443 37792 47834)	Atlas-SNP	.											.	IL27RA	56	.	0			c.G320A						PASS	.						66.0	61.0	63.0					19																	14150421		2203	4300	6503	SO:0001583	missense	9466	exon3			TCTGGGGCACTAA	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.320G>A	chr19.hg19:g.14150421G>A	ENSP00000263379:p.Gly107Asp	170.0	0.0	.		190.0	61.0	.	NM_004843	A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	hg19	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314782	0.40996	.	.	ENSG00000104998	ENST00000263379	T	0.61627	0.09	4.54	-2.12	0.07165	.	0.705821	0.12338	N	0.477779	T	0.46073	0.1374	L	0.32530	0.975	0.09310	N	0.999991	P	0.52316	0.952	P	0.49140	0.601	T	0.43718	-0.9374	10	0.23891	T	0.37	-20.1299	7.3547	0.26713	0.0:0.2745:0.2642:0.4613	.	107	Q6UWB1	I27RA_HUMAN	D	107	ENSP00000263379:G107D	ENSP00000263379:G107D	G	+	2	0	IL27RA	14011421	0.006000	0.16342	0.097000	0.21041	0.288000	0.27193	-0.354000	0.07681	-0.030000	0.13804	0.555000	0.69702	GGC	.	.	.	none		0.612	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	
MYO9B	4650	hgsc.bcm.edu	37	19	17322846	17322846	+	Silent	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:17322846G>A	ENST00000594824.1	+	40	6348	c.6201G>A	c.(6199-6201)acG>acA	p.T2067T	MYO9B_ENST00000397274.2_3'UTR|MYO9B_ENST00000595618.1_3'UTR			Q13459	MYO9B_HUMAN	myosin IXB	2067	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TCATGCCCACGGCCAACATCA	0.736																																					p.T2067T		Atlas-SNP	.											.	MYO9B	264	.	0			c.G6201A						PASS	.						9.0	11.0	10.0					19																	17322846		1808	4035	5843	SO:0001819	synonymous_variant	4650	exon40			GCCCACGGCCAAC		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.6201G>A	chr19.hg19:g.17322846G>A		32.0	0.0	.		59.0	36.0	.	NM_004145	O75314|Q9NUJ2|Q9UHN0	Silent	SNP	ENST00000594824.1	hg19																																																																																				.	.	.	none		0.736	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
MAP3K10	4294	hgsc.bcm.edu	37	19	40698281	40698281	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:40698281G>T	ENST00000253055.3	+	1	631	c.343G>T	c.(343-345)Gcc>Tcc	p.A115S	MAP3K10_ENST00000593906.1_3'UTR	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	115	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GGTCTATCGGGCCCTGTGGCG	0.687																																					p.A115S		Atlas-SNP	.											.	MAP3K10	70	.	0			c.G343T						PASS	.						33.0	38.0	36.0					19																	40698281		2202	4298	6500	SO:0001583	missense	4294	exon1			TATCGGGCCCTGT	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.343G>T	chr19.hg19:g.40698281G>T	ENSP00000253055:p.Ala115Ser	9.0	0.0	.		28.0	4.0	.	NM_002446	Q12761|Q14871	Missense_Mutation	SNP	ENST00000253055.3	hg19	CCDS12549.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976122	0.92982	.	.	ENSG00000130758	ENST00000253055	D	0.84944	-1.92	4.3	4.3	0.51218	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.207947	0.38897	N	0.001532	D	0.89223	0.6654	M	0.63428	1.95	0.39678	D	0.970865	P	0.51933	0.949	P	0.58660	0.843	D	0.91138	0.4943	10	0.87932	D	0	.	14.3128	0.66426	0.0:0.0:1.0:0.0	.	115	Q02779	M3K10_HUMAN	S	115	ENSP00000253055:A115S	ENSP00000253055:A115S	A	+	1	0	MAP3K10	45390121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.646000	0.98474	2.232000	0.73038	0.655000	0.94253	GCC	.	.	.	none		0.687	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
ZNF221	7638	hgsc.bcm.edu	37	19	44471195	44471195	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:44471195G>C	ENST00000251269.5	+	6	1869	c.1541G>C	c.(1540-1542)aGa>aCa	p.R514T	ZNF221_ENST00000587682.1_Missense_Mutation_p.R514T|ZNF221_ENST00000592350.1_Missense_Mutation_p.R514T	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TGTGGAAAGAGATTTACTCAG	0.428																																					p.R514T		Atlas-SNP	.											ZNF221,colon,carcinoma,0,1	ZNF221	59	.	0			c.G1541C						PASS	.						94.0	89.0	91.0					19																	44471195		2203	4300	6503	SO:0001583	missense	7638	exon6			GAAAGAGATTTAC	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1541G>C	chr19.hg19:g.44471195G>C	ENSP00000251269:p.Arg514Thr	51.0	0.0	.		51.0	15.0	.	NM_013359	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	hg19	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	g	12.16	1.853235	0.32699	.	.	ENSG00000159905	ENST00000251269	T	0.16597	2.33	2.63	-1.52	0.08637	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10895	0.0266	N	0.11870	0.19	0.09310	N	1	P	0.51240	0.943	P	0.48873	0.593	T	0.25152	-1.0140	9	0.38643	T	0.18	.	5.5077	0.16864	0.1145:0.0:0.5338:0.3517	.	514	Q9UK13	ZN221_HUMAN	T	514	ENSP00000251269:R514T	ENSP00000251269:R514T	R	+	2	0	ZNF221	49163035	0.000000	0.05858	0.000000	0.03702	0.888000	0.51559	0.114000	0.15520	-0.005000	0.14395	0.313000	0.20887	AGA	.	.	.	none		0.428	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
SEPT5	5413	hgsc.bcm.edu	37	22	19709430	19709430	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr22:19709430C>T	ENST00000455784.2	+	10	1025	c.900C>T	c.(898-900)tgC>tgT	p.C300C	SEPT5_ENST00000438754.2_Nonsense_Mutation_p.R306*|GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000383045.3_Silent_p.C309C|SEPT5_ENST00000406395.1_Nonsense_Mutation_p.R297*	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	300	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					ACGTGACGTGCGACGTGCACT	0.662																																					p.R306X		Atlas-SNP	.											SEPT5_ENST00000455784,caecum,carcinoma,0,1	SEPT5	32	.	0			c.C916T						PASS	.						58.0	52.0	54.0					22																	19709430		2203	4299	6502	SO:0001819	synonymous_variant	5413	exon9			GACGTGCGACGTG	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.900C>T	chr22.hg19:g.19709430C>T		67.0	0.0	.		119.0	43.0	.	NM_001009939	O15251|Q96MY5	Nonsense_Mutation	SNP	ENST00000455784.2	hg19	CCDS13764.1	.	.	.	.	.	.	.	.	.	.	C	35	5.483869	0.96307	.	.	ENSG00000184702	ENST00000406395;ENST00000438754	.	.	.	3.66	-2.26	0.06867	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999992	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	5.9818	0.19411	0.0:0.3259:0.1386:0.5355	.	.	.	.	X	297;306	.	ENSP00000384535:R297X	R	+	1	2	SEPT5	18089430	0.020000	0.18652	0.802000	0.32245	0.983000	0.72400	-0.876000	0.04201	-0.201000	0.10284	0.297000	0.19635	CGA	.	.	.	none		0.662	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
MTMR3	8897	hgsc.bcm.edu	37	22	30416249	30416249	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr22:30416249C>T	ENST00000401950.2	+	17	2943	c.2601C>T	c.(2599-2601)tgC>tgT	p.C867C	MTMR3_ENST00000351488.3_Silent_p.C867C|MTMR3_ENST00000406629.1_Silent_p.C867C|MTMR3_ENST00000323630.5_Silent_p.C731C|CTA-85E5.10_ENST00000429350.1_RNA|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000333027.3_Silent_p.C867C	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	867					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ATAGATCTTGCCTTGTAAATA	0.512																																					p.C867C		Atlas-SNP	.											.	MTMR3	106	.	0			c.C2601T						PASS	.						69.0	65.0	66.0					22																	30416249		2203	4300	6503	SO:0001819	synonymous_variant	8897	exon17			ATCTTGCCTTGTA	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2601C>T	chr22.hg19:g.30416249C>T		139.0	0.0	.		145.0	60.0	.	NM_153050	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	ENST00000401950.2	hg19	CCDS13870.1																																																																																			.	.	.	none		0.512	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
POLA1	5422	hgsc.bcm.edu	37	X	24750526	24750526	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chrX:24750526T>A	ENST00000379059.3	+	16	1723	c.1708T>A	c.(1708-1710)Ttg>Atg	p.L570M	POLA1_ENST00000493342.1_3'UTR|POLA1_ENST00000379068.3_Missense_Mutation_p.L576M	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	570					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	CAGTTTTGCATTGGATAAAGC	0.398																																					p.L570M		Atlas-SNP	.											.	POLA1	117	.	0			c.T1708A						PASS	.						189.0	158.0	168.0					X																	24750526		2203	4300	6503	SO:0001583	missense	5422	exon16			TTTGCATTGGATA		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1708T>A	chrX.hg19:g.24750526T>A	ENSP00000368349:p.Leu570Met	43.0	0.0	.		26.0	23.0	.	NM_016937	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	hg19	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.534808	0.45073	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.45276	0.9;0.9	5.42	0.376	0.16193	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.268948	0.37483	N	0.002076	T	0.45357	0.1338	M	0.82323	2.585	0.33032	D	0.530339	B	0.32283	0.362	B	0.36244	0.22	T	0.54675	-0.8258	10	0.54805	T	0.06	-6.8741	9.4781	0.38884	0.0:0.4038:0.0:0.5962	.	570	P09884	DPOLA_HUMAN	M	576;570	ENSP00000368358:L576M;ENSP00000368349:L570M	ENSP00000368349:L570M	L	+	1	2	POLA1	24660447	0.321000	0.24625	0.054000	0.19295	0.938000	0.57974	0.682000	0.25335	-0.193000	0.10415	0.417000	0.27973	TTG	.	.	.	none		0.398	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
GATA1	2623	hgsc.bcm.edu	37	X	48652221	48652221	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chrX:48652221C>T	ENST00000376670.3	+	6	1003	c.892C>T	c.(892-894)Cgg>Tgg	p.R298W	GATA1_ENST00000376665.3_Intron	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	298					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						ACTGACCATGCGGAAGGATGG	0.582			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																p.R298W	Pancreas(9;429 505 11287 29617)	Atlas-SNP	.		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	GATA1	342	.	0			c.C892T						PASS	.						21.0	20.0	21.0					X																	48652221		2203	4299	6502	SO:0001583	missense	2623	exon6			ACCATGCGGAAGG	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.892C>T	chrX.hg19:g.48652221C>T	ENSP00000365858:p.Arg298Trp	73.0	0.0	.		75.0	4.0	.	NM_002049	Q96GB8	Missense_Mutation	SNP	ENST00000376670.3	hg19	CCDS14305.1	.	.	.	.	.	.	.	.	.	.	c	18.07	3.540683	0.65085	.	.	ENSG00000102145	ENST00000376670	D	0.99667	-6.34	4.21	-2.43	0.06522	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (2);	0.068357	0.56097	U	0.000034	D	0.99007	0.9661	L	0.28694	0.88	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96825	0.9607	10	0.87932	D	0	-11.8489	14.9001	0.70672	0.8239:0.1761:0.0:0.0	.	298	P15976	GATA1_HUMAN	W	298	ENSP00000365858:R298W	ENSP00000365858:R298W	R	+	1	2	GATA1	48537165	0.693000	0.27728	0.976000	0.42696	0.976000	0.68499	-0.187000	0.09656	-1.041000	0.03266	0.365000	0.22127	CGG	.	.	.	none		0.582	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056517.1	NM_002049	
ARID1A	8289	hgsc.bcm.edu	37	1	27106015	27106015	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:27106015delC	ENST00000324856.7	+	20	5997	c.5626delC	c.(5626-5628)ccafs	p.P1876fs	ARID1A_ENST00000374152.2_Frame_Shift_Del_p.P1493fs|ARID1A_ENST00000457599.2_Frame_Shift_Del_p.P1659fs|ARID1A_ENST00000540690.1_Frame_Shift_Del_p.P204fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1876					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACCCTGCCCACCAGCCCCTCG	0.622			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.P1875fs		Atlas-Indel,Pindel	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.5625delA						PASS	.						64.0	70.0	68.0					1																	27106015		2203	4300	6503	SO:0001589	frameshift_variant	8289	exon20			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5626delC	chr1.hg19:g.27106015delC	ENSP00000320485:p.Pro1876fs	118.0	0.0	0		122.0	49.0	0.401639	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.	.	none		0.622	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
COL7A1	1294	hgsc.bcm.edu	37	3	48610131	48610131	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:48610131delT	ENST00000328333.8	-	87	6980	c.6873delA	c.(6871-6873)gaafs	p.E2291fs	COL7A1_ENST00000454817.1_Frame_Shift_Del_p.E2259fs	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2291	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGGGCCAGGTTCTCCTTTAG	0.632																																					p.P2292fs		Pindel	.											.	COL7A1	320	.	0			c.6874delC						PASS	.						24.0	30.0	28.0					3																	48610131		2200	4297	6497	SO:0001589	frameshift_variant	1294	exon87			.	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.6873delA	chr3.hg19:g.48610131delT	ENSP00000332371:p.Glu2291fs	136.0	0.0	.		114.0	31.0	0.272	NM_000094	Q14054|Q16507	Frame_Shift_Del	DEL	ENST00000328333.8	hg19	CCDS2773.1																																																																																			.	.	.	none		0.632	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
USF2	7392	hgsc.bcm.edu	37	19	35761401	35761402	+	In_Frame_Ins	INS	-	-	TCAGCGGGGAGGCACGATTTGCCT			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:35761401_35761402insTCAGCGGGGAGGCACGATTTGCCT	ENST00000222305.3	+	5	518_519	c.481_482insTCAGCGGGGAGGCACGATTTGCCT	c.(481-483)gtc>gTCAGCGGGGAGGCACGATTTGCCTtc	p.161_162insSGEARFAF	USF2_ENST00000595068.1_In_Frame_Ins_p.161_162insSGEARFAF|USF2_ENST00000343550.5_In_Frame_Ins_p.94_95insSGEARFAF|USF2_ENST00000594064.1_In_Frame_Ins_p.159_160insSGEARFAF|USF2_ENST00000379134.3_Intron	NM_003367.2	NP_003358.1	Q15853	USF2_HUMAN	upstream transcription factor 2, c-fos interacting	161					lactation (GO:0007595)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|urinary_tract(1)	13	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGCCGAGGCTGTCAGCGGGGAG	0.589																																					p.V161delinsVSGEARFAF	NSCLC(103;173 2832 8890)	Pindel	.											.	USF2	26	.	0			c.481_482insTCAGCGGGGAGGCACGATTTGCCT						PASS	.																																			SO:0001652	inframe_insertion	7392	exon5			.	AY007087	CCDS12452.1, CCDS12453.1	19q13	2013-05-21				ENSG00000105698		"""Basic helix-loop-helix proteins"""	12594	protein-coding gene	gene with protein product		600390				8954795	Standard	NM_003367		Approved	FIP, bHLHb12	uc002nyq.1	Q15853		ENST00000222305.3:c.482_505dupTCAGCGGGGAGGCACGATTTGCCT	chr19.hg19:g.35761401_35761402insTCAGCGGGGAGGCACGATTTGCCT	ENSP00000222305:p.Val161_Ser162insSerGlyGluAlaArgPheAlaPhe	287.0	0.0	.		225.0	32.0	0.142	NM_003367	O00671|O00709|Q05750|Q07952|Q15851|Q15852|Q6FI33|Q6YI47	In_Frame_Ins	INS	ENST00000222305.3	hg19	CCDS12452.1																																																																																			.	.	.	none		0.589	USF2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466056.1	NM_003367	
IL17RD	54756	hgsc.bcm.edu	37	3	57144293	57144293	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:57144293delC	ENST00000296318.7	-	4	445	c.357delG	c.(355-357)aagfs	p.K119fs	IL17RD_ENST00000320057.5_5'UTR|IL17RD_ENST00000463523.1_5'UTR|IL17RD_ENST00000427856.2_Frame_Shift_Del_p.K95fs	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	119					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		TTCCCTCCGACTTCAGCTCCT	0.438																																					p.S120fs		Pindel	.											.	IL17RD	93	.	0			c.358delT						PASS	.						121.0	109.0	113.0					3																	57144293		1911	4137	6048	SO:0001589	frameshift_variant	54756	exon4			.	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.357delG	chr3.hg19:g.57144293delC	ENSP00000296318:p.Lys119fs	123.0	0.0	.		90.0	27.0	0.300	NM_017563	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Frame_Shift_Del	DEL	ENST00000296318.7	hg19	CCDS2880.2																																																																																			.	.	.	none		0.438	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
