#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM46B	115572	hgsc.bcm.edu	37	1	27332755	27332755	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:27332755G>A	ENST00000289166.5	-	2	1123	c.958C>T	c.(958-960)Cgg>Tgg	p.R320W		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	320										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		AGGGTGCGCCGCTGCTCCACC	0.682																																					p.R320W		Atlas-SNP	.											.	FAM46B	44	.	0			c.C958T						PASS	.						20.0	22.0	21.0					1																	27332755		2201	4298	6499	SO:0001583	missense	115572	exon2			TGCGCCGCTGCTC	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.958C>T	chr1.hg19:g.27332755G>A	ENSP00000289166:p.Arg320Trp	89.0	0.0	.		89.0	4.0	.	NM_052943		Missense_Mutation	SNP	ENST00000289166.5	hg19	CCDS294.2	.	.	.	.	.	.	.	.	.	.	G	16.33	3.094188	0.56075	.	.	ENSG00000158246	ENST00000289166	T	0.25085	1.82	5.31	3.24	0.37175	Domain of unknown function DUF1693 (1);	0.379713	0.30584	N	0.009309	T	0.42131	0.1189	L	0.54323	1.7	0.37467	D	0.915445	D	0.57899	0.981	P	0.61070	0.883	T	0.53330	-0.8454	10	0.59425	D	0.04	-5.9287	15.2423	0.73480	0.0:0.0:0.7268:0.2732	.	320	Q96A09	FA46B_HUMAN	W	320	ENSP00000289166:R320W	ENSP00000289166:R320W	R	-	1	2	FAM46B	27205342	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	4.588000	0.60999	1.415000	0.47037	0.561000	0.74099	CGG	.	.	.	none		0.682	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943	
FUBP1	8880	hgsc.bcm.edu	37	1	78414969	78414969	+	Silent	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:78414969A>G	ENST00000370768.2	-	19	1878	c.1797T>C	c.(1795-1797)gcT>gcC	p.A599A	FUBP1_ENST00000370767.1_Silent_p.A599A|FUBP1_ENST00000436586.2_Silent_p.A620A|FUBP1_ENST00000489495.1_5'Flank	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	599					positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CCCCAGTCGGAGCAGGAACTG	0.448			"""F, N"""		oligodendroglioma																																p.A599A		Atlas-SNP	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	112	.	0			c.T1797C						PASS	.						64.0	69.0	67.0					1																	78414969		2203	4300	6503	SO:0001819	synonymous_variant	8880	exon19			AGTCGGAGCAGGA	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1797T>C	chr1.hg19:g.78414969A>G		64.0	0.0	.		69.0	14.0	.	NM_003902	Q12828	Silent	SNP	ENST00000370768.2	hg19	CCDS683.1																																																																																			.	.	.	none		0.448	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
LRRC8C	84230	hgsc.bcm.edu	37	1	90179188	90179188	+	Silent	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:90179188T>C	ENST00000370454.4	+	3	1314	c.1059T>C	c.(1057-1059)taT>taC	p.Y353Y	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	353					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CCTTTGAGTATGTCCGTCAGG	0.388																																					p.Y353Y		Atlas-SNP	.											.	LRRC8C	73	.	0			c.T1059C						PASS	.						54.0	50.0	51.0					1																	90179188		2203	4299	6502	SO:0001819	synonymous_variant	84230	exon3			TGAGTATGTCCGT		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1059T>C	chr1.hg19:g.90179188T>C		142.0	0.0	.		146.0	36.0	.	NM_032270	B3KXS9|Q29RV6|Q9H075	Silent	SNP	ENST00000370454.4	hg19	CCDS725.1																																																																																			.	.	.	none		0.388	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
SLC19A2	10560	hgsc.bcm.edu	37	1	169446750	169446750	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:169446750G>A	ENST00000236137.5	-	2	686	c.450C>T	c.(448-450)gaC>gaT	p.D150D	SLC19A2_ENST00000367804.4_Intron	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	150					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	ACATGCCCAGGTCCACCACAC	0.478																																					p.D150D		Atlas-SNP	.											.	SLC19A2	35	.	0			c.C450T						PASS	.						93.0	96.0	95.0					1																	169446750		2203	4300	6503	SO:0001819	synonymous_variant	10560	exon2			GCCCAGGTCCACC	AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.450C>T	chr1.hg19:g.169446750G>A		179.0	0.0	.		176.0	52.0	.	NM_006996	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Silent	SNP	ENST00000236137.5	hg19	CCDS1280.1																																																																																			.	.	.	none		0.478	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1	NM_006996	
CACNA1E	777	hgsc.bcm.edu	37	1	181701628	181701628	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:181701628G>A	ENST00000367573.2	+	20	2406	c.2406G>A	c.(2404-2406)gcG>gcA	p.A802A	CACNA1E_ENST00000367570.1_Silent_p.A802A|CACNA1E_ENST00000367567.4_Silent_p.A409A|CACNA1E_ENST00000357570.5_Silent_p.A753A|CACNA1E_ENST00000526775.1_Silent_p.A783A|CACNA1E_ENST00000360108.3_Silent_p.A783A|CACNA1E_ENST00000358338.5_Silent_p.A734A	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	802					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GAGAGGAGGCGCCGACCATGa	0.657																																					p.A802A		Atlas-SNP	.											.	CACNA1E	778	.	0			c.G2406A						PASS	.						39.0	57.0	51.0					1																	181701628		1759	3301	5060	SO:0001819	synonymous_variant	777	exon20			GGAGGCGCCGACC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2406G>A	chr1.hg19:g.181701628G>A		328.0	0.0	.		380.0	44.0	.	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	hg19	CCDS55664.1																																																																																			.	.	.	none		0.657	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
ADCK3	56997	hgsc.bcm.edu	37	1	227172964	227172964	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:227172964G>A	ENST00000366779.1	+	19	4353	c.1582G>A	c.(1582-1584)Gct>Act	p.A528T	ADCK3_ENST00000366777.3_Missense_Mutation_p.A528T|ADCK3_ENST00000458507.2_Missense_Mutation_p.A249T|ADCK3_ENST00000433743.2_Missense_Mutation_p.A202T|ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000366778.1_Missense_Mutation_p.A476T			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	528					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						GATCATCAGGGCTGCTGCCGA	0.632																																					p.A528T		Atlas-SNP	.											.	ADCK3	77	.	0			c.G1582A						PASS	.						119.0	116.0	117.0					1																	227172964		2203	4300	6503	SO:0001583	missense	56997	exon14			ATCAGGGCTGCTG	AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1582G>A	chr1.hg19:g.227172964G>A	ENSP00000355741:p.Ala528Thr	62.0	0.0	.		62.0	17.0	.	NM_020247	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Missense_Mutation	SNP	ENST00000366779.1	hg19	CCDS1557.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998025	0.93227	.	.	ENSG00000163050	ENST00000366779;ENST00000366778;ENST00000366777;ENST00000366776;ENST00000458507;ENST00000366775;ENST00000405743;ENST00000433743	T;T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1;0.1	5.69	5.69	0.88448	.	0.105243	0.64402	D	0.000005	D	0.82554	0.5062	H	0.94847	3.59	0.58432	D	0.999995	D;D	0.64830	0.982;0.994	P;D	0.63033	0.796;0.91	D	0.87070	0.2159	10	0.87932	D	0	-11.9896	19.815	0.96564	0.0:0.0:1.0:0.0	.	202;528	E7EVZ8;Q8NI60	.;ADCK3_HUMAN	T	528;476;528;453;249;373;479;202	ENSP00000355741:A528T;ENSP00000355740:A476T;ENSP00000355739:A528T;ENSP00000355738:A453T;ENSP00000403704:A249T;ENSP00000355737:A373T;ENSP00000404550:A202T	ENSP00000355737:A373T	A	+	1	0	ADCK3	225239587	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.953000	0.56699	2.681000	0.91329	0.561000	0.74099	GCT	.	.	.	none		0.632	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091712.1	NM_020247	
FMN2	56776	hgsc.bcm.edu	37	1	240370577	240370577	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:240370577A>T	ENST00000319653.9	+	5	2695	c.2465A>T	c.(2464-2466)cAa>cTa	p.Q822L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	822	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCTGCTGGGCAAGGACAGCCT	0.537																																					p.Q822L		Atlas-SNP	.											.	FMN2	451	.	0			c.A2465T						PASS	.						74.0	71.0	72.0					1																	240370577		2203	4300	6503	SO:0001583	missense	56776	exon5			CTGGGCAAGGACA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2465A>T	chr1.hg19:g.240370577A>T	ENSP00000318884:p.Gln822Leu	128.0	0.0	.		121.0	32.0	.	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	A	7.760	0.705185	0.15172	.	.	ENSG00000155816	ENST00000319653	T	0.31510	1.49	4.09	4.09	0.47781	Actin-binding FH2/DRF autoregulatory (1);	0.425372	0.19864	N	0.104352	T	0.30823	0.0777	L	0.57536	1.79	0.80722	D	1	B	0.30482	0.281	B	0.32533	0.147	T	0.07849	-1.0751	9	.	.	.	.	12.1017	0.53788	1.0:0.0:0.0:0.0	.	822	Q9NZ56	FMN2_HUMAN	L	822	ENSP00000318884:Q822L	.	Q	+	2	0	FMN2	238437200	0.247000	0.23920	0.447000	0.26932	0.071000	0.16799	1.728000	0.38105	1.842000	0.53543	0.454000	0.30748	CAA	.	.	.	none		0.537	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
ABCB6	10058	hgsc.bcm.edu	37	2	220075010	220075010	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr2:220075010C>A	ENST00000265316.3	-	18	2678	c.2362G>T	c.(2362-2364)Gtg>Ttg	p.V788L	ABCB6_ENST00000439002.2_Missense_Mutation_p.V742L	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	788	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCATTGACCACAGTTGAGAGC	0.547																																					p.V788L		Atlas-SNP	.											.	ABCB6	76	.	0			c.G2362T						PASS	.						96.0	92.0	93.0					2																	220075010		2203	4300	6503	SO:0001583	missense	10058	exon18			TGACCACAGTTGA	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.2362G>T	chr2.hg19:g.220075010C>A	ENSP00000265316:p.Val788Leu	122.0	0.0	.		175.0	28.0	.	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	ENST00000265316.3	hg19	CCDS2436.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954783	0.73902	.	.	ENSG00000115657	ENST00000265316;ENST00000439002	D;D	0.85088	-1.94;-1.94	4.83	4.83	0.62350	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.060728	0.64402	D	0.000004	T	0.76054	0.3934	N	0.04805	-0.155	0.80722	D	1	P;P	0.43431	0.807;0.707	B;B	0.43575	0.424;0.204	T	0.82082	-0.0633	10	0.72032	D	0.01	-19.1858	18.0957	0.89489	0.0:1.0:0.0:0.0	.	742;788	Q9NP58-4;Q9NP58	.;ABCB6_HUMAN	L	788;742	ENSP00000265316:V788L;ENSP00000394333:V742L	ENSP00000265316:V788L	V	-	1	0	ABCB6	219783254	1.000000	0.71417	0.976000	0.42696	0.995000	0.86356	2.882000	0.48546	2.673000	0.90976	0.650000	0.86243	GTG	.	.	.	none		0.547	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
TMEM43	79188	hgsc.bcm.edu	37	3	14183165	14183165	+	Missense_Mutation	SNP	C	C	T	rs63750743		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:14183165C>T	ENST00000306077.4	+	12	1327	c.1073C>T	c.(1072-1074)tCg>tTg	p.S358L	RP11-434D12.1_ENST00000601399.1_Intron|RP11-434D12.1_ENST00000608606.1_Intron	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	358			S -> L (in ARVD5). {ECO:0000269|PubMed:18313022}.		nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						GTGGCCACCTCGCTGACCCTG	0.602																																					p.S358L		Atlas-SNP	.											.	TMEM43	33	.	0			c.C1073T	GRCh37	CM081452	TMEM43	M	rs63750743	PASS	.						135.0	110.0	119.0					3																	14183165		2203	4300	6503	SO:0001583	missense	79188	exon12			CCACCTCGCTGAC	BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.1073C>T	chr3.hg19:g.14183165C>T	ENSP00000303992:p.Ser358Leu	135.0	0.0	.		155.0	14.0	.	NM_024334	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	ENST00000306077.4	hg19	CCDS2618.1	.	.	.	.	.	.	.	.	.	.	C	35	5.493272	0.96339	.	.	ENSG00000170876	ENST00000306077	T	0.35973	1.28	5.71	5.71	0.89125	.	0.066812	0.64402	D	0.000008	T	0.58293	0.2112	L	0.57536	1.79	0.80722	A	1	D	0.89917	1.0	D	0.69142	0.962	T	0.55711	-0.8098	9	0.52906	T	0.07	-15.2636	19.8516	0.96743	0.0:1.0:0.0:0.0	rs63750743	358	Q9BTV4	TMM43_HUMAN	L	358	ENSP00000303992:S358L	ENSP00000303992:S358L	S	+	2	0	TMEM43	14158166	1.000000	0.71417	0.940000	0.37924	0.911000	0.54048	7.205000	0.77881	2.685000	0.91497	0.585000	0.79938	TCG	.	.	.	weak		0.602	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
SMARCC1	6599	hgsc.bcm.edu	37	3	47718172	47718172	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:47718172C>A	ENST00000254480.5	-	17	1791	c.1672G>T	c.(1672-1674)Gta>Tta	p.V558L	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	558					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		TCAGCTAATACATTAAAATGA	0.463																																					p.V558L		Atlas-SNP	.											.	SMARCC1	85	.	0			c.G1672T						PASS	.						73.0	70.0	71.0					3																	47718172		2203	4300	6503	SO:0001583	missense	6599	exon17			CTAATACATTAAA	U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.1672G>T	chr3.hg19:g.47718172C>A	ENSP00000254480:p.Val558Leu	112.0	0.0	.		131.0	19.0	.	NM_003074	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	ENST00000254480.5	hg19	CCDS2758.1	.	.	.	.	.	.	.	.	.	.	C	35	5.457122	0.96223	.	.	ENSG00000173473	ENST00000254480	T	0.55760	0.5	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.85099	2.735	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.78959	-0.1998	10	0.87932	D	0	-21.3909	19.4236	0.94732	0.0:1.0:0.0:0.0	.	558	Q92922	SMRC1_HUMAN	L	558	ENSP00000254480:V558L	ENSP00000254480:V558L	V	-	1	0	SMARCC1	47693176	1.000000	0.71417	0.995000	0.50966	0.958000	0.62258	7.580000	0.82523	2.937000	0.99478	0.650000	0.86243	GTA	.	.	.	none		0.463	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
APEH	327	hgsc.bcm.edu	37	3	49718019	49718019	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:49718019T>C	ENST00000296456.5	+	14	1656	c.1256T>C	c.(1255-1257)cTc>cCc	p.L419P	APEH_ENST00000438011.1_Missense_Mutation_p.L419P	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	419					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACCAGGACCTCATGGTGGCA	0.572																																					p.L419P		Atlas-SNP	.											.	APEH	45	.	0			c.T1256C						PASS	.						136.0	107.0	117.0					3																	49718019		2203	4300	6503	SO:0001583	missense	327	exon14			AGGACCTCATGGT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.1256T>C	chr3.hg19:g.49718019T>C	ENSP00000296456:p.Leu419Pro	175.0	0.0	.		269.0	67.0	.	NM_001640	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	hg19	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.573571	0.86542	.	.	ENSG00000164062	ENST00000296456;ENST00000438011	T;T	0.39787	1.06;1.06	5.44	5.44	0.79542	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	M	0.66939	2.045	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.61201	0.885;0.885	T	0.58228	-0.7673	10	0.36615	T	0.2	-28.7761	15.1365	0.72572	0.0:0.0:0.0:1.0	.	419;419	C9JIF9;P13798	.;ACPH_HUMAN	P	419	ENSP00000296456:L419P;ENSP00000415862:L419P	ENSP00000296456:L419P	L	+	2	0	APEH	49693023	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.147000	0.77382	2.056000	0.61249	0.459000	0.35465	CTC	.	.	.	none		0.572	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
SLC15A2	6565	hgsc.bcm.edu	37	3	121649781	121649781	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:121649781A>G	ENST00000489711.1	+	18	2036	c.1648A>G	c.(1648-1650)Act>Gct	p.T550A	SLC15A2_ENST00000465060.1_3'UTR|SLC15A2_ENST00000295605.2_Missense_Mutation_p.T519A	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	550					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TGCTTATAGAACTGTGCAAAG	0.388																																					p.T550A		Atlas-SNP	.											.	SLC15A2	92	.	0			c.A1648G						PASS	.						196.0	183.0	187.0					3																	121649781		2203	4300	6503	SO:0001583	missense	6565	exon18			TATAGAACTGTGC	BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.1648A>G	chr3.hg19:g.121649781A>G	ENSP00000417085:p.Thr550Ala	157.0	0.0	.		199.0	31.0	.	NM_021082	A8K1A5|B4E2A7	Missense_Mutation	SNP	ENST00000489711.1	hg19	CCDS3007.1	.	.	.	.	.	.	.	.	.	.	A	0.388	-0.925105	0.02377	.	.	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605	T;T	0.02656	4.5;4.21	5.42	1.6	0.23607	.	0.546824	0.20900	N	0.083650	T	0.02156	0.0067	L	0.45228	1.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49051	-0.8979	10	0.08599	T	0.76	-1.3387	3.1896	0.06613	0.5309:0.0:0.1062:0.3628	.	519;550	B4E2A7;Q16348	.;S15A2_HUMAN	A	550;512;519	ENSP00000417085:T550A;ENSP00000295605:T519A	ENSP00000295605:T519A	T	+	1	0	SLC15A2	123132471	0.000000	0.05858	0.036000	0.18154	0.509000	0.34042	0.828000	0.27435	0.109000	0.17891	0.528000	0.53228	ACT	.	.	.	none		0.388	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355239.1	NM_021082	
HEG1	57493	hgsc.bcm.edu	37	3	124748131	124748131	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:124748131C>T	ENST00000311127.4	-	2	585	c.518G>A	c.(517-519)aGc>aAc	p.S173N		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	173					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TGAAGAGCCGCTCCTTCCTCT	0.512																																					p.S173N		Atlas-SNP	.											.	HEG1	109	.	0			c.G518A						PASS	.						92.0	89.0	90.0					3																	124748131		1958	4173	6131	SO:0001583	missense	57493	exon2			GAGCCGCTCCTTC	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.518G>A	chr3.hg19:g.124748131C>T	ENSP00000311502:p.Ser173Asn	195.0	0.0	.		241.0	56.0	.	NM_020733	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	hg19	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	C	0.917	-0.717219	0.03182	.	.	ENSG00000173706	ENST00000311127	T	0.44482	0.92	5.38	-10.8	0.00216	.	.	.	.	.	T	0.09158	0.0226	N	0.01352	-0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13361	-1.0512	9	0.02654	T	1	.	5.997	0.19499	0.0926:0.2061:0.5365:0.1648	.	173;173	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	N	173	ENSP00000311502:S173N	ENSP00000311502:S173N	S	-	2	0	HEG1	126230821	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.000000	0.03693	-1.869000	0.01141	-1.298000	0.01336	AGC	.	.	.	none		0.512	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
COL6A5	256076	hgsc.bcm.edu	37	3	130095526	130095526	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:130095526G>T	ENST00000432398.2	+	3	1008	c.514G>T	c.(514-516)Gct>Tct	p.A172S	COL6A5_ENST00000265379.6_Missense_Mutation_p.A172S	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	172	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GGTGCAGAAAGCTTCTGAGGA	0.502																																					p.A172S		Atlas-SNP	.											.	COL6A5	205	.	0			c.G514T						PASS	.						81.0	81.0	81.0					3																	130095526		692	1591	2283	SO:0001583	missense	256076	exon3			CAGAAAGCTTCTG	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.514G>T	chr3.hg19:g.130095526G>T	ENSP00000390895:p.Ala172Ser	108.0	0.0	.		155.0	20.0	.	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	hg19		.	.	.	.	.	.	.	.	.	.	G	6.971	0.549091	0.13312	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.80214	-1.35;-1.35	5.14	3.34	0.38264	.	.	.	.	.	T	0.80989	0.4730	M	0.72479	2.2	0.09310	N	0.99999	P	0.38582	0.638	P	0.45577	0.486	T	0.69379	-0.5161	9	0.38643	T	0.18	.	6.3024	0.21119	0.1591:0.0:0.6941:0.1469	.	172	A8TX70-2	.	S	172	ENSP00000390895:A172S;ENSP00000265379:A172S	ENSP00000265379:A172S	A	+	1	0	COL6A5	131578216	0.445000	0.25657	0.010000	0.14722	0.017000	0.09413	2.715000	0.47210	0.671000	0.31185	-0.259000	0.10710	GCT	.	.	.	none		0.502	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
KLHL24	54800	hgsc.bcm.edu	37	3	183381404	183381404	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:183381404C>A	ENST00000454652.2	+	5	1465	c.1079C>A	c.(1078-1080)gCt>gAt	p.A360D	KLHL24_ENST00000476808.1_Missense_Mutation_p.A360D|KLHL24_ENST00000242810.6_Missense_Mutation_p.A360D	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	360						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			GCAGTCTGTGCTCTAAGGAAT	0.353																																					p.A360D		Atlas-SNP	.											.	KLHL24	56	.	0			c.C1079A						PASS	.						104.0	99.0	101.0					3																	183381404		2203	4300	6503	SO:0001583	missense	54800	exon4			TCTGTGCTCTAAG		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1079C>A	chr3.hg19:g.183381404C>A	ENSP00000395012:p.Ala360Asp	84.0	0.0	.		107.0	11.0	.	NM_017644	A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	ENST00000454652.2	hg19	CCDS3246.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086083	0.76642	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.79352	-1.26;-1.26;-1.26	5.34	5.34	0.76211	Galactose oxidase, beta-propeller (1);	0.047926	0.85682	D	0.000000	D	0.85048	0.5608	M	0.80847	2.515	0.80722	D	1	B;B	0.30146	0.131;0.27	B;B	0.42593	0.04;0.392	D	0.84947	0.0869	10	0.66056	D	0.02	.	19.4149	0.94690	0.0:1.0:0.0:0.0	.	360;360	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	D	360	ENSP00000242810:A360D;ENSP00000395012:A360D;ENSP00000419010:A360D	ENSP00000242810:A360D	A	+	2	0	KLHL24	184864098	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.445000	0.80570	2.675000	0.91044	0.462000	0.41574	GCT	.	.	.	none		0.353	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	NM_017644	
WDFY3	23001	hgsc.bcm.edu	37	4	85716095	85716095	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:85716095G>T	ENST00000295888.4	-	20	3612	c.3205C>A	c.(3205-3207)Cct>Act	p.P1069T	WDFY3_ENST00000322366.6_Missense_Mutation_p.P1069T	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1069					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TTATTTGTAGGAGCATTATGA	0.378																																					p.P1069T		Atlas-SNP	.											.	WDFY3	314	.	0			c.C3205A						PASS	.						72.0	69.0	70.0					4																	85716095		2203	4300	6503	SO:0001583	missense	23001	exon20			TTGTAGGAGCATT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.3205C>A	chr4.hg19:g.85716095G>T	ENSP00000295888:p.Pro1069Thr	357.0	0.0	.		404.0	105.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	3.505	-0.100986	0.06967	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.40476	1.03;1.03	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.30417	0.0764	N	0.24115	0.695	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	T	0.14643	-1.0465	10	0.07325	T	0.83	.	19.6264	0.95679	0.0:0.0:1.0:0.0	.	1069	Q8IZQ1	WDFY3_HUMAN	T	1069	ENSP00000318466:P1069T;ENSP00000295888:P1069T	ENSP00000295888:P1069T	P	-	1	0	WDFY3	85935119	1.000000	0.71417	0.996000	0.52242	0.219000	0.24729	7.424000	0.80242	2.717000	0.92951	0.655000	0.94253	CCT	.	.	.	none		0.378	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
STPG2	285555	hgsc.bcm.edu	37	4	98893529	98893529	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:98893529T>C	ENST00000295268.3	-	7	924	c.835A>G	c.(835-837)Aag>Gag	p.K279E		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	279			K -> R (in dbSNP:rs7654193).														TTCTGTTTCTTTGAGCAGATA	0.358																																					p.K279E		Atlas-SNP	.											.	.	.	.	0			c.A835G						PASS	.						71.0	71.0	71.0					4																	98893529		2203	4300	6503	SO:0001583	missense	285555	exon7			GTTTCTTTGAGCA	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.835A>G	chr4.hg19:g.98893529T>C	ENSP00000295268:p.Lys279Glu	248.0	0.0	.		220.0	41.0	.	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	hg19	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.723977	0.00694	.	.	ENSG00000163116	ENST00000295268	T	0.11604	2.76	5.45	1.74	0.24563	.	0.432965	0.22937	N	0.053831	T	0.06005	0.0156	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.34800	-0.9814	9	.	.	.	-8.5472	4.1354	0.10169	0.0:0.3996:0.2191:0.3813	.	279	Q8N412	CD037_HUMAN	E	279	ENSP00000295268:K279E	.	K	-	1	0	C4orf37	99112552	0.115000	0.22152	0.080000	0.20451	0.292000	0.27327	0.392000	0.20801	0.901000	0.36495	0.455000	0.32223	AAG	.	.	.	none		0.358	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
NR3C2	4306	hgsc.bcm.edu	37	4	149356416	149356416	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:149356416T>C	ENST00000358102.3	-	2	1959	c.1597A>G	c.(1597-1599)Ata>Gta	p.I533V	NR3C2_ENST00000344721.4_Missense_Mutation_p.I533V|NR3C2_ENST00000512865.1_Missense_Mutation_p.I533V|NR3C2_ENST00000511528.1_Missense_Mutation_p.I533V|NR3C2_ENST00000355292.3_Missense_Mutation_p.I533V	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	533	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GATAAAGATATTGTACCTTGA	0.483																																					p.I533V	Melanoma(27;428 957 40335 51025 51111)	Atlas-SNP	.											.	NR3C2	94	.	0			c.A1597G						PASS	.						121.0	112.0	115.0					4																	149356416		2203	4300	6503	SO:0001583	missense	4306	exon2			AAGATATTGTACC	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1597A>G	chr4.hg19:g.149356416T>C	ENSP00000350815:p.Ile533Val	200.0	0.0	.		216.0	54.0	.	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	hg19	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.234464	0.39498	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90069	-2.6;-2.61;-2.6;-2.17;-2.18;-2.61	5.51	5.51	0.81932	.	0.037872	0.85682	D	0.000000	T	0.80839	0.4700	N	0.24115	0.695	0.45806	D	0.998684	B;P	0.41524	0.144;0.753	B;B	0.35550	0.035;0.205	T	0.80576	-0.1321	9	.	.	.	.	15.9104	0.79470	0.0:0.0:0.0:1.0	.	533;533	B0ZBF5;B0ZBF6	.;.	V	533	ENSP00000341390:I533V;ENSP00000347441:I533V;ENSP00000350815:I533V;ENSP00000423510:I533V;ENSP00000343907:I533V;ENSP00000421481:I533V	.	I	-	1	0	NR3C2	149575866	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.615000	0.83006	2.210000	0.71456	0.533000	0.62120	ATA	.	.	.	none		0.483	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
C5orf42	65250	hgsc.bcm.edu	37	5	37121780	37121780	+	Silent	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:37121780A>G	ENST00000508244.1	-	47	9055	c.8962T>C	c.(8962-8964)Ttg>Ctg	p.L2988L	C5orf42_ENST00000425232.2_Silent_p.L2988L|C5orf42_ENST00000274258.7_Silent_p.L1886L|C5orf42_ENST00000512288.1_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2988						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TTGTTAGGCAATGGTTTCTGT	0.463																																					p.L2988L		Atlas-SNP	.											.	C5orf42	422	.	0			c.T8962C						PASS	.						308.0	265.0	280.0					5																	37121780		2203	4300	6503	SO:0001819	synonymous_variant	65250	exon48			TAGGCAATGGTTT		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.8962T>C	chr5.hg19:g.37121780A>G		445.0	1.0	.		701.0	235.0	.	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	ENST00000508244.1	hg19	CCDS34146.2																																																																																			.	.	.	none		0.463	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
ADAMTS6	11174	hgsc.bcm.edu	37	5	64587271	64587271	+	IGR	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:64587271T>A								ADAMTS6 (92679 upstream) : ADAMTS6 (5763 downstream)																							GGGAGGCTCATTATCAAGGCA	0.458																																					p.N466I		Atlas-SNP	.											.	ADAMTS6	174	.	0			c.A1397T						PASS	.						107.0	97.0	101.0					5																	64587271		2203	4300	6503	SO:0001628	intergenic_variant	11174	exon11			GGCTCATTATCAA																													chr5.hg19:g.64587271T>A		171.0	0.0	.		326.0	50.0	.	NM_197941		Missense_Mutation	SNP		hg19		.	.	.	.	.	.	.	.	.	.	T	18.48	3.633123	0.67015	.	.	ENSG00000049192	ENST00000381055;ENST00000464680	D;D	0.90004	-2.6;-2.6	5.26	5.26	0.73747	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.92854	0.7727	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.987;0.997	D	0.93648	0.6970	10	0.87932	D	0	.	15.4604	0.75353	0.0:0.0:0.0:1.0	.	466;466	D6R9L6;Q9UKP5	.;ATS6_HUMAN	I	466	ENSP00000370443:N466I;ENSP00000423551:N466I	ENSP00000370443:N466I	N	-	2	0	ADAMTS6	64623027	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.578000	0.82498	2.117000	0.64856	0.533000	0.62120	AAT	.	.	.	none	0	0.458								
UTP15	84135	hgsc.bcm.edu	37	5	72864379	72864379	+	Silent	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:72864379T>A	ENST00000296792.4	+	4	573	c.318T>A	c.(316-318)ctT>ctA	p.L106L	UTP15_ENST00000543251.1_5'UTR|UTP15_ENST00000508491.1_Silent_p.L87L|ANKRA2_ENST00000296785.3_5'Flank	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	106					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		GAGTTCAACTTTTTGATATAA	0.413																																					p.L106L		Atlas-SNP	.											.	UTP15	30	.	0			c.T318A						PASS	.						101.0	103.0	102.0					5																	72864379		2203	4300	6503	SO:0001819	synonymous_variant	84135	exon4			TCAACTTTTTGAT	AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.318T>A	chr5.hg19:g.72864379T>A		115.0	0.0	.		187.0	33.0	.	NM_032175	B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Silent	SNP	ENST00000296792.4	hg19	CCDS34186.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.454530	0.26161	.	.	ENSG00000164338	ENST00000509005	.	.	.	5.55	-2.87	0.05700	.	.	.	.	.	T	0.51500	0.1678	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49735	-0.8908	4	.	.	.	.	7.9204	0.29843	0.0:0.4287:0.3982:0.1731	.	.	.	.	Y	133	.	.	F	+	2	0	UTP15	72900135	0.042000	0.20092	0.996000	0.52242	0.996000	0.88848	-1.057000	0.03486	-0.143000	0.11334	0.533000	0.62120	TTT	.	.	.	none		0.413	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368965.1	NM_032175	
RAPGEF6	51735	hgsc.bcm.edu	37	5	130767032	130767032	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:130767032A>T	ENST00000509018.1	-	26	4190	c.3985T>A	c.(3985-3987)Ttg>Atg	p.L1329M	RAPGEF6_ENST00000307984.5_Missense_Mutation_p.L1342M|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.L1337M|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.L1337M|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.L1379M	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1329	Ser-rich.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GATGGCTTCAAGAGTGTCCAC	0.393																																					p.L1342M	Melanoma(168;435 1955 13113 13877 23213)	Atlas-SNP	.											.	RAPGEF6	361	.	0			c.T4024A						PASS	.						72.0	72.0	72.0					5																	130767032		2197	4299	6496	SO:0001583	missense	51735	exon28			GCTTCAAGAGTGT	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3985T>A	chr5.hg19:g.130767032A>T	ENSP00000421684:p.Leu1329Met	59.0	0.0	.		89.0	4.0	.	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	hg19	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	A	4.759	0.141223	0.09083	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000514667	T;T;T;T;T	0.24908	1.92;1.83;1.83;1.92;2.01	5.11	2.68	0.31781	.	0.495083	0.22765	N	0.055912	T	0.10423	0.0255	N	0.08118	0	0.21933	N	0.999463	B;B;B;B;B	0.22983	0.01;0.078;0.01;0.017;0.01	B;B;B;B;B	0.27170	0.007;0.077;0.007;0.017;0.007	T	0.14476	-1.0471	10	0.33940	T	0.23	.	1.1646	0.01813	0.486:0.1362:0.2288:0.1489	.	1337;1337;1379;1342;1329	A3KN82;B7ZML2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;RPGF6_HUMAN	M	1329;1342;1337;1337;1342;1379	ENSP00000421684:L1329M;ENSP00000309298:L1342M;ENSP00000426081:L1337M;ENSP00000296859:L1337M;ENSP00000426948:L1379M	ENSP00000426948:L1379M	L	-	1	2	RAPGEF6;FNIP1	130794931	0.923000	0.31300	0.787000	0.31911	0.394000	0.30568	0.496000	0.22499	0.899000	0.36444	0.533000	0.62120	TTG	.	.	.	none		0.393	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
DEFB113	245927	hgsc.bcm.edu	37	6	49936558	49936558	+	Silent	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:49936558T>C	ENST00000398718.1	-	2	80	c.81A>G	c.(79-81)gaA>gaG	p.E27E		NM_001037729.1	NP_001032818.1	Q30KQ7	DB113_HUMAN	defensin, beta 113	27					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Lung NSC(77;0.042)					TCTCTGCAACTTCTCTTGTTT	0.363																																					p.E27E		Atlas-SNP	.											.	DEFB113	18	.	0			c.A81G						PASS	.						95.0	92.0	93.0					6																	49936558		1859	4093	5952	SO:0001819	synonymous_variant	245927	exon2			TGCAACTTCTCTT	DQ012017	CCDS43472.1	6p12.3	2010-03-30			ENSG00000214642	ENSG00000214642		"""Defensins, beta"""	18094	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037729		Approved	DEFB-13	uc011dwq.2	Q30KQ7	OTTHUMG00000160210	ENST00000398718.1:c.81A>G	chr6.hg19:g.49936558T>C		57.0	0.0	.		85.0	15.0	.	NM_001037729		Silent	SNP	ENST00000398718.1	hg19	CCDS43472.1																																																																																			.	.	.	none		0.363	DEFB113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359666.1		
PKHD1	5314	hgsc.bcm.edu	37	6	51750667	51750667	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:51750667G>T	ENST00000371117.3	-	45	7488	c.7213C>A	c.(7213-7215)Cag>Aag	p.Q2405K	PKHD1_ENST00000340994.4_Missense_Mutation_p.Q2405K	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2405					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AAGCTTACCTGGGCACCACCT	0.383																																					p.Q2405K		Atlas-SNP	.											.	PKHD1	927	.	0			c.C7213A						PASS	.						43.0	41.0	42.0					6																	51750667		2203	4300	6503	SO:0001583	missense	5314	exon45			TTACCTGGGCACC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7213C>A	chr6.hg19:g.51750667G>T	ENSP00000360158:p.Gln2405Lys	136.0	0.0	.		130.0	29.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.841905	0.51057	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.79653	-1.29;-1.29	5.81	5.81	0.92471	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.147468	0.48286	D	0.000193	T	0.69797	0.3151	M	0.67953	2.075	0.34697	D	0.726304	P;B;P	0.40000	0.698;0.313;0.698	B;B;B	0.35353	0.201;0.104;0.167	T	0.72704	-0.4213	10	0.27082	T	0.32	.	17.2257	0.86970	0.0:0.0:1.0:0.0	.	2405;2405;2405	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	K	2405	ENSP00000360158:Q2405K;ENSP00000341097:Q2405K	ENSP00000341097:Q2405K	Q	-	1	0	PKHD1	51858626	0.998000	0.40836	0.941000	0.38009	0.505000	0.33919	3.052000	0.49893	2.756000	0.94617	0.650000	0.86243	CAG	.	.	.	none		0.383	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
ALDH8A1	64577	hgsc.bcm.edu	37	6	135260502	135260502	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:135260502A>G	ENST00000265605.2	-	4	562	c.494T>C	c.(493-495)aTa>aCa	p.I165T	ALDH8A1_ENST00000367847.2_Intron|RP11-349J5.2_ENST00000416448.2_RNA|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.I165T	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	165					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CGCTGGAGCTATCTTCCAGGT	0.542																																					p.I165T		Atlas-SNP	.											.	ALDH8A1	68	.	0			c.T494C						PASS	.						100.0	87.0	91.0					6																	135260502		2203	4300	6503	SO:0001583	missense	64577	exon4			GGAGCTATCTTCC	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.494T>C	chr6.hg19:g.135260502A>G	ENSP00000265605:p.Ile165Thr	106.0	0.0	.		128.0	17.0	.	NM_022568	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	hg19	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.654610	0.67472	.	.	ENSG00000118514	ENST00000265605;ENST00000367845	T;T	0.78364	-1.17;-1.17	5.45	4.29	0.51040	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.097324	0.64402	D	0.000001	T	0.79805	0.4509	M	0.72118	2.19	0.80722	D	1	D;D	0.54397	0.958;0.966	P;D	0.64687	0.881;0.928	T	0.78919	-0.2014	10	0.35671	T	0.21	.	11.1526	0.48469	0.9277:0.0:0.0723:0.0	.	165;165	Q9H2A2-2;Q9H2A2	.;AL8A1_HUMAN	T	165	ENSP00000265605:I165T;ENSP00000356819:I165T	ENSP00000265605:I165T	I	-	2	0	ALDH8A1	135302195	1.000000	0.71417	0.338000	0.25549	0.733000	0.41908	7.522000	0.81844	0.909000	0.36697	0.460000	0.39030	ATA	.	.	.	none		0.542	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
SCAF8	22828	hgsc.bcm.edu	37	6	155154048	155154048	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:155154048G>A	ENST00000367178.3	+	20	3911	c.3335G>A	c.(3334-3336)gGt>gAt	p.G1112D	SCAF8_ENST00000417268.1_Missense_Mutation_p.G1112D|TIAM2_ENST00000461783.3_5'UTR|SCAF8_ENST00000367186.4_Missense_Mutation_p.G1178D	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	1112					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						GTCTATGGTGGTCCAAAAGGC	0.468																																					p.G1112D		Atlas-SNP	.											.	SCAF8	122	.	0			c.G3335A						PASS	.						66.0	72.0	70.0					6																	155154048		2203	4300	6503	SO:0001583	missense	22828	exon20			ATGGTGGTCCAAA	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.3335G>A	chr6.hg19:g.155154048G>A	ENSP00000356146:p.Gly1112Asp	199.0	0.0	.		216.0	40.0	.	NM_014892	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	hg19	CCDS5247.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784709	0.70222	.	.	ENSG00000213079;ENSG00000213079;ENSG00000213079;ENSG00000146426	ENST00000367178;ENST00000417268;ENST00000367186;ENST00000528928	T;T;T	0.61274	0.18;0.18;0.12	5.97	5.97	0.96955	.	0.000000	0.64402	U	0.000001	T	0.63534	0.2519	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66388	-0.5936	10	0.87932	D	0	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	1157;1178;1112	B7Z876;B7Z888;Q9UPN6	.;.;SCAF8_HUMAN	D	1112;1112;1178;73	ENSP00000356146:G1112D;ENSP00000413098:G1112D;ENSP00000356154:G1178D	ENSP00000356146:G1112D	G	+	2	0	TIAM2;SCAF8	155195740	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	5.774000	0.68906	2.828000	0.97474	0.655000	0.94253	GGT	.	.	.	none		0.468	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
LPA	4018	hgsc.bcm.edu	37	6	161071523	161071523	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr6:161071523G>T	ENST00000316300.5	-	2	100	c.56C>A	c.(55-57)cCt>cAt	p.P19H	LPA_ENST00000447678.1_Missense_Mutation_p.P19H			P08519	APOA_HUMAN	lipoprotein, Lp(a)	2527					blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GCTTTGCTCAGGTGCTGCTAA	0.433																																					p.P19H		Atlas-SNP	.											.	LPA	237	.	0			c.C56A						PASS	.						129.0	134.0	132.0					6																	161071523		2186	4297	6483	SO:0001583	missense	4018	exon3			TGCTCAGGTGCTG	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.56C>A	chr6.hg19:g.161071523G>T	ENSP00000321334:p.Pro19His	95.0	0.0	.		109.0	16.0	.	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	hg19	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	g	7.332	0.619100	0.14129	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.61627	0.09;0.09	2.71	2.71	0.32032	.	.	.	.	.	T	0.32164	0.0820	L	0.43152	1.355	0.09310	N	1	.	.	.	.	.	.	T	0.16719	-1.0393	7	0.20519	T	0.43	.	9.0216	0.36204	0.0:0.0:1.0:0.0	.	.	.	.	H	19	ENSP00000321334:P19H;ENSP00000395608:P19H	ENSP00000321334:P19H	P	-	2	0	LPA	160991513	0.652000	0.27349	0.137000	0.22149	0.005000	0.04900	4.568000	0.60857	1.519000	0.48950	0.499000	0.49734	CCT	.	.	.	none		0.433	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
METTL2B	55798	hgsc.bcm.edu	37	7	128119287	128119287	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:128119287G>T	ENST00000262432.8	+	3	315	c.278G>T	c.(277-279)aGa>aTa	p.R93I	RP11-212P7.3_ENST00000462662.1_RNA|METTL2B_ENST00000480046.1_Missense_Mutation_p.R28I	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	93					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TTCAAGGATAGACATTGGCTT	0.348																																					p.R93I		Atlas-SNP	.											.	METTL2B	34	.	0			c.G278T						PASS	.						46.0	48.0	47.0					7																	128119287		2202	4296	6498	SO:0001583	missense	55798	exon3			AGGATAGACATTG	AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.278G>T	chr7.hg19:g.128119287G>T	ENSP00000262432:p.Arg93Ile	390.0	0.0	.		481.0	67.0	.	NM_018396	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	ENST00000262432.8	hg19	CCDS5803.2	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704511	0.48412	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;T;T	0.04654	3.58;3.58;3.58	2.86	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.01583	-1.1319	10	0.87932	D	0	-0.8843	7.7593	0.28942	0.1338:0.0:0.8662:0.0	.	28;93	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	I	87;93;28	ENSP00000418634:R87I;ENSP00000262432:R93I;ENSP00000418402:R28I	ENSP00000262432:R93I	R	+	2	0	METTL2B	127906523	1.000000	0.71417	0.984000	0.44739	0.344000	0.29017	9.445000	0.97587	0.540000	0.28808	-0.491000	0.04670	AGA	.	.	.	none		0.348	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
TAS2R39	259285	hgsc.bcm.edu	37	7	142880641	142880641	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:142880641G>A	ENST00000446620.1	+	1	130	c.130G>A	c.(130-132)Gaa>Aaa	p.E44K		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	44					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					TTTACTTGCTGAATACCTCAT	0.413																																					p.E44K		Atlas-SNP	.											.	TAS2R39	42	.	0			c.G130A						PASS	.						145.0	132.0	136.0					7																	142880641		1939	4149	6088	SO:0001583	missense	259285	exon1			CTTGCTGAATACC	AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.130G>A	chr7.hg19:g.142880641G>A	ENSP00000405095:p.Glu44Lys	106.0	0.0	.		188.0	13.0	.	NM_176881	A4FUI7|Q3ZCN6|Q645W4	Missense_Mutation	SNP	ENST00000446620.1	hg19	CCDS47729.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876777	0.51801	.	.	ENSG00000236398	ENST00000446620	T	0.37411	1.2	4.66	4.66	0.58398	.	.	.	.	.	T	0.65196	0.2668	M	0.89478	3.035	0.29517	N	0.853797	D	0.71674	0.998	D	0.68765	0.96	T	0.65676	-0.6110	9	0.72032	D	0.01	.	14.7561	0.69567	0.0:0.0:1.0:0.0	.	44	P59534	T2R39_HUMAN	K	44	ENSP00000405095:E44K	ENSP00000405095:E44K	E	+	1	0	TAS2R39	142590763	0.321000	0.24625	0.437000	0.26809	0.026000	0.11368	1.677000	0.37576	2.583000	0.87209	0.557000	0.71058	GAA	.	.	.	none		0.413	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327090.2	NM_176881	
REPIN1	29803	hgsc.bcm.edu	37	7	150069172	150069172	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:150069172C>A	ENST00000425389.2	+	1	920	c.842C>A	c.(841-843)tCg>tAg	p.S281*	REPIN1_ENST00000444957.1_Nonsense_Mutation_p.S281*|REPIN1_ENST00000540729.1_Nonsense_Mutation_p.S281*|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000489432.2_Nonsense_Mutation_p.S338*|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000397281.2_Nonsense_Mutation_p.S281*|RP4-584D14.5_ENST00000488310.1_RNA	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	281					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TATCTGACTTCGCACCGGCGC	0.637																																					p.S338X		Atlas-SNP	.											.	REPIN1	74	.	0			c.C1013A						PASS	.						18.0	23.0	22.0					7																	150069172		2160	4279	6439	SO:0001587	stop_gained	29803	exon3			TGACTTCGCACCG	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.842C>A	chr7.hg19:g.150069172C>A	ENSP00000388287:p.Ser281*	35.0	0.0	.		52.0	9.0	.	NM_001099695	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Nonsense_Mutation	SNP	ENST00000425389.2	hg19	CCDS43677.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.090002	0.76756	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000475514;ENST00000488943;ENST00000425389	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.22017	N	0.999416	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-5.8606	11.3408	0.49531	0.0:0.8167:0.1833:0.0	.	.	.	.	X	281;281;281;338;340;341;281	.	ENSP00000380451:S281X	S	+	2	0	REPIN1	149700105	0.000000	0.05858	0.985000	0.45067	0.853000	0.48598	-1.414000	0.02471	2.550000	0.86006	0.462000	0.41574	TCG	.	.	.	none		0.637	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374	
MTUS1	57509	hgsc.bcm.edu	37	8	17612803	17612803	+	Missense_Mutation	SNP	A	A	G	rs374892928		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:17612803A>G	ENST00000262102.6	-	2	738	c.514T>C	c.(514-516)Ttt>Ctt	p.F172L	MTUS1_ENST00000381869.3_Missense_Mutation_p.F172L|MTUS1_ENST00000381862.3_Missense_Mutation_p.F172L|MTUS1_ENST00000519263.1_Missense_Mutation_p.F172L	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	172					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TGTGATATAAAGGTGCAGTTA	0.438																																					p.F172L		Atlas-SNP	.											.	MTUS1	144	.	0			c.T514C						PASS	.						146.0	132.0	136.0					8																	17612803		1963	4150	6113	SO:0001583	missense	57509	exon2			ATATAAAGGTGCA	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.514T>C	chr8.hg19:g.17612803A>G	ENSP00000262102:p.Phe172Leu	191.0	0.0	.		224.0	34.0	.	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	hg19	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	A	13.70	2.316888	0.40996	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.30182	2.43;2.5;2.43;1.54	4.09	2.91	0.33838	.	0.407817	0.21445	N	0.074440	T	0.21921	0.0528	L	0.32530	0.975	0.09310	N	0.999999	B;B;P	0.44139	0.356;0.206;0.827	B;B;B	0.43331	0.104;0.052;0.416	T	0.05886	-1.0858	9	.	.	.	-5.1088	5.1218	0.14863	0.5864:0.2499:0.0:0.1636	.	172;172;172	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	L	172	ENSP00000371293:F172L;ENSP00000262102:F172L;ENSP00000430167:F172L;ENSP00000371286:F172L	.	F	-	1	0	MTUS1	17657083	0.265000	0.24102	0.123000	0.21794	0.013000	0.08279	1.311000	0.33562	0.883000	0.36040	-0.490000	0.04691	TTT	.	.	.	alt		0.438	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
KAT6A	7994	hgsc.bcm.edu	37	8	41794945	41794945	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:41794945A>T	ENST00000396930.3	-	17	3724	c.3181T>A	c.(3181-3183)Tta>Ata	p.L1061I	KAT6A_ENST00000265713.2_Missense_Mutation_p.L1061I|KAT6A_ENST00000406337.1_Missense_Mutation_p.L1061I	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1061					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GTGGGTTCTAATCTTGGCATT	0.428																																					p.L1061I		Atlas-SNP	.											.	.	.	.	0			c.T3181A						PASS	.						120.0	115.0	117.0					8																	41794945		2203	4300	6503	SO:0001583	missense	7994	exon17			GTTCTAATCTTGG	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3181T>A	chr8.hg19:g.41794945A>T	ENSP00000380136:p.Leu1061Ile	215.0	0.0	.		281.0	58.0	.	NM_001099412	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	hg19	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	A	13.75	2.330228	0.41297	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.66099	-0.19;-0.19;-0.19	5.63	3.27	0.37495	.	0.000000	0.53938	D	0.000041	T	0.73853	0.3640	M	0.69823	2.125	0.42293	D	0.992149	D	0.69078	0.997	D	0.78314	0.991	T	0.72571	-0.4253	10	0.62326	D	0.03	-9.4799	7.9093	0.29780	0.6901:0.0:0.3099:0.0	.	1061	Q92794	KAT6A_HUMAN	I	1061;1061;1061;641	ENSP00000265713:L1061I;ENSP00000385888:L1061I;ENSP00000380136:L1061I	ENSP00000265713:L1061I	L	-	1	2	KAT6A	41914102	0.999000	0.42202	0.996000	0.52242	0.990000	0.78478	3.600000	0.54052	0.436000	0.26393	0.528000	0.53228	TTA	.	.	.	none		0.428	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
WWP1	11059	hgsc.bcm.edu	37	8	87423961	87423961	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr8:87423961G>C	ENST00000517970.1	+	9	1226	c.919G>C	c.(919-921)Gct>Cct	p.A307P	WWP1_ENST00000341922.2_Missense_Mutation_p.A177P|WWP1_ENST00000265428.4_Missense_Mutation_p.A307P|WWP1_ENST00000349423.2_Missense_Mutation_p.A89P	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	307					central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GGAATCTGAAGCTAGAAGTAT	0.408																																					p.A307P		Atlas-SNP	.											.	WWP1	97	.	0			c.G919C						PASS	.						78.0	76.0	77.0					8																	87423961		2203	4300	6503	SO:0001583	missense	11059	exon9			TCTGAAGCTAGAA	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.919G>C	chr8.hg19:g.87423961G>C	ENSP00000427793:p.Ala307Pro	109.0	0.0	.		111.0	18.0	.	NM_007013	O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	ENST00000517970.1	hg19	CCDS6242.1	.	.	.	.	.	.	.	.	.	.	G	5.203	0.222924	0.09863	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	T;T;T;T	0.46451	0.89;0.89;0.87;0.89	5.69	4.81	0.61882	.	0.669254	0.14402	N	0.321845	T	0.21962	0.0529	N	0.08118	0	0.39335	D	0.965486	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.003	T	0.08513	-1.0718	10	0.30078	T	0.28	.	7.2873	0.26346	0.1504:0.1403:0.7094:0.0	.	89;307	Q9H0M0-6;Q9H0M0	.;WWP1_HUMAN	P	307;307;177;89	ENSP00000427793:A307P;ENSP00000265428:A307P;ENSP00000340564:A177P;ENSP00000342665:A89P	ENSP00000265428:A307P	A	+	1	0	WWP1	87493077	0.557000	0.26546	0.093000	0.20910	0.015000	0.08874	0.271000	0.18626	1.410000	0.46936	0.650000	0.86243	GCT	.	.	.	none		0.408	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
PLIN2	123	hgsc.bcm.edu	37	9	19126158	19126158	+	Silent	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr9:19126158C>A	ENST00000276914.2	-	3	359	c.180G>T	c.(178-180)gtG>gtT	p.V60V	PLIN2_ENST00000380464.3_Silent_p.V60V|PLIN2_ENST00000380465.3_Silent_p.V60V|PLIN2_ENST00000411567.1_Silent_p.V60V	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	60					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						TGGTCATGGCCACGGAGGTGA	0.527																																					p.V60V		Atlas-SNP	.											.	PLIN2	41	.	0			c.G180T						PASS	.						160.0	124.0	136.0					9																	19126158		2203	4300	6503	SO:0001819	synonymous_variant	123	exon3			CATGGCCACGGAG	X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.180G>T	chr9.hg19:g.19126158C>A		207.0	0.0	.		263.0	49.0	.	NM_001122	Q9BSC3	Silent	SNP	ENST00000276914.2	hg19	CCDS6490.1																																																																																			.	.	.	none		0.527	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
AGTPBP1	23287	hgsc.bcm.edu	37	9	88233969	88233969	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr9:88233969C>G	ENST00000357081.3	-	17	2408	c.2264G>C	c.(2263-2265)gGa>gCa	p.G755A	AGTPBP1_ENST00000376109.3_Missense_Mutation_p.G767A|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.G593A|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.G715A|AGTPBP1_ENST00000337006.4_3'UTR			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	755					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						TGGTCGCATTCCACTGACTTC	0.328																																					p.G715A		Atlas-SNP	.											.	AGTPBP1	128	.	0			c.G2144C						PASS	.						92.0	93.0	92.0					9																	88233969		2203	4300	6503	SO:0001583	missense	23287	exon17			CGCATTCCACTGA	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.2264G>C	chr9.hg19:g.88233969C>G	ENSP00000349592:p.Gly755Ala	136.0	0.0	.		130.0	27.0	.	NM_015239	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	ENST00000357081.3	hg19		.	.	.	.	.	.	.	.	.	.	C	16.55	3.154898	0.57259	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.38	5.38	0.77491	.	0.097920	0.64402	D	0.000001	T	0.55593	0.1930	M	0.67517	2.055	0.80722	D	1	B;D;D;P	0.76494	0.34;0.992;0.999;0.729	B;P;D;B	0.73708	0.257;0.872;0.981;0.439	T	0.54057	-0.8350	10	0.48119	T	0.1	-15.9497	19.1333	0.93415	0.0:1.0:0.0:0.0	.	767;755;593;715	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	A	755;715;767;593	ENSP00000349592:G755A;ENSP00000365251:G715A;ENSP00000365277:G767A;ENSP00000402804:G593A	ENSP00000349592:G755A	G	-	2	0	AGTPBP1	87423789	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.890000	0.69774	2.532000	0.85374	0.650000	0.86243	GGA	.	.	.	none		0.328	AGTPBP1-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052893.1	NM_015239	
PHPT1	29085	hgsc.bcm.edu	37	9	139744582	139744582	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr9:139744582A>G	ENST00000247665.10	+	2	615	c.278A>G	c.(277-279)tAt>tGt	p.Y93C	PHPT1_ENST00000371661.1_Missense_Mutation_p.Y93C|MAMDC4_ENST00000445819.1_5'Flank|PHPT1_ENST00000492540.1_3'UTR|PHPT1_ENST00000545326.1_Missense_Mutation_p.Y93C|MAMDC4_ENST00000317446.2_5'Flank	NM_014172.4	NP_054891.2	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1	93					negative regulation of ATP citrate synthase activity (GO:2000984)|negative regulation of lyase activity (GO:0051350)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-histidine dephosphorylation (GO:0035971)|positive regulation of cell motility (GO:2000147)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|protein dephosphorylation (GO:0006470)|regulation of actin cytoskeleton reorganization (GO:2000249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium channel inhibitor activity (GO:0019855)|ion channel binding (GO:0044325)|phosphohistidine phosphatase activity (GO:0008969)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|large_intestine(1)|lung(1)	3	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GTGTACGGCTATTCCATGGTG	0.662																																					p.Y93C		Atlas-SNP	.											.	PHPT1	14	.	0			c.A278G						PASS	.						93.0	86.0	88.0					9																	139744582		2202	4300	6502	SO:0001583	missense	29085	exon2			ACGGCTATTCCAT	AF131857	CCDS7009.1, CCDS48060.1	9q34.3	2008-02-05			ENSG00000054148	ENSG00000054148	3.1.3.-		30033	protein-coding gene	gene with protein product	"""phosphohistidine phosphatase 14kDa"", "" sex-regulated protein janus-a"""	610167				11042152, 8619474	Standard	NM_014172		Approved	PHP14, HSPC141, CGI-202, DKFZp564M173, bA216L13.10	uc004cjq.4	Q9NRX4	OTTHUMG00000020950	ENST00000247665.10:c.278A>G	chr9.hg19:g.139744582A>G	ENSP00000247665:p.Tyr93Cys	120.0	0.0	.		179.0	30.0	.	NM_001135861	B1AMX0|B1AMX1|Q9H0Y3	Missense_Mutation	SNP	ENST00000247665.10	hg19	CCDS7009.1	.	.	.	.	.	.	.	.	.	.	.	22.3	4.267724	0.80469	.	.	ENSG00000054148	ENST00000371661;ENST00000545326;ENST00000247665	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	T	0.80979	0.4728	M	0.88450	2.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.83346	-0.0005	8	0.46703	T	0.11	-0.3441	13.1692	0.59589	1.0:0.0:0.0:0.0	.	93;93	Q9NRX4-2;Q9NRX4	.;PHP14_HUMAN	C	93	.	ENSP00000247665:Y93C	Y	+	2	0	PHPT1	138864403	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.655000	0.67981	1.703000	0.51240	0.374000	0.22700	TAT	.	.	.	none		0.662	PHPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055150.1	NM_014172	
NOLC1	9221	hgsc.bcm.edu	37	10	103917872	103917872	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr10:103917872G>A	ENST00000605788.1	+	5	743	c.508G>A	c.(508-510)Gat>Aat	p.D170N	NOLC1_ENST00000405356.1_Missense_Mutation_p.D170N|NOLC1_ENST00000603742.1_5'UTR|NOLC1_ENST00000488254.2_Missense_Mutation_p.D171N	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	170	11 X 12 AA approximate repeats of an acidic serine cluster.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		CTCTGATTCTGATTCTGACTC	0.488																																					p.D170N		Atlas-SNP	.											.	NOLC1	61	.	0			c.G508A						PASS	.						88.0	90.0	89.0					10																	103917872		2203	4300	6503	SO:0001583	missense	9221	exon5			GATTCTGATTCTG	Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.508G>A	chr10.hg19:g.103917872G>A	ENSP00000474710:p.Asp170Asn	162.0	0.0	.		193.0	35.0	.	NM_004741	Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	ENST00000605788.1	hg19	CCDS7530.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948000	0.73787	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.52057	0.68	5.72	5.72	0.89469	.	0.256859	0.33834	N	0.004509	T	0.68796	0.3040	M	0.77313	2.365	0.80722	D	1	D;D;D	0.63046	0.992;0.992;0.986	P;P;P	0.61592	0.891;0.891;0.78	T	0.71341	-0.4622	10	0.66056	D	0.02	-7.6697	18.8652	0.92289	0.0:0.0:1.0:0.0	.	171;170;170	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	N	170	ENSP00000385410:D170N	ENSP00000359024:D170N	D	+	1	0	NOLC1	103907862	1.000000	0.71417	0.959000	0.39883	0.796000	0.44982	6.775000	0.75018	2.709000	0.92574	0.561000	0.74099	GAT	.	.	.	none		0.488	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
OR2AG2	338755	hgsc.bcm.edu	37	11	6789370	6789370	+	Silent	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:6789370G>T	ENST00000338569.2	-	1	916	c.819C>A	c.(817-819)atC>atA	p.I273I		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AAACAGAGATGATGTTGTCTT	0.512																																					p.I273I		Atlas-SNP	.											OR2AG2,caecum,carcinoma,0,1	OR2AG2	55	.	0			c.C819A						PASS	.						151.0	138.0	142.0					11																	6789370		2201	4296	6497	SO:0001819	synonymous_variant	338755	exon1			AGAGATGATGTTG	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.819C>A	chr11.hg19:g.6789370G>T		332.0	0.0	.		456.0	86.0	.	NM_001004490		Silent	SNP	ENST00000338569.2	hg19	CCDS31413.1																																																																																			.	.	.	none		0.512	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490	
RBM14	10432	hgsc.bcm.edu	37	11	66384484	66384484	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:66384484T>C	ENST00000310137.4	+	1	432	c.293T>C	c.(292-294)cTc>cCc	p.L98P	RBM14_ENST00000443702.1_Missense_Mutation_p.L98P|RBM14_ENST00000409372.1_Missense_Mutation_p.L98P|RBM14-RBM4_ENST00000511114.1_3'UTR|RBM14-RBM4_ENST00000500635.2_Missense_Mutation_p.L98P|RBM4_ENST00000514361.3_Missense_Mutation_p.L98P|RBM4_ENST00000503028.2_5'UTR|RBM14_ENST00000409738.4_Missense_Mutation_p.L98P|RNU4-39P_ENST00000362455.1_RNA|RBM14-RBM4_ENST00000412278.2_Missense_Mutation_p.L98P|RBM14_ENST00000393979.3_Missense_Mutation_p.L98P	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	98	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CTGCGCAGCCTCTTCGAGCGC	0.647																																					p.L98P		Atlas-SNP	.											.	RBM14	59	.	0			c.T293C						PASS	.						52.0	62.0	59.0					11																	66384484		2141	4173	6314	SO:0001583	missense	10432	exon1			GCAGCCTCTTCGA	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.293T>C	chr11.hg19:g.66384484T>C	ENSP00000311747:p.Leu98Pro	63.0	0.0	.		67.0	8.0	.	NM_001198837	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	ENST00000310137.4	hg19	CCDS8147.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.761857	0.69763	.	.	ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000239306;ENSG00000248643;ENSG00000248643	ENST00000310137;ENST00000393979;ENST00000409372;ENST00000443702;ENST00000409738;ENST00000412278;ENST00000500635	T;T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89;1.89	5.19	4.01	0.46588	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.257070	0.27811	N	0.017747	T	0.58977	0.2160	H	0.94808	3.585	0.80722	D	1	D;D;D;B	0.89917	1.0;0.999;0.995;0.213	D;D;D;B	0.87578	0.998;0.964;0.974;0.398	T	0.68002	-0.5524	10	0.59425	D	0.04	-4.9687	10.4857	0.44719	0.0:0.0:0.1621:0.8379	.	98;98;98;98	B0LM41;Q96PK6-2;Q2PYN1;Q96PK6	.;.;.;RBM14_HUMAN	P	98	ENSP00000311747:L98P;ENSP00000377548:L98P;ENSP00000386518:L98P;ENSP00000414650:L98P;ENSP00000386995:L98P;ENSP00000388552:L98P;ENSP00000421279:L98P	ENSP00000311747:L98P	L	+	2	0	RBM14;RBM14-RBM4	66141060	0.914000	0.31030	1.000000	0.80357	0.966000	0.64601	1.791000	0.38744	1.971000	0.57363	0.459000	0.35465	CTC	.	.	.	none		0.647	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
KIAA1377	57562	hgsc.bcm.edu	37	11	101832493	101832493	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:101832493C>G	ENST00000263468.8	+	6	997	c.727C>G	c.(727-729)Cag>Gag	p.Q243E	KIAA1377_ENST00000537689.1_Missense_Mutation_p.Q44E	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	243										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TGAAGTTAATCAGATAACCAA	0.313																																					p.Q243E		Atlas-SNP	.											.	KIAA1377	111	.	0			c.C727G						PASS	.						39.0	42.0	41.0					11																	101832493		2199	4295	6494	SO:0001583	missense	57562	exon6			GTTAATCAGATAA	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.727C>G	chr11.hg19:g.101832493C>G	ENSP00000263468:p.Gln243Glu	57.0	0.0	.		73.0	14.0	.	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	hg19	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444976	0.25987	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.07908	3.15;3.15	5.51	5.51	0.81932	.	0.475599	0.20115	N	0.098938	T	0.12860	0.0312	M	0.70595	2.14	0.22684	N	0.998852	B	0.24823	0.112	B	0.26094	0.066	T	0.07597	-1.0764	10	0.48119	T	0.1	0.0806	11.3463	0.49563	0.1257:0.6801:0.1941:0.0	.	243	Q9P2H0	K1377_HUMAN	E	243;44	ENSP00000263468:Q243E;ENSP00000443184:Q44E	ENSP00000263468:Q243E	Q	+	1	0	KIAA1377	101337703	0.999000	0.42202	0.995000	0.50966	0.907000	0.53573	1.559000	0.36320	2.595000	0.87683	0.561000	0.74099	CAG	.	.	.	none		0.313	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
CACNA1C	775	hgsc.bcm.edu	37	12	2763057	2763057	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:2763057C>T	ENST00000347598.4	+	35	4275	c.4275C>T	c.(4273-4275)atC>atT	p.I1425I	CACNA1C_ENST00000335762.5_Silent_p.I1402I|CACNA1C_ENST00000399617.1_Silent_p.I1377I|CACNA1C_ENST00000399649.1_Silent_p.I1364I|CACNA1C_ENST00000399655.1_Silent_p.I1377I|CACNA1C_ENST00000399606.1_Silent_p.I1397I|CACNA1C_ENST00000327702.7_Silent_p.I1377I|CACNA1C_ENST00000399621.1_Silent_p.I1377I|CACNA1C_ENST00000399591.1_Silent_p.I1366I|CACNA1C_ENST00000399601.1_Silent_p.I1377I|CACNA1C_ENST00000399634.1_Silent_p.I1377I|CACNA1C_ENST00000399644.1_Silent_p.I1377I|CACNA1C_ENST00000399629.1_Silent_p.I1394I|CACNA1C_ENST00000402845.3_Silent_p.I1377I|CACNA1C_ENST00000399641.1_Silent_p.I1377I|CACNA1C_ENST00000399637.1_Silent_p.I1377I|CACNA1C_ENST00000344100.3_Silent_p.I1399I|CACNA1C_ENST00000399595.1_Silent_p.I1366I|CACNA1C_ENST00000399603.1_Silent_p.I1377I|CACNA1C_ENST00000399638.1_Silent_p.I1405I|CACNA1C_ENST00000399597.1_Silent_p.I1377I|CACNA1C_ENST00000406454.3_Silent_p.I1377I	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1425					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGCGGTGATCGGGATGCAGG	0.627																																					p.I1425I		Atlas-SNP	.											Q6YL47_HUMAN,right_upper_lobe,carcinoma,0,5	CACNA1C	1023	.	0			c.C4275T						PASS	.						75.0	78.0	77.0					12																	2763057		2028	4203	6231	SO:0001819	synonymous_variant	775	exon35			GGTGATCGGGATG	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4275C>T	chr12.hg19:g.2763057C>T		69.0	0.0	.		109.0	27.0	.	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	hg19	CCDS44788.1																																																																																			.	.	.	none		0.627	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
A2M	2	hgsc.bcm.edu	37	12	9242617	9242617	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:9242617T>A	ENST00000318602.7	-	21	2906	c.2599A>T	c.(2599-2601)Aat>Tat	p.N867Y		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	867					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AAATTCACATTTCCTGAAAAA	0.438																																					p.N867Y		Atlas-SNP	.											.	A2M	180	.	0			c.A2599T						PASS	.						119.0	118.0	118.0					12																	9242617		1893	4112	6005	SO:0001583	missense	2	exon21			TCACATTTCCTGA	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2599A>T	chr12.hg19:g.9242617T>A	ENSP00000323929:p.Asn867Tyr	144.0	0.0	.		171.0	35.0	.	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	hg19	CCDS44827.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.24|11.24	1.580426|1.580426	0.28180|0.28180	.|.	.|.	ENSG00000175899|ENSG00000175899	ENST00000543436|ENST00000318602;ENST00000540099	.|T	.|0.17054	.|2.3	5.68|5.68	3.33|3.33	0.38152|0.38152	.|.	.|0.737822	.|0.13068	.|N	.|0.416350	T|T	0.19327|0.19327	0.0464|0.0464	M|M	0.80028|0.80028	2.48|2.48	0.09310|0.09310	N|N	1|1	.|B	.|0.17465	.|0.022	.|B	.|0.15870	.|0.014	T|T	0.41998|0.41998	-0.9477|-0.9477	5|10	.|0.66056	.|D	.|0.02	.|.	0.9957|0.9957	0.01466|0.01466	0.1621:0.1524:0.1695:0.516|0.1621:0.1524:0.1695:0.516	.|.	.|867	.|P01023	.|A2MG_HUMAN	D|Y	114|867;882	.|ENSP00000323929:N867Y	.|ENSP00000323929:N867Y	E|N	-|-	3|1	2|0	A2M|A2M	9133884|9133884	0.000000|0.000000	0.05858|0.05858	0.405000|0.405000	0.26409|0.26409	0.850000|0.850000	0.48378|0.48378	0.257000|0.257000	0.18369|0.18369	0.955000|0.955000	0.37878|0.37878	-0.336000|-0.336000	0.08194|0.08194	GAA|AAT	.	.	.	none		0.438	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
PTPRB	5787	hgsc.bcm.edu	37	12	71002988	71002988	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:71002988G>A	ENST00000261266.5	-	2	215	c.186C>T	c.(184-186)acC>acT	p.T62T	PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000538708.1_Silent_p.T62T|PTPRB_ENST00000551525.1_Silent_p.T279T|PTPRB_ENST00000451516.2_Silent_p.T62T|PTPRB_ENST00000334414.6_Silent_p.T280T|PTPRB_ENST00000550857.1_Silent_p.T62T|PTPRB_ENST00000550358.1_Silent_p.T280T	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	62	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CGGCCCCCAGGGTGTCACTGC	0.498																																					p.T280T		Atlas-SNP	.											.	PTPRB	676	.	0			c.C840T						PASS	.						86.0	90.0	88.0					12																	71002988		1923	4116	6039	SO:0001819	synonymous_variant	5787	exon4			CCCCAGGGTGTCA	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.186C>T	chr12.hg19:g.71002988G>A		275.0	0.0	.		372.0	77.0	.	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.252789	0.01469	.	.	ENSG00000127329	ENST00000547715	.	.	.	4.75	-4.0	0.04057	.	.	.	.	.	T	0.17023	0.0409	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.21930	-1.0231	4	.	.	.	.	0.6526	0.00829	0.3902:0.1252:0.1784:0.3062	.	.	.	.	S	54	.	.	P	-	1	0	PTPRB	69289255	0.707000	0.27866	0.000000	0.03702	0.051000	0.14879	-0.453000	0.06778	-1.290000	0.02372	-0.194000	0.12790	CCT	.	.	.	none		0.498	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
PGAM5	192111	hgsc.bcm.edu	37	12	133294130	133294130	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr12:133294130T>C	ENST00000498926.2	+	3	534	c.476T>C	c.(475-477)aTc>aCc	p.I159T	PGAM5_ENST00000543955.1_Missense_Mutation_p.I10T|PGAM5_ENST00000454808.2_Missense_Mutation_p.I10T|PXMP2_ENST00000545677.1_3'UTR|PGAM5_ENST00000317555.2_Missense_Mutation_p.I159T	NM_001170543.1|NM_001170544.1	NP_001164014.1|NP_001164015.1	Q96HS1	PGAM5_HUMAN	phosphoglycerate mutase family member 5	159					dephosphorylation (GO:0016311)|necroptotic process (GO:0070266)|positive regulation of GTPase activity (GO:0043547)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.89e-08)|Epithelial(86;1.14e-07)|all cancers(50;3.57e-06)		ACCACCGATATCATCAGCCGG	0.632																																					p.I159T		Atlas-SNP	.											.	PGAM5	18	.	0			c.T476C						PASS	.						49.0	55.0	53.0					12																	133294130		2203	4298	6501	SO:0001583	missense	192111	exon3			CCGATATCATCAG	BC008196	CCDS9280.1, CCDS53845.1	12q24.33	2011-07-28			ENSG00000247077	ENSG00000247077			28763	protein-coding gene	gene with protein product		614939				11283018	Standard	NM_001170543		Approved	MGC5352, BXLBv68	uc009zyv.3	Q96HS1	OTTHUMG00000168021	ENST00000498926.2:c.476T>C	chr12.hg19:g.133294130T>C	ENSP00000438465:p.Ile159Thr	29.0	0.0	.		43.0	4.0	.	NM_138575	A9LN06|C9IZY7|Q96JB0	Missense_Mutation	SNP	ENST00000498926.2	hg19	CCDS53845.1	.	.	.	.	.	.	.	.	.	.	T	19.44	3.827390	0.71143	.	.	ENSG00000247077	ENST00000317555;ENST00000498926;ENST00000543955;ENST00000454808	T;T	0.73681	1.36;-0.77	5.6	5.6	0.85130	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.86577	0.5966	M	0.79693	2.465	0.80722	D	1	D;D	0.76494	0.999;0.988	D;D	0.81914	0.995;0.962	D	0.88249	0.2915	10	0.66056	D	0.02	-3.8102	15.8035	0.78473	0.0:0.0:0.0:1.0	.	159;159	Q96HS1;Q96HS1-2	PGAM5_HUMAN;.	T	159;159;10;10	ENSP00000321503:I159T;ENSP00000438465:I159T	ENSP00000321503:I159T	I	+	2	0	PGAM5	131804203	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	7.459000	0.80802	2.130000	0.65690	0.482000	0.46254	ATC	.	.	.	none		0.632	PGAM5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397562.1	NM_138575	
MTRF1	9617	hgsc.bcm.edu	37	13	41791352	41791352	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr13:41791352C>T	ENST00000379480.4	-	10	1337	c.1237G>A	c.(1237-1239)Ggt>Agt	p.G413S	MTRF1_ENST00000379477.1_Missense_Mutation_p.G413S|MTRF1_ENST00000430347.2_Silent_p.V461V	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	413					regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)			breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		CCCTTCCCACCACATAAAAAT	0.348																																					p.G413S		Atlas-SNP	.											.	MTRF1	24	.	0			c.G1237A						PASS	.						56.0	61.0	59.0					13																	41791352		2203	4300	6503	SO:0001583	missense	9617	exon10			TCCCACCACATAA	AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.1237G>A	chr13.hg19:g.41791352C>T	ENSP00000368793:p.Gly413Ser	131.0	0.0	.		181.0	38.0	.	NM_004294	B4DG01|Q5T6Y5|Q8IUQ6	Missense_Mutation	SNP	ENST00000379480.4	hg19	CCDS9378.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505562	0.64410	.	.	ENSG00000120662	ENST00000379480;ENST00000379477	T;T	0.58210	0.35;0.35	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75068	-0.3448	10	0.87932	D	0	-9.2822	16.8351	0.85955	0.0:1.0:0.0:0.0	.	413	O75570	RF1M_HUMAN	S	413	ENSP00000368793:G413S;ENSP00000368790:G413S	ENSP00000368790:G413S	G	-	1	0	MTRF1	40689352	1.000000	0.71417	1.000000	0.80357	0.228000	0.25075	4.053000	0.57427	2.583000	0.87209	0.655000	0.94253	GGT	.	.	.	none		0.348	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044666.3	NM_004294	
BCL2L2	599	hgsc.bcm.edu	37	14	23776985	23776985	+	Silent	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr14:23776985C>A	ENST00000250405.5	+	3	238	c.9C>A	c.(7-9)acC>acA	p.T3T	BCL2L2-PABPN1_ENST00000557008.1_Silent_p.T3T|BCL2L2-PABPN1_ENST00000553781.1_Silent_p.T3T	NM_001199839.1|NM_004050.4	NP_001186768.1|NP_004041	Q92843	B2CL2_HUMAN	BCL2-like 2	3					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|Sertoli cell proliferation (GO:0060011)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|lung(4)|prostate(1)	6	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00654)		GGATGGCGACCCCAGCCTCGG	0.562																																					p.T3T		Atlas-SNP	.											.	.	.	.	0			c.C9A						PASS	.						53.0	63.0	60.0					14																	23776985		2203	4298	6501	SO:0001819	synonymous_variant	100529063	exon3			GGCGACCCCAGCC	D87461	CCDS9591.1	14q11.2-q12	2014-03-07			ENSG00000129473	ENSG00000129473		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	995	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 51"""	601931				8761287	Standard	NM_001199839		Approved	KIAA0271, BCL-W, PPP1R51		Q92843	OTTHUMG00000028738	ENST00000250405.5:c.9C>A	chr14.hg19:g.23776985C>A		80.0	0.0	.		83.0	26.0	.	NM_001199864	A8K0F4|Q2M3U0|Q5U0H4	Silent	SNP	ENST00000250405.5	hg19	CCDS9591.1																																																																																			.	.	.	none		0.562	BCL2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071763.3	NM_004050	
MAP1A	4130	hgsc.bcm.edu	37	15	43817788	43817788	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr15:43817788A>G	ENST00000300231.5	+	4	4567	c.4117A>G	c.(4117-4119)Act>Gct	p.T1373A	MAP1A_ENST00000399453.1_Missense_Mutation_p.T1373A|MAP1A_ENST00000382031.1_Missense_Mutation_p.T1611A			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1373					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GAAAGACAAAACTCTGGAGCA	0.443																																					p.T1373A		Atlas-SNP	.											.	MAP1A	189	.	0			c.A4117G						PASS	.						99.0	96.0	97.0					15																	43817788		1906	4125	6031	SO:0001583	missense	4130	exon4			GACAAAACTCTGG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4117A>G	chr15.hg19:g.43817788A>G	ENSP00000300231:p.Thr1373Ala	151.0	0.0	.		171.0	52.0	.	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	hg19	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	A	9.136	1.012745	0.19277	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.02280	4.36;4.36;4.36	4.47	1.97	0.26223	.	.	.	.	.	T	0.02807	0.0084	M	0.63428	1.95	0.09310	N	0.999998	B	0.33549	0.417	B	0.30495	0.116	T	0.41431	-0.9509	9	0.27785	T	0.31	0.3065	5.6758	0.17747	0.7318:0.171:0.0972:0.0	.	1373	P78559	MAP1A_HUMAN	A	1611;1373;1373	ENSP00000371462:T1611A;ENSP00000382380:T1373A;ENSP00000300231:T1373A	ENSP00000300231:T1373A	T	+	1	0	MAP1A	41605080	0.004000	0.15560	0.999000	0.59377	0.716000	0.41182	1.917000	0.39996	0.866000	0.35629	0.460000	0.39030	ACT	.	.	.	none		0.443	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
IGFALS	3483	hgsc.bcm.edu	37	16	1837738	1837738	+	IGR	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:1837738A>G	ENST00000215539.3	-	0	2116				NUBP2_ENST00000568706.1_5'UTR|NUBP2_ENST00000262302.9_Missense_Mutation_p.D132G|NUBP2_ENST00000543305.1_5'UTR|NUBP2_ENST00000565134.1_Missense_Mutation_p.D132G|NUBP2_ENST00000565987.1_Missense_Mutation_p.D72G			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit						cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						CTGGTGGTGGACACGCCCCCG	0.682																																					p.D132G		Atlas-SNP	.											.	NUBP2	25	.	0			c.A395G						PASS	.						66.0	67.0	66.0					16																	1837738		2199	4300	6499	SO:0001628	intergenic_variant	10101	exon4			TGGTGGACACGCC	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638		chr16.hg19:g.1837738A>G		97.0	0.0	.		141.0	6.0	.	NM_012225	B4DZY8|E9PGU3	Missense_Mutation	SNP	ENST00000215539.3	hg19	CCDS10446.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307453	0.81247	.	.	ENSG00000095906	ENST00000262302	D	0.81821	-1.54	4.92	4.92	0.64577	Mrp, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94555	0.8246	H	0.99867	4.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96490	0.9363	10	0.87932	D	0	-9.7752	13.4012	0.60883	1.0:0.0:0.0:0.0	.	132	Q9Y5Y2	NUBP2_HUMAN	G	132	ENSP00000262302:D132G	ENSP00000262302:D132G	D	+	2	0	NUBP2	1777739	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	7.008000	0.76341	1.854000	0.53819	0.459000	0.35465	GAC	.	.	.	none		0.682	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250509.2		
CCP110	9738	hgsc.bcm.edu	37	16	19548820	19548820	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:19548820A>T	ENST00000381396.5	+	4	2076	c.1829A>T	c.(1828-1830)gAa>gTa	p.E610V	CCP110_ENST00000396212.2_Missense_Mutation_p.E610V|CCP110_ENST00000396208.2_Missense_Mutation_p.E610V	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	610					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						GGAATAACTGAACAAGAAAGG	0.348																																					p.E610V		Atlas-SNP	.											.	CCP110	57	.	0			c.A1829T						PASS	.						67.0	72.0	70.0					16																	19548820		2197	4300	6497	SO:0001583	missense	9738	exon4			TAACTGAACAAGA	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1829A>T	chr16.hg19:g.19548820A>T	ENSP00000370803:p.Glu610Val	184.0	0.0	.		235.0	40.0	.	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	hg19	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.527464	0.44969	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.16897	2.31;2.31;2.31	5.17	5.17	0.71159	.	0.139138	0.46145	D	0.000310	T	0.16557	0.0398	L	0.58101	1.795	0.30579	N	0.762718	P;P	0.45715	0.865;0.865	B;B	0.42555	0.391;0.391	T	0.30090	-0.9990	10	0.48119	T	0.1	-1.1381	3.1962	0.06634	0.6412:0.1436:0.0771:0.1382	.	610;610	O43303;O43303-2	CP110_HUMAN;.	V	610	ENSP00000379515:E610V;ENSP00000370803:E610V;ENSP00000379511:E610V	ENSP00000370803:E610V	E	+	2	0	CCP110	19456321	1.000000	0.71417	0.981000	0.43875	0.972000	0.66771	2.685000	0.46959	1.933000	0.56026	0.460000	0.39030	GAA	.	.	.	none		0.348	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
CCP110	9738	hgsc.bcm.edu	37	16	19548822	19548822	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:19548822C>A	ENST00000381396.5	+	4	2078	c.1831C>A	c.(1831-1833)Caa>Aaa	p.Q611K	CCP110_ENST00000396212.2_Missense_Mutation_p.Q611K|CCP110_ENST00000396208.2_Missense_Mutation_p.Q611K	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	611					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						AATAACTGAACAAGAAAGGCA	0.348																																					p.Q611K		Atlas-SNP	.											.	CCP110	57	.	0			c.C1831A						PASS	.						66.0	71.0	69.0					16																	19548822		2197	4300	6497	SO:0001583	missense	9738	exon4			ACTGAACAAGAAA	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1831C>A	chr16.hg19:g.19548822C>A	ENSP00000370803:p.Gln611Lys	181.0	0.0	.		234.0	40.0	.	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	hg19	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694577	0.48202	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.19105	2.17;2.17;2.17	5.17	5.17	0.71159	.	0.260422	0.33127	N	0.005246	T	0.25005	0.0607	L	0.58101	1.795	0.35963	D	0.834752	P;P	0.41978	0.767;0.767	B;B	0.41510	0.359;0.359	T	0.33904	-0.9850	10	0.72032	D	0.01	-0.143	12.0805	0.53667	0.0:0.9211:0.0:0.0789	.	611;611	O43303;O43303-2	CP110_HUMAN;.	K	611	ENSP00000379515:Q611K;ENSP00000370803:Q611K;ENSP00000379511:Q611K	ENSP00000370803:Q611K	Q	+	1	0	CCP110	19456323	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	3.793000	0.55484	2.385000	0.81259	0.563000	0.77884	CAA	.	.	.	none		0.348	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
PRR14	78994	hgsc.bcm.edu	37	16	30666137	30666137	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:30666137G>A	ENST00000542965.2	+	7	1302	c.846G>A	c.(844-846)ctG>ctA	p.L282L	PRR14_ENST00000300835.4_Silent_p.L282L			Q9BWN1	PRR14_HUMAN	proline rich 14	282	Pro-rich.									breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			CAATGAAGCTGGAGTTGAAGA	0.637																																					p.L282L		Atlas-SNP	.											.	PRR14	45	.	0			c.G846A						PASS	.						19.0	23.0	21.0					16																	30666137		2192	4295	6487	SO:0001819	synonymous_variant	78994	exon8			GAAGCTGGAGTTG	AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.846G>A	chr16.hg19:g.30666137G>A		37.0	0.0	.		37.0	6.0	.	NM_024031	Q8WTX2	Silent	SNP	ENST00000542965.2	hg19	CCDS10687.1																																																																																			.	.	.	none		0.637	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434433.1	NM_024031	
FBXL19	54620	hgsc.bcm.edu	37	16	30958111	30958111	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:30958111A>G	ENST00000380310.2	+	10	1906	c.1748A>G	c.(1747-1749)gAg>gGg	p.E583G	AC135048.13_ENST00000566056.1_RNA|ORAI3_ENST00000566237.1_5'Flank|FBXL19_ENST00000562319.1_Missense_Mutation_p.E563G|ORAI3_ENST00000318663.4_5'Flank|FBXL19_ENST00000565690.1_Missense_Mutation_p.E447G|ORAI3_ENST00000562699.1_5'Flank|FBXL19_ENST00000471231.2_Missense_Mutation_p.E271G|FBXL19_ENST00000338343.4_Missense_Mutation_p.E563G	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	583					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						GCAGGTTTGGAGCTGACAGAT	0.667																																					p.E583G		Atlas-SNP	.											.	FBXL19	74	.	0			c.A1748G						PASS	.						33.0	40.0	38.0					16																	30958111		2140	4240	6380	SO:0001583	missense	54620	exon10			GTTTGGAGCTGAC	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.1748A>G	chr16.hg19:g.30958111A>G	ENSP00000369666:p.Glu583Gly	102.0	0.0	.		100.0	4.0	.	NM_001099784	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	hg19	CCDS45465.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.411339	0.42817	.	.	ENSG00000099364	ENST00000338343;ENST00000380310	T;T	0.35421	1.31;1.31	4.76	4.76	0.60689	.	0.135420	0.48286	D	0.000188	T	0.26882	0.0658	N	0.25031	0.7	0.48762	D	0.999706	B;B	0.25390	0.125;0.005	B;B	0.24006	0.05;0.005	T	0.08827	-1.0703	10	0.62326	D	0.03	-16.01	13.2832	0.60228	1.0:0.0:0.0:0.0	.	583;540	Q6PCT2;Q6PCT2-2	FXL19_HUMAN;.	G	563;583	ENSP00000339712:E563G;ENSP00000369666:E583G	ENSP00000339712:E563G	E	+	2	0	FBXL19	30865612	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.381000	0.79718	1.789000	0.52484	0.459000	0.35465	GAG	.	.	.	none		0.667	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_019085	
ITGAX	3687	hgsc.bcm.edu	37	16	31374006	31374006	+	Missense_Mutation	SNP	G	G	C	rs554674355		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr16:31374006G>C	ENST00000268296.4	+	12	1412	c.1291G>C	c.(1291-1293)Ggg>Cgg	p.G431R	ITGAX_ENST00000562522.1_Missense_Mutation_p.G431R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	431					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCAGCACACCGGGAAGGCTGT	0.647																																					p.G431R		Atlas-SNP	.											.	ITGAX	198	.	0			c.G1291C						PASS	.						34.0	33.0	33.0					16																	31374006		2197	4300	6497	SO:0001583	missense	3687	exon12			CACACCGGGAAGG	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1291G>C	chr16.hg19:g.31374006G>C	ENSP00000268296:p.Gly431Arg	371.0	0.0	.		523.0	116.0	.	NM_000887	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	hg19	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	g	18.79	3.698354	0.68386	.	.	ENSG00000140678	ENST00000268296	T	0.54479	0.57	3.76	2.69	0.31865	.	.	.	.	.	T	0.80979	0.4728	H	0.98559	4.265	0.33798	D	0.62635	D	0.89917	1.0	D	0.87578	0.998	D	0.87513	0.2441	9	0.87932	D	0	.	10.1899	0.43019	0.0:0.2038:0.7962:0.0	.	431	P20702	ITAX_HUMAN	R	431	ENSP00000268296:G431R	ENSP00000268296:G431R	G	+	1	0	ITGAX	31281507	0.999000	0.42202	0.997000	0.53966	0.899000	0.52679	3.647000	0.54403	1.829000	0.53265	0.448000	0.29417	GGG	.	.	.	none		0.647	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
PPM1E	22843	hgsc.bcm.edu	37	17	56833454	56833454	+	Silent	SNP	G	G	A	rs77856248		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:56833454G>A	ENST00000308249.2	+	1	225	c.96G>A	c.(94-96)gaG>gaA	p.E32E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			Gcgagccggagccggaacccg	0.667																																					p.E32E		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G96A						PASS	.						14.0	20.0	18.0					17																	56833454		2185	4284	6469	SO:0001819	synonymous_variant	22843	exon1			GCCGGAGCCGGAA	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.96G>A	chr17.hg19:g.56833454G>A		54.0	0.0	.		78.0	14.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.667	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833457	56833457	+	Silent	SNP	G	G	C	rs3834568|rs201186780|rs74256772	byFrequency	TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:56833457G>C	ENST00000308249.2	+	1	228	c.99G>C	c.(97-99)ccG>ccC	p.P33P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			agccggagccggaacccgaac	0.672																																					p.P33P		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G99C						PASS	.						14.0	20.0	18.0					17																	56833457		2188	4284	6472	SO:0001819	synonymous_variant	22843	exon1			GGAGCCGGAACCC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.99G>C	chr17.hg19:g.56833457G>C		50.0	0.0	.		76.0	17.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.672	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833490	56833490	+	Silent	SNP	G	G	A	rs59676153		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:56833490G>A	ENST00000308249.2	+	1	261	c.132G>A	c.(130-132)gaG>gaA	p.E44E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			ccgaacccgagtccgagcccg	0.706																																					p.E44E		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	.	0			c.G132A						PASS	.																																			SO:0001819	synonymous_variant	22843	exon1			ACCCGAGTCCGAG	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.132G>A	chr17.hg19:g.56833490G>A		65.0	0.0	.		97.0	9.0	.	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.	.	weak		0.706	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
ZNF236	7776	hgsc.bcm.edu	37	18	74680294	74680294	+	Nonstop_Mutation	SNP	G	G	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr18:74680294G>T	ENST00000253159.8	+	31	5735	c.5537G>T	c.(5536-5538)tGa>tTa	p.*1846L	ZNF236_ENST00000320610.9_Nonstop_Mutation_p.*1848L	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	0					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CACGTCTTCTGATGCGAGTTG	0.542																																					p.X1846L		Atlas-SNP	.											.	ZNF236	325	.	0			c.G5537T						PASS	.						65.0	76.0	72.0					18																	74680294		1938	4135	6073	SO:0001578	stop_lost	7776	exon31			TCTTCTGATGCGA	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.5537G>T	chr18.hg19:g.74680294G>T	ENSP00000253159:p.*1846Leuext*8	56.0	0.0	.		72.0	4.0	.	NM_007345	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	hg19	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	G	8.724	0.914980	0.17907	.	.	ENSG00000130856	ENST00000253159	.	.	.	4.91	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5206	0.61566	0.0765:0.0:0.9235:0.0	.	.	.	.	L	1846	.	.	X	+	2	2	ZNF236	72809282	1.000000	0.71417	0.888000	0.34837	0.039000	0.13416	5.969000	0.70422	1.207000	0.43291	0.557000	0.71058	TGA	.	.	.	none		0.542	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
DOT1L	84444	hgsc.bcm.edu	37	19	2210830	2210830	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:2210830C>T	ENST00000398665.3	+	14	1363	c.1327C>T	c.(1327-1329)Cag>Tag	p.Q443*	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	443					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCGTGTCTCAGACGGCGGC	0.692																																					p.Q443X		Atlas-SNP	.											.	DOT1L	205	.	0			c.C1327T						PASS	.						26.0	34.0	31.0					19																	2210830		1991	4142	6133	SO:0001587	stop_gained	84444	exon14			GTGTCTCAGACGG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1327C>T	chr19.hg19:g.2210830C>T	ENSP00000381657:p.Gln443*	98.0	0.0	.		151.0	35.0	.	NM_032482	O60379|Q96JL1	Nonsense_Mutation	SNP	ENST00000398665.3	hg19	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878112	0.91664	.	.	ENSG00000104885	ENST00000398665;ENST00000221482	.	.	.	4.84	4.84	0.62591	.	0.625695	0.16263	N	0.222122	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.1526	16.9353	0.86202	0.0:1.0:0.0:0.0	.	.	.	.	X	443	.	ENSP00000221482:Q443X	Q	+	1	0	DOT1L	2161830	0.963000	0.33076	0.020000	0.16555	0.076000	0.17211	4.755000	0.62198	2.222000	0.72286	0.561000	0.74099	CAG	.	.	.	none		0.692	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
HAPLN4	404037	hgsc.bcm.edu	37	19	19371725	19371725	+	Silent	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:19371725G>A	ENST00000291481.7	-	3	444	c.381C>T	c.(379-381)tcC>tcT	p.S127S	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	127	Ig-like C2-type.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	GGAGGACCAGGGAGGCATCCC	0.652																																					p.S127S		Atlas-SNP	.											.	HAPLN4	44	.	0			c.C381T						PASS	.						66.0	61.0	63.0					19																	19371725		2203	4300	6503	SO:0001819	synonymous_variant	404037	exon3			GACCAGGGAGGCA	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.381C>T	chr19.hg19:g.19371725G>A		64.0	0.0	.		50.0	12.0	.	NM_023002	A5PKW5|Q96PW2	Silent	SNP	ENST00000291481.7	hg19	CCDS12398.1																																																																																			.	.	.	none		0.652	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002	
GRAMD1A	57655	hgsc.bcm.edu	37	19	35500151	35500151	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:35500151A>C	ENST00000317991.5	+	2	329	c.137A>C	c.(136-138)gAt>gCt	p.D46A	GRAMD1A_ENST00000424536.2_Missense_Mutation_p.D46A|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.D46A|GRAMD1A_ENST00000599564.1_Missense_Mutation_p.D133A|GRAMD1A_ENST00000504615.2_5'UTR|GRAMD1A_ENST00000598073.1_3'UTR	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	46						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			AAGGGATCAGATAGCTCCTCA	0.647																																					p.D46A		Atlas-SNP	.											.	GRAMD1A	39	.	0			c.A137C						PASS	.						38.0	45.0	43.0					19																	35500151		1939	4128	6067	SO:0001583	missense	57655	exon2			GATCAGATAGCTC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.137A>C	chr19.hg19:g.35500151A>C	ENSP00000441032:p.Asp46Ala	72.0	0.0	.		138.0	22.0	.	NM_020895	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	hg19	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.579681	0.65992	.	.	ENSG00000089351	ENST00000453966;ENST00000317991;ENST00000411896	T;T	0.25250	1.81;1.83	4.67	4.67	0.58626	.	0.081214	0.49916	D	0.000124	T	0.30665	0.0772	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.60160	0.987;0.978;0.987;0.987	P;P;P;P	0.61477	0.889;0.698;0.841;0.889	T	0.05402	-1.0887	10	0.45353	T	0.12	.	12.1081	0.53823	1.0:0.0:0.0:0.0	.	46;46;46;133	Q96CP6-3;Q96CP6;Q96CP6-2;F5GZ02	.;GRM1A_HUMAN;.;.	A	133;46;46	ENSP00000441032:D46A;ENSP00000439267:D46A	ENSP00000441032:D46A	D	+	2	0	GRAMD1A	40191991	1.000000	0.71417	0.569000	0.28460	0.688000	0.40055	4.842000	0.62831	1.965000	0.57142	0.459000	0.35465	GAT	.	.	.	none		0.647	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
ZNF749	388567	hgsc.bcm.edu	37	19	57956504	57956504	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:57956504C>T	ENST00000334181.4	+	3	2238	c.1988C>T	c.(1987-1989)aCt>aTt	p.T663I	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	663					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGAGTTCATACTGGAGAAAAG	0.383																																					p.T663I		Atlas-SNP	.											.	ZNF749	75	.	0			c.C1988T						PASS	.						42.0	44.0	43.0					19																	57956504		2203	4300	6503	SO:0001583	missense	388567	exon3			TTCATACTGGAGA	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.1988C>T	chr19.hg19:g.57956504C>T	ENSP00000333980:p.Thr663Ile	82.0	0.0	.		86.0	4.0	.	NM_001023561		Missense_Mutation	SNP	ENST00000334181.4	hg19	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	C	11.60	1.686234	0.29962	.	.	ENSG00000186230	ENST00000334181	T	0.25749	1.78	2.05	-3.04	0.05412	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17746	0.0426	L	0.46819	1.47	0.22835	N	0.998678	P	0.35959	0.53	B	0.34180	0.177	T	0.15809	-1.0424	9	0.87932	D	0	.	3.6737	0.08284	0.1878:0.558:0.0:0.2541	.	663	O43361	ZN749_HUMAN	I	663	ENSP00000333980:T663I	ENSP00000333980:T663I	T	+	2	0	ZNF749	62648316	0.000000	0.05858	0.000000	0.03702	0.188000	0.23474	-0.145000	0.10265	-0.817000	0.04335	0.313000	0.20887	ACT	.	.	.	none		0.383	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
ZNF418	147686	hgsc.bcm.edu	37	19	58438722	58438722	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr19:58438722T>A	ENST00000396147.1	-	4	1118	c.827A>T	c.(826-828)cAt>cTt	p.H276L	ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000599852.1_Missense_Mutation_p.H191L|ZNF418_ENST00000595830.1_Missense_Mutation_p.H276L|ZNF418_ENST00000425570.3_Missense_Mutation_p.H297L|ZNF418_ENST00000600989.1_Intron	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		AACTCGCTGATGCTGAACAAG	0.433																																					p.H276L		Atlas-SNP	.											.	ZNF418	76	.	0			c.A827T						PASS	.						90.0	92.0	91.0					19																	58438722		2189	4296	6485	SO:0001583	missense	147686	exon4			CGCTGATGCTGAA	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.827A>T	chr19.hg19:g.58438722T>A	ENSP00000379451:p.His276Leu	142.0	0.0	.		172.0	34.0	.	NM_133460	Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	ENST00000396147.1	hg19	CCDS42642.1	.	.	.	.	.	.	.	.	.	.	.	11.49	1.655252	0.29425	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	D;D	0.86865	-2.18;-2.18	2.26	1.15	0.20763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.90147	0.6921	H	0.98295	4.195	0.09310	N	0.999995	P	0.38110	0.618	B	0.33254	0.16	D	0.83866	0.0271	9	0.87932	D	0	.	6.5871	0.22626	0.2146:0.0:0.0:0.7854	.	276	Q8TF45	ZN418_HUMAN	L	276;297;242	ENSP00000379451:H276L;ENSP00000407039:H297L	ENSP00000379451:H276L	H	-	2	0	ZNF418	63130534	.	.	0.001000	0.08648	0.109000	0.19521	.	.	0.129000	0.18514	0.240000	0.17902	CAT	.	.	.	none		0.433	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	NM_133460	
CST9L	128821	hgsc.bcm.edu	37	20	23546696	23546696	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:23546696T>G	ENST00000376979.3	-	2	567	c.269A>C	c.(268-270)gAg>gCg	p.E90A		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	90						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					CAGCAGTAGCTCCATTGAGAA	0.468																																					p.E90A		Atlas-SNP	.											.	CST9L	25	.	0			c.A269C						PASS	.						205.0	177.0	187.0					20																	23546696		2203	4300	6503	SO:0001583	missense	128821	exon2			AGTAGCTCCATTG		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.269A>C	chr20.hg19:g.23546696T>G	ENSP00000366178:p.Glu90Ala	244.0	0.0	.		338.0	67.0	.	NM_080610	B2R5A1	Missense_Mutation	SNP	ENST00000376979.3	hg19	CCDS13157.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.067516	0.36470	.	.	ENSG00000101435	ENST00000376979	T	0.28666	1.6	1.92	1.92	0.25849	Proteinase inhibitor I25, cystatin (2);	0.919888	0.08938	N	0.872000	T	0.44265	0.1285	M	0.75264	2.295	0.09310	N	1	D	0.58970	0.984	P	0.55749	0.783	T	0.23619	-1.0183	10	0.37606	T	0.19	.	5.8418	0.18637	0.0:0.0:0.0:1.0	.	90	Q9H4G1	CST9L_HUMAN	A	90	ENSP00000366178:E90A	ENSP00000366178:E90A	E	-	2	0	CST9L	23494696	0.004000	0.15560	0.108000	0.21378	0.004000	0.04260	0.143000	0.16115	1.118000	0.41863	0.402000	0.26972	GAG	.	.	.	none		0.468	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610	
RBM12	10137	hgsc.bcm.edu	37	20	34240740	34240740	+	Silent	SNP	A	A	G	rs376657170|rs201181145		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:34240740A>G	ENST00000374114.3	-	3	2768	c.2505T>C	c.(2503-2505)ccT>ccC	p.P835P	RBM12_ENST00000374104.3_Silent_p.P835P|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317677.5_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000359646.1_Silent_p.P835P|RP1-309K20.6_ENST00000541176.2_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	835	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GGATTgggccagggccggggc	0.597																																					p.P835P		Atlas-SNP	.											RBM12,rectum,carcinoma,0,2	RBM12	93	.	0			c.T2505C						PASS	.						20.0	22.0	21.0					20																	34240740		2143	4252	6395	SO:0001819	synonymous_variant	10137	exon2			TGGGCCAGGGCCG	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2505T>C	chr20.hg19:g.34240740A>G		27.0	0.0	.		35.0	6.0	.	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	hg19	CCDS13261.1																																																																																			.	.	.	alt		0.597	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
DHX35	60625	hgsc.bcm.edu	37	20	37653978	37653978	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:37653978C>T	ENST00000252011.3	+	18	1810	c.1777C>T	c.(1777-1779)Caa>Taa	p.Q593*	DHX35_ENST00000373323.4_Nonsense_Mutation_p.Q562*|DHX35_ENST00000373325.2_Nonsense_Mutation_p.Q593*	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	593					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TGTCAAGTTTCAAGTGCCCAG	0.443																																					p.Q593X		Atlas-SNP	.											.	DHX35	82	.	0			c.C1777T						PASS	.						176.0	185.0	182.0					20																	37653978		2203	4300	6503	SO:0001587	stop_gained	60625	exon18			AAGTTTCAAGTGC	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1777C>T	chr20.hg19:g.37653978C>T	ENSP00000252011:p.Gln593*	186.0	0.0	.		222.0	42.0	.	NM_021931	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Nonsense_Mutation	SNP	ENST00000252011.3	hg19	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	C	38	6.967926	0.97971	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000373321;ENST00000449559	.	.	.	5.41	4.4	0.53042	.	0.097447	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4304	0.44405	0.3784:0.6216:0.0:0.0	.	.	.	.	X	593;593;562;73;57	.	ENSP00000252011:Q593X	Q	+	1	0	DHX35	37087392	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.037000	0.64170	2.530000	0.85305	0.655000	0.94253	CAA	.	.	.	none		0.443	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
SLC9A8	23315	hgsc.bcm.edu	37	20	48431566	48431566	+	Silent	SNP	T	T	C	rs536021956		TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr20:48431566T>C	ENST00000361573.2	+	2	90	c.48T>C	c.(46-48)caT>caC	p.H16H	SLC9A8_ENST00000417961.1_Silent_p.H16H|SLC9A8_ENST00000539601.1_5'UTR|SLC9A8_ENST00000541138.1_5'UTR			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	16					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			ATACAACTCATGAGGGTTTCA	0.522																																					p.H16H		Atlas-SNP	.											.	SLC9A8	63	.	0			c.T48C						PASS	.						90.0	78.0	82.0					20																	48431566		2203	4300	6503	SO:0001819	synonymous_variant	23315	exon2			AACTCATGAGGGT	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.48T>C	chr20.hg19:g.48431566T>C		127.0	0.0	.		184.0	45.0	.	NM_001260491	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Silent	SNP	ENST00000361573.2	hg19	CCDS13421.1																																																																																			.	.	.	none		0.522	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	
MYO18B	84700	hgsc.bcm.edu	37	22	26422672	26422672	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:26422672C>T	ENST00000407587.2	+	43	6904	c.6735C>T	c.(6733-6735)ccC>ccT	p.P2245P	MYO18B_ENST00000335473.7_Silent_p.P2244P|MYO18B_ENST00000536101.1_Silent_p.P2244P			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2244						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AAAAGCTGCCCAGTCCTTCAG	0.607																																					p.P2244P		Atlas-SNP	.											.	MYO18B	322	.	0			c.C6732T						PASS	.						24.0	25.0	25.0					22																	26422672		1910	4104	6014	SO:0001819	synonymous_variant	84700	exon43			GCTGCCCAGTCCT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6735C>T	chr22.hg19:g.26422672C>T		128.0	0.0	.		159.0	30.0	.	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	10.77	1.444427	0.25987	.	.	ENSG00000133454	ENST00000543971	T	0.55234	0.53	4.94	-4.84	0.03151	.	0.116110	0.34002	N	0.004359	T	0.50394	0.1613	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53315	-0.8456	7	0.72032	D	0.01	.	5.3684	0.16127	0.2432:0.2637:0.4198:0.0733	.	.	.	.	L	194	ENSP00000444262:P194L	ENSP00000444262:P194L	P	+	2	0	MYO18B	24752672	0.013000	0.17824	0.962000	0.40283	0.992000	0.81027	-1.785000	0.01767	-0.418000	0.07450	0.491000	0.48974	CCA	.	.	.	none		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
BAIAP2L2	80115	hgsc.bcm.edu	37	22	38483172	38483172	+	Silent	SNP	G	G	T	rs539447143	byFrequency	TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:38483172G>T	ENST00000381669.3	-	11	1362	c.1218C>A	c.(1216-1218)tcC>tcA	p.S406S	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	406					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					gtgtcatgggggacatggagg	0.662													G|||	30	0.00599042	0.0068	0.0014	5008	,	,		13061	0.0		0.004	False		,,,				2504	0.0164				p.S406S		Atlas-SNP	.											.	BAIAP2L2	39	.	0			c.C1218A						PASS	.						31.0	37.0	35.0					22																	38483172		1925	4122	6047	SO:0001819	synonymous_variant	80115	exon11			CATGGGGGACATG	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1218C>A	chr22.hg19:g.38483172G>T		103.0	0.0	.		146.0	17.0	.	NM_025045	B0QYE2|Q96BG7	Silent	SNP	ENST00000381669.3	hg19	CCDS43018.1																																																																																			.	.	.	none		0.662	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
SMC1B	27127	hgsc.bcm.edu	37	22	45785629	45785629	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:45785629G>C	ENST00000357450.4	-	10	1693	c.1694C>G	c.(1693-1695)gCt>gGt	p.A565G	SMC1B_ENST00000404354.3_Missense_Mutation_p.A565G	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	565	Flexible hinge.				meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CTCAGGTTCAGCTCTTTCCTC	0.383																																					p.A565G		Atlas-SNP	.											.	SMC1B	215	.	0			c.C1694G						PASS	.						150.0	138.0	141.0					22																	45785629		1873	4115	5988	SO:0001583	missense	27127	exon10			GGTTCAGCTCTTT	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.1694C>G	chr22.hg19:g.45785629G>C	ENSP00000350036:p.Ala565Gly	155.0	0.0	.		169.0	36.0	.	NM_148674	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	hg19	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.742185	0.30865	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	D;D	0.86297	-2.1;-2.1	5.49	5.49	0.81192	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.108364	0.40728	N	0.001024	D	0.86674	0.5989	L	0.52759	1.655	0.58432	D	0.999991	B;B;B	0.24533	0.105;0.04;0.04	B;B;B	0.32289	0.143;0.037;0.037	T	0.82969	-0.0193	10	0.44086	T	0.13	.	19.3758	0.94508	0.0:0.0:1.0:0.0	.	565;565;565	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	G	565	ENSP00000350036:A565G;ENSP00000385902:A565G	ENSP00000350036:A565G	A	-	2	0	SMC1B	44164293	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.695000	0.61767	2.577000	0.86979	0.655000	0.94253	GCT	.	.	.	none		0.383	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
SHANK3	85358	hgsc.bcm.edu	37	22	51159826	51159826	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr22:51159826G>A	ENST00000414786.2	+	21	3750	c.3523G>A	c.(3523-3525)Gag>Aag	p.E1175K	SHANK3_ENST00000262795.3_Missense_Mutation_p.E1205K|SHANK3_ENST00000445220.2_Missense_Mutation_p.E1191K			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1189					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		GAAGTCACCCGAGGACAAGAA	0.662																																					p.E1175K		Atlas-SNP	.											.	SHANK3	96	.	0			c.G3523A						PASS	.						39.0	48.0	45.0					22																	51159826		2100	4200	6300	SO:0001583	missense	85358	exon21			TCACCCGAGGACA	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.3523G>A	chr22.hg19:g.51159826G>A	ENSP00000464552:p.Glu1175Lys	177.0	0.0	.		213.0	39.0	.	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	hg19		.	.	.	.	.	.	.	.	.	.	G	15.47	2.843265	0.51057	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.26373	1.74;1.74	4.58	4.58	0.56647	.	0.163605	0.51477	D	0.000081	T	0.25827	0.0629	M	0.70275	2.135	0.29353	N	0.865219	D;P;P	0.53462	0.96;0.492;0.921	B;B;B	0.34489	0.184;0.024;0.163	T	0.43556	-0.9384	10	0.56958	D	0.05	.	14.8583	0.70359	0.0:0.0:1.0:0.0	.	1189;1190;1205	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	K	1205;1191	ENSP00000442518:E1205K;ENSP00000446078:E1191K	ENSP00000442518:E1205K	E	+	1	0	SHANK3	49506692	1.000000	0.71417	0.875000	0.34327	0.943000	0.58893	8.323000	0.90002	2.093000	0.63338	0.462000	0.41574	GAG	.	.	.	none		0.662	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
BMP15	9210	hgsc.bcm.edu	37	X	50658965	50658965	+	Silent	SNP	C	C	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chrX:50658965C>T	ENST00000252677.3	+	2	537	c.537C>T	c.(535-537)aaC>aaT	p.N179N		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	179					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					TGATGTCTAACGCTTGGAAAG	0.473																																					p.N179N		Atlas-SNP	.											.	BMP15	62	.	0			c.C537T						PASS	.						116.0	94.0	101.0					X																	50658965		2203	4299	6502	SO:0001819	synonymous_variant	9210	exon2			GTCTAACGCTTGG	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.537C>T	chrX.hg19:g.50658965C>T		184.0	0.0	.		217.0	78.0	.	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Silent	SNP	ENST00000252677.3	hg19	CCDS14334.1																																																																																			.	.	.	none		0.473	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
ZCCHC5	203430	hgsc.bcm.edu	37	X	77913359	77913359	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chrX:77913359G>A	ENST00000321110.1	-	2	854	c.559C>T	c.(559-561)Cct>Tct	p.P187S		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	187	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TCCTGGGGAGGTGGAAGCTCA	0.537																																					p.P187S		Atlas-SNP	.											.	ZCCHC5	101	.	0			c.C559T						PASS	.						41.0	41.0	41.0					X																	77913359		2203	4300	6503	SO:0001583	missense	203430	exon2			GGGGAGGTGGAAG	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.559C>T	chrX.hg19:g.77913359G>A	ENSP00000316794:p.Pro187Ser	15.0	0.0	.		47.0	18.0	.	NM_152694	B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	hg19	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.432832	0.01108	.	.	ENSG00000179300	ENST00000321110	T	0.17691	2.26	3.46	-5.74	0.02391	.	.	.	.	.	T	0.05547	0.0146	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40289	-0.9571	9	0.07175	T	0.84	.	1.35	0.02171	0.2436:0.2501:0.329:0.1772	.	187	Q8N8U3	ZCHC5_HUMAN	S	187	ENSP00000316794:P187S	ENSP00000316794:P187S	P	-	1	0	ZCCHC5	77800015	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.423000	0.01030	-1.795000	0.01255	-3.016000	0.00074	CCT	.	.	.	none		0.537	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
MT-ND5	4540	hgsc.bcm.edu	37	M	12957	12957	+	Silent	SNP	T	T	C			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chrM:12957T>C	ENST00000361567.2	+	1	621	c.621T>C	c.(619-621)aaT>aaC	p.N207N	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	207					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTAAACGCTAATCCAAGCCTC	0.522																																					p.N207N		Atlas-SNP	.											.	.	.	.	0			c.T621C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CGCTAATCCAAGC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.621T>C	chrM.hg19:g.12957T>C		19.0	0.0	.		39.0	30.0	.	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.522	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
YEATS2	55689	hgsc.bcm.edu	37	3	183476664	183476664	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:183476664delA	ENST00000305135.5	+	13	1762	c.1567delA	c.(1567-1569)aagfs	p.K523fs		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	523					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCCTACAAACAAGATCTCCAC	0.373																																					p.N522fs		Atlas-Indel,Pindel	.											.	YEATS2	111	.	0			c.1566delC						PASS	.						138.0	126.0	129.0					3																	183476664		1834	4080	5914	SO:0001589	frameshift_variant	55689	exon13			.	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1567delA	chr3.hg19:g.183476664delA	ENSP00000306983:p.Lys523fs	339.0	0.0	0		383.0	55.0	0.143603	NM_018023	A7E2B9|D3DNS9|Q641P6|Q9NW96	Frame_Shift_Del	DEL	ENST00000305135.5	hg19	CCDS43175.1																																																																																			.	.	.	none		0.373	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
MAML2	84441	hgsc.bcm.edu	37	11	95712439	95712440	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:95712439_95712440insT	ENST00000524717.1	-	5	4427_4428	c.3143_3144insA	c.(3142-3144)aatfs	p.N1048fs		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	1048					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TGGGTCTGAGATTCAGACCCCT	0.5			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.N1048fs		Atlas-Indel,Pindel	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2	94	.	0			c.3144_3145insA						PASS	.																																			SO:0001589	frameshift_variant	84441	exon5			.	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.3144dupA	chr11.hg19:g.95712441_95712441dupT	ENSP00000434552:p.Asn1048fs	154.0	0.0	0		214.0	49.0	0.228972	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Frame_Shift_Ins	INS	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.	.	none		0.500	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
CACNA1D	776	hgsc.bcm.edu	37	3	53844325	53844325	+	Splice_Site	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr3:53844325delA	ENST00000350061.5	+	47	6703	c.6192delA	c.(6190-6192)gca>gc	p.A2064fs	CACNA1D_ENST00000288139.4_Splice_Site_p.A2084fs|CACNA1D_ENST00000544977.1_3'UTR|CACNA1D_ENST00000422281.2_Splice_Site_p.A2040fs	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	2064					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGTGGAGGCAGTGAGTACGG	0.612																																					p.A2084fs		Atlas-Indel,Pindel	.											.	CACNA1D	324	.	0			c.6251delC						PASS	.						53.0	60.0	57.0					3																	53844325		2203	4300	6503	SO:0001630	splice_region_variant	776	exon48			.	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.6192+1A>-	chr3.hg19:g.53844325delA		376.0	0.0	0		472.0	86.0	0.182203	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Frame_Shift_Del	DEL	ENST00000350061.5	hg19	CCDS46848.1																																																																																			.	.	.	none		0.612	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	Frame_Shift_Del
SAV1	60485	hgsc.bcm.edu	37	14	51132105	51132106	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr14:51132105_51132106delCT	ENST00000324679.4	-	2	689_690	c.326_327delAG	c.(325-327)gagfs	p.E109fs	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	109					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					AAGAACCATACTCTCTAGGGAC	0.376																																					p.109_110del		Atlas-Indel,Pindel	.											.	SAV1	18	.	0			c.327_328del						PASS	.																																			SO:0001589	frameshift_variant	60485	exon2			.	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.326_327delAG	chr14.hg19:g.51132109_51132110delCT	ENSP00000324729:p.Glu109fs	725.0	0.0	0		757.0	161.0	0.212682	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Frame_Shift_Del	DEL	ENST00000324679.4	hg19	CCDS9701.1																																																																																			.	.	.	none		0.376	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
RNF213	57674	hgsc.bcm.edu	37	17	78350139	78350141	+	In_Frame_Del	DEL	GAT	GAT	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:78350139_78350141delGAT	ENST00000582970.1	+	52	13367_13369	c.13224_13226delGAT	c.(13222-13227)aagatc>aac	p.4408_4409KI>N	RNF213_ENST00000508628.2_In_Frame_Del_p.4457_4458KI>N|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000336301.6_In_Frame_Del_p.2481_2482KI>N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4408					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCGAATGCAAGATCCTTTCACCT	0.433																																					p.4408_4409del		Atlas-Indel,Pindel	.											.	RNF213	766	.	0			c.13223_13225del						PASS	.																																			SO:0001651	inframe_deletion	57674	exon52			.	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13224_13226delGAT	chr17.hg19:g.78350139_78350141delGAT	ENSP00000464087:p.Lys4408_Ile4409delinsAsn	159.0	0.0	0		253.0	32.0	0.126482	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	In_Frame_Del	DEL	ENST00000582970.1	hg19	CCDS58606.1																																																																																			.	.	.	none		0.433	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RBMXL1	494115	hgsc.bcm.edu	37	1	89449426	89449426	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:89449426delA	ENST00000321792.5	-	2	511	c.84delT	c.(82-84)tttfs	p.F28fs	CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000413769.1_5'UTR|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000260508.4_Intron|RBMXL1_ENST00000399794.2_Frame_Shift_Del_p.F28fs|CCBL2_ENST00000370491.3_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	28	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CATATTTGCCAAATACTGTTT	0.413											OREG0013593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G29fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.85delG						PASS	.						191.0	187.0	188.0					1																	89449426		2203	4300	6503	SO:0001589	frameshift_variant	494115	exon2			.	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.84delT	chr1.hg19:g.89449426delA	ENSP00000318415:p.Phe28fs	522.0	0.0	0	1267	503.0	53.0	0.105368	NM_019610		Frame_Shift_Del	DEL	ENST00000321792.5	hg19	CCDS716.1																																																																																			.	.	.	none		0.413	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
GHDC	84514	hgsc.bcm.edu	37	17	40344519	40344519	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:40344519delA	ENST00000301671.8	-	4	1070	c.629delT	c.(628-630)ttcfs	p.F210fs	GHDC_ENST00000414034.3_Frame_Shift_Del_p.F210fs|GHDC_ENST00000428494.2_Frame_Shift_Del_p.F171fs|GHDC_ENST00000436923.2_Frame_Shift_Del_p.F210fs|GHDC_ENST00000593209.1_Frame_Shift_Del_p.F210fs|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000587427.1_Frame_Shift_Del_p.F210fs			Q8N2G8	GHDC_HUMAN	GH3 domain containing	210						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CAGGCCCAAGAAAACATCCAG	0.652																																					p.F210fs		Atlas-Indel,Pindel	.											.	GHDC	63	.	0			c.630delC						PASS	.						82.0	94.0	89.0					17																	40344519		2202	4298	6500	SO:0001589	frameshift_variant	84514	exon5			.	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.629delT	chr17.hg19:g.40344519delA	ENSP00000301671:p.Phe210fs	132.0	0.0	0		194.0	19.0	0.0979381	NM_032484	B4DQS4|E9PDB5|Q9BXM6	Frame_Shift_Del	DEL	ENST00000301671.8	hg19	CCDS11422.1																																																																																			.	.	.	none		0.652	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
IQGAP3	128239	hgsc.bcm.edu	37	1	156517916	156517917	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr1:156517916_156517917delAG	ENST00000361170.2	-	19	2262_2263	c.2252_2253delCT	c.(2251-2253)gctfs	p.A751fs		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	751	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGAATGCTCAGCAAACTTCTG	0.579																																					p.751_752del		Atlas-Indel,Pindel	.											.	IQGAP3	146	.	0			c.2253_2254del						PASS	.																																			SO:0001589	frameshift_variant	128239	exon19			.	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2252_2253delCT	chr1.hg19:g.156517916_156517917delAG	ENSP00000354451:p.Ala751fs	101.0	0.0	0		131.0	33.0	0.251908	NM_178229	Q5T3H8	Frame_Shift_Del	DEL	ENST00000361170.2	hg19	CCDS1144.1																																																																																			.	.	.	none		0.579	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
CNGA1	1259	hgsc.bcm.edu	37	4	47938977	47938977	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr4:47938977delT	ENST00000514170.1	-	11	1853	c.1534delA	c.(1534-1536)atcfs	p.I512fs	CNGA1_ENST00000544810.1_Frame_Shift_Del_p.I512fs|CNGA1_ENST00000402813.3_Frame_Shift_Del_p.I581fs|CNGA1_ENST00000358519.4_Frame_Shift_Del_p.I512fs|CNGA1_ENST00000420489.2_Frame_Shift_Del_p.I512fs			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	512					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						TCTCGTCCGATATCCCCTTTC	0.463																																					p.I581fs		Atlas-Indel,Pindel	.											.	CNGA1	74	.	0			c.1742delT						PASS	.						111.0	112.0	111.0					4																	47938977		2138	4277	6415	SO:0001589	frameshift_variant	1259	exon10			.	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1534delA	chr4.hg19:g.47938977delT	ENSP00000426862:p.Ile512fs	189.0	0.0	0		176.0	29.0	0.164773	NM_001142564	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Frame_Shift_Del	DEL	ENST00000514170.1	hg19	CCDS43226.1																																																																																			.	.	.	none		0.463	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087	
CCDC112	153733	hgsc.bcm.edu	37	5	114603580	114603581	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr5:114603580_114603581insTT	ENST00000512261.1	-	11	1749_1750	c.1333_1334insAA	c.(1333-1335)agafs	p.R445fs	CCDC112_ENST00000379611.5_Frame_Shift_Ins_p.R528fs|CCDC112_ENST00000506442.1_Frame_Shift_Ins_p.R413fs|CCDC112_ENST00000395557.4_Frame_Shift_Ins_p.R445fs			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	445										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		ATCTCATACTCTTCTCTGTATT	0.327																																					p.R528fs		Atlas-Indel,Pindel	.											.	CCDC112	55	.	0			c.1583_1584insAA						PASS	.																																			SO:0001589	frameshift_variant	153733	exon10			.	BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.1332_1333dupAA	chr5.hg19:g.114603581_114603582dupTT	ENSP00000423712:p.Arg445fs	238.0	0.0	0		238.0	31.0	0.130252	NM_001040440	Q6A334	Frame_Shift_Ins	INS	ENST00000512261.1	hg19	CCDS4117.1																																																																																			.	.	.	none		0.327	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370999.1	NM_152549	
DNHD1	144132	hgsc.bcm.edu	37	11	6561201	6561201	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr11:6561201delC	ENST00000527990.2	+	16	3516	c.3516delC	c.(3514-3516)ttcfs	p.F1172fs	DNHD1_ENST00000254579.6_Frame_Shift_Del_p.F1172fs			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1172					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TGCTCAACTTCATCCTGCATG	0.582																																					p.F1172fs		Atlas-Indel,Pindel	.											.	DNHD1	198	.	0			c.3515delT						PASS	.						62.0	66.0	65.0					11																	6561201		692	1591	2283	SO:0001589	frameshift_variant	144132	exon18			.	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.3516delC	chr11.hg19:g.6561201delC	ENSP00000436180:p.Phe1172fs	170.0	0.0	0		219.0	19.0	0.086758	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Frame_Shift_Del	DEL	ENST00000527990.2	hg19	CCDS44532.1																																																																																			.	.	.	none		0.582	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
MMD	23531	hgsc.bcm.edu	37	17	53485137	53485138	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr17:53485137_53485138insAG	ENST00000262065.3	-	4	609_610	c.313_314insCT	c.(313-315)tatfs	p.Y105fs		NM_012329.2	NP_036461.2	Q15546	PAQRB_HUMAN	monocyte to macrophage differentiation-associated	105					cytolysis (GO:0019835)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						AATGAAGAAATAGATAACCATT	0.386																																					p.Y105fs		Atlas-Indel,Pindel	.											.	MMD	26	.	0			c.314_315insCT						PASS	.																																			SO:0001589	frameshift_variant	23531	exon4			.	X85750	CCDS11586.1	17q	2008-05-02				ENSG00000108960			7153	protein-coding gene	gene with protein product		604467				7503749, 16044242	Standard	NM_012329		Approved	MMA, PAQR11	uc002iui.3	Q15546		ENST00000262065.3:c.312_313dupCT	chr17.hg19:g.53485138_53485139dupAG	ENSP00000262065:p.Tyr105fs	114.0	0.0	0		115.0	31.0	0.269565	NM_012329	B2R6X9|D3DTY6|Q8TAN7	Frame_Shift_Ins	INS	ENST00000262065.3	hg19	CCDS11586.1																																																																																			.	.	.	none		0.386	MMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439214.1		
NPTX2	4885	hgsc.bcm.edu	37	7	98257767	98257767	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NK-01A-11D-A26P-10	TCGA-HE-A5NK-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	73f57b92-a6e6-4472-940b-579c22d208bf	254baf21-7011-4eb9-84cf-45364c96ccb7	g.chr7:98257767delC	ENST00000265634.3	+	5	1287	c.1122delC	c.(1120-1122)agcfs	p.S374fs		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	374	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GGGAGCTCAGCCAGTTCAACA	0.567																																					p.S374fs		Pindel	.											.	NPTX2	45	.	0			c.1121delG						PASS	.						89.0	70.0	76.0					7																	98257767		2203	4300	6503	SO:0001589	frameshift_variant	4885	exon5			.		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1122delC	chr7.hg19:g.98257767delC	ENSP00000265634:p.Ser374fs	170.0	0.0	.		250.0	30.0	0.120	NM_002523	A4D267|Q86XV7|Q96G70	Frame_Shift_Del	DEL	ENST00000265634.3	hg19	CCDS5657.1																																																																																			.	.	.	none		0.567	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
