#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRDM16	63976	hgsc.bcm.edu	37	1	3322089	3322089	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:3322089C>A	ENST00000270722.5	+	8	1112	c.1063C>A	c.(1063-1065)Cac>Aac	p.H355N	PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.H355N|PRDM16_ENST00000442529.2_Missense_Mutation_p.H355N|PRDM16_ENST00000511072.1_Missense_Mutation_p.H356N|PRDM16_ENST00000514189.1_Missense_Mutation_p.H356N|PRDM16_ENST00000441472.2_Missense_Mutation_p.H355N|PRDM16_ENST00000378398.3_Missense_Mutation_p.H356N			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	355					brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CCTTCAGCGGCACATCCGCTC	0.687			T	EVI1	"""MDS, AML"""																																p.H355N		Atlas-SNP	.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16	147	.	0			c.C1063A						PASS	.						35.0	40.0	38.0					1																	3322089		2201	4297	6498	SO:0001583	missense	63976	exon8			CAGCGGCACATCC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1063C>A	chr1.hg19:g.3322089C>A	ENSP00000270722:p.His355Asn	87.0	0.0	.		75.0	19.0	.	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	hg19	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	C	33	5.250276	0.95305	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	D;D;D;D;D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2;-10.2;-10.2;-10.2;-10.2	4.56	4.56	0.56223	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	U	0.000138	D	0.99981	0.9994	H	0.96916	3.905	0.58432	D	0.999998	D;D;D;D	0.76494	0.997;0.992;0.997;0.999	D;P;D;D	0.73380	0.948;0.843;0.956;0.98	D	0.97889	1.0296	10	0.87932	D	0	.	17.307	0.87198	0.0:1.0:0.0:0.0	.	355;355;355;355	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	N	356;356;355;355;355;356;355;171;171;164	ENSP00000426975:H356N;ENSP00000367651:H356N;ENSP00000407968:H355N;ENSP00000405253:H355N;ENSP00000367643:H355N;ENSP00000421400:H356N;ENSP00000270722:H355N;ENSP00000422504:H171N;ENSP00000425796:H164N	ENSP00000270722:H355N	H	+	1	0	PRDM16	3311949	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.677000	0.84024	2.066000	0.61787	0.491000	0.48974	CAC	.	.	.	none		0.687	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
TNFRSF8	943	hgsc.bcm.edu	37	1	12169703	12169703	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:12169703G>C	ENST00000263932.2	+	5	724	c.502G>C	c.(502-504)Gaa>Caa	p.E168Q	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.E57Q	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	168					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	GAACTGCAAGGAACCCTCCAG	0.647																																					p.E168Q		Atlas-SNP	.											.	TNFRSF8	70	.	0			c.G502C						PASS	.						49.0	51.0	50.0					1																	12169703		2203	4300	6503	SO:0001583	missense	943	exon5			TGCAAGGAACCCT	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.502G>C	chr1.hg19:g.12169703G>C	ENSP00000263932:p.Glu168Gln	74.0	0.0	.		51.0	13.0	.	NM_001243	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	ENST00000263932.2	hg19	CCDS144.1	.	.	.	.	.	.	.	.	.	.	.	5.361	0.251949	0.10185	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	T;T	0.06528	3.29;3.29	3.86	-4.19	0.03835	.	3.622260	0.00732	N	0.000951	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B;B	0.13594	0.008;0.004	B;B	0.14578	0.011;0.003	T	0.35748	-0.9776	10	0.12766	T	0.61	-0.0897	1.4258	0.02323	0.4681:0.1472:0.2362:0.1485	.	57;168	D3YTD8;P28908	.;TNR8_HUMAN	Q	168;57	ENSP00000263932:E168Q;ENSP00000390650:E57Q	ENSP00000263932:E168Q	E	+	1	0	TNFRSF8	12092290	0.000000	0.05858	0.000000	0.03702	0.236000	0.25371	0.010000	0.13242	-0.870000	0.04047	-0.244000	0.11960	GAA	.	.	.	none		0.647	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
ARID1A	8289	hgsc.bcm.edu	37	1	27056261	27056261	+	Silent	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:27056261G>T	ENST00000324856.7	+	2	1628	c.1257G>T	c.(1255-1257)ggG>ggT	p.G419G	ARID1A_ENST00000374152.2_Silent_p.G36G|ARID1A_ENST00000457599.2_Silent_p.G419G	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	419					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGTACCCAGGGCAGCCATACG	0.622			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.G419G		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.G1257T						PASS	.						57.0	61.0	59.0					1																	27056261		2203	4300	6503	SO:0001819	synonymous_variant	8289	exon2			CCCAGGGCAGCCA	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1257G>T	chr1.hg19:g.27056261G>T		246.0	0.0	.		240.0	63.0	.	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.	.	none		0.622	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
DAB1	1600	hgsc.bcm.edu	37	1	57610985	57610985	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:57610985T>C	ENST00000371231.1	-	2	219	c.185A>G	c.(184-186)cAa>cGa	p.Q62R	DAB1_ENST00000420954.2_Missense_Mutation_p.Q62R|DAB1_ENST00000371230.1_Missense_Mutation_p.Q62R|DAB1_ENST00000439789.2_Missense_Mutation_p.Q62R|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371236.2_Missense_Mutation_p.Q62R|DAB1_ENST00000371234.4_Missense_Mutation_p.Q62R|DAB1_ENST00000414851.2_Missense_Mutation_p.Q62R			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	62	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CATGGAATCTTGACATAACTT	0.393																																					p.Q62R		Atlas-SNP	.											.	DAB1	129	.	0			c.A185G						PASS	.						146.0	128.0	134.0					1																	57610985		2203	4300	6503	SO:0001583	missense	1600	exon5			GAATCTTGACATA	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.185A>G	chr1.hg19:g.57610985T>C	ENSP00000360275:p.Gln62Arg	136.0	0.0	.		106.0	27.0	.	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	hg19		.	.	.	.	.	.	.	.	.	.	T	29.1	4.976972	0.92982	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231;ENST00000371232;ENST00000332102;ENST00000371230	T;T;T;T;T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15	5.49	5.49	0.81192	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.38825	0.1055	L	0.39514	1.22	0.46356	D	0.999002	D;D;D;P;D	0.76494	0.999;0.996;0.992;0.768;0.992	D;D;D;P;D	0.85130	0.997;0.991;0.984;0.806;0.989	T	0.15925	-1.0420	10	0.66056	D	0.02	-28.791	15.5959	0.76578	0.0:0.0:0.0:1.0	.	62;62;62;62;62	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	R	62	ENSP00000360280:Q62R;ENSP00000360278:Q62R;ENSP00000395296:Q62R;ENSP00000387581:Q62R;ENSP00000409328:Q62R;ENSP00000360275:Q62R;ENSP00000360276:Q62R;ENSP00000329120:Q62R;ENSP00000360274:Q62R	ENSP00000329120:Q62R	Q	-	2	0	DAB1	57383573	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.036000	0.88901	2.079000	0.62486	0.533000	0.62120	CAA	.	.	.	none		0.393	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
SYCP1	6847	hgsc.bcm.edu	37	1	115428830	115428830	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:115428830G>C	ENST00000369522.3	+	14	1330	c.1090G>C	c.(1090-1092)Gaa>Caa	p.E364Q	SYCP1_ENST00000369518.1_Missense_Mutation_p.E364Q	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	364					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AACTCAAATGGAAGAATCTAA	0.338																																					p.E364Q		Atlas-SNP	.											SYCP1,NS,malignant_melanoma,0,2	SYCP1	149	.	0			c.G1090C						PASS	.						79.0	86.0	84.0					1																	115428830		2203	4300	6503	SO:0001583	missense	6847	exon14			CAAATGGAAGAAT	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1090G>C	chr1.hg19:g.115428830G>C	ENSP00000358535:p.Glu364Gln	112.0	0.0	.		121.0	34.0	.	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	hg19	CCDS879.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497246	0.64186	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.56611	0.45;0.45;0.45	5.83	5.83	0.93111	.	0.110634	0.64402	D	0.000012	T	0.64057	0.2564	M	0.72894	2.215	0.41456	D	0.988014	D;D	0.69078	0.997;0.997	D;D	0.65323	0.934;0.934	T	0.65319	-0.6197	10	0.54805	T	0.06	-7.2709	15.6081	0.76689	0.0:0.0:1.0:0.0	.	364;364	B7ZLS9;Q15431	.;SYCP1_HUMAN	Q	364	ENSP00000358535:E364Q;ENSP00000410011:E364Q;ENSP00000358531:E364Q	ENSP00000358531:E364Q	E	+	1	0	SYCP1	115230353	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	4.056000	0.57448	2.746000	0.94184	0.561000	0.74099	GAA	.	.	.	none		0.338	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
C1orf110	339512	hgsc.bcm.edu	37	1	162825494	162825494	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:162825494C>G	ENST00000367910.1	-	3	362	c.242G>C	c.(241-243)aGa>aCa	p.R81T	C1orf110_ENST00000367912.2_Missense_Mutation_p.R80T|C1orf110_ENST00000367911.2_Missense_Mutation_p.R76T|C1orf110_ENST00000524691.1_5'UTR	NM_178550.4	NP_848645.3	Q86UF4	CA110_HUMAN	chromosome 1 open reading frame 110	81										endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	12						ATCTTCTGGTCTCTTCTGAAA	0.413																																					p.R81T		Atlas-SNP	.											.	C1orf110	22	.	0			c.G242C						PASS	.						121.0	110.0	114.0					1																	162825494		1883	4108	5991	SO:0001583	missense	339512	exon3			TCTGGTCTCTTCT	BC040018	CCDS44269.1	1q23.3	2012-06-26			ENSG00000185860	ENSG00000185860			28736	protein-coding gene	gene with protein product						12477932	Standard	NM_178550		Approved	MGC48998	uc001gck.2	Q86UF4	OTTHUMG00000034421	ENST00000367910.1:c.242G>C	chr1.hg19:g.162825494C>G	ENSP00000356886:p.Arg81Thr	224.0	0.0	.		220.0	52.0	.	NM_178550	Q5JSG1|Q6ZW57	Missense_Mutation	SNP	ENST00000367910.1	hg19	CCDS44269.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760276	0.49468	.	.	ENSG00000185860	ENST00000367912;ENST00000367911;ENST00000367910	.	.	.	4.33	1.45	0.22620	.	0.482216	0.19466	N	0.113574	T	0.43964	0.1271	M	0.67953	2.075	0.32586	N	0.527883	D;D	0.63046	0.992;0.992	P;P	0.60541	0.876;0.876	T	0.42816	-0.9429	8	0.87932	D	0	-7.4143	5.7335	0.18053	0.0:0.6659:0.0:0.3341	.	80;81	Q86UF4-2;Q86UF4	.;CA110_HUMAN	T	80;76;81	.	ENSP00000356886:R81T	R	-	2	0	C1orf110	161092118	0.112000	0.22096	0.077000	0.20336	0.980000	0.70556	-0.042000	0.12063	0.559000	0.29153	0.655000	0.94253	AGA	.	.	.	none		0.413	C1orf110-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083211.2	NM_178550	
TROVE2	6738	hgsc.bcm.edu	37	1	193038376	193038376	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:193038376G>T	ENST00000367446.3	+	2	402	c.192G>T	c.(190-192)ttG>ttT	p.L64F	TROVE2_ENST00000367444.3_Missense_Mutation_p.L64F|TROVE2_ENST00000432079.1_Intron|TROVE2_ENST00000400968.2_Missense_Mutation_p.L64F|TROVE2_ENST00000460715.2_Intron|TROVE2_ENST00000416058.2_5'UTR|TROVE2_ENST00000367445.3_Missense_Mutation_p.L64F|TROVE2_ENST00000367443.1_Missense_Mutation_p.L64F|TROVE2_ENST00000367441.1_Missense_Mutation_p.L64F	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	64	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)	p.L64F(1)		biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						TAATTAGATTGATTGAAGATG	0.398																																					p.L64F		Atlas-SNP	.											TROVE2,NS,carcinoma,0,1	TROVE2	50	.	1	Substitution - Missense(1)	lung(1)	c.G192T						PASS	.						64.0	59.0	61.0					1																	193038376		1881	4119	6000	SO:0001583	missense	6738	exon2			TAGATTGATTGAA	BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.192G>T	chr1.hg19:g.193038376G>T	ENSP00000356416:p.Leu64Phe	136.0	0.0	.		141.0	21.0	.	NM_004600	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	ENST00000367446.3	hg19	CCDS1379.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525859	0.64860	.	.	ENSG00000116747	ENST00000400968;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441;ENST00000512587	T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.6	5.6	0.85130	TROVE (2);	0.075418	0.53938	D	0.000050	T	0.39759	0.1090	M	0.75447	2.3	0.80722	D	1	D;D;D;D	0.89917	0.978;0.992;1.0;1.0	D;D;D;D	0.77557	0.941;0.941;0.99;0.99	T	0.11792	-1.0573	10	0.51188	T	0.08	-9.6748	10.9958	0.47575	0.0:0.1392:0.7166:0.1442	.	64;64;64;64	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	F	64;64;64;64;64;64;5	ENSP00000383752:L64F;ENSP00000356416:L64F;ENSP00000356413:L64F;ENSP00000356415:L64F;ENSP00000356414:L64F;ENSP00000356411:L64F;ENSP00000424612:L5F	ENSP00000356411:L64F	L	+	3	2	TROVE2	191304999	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.829000	0.27449	2.648000	0.89879	0.557000	0.71058	TTG	.	.	.	none		0.398	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086688.1	NM_004600	
DNAH14	127602	hgsc.bcm.edu	37	1	225230800	225230800	+	Silent	SNP	T	T	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:225230800T>G	ENST00000445597.2	+	11	1809	c.1809T>G	c.(1807-1809)ctT>ctG	p.L603L	DNAH14_ENST00000430092.1_Silent_p.L584L|DNAH14_ENST00000439375.2_Silent_p.L584L			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	603					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GTTACAATCTTGAAGATATTA	0.388																																					p.L584L		Atlas-SNP	.											.	DNAH14	300	.	0			c.T1752G						PASS	.						64.0	59.0	60.0					1																	225230800		692	1591	2283	SO:0001819	synonymous_variant	127602	exon13			CAATCTTGAAGAT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.1809T>G	chr1.hg19:g.225230800T>G		62.0	0.0	.		65.0	20.0	.	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	hg19																																																																																				.	.	.	none		0.388	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
PYCR2	29920	hgsc.bcm.edu	37	1	226111423	226111423	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:226111423A>G	ENST00000343818.6	-	2	264	c.116T>C	c.(115-117)cTg>cCg	p.L39P	RP4-559A3.7_ENST00000432920.2_Missense_Mutation_p.L39P|PYCR2_ENST00000478402.1_5'UTR	NM_013328.2	NP_037460.2	Q96C36	P5CR2_HUMAN	pyrroline-5-carboxylate reductase family, member 2	39					L-proline biosynthetic process (GO:0055129)	cytoplasm (GO:0005737)	pyrroline-5-carboxylate reductase activity (GO:0004735)			kidney(1)|lung(3)	4	Breast(184;0.197)				L-Proline(DB00172)	CACCGTGGGCAGGTTCATTTC	0.612																																					p.L39P		Atlas-SNP	.											.	PYCR2	13	.	0			c.T116C						PASS	.						47.0	51.0	49.0					1																	226111423		2203	4300	6503	SO:0001583	missense	29920	exon2			GTGGGCAGGTTCA	AF151351	CCDS31043.1, CCDS73039.1	1q42.13	2008-02-05			ENSG00000143811	ENSG00000143811			30262	protein-coding gene	gene with protein product						12477932	Standard	NM_013328		Approved	P5CR2	uc001hpq.4	Q96C36	OTTHUMG00000037506	ENST00000343818.6:c.116T>C	chr1.hg19:g.226111423A>G	ENSP00000342502:p.Leu39Pro	78.0	0.0	.		87.0	20.0	.	NM_013328	A8K798|Q7Z515|Q9Y5J4	Missense_Mutation	SNP	ENST00000343818.6	hg19	CCDS31043.1	.	.	.	.	.	.	.	.	.	.	a	28.5	4.921791	0.92319	.	.	ENSG00000255835;ENSG00000143811	ENST00000432920;ENST00000343818	T;T	0.42131	0.98;0.98	4.36	4.36	0.52297	NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000001	T	0.53850	0.1822	L	0.45581	1.43	0.80722	D	1	D;B	0.76494	0.999;0.004	D;B	0.72982	0.979;0.005	T	0.50996	-0.8761	9	.	.	.	-10.908	11.8145	0.52202	1.0:0.0:0.0:0.0	.	39;39	E7EUD8;Q96C36	.;P5CR2_HUMAN	P	39	ENSP00000414068:L39P;ENSP00000342502:L39P	.	L	-	2	0	PYCR2;RP4-559A3.7	224178046	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.530000	0.90606	1.963000	0.57068	0.533000	0.62120	CTG	.	.	.	none		0.612	PYCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091314.1	NM_013328	
GRHL1	29841	hgsc.bcm.edu	37	2	10139100	10139100	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:10139100A>G	ENST00000324907.9	+	15	1821	c.1685A>G	c.(1684-1686)gAc>gGc	p.D562G	GRHL1_ENST00000324883.5_Missense_Mutation_p.D373G|GRHL1_ENST00000405379.2_Missense_Mutation_p.D562G|GRHL1_ENST00000480736.1_Missense_Mutation_p.D16G	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	562					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		TAGATCTCAGACAAATACGAT	0.353																																					p.D562G		Atlas-SNP	.											.	GRHL1	95	.	0			c.A1685G						PASS	.						49.0	45.0	47.0					2																	10139100		2203	4300	6503	SO:0001583	missense	29841	exon15			TCTCAGACAAATA	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1685A>G	chr2.hg19:g.10139100A>G	ENSP00000324693:p.Asp562Gly	160.0	0.0	.		141.0	8.0	.	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	hg19	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	A	16.90	3.248796	0.59103	.	.	ENSG00000134317	ENST00000405379;ENST00000324883;ENST00000324907;ENST00000480736	T;T;T	0.17691	2.74;2.26;2.74	5.34	5.34	0.76211	.	0.047940	0.85682	D	0.000000	T	0.17789	0.0427	L	0.40543	1.245	0.80722	D	1	B;B	0.13145	0.007;0.001	B;B	0.17098	0.017;0.005	T	0.02150	-1.1205	10	0.72032	D	0.01	-11.0287	15.269	0.73683	1.0:0.0:0.0:0.0	.	373;562	Q9NZI5-2;Q9NZI5	.;GRHL1_HUMAN	G	562;373;562;16	ENSP00000384209:D562G;ENSP00000324494:D373G;ENSP00000324693:D562G	ENSP00000324494:D373G	D	+	2	0	GRHL1	10056551	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.630000	0.90987	2.138000	0.66242	0.482000	0.46254	GAC	.	.	.	none		0.353	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
ATL2	64225	hgsc.bcm.edu	37	2	38527436	38527436	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:38527436G>C	ENST00000378954.4	-	10	1107	c.1106C>G	c.(1105-1107)cCa>cGa	p.P369R	ATL2_ENST00000406122.1_Missense_Mutation_p.P198R|ATL2_ENST00000419554.2_Missense_Mutation_p.P369R|ATL2_ENST00000539122.1_Missense_Mutation_p.P198R|ATL2_ENST00000452935.2_Missense_Mutation_p.P351R|ATL2_ENST00000546051.1_Missense_Mutation_p.P198R|ATL2_ENST00000332337.4_Missense_Mutation_p.P351R|ATL2_ENST00000402054.1_Missense_Mutation_p.P198R	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	369					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						CTTTGGATGTGGAAGTTCTTC	0.373																																					p.P369R		Atlas-SNP	.											.	ATL2	49	.	0			c.C1106G						PASS	.						143.0	141.0	142.0					2																	38527436		2203	4300	6503	SO:0001583	missense	64225	exon10			GGATGTGGAAGTT		CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1106C>G	chr2.hg19:g.38527436G>C	ENSP00000368237:p.Pro369Arg	41.0	0.0	.		38.0	11.0	.	NM_001135673	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	hg19	CCDS46260.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.709464	0.89018	.	.	ENSG00000119787	ENST00000378954;ENST00000406122;ENST00000402054;ENST00000539122;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000546051	T;T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07	5.51	5.51	0.81932	Guanylate-binding protein, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.56673	0.2001	M	0.89601	3.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.64859	-0.6308	10	0.87932	D	0	-13.0964	18.7695	0.91885	0.0:0.0:1.0:0.0	.	198;351;351;369;369	B5MCN0;B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9	.;.;.;.;ATLA2_HUMAN	R	369;198;198;198;351;369;351;198	ENSP00000368237:P369R;ENSP00000385446:P198R;ENSP00000384062:P198R;ENSP00000446192:P198R;ENSP00000333393:P351R;ENSP00000415336:P369R;ENSP00000390743:P351R;ENSP00000438938:P198R	ENSP00000333393:P351R	P	-	2	0	ATL2	38380940	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.529000	0.98049	2.736000	0.93811	0.655000	0.94253	CCA	.	.	.	none		0.373	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	NM_022374	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43937155	43937155	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:43937155G>A	ENST00000282406.4	+	12	2103	c.1993G>A	c.(1993-1995)Gaa>Aaa	p.E665K		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	665	Ser-rich.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)	p.E665K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TGTGGCTTCTGAAAGTGATTA	0.458																																					p.E665K		Atlas-SNP	.											PLEKHH2,NS,carcinoma,0,1	PLEKHH2	156	.	1	Substitution - Missense(1)	lung(1)	c.G1993A						PASS	.						177.0	170.0	172.0					2																	43937155		2203	4300	6503	SO:0001583	missense	130271	exon12			GCTTCTGAAAGTG	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.1993G>A	chr2.hg19:g.43937155G>A	ENSP00000282406:p.Glu665Lys	323.0	0.0	.		308.0	82.0	.	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	hg19	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194124	0.78902	.	.	ENSG00000152527	ENST00000282406	T	0.75589	-0.95	5.23	5.23	0.72850	.	0.346472	0.32533	N	0.005963	T	0.77644	0.4161	L	0.41492	1.28	0.58432	D	0.999996	P;P;D	0.55385	0.92;0.787;0.971	P;B;P	0.53401	0.694;0.254;0.725	T	0.80346	-0.1421	10	0.72032	D	0.01	-11.6976	18.7989	0.92008	0.0:0.0:1.0:0.0	.	665;102;665	Q8IVE3;Q8IVE3-2;Q8IVE3-3	PKHH2_HUMAN;.;.	K	665	ENSP00000282406:E665K	ENSP00000282406:E665K	E	+	1	0	PLEKHH2	43790659	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.355000	0.97087	2.423000	0.82170	0.563000	0.77884	GAA	.	.	.	none		0.458	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
C2orf73	129852	hgsc.bcm.edu	37	2	54587567	54587567	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:54587567A>T	ENST00000398634.2	+	5	774	c.732A>T	c.(730-732)agA>agT	p.R244S	C2orf73_ENST00000491538.1_Intron|C2orf73_ENST00000405749.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	244										breast(2)	2						CAGACGTCAGACAGGCAGCCA	0.498																																					p.R244S		Atlas-SNP	.											.	C2orf73	17	.	0			c.A732T						PASS	.						33.0	32.0	32.0					2																	54587567		1907	4131	6038	SO:0001583	missense	129852	exon5			CGTCAGACAGGCA	BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.732A>T	chr2.hg19:g.54587567A>T	ENSP00000381631:p.Arg244Ser	112.0	0.0	.		123.0	25.0	.	NM_001100396	A0AV79|A0AV81|Q8N7V4	Missense_Mutation	SNP	ENST00000398634.2	hg19	CCDS46285.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.756992	0.89843	.	.	ENSG00000177994	ENST00000398634;ENST00000447328	T;T	0.43688	0.94;0.94	5.22	-4.39	0.03611	.	0.275143	0.30989	N	0.008480	T	0.27559	0.0677	L	0.51422	1.61	0.09310	N	1	B;B	0.16396	0.017;0.017	B;B	0.14578	0.007;0.011	T	0.18085	-1.0348	9	.	.	.	-22.3764	7.55	0.27790	0.3399:0.4503:0.2098:0.0	.	186;244	B7ZM12;Q8N5S3	.;CB073_HUMAN	S	244;186	ENSP00000381631:R244S;ENSP00000389570:R186S	.	R	+	3	2	C2orf73	54441071	0.996000	0.38824	0.026000	0.17262	0.956000	0.61745	0.694000	0.25512	-0.510000	0.06523	0.455000	0.32223	AGA	.	.	.	none		0.498	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324075.2	NM_001100396	
AFTPH	54812	hgsc.bcm.edu	37	2	64779245	64779245	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:64779245A>G	ENST00000422803.1	+	2	951	c.637A>G	c.(637-639)Agc>Ggc	p.S213G	AFTPH_ENST00000409933.1_Missense_Mutation_p.S213G|AFTPH_ENST00000238855.7_Missense_Mutation_p.S213G|AFTPH_ENST00000238856.4_Missense_Mutation_p.S213G|AFTPH_ENST00000409183.1_5'Flank			Q6ULP2	AFTIN_HUMAN	aftiphilin	213					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						GAAGCCTCTTAGCACTCATAG	0.408																																					p.S213G		Atlas-SNP	.											.	AFTPH	117	.	0			c.A637G						PASS	.						99.0	94.0	95.0					2																	64779245		2203	4300	6503	SO:0001583	missense	54812	exon2			CCTCTTAGCACTC	AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.637A>G	chr2.hg19:g.64779245A>G	ENSP00000397726:p.Ser213Gly	81.0	0.0	.		89.0	22.0	.	NM_017657	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.69	1.421187	0.25639	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	5.11	5.11	0.69529	.	0.449420	0.26166	N	0.025958	T	0.18882	0.0453	L	0.40543	1.245	0.28041	N	0.933768	B;B;B;B	0.33171	0.4;0.4;0.4;0.4	B;B;B;B	0.31101	0.124;0.124;0.124;0.124	T	0.11966	-1.0566	10	0.20519	T	0.43	-0.0973	10.0775	0.42368	0.9237:0.0:0.0763:0.0	.	213;213;213;213	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	G	213	ENSP00000238856:S213G;ENSP00000397726:S213G;ENSP00000238855:S213G;ENSP00000387071:S213G	ENSP00000238855:S213G	S	+	1	0	AFTPH	64632749	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.209000	0.32357	2.243000	0.73865	0.482000	0.46254	AGC	.	.	.	none		0.408	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657	
SH2D6	284948	hgsc.bcm.edu	37	2	85662170	85662170	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:85662170A>C	ENST00000340326.2	+	1	253	c.92A>C	c.(91-93)aAt>aCt	p.N31T	SH2D6_ENST00000389938.2_Intron|SH2D6_ENST00000481426.2_Intron|Y_RNA_ENST00000384478.1_RNA	NM_198482.1	NP_940884.1	Q7Z4S9	SH2D6_HUMAN	SH2 domain containing 6	31										central_nervous_system(1)|lung(2)	3						ccccaGCTCAATAATCTGCTT	0.637																																					p.N31T		Atlas-SNP	.											.	SH2D6	15	.	0			c.A92C						PASS	.						12.0	13.0	13.0					2																	85662170		2197	4298	6495	SO:0001583	missense	284948	exon1			AGCTCAATAATCT	AF450483	CCDS1976.1	2p11.2	2013-02-14			ENSG00000152292	ENSG00000152292		"""SH2 domain containing"""	30439	protein-coding gene	gene with protein product						12477932	Standard	NM_198482		Approved	FLJ35993	uc002spq.3	Q7Z4S9	OTTHUMG00000130176	ENST00000340326.2:c.92A>C	chr2.hg19:g.85662170A>C	ENSP00000341867:p.Asn31Thr	257.0	0.0	.		194.0	46.0	.	NM_198482	A6ND14|Q6R306	Missense_Mutation	SNP	ENST00000340326.2	hg19	CCDS1976.1	.	.	.	.	.	.	.	.	.	.	A	2.895	-0.228883	0.06022	.	.	ENSG00000152292	ENST00000340326	T	0.76968	-1.06	3.25	-6.5	0.01884	.	66.330300	0.00166	N	0.000000	T	0.55097	0.1899	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.50224	-0.8853	10	0.20046	T	0.44	7.3091	7.7682	0.28993	0.2024:0.2909:0.5066:0.0	.	31	Q7Z4S9	SH2D6_HUMAN	T	31	ENSP00000341867:N31T	ENSP00000341867:N31T	N	+	2	0	SH2D6	85515681	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-1.051000	0.03507	-1.835000	0.01191	-0.475000	0.04921	AAT	.	.	.	none		0.637	SH2D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252493.2	NM_198482	
ANAPC1	64682	hgsc.bcm.edu	37	2	112638235	112638235	+	Silent	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:112638235G>T	ENST00000341068.3	-	2	940	c.168C>A	c.(166-168)ggC>ggA	p.G56G	ANAPC1_ENST00000489177.1_5'UTR	NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	56					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						ATCCCACCAAGCCAGCAGCAC	0.463																																					p.G56G		Atlas-SNP	.											.	ANAPC1	116	.	0			c.C168A						PASS	.						37.0	37.0	37.0					2																	112638235		2203	4300	6503	SO:0001819	synonymous_variant	64682	exon2			CACCAAGCCAGCA	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.168C>A	chr2.hg19:g.112638235G>T		272.0	0.0	.		267.0	75.0	.	NM_022662	Q2M3H8|Q9BSE6|Q9H8D0	Silent	SNP	ENST00000341068.3	hg19	CCDS2093.1																																																																																			.	.	.	none		0.463	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
LY75	4065	hgsc.bcm.edu	37	2	160746833	160746833	+	Silent	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:160746833T>C	ENST00000263636.4	-	4	720	c.693A>G	c.(691-693)caA>caG	p.Q231Q	LY75-CD302_ENST00000505052.1_Silent_p.Q231Q|LY75_ENST00000554112.1_Silent_p.Q231Q|LY75_ENST00000553424.1_Silent_p.Q231Q|LY75-CD302_ENST00000504764.1_Silent_p.Q231Q	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	231	C-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GAGTATTAAATTGGTAGCAAC	0.373																																					p.Q231Q		Atlas-SNP	.											.	LY75	151	.	0			c.A693G						PASS	.						94.0	95.0	95.0					2																	160746833		2203	4300	6503	SO:0001819	synonymous_variant	4065	exon4			ATTAAATTGGTAG	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.693A>G	chr2.hg19:g.160746833T>C		115.0	0.0	.		105.0	12.0	.	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	ENST00000263636.4	hg19	CCDS2211.1																																																																																			.	.	.	none		0.373	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
HOXD4	3233	hgsc.bcm.edu	37	2	177017568	177017568	+	Silent	SNP	A	A	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:177017568A>T	ENST00000306324.3	+	2	1078	c.666A>T	c.(664-666)tcA>tcT	p.S222S	MIR10B_ENST00000385011.1_RNA|HOXD3_ENST00000468418.3_5'UTR	NM_014621.2	NP_055436.2	P09016	HXD4_HUMAN	homeobox D4	222	Poly-Ser.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		AAGGCAGGTCATCGTCCTCAT	0.537																																					p.S222S		Atlas-SNP	.											.	HOXD4	32	.	0			c.A666T						PASS	.						119.0	121.0	120.0					2																	177017568		2203	4300	6503	SO:0001819	synonymous_variant	3233	exon2			CAGGTCATCGTCC		CCDS2269.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170166	ENSG00000170166		"""Homeoboxes / ANTP class : HOXL subclass"""	5138	protein-coding gene	gene with protein product		142981	"""homeo box D4"""	HOX4B, HOX4		1973146, 1358459	Standard	NM_014621		Approved		uc002uks.3	P09016	OTTHUMG00000132515	ENST00000306324.3:c.666A>T	chr2.hg19:g.177017568A>T		94.0	0.0	.		94.0	19.0	.	NM_014621	B2R9R3|Q96AU0	Silent	SNP	ENST00000306324.3	hg19	CCDS2269.1																																																																																			.	.	.	none		0.537	HOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255697.2		
PRKRA	8575	hgsc.bcm.edu	37	2	179300994	179300994	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:179300994G>A	ENST00000325748.4	-	7	862	c.662C>T	c.(661-663)tCt>tTt	p.S221F	AC009948.5_ENST00000436616.2_RNA|AC009948.5_ENST00000453026.2_RNA|PRKRA_ENST00000438687.3_Missense_Mutation_p.S108F|AC009948.5_ENST00000454488.1_RNA|PRKRA_ENST00000432031.2_Missense_Mutation_p.S210F|PRKRA_ENST00000487082.1_Missense_Mutation_p.S196F	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator	221	Sufficient for self-association and interaction with TARBP2.				cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			TTCACCAGGAGAATTCCTCAA	0.388																																					p.S221F	Melanoma(200;68 3001 23825 48764)	Atlas-SNP	.											.	PRKRA	56	.	0			c.C662T						PASS	.						154.0	173.0	167.0					2																	179300994		2203	4300	6503	SO:0001583	missense	8575	exon7			CCAGGAGAATTCC	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.662C>T	chr2.hg19:g.179300994G>A	ENSP00000318176:p.Ser221Phe	68.0	0.0	.		77.0	14.0	.	NM_003690	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Missense_Mutation	SNP	ENST00000325748.4	hg19	CCDS2279.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.432252	0.83776	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	T;T;T;T	0.76186	-0.98;-0.99;-0.98;-1.0	5.92	5.92	0.95590	.	0.065506	0.64402	D	0.000008	D	0.85695	0.5756	M	0.73217	2.22	0.48762	D	0.999701	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.964	D	0.86199	0.1617	10	0.72032	D	0.01	.	17.2511	0.87042	0.0:0.0:1.0:0.0	.	221;210	O75569;O75569-2	PRKRA_HUMAN;.	F	221;108;196;210	ENSP00000318176:S221F;ENSP00000398980:S108F;ENSP00000430604:S196F;ENSP00000393883:S210F	ENSP00000318176:S221F	S	-	2	0	PRKRA	179009240	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.222000	0.72249	2.822000	0.97130	0.650000	0.86243	TCT	.	.	.	none		0.388	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	
TTN	7273	hgsc.bcm.edu	37	2	179455837	179455837	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:179455837T>C	ENST00000591111.1	-	254	55916	c.55692A>G	c.(55690-55692)atA>atG	p.I18564M	TTN_ENST00000342992.6_Missense_Mutation_p.I17637M|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I11332M|TTN_ENST00000359218.5_Missense_Mutation_p.I11265M|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I20205M|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I11140M|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18564	Fibronectin type-III 34. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAATATAATTTATCACAGGGC	0.448																																					p.I20205M		Atlas-SNP	.											.	TTN	18412	.	0			c.A60615G						PASS	.						103.0	102.0	102.0					2																	179455837		1868	4097	5965	SO:0001583	missense	7273	exon304			ATAATTTATCACA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55692A>G	chr2.hg19:g.179455837T>C	ENSP00000465570:p.Ile18564Met	181.0	0.0	.		149.0	35.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	7.626	0.677919	0.14841	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	6.11	-1.34	0.09143	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.30135	0.0755	N	0.12746	0.255	0.28797	N	0.899017	B;B;B;B	0.25850	0.136;0.136;0.136;0.136	B;B;B;B	0.21151	0.033;0.033;0.033;0.033	T	0.27640	-1.0068	9	0.87932	D	0	.	7.5324	0.27691	0.1013:0.0615:0.5558:0.2813	.	11140;11265;11332;18564	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	17637;11140;11332;11265;11138	ENSP00000343764:I17637M;ENSP00000434586:I11140M;ENSP00000340554:I11332M;ENSP00000352154:I11265M	ENSP00000340554:I11332M	I	-	3	3	TTN	179164083	0.992000	0.36948	1.000000	0.80357	0.993000	0.82548	0.173000	0.16724	0.143000	0.18926	-0.331000	0.08364	ATA	.	.	.	none		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DLEC1	9940	hgsc.bcm.edu	37	3	38101345	38101345	+	Splice_Site	SNP	T	T	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr3:38101345T>A	ENST00000308059.6	+	3	694		c.e3+2		DLEC1_ENST00000346219.3_Splice_Site|DLEC1_ENST00000452631.2_Splice_Site					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CACCTAAAGGTAATGCTTCTG	0.488																																					.		Atlas-SNP	.											.	DLEC1	278	.	0			c.673+2T>A						PASS	.						130.0	128.0	128.0					3																	38101345		1939	4141	6080	SO:0001630	splice_region_variant	9940	exon3			TAAAGGTAATGCT	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.673+2T>A	chr3.hg19:g.38101345T>A		88.0	0.0	.		79.0	12.0	.	NM_007337		Splice_Site	SNP	ENST00000308059.6	hg19	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	T	16.28	3.077564	0.55753	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0009	0.47604	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DLEC1	38076349	1.000000	0.71417	0.996000	0.52242	0.627000	0.37826	3.947000	0.56652	2.089000	0.63090	0.533000	0.62120	.	.	.	.	none		0.488	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	Intron
FAM19A4	151647	hgsc.bcm.edu	37	3	68929968	68929968	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr3:68929968G>T	ENST00000295569.7	-	3	535	c.43C>A	c.(43-45)Ctg>Atg	p.L15M	RNA5SP135_ENST00000517019.1_RNA	NM_001005527.2|NM_182522.4	NP_001005527.1|NP_872328.1	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A4	15						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(5)|skin(2)	10		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		CAGTGCGACAGCAACACTGAC	0.552																																					p.L15M		Atlas-SNP	.											.	FAM19A4	23	.	0			c.C43A						PASS	.						83.0	75.0	78.0					3																	68929968		2203	4300	6503	SO:0001583	missense	151647	exon3			GCGACAGCAACAC	AY325117	CCDS2907.1	3p14.1	2014-08-14			ENSG00000163377	ENSG00000163377			21591	protein-coding gene	gene with protein product						15028294, 25109685	Standard	NM_182522		Approved	TAFA-4	uc021xah.1	Q96LR4	OTTHUMG00000158744	ENST00000295569.7:c.43C>A	chr3.hg19:g.68929968G>T	ENSP00000295569:p.Leu15Met	103.0	0.0	.		141.0	8.0	.	NM_182522	A8MVT2	Missense_Mutation	SNP	ENST00000295569.7	hg19	CCDS2907.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652658	0.47362	.	.	ENSG00000163377	ENST00000295569;ENST00000495737	.	.	.	5.18	5.18	0.71444	.	0.492735	0.18075	N	0.152484	T	0.26666	0.0652	N	0.08118	0	0.28953	N	0.890319	P	0.36438	0.553	B	0.31751	0.135	T	0.18304	-1.0341	9	0.46703	T	0.11	-7.3645	18.7219	0.91698	0.0:0.0:1.0:0.0	.	15	Q96LR4	F19A4_HUMAN	M	15	.	ENSP00000295569:L15M	L	-	1	2	FAM19A4	69012658	1.000000	0.71417	0.691000	0.30163	0.990000	0.78478	4.329000	0.59260	2.414000	0.81942	0.591000	0.81541	CTG	.	.	.	none		0.552	FAM19A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352002.1	NM_182522	
ABI3BP	25890	hgsc.bcm.edu	37	3	100470405	100470405	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr3:100470405T>C	ENST00000284322.5	-	34	3212	c.3103A>G	c.(3103-3105)Atc>Gtc	p.I1035V	ABI3BP_ENST00000471714.1_Missense_Mutation_p.I1737V|ABI3BP_ENST00000383691.4_Missense_Mutation_p.I989V	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	1035					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						CCTTCTTTGATTGGTAACTGG	0.408																																					p.I1035V		Atlas-SNP	.											.	ABI3BP	305	.	0			c.A3103G						PASS	.						59.0	55.0	56.0					3																	100470405		1880	4109	5989	SO:0001583	missense	25890	exon34			CTTTGATTGGTAA	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.3103A>G	chr3.hg19:g.100470405T>C	ENSP00000284322:p.Ile1035Val	94.0	0.0	.		116.0	21.0	.	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	ENST00000284322.5	hg19	CCDS46880.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.255157	0.39896	.	.	ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000383692;ENST00000429331;ENST00000383691	T;T;T	0.44482	0.92;0.92;0.92	5.92	4.74	0.60224	.	0.502303	0.22224	N	0.062901	T	0.16981	0.0408	N	0.02011	-0.69	0.20403	N	0.999902	B;B;B;B	0.22276	0.011;0.002;0.067;0.057	B;B;B;B	0.18263	0.021;0.007;0.018;0.003	T	0.13522	-1.0506	10	0.33940	T	0.23	-0.2949	8.009	0.30342	0.0:0.0748:0.1379:0.7872	.	989;1035;1737;744	B4DSV9;Q7Z7G0;D3YTG3;D3YTD6	.;TARSH_HUMAN;.;.	V	1737;1035;744;446;989	ENSP00000420524:I1737V;ENSP00000284322:I1035V;ENSP00000373189:I989V	ENSP00000284322:I1035V	I	-	1	0	ABI3BP	101953095	0.949000	0.32298	1.000000	0.80357	0.984000	0.73092	1.044000	0.30329	1.034000	0.39945	0.533000	0.62120	ATC	.	.	.	none		0.408	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
TRPC1	7220	hgsc.bcm.edu	37	3	142443574	142443574	+	Splice_Site	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr3:142443574G>A	ENST00000476941.1	+	1	658		c.e1+1		TRPC1_ENST00000273482.6_Splice_Site	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1						axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TGCGACAAGGGTGAGAGTTAG	0.572																																					.		Atlas-SNP	.											.	TRPC1	82	.	0			c.172+1G>A						PASS	.						137.0	118.0	124.0					3																	142443574		2203	4300	6503	SO:0001630	splice_region_variant	7220	exon1			ACAAGGGTGAGAG	X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.172+1G>A	chr3.hg19:g.142443574G>A		45.0	0.0	.		63.0	23.0	.	NM_003304	Q14CE4	Splice_Site	SNP	ENST00000476941.1	hg19	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178518	0.78564	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	.	.	.	5.02	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5725	0.61856	0.0:0.0:0.8446:0.1554	.	.	.	.	.	-1	.	.	.	+	.	.	TRPC1	143926264	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.209000	0.72171	1.231000	0.43661	0.650000	0.86243	.	.	.	.	none		0.572	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	Intron
ETV5	2119	hgsc.bcm.edu	37	3	185774898	185774898	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr3:185774898C>A	ENST00000306376.5	-	11	1421	c.1175G>T	c.(1174-1176)cGa>cTa	p.R392L	ETV5_ENST00000537818.1_Missense_Mutation_p.R434L|ETV5_ENST00000434744.1_Missense_Mutation_p.R392L|ETV5_ENST00000480706.1_5'UTR	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	392					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			CTCCATGCCTCGACCTGTCCA	0.517			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.R392L		Atlas-SNP	.		Dom	yes		3	3q28	2119	ets variant gene 5		E	ETV5_ENST00000306376,NS,carcinoma,0,2	ETV5	106	.	0			c.G1175T						PASS	.						91.0	89.0	89.0					3																	185774898		2203	4300	6503	SO:0001583	missense	2119	exon11			ATGCCTCGACCTG	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.1175G>T	chr3.hg19:g.185774898C>A	ENSP00000306894:p.Arg392Leu	81.0	0.0	.		94.0	33.0	.	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	hg19	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	C	33	5.288657	0.95517	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.57107	0.42;0.42;0.42	5.69	5.69	0.88448	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.78323	0.4265	M	0.89214	3.015	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81996	-0.0676	10	0.87932	D	0	.	18.5905	0.91210	0.0:1.0:0.0:0.0	.	392;434	P41161;B7Z7D7	ETV5_HUMAN;.	L	392;392;434	ENSP00000306894:R392L;ENSP00000413755:R392L;ENSP00000441737:R434L	ENSP00000306894:R392L	R	-	2	0	ETV5	187257592	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.691000	0.91804	0.655000	0.94253	CGA	.	.	.	none		0.517	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
CCDC50	152137	hgsc.bcm.edu	37	3	191092937	191092937	+	Intron	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr3:191092937C>T	ENST00000392455.3	+	6	1046				CCDC50_ENST00000392456.3_Missense_Mutation_p.H179Y	NM_174908.3	NP_777568.1	Q8IVM0	CCD50_HUMAN	coiled-coil domain containing 50							cytoplasm (GO:0005737)	ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|stomach(1)	23	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		GACTGTGAAGCACAAGAAAGA	0.498																																					p.H179Y		Atlas-SNP	.											.	CCDC50	39	.	0			c.C535T						PASS	.						83.0	78.0	79.0					3																	191092937		2203	4300	6503	SO:0001627	intron_variant	152137	exon6			GTGAAGCACAAGA	AJ416916	CCDS33912.1, CCDS33913.1	3q28	2010-12-24		2005-12-23	ENSG00000152492	ENSG00000152492			18111	protein-coding gene	gene with protein product		611051	"""deafness, autosomal dominant 44"""	C3orf6, DFNA44		16803894, 17503326	Standard	NM_178335		Approved	Ymer	uc003fsv.3	Q8IVM0	OTTHUMG00000156177	ENST00000392455.3:c.449-5011C>T	chr3.hg19:g.191092937C>T		84.0	0.0	.		84.0	14.0	.	NM_178335	Q86VH7	Missense_Mutation	SNP	ENST00000392455.3	hg19	CCDS33913.1	.	.	.	.	.	.	.	.	.	.	C	9.887	1.203179	0.22121	.	.	ENSG00000152492	ENST00000392456	T	0.32023	1.47	5.65	5.65	0.86999	.	0.753598	0.11889	N	0.519796	T	0.27559	0.0677	.	.	.	0.09310	N	0.999996	B	0.15930	0.015	B	0.19148	0.024	T	0.10636	-1.0621	9	0.40728	T	0.16	.	15.5749	0.76368	0.0:1.0:0.0:0.0	.	179	Q8IVM0-2	.	Y	179	ENSP00000376250:H179Y	ENSP00000376250:H179Y	H	+	1	0	CCDC50	192575631	0.294000	0.24380	0.102000	0.21198	0.129000	0.20672	1.489000	0.35562	2.821000	0.97095	0.650000	0.86243	CAC	.	.	.	none		0.498	CCDC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343315.1	NM_174908	
MSANTD1	345222	hgsc.bcm.edu	37	4	3254938	3254938	+	Silent	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr4:3254938T>C	ENST00000438480.2	+	2	2072	c.325T>C	c.(325-327)Tta>Cta	p.L109L	MSANTD1_ENST00000510580.1_Silent_p.L109L|MSANTD1_ENST00000507492.1_Silent_p.L96L	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	109	Myb-like.									endometrium(1)|lung(2)	3						TTTCAGGAAATTAAAATGCAT	0.597																																					p.L109L		Atlas-SNP	.											.	MSANTD1	14	.	0			c.T325C						PASS	.						67.0	84.0	78.0					4																	3254938		2203	4300	6503	SO:0001819	synonymous_variant	345222	exon2			AGGAAATTAAAAT		CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.325T>C	chr4.hg19:g.3254938T>C		86.0	0.0	.		70.0	12.0	.	NM_001042690	C9J6V0	Silent	SNP	ENST00000438480.2	hg19	CCDS47003.1																																																																																			.	.	.	none		0.597	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982	
CDH9	1007	hgsc.bcm.edu	37	5	26988254	26988254	+	Missense_Mutation	SNP	A	A	T	rs144749356		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr5:26988254A>T	ENST00000231021.4	-	2	359	c.187T>A	c.(187-189)Ttg>Atg	p.L63M		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	63	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TACTCTTCCAATAAGAAGAAC	0.383																																					p.L63M	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.T187A						PASS	.						93.0	88.0	89.0					5																	26988254		2203	4300	6503	SO:0001583	missense	1007	exon2			CTTCCAATAAGAA	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.187T>A	chr5.hg19:g.26988254A>T	ENSP00000231021:p.Leu63Met	147.0	0.0	.		137.0	50.0	.	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799156	0.70567	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	T;T;T	0.00571	6.5;6.5;6.5	5.64	2.02	0.26589	Cadherin-like (1);	0.080037	0.50627	D	0.000105	T	0.01523	0.0049	M	0.74467	2.265	0.41359	D	0.987417	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	T	0.63359	-0.6655	9	.	.	.	.	6.2494	0.20837	0.4865:0.0:0.5135:0.0	.	63;63	E7EPN0;Q9ULB4	.;CADH9_HUMAN	M	63	ENSP00000231021:L63M;ENSP00000426239:L63M;ENSP00000422538:L63M	.	L	-	1	2	CDH9	27024011	0.988000	0.35896	1.000000	0.80357	0.993000	0.82548	0.656000	0.24948	0.435000	0.26365	0.482000	0.46254	TTG	.	A|1.000;G|0.000	.	alt		0.383	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
GABRG2	2566	hgsc.bcm.edu	37	5	161524860	161524860	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr5:161524860C>G	ENST00000361925.4	+	4	764	c.544C>G	c.(544-546)Cta>Gta	p.L182V	GABRG2_ENST00000414552.2_Missense_Mutation_p.L182V|GABRG2_ENST00000393933.4_Missense_Mutation_p.L87V|GABRG2_ENST00000356592.3_Missense_Mutation_p.L182V			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	182					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCTCTACACCCTAAGGTATTC	0.368																																					p.L182V		Atlas-SNP	.											.	GABRG2	142	.	0			c.C544G						PASS	.						70.0	71.0	71.0					5																	161524860		2203	4300	6503	SO:0001583	missense	2566	exon4			TACACCCTAAGGT		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.544C>G	chr5.hg19:g.161524860C>G	ENSP00000354651:p.Leu182Val	47.0	0.0	.		65.0	7.0	.	NM_198904	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	hg19	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850018	0.51270	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	5.82	0.467	0.16721	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.79828	0.4513	L	0.52206	1.635	0.58432	D	0.999999	D;P;P	0.56035	0.974;0.629;0.939	P;P;P	0.58660	0.843;0.531;0.615	T	0.77691	-0.2493	10	0.87932	D	0	.	10.5972	0.45345	0.0:0.4263:0.0:0.5737	.	182;182;182	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	V	182;182;182;87;87	ENSP00000349000:L182V;ENSP00000410732:L182V;ENSP00000354651:L182V;ENSP00000377510:L87V;ENSP00000430182:L87V	ENSP00000349000:L182V	L	+	1	2	GABRG2	161457438	0.005000	0.15991	0.636000	0.29352	0.990000	0.78478	0.140000	0.16056	-0.234000	0.09782	0.563000	0.77884	CTA	.	.	.	none		0.368	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
TNXB	7148	hgsc.bcm.edu	37	6	32014119	32014119	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr6:32014119A>G	ENST00000375244.3	-	31	10640	c.10439T>C	c.(10438-10440)gTg>gCg	p.V3480A	TNXB_ENST00000451343.1_5'Flank|TNXB_ENST00000375247.2_Missense_Mutation_p.V3478A			P22105	TENX_HUMAN	tenascin XB	3525	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GTACTGGACCACGAAGGAGTC	0.652																																					p.V3478A		Atlas-SNP	.											.	TNXB	553	.	0			c.T10433C						PASS	.						37.0	44.0	41.0					6																	32014119		1427	2654	4081	SO:0001583	missense	7148	exon31			TGGACCACGAAGG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10439T>C	chr6.hg19:g.32014119A>G	ENSP00000364393:p.Val3480Ala	57.0	0.0	.		57.0	12.0	.	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	hg19		.	.	.	.	.	.	.	.	.	.	A	14.77	2.634222	0.47049	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56611	0.45;0.45	4.25	3.04	0.35103	.	0.175077	0.27270	N	0.020129	T	0.33990	0.0882	M	0.87328	2.875	0.23113	N	0.998276	B	0.24823	0.112	B	0.31337	0.128	T	0.45527	-0.9255	10	0.07990	T	0.79	.	9.1299	0.36839	0.9067:0.0:0.0933:0.0	.	3478	P22105-3	.	A	3480;3478	ENSP00000364393:V3480A;ENSP00000364396:V3478A	ENSP00000364393:V3480A	V	-	2	0	TNXB	32122097	0.376000	0.25098	0.997000	0.53966	0.484000	0.33280	2.793000	0.47845	1.772000	0.52199	0.260000	0.18958	GTG	.	.	.	none		0.652	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
DNAH8	1769	hgsc.bcm.edu	37	6	38976613	38976613	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr6:38976613C>A	ENST00000359357.3	+	87	12841	c.12587C>A	c.(12586-12588)gCt>gAt	p.A4196D	DNAH8_ENST00000441566.1_Missense_Mutation_p.A4160D			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4196					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ACTGCTTCTGCTGTTCTTGAA	0.403																																					p.A4413D		Atlas-SNP	.											.	DNAH8	1239	.	0			c.C13238A						PASS	.						139.0	141.0	140.0					6																	38976613		2203	4300	6503	SO:0001583	missense	1769	exon89			CTTCTGCTGTTCT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12587C>A	chr6.hg19:g.38976613C>A	ENSP00000352312:p.Ala4196Asp	129.0	0.0	.		132.0	31.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	C	9.309	1.055145	0.19907	.	.	ENSG00000124721	ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.08458	3.09;3.09;3.09	5.68	0.0947	0.14482	Dynein heavy chain (1);	0.691017	0.13632	N	0.373632	T	0.00815	0.0027	N	0.02420	-0.555	0.32197	N	0.578309	B	0.02656	0.0	B	0.04013	0.001	T	0.47861	-0.9084	10	0.09843	T	0.71	.	9.2075	0.37298	0.6484:0.1727:0.1789:0.0	.	4196	Q96JB1	DYH8_HUMAN	D	4401;4196;4160	ENSP00000333363:A4401D;ENSP00000352312:A4196D;ENSP00000402294:A4160D	ENSP00000333363:A4401D	A	+	2	0	DNAH8	39084591	0.890000	0.30428	0.949000	0.38748	0.993000	0.82548	1.792000	0.38754	0.235000	0.21160	0.650000	0.86243	GCT	.	.	.	none		0.403	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TTBK1	84630	hgsc.bcm.edu	37	6	43250879	43250879	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr6:43250879C>T	ENST00000259750.4	+	14	2484	c.2401C>T	c.(2401-2403)Cag>Tag	p.Q801*		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	801					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TGACCGGAGCCAGGAGGGTGC	0.682																																					p.Q801X		Atlas-SNP	.											.	TTBK1	124	.	0			c.C2401T						PASS	.						9.0	9.0	9.0					6																	43250879		2191	4284	6475	SO:0001587	stop_gained	84630	exon14			CGGAGCCAGGAGG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2401C>T	chr6.hg19:g.43250879C>T	ENSP00000259750:p.Gln801*	94.0	0.0	.		103.0	20.0	.	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Nonsense_Mutation	SNP	ENST00000259750.4	hg19	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	C	37	6.087026	0.97271	.	.	ENSG00000146216	ENST00000259750	.	.	.	4.62	4.62	0.57501	.	0.184674	0.35179	N	0.003390	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	16.2343	0.82363	0.0:1.0:0.0:0.0	.	.	.	.	X	801	.	ENSP00000259750:Q801X	Q	+	1	0	TTBK1	43358857	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	5.728000	0.68531	2.099000	0.63709	0.561000	0.74099	CAG	.	.	.	none		0.682	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
SCML4	256380	hgsc.bcm.edu	37	6	108093476	108093476	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr6:108093476G>A	ENST00000369020.3	-	2	301	c.56C>T	c.(55-57)aCg>aTg	p.T19M	SCML4_ENST00000369022.2_Intron	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		CTTCATAGGCGTGGAGTGAAG	0.512																																					p.T19M		Atlas-SNP	.											.	SCML4	65	.	0			c.C56T						PASS	.						136.0	130.0	132.0					6																	108093476		692	1591	2283	SO:0001583	missense	256380	exon2			ATAGGCGTGGAGT		CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.56C>T	chr6.hg19:g.108093476G>A	ENSP00000358016:p.Thr19Met	113.0	0.0	.		115.0	18.0	.	NM_198081	B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	hg19	CCDS5060.2	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930166	0.52759	.	.	ENSG00000146285	ENST00000369020	T	0.47528	0.84	5.35	5.35	0.76521	AT hook, DNA-binding motif (1);	.	.	.	.	T	0.25865	0.0630	N	0.22421	0.69	0.42132	D	0.991477	D;P	0.67145	0.996;0.834	B;B	0.43809	0.432;0.34	T	0.08554	-1.0716	9	0.56958	D	0.05	.	13.7945	0.63162	0.0:0.0:0.8467:0.1533	.	19;19	B4E0X3;Q8N228	.;SCML4_HUMAN	M	19	ENSP00000358016:T19M	ENSP00000358016:T19M	T	-	2	0	SCML4	108200169	0.537000	0.26386	0.010000	0.14722	0.973000	0.67179	4.366000	0.59492	2.789000	0.95967	0.655000	0.94253	ACG	.	.	.	none		0.512	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128	
BCLAF1	9774	hgsc.bcm.edu	37	6	136599311	136599311	+	Silent	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr6:136599311A>G	ENST00000531224.1	-	4	960	c.708T>C	c.(706-708)ccT>ccC	p.P236P	BCLAF1_ENST00000392348.2_Silent_p.P234P|BCLAF1_ENST00000353331.4_Silent_p.P234P|BCLAF1_ENST00000527536.1_Silent_p.P236P|BCLAF1_ENST00000530767.1_Silent_p.P236P|BCLAF1_ENST00000527759.1_Silent_p.P234P	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	236					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AACTCTGACTAGGTGGTGTAG	0.448																																					p.P236P	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.	BCLAF1	203	.	0			c.T708C						PASS	.						194.0	183.0	186.0					6																	136599311		2203	4300	6503	SO:0001819	synonymous_variant	9774	exon4			CTGACTAGGTGGT	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.708T>C	chr6.hg19:g.136599311A>G		98.0	0.0	.		109.0	17.0	.	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Silent	SNP	ENST00000531224.1	hg19	CCDS5177.1																																																																																			.	.	.	none		0.448	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
CNKSR3	154043	hgsc.bcm.edu	37	6	154771340	154771340	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr6:154771340G>A	ENST00000607772.1	-	2	649	c.105C>T	c.(103-105)atC>atT	p.I35I	CNKSR3_ENST00000479339.1_5'UTR	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	35	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		GCTCGCCGTTGATCTTCTCTC	0.507																																					p.I35I		Atlas-SNP	.											.	CNKSR3	56	.	0			c.C105T						PASS	.						120.0	114.0	116.0					6																	154771340		2203	4300	6503	SO:0001819	synonymous_variant	154043	exon2			GCCGTTGATCTTC	AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.105C>T	chr6.hg19:g.154771340G>A		87.0	0.0	.		78.0	23.0	.	NM_173515	Q5SGD5|Q96N65	Silent	SNP	ENST00000607772.1	hg19	CCDS5246.1																																																																																			.	.	.	none		0.507	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515	
EIF3B	8662	hgsc.bcm.edu	37	7	2409282	2409282	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr7:2409282T>A	ENST00000360876.4	+	10	1635	c.1579T>A	c.(1579-1581)Tgt>Agt	p.C527S	EIF3B_ENST00000397011.2_Missense_Mutation_p.C527S	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		AGACTACTTGTGTGTGAAAGT	0.507																																					p.C527S		Atlas-SNP	.											.	EIF3B	54	.	0			c.T1579A						PASS	.						111.0	101.0	104.0					7																	2409282		2203	4300	6503	SO:0001583	missense	8662	exon10			TACTTGTGTGTGA	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1579T>A	chr7.hg19:g.2409282T>A	ENSP00000354125:p.Cys527Ser	95.0	0.0	.		95.0	19.0	.	NM_001037283		Missense_Mutation	SNP	ENST00000360876.4	hg19	CCDS5332.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.099575	0.76983	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.05382	3.45;3.45	5.77	5.77	0.91146	Translation initiation factor 2A, beta propellor-like domain (1);Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.33614	0.0869	M	0.92923	3.36	0.80722	D	1	D	0.56287	0.975	D	0.65773	0.938	T	0.38520	-0.9657	10	0.87932	D	0	-25.5088	16.383	0.83481	0.0:0.0:0.0:1.0	.	527	P55884	EIF3B_HUMAN	S	527;527;527;451	ENSP00000354125:C527S;ENSP00000380206:C527S	ENSP00000316638:C527S	C	+	1	0	EIF3B	2375808	1.000000	0.71417	0.926000	0.36857	0.559000	0.35586	7.796000	0.85898	2.326000	0.78906	0.533000	0.62120	TGT	.	.	.	none		0.507	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1		
CDK14	5218	hgsc.bcm.edu	37	7	90547017	90547017	+	Silent	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr7:90547017G>T	ENST00000380050.3	+	8	935	c.804G>T	c.(802-804)ggG>ggT	p.G268G	CDK14_ENST00000436577.2_Silent_p.G139G|CDK14_ENST00000406263.1_Silent_p.G222G|CDK14_ENST00000265741.3_Silent_p.G250G			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	268	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GTGACACGGGGGAGTTAAAGC	0.438																																					p.G250G	GBM(83;1228 1256 8311 16577 31299)	Atlas-SNP	.											.	CDK14	153	.	0			c.G750T						PASS	.						118.0	116.0	117.0					7																	90547017		2203	4300	6503	SO:0001819	synonymous_variant	5218	exon7			CACGGGGGAGTTA		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.804G>T	chr7.hg19:g.90547017G>T		129.0	0.0	.		118.0	9.0	.	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Silent	SNP	ENST00000380050.3	hg19																																																																																				.	.	.	none		0.438	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
TTI2	80185	hgsc.bcm.edu	37	8	33364813	33364813	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr8:33364813G>A	ENST00000431156.2	-	4	1479	c.861C>T	c.(859-861)aaC>aaT	p.N287N	TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000360742.5_Silent_p.N287N|TTI2_ENST00000520636.1_Intron	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	287																	CCTGGGCTCTGTTATACTGGA	0.428																																					p.N287N		Atlas-SNP	.											.	.	.	.	0			c.C861T						PASS	.						142.0	117.0	125.0					8																	33364813		2203	4300	6503	SO:0001819	synonymous_variant	80185	exon4			GGCTCTGTTATAC	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.861C>T	chr8.hg19:g.33364813G>A		166.0	0.0	.		167.0	39.0	.	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Silent	SNP	ENST00000431156.2	hg19	CCDS6090.1																																																																																			.	.	.	none		0.428	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
SOX17	64321	hgsc.bcm.edu	37	8	55370847	55370847	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr8:55370847C>G	ENST00000297316.4	+	1	353	c.149C>G	c.(148-150)gCg>gGg	p.A50G		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	50					angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			GAGGCGCCGGCGAACAGCGGA	0.736																																					p.A50G		Atlas-SNP	.											.	SOX17	37	.	0			c.C149G						PASS	.						8.0	11.0	10.0					8																	55370847		2132	4192	6324	SO:0001583	missense	64321	exon1			CGCCGGCGAACAG	AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.149C>G	chr8.hg19:g.55370847C>G	ENSP00000297316:p.Ala50Gly	33.0	0.0	.		41.0	9.0	.	NM_022454		Missense_Mutation	SNP	ENST00000297316.4	hg19	CCDS6159.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275942	0.59649	.	.	ENSG00000164736	ENST00000297316	D	0.97256	-4.31	4.45	2.5	0.30297	High mobility group, superfamily (1);	0.135798	0.49305	D	0.000146	D	0.93200	0.7834	L	0.53249	1.67	0.28938	N	0.891172	B	0.12630	0.006	B	0.10450	0.005	D	0.84162	0.0429	10	0.22109	T	0.4	.	4.3996	0.11379	0.1554:0.601:0.1519:0.0917	.	50	Q9H6I2	SOX17_HUMAN	G	50	ENSP00000297316:A50G	ENSP00000297316:A50G	A	+	2	0	SOX17	55533400	0.266000	0.24112	0.987000	0.45799	0.817000	0.46193	2.262000	0.43285	1.225000	0.43566	0.561000	0.74099	GCG	.	.	.	none		0.736	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378526.2		
RPS20	6224	hgsc.bcm.edu	37	8	56986652	56986652	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr8:56986652G>T	ENST00000521262.1	-	2	323	c.70C>A	c.(70-72)Cta>Ata	p.L24I	RPS20_ENST00000519606.1_Missense_Mutation_p.L24I|RPS20_ENST00000519807.1_Missense_Mutation_p.L24I|SNORD54_ENST00000459159.1_RNA|RPS20_ENST00000520490.1_5'UTR|RPS20_ENST00000523936.1_Missense_Mutation_p.L24I|RPS20_ENST00000524349.1_5'UTR|RPS20_ENST00000520627.1_Intron|RPS20_ENST00000518875.1_Missense_Mutation_p.L24I|RPS20_ENST00000009589.3_Missense_Mutation_p.L24I|CTA-397H3.3_ENST00000521403.1_RNA			P60866	RS20_HUMAN	ribosomal protein S20	24					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)						all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)			CGGCTTGTTAGGGTGATTCGA	0.468																																					p.L24I		Atlas-SNP	.											.	RPS20	16	.	0			c.C70A						PASS	.						72.0	77.0	75.0					8																	56986652		2203	4300	6503	SO:0001583	missense	6224	exon2			TTGTTAGGGTGAT	L06498	CCDS6163.1, CCDS55231.1	8q12.1	2011-04-05				ENSG00000008988		"""S ribosomal proteins"""	10405	protein-coding gene	gene with protein product		603682				9582194, 8479924	Standard	NM_001023		Approved	S20	uc003xsm.2	P60866		ENST00000521262.1:c.70C>A	chr8.hg19:g.56986652G>T	ENSP00000427788:p.Leu24Ile	31.0	0.0	.		29.0	11.0	.	NM_001146227	B2R4F4|B4DW28|P17075|Q5M8S9	Missense_Mutation	SNP	ENST00000521262.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.59	2.877815	0.51801	.	.	ENSG00000008988	ENST00000519807;ENST00000009589;ENST00000521262;ENST00000523936;ENST00000519606;ENST00000518875	.	.	.	5.17	3.38	0.38709	.	0.000000	0.64402	D	0.000001	T	0.80292	0.4596	M	0.92077	3.27	0.80722	D	1	P;D	0.54772	0.824;0.968	D;P	0.72338	0.977;0.785	T	0.79288	-0.1865	9	0.72032	D	0.01	-24.3785	6.6251	0.22824	0.4059:0.0:0.5941:0.0	.	24;24	P60866;B4DW28	RS20_HUMAN;.	I	24	.	ENSP00000009589:L24I	L	-	1	2	RPS20	57149206	1.000000	0.71417	0.010000	0.14722	0.016000	0.09150	3.119000	0.50422	0.588000	0.29660	0.655000	0.94253	CTA	.	.	.	none		0.468	RPS20-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000378166.1	NM_001023	
CRISPLD1	83690	hgsc.bcm.edu	37	8	75925137	75925137	+	Silent	SNP	G	G	A	rs369100451		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr8:75925137G>A	ENST00000262207.4	+	4	858	c.390G>A	c.(388-390)ccG>ccA	p.P130P	CRISPLD1_ENST00000517786.1_5'UTR|CRISPLD1_ENST00000523524.1_5'UTR	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	130	SCP.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			ATAGGCCCCCGACGTTTCATG	0.378																																					p.P130P		Atlas-SNP	.											CRISPLD1,NS,carcinoma,0,1	CRISPLD1	94	.	0			c.G390A						PASS	.	G		0,4406		0,0,2203	102.0	96.0	98.0		390	0.2	1.0	8		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CRISPLD1	NM_031461.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		130/501	75925137	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	83690	exon4			GCCCCCGACGTTT	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.390G>A	chr8.hg19:g.75925137G>A		105.0	2.0	.		89.0	17.0	.	NM_031461	B2RA60|B7Z929	Silent	SNP	ENST00000262207.4	hg19	CCDS6219.1																																																																																			.	.	.	weak		0.378	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
JAK2	3717	hgsc.bcm.edu	37	9	5081774	5081774	+	Silent	SNP	T	T	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr9:5081774T>A	ENST00000381652.3	+	19	2978	c.2484T>A	c.(2482-2484)ggT>ggA	p.G828G	JAK2_ENST00000539801.1_Silent_p.G828G|AL161450.1_ENST00000601793.1_Intron|JAK2_ENST00000544510.1_Silent_p.G679G	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	828					actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TGAGGATAGGTGCCCTGGGGT	0.363		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.G828G		Atlas-SNP	.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2	35466	.	0			c.T2484A						PASS	.						110.0	111.0	111.0					9																	5081774		2203	4300	6503	SO:0001819	synonymous_variant	3717	exon19	Familial Cancer Database		GATAGGTGCCCTG		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.2484T>A	chr9.hg19:g.5081774T>A		105.0	0.0	.		122.0	25.0	.	NM_004972	O14636|O75297	Silent	SNP	ENST00000381652.3	hg19	CCDS6457.1																																																																																			.	.	.	none		0.363	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
DAB2IP	153090	hgsc.bcm.edu	37	9	124526156	124526156	+	Silent	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr9:124526156C>T	ENST00000408936.3	+	8	1640	c.1458C>T	c.(1456-1458)taC>taT	p.Y486Y	DAB2IP_ENST00000309989.1_Silent_p.Y362Y|DAB2IP_ENST00000259371.2_Silent_p.Y458Y			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	486	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						TCAACTCCTACTGGTCAGTGC	0.622																																					p.Y458Y		Atlas-SNP	.											.	DAB2IP	150	.	0			c.C1374T						PASS	.						110.0	89.0	96.0					9																	124526156		2203	4300	6503	SO:0001819	synonymous_variant	153090	exon8			CTCCTACTGGTCA	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.1458C>T	chr9.hg19:g.124526156C>T		80.0	0.0	.		77.0	22.0	.	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	ENST00000408936.3	hg19																																																																																				.	.	.	none		0.622	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
TTC16	158248	hgsc.bcm.edu	37	9	130485525	130485525	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr9:130485525C>A	ENST00000373289.3	+	7	865	c.785C>A	c.(784-786)gCt>gAt	p.A262D	PTRH1_ENST00000419060.1_Intron|TTC16_ENST00000489226.1_3'UTR|PTRH1_ENST00000429848.1_Intron|TTC16_ENST00000393748.4_Missense_Mutation_p.A86D	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	262										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						GGGATCCTGGCTGTGCAGGGC	0.632																																					p.A262D		Atlas-SNP	.											.	TTC16	55	.	0			c.C785A						PASS	.						73.0	63.0	66.0					9																	130485525		2203	4300	6503	SO:0001583	missense	158248	exon7			TCCTGGCTGTGCA	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.785C>A	chr9.hg19:g.130485525C>A	ENSP00000362386:p.Ala262Asp	57.0	0.0	.		45.0	12.0	.	NM_144965	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	hg19	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592520	0.46214	.	.	ENSG00000167094	ENST00000373289;ENST00000393748;ENST00000316259	T;T	0.63580	-0.05;0.19	5.03	5.03	0.67393	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77096	0.4080	M	0.75615	2.305	0.37008	D	0.895586	D;D;D	0.89917	1.0;0.991;1.0	D;D;D	0.97110	1.0;0.944;1.0	T	0.79027	-0.1971	10	0.36615	T	0.2	-22.1378	13.7181	0.62710	0.0:1.0:0.0:0.0	.	249;214;262	B4DZ42;B4DH05;Q8NEE8	.;.;TTC16_HUMAN	D	262;86;207	ENSP00000362386:A262D;ENSP00000377349:A86D	ENSP00000319048:A207D	A	+	2	0	TTC16	129525346	0.984000	0.35163	0.496000	0.27539	0.082000	0.17680	3.469000	0.53093	2.623000	0.88846	0.462000	0.41574	GCT	.	.	.	none		0.632	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	
QRFP	347148	hgsc.bcm.edu	37	9	133768991	133768991	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr9:133768991T>A	ENST00000343079.1	-	1	234	c.235A>T	c.(235-237)Aga>Tga	p.R79*		NM_198180.1	NP_937823.1			pyroglutamylated RFamide peptide											cervix(1)|endometrium(3)|lung(1)|skin(2)	7	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.17e-05)|Epithelial(140;0.000267)		GCATGCTCTCTGCCCGATGTC	0.672																																					p.R79X		Atlas-SNP	.											.	QRFP	14	.	0			c.A235T						PASS	.						60.0	62.0	61.0					9																	133768991		2203	4300	6503	SO:0001587	stop_gained	347148	exon1			GCTCTCTGCCCGA	AB109625	CCDS6936.1	9q34.12	2013-02-28			ENSG00000188710	ENSG00000188710		"""Endogenous ligands"""	29982	protein-coding gene	gene with protein product	"""prepro-QRFP"""	609795				12714592, 15808908	Standard	NM_198180		Approved	26RFa, P518	uc011mcb.2	P83859	OTTHUMG00000131663	ENST00000343079.1:c.235A>T	chr9.hg19:g.133768991T>A	ENSP00000345487:p.Arg79*	79.0	0.0	.		84.0	20.0	.	NM_198180		Nonsense_Mutation	SNP	ENST00000343079.1	hg19	CCDS6936.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459665	0.63401	.	.	ENSG00000188710	ENST00000343079	.	.	.	4.65	-0.931	0.10438	.	0.790949	0.10741	N	0.639422	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0344	6.0641	0.19854	0.0:0.1555:0.4051:0.4393	.	.	.	.	X	79	.	ENSP00000345487:R79X	R	-	1	2	QRFP	132758812	0.000000	0.05858	0.000000	0.03702	0.257000	0.26127	-0.356000	0.07661	-0.361000	0.08125	0.379000	0.24179	AGA	.	.	.	none		0.672	QRFP-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254566.1	NM_198180	
ITIH5	80760	hgsc.bcm.edu	37	10	7683994	7683994	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:7683994G>A	ENST00000256861.6	-	3	273	c.195C>T	c.(193-195)gcC>gcT	p.A65A	ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397145.2_Silent_p.A65A|ITIH5_ENST00000397146.2_Silent_p.A65A|ITIH5_ENST00000434980.1_5'Flank	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	65	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CCGTAGTGAAGGCATAACGGG	0.438																																					p.A65A		Atlas-SNP	.											.	ITIH5	343	.	0			c.C195T						PASS	.						151.0	135.0	140.0					10																	7683994		2203	4300	6503	SO:0001819	synonymous_variant	80760	exon3			AGTGAAGGCATAA			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.195C>T	chr10.hg19:g.7683994G>A		161.0	0.0	.		143.0	11.0	.	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	hg19																																																																																				.	.	.	none		0.438	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
SLC16A9	220963	hgsc.bcm.edu	37	10	61424076	61424076	+	Silent	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:61424076A>G	ENST00000395348.3	-	4	981	c.345T>C	c.(343-345)ctT>ctC	p.L115L	SLC16A9_ENST00000395347.1_Silent_p.L115L	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	115					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						AACCACATCCAAGACCTAAGC	0.398																																					p.L115L		Atlas-SNP	.											.	SLC16A9	58	.	0			c.T345C						PASS	.						122.0	114.0	117.0					10																	61424076		2203	4300	6503	SO:0001819	synonymous_variant	220963	exon4			ACATCCAAGACCT	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.345T>C	chr10.hg19:g.61424076A>G		71.0	0.0	.		64.0	19.0	.	NM_194298	Q6ZMI2|Q9UFH8	Silent	SNP	ENST00000395348.3	hg19	CCDS7256.1																																																																																			.	.	.	none		0.398	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
POLR3A	11128	hgsc.bcm.edu	37	10	79744981	79744981	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:79744981G>A	ENST00000372371.3	-	24	3326	c.3189C>T	c.(3187-3189)atC>atT	p.I1063I		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1063					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			CGCCCAGGGTGATGTTCATGG	0.542																																					p.I1063I		Atlas-SNP	.											.	POLR3A	104	.	0			c.C3189T						PASS	.						145.0	140.0	141.0					10																	79744981		2203	4300	6503	SO:0001819	synonymous_variant	11128	exon24			CAGGGTGATGTTC	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3189C>T	chr10.hg19:g.79744981G>A		51.0	0.0	.		75.0	18.0	.	NM_007055	Q8IW34|Q8TCW5	Silent	SNP	ENST00000372371.3	hg19	CCDS7354.1																																																																																			.	.	.	none		0.542	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055	
C10orf76	79591	hgsc.bcm.edu	37	10	103769138	103769138	+	Nonsense_Mutation	SNP	A	A	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:103769138A>C	ENST00000370033.4	-	13	1066	c.947T>G	c.(946-948)tTa>tGa	p.L316*		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	316						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AACCTGAGCTAATACTGTGAT	0.348																																					p.L316X		Atlas-SNP	.											.	C10orf76	48	.	0			c.T947G						PASS	.						229.0	229.0	229.0					10																	103769138		1812	4082	5894	SO:0001587	stop_gained	79591	exon13			TGAGCTAATACTG	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.947T>G	chr10.hg19:g.103769138A>C	ENSP00000359050:p.Leu316*	73.0	0.0	.		79.0	16.0	.	NM_024541	Q2TB87|Q9H8Z9	Nonsense_Mutation	SNP	ENST00000370033.4	hg19	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	A	37	6.589992	0.97688	.	.	ENSG00000120029	ENST00000370033	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4391	13.0603	0.59003	0.8661:0.1339:0.0:0.0	.	.	.	.	X	316	.	ENSP00000359050:L316X	L	-	2	0	C10orf76	103759128	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	8.160000	0.89653	2.326000	0.78906	0.533000	0.62120	TTA	.	.	.	none		0.348	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
SEC23IP	11196	hgsc.bcm.edu	37	10	121689138	121689138	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:121689138C>T	ENST00000369075.3	+	14	2405	c.2333C>T	c.(2332-2334)tCa>tTa	p.S778L	SEC23IP_ENST00000543134.1_Missense_Mutation_p.S567L	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	778					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		GCTTACAACTCATTAGATTTT	0.373																																					p.S778L		Atlas-SNP	.											.	SEC23IP	100	.	0			c.C2333T						PASS	.						167.0	171.0	170.0					10																	121689138		2203	4300	6503	SO:0001583	missense	11196	exon14			ACAACTCATTAGA	AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.2333C>T	chr10.hg19:g.121689138C>T	ENSP00000358071:p.Ser778Leu	162.0	0.0	.		174.0	38.0	.	NM_007190	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	hg19	CCDS7618.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153540	0.57259	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.31247	1.5;1.5	5.62	5.62	0.85841	.	0.316794	0.35013	N	0.003513	T	0.31827	0.0809	L	0.47716	1.5	0.47862	D	0.99953	P;B	0.34977	0.478;0.399	B;B	0.33254	0.16;0.101	T	0.04333	-1.0959	10	0.41790	T	0.15	-14.0611	19.6585	0.95853	0.0:1.0:0.0:0.0	.	567;778	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	L	778;567	ENSP00000358071:S778L;ENSP00000438773:S567L	ENSP00000358071:S778L	S	+	2	0	SEC23IP	121679128	0.007000	0.16637	1.000000	0.80357	0.991000	0.79684	2.352000	0.44080	2.657000	0.90304	0.467000	0.42956	TCA	.	.	.	none		0.373	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
RIC8A	60626	hgsc.bcm.edu	37	11	209732	209732	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:209732A>G	ENST00000526104.1	+	3	1802	c.458A>G	c.(457-459)gAg>gGg	p.E153G	RIC8A_ENST00000325207.5_Missense_Mutation_p.E153G|BET1L_ENST00000486280.1_5'Flank|BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000529614.2_5'Flank|BET1L_ENST00000410108.1_5'Flank|BET1L_ENST00000332865.6_5'Flank|RIC8A_ENST00000527696.1_Missense_Mutation_p.E147G			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	153					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTGTACCGTGAGAGGAGCTTC	0.617																																					p.E153G		Atlas-SNP	.											.	RIC8A	45	.	0			c.A458G						PASS	.						58.0	52.0	54.0					11																	209732		2203	4300	6503	SO:0001583	missense	60626	exon3			ACCGTGAGAGGAG	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.458A>G	chr11.hg19:g.209732A>G	ENSP00000432008:p.Glu153Gly	54.0	0.0	.		53.0	13.0	.	NM_021932	Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	ENST00000526104.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.91|12.91	2.079005|2.079005	0.36662|0.36662	.|.	.|.	ENSG00000177963|ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000528357;ENST00000530889;ENST00000527696;ENST00000527468|ENST00000527728	.|.	.|.	.|.	4.45|4.45	1.98|1.98	0.26296|0.26296	Armadillo-type fold (1);|.	0.388332|.	0.27618|.	N|.	0.018576|.	T|T	0.45796|0.45796	0.1360|0.1360	M|M	0.65498|0.65498	2.005|2.005	0.09310|0.09310	N|N	0.999999|0.999999	P;P;P|.	0.36837|.	0.547;0.571;0.515|.	B;B;B|.	0.37198|.	0.221;0.243;0.156|.	T|T	0.33879|0.33879	-0.9851|-0.9851	9|5	0.37606|.	T|.	0.19|.	-8.9933|-8.9933	7.3499|7.3499	0.26684|0.26684	0.7073:0.1496:0.0:0.143|0.7073:0.1496:0.0:0.143	.|.	147;153;153|.	Q9NPQ8-2;Q9NPQ8;Q9NPQ8-3|.	.;RIC8A_HUMAN;.|.	G|G	153;153;129;157;147;43|35	.|.	ENSP00000325941:E153G|.	E|R	+|+	2|1	0|2	RIC8A|RIC8A	199732|199732	0.977000|0.977000	0.34250|0.34250	0.001000|0.001000	0.08648|0.08648	0.623000|0.623000	0.37688|0.37688	2.748000|2.748000	0.47483|0.47483	0.257000|0.257000	0.21650|0.21650	-0.444000|-0.444000	0.05651|0.05651	GAG|AGA	.	.	.	none		0.617	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000384761.1	NM_021932	
OR10A2	341276	hgsc.bcm.edu	37	11	6891542	6891542	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:6891542C>T	ENST00000307322.4	+	1	619	c.557C>T	c.(556-558)gCc>gTc	p.A186V		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GAGATCTACGCCATCGTCGGA	0.507																																					p.A186V		Atlas-SNP	.											.	OR10A2	55	.	0			c.C557T						PASS	.						241.0	183.0	203.0					11																	6891542		2201	4296	6497	SO:0001583	missense	341276	exon1			TCTACGCCATCGT	BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.557C>T	chr11.hg19:g.6891542C>T	ENSP00000303862:p.Ala186Val	158.0	0.0	.		126.0	28.0	.	NM_001004460	B2RNL9|Q6IFG9	Missense_Mutation	SNP	ENST00000307322.4	hg19	CCDS31415.1	.	.	.	.	.	.	.	.	.	.	c	2.385	-0.341102	0.05243	.	.	ENSG00000170790	ENST00000307322	T	0.00034	8.87	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000019	T	0.00073	0.0002	N	0.00282	-1.705	0.25130	N	0.990577	D	0.76494	0.999	D	0.73708	0.981	T	0.66085	-0.6011	10	0.02654	T	1	.	9.6519	0.39904	0.2081:0.7919:0.0:0.0	.	186	Q9H208	O10A2_HUMAN	V	186	ENSP00000303862:A186V	ENSP00000303862:A186V	A	+	2	0	OR10A2	6848118	0.000000	0.05858	0.985000	0.45067	0.372000	0.29890	0.467000	0.22035	2.356000	0.79943	0.650000	0.86243	GCC	.	.	.	none		0.507	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385984.1	NM_001004460	
MICAL2	9645	hgsc.bcm.edu	37	11	12244191	12244191	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:12244191G>A	ENST00000256194.4	+	11	1638	c.1350G>A	c.(1348-1350)caG>caA	p.Q450Q	MICAL2_ENST00000342902.5_Silent_p.Q450Q|MICAL2_ENST00000537344.1_Silent_p.Q450Q|MICAL2_ENST00000379612.3_Silent_p.Q450Q|MICAL2_ENST00000527546.1_Silent_p.Q450Q	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	450	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		TGTTACCTCAGACAACCCCGG	0.572																																					p.Q450Q		Atlas-SNP	.											.	MICAL2	114	.	0			c.G1350A						PASS	.						93.0	75.0	81.0					11																	12244191		2201	4294	6495	SO:0001819	synonymous_variant	9645	exon11			ACCTCAGACAACC	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.1350G>A	chr11.hg19:g.12244191G>A		34.0	0.0	.		34.0	10.0	.	NM_014632	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Silent	SNP	ENST00000256194.4	hg19	CCDS7809.1																																																																																			.	.	.	none		0.572	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
OR5AS1	219447	hgsc.bcm.edu	37	11	55798423	55798423	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:55798423T>G	ENST00000313555.1	+	1	529	c.529T>G	c.(529-531)Ttt>Gtt	p.F177V		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					CGTCAATCATTTTTTCTGTGA	0.443																																					p.F177V		Atlas-SNP	.											.	OR5AS1	121	.	0			c.T529G						PASS	.						266.0	261.0	263.0					11																	55798423		2201	4296	6497	SO:0001583	missense	219447	exon1			AATCATTTTTTCT	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.529T>G	chr11.hg19:g.55798423T>G	ENSP00000324111:p.Phe177Val	240.0	0.0	.		241.0	56.0	.	NM_001001921	Q6IFB8	Missense_Mutation	SNP	ENST00000313555.1	hg19	CCDS31516.1	.	.	.	.	.	.	.	.	.	.	T	11.96	1.793640	0.31685	.	.	ENSG00000181785	ENST00000313555	T	0.00350	7.98	5.46	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35805	U	0.002971	T	0.01092	0.0036	M	0.93150	3.385	0.09310	N	0.999993	D	0.89917	1.0	D	0.87578	0.998	T	0.20338	-1.0278	10	0.54805	T	0.06	.	11.6	0.50997	0.0:0.0:0.1495:0.8505	.	177	Q8N127	O5AS1_HUMAN	V	177	ENSP00000324111:F177V	ENSP00000324111:F177V	F	+	1	0	OR5AS1	55554999	0.995000	0.38212	0.667000	0.29798	0.142000	0.21351	2.802000	0.47916	0.882000	0.36016	0.523000	0.50628	TTT	.	.	.	none		0.443	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921	
OR5M10	390167	hgsc.bcm.edu	37	11	56344355	56344355	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:56344355C>A	ENST00000526812.2	-	1	908	c.843G>T	c.(841-843)ttG>ttT	p.L281F		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						GCATTGGGCTCAAAAAAGTAT	0.393																																					p.L281F		Atlas-SNP	.											.	OR5M10	56	.	0			c.G843T						PASS	.						189.0	187.0	188.0					11																	56344355		1827	4083	5910	SO:0001583	missense	390167	exon1			TGGGCTCAAAAAA	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.843G>T	chr11.hg19:g.56344355C>A	ENSP00000436004:p.Leu281Phe	244.0	0.0	.		250.0	47.0	.	NM_001004741	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	hg19	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.034578	0.54896	.	.	ENSG00000254834	ENST00000526812	T	0.00202	8.56	4.2	1.22	0.21188	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	N	0.21282	0.65	0.24031	N	0.996113	D	0.53151	0.958	P	0.55455	0.776	T	0.54248	-0.8322	9	0.87932	D	0	.	5.4515	0.16568	0.0:0.5849:0.1474:0.2677	.	281	Q6IEU7	OR5MA_HUMAN	F	281	ENSP00000436004:L281F	ENSP00000436004:L281F	L	-	3	2	OR5M10	56100931	0.000000	0.05858	0.819000	0.32651	0.878000	0.50629	-1.843000	0.01680	0.149000	0.19098	0.632000	0.83419	TTG	.	.	.	none		0.393	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
FAM111B	374393	hgsc.bcm.edu	37	11	58893342	58893342	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:58893342C>A	ENST00000343597.3	+	4	1963	c.1772C>A	c.(1771-1773)aCt>aAt	p.T591N	FAM111B_ENST00000529618.1_Missense_Mutation_p.T561N|FAM111B_ENST00000411426.1_Missense_Mutation_p.T561N	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	591							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						GATGGTTGTACTGTGATTCCT	0.383																																					p.T591N		Atlas-SNP	.											.	FAM111B	84	.	0			c.C1772A						PASS	.						126.0	110.0	115.0					11																	58893342		2201	4295	6496	SO:0001583	missense	374393	exon4			GTTGTACTGTGAT	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.1772C>A	chr11.hg19:g.58893342C>A	ENSP00000341565:p.Thr591Asn	132.0	0.0	.		143.0	35.0	.	NM_198947	B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	hg19	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	C	11.22	1.573566	0.28092	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	T;T;T	0.33438	1.41;1.41;1.41	4.62	2.75	0.32379	Peptidase cysteine/serine, trypsin-like (1);	0.662303	0.13892	N	0.355572	T	0.23249	0.0562	L	0.27053	0.805	0.09310	N	1	B	0.33413	0.411	B	0.37346	0.247	T	0.17776	-1.0358	10	0.56958	D	0.05	.	7.9224	0.29854	0.0:0.8058:0.0:0.1942	.	591	Q6SJ93	F111B_HUMAN	N	561;561;591	ENSP00000393855:T561N;ENSP00000432875:T561N;ENSP00000341565:T591N	ENSP00000341565:T591N	T	+	2	0	FAM111B	58649918	0.000000	0.05858	0.001000	0.08648	0.166000	0.22503	-0.344000	0.07780	0.571000	0.29365	0.650000	0.86243	ACT	.	.	.	none		0.383	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
TMEM132A	54972	hgsc.bcm.edu	37	11	60704300	60704300	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:60704300G>C	ENST00000453848.2	+	11	3151	c.2993G>C	c.(2992-2994)cGc>cCc	p.R998P	TMEM132A_ENST00000005286.4_Missense_Mutation_p.R999P			Q24JP5	T132A_HUMAN	transmembrane protein 132A	998	Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						GAGGACATCCGCTGGGTGTGT	0.627																																					p.R999P		Atlas-SNP	.											.	TMEM132A	135	.	0			c.G2996C						PASS	.						33.0	41.0	38.0					11																	60704300		2203	4299	6502	SO:0001583	missense	54972	exon11			ACATCCGCTGGGT	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2993G>C	chr11.hg19:g.60704300G>C	ENSP00000405823:p.Arg998Pro	36.0	0.0	.		46.0	12.0	.	NM_017870	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	hg19	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965535	0.53507	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	T;T	0.05925	3.37;3.37	4.55	3.63	0.41609	.	0.492294	0.18280	N	0.146041	T	0.13415	0.0325	L	0.47716	1.5	0.34714	D	0.728022	D;D	0.71674	0.998;0.998	P;P	0.59643	0.861;0.861	T	0.13361	-1.0512	10	0.87932	D	0	-19.0101	7.9668	0.30104	0.0827:0.0:0.7597:0.1576	.	998;999	Q24JP5;Q24JP5-2	T132A_HUMAN;.	P	749;998;999	ENSP00000405823:R998P;ENSP00000005286:R999P	ENSP00000005286:R999P	R	+	2	0	TMEM132A	60460876	0.286000	0.24305	1.000000	0.80357	0.998000	0.95712	1.948000	0.40303	1.282000	0.44496	0.655000	0.94253	CGC	.	.	.	none		0.627	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
CPT1A	1374	hgsc.bcm.edu	37	11	68571538	68571538	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:68571538G>T	ENST00000265641.5	-	5	639	c.485C>A	c.(484-486)cCc>cAc	p.P162H	CPT1A_ENST00000540367.1_Missense_Mutation_p.P162H|CPT1A_ENST00000539743.1_Missense_Mutation_p.P162H|CPT1A_ENST00000376618.2_Missense_Mutation_p.P162H	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	162					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GTACAACATGGGTTTTCGGCC	0.498																																					p.P162H		Atlas-SNP	.											.	CPT1A	89	.	0			c.C485A						PASS	.						97.0	88.0	91.0					11																	68571538		2200	4294	6494	SO:0001583	missense	1374	exon5			AACATGGGTTTTC	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.485C>A	chr11.hg19:g.68571538G>T	ENSP00000265641:p.Pro162His	62.0	0.0	.		88.0	18.0	.	NM_001876	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	hg19	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056444	0.76074	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96	5.11	4.2	0.49525	.	0.053589	0.85682	D	0.000000	D	0.92625	0.7657	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.80764	0.987;0.967;0.994	D	0.93446	0.6798	10	0.72032	D	0.01	.	13.5493	0.61723	0.0755:0.0:0.9245:0.0	.	162;162;162	B2RAQ8;P50416;P50416-2	.;CPT1A_HUMAN;.	H	162	ENSP00000439084:P162H;ENSP00000365803:P162H;ENSP00000265641:P162H;ENSP00000446108:P162H	ENSP00000265641:P162H	P	-	2	0	CPT1A	68328114	1.000000	0.71417	0.590000	0.28732	0.888000	0.51559	9.426000	0.97469	1.162000	0.42619	0.591000	0.81541	CCC	.	.	.	none		0.498	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
PCF11	51585	hgsc.bcm.edu	37	11	82877674	82877674	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:82877674A>G	ENST00000298281.4	+	5	2187	c.1735A>G	c.(1735-1737)Act>Gct	p.T579A		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	579					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AAAGTCAGGCACTGAACCAAA	0.393																																					p.T579A		Atlas-SNP	.											.	PCF11	220	.	0			c.A1735G						PASS	.						64.0	64.0	64.0					11																	82877674		1850	4075	5925	SO:0001583	missense	51585	exon5			TCAGGCACTGAAC	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1735A>G	chr11.hg19:g.82877674A>G	ENSP00000298281:p.Thr579Ala	80.0	0.0	.		83.0	16.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	7.818	0.717156	0.15372	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.42131	1.99;0.98;0.99	6.07	-8.05	0.01106	.	1.378680	0.04525	N	0.385316	T	0.18130	0.0435	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10337	-1.0634	9	.	.	.	.	2.4752	0.04574	0.2456:0.0806:0.1902:0.4836	.	579;579	E9PQ01;O94913	.;PCF11_HUMAN	A	579	ENSP00000298281:T579A;ENSP00000434540:T579A;ENSP00000431567:T579A	.	T	+	1	0	PCF11	82555322	0.000000	0.05858	0.178000	0.23040	0.985000	0.73830	-0.195000	0.09546	-1.112000	0.02984	0.533000	0.62120	ACT	.	.	.	none		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
GPD1	2819	hgsc.bcm.edu	37	12	50500627	50500627	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr12:50500627T>C	ENST00000301149.3	+	5	771	c.539T>C	c.(538-540)cTg>cCg	p.L180P	GPD1_ENST00000547190.1_3'UTR|GPD1_ENST00000548814.1_Missense_Mutation_p.L157P	NM_001257199.1|NM_005276.3	NP_001244128.1|NP_005267.2	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	180					cellular lipid metabolic process (GO:0044255)|cellular response to cAMP (GO:0071320)|cellular response to tumor necrosis factor (GO:0071356)|gluconeogenesis (GO:0006094)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophosphate shuttle (GO:0006127)|glycerophospholipid biosynthetic process (GO:0046474)|NADH oxidation (GO:0006116)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrion (GO:0005739)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|NAD binding (GO:0051287)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						CTGAAAGAGCTGATGCAGACA	0.498																																					p.L180P	NSCLC(141;1402 1905 9497 13391 44868)	Atlas-SNP	.											.	GPD1	23	.	0			c.T539C						PASS	.						64.0	58.0	60.0					12																	50500627		2203	4300	6503	SO:0001583	missense	2819	exon5			AAGAGCTGATGCA		CCDS8799.1, CCDS58229.1	12q13.12	2013-09-20			ENSG00000167588	ENSG00000167588	1.1.1.8		4455	protein-coding gene	gene with protein product		138420					Standard	NM_005276		Approved		uc001rvz.4	P21695	OTTHUMG00000169813	ENST00000301149.3:c.539T>C	chr12.hg19:g.50500627T>C	ENSP00000301149:p.Leu180Pro	32.0	0.0	.		50.0	11.0	.	NM_005276	F8W1L5|Q8N1B0	Missense_Mutation	SNP	ENST00000301149.3	hg19	CCDS8799.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.604642	0.87157	.	.	ENSG00000167588	ENST00000301149;ENST00000547190;ENST00000548814	T;T	0.59364	0.27;0.27	5.39	5.39	0.77823	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.84497	0.5485	H	0.97659	4.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.99;1.0	D	0.90186	0.4246	10	0.87932	D	0	-14.9432	15.7152	0.77663	0.0:0.0:0.0:1.0	.	157;180	F8W1L5;P21695	.;GPDA_HUMAN	P	180;180;157	ENSP00000301149:L180P;ENSP00000446768:L157P	ENSP00000301149:L180P	L	+	2	0	GPD1	48786894	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	8.040000	0.89188	2.184000	0.69523	0.459000	0.35465	CTG	.	.	.	none		0.498	GPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406018.1		
PCBP2	5094	hgsc.bcm.edu	37	12	53848614	53848614	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr12:53848614A>C	ENST00000439930.3	+	1	52	c.30A>C	c.(28-30)ttA>ttC	p.L10F	PCBP2_ENST00000603815.1_Missense_Mutation_p.L10F|PCBP2_ENST00000546463.1_Missense_Mutation_p.L10F|PCBP2_ENST00000359462.5_Missense_Mutation_p.L10F|PCBP2_ENST00000552819.1_Missense_Mutation_p.L10F|RP11-793H13.8_ENST00000547717.1_RNA|PCBP2_ENST00000437231.1_Missense_Mutation_p.L10F|PCBP2_ENST00000359282.5_Missense_Mutation_p.L10F|PCBP2_ENST00000549863.1_Missense_Mutation_p.L10F|PCBP2_ENST00000455667.3_Missense_Mutation_p.L10F|PCBP2_ENST00000447282.1_Missense_Mutation_p.L10F|PCBP2_ENST00000552296.2_Missense_Mutation_p.L10F|PCBP2_ENST00000548933.1_Missense_Mutation_p.L10F|PCBP2_ENST00000541275.1_Missense_Mutation_p.L10F			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	10					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						AAGGTGGATTAAATGTCACTC	0.517																																					p.L10F		Atlas-SNP	.											.	PCBP2	38	.	0			c.A30C						PASS	.						148.0	122.0	131.0					12																	53848614		2203	4300	6503	SO:0001583	missense	5094	exon2			TGGATTAAATGTC	BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.30A>C	chr12.hg19:g.53848614A>C	ENSP00000408949:p.Leu10Phe	110.0	0.0	.		109.0	26.0	.	NM_005016	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Missense_Mutation	SNP	ENST00000439930.3	hg19	CCDS44901.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950795	0.73787	.	.	ENSG00000197111	ENST00000541275;ENST00000359282;ENST00000447282;ENST00000437231;ENST00000439930;ENST00000549863;ENST00000359462;ENST00000550927;ENST00000546463;ENST00000550192;ENST00000551104;ENST00000550520;ENST00000552296;ENST00000552083;ENST00000552819;ENST00000455667;ENST00000548933	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50277	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.75;0.87;0.87;0.87;0.87	5.15	5.15	0.70609	.	0.145946	0.46758	D	0.000266	T	0.65903	0.2736	M	0.77820	2.39	0.46981	D	0.999279	D;D;D;D;D;D;D;D;D	0.89917	0.998;1.0;0.999;0.999;0.981;1.0;0.999;1.0;0.999	D;D;D;D;D;D;D;D;D	0.87578	0.98;0.997;0.99;0.979;0.949;0.998;0.979;0.996;0.99	T	0.68622	-0.5360	10	0.56958	D	0.05	.	8.701	0.34325	0.9141:0.0:0.0859:0.0	.	10;10;10;10;10;10;10;10;10	B4DLC0;F8VRG9;Q15366;Q32Q82;G3V0E8;F8VYL7;Q68Y55;Q6IPF4;A8K7X6	.;.;PCBP2_HUMAN;.;.;.;.;.;.	F	10	ENSP00000446130:L10F;ENSP00000352228:L10F;ENSP00000394116:L10F;ENSP00000390304:L10F;ENSP00000408949:L10F;ENSP00000447670:L10F;ENSP00000352438:L10F;ENSP00000448762:L10F;ENSP00000448079:L10F;ENSP00000446601:L10F;ENSP00000448847:L10F;ENSP00000448927:L10F;ENSP00000449070:L10F;ENSP00000388008:L10F;ENSP00000449062:L10F	ENSP00000352228:L10F	L	+	3	2	PCBP2	52134881	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.763000	0.26517	2.171000	0.68590	0.454000	0.30748	TTA	.	.	.	none		0.517	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407545.2	NM_005016	
PAN2	9924	hgsc.bcm.edu	37	12	56720418	56720418	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr12:56720418G>A	ENST00000425394.2	-	7	1621	c.1245C>T	c.(1243-1245)aaC>aaT	p.N415N	PAN2_ENST00000440411.3_Silent_p.N415N|PAN2_ENST00000257931.5_Silent_p.N415N|PAN2_ENST00000548043.1_Silent_p.N415N	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CTGGAGCAGAGTTGGCAGCAG	0.577																																					p.N415N		Atlas-SNP	.											.	PAN2	107	.	0			c.C1245T						PASS	.						43.0	38.0	40.0					12																	56720418		2203	4299	6502	SO:0001819	synonymous_variant	9924	exon7			AGCAGAGTTGGCA	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1245C>T	chr12.hg19:g.56720418G>A		70.0	0.0	.		66.0	23.0	.	NM_014871		Silent	SNP	ENST00000425394.2	hg19	CCDS44922.1																																																																																			.	.	.	none		0.577	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
LRP1	4035	hgsc.bcm.edu	37	12	57548432	57548432	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr12:57548432A>G	ENST00000243077.3	+	8	1641	c.1175A>G	c.(1174-1176)gAa>gGa	p.E392G	LRP1_ENST00000554174.1_Missense_Mutation_p.E392G	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	392					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GACTATATTGAAGTGGTGGAC	0.557																																					p.E392G		Atlas-SNP	.											.	LRP1	428	.	0			c.A1175G						PASS	.						50.0	43.0	45.0					12																	57548432		2203	4297	6500	SO:0001583	missense	4035	exon8			ATATTGAAGTGGT	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.1175A>G	chr12.hg19:g.57548432A>G	ENSP00000243077:p.Glu392Gly	68.0	0.0	.		62.0	18.0	.	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319176	0.41096	.	.	ENSG00000123384	ENST00000243077;ENST00000554174	D;D	0.91124	-2.79;-2.79	4.53	4.53	0.55603	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.93145	0.7817	L	0.60455	1.87	0.49798	D	0.999829	D;B	0.71674	0.998;0.357	D;B	0.70227	0.968;0.108	D	0.92651	0.6133	10	0.45353	T	0.12	.	12.1491	0.54040	1.0:0.0:0.0:0.0	.	392;392	Q07954;Q6PJ72	LRP1_HUMAN;.	G	392	ENSP00000243077:E392G;ENSP00000451737:E392G	ENSP00000243077:E392G	E	+	2	0	LRP1	55834699	1.000000	0.71417	0.994000	0.49952	0.469000	0.32828	9.139000	0.94554	2.039000	0.60335	0.528000	0.53228	GAA	.	.	.	none		0.557	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
FAM19A2	338811	hgsc.bcm.edu	37	12	62148697	62148697	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr12:62148697C>T	ENST00000416284.3	-	3	1799	c.215G>A	c.(214-216)gGg>gAg	p.G72E	FAM19A2_ENST00000551619.1_Missense_Mutation_p.G72E|FAM19A2_ENST00000551449.1_Intron|FAM19A2_ENST00000550003.1_5'UTR	NM_178539.4	NP_848634.1	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A2	72						cytoplasm (GO:0005737)				endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	15			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		TGCCACCTGCCCAGGGAAGCA	0.498																																					p.G72E		Atlas-SNP	.											.	FAM19A2	38	.	0			c.G215A						PASS	.						186.0	125.0	146.0					12																	62148697		2203	4300	6503	SO:0001583	missense	338811	exon3			ACCTGCCCAGGGA	AY325115	CCDS8962.1	12q14.1	2012-10-03			ENSG00000198673	ENSG00000198673			21589	protein-coding gene	gene with protein product						15028294	Standard	NM_178539		Approved	TAFA-2	uc001sqw.3	Q8N3H0	OTTHUMG00000170207	ENST00000416284.3:c.215G>A	chr12.hg19:g.62148697C>T	ENSP00000393987:p.Gly72Glu	95.0	0.0	.		128.0	54.0	.	NM_178539	B3KVV4|Q4G0R9|Q68DK0|Q6GTX6	Missense_Mutation	SNP	ENST00000416284.3	hg19	CCDS8962.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730284	0.89390	.	.	ENSG00000198673	ENST00000416284;ENST00000551619;ENST00000552075;ENST00000549958;ENST00000548780	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.84120	0.5402	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85714	0.1321	8	.	.	.	.	18.8508	0.92227	0.0:1.0:0.0:0.0	.	72	Q8N3H0	F19A2_HUMAN	E	72;72;73;79;73	.	.	G	-	2	0	FAM19A2	60434964	1.000000	0.71417	0.977000	0.42913	0.891000	0.51852	7.752000	0.85141	2.455000	0.83008	0.558000	0.71614	GGG	.	.	.	none		0.498	FAM19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407967.2	NM_178539	
TPTE2	93492	hgsc.bcm.edu	37	13	20048076	20048076	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr13:20048076G>C	ENST00000400230.2	-	6	414	c.370C>G	c.(370-372)Ctt>Gtt	p.L124V	TPTE2_ENST00000382977.4_Missense_Mutation_p.L124V|TPTE2_ENST00000382975.4_Missense_Mutation_p.L124V|TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000382978.1_Missense_Mutation_p.L124V|TPTE2_ENST00000255310.6_Missense_Mutation_p.L87V|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000390680.2_Missense_Mutation_p.L87V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	124					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ACTCGAAGAAGAACATCCATG	0.358																																					p.L124V		Atlas-SNP	.											.	TPTE2	225	.	0			c.C370G						PASS	.						36.0	41.0	39.0					13																	20048076		2198	4290	6488	SO:0001583	missense	93492	exon7			GAAGAAGAACATC	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.370C>G	chr13.hg19:g.20048076G>C	ENSP00000383089:p.Leu124Val	90.0	0.0	.		112.0	31.0	.	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	hg19	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	g	11.47	1.647647	0.29246	.	.	ENSG00000132958	ENST00000382978;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000343548	D;D;D;D;D;D	0.98419	-4.45;-4.92;-4.45;-4.45;-4.92;-4.45	2.33	-0.47	0.12131	Ion transport (1);	0.079005	0.50627	U	0.000114	D	0.96697	0.8922	L	0.49513	1.565	0.26630	N	0.972498	P;P	0.47962	0.903;0.831	P;P	0.53722	0.487;0.733	D	0.92530	0.6032	9	.	.	.	-8.3239	4.9435	0.13978	0.5016:0.0:0.4984:0.0	.	87;124	Q6XPS3-3;Q6XPS3	.;TPTE2_HUMAN	V	124;124;87;87;124;124;124	ENSP00000372438:L124V;ENSP00000383089:L124V;ENSP00000255310:L87V;ENSP00000375098:L87V;ENSP00000372437:L124V;ENSP00000372435:L124V	.	L	-	1	0	TPTE2	18946076	0.997000	0.39634	0.042000	0.18584	0.096000	0.18686	0.842000	0.27627	-0.167000	0.10871	0.411000	0.27672	CTT	.	.	.	none		0.358	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
ATP7B	540	hgsc.bcm.edu	37	13	52513260	52513260	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr13:52513260A>G	ENST00000242839.4	-	17	3782	c.3626T>C	c.(3625-3627)cTg>cCg	p.L1209P	ATP7B_ENST00000482841.1_5'Flank|ATP7B_ENST00000400370.3_Missense_Mutation_p.L779P|ATP7B_ENST00000417240.2_Missense_Mutation_p.L420P|ATP7B_ENST00000418097.2_Missense_Mutation_p.L1144P|ATP7B_ENST00000400366.3_Missense_Mutation_p.L1098P|ATP7B_ENST00000344297.5_Missense_Mutation_p.L1002P|ATP7B_ENST00000448424.2_Missense_Mutation_p.L1131P	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1209					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CATGCTCTGCAGCGTGTGCAC	0.582									Wilson disease																												p.L1209P		Atlas-SNP	.											.	ATP7B	123	.	0			c.T3626C						PASS	.						79.0	84.0	82.0					13																	52513260		2172	4271	6443	SO:0001583	missense	540	exon17	Familial Cancer Database		CTCTGCAGCGTGT	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.3626T>C	chr13.hg19:g.52513260A>G	ENSP00000242839:p.Leu1209Pro	73.0	0.0	.		60.0	16.0	.	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	hg19	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	A	18.39	3.613031	0.66672	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000417240;ENST00000448424;ENST00000400370;ENST00000418097	D;D;D;D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98	5.15	5.15	0.70609	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.99284	0.9750	H	0.96048	3.76	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.999;0.999;0.999;1.0	D	0.98821	1.0747	10	0.87932	D	0	-17.3007	15.1342	0.72549	1.0:0.0:0.0:0.0	.	1131;1161;1144;420;779;1098;1002;1209	E7ET55;B7ZLR4;F5H748;E7EQQ2;F5H562;P35670-3;P35670-2;P35670	.;.;.;.;.;.;.;ATP7B_HUMAN	P	1209;1098;1002;420;1131;779;1144	ENSP00000242839:L1209P;ENSP00000383217:L1098P;ENSP00000342559:L1002P;ENSP00000390360:L420P;ENSP00000416738:L1131P;ENSP00000383221:L779P;ENSP00000393343:L1144P	ENSP00000242839:L1209P	L	-	2	0	ATP7B	51411261	1.000000	0.71417	1.000000	0.80357	0.379000	0.30106	9.081000	0.94049	2.169000	0.68431	0.460000	0.39030	CTG	.	.	.	none		0.582	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
IRG1	730249	hgsc.bcm.edu	37	13	77531223	77531223	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr13:77531223G>C	ENST00000377462.1	+	5	611	c.549G>C	c.(547-549)aaG>aaC	p.K183N	IRG1_ENST00000449753.1_Missense_Mutation_p.K183N	NM_001258406.1	NP_001245335.1	A6NK06	IRG1_HUMAN	immunoresponsive 1 homolog (mouse)	183					cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to progesterone stimulus (GO:0071393)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of type I interferon production (GO:0032480)|positive regulation of antimicrobial humoral response (GO:0002760)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|propionate catabolic process (GO:0019543)|tolerance induction to lipopolysaccharide (GO:0072573)	mitochondrion (GO:0005739)	2-methylcitrate dehydratase activity (GO:0047547)|aconitate decarboxylase activity (GO:0047613)										GCTCGACAAAGTGCCGAGAAG	0.547																																					p.K179N		Atlas-SNP	.											.	IRG1	1	.	0			c.G537C						PASS	.																																			SO:0001583	missense	730249	exon4			GACAAAGTGCCGA		CCDS58299.1	13q22.3	2013-04-29			ENSG00000102794	ENSG00000102794			33904	protein-coding gene	gene with protein product		615275				23610393	Standard	NM_001258406		Approved		uc031qmi.1	A6NK06	OTTHUMG00000017098	ENST00000377462.1:c.549G>C	chr13.hg19:g.77531223G>C	ENSP00000366682:p.Lys183Asn	166.0	0.0	.		154.0	33.0	.	NM_001258406		Missense_Mutation	SNP	ENST00000377462.1	hg19	CCDS58299.1	.	.	.	.	.	.	.	.	.	.	G	9.630	1.136157	0.21123	.	.	ENSG00000102794	ENST00000377462;ENST00000449753	.	.	.	5.78	1.64	0.23874	.	0.353337	0.36703	N	0.002443	T	0.42899	0.1223	L	0.31294	0.92	0.36470	D	0.867224	.	.	.	.	.	.	T	0.45556	-0.9253	7	0.56958	D	0.05	-1.5473	6.2474	0.20827	0.3656:0.1259:0.5085:0.0	.	.	.	.	N	183	.	ENSP00000366682:K183N	K	+	3	2	IRG1	76429224	1.000000	0.71417	0.858000	0.33744	0.431000	0.31685	0.947000	0.29082	0.228000	0.21019	-0.253000	0.11424	AAG	.	.	.	none		0.547	IRG1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045311.1	XM_001133269	
SLITRK1	114798	hgsc.bcm.edu	37	13	84455218	84455218	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr13:84455218A>G	ENST00000377084.2	-	1	1310	c.425T>C	c.(424-426)tTa>tCa	p.L142S		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	142					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TATATCTCGTAATAAATTAAA	0.453																																					p.L142S		Atlas-SNP	.											.	SLITRK1	196	.	0			c.T425C						PASS	.						59.0	64.0	62.0					13																	84455218		2203	4300	6503	SO:0001583	missense	114798	exon1			TCTCGTAATAAAT	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.425T>C	chr13.hg19:g.84455218A>G	ENSP00000366288:p.Leu142Ser	79.0	0.0	.		72.0	25.0	.	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	hg19	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.822760	0.50739	.	.	ENSG00000178235	ENST00000377084	T	0.66815	-0.23	4.45	4.45	0.53987	.	0.000000	0.64402	D	0.000004	D	0.85483	0.5707	H	0.94385	3.53	0.52099	D	0.999942	D	0.76494	0.999	D	0.77557	0.99	D	0.89217	0.3568	10	0.87932	D	0	-3.848	12.6952	0.56999	1.0:0.0:0.0:0.0	.	142	Q96PX8	SLIK1_HUMAN	S	142	ENSP00000366288:L142S	ENSP00000366288:L142S	L	-	2	0	SLITRK1	83353219	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.139000	0.94554	1.874000	0.54306	0.459000	0.35465	TTA	.	.	.	none		0.453	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SLC10A2	6555	hgsc.bcm.edu	37	13	103701721	103701721	+	Silent	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr13:103701721A>G	ENST00000245312.3	-	5	1433	c.837T>C	c.(835-837)acT>acC	p.T279T		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	279					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GCTCCTCAGGAGTGAAGGAGA	0.478																																					p.T279T		Atlas-SNP	.											.	SLC10A2	67	.	0			c.T837C						PASS	.						183.0	144.0	157.0					13																	103701721		2203	4300	6503	SO:0001819	synonymous_variant	6555	exon5			CTCAGGAGTGAAG	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.837T>C	chr13.hg19:g.103701721A>G		86.0	0.0	.		97.0	18.0	.	NM_000452	A1L4F4|Q13839	Silent	SNP	ENST00000245312.3	hg19	CCDS9506.1																																																																																			.	.	.	none		0.478	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
OR4K17	390436	hgsc.bcm.edu	37	14	20586055	20586055	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:20586055A>G	ENST00000315543.4	+	1	490	c.490A>G	c.(490-492)Atg>Gtg	p.M164V		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CCTACACTACATGACCATCAT	0.443																																					p.M164V		Atlas-SNP	.											.	OR4K17	58	.	0			c.A490G						PASS	.						206.0	172.0	183.0					14																	20586055		2203	4300	6503	SO:0001583	missense	390436	exon1			CACTACATGACCA		CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.490A>G	chr14.hg19:g.20586055A>G	ENSP00000319197:p.Met164Val	186.0	0.0	.		244.0	54.0	.	NM_001004715	Q6IF12	Missense_Mutation	SNP	ENST00000315543.4	hg19	CCDS32030.1	.	.	.	.	.	.	.	.	.	.	.	4.360	0.066302	0.08388	.	.	ENSG00000176230	ENST00000315543	T	0.19105	2.17	2.86	0.121	0.14695	GPCR, rhodopsin-like superfamily (1);	0.561138	0.13408	U	0.390079	T	0.11153	0.0272	N	0.21617	0.685	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.23976	-1.0173	10	0.38643	T	0.18	.	3.7424	0.08536	0.5547:0.1951:0.2502:0.0	.	136	Q8NGC6	OR4KH_HUMAN	V	164	ENSP00000319197:M164V	ENSP00000319197:M164V	M	+	1	0	OR4K17	19655895	0.000000	0.05858	0.834000	0.33040	0.839000	0.47603	-1.897000	0.01603	0.316000	0.23135	0.332000	0.21555	ATG	.	.	.	none		0.443	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1		
METTL3	56339	hgsc.bcm.edu	37	14	21967914	21967914	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:21967914A>C	ENST00000298717.4	-	7	1488	c.1337T>G	c.(1336-1338)cTc>cGc	p.L446R		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	446					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		TTACCCCCAGAGATTTAGACA	0.383																																					p.L446R		Atlas-SNP	.											.	METTL3	48	.	0			c.T1337G						PASS	.						161.0	149.0	153.0					14																	21967914		2203	4300	6503	SO:0001583	missense	56339	exon7			CCCCAGAGATTTA	AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1337T>G	chr14.hg19:g.21967914A>C	ENSP00000298717:p.Leu446Arg	119.0	0.0	.		126.0	42.0	.	NM_019852	O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	ENST00000298717.4	hg19	CCDS32044.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.495927	0.64186	.	.	ENSG00000165819	ENST00000298717	T	0.38401	1.14	5.02	5.02	0.67125	.	0.064498	0.64402	D	0.000008	T	0.31513	0.0799	L	0.28274	0.84	0.80722	D	1	P	0.42248	0.774	B	0.44224	0.444	T	0.06534	-1.0821	10	0.40728	T	0.16	-9.7454	13.8626	0.63571	1.0:0.0:0.0:0.0	.	446	Q86U44	MTA70_HUMAN	R	446	ENSP00000298717:L446R	ENSP00000298717:L446R	L	-	2	0	METTL3	21037754	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	6.366000	0.73095	2.116000	0.64780	0.377000	0.23210	CTC	.	.	.	none		0.383	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1	NM_019852	
PCNX	22990	hgsc.bcm.edu	37	14	71524368	71524368	+	Silent	SNP	C	C	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:71524368C>G	ENST00000304743.2	+	26	5225	c.4779C>G	c.(4777-4779)ctC>ctG	p.L1593L	PCNX_ENST00000439984.3_Silent_p.L1482L|PCNX_ENST00000238570.5_Intron	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1593						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CTGACTATCTCAATGCATTAG	0.448																																					p.L1593L		Atlas-SNP	.											.	PCNX	198	.	0			c.C4779G						PASS	.						324.0	325.0	325.0					14																	71524368		2203	4300	6503	SO:0001819	synonymous_variant	22990	exon26			CTATCTCAATGCA	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4779C>G	chr14.hg19:g.71524368C>G		120.0	0.0	.		94.0	24.0	.	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	ENST00000304743.2	hg19	CCDS9806.1																																																																																			.	.	.	none		0.448	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
CPSF2	53981	hgsc.bcm.edu	37	14	92608527	92608527	+	Silent	SNP	T	T	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:92608527T>A	ENST00000298875.4	+	8	966	c.681T>A	c.(679-681)ctT>ctA	p.L227L		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	227					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		TGGAAACACTTCGAGGTGATG	0.373																																					p.L227L	Ovarian(78;28 1788 18702 44111)	Atlas-SNP	.											.	CPSF2	63	.	0			c.T681A						PASS	.						162.0	148.0	153.0					14																	92608527		2203	4300	6503	SO:0001819	synonymous_variant	53981	exon8			AACACTTCGAGGT	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.681T>A	chr14.hg19:g.92608527T>A		265.0	0.0	.		237.0	64.0	.	NM_017437	B3KME1|Q6NSJ1|Q9H3W7	Silent	SNP	ENST00000298875.4	hg19	CCDS9902.1																																																																																			.	.	.	none		0.373	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1		
USP3	9960	hgsc.bcm.edu	37	15	63866572	63866572	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr15:63866572C>A	ENST00000380324.3	+	11	1195	c.1066C>A	c.(1066-1068)Caa>Aaa	p.Q356K	USP3_ENST00000536001.1_3'UTR|USP3-AS1_ENST00000560350.1_RNA|USP3_ENST00000559711.1_Missense_Mutation_p.Q267K|USP3_ENST00000539772.1_Missense_Mutation_p.Q107K|USP3_ENST00000540797.1_Missense_Mutation_p.Q312K|USP3-AS1_ENST00000559357.1_RNA|USP3-AS1_ENST00000559861.1_RNA|USP3_ENST00000558285.1_Missense_Mutation_p.Q339K|USP3_ENST00000268049.7_Missense_Mutation_p.Q334K	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	356	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		CTCTAAGAATCAAGAAAATGG	0.323																																					p.Q356K		Atlas-SNP	.											.	USP3	37	.	0			c.C1066A						PASS	.						102.0	100.0	100.0					15																	63866572		2203	4300	6503	SO:0001583	missense	9960	exon11			AAGAATCAAGAAA	AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.1066C>A	chr15.hg19:g.63866572C>A	ENSP00000369681:p.Gln356Lys	299.0	0.0	.		278.0	61.0	.	NM_006537	B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	ENST00000380324.3	hg19	CCDS32265.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644326	0.67244	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000536848;ENST00000538686	T;T;T;T	0.28454	2.12;2.23;2.33;1.61	5.98	5.98	0.97165	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.31734	0.0806	L	0.50333	1.59	0.58432	D	0.999999	B;B;B;B	0.26041	0.056;0.069;0.14;0.14	B;B;B;B	0.31869	0.046;0.053;0.137;0.137	T	0.16928	-1.0386	10	0.02654	T	1	.	20.452	0.99131	0.0:1.0:0.0:0.0	.	312;312;334;356	F5H1A6;B4DVU5;Q6JHV3;Q9Y6I4	.;.;.;UBP3_HUMAN	K	312;356;334;107;271;187	ENSP00000445828:Q312K;ENSP00000369681:Q356K;ENSP00000268049:Q334K;ENSP00000445642:Q107K	ENSP00000268049:Q334K	Q	+	1	0	USP3	61653625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.838000	0.97847	0.591000	0.81541	CAA	.	.	.	none		0.323	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417773.1		
THSD4	79875	hgsc.bcm.edu	37	15	72030175	72030175	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr15:72030175G>A	ENST00000355327.3	+	11	1869	c.1735G>A	c.(1735-1737)Gag>Aag	p.E579K	THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000357769.4_Missense_Mutation_p.E219K|THSD4_ENST00000261862.6_Missense_Mutation_p.E579K			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	579					elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GGAGGCCCCTGAGATGTTCAC	0.582																																					p.E579K		Atlas-SNP	.											.	THSD4	75	.	0			c.G1735A						PASS	.						141.0	180.0	167.0					15																	72030175		2062	4187	6249	SO:0001583	missense	79875	exon10			GCCCCTGAGATGT	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.1735G>A	chr15.hg19:g.72030175G>A	ENSP00000347484:p.Glu579Lys	114.0	0.0	.		103.0	15.0	.	NM_024817	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	hg19	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	G	5.140	0.211483	0.09757	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.61158	0.13;0.13;0.4	5.31	4.39	0.52855	.	.	.	.	.	T	0.33352	0.0860	N	0.24115	0.695	0.09310	N	1	P;B;B	0.35328	0.495;0.008;0.091	B;B;B	0.22753	0.041;0.001;0.024	T	0.14531	-1.0469	9	0.06365	T	0.9	.	9.5486	0.39295	0.0966:0.0:0.9034:0.0	.	219;219;579	B4E1J6;B4DR13;Q6ZMP0	.;.;THSD4_HUMAN	K	579;579;219	ENSP00000347484:E579K;ENSP00000261862:E579K;ENSP00000350413:E219K	ENSP00000261862:E579K	E	+	1	0	THSD4	69817229	0.989000	0.36119	0.005000	0.12908	0.004000	0.04260	2.904000	0.48719	1.230000	0.43646	0.650000	0.86243	GAG	.	.	.	none		0.582	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817	
SCAMP2	10066	hgsc.bcm.edu	37	15	75146985	75146985	+	Silent	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr15:75146985G>T	ENST00000268099.9	-	2	172	c.63C>A	c.(61-63)ccC>ccA	p.P21P		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	21					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						GGGTCACAGAGGGATCCTGAG	0.627																																					p.P21P		Atlas-SNP	.											.	SCAMP2	18	.	0			c.C63A						PASS	.						32.0	41.0	38.0					15																	75146985		2197	4295	6492	SO:0001819	synonymous_variant	10066	exon2			CACAGAGGGATCC	AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.63C>A	chr15.hg19:g.75146985G>T		97.0	0.0	.		66.0	15.0	.	NM_005697	B2RDF0|Q9BQE8	Silent	SNP	ENST00000268099.9	hg19	CCDS10271.1																																																																																			.	.	.	none		0.627	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286403.3	NM_005697	
ITGAM	3684	hgsc.bcm.edu	37	16	31341675	31341675	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr16:31341675T>A	ENST00000287497.8	+	27	3182	c.3107T>A	c.(3106-3108)tTc>tAc	p.F1036Y	ITGAM_ENST00000544665.3_Missense_Mutation_p.F1037Y			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	1036					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GACATCCCGTTCTTTGGCATC	0.567																																					p.F1037Y		Atlas-SNP	.											.	ITGAM	137	.	0			c.T3110A						PASS	.						97.0	96.0	96.0					16																	31341675		2027	4194	6221	SO:0001583	missense	3684	exon27			TCCCGTTCTTTGG	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3107T>A	chr16.hg19:g.31341675T>A	ENSP00000287497:p.Phe1036Tyr	95.0	0.0	.		107.0	38.0	.	NM_001145808	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	hg19	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419955	0.62622	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.47869	0.83;0.83	5.51	1.04	0.20106	.	.	.	.	.	T	0.26702	0.0653	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.19031	-1.0318	9	0.56958	D	0.05	.	4.1662	0.10308	0.1547:0.5648:0.0:0.2805	.	1036;1036	Q4VAK1;P11215	.;ITAM_HUMAN	Y	1037;1036	ENSP00000441691:F1037Y;ENSP00000287497:F1036Y	ENSP00000287497:F1036Y	F	+	2	0	ITGAM	31249176	0.023000	0.18921	0.023000	0.16930	0.960000	0.62799	-0.047000	0.11963	0.216000	0.20781	0.372000	0.22366	TTC	.	.	.	none		0.567	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
GLG1	2734	hgsc.bcm.edu	37	16	74487150	74487150	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr16:74487150C>T	ENST00000422840.2	-	26	3454	c.3455G>A	c.(3454-3456)aGt>aAt	p.S1152N	GLG1_ENST00000205061.5_Missense_Mutation_p.S1152N|GLG1_ENST00000447066.2_Missense_Mutation_p.S1141N	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	1152					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						GATGCTCCCACTGATCACAGA	0.502																																					p.S1152N		Atlas-SNP	.											.	GLG1	106	.	0			c.G3455A						PASS	.						242.0	202.0	216.0					16																	74487150		2198	4300	6498	SO:0001583	missense	2734	exon26			CTCCCACTGATCA		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.3455G>A	chr16.hg19:g.74487150C>T	ENSP00000405984:p.Ser1152Asn	133.0	0.0	.		142.0	52.0	.	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	hg19	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	C	9.147	1.015288	0.19355	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.54	3.53	0.40419	.	0.247900	0.47093	D	0.000242	T	0.15869	0.0382	N	0.08118	0	0.22693	N	0.998846	B;B;B;B	0.21520	0.0;0.057;0.0;0.0	B;B;B;B	0.18871	0.0;0.023;0.0;0.0	T	0.12426	-1.0548	9	0.26408	T	0.33	-17.7364	5.7869	0.18338	0.1097:0.6149:0.1891:0.0863	.	282;1152;1152;1141	Q6ZMF1;Q92896;Q92896-2;B7Z8Y4	.;GSLG1_HUMAN;.;.	N	1152;1141;1152	.	ENSP00000205061:S1152N	S	-	2	0	GLG1	73044651	0.946000	0.32159	0.986000	0.45419	0.757000	0.42996	1.676000	0.37565	1.339000	0.45563	-0.346000	0.07831	AGT	.	.	.	none		0.502	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
CENPN	55839	hgsc.bcm.edu	37	16	81060147	81060147	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr16:81060147T>G	ENST00000305850.5	+	9	1504	c.714T>G	c.(712-714)atT>atG	p.I238M	RP11-303E16.3_ENST00000561808.1_RNA|CENPN_ENST00000439957.3_Missense_Mutation_p.I218M|RP11-303E16.3_ENST00000566390.1_RNA|RP11-303E16.3_ENST00000562315.1_RNA|CENPN_ENST00000428963.2_Missense_Mutation_p.I204M|CENPN_ENST00000393335.3_Missense_Mutation_p.I238M	NM_001100624.2|NM_001270474.1	NP_001094094.2|NP_001257403.1	Q96H22	CENPN_HUMAN	centromere protein N	238					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|large_intestine(5)|lung(4)	10						CAAGGATCATTCATGAAAACA	0.343																																					p.I238M		Atlas-SNP	.											CENPN_ENST00000439957,NS,lymphoid_neoplasm,0,3	CENPN	84	.	0			c.T714G						PASS	.						88.0	84.0	85.0					16																	81060147		1815	4073	5888	SO:0001583	missense	55839	exon9			GATCATTCATGAA	AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000305850.5:c.714T>G	chr16.hg19:g.81060147T>G	ENSP00000305608:p.Ile238Met	252.0	0.0	.		260.0	104.0	.	NM_001100624	A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Missense_Mutation	SNP	ENST00000305850.5	hg19	CCDS42200.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915992	0.33815	.	.	ENSG00000166451	ENST00000305850;ENST00000439957;ENST00000393335;ENST00000428963	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.25	2.99	0.34606	.	0.607838	0.18923	N	0.127436	T	0.28333	0.0700	L	0.57536	1.79	0.22142	N	0.999337	P;P;P;P	0.51147	0.627;0.681;0.942;0.681	P;P;P;P	0.52309	0.5;0.581;0.695;0.581	T	0.08186	-1.0734	10	0.41790	T	0.15	-9.6647	7.0343	0.24985	0.1146:0.131:0.0:0.7544	.	218;204;238;238	E7ETS3;E7ES30;A8MZE6;Q96H22	.;.;.;CENPN_HUMAN	M	238;218;238;204	ENSP00000305608:I238M;ENSP00000395235:I218M;ENSP00000377007:I238M;ENSP00000393991:I204M	ENSP00000305608:I238M	I	+	3	3	CENPN	79617648	1.000000	0.71417	0.998000	0.56505	0.691000	0.40173	0.720000	0.25896	0.156000	0.19299	-1.967000	0.00467	ATT	.	.	.	none		0.343	CENPN-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269051.1	NM_018455	
PIEZO1	9780	hgsc.bcm.edu	37	16	88782672	88782672	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr16:88782672G>C	ENST00000301015.9	-	49	7309	c.7063C>G	c.(7063-7065)Ctc>Gtc	p.L2355V	MIR4722_ENST00000578292.1_RNA|RP5-1142A6.9_ENST00000564984.1_RNA|PIEZO1_ENST00000327397.7_Missense_Mutation_p.L223V	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	2355					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						TTGGGGAAGAGATTAGGGATG	0.657																																					p.L2355V		Atlas-SNP	.											.	PIEZO1	79	.	0			c.C7063G						PASS	.						44.0	46.0	45.0					16																	88782672		692	1590	2282	SO:0001583	missense	9780	exon49			GGAAGAGATTAGG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.7063C>G	chr16.hg19:g.88782672G>C	ENSP00000301015:p.Leu2355Val	42.0	0.0	.		50.0	14.0	.	NM_001142864	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	hg19	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.651|7.651	0.682874|0.682874	0.14907|0.14907	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000301015;ENST00000327397|ENST00000451779	T;T|.	0.74106|.	-0.81;-0.81|.	3.81|3.81	2.84|2.84	0.33178|0.33178	.|.	0.258114|.	0.32175|.	N|.	0.006466|.	T|T	0.42810|0.42810	0.1219|0.1219	L|L	0.33710|0.33710	1.025|1.025	0.38789|0.38789	D|D	0.954937|0.954937	B;P;P|.	0.44776|.	0.118;0.843;0.843|.	B;B;B|.	0.40659|.	0.16;0.336;0.336|.	T|T	0.29488|0.29488	-1.0010|-1.0010	10|5	0.26408|.	T|.	0.33|.	-30.4795|-30.4795	5.9755|5.9755	0.19377|0.19377	0.1006:0.0:0.7074:0.1919|0.1006:0.0:0.7074:0.1919	.|.	2355;223;223|.	Q92508;E7EUT2;Q96HU3|.	PIEZ1_HUMAN;.;.|.	V|C	2355;223|2300	ENSP00000301015:L2355V;ENSP00000333704:L223V|.	ENSP00000301015:L2355V|.	L|S	-|-	1|2	0|0	FAM38A|FAM38A	87310173|87310173	0.998000|0.998000	0.40836|0.40836	0.970000|0.970000	0.41538|0.41538	0.476000|0.476000	0.33039|0.33039	2.395000|2.395000	0.44459|0.44459	0.931000|0.931000	0.37242|0.37242	0.467000|0.467000	0.42956|0.42956	CTC|TCT	.	.	.	none		0.657	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
SHPK	23729	hgsc.bcm.edu	37	17	3526658	3526658	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:3526658G>A	ENST00000225519.3	-	4	724	c.622C>T	c.(622-624)Cag>Tag	p.Q208*		NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	208					carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		CTTTGGCTCTGCGTGTTGAAA	0.562																																					p.Q208X		Atlas-SNP	.											.	SHPK	34	.	0			c.C622T						PASS	.						167.0	150.0	156.0					17																	3526658		2203	4300	6503	SO:0001587	stop_gained	23729	exon4			GGCTCTGCGTGTT	AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.622C>T	chr17.hg19:g.3526658G>A	ENSP00000225519:p.Gln208*	98.0	0.0	.		86.0	23.0	.	NM_013276	B2R640|Q8WUH3	Nonsense_Mutation	SNP	ENST00000225519.3	hg19	CCDS11030.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885948	0.91814	.	.	ENSG00000197417	ENST00000225519	.	.	.	5.15	0.667	0.17907	.	0.788742	0.11854	N	0.523030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-0.7028	4.2396	0.10642	0.0832:0.1092:0.4512:0.3564	.	.	.	.	X	208	.	ENSP00000225519:Q208X	Q	-	1	0	SHPK	3473407	0.281000	0.24258	0.676000	0.29932	0.912000	0.54170	1.047000	0.30367	0.656000	0.30886	0.561000	0.74099	CAG	.	.	.	none		0.562	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207378.2		
USP6	9098	hgsc.bcm.edu	37	17	5071273	5071273	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:5071273C>T	ENST00000574788.1	+	34	5313	c.3083C>T	c.(3082-3084)gCc>gTc	p.A1028V	USP6_ENST00000304328.5_Missense_Mutation_p.A711V|USP6_ENST00000250066.6_Missense_Mutation_p.A1028V|USP6_ENST00000332776.4_3'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1028	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CGAGCGCAAGCCGAGCCCATC	0.532			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.A1028V		Atlas-SNP	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	213	.	0			c.C3083T						PASS	.						59.0	58.0	58.0					17																	5071273		2203	4300	6503	SO:0001583	missense	9098	exon26			CGCAAGCCGAGCC	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3083C>T	chr17.hg19:g.5071273C>T	ENSP00000460380:p.Ala1028Val	116.0	0.0	.		139.0	25.0	.	NM_004505	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	hg19	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657489	0.47467	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.14391	2.9;2.51	2.35	2.35	0.29111	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.26412	0.0645	L	0.46741	1.465	0.48632	D	0.999683	D;D	0.71674	0.998;0.987	D;D	0.80764	0.994;0.939	T	0.01617	-1.1311	10	0.59425	D	0.04	.	10.4068	0.44266	0.0:1.0:0.0:0.0	.	711;1028	P35125-2;P35125	.;UBP6_HUMAN	V	1028;711	ENSP00000250066:A1028V;ENSP00000305473:A711V	ENSP00000250066:A1028V	A	+	2	0	USP6	5011997	1.000000	0.71417	0.998000	0.56505	0.338000	0.28826	7.512000	0.81728	1.313000	0.45069	0.184000	0.17185	GCC	.	.	.	none		0.532	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
DLG4	1742	hgsc.bcm.edu	37	17	7106870	7106870	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:7106870G>A	ENST00000399506.2	-	6	569	c.378C>T	c.(376-378)cgC>cgT	p.R126R	DLG4_ENST00000302955.6_Silent_p.R123R|DLG4_ENST00000399510.2_Silent_p.R169R|DLG4_ENST00000485100.1_Silent_p.R123R			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	126	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	GGGTCACCTCGCGCACGTCCA	0.622																																					p.R169R		Atlas-SNP	.											DLG4_ENST00000302955,NS,carcinoma,0,2	DLG4	110	.	0			c.C507T						PASS	.						35.0	40.0	39.0					17																	7106870		2056	4183	6239	SO:0001819	synonymous_variant	1742	exon8			CACCTCGCGCACG	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.378C>T	chr17.hg19:g.7106870G>A		43.0	0.0	.		31.0	8.0	.	NM_001365	B7Z1S1|G5E939|Q92941|Q9UKK8	Silent	SNP	ENST00000399506.2	hg19																																																																																				.	.	.	none		0.622	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	NM_001365	
RAI1	10743	hgsc.bcm.edu	37	17	17697241	17697241	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:17697241G>T	ENST00000353383.1	+	3	1448	c.979G>T	c.(979-981)Gcc>Tcc	p.A327S	RAI1_ENST00000261641.6_Missense_Mutation_p.A327S	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	327	Gln-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GCCGGACGCAGCCGTCCGGAC	0.642																																					p.A327S		Atlas-SNP	.											.	RAI1	121	.	0			c.G979T						PASS	.						60.0	75.0	70.0					17																	17697241		2203	4300	6503	SO:0001583	missense	10743	exon3			GACGCAGCCGTCC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.979G>T	chr17.hg19:g.17697241G>T	ENSP00000323074:p.Ala327Ser	51.0	0.0	.		48.0	11.0	.	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	hg19	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	G	4.494	0.091621	0.08632	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641;ENST00000315321	T;T;T	0.25414	1.8;1.8;1.8	5.55	2.35	0.29111	.	0.294557	0.33753	N	0.004581	T	0.14485	0.0350	N	0.19112	0.55	0.24098	N	0.995885	B	0.14012	0.009	B	0.14023	0.01	T	0.16928	-1.0386	10	0.51188	T	0.08	.	6.7903	0.23695	0.1908:0.3483:0.4608:0.0	.	327	Q7Z5J4	RAI1_HUMAN	S	327;327;327;327;327;304	ENSP00000323074:A327S;ENSP00000379120:A327S;ENSP00000261641:A327S	ENSP00000261641:A327S	A	+	1	0	RAI1	17637966	0.127000	0.22367	0.027000	0.17364	0.221000	0.24807	0.574000	0.23714	0.711000	0.32018	0.561000	0.74099	GCC	.	.	.	none		0.642	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
ALDH3A2	224	hgsc.bcm.edu	37	17	19564524	19564524	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:19564524C>A	ENST00000176643.6	+	6	1329	c.883C>A	c.(883-885)Ctt>Att	p.L295I	ALDH3A2_ENST00000581518.1_Missense_Mutation_p.L295I|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.L295I|SNORA31_ENST00000516540.1_RNA|ALDH3A2_ENST00000571163.1_5'Flank|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.L295I|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.L295I			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	295					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					ACTAAGTTTGCTTGAAGGACA	0.368																																					p.L295I		Atlas-SNP	.											.	ALDH3A2	41	.	0			c.C883A						PASS	.						84.0	79.0	80.0					17																	19564524		2203	4300	6503	SO:0001583	missense	224	exon6			AGTTTGCTTGAAG	L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.883C>A	chr17.hg19:g.19564524C>A	ENSP00000176643:p.Leu295Ile	88.0	0.0	.		90.0	26.0	.	NM_001031806	Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	ENST00000176643.6	hg19	CCDS11210.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.839363	0.32513	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	T;T;T	0.73681	-0.77;-0.77;-0.77	5.91	5.91	0.95273	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.044427	0.85682	D	0.000000	T	0.68320	0.2988	L	0.45051	1.395	0.80722	D	1	B;B	0.16603	0.018;0.014	B;B	0.26969	0.074;0.075	T	0.61312	-0.7088	10	0.26408	T	0.33	-23.027	14.1492	0.65370	0.1497:0.8503:0.0:0.0	.	295;295	P51648;P51648-2	AL3A2_HUMAN;.	I	295	ENSP00000176643:L295I;ENSP00000378942:L295I;ENSP00000345774:L295I	ENSP00000176643:L295I	L	+	1	0	ALDH3A2	19505116	0.959000	0.32827	1.000000	0.80357	0.978000	0.69477	0.014000	0.13333	2.803000	0.96430	0.650000	0.86243	CTT	.	.	.	none		0.368	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132268.1		
ATP6V0A1	535	hgsc.bcm.edu	37	17	40647714	40647714	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:40647714T>C	ENST00000343619.4	+	14	1663	c.1540T>C	c.(1540-1542)Tac>Cac	p.Y514H	ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.Y471H|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.Y521H|RP11-194N12.2_ENST00000591343.1_RNA|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.Y160H|MIR548AT_ENST00000578714.1_RNA|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.Y514H|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.Y514H|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.Y471H	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	514					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TGGTGGACCATACCCTTTTGG	0.433																																					p.Y521H		Atlas-SNP	.											.	ATP6V0A1	67	.	0			c.T1561C						PASS	.						84.0	66.0	72.0					17																	40647714		2203	4300	6503	SO:0001583	missense	535	exon14			GGACCATACCCTT	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1540T>C	chr17.hg19:g.40647714T>C	ENSP00000342951:p.Tyr514His	78.0	0.0	.		67.0	17.0	.	NM_001130020	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	hg19	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	T	33	5.195566	0.94960	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84;-2.84;-2.84	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.97340	0.9130	H	0.98218	4.175	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;0.999	D;D;D;D;D	0.91635	0.996;0.999;0.999;0.966;0.994	D	0.98763	1.0725	10	0.87932	D	0	-21.8156	16.6288	0.85011	0.0:0.0:0.0:1.0	.	471;471;521;514;514	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	H	514;514;514;521;471;160	ENSP00000342951:Y514H;ENSP00000444676:Y514H;ENSP00000377415:Y514H;ENSP00000264649:Y521H;ENSP00000443991:Y471H;ENSP00000446377:Y160H	ENSP00000264649:Y521H	Y	+	1	0	ATP6V0A1	37901240	1.000000	0.71417	0.982000	0.44146	0.974000	0.67602	8.012000	0.88631	2.326000	0.78906	0.533000	0.62120	TAC	.	.	.	none		0.433	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
NBR1	4077	hgsc.bcm.edu	37	17	41353793	41353793	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:41353793A>T	ENST00000422280.1	+	18	3018	c.2559A>T	c.(2557-2559)agA>agT	p.R853S	NBR1_ENST00000389312.4_Missense_Mutation_p.R853S|NBR1_ENST00000341165.6_Missense_Mutation_p.R853S|NBR1_ENST00000589872.1_Missense_Mutation_p.R853S|NBR1_ENST00000542611.1_Missense_Mutation_p.R832S|NBR1_ENST00000590996.1_Missense_Mutation_p.R853S	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	853					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		ATCAGATCAGAGGAGGTAATG	0.433																																					p.R853S		Atlas-SNP	.											.	NBR1	55	.	0			c.A2559T						PASS	.						149.0	118.0	127.0					17																	41353793		1568	3582	5150	SO:0001583	missense	4077	exon18			GATCAGAGGAGGT	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.2559A>T	chr17.hg19:g.41353793A>T	ENSP00000411250:p.Arg853Ser	194.0	0.0	.		160.0	31.0	.	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	hg19	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.167954	0.38315	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000537493;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.55760	1.56;0.5;1.56;1.56	5.54	5.54	0.83059	.	.	.	.	.	T	0.67429	0.2892	M	0.64997	1.995	0.46631	D	0.999136	D;B;B	0.63880	0.993;0.08;0.017	D;B;B	0.72338	0.977;0.074;0.008	T	0.67473	-0.5662	9	0.45353	T	0.12	-18.4523	11.9929	0.53186	1.0:0.0:0.0:0.0	.	832;853;853	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	S	853;832;104;853;853;853	ENSP00000411250:R853S;ENSP00000437545:R832S;ENSP00000343479:R853S;ENSP00000373963:R853S	ENSP00000343479:R853S	R	+	3	2	NBR1	38709319	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.322000	0.59215	2.327000	0.79052	0.533000	0.62120	AGA	.	.	.	none		0.433	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
NFE2L1	4779	hgsc.bcm.edu	37	17	46136179	46136179	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:46136179T>C	ENST00000362042.3	+	6	2111	c.1495T>C	c.(1495-1497)Tct>Cct	p.S499P	RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000585291.1_Missense_Mutation_p.S469P|NFE2L1_ENST00000583378.1_Missense_Mutation_p.S300P|NFE2L1_ENST00000361665.3_Missense_Mutation_p.S488P|NFE2L1_ENST00000536222.1_Missense_Mutation_p.S343P|NFE2L1_ENST00000357480.5_Missense_Mutation_p.S469P|NFE2L1_ENST00000582155.1_Missense_Mutation_p.S311P	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	499	Poly-Ser.				anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CAGttcttcctcttcttcctc	0.537																																					p.S499P		Atlas-SNP	.											.	NFE2L1	60	.	0			c.T1495C						PASS	.						85.0	84.0	84.0					17																	46136179		2203	4300	6503	SO:0001583	missense	4779	exon6			TCTTCCTCTTCTT	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.1495T>C	chr17.hg19:g.46136179T>C	ENSP00000354855:p.Ser499Pro	40.0	0.0	.		53.0	18.0	.	NM_003204	D3DTU3|D3DTU5|Q12877|Q96FN6	Missense_Mutation	SNP	ENST00000362042.3	hg19	CCDS11524.1	.	.	.	.	.	.	.	.	.	.	T	10.16	1.272865	0.23221	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	T;T	0.38240	1.15;1.15	3.45	3.45	0.39498	.	0.195954	0.32785	N	0.005651	T	0.48077	0.1480	L	0.52573	1.65	0.50039	D	0.999841	P;P;P;D	0.54601	0.945;0.909;0.945;0.967	D;P;P;D	0.68621	0.959;0.665;0.82;0.939	T	0.39251	-0.9623	10	0.41790	T	0.15	-6.8658	8.8827	0.35384	0.0:0.0:0.0:1.0	.	343;311;469;499	F5H1B7;B4DYE1;Q14494-2;Q14494	.;.;.;NF2L1_HUMAN	P	518;499;469;343	ENSP00000350072:S469P;ENSP00000445811:S343P	ENSP00000350072:S469P	S	+	1	0	NFE2L1	43491178	0.998000	0.40836	0.808000	0.32385	0.295000	0.27426	2.390000	0.44416	1.545000	0.49373	0.460000	0.39030	TCT	.	.	.	none		0.537	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1	NM_003204	
ACE	1636	hgsc.bcm.edu	37	17	61573760	61573760	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:61573760T>C	ENST00000290866.4	+	23	3410	c.3386T>C	c.(3385-3387)tTt>tCt	p.F1129S	ACE_ENST00000490216.2_Missense_Mutation_p.F555S|ACE_ENST00000413513.3_Intron|ACE_ENST00000577647.1_Missense_Mutation_p.F555S|ACE_ENST00000290863.6_Missense_Mutation_p.F555S|ACE_ENST00000428043.1_Missense_Mutation_p.F1129S|ACE_ENST00000421982.2_Intron	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	1129	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	TCCAGGTACTTTGTCAGCTTC	0.617																																					p.F1129S		Atlas-SNP	.											.	ACE	187	.	0			c.T3386C						PASS	.						101.0	97.0	98.0					17																	61573760		2203	4300	6503	SO:0001583	missense	1636	exon23			GGTACTTTGTCAG	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.3386T>C	chr17.hg19:g.61573760T>C	ENSP00000290866:p.Phe1129Ser	86.0	0.0	.		105.0	32.0	.	NM_000789	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	hg19	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.740370	0.30865	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863	T;T;T	0.47528	0.84;0.84;0.84	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.77638	0.4160	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.84953	0.0872	10	0.87932	D	0	-25.0283	14.67	0.68937	0.0:0.0:0.0:1.0	.	555;1129	P12821-3;P12821	.;ACE_HUMAN	S	1129;1129;555	ENSP00000290866:F1129S;ENSP00000397593:F1129S;ENSP00000290863:F555S	ENSP00000290863:F555S	F	+	2	0	ACE	58927492	1.000000	0.71417	0.891000	0.34965	0.277000	0.26821	6.174000	0.71943	1.938000	0.56188	0.397000	0.26171	TTT	.	.	.	none		0.617	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
LPIN2	9663	hgsc.bcm.edu	37	18	2927795	2927795	+	Silent	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr18:2927795G>A	ENST00000261596.4	-	12	1873	c.1635C>T	c.(1633-1635)tcC>tcT	p.S545S		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	545					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CTTTCACCCAGGACTCAACTG	0.498																																					p.S545S		Atlas-SNP	.											.	LPIN2	75	.	0			c.C1635T						PASS	.						124.0	115.0	118.0					18																	2927795		2203	4300	6503	SO:0001819	synonymous_variant	9663	exon12			CACCCAGGACTCA	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1635C>T	chr18.hg19:g.2927795G>A		151.0	0.0	.		134.0	24.0	.	NM_014646	A7MD25|D3DUH3	Silent	SNP	ENST00000261596.4	hg19	CCDS11829.1																																																																																			.	.	.	none		0.498	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
SOCS6	9306	hgsc.bcm.edu	37	18	67992989	67992989	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr18:67992989A>T	ENST00000397942.3	+	2	1401	c.1085A>T	c.(1084-1086)cAa>cTa	p.Q362L	SOCS6_ENST00000582322.1_Missense_Mutation_p.Q362L	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	362					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GACTCAGTGCAAAGTAGTGGT	0.493																																					p.Q362L	Melanoma(84;1024 1361 24382 36583 42651)	Atlas-SNP	.											.	SOCS6	54	.	0			c.A1085T						PASS	.						84.0	81.0	82.0					18																	67992989		2203	4300	6503	SO:0001583	missense	9306	exon2			CAGTGCAAAGTAG	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1085A>T	chr18.hg19:g.67992989A>T	ENSP00000381034:p.Gln362Leu	72.0	0.0	.		88.0	18.0	.	NM_004232	Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	hg19	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	A	19.24	3.789933	0.70337	.	.	ENSG00000170677	ENST00000397942	T	0.24908	1.83	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000001	T	0.22975	0.0555	L	0.32530	0.975	0.58432	D	0.999999	P	0.35714	0.517	B	0.35550	0.205	T	0.04165	-1.0972	10	0.66056	D	0.02	-11.4417	15.3465	0.74343	1.0:0.0:0.0:0.0	.	362	O14544	SOCS6_HUMAN	L	362	ENSP00000381034:Q362L	ENSP00000381034:Q362L	Q	+	2	0	SOCS6	66143969	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.210000	0.77924	2.029000	0.59856	0.459000	0.35465	CAA	.	.	.	none		0.493	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
CIRBP	1153	hgsc.bcm.edu	37	19	1272031	1272031	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr19:1272031A>C	ENST00000588030.1	+	6	743	c.483A>C	c.(481-483)agA>agC	p.R161S	CIRBP_ENST00000587896.1_Missense_Mutation_p.R161S|CIRBP-AS1_ENST00000600215.1_RNA|C19orf24_ENST00000409293.4_5'Flank|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000588090.1_Missense_Mutation_p.R161S|CIRBP_ENST00000591935.1_Missense_Mutation_p.R161S|CIRBP_ENST00000589686.1_Missense_Mutation_p.R161S|CIRBP_ENST00000589660.1_Missense_Mutation_p.R161S|CIRBP_ENST00000587323.1_Missense_Mutation_p.R161S|CIRBP_ENST00000413636.2_Missense_Mutation_p.R127S|CIRBP_ENST00000585630.1_Missense_Mutation_p.R161S|CIRBP_ENST00000588230.1_Missense_Mutation_p.R161S|CIRBP_ENST00000320936.5_Missense_Mutation_p.R161S|CIRBP_ENST00000586773.1_Missense_Mutation_p.R161S|CIRBP_ENST00000589710.1_Missense_Mutation_p.R161S|CIRBP_ENST00000589235.1_Missense_Mutation_p.R161S|CIRBP_ENST00000444172.2_Missense_Mutation_p.R108S|CIRBP_ENST00000586472.1_Missense_Mutation_p.R161S			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	161					mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCCTACAGAGACAGTTATG	0.592																																					p.R161S		Atlas-SNP	.											.	CIRBP	19	.	0			c.A483C						PASS	.						129.0	109.0	116.0					19																	1272031		2203	4300	6503	SO:0001583	missense	1153	exon6			CTACAGAGACAGT	D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.483A>C	chr19.hg19:g.1272031A>C	ENSP00000468788:p.Arg161Ser	154.0	0.0	.		110.0	35.0	.	NM_001280	B3KT17|B4E2X2	Missense_Mutation	SNP	ENST00000588030.1	hg19	CCDS12059.1	.	.	.	.	.	.	.	.	.	.	A	13.13	2.144678	0.37825	.	.	ENSG00000099622	ENST00000320936;ENST00000413636;ENST00000444172	T;T	0.71579	0.11;-0.58	4.78	2.68	0.31781	.	0.000000	0.85682	D	0.000000	T	0.78874	0.4352	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.80764	0.994;0.994;0.981	T	0.76162	-0.3060	10	0.87932	D	0	-21.1913	6.8142	0.23820	0.7263:0.0:0.2737:0.0	.	127;161;161	B4E2X2;D6W5Y5;Q14011	.;.;CIRBP_HUMAN	S	161;127;108	ENSP00000322887:R161S;ENSP00000412831:R127S	ENSP00000322887:R161S	R	+	3	2	CIRBP	1223031	1.000000	0.71417	0.999000	0.59377	0.261000	0.26267	1.005000	0.29834	0.220000	0.20860	0.260000	0.18958	AGA	.	.	.	none		0.592	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449969.1	NM_001280	
GTF2F1	2962	hgsc.bcm.edu	37	19	6387445	6387445	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr19:6387445C>T	ENST00000394456.5	-	5	916	c.452G>A	c.(451-453)cGg>cAg	p.R151Q	GTF2F1_ENST00000429701.2_Intron|CTB-180A7.6_ENST00000599584.1_RNA	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	151					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						CGTGCGATGCCGGGCCAGCGG	0.627																																					p.R151Q		Atlas-SNP	.											.	GTF2F1	39	.	0			c.G452A						PASS	.						127.0	116.0	120.0					19																	6387445		2203	4300	6503	SO:0001583	missense	2962	exon5			CGATGCCGGGCCA		CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.452G>A	chr19.hg19:g.6387445C>T	ENSP00000377969:p.Arg151Gln	67.0	0.0	.		48.0	11.0	.	NM_002096	B2RCS0|Q9BWN0	Missense_Mutation	SNP	ENST00000394456.5	hg19	CCDS12165.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320920	0.60634	.	.	ENSG00000125651	ENST00000394456;ENST00000542045	T	0.43294	0.95	5.39	3.24	0.37175	Transcription Factor IIF, Rap30/Rap74, interaction (1);	0.212725	0.39475	N	0.001358	T	0.20414	0.0491	N	0.22421	0.69	0.80722	D	1	B	0.27932	0.194	B	0.19666	0.026	T	0.11542	-1.0583	10	0.02654	T	1	-22.0428	7.1332	0.25512	0.0:0.6463:0.0:0.3537	.	151	P35269	T2FA_HUMAN	Q	151;211	ENSP00000377969:R151Q	ENSP00000377969:R151Q	R	-	2	0	GTF2F1	6338445	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	3.013000	0.49582	0.608000	0.30000	0.655000	0.94253	CGG	.	.	.	none		0.627	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398033.1	NM_002096	
MUC16	94025	hgsc.bcm.edu	37	19	9071193	9071194	+	Missense_Mutation	DNP	TG	TG	AA			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr19:9071193_9071194TG>AA	ENST00000397910.4	-	3	16455_16456	c.16252_16253CA>TT	c.(16252-16254)CAt>TTt	p.H5418F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5420	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTTGTGGAATGATGCATGGCG	0.505																																					p.H5418L|p.H5418Y		Atlas-SNP	.											.	MUC16	4315	.	0			c.A16253T|c.C16252T						PASS	.																																			SO:0001583	missense	94025	exon3			GTGGAATGATGCA|TGGAATGATGCAT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16252_16253delinsAA	chr19.hg19:g.9071193_9071194delinsAA	ENSP00000381008:p.His5418Phe	159.0|162.0	0.0	.		183.0	48.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.	.	none		0.505	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
COL5A3	50509	hgsc.bcm.edu	37	19	10106262	10106262	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr19:10106262G>T	ENST00000264828.3	-	16	1650	c.1565C>A	c.(1564-1566)cCc>cAc	p.P522H	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	522	Collagen-like 2.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TCGGCCAGGGGGTCCATGAGG	0.512																																					p.P522H		Atlas-SNP	.											.	COL5A3	243	.	0			c.C1565A						PASS	.						61.0	54.0	56.0					19																	10106262		2203	4300	6503	SO:0001583	missense	50509	exon16			CCAGGGGGTCCAT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1565C>A	chr19.hg19:g.10106262G>T	ENSP00000264828:p.Pro522His	40.0	0.0	.		41.0	9.0	.	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	hg19	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753677	0.49362	.	.	ENSG00000080573	ENST00000264828	D	0.96967	-4.19	5.06	5.06	0.68205	.	0.411439	0.21579	N	0.072270	D	0.97964	0.9330	M	0.83012	2.62	0.46901	D	0.999248	D	0.89917	1.0	D	0.77004	0.989	D	0.98171	1.0452	10	0.56958	D	0.05	.	14.2733	0.66164	0.0:0.0:1.0:0.0	.	522	P25940	CO5A3_HUMAN	H	522	ENSP00000264828:P522H	ENSP00000264828:P522H	P	-	2	0	COL5A3	9967262	0.986000	0.35501	0.986000	0.45419	0.895000	0.52256	1.924000	0.40065	2.519000	0.84933	0.655000	0.94253	CCC	.	.	.	none		0.512	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
UNC13A	23025	hgsc.bcm.edu	37	19	17720812	17720812	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr19:17720812C>T	ENST00000519716.2	-	43	4747	c.4748G>A	c.(4747-4749)cGc>cAc	p.R1583H	UNC13A_ENST00000551649.1_Missense_Mutation_p.R1602H|UNC13A_ENST00000252773.7_Missense_Mutation_p.R1583H|UNC13A_ENST00000552293.1_Missense_Mutation_p.R1577H|UNC13A_ENST00000550896.1_Missense_Mutation_p.R1556H|UNC13A_ENST00000428389.2_Missense_Mutation_p.R1671H	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1583	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CGCAAACTTGCGTTTCTTGTC	0.527																																					p.R1583H		Atlas-SNP	.											.	UNC13A	299	.	0			c.G4748A						PASS	.						145.0	153.0	150.0					19																	17720812		2079	4234	6313	SO:0001583	missense	23025	exon41			AACTTGCGTTTCT	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.4748G>A	chr19.hg19:g.17720812C>T	ENSP00000429562:p.Arg1583His	117.0	0.0	.		90.0	18.0	.	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	hg19	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759588	0.89932	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	4.13	4.13	0.48395	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	T	0.78648	0.4316	M	0.62154	1.92	0.51767	D	0.999935	D	0.89917	1.0	D	0.97110	1.0	T	0.81099	-0.1086	10	0.66056	D	0.02	-15.6131	13.9527	0.64129	0.0:1.0:0.0:0.0	.	1583	Q9UPW8	UN13A_HUMAN	H	1583;1671;1583;1602;1577;1556	ENSP00000429562:R1583H;ENSP00000400409:R1671H;ENSP00000252773:R1583H;ENSP00000447236:R1602H;ENSP00000447572:R1577H;ENSP00000446831:R1556H	ENSP00000252773:R1583H	R	-	2	0	UNC13A	17581812	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.691000	0.84191	1.869000	0.54173	0.478000	0.44815	CGC	.	.	.	none		0.527	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
NLRP7	199713	hgsc.bcm.edu	37	19	55447667	55447667	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr19:55447667G>T	ENST00000590030.1	-	5	2302	c.2262C>A	c.(2260-2262)gaC>gaA	p.D754E	NLRP7_ENST00000592784.1_Missense_Mutation_p.D754E|NLRP7_ENST00000588756.1_Missense_Mutation_p.D754E|NLRP7_ENST00000340844.2_Missense_Mutation_p.D754E|NLRP7_ENST00000446217.1_Missense_Mutation_p.D782E|NLRP7_ENST00000328092.5_Missense_Mutation_p.D726E|NLRP7_ENST00000448121.2_Missense_Mutation_p.D726E			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	754							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TTCTGAGCAGGTCACACAGCA	0.577																																					p.D754E		Atlas-SNP	.											.	NLRP7	411	.	0			c.C2262A						PASS	.						136.0	102.0	114.0					19																	55447667		2203	4300	6503	SO:0001583	missense	199713	exon6			GAGCAGGTCACAC	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2262C>A	chr19.hg19:g.55447667G>T	ENSP00000465520:p.Asp754Glu	69.0	0.0	.		81.0	22.0	.	NM_001127255	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	hg19	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.281893	0.00251	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T	0.51071	0.72;0.72;0.72	2.31	-2.58	0.06228	.	1.603560	0.04433	N	0.369540	T	0.18509	0.0444	N	0.05306	-0.075	0.09310	N	1	B;B;B;B	0.13145	0.004;0.004;0.004;0.007	B;B;B;B	0.08055	0.002;0.002;0.002;0.003	T	0.16364	-1.0405	10	0.02654	T	1	.	1.8101	0.03089	0.199:0.301:0.3702:0.1298	.	782;754;754;726	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	E	754;726;754;782;521	ENSP00000409137:D726E;ENSP00000339491:D754E;ENSP00000414273:D782E	ENSP00000329568:D754E	D	-	3	2	NLRP7	60139479	0.021000	0.18746	0.000000	0.03702	0.001000	0.01503	-0.000000	0.12993	-0.524000	0.06400	-2.688000	0.00140	GAC	.	.	.	none		0.577	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
ZNF551	90233	hgsc.bcm.edu	37	19	58199244	58199244	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr19:58199244G>T	ENST00000282296.5	+	3	1786	c.1601G>T	c.(1600-1602)aGt>aTt	p.S534I	AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.S518I|AC003006.7_ENST00000599221.1_Intron|ZNF551_ENST00000596085.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	534					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TATGAGTGCAGTGAATGTGGC	0.443																																					p.S534I		Atlas-SNP	.											.	ZNF551	65	.	0			c.G1601T						PASS	.						86.0	81.0	83.0					19																	58199244		2203	4300	6503	SO:0001583	missense	90233	exon3			AGTGCAGTGAATG	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1601G>T	chr19.hg19:g.58199244G>T	ENSP00000282296:p.Ser534Ile	82.0	0.0	.		67.0	16.0	.	NM_138347	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	hg19	CCDS12959.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.02|12.02	1.811290|1.811290	0.32053|0.32053	.|.	.|.	ENSG00000204519|ENSG00000228006	ENST00000356715;ENST00000282296;ENST00000359821|ENST00000541705	.|.	.|.	.|.	2.31|2.31	-3.52|-3.52	0.04682|0.04682	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|1.745300	.|0.03889	.|U	.|0.278446	T|T	0.47710|0.47710	0.1460|0.1460	M|M	0.73430|0.73430	2.235|2.235	0.09310|0.09310	N|N	1|1	D|.	0.64830|.	0.994|.	D|.	0.73708|.	0.981|.	T|T	0.31833|0.31833	-0.9929|-0.9929	7|7	.|0.17369	.|T	.|0.5	.|.	5.7017|5.7017	0.17885|0.17885	0.2834:0.4143:0.3024:0.0|0.2834:0.4143:0.3024:0.0	.|.	534|.	Q7Z340|.	ZN551_HUMAN|.	I|N	534;518;317|54	.|.	.|ENSP00000437781:T54N	S|T	+|-	2|2	0|0	ZNF551|AC004017.1	62891056|62891056	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-4.012000|-4.012000	0.00314|0.00314	-1.099000|-1.099000	0.03034|0.03034	-1.134000|-1.134000	0.01955|0.01955	AGT|ACT	.	.	.	none		0.443	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
C20orf194	25943	hgsc.bcm.edu	37	20	3305593	3305593	+	Missense_Mutation	SNP	G	G	C	rs190605250		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr20:3305593G>C	ENST00000252032.9	-	14	1278	c.1211C>G	c.(1210-1212)aCt>aGt	p.T404S	C20orf194_ENST00000453730.2_Missense_Mutation_p.T142S	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	404										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						AGATCCCAGAGTTTGCTCTGC	0.418																																					p.T404S		Atlas-SNP	.											.	C20orf194	83	.	0			c.C1211G						PASS	.						100.0	106.0	104.0					20																	3305593		1866	4105	5971	SO:0001583	missense	25943	exon14			CCCAGAGTTTGCT	AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.1211C>G	chr20.hg19:g.3305593G>C	ENSP00000252032:p.Thr404Ser	75.0	0.0	.		59.0	5.0	.	NM_001009984	Q66K86|Q6P2R9|Q9UFX9	Missense_Mutation	SNP	ENST00000252032.9	hg19	CCDS42851.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446795	0.43429	.	.	ENSG00000088854	ENST00000252032;ENST00000453730	T;T	0.33216	2.23;1.42	5.34	4.39	0.52855	.	0.175484	0.49305	D	0.000147	T	0.31040	0.0784	L	0.60455	1.87	0.37681	D	0.9235	B;B	0.10296	0.003;0.001	B;B	0.12156	0.007;0.007	T	0.19811	-1.0294	10	0.39692	T	0.17	.	12.9761	0.58538	0.0789:0.0:0.9211:0.0	.	143;404	Q0IIP3;Q5TEA3	.;CT194_HUMAN	S	404;142	ENSP00000252032:T404S;ENSP00000407229:T142S	ENSP00000252032:T404S	T	-	2	0	C20orf194	3253593	0.758000	0.28405	0.993000	0.49108	0.986000	0.74619	1.707000	0.37888	1.479000	0.48272	0.655000	0.94253	ACT	.	G|1.000;A|0.000	.	alt		0.418	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077734.1	NM_001009984	
RALGAPB	57148	hgsc.bcm.edu	37	20	37159824	37159824	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr20:37159824A>T	ENST00000262879.6	+	14	2349	c.2065A>T	c.(2065-2067)Att>Ttt	p.I689F	RALGAPB_ENST00000397038.1_Missense_Mutation_p.I467F|RALGAPB_ENST00000397040.1_Missense_Mutation_p.I689F|RALGAPB_ENST00000397042.3_Missense_Mutation_p.I689F			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	689					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AATGTTAAATATTGTTCAAGA	0.313																																					p.I689F		Atlas-SNP	.											.	RALGAPB	134	.	0			c.A2065T						PASS	.						116.0	114.0	115.0					20																	37159824		2203	4300	6503	SO:0001583	missense	57148	exon14			TTAAATATTGTTC	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.2065A>T	chr20.hg19:g.37159824A>T	ENSP00000262879:p.Ile689Phe	127.0	0.0	.		130.0	34.0	.	NM_020336	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	ENST00000262879.6	hg19	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.876802	0.91664	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000304939;ENST00000397038;ENST00000397040;ENST00000438490	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.57899	0.981;0.981;0.981;0.981	P;P;P;P	0.57101	0.813;0.813;0.813;0.813	T	0.54990	-0.8210	9	0.10111	T	0.7	.	15.8481	0.78907	1.0:0.0:0.0:0.0	.	517;689;689;689	A2A2F0;Q86X10-4;A2A2E9;Q86X10	.;.;.;RLGPB_HUMAN	F	689;689;689;467;689;517	.	ENSP00000262879:I689F	I	+	1	0	RALGAPB	36593238	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.574000	0.74014	2.149000	0.67028	0.397000	0.26171	ATT	.	.	.	none		0.313	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336	
L3MBTL1	26013	hgsc.bcm.edu	37	20	42157990	42157990	+	Silent	SNP	C	C	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr20:42157990C>T	ENST00000427442.2	+	9	1131	c.972C>T	c.(970-972)ttC>ttT	p.F324F	L3MBTL1_ENST00000373134.1_Silent_p.F256F|L3MBTL1_ENST00000373135.3_Silent_p.F256F|L3MBTL1_ENST00000444063.1_Silent_p.F256F|L3MBTL1_ENST00000418998.1_Silent_p.F324F			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	256					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CCATGTACTTCATCCTCACCG	0.517																																					p.F324F		Atlas-SNP	.											.	L3MBTL1	105	.	0			c.C972T						PASS	.						191.0	121.0	145.0					20																	42157990		2203	4300	6503	SO:0001819	synonymous_variant	26013	exon9			GTACTTCATCCTC	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.972C>T	chr20.hg19:g.42157990C>T		58.0	0.0	.		71.0	26.0	.	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	ENST00000427442.2	hg19	CCDS46602.2																																																																																			.	.	.	none		0.517	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
CSE1L	1434	hgsc.bcm.edu	37	20	47686789	47686789	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr20:47686789T>A	ENST00000262982.2	+	8	846	c.723T>A	c.(721-723)aaT>aaA	p.N241K	CSE1L_ENST00000542325.1_Missense_Mutation_p.N24K|CSE1L_ENST00000396192.3_Missense_Mutation_p.N241K	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	241					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			GGATGAATAATTTTCATACTC	0.284																																					p.N241K		Atlas-SNP	.											.	CSE1L	83	.	0			c.T723A						PASS	.						69.0	80.0	77.0					20																	47686789		2198	4298	6496	SO:0001583	missense	1434	exon8			GAATAATTTTCAT	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.723T>A	chr20.hg19:g.47686789T>A	ENSP00000262982:p.Asn241Lys	87.0	0.0	.		82.0	23.0	.	NM_001256135	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	hg19	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	T	14.79	2.639615	0.47153	.	.	ENSG00000124207	ENST00000417408;ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.66280	-0.2;-0.2;-0.2	5.42	2.91	0.33838	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	L	0.39898	1.24	0.58432	D	0.999999	P;B;P	0.44344	0.833;0.418;0.737	P;B;P	0.49140	0.499;0.236;0.601	T	0.46076	-0.9217	10	0.11182	T	0.66	-24.0938	9.6613	0.39956	0.0:0.2852:0.0:0.7148	.	24;241;241	B4DUC5;F8W904;P55060	.;.;XPO2_HUMAN	K	7;241;24;241	ENSP00000262982:N241K;ENSP00000446477:N24K;ENSP00000379495:N241K	ENSP00000262982:N241K	N	+	3	2	CSE1L	47120196	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.762000	0.26503	0.354000	0.24105	0.482000	0.46254	AAT	.	.	.	none		0.284	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
PCK1	5105	hgsc.bcm.edu	37	20	56137813	56137813	+	Silent	SNP	C	C	A	rs144907840	byFrequency	TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr20:56137813C>A	ENST00000319441.4	+	4	632	c.468C>A	c.(466-468)atC>atA	p.I156I	PCK1_ENST00000543666.1_Intron|PCK1_ENST00000535860.1_Silent_p.I24I	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	156					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TGTCAAAGATCGGCATCGAGC	0.617																																					p.I156I		Atlas-SNP	.											.	PCK1	95	.	0			c.C468A						PASS	.						68.0	56.0	60.0					20																	56137813		2203	4300	6503	SO:0001819	synonymous_variant	5105	exon4			AAAGATCGGCATC		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.468C>A	chr20.hg19:g.56137813C>A		75.0	0.0	.		55.0	15.0	.	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	C|1.000;T|0.000	.	alt		0.617	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
LTN1	26046	hgsc.bcm.edu	37	21	30339388	30339388	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr21:30339388T>G	ENST00000361371.5	-	10	1504	c.1425A>C	c.(1423-1425)aaA>aaC	p.K475N	LTN1_ENST00000389194.2_Missense_Mutation_p.K521N|LTN1_ENST00000389195.2_Missense_Mutation_p.K521N			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	475					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TTTTTTCATCTTTTTCCGTGT	0.433																																					p.K521N		Atlas-SNP	.											.	LTN1	141	.	0			c.A1563C						PASS	.						173.0	153.0	160.0					21																	30339388		2203	4300	6503	SO:0001583	missense	26046	exon10			TTCATCTTTTTCC	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1425A>C	chr21.hg19:g.30339388T>G	ENSP00000354977:p.Lys475Asn	202.0	0.0	.		180.0	33.0	.	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	hg19		.	.	.	.	.	.	.	.	.	.	T	7.074	0.568893	0.13560	.	.	ENSG00000198862	ENST00000389194;ENST00000361371;ENST00000446611;ENST00000389195	T;T;T	0.23950	2.22;2.23;1.88	5.02	2.38	0.29361	Armadillo-type fold (1);	0.380490	0.31566	N	0.007428	T	0.09512	0.0234	N	0.08118	0	0.29856	N	0.828004	B	0.02656	0.0	B	0.01281	0.0	T	0.23762	-1.0179	10	0.14252	T	0.57	.	3.8422	0.08918	0.1875:0.2734:0.0:0.5391	.	475	O94822	LTN1_HUMAN	N	521;475;477;521	ENSP00000373846:K521N;ENSP00000354977:K475N;ENSP00000373847:K521N	ENSP00000354977:K475N	K	-	3	2	LTN1	29261259	0.060000	0.20803	0.102000	0.21198	0.563000	0.35712	0.127000	0.15790	0.388000	0.25054	-0.256000	0.11100	AAA	.	.	.	none		0.433	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
MX2	4600	hgsc.bcm.edu	37	21	42775260	42775260	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr21:42775260A>G	ENST00000330714.3	+	12	1824	c.1640A>G	c.(1639-1641)cAa>cGa	p.Q547R		NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	547					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				AACCTTAACCAAACTGTTCAG	0.398																																					p.Q547R		Atlas-SNP	.											.	MX2	84	.	0			c.A1640G						PASS	.						72.0	69.0	70.0					21																	42775260		2203	4300	6503	SO:0001583	missense	4600	exon12			TTAACCAAACTGT		CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.1640A>G	chr21.hg19:g.42775260A>G	ENSP00000333657:p.Gln547Arg	128.0	0.0	.		105.0	24.0	.	NM_002463	B7Z5D3|D3DSI7	Missense_Mutation	SNP	ENST00000330714.3	hg19	CCDS13672.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.540708	0.00934	.	.	ENSG00000183486	ENST00000330714	T	0.72835	-0.69	3.63	0.0676	0.14366	Dynamin central domain (1);	0.316592	0.32687	N	0.005766	T	0.36826	0.0981	N	0.04805	-0.155	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31194	-0.9952	10	0.02654	T	1	.	5.4593	0.16607	0.5476:0.0:0.4524:0.0	.	547	P20592	MX2_HUMAN	R	547	ENSP00000333657:Q547R	ENSP00000333657:Q547R	Q	+	2	0	MX2	41697130	0.009000	0.17119	0.000000	0.03702	0.001000	0.01503	0.513000	0.22770	0.132000	0.18615	0.533000	0.62120	CAA	.	.	.	none		0.398	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463	
PFKL	5211	hgsc.bcm.edu	37	21	45744509	45744509	+	Missense_Mutation	SNP	G	G	A	rs138177950		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr21:45744509G>A	ENST00000349048.4	+	17	1841	c.1786G>A	c.(1786-1788)Gag>Aag	p.E596K	PFKL_ENST00000403390.1_Missense_Mutation_p.E643K	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	596	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		CTACGTCTTCGAGGACCCTTT	0.652																																					p.E596K		Atlas-SNP	.											.	PFKL	65	.	0			c.G1786A						PASS	.	G	LYS/GLU	0,4404		0,0,2202	67.0	64.0	65.0		1786	4.1	1.0	21	dbSNP_134	65	1,8599	1.2+/-3.3	0,1,4299	no	missense	PFKL	NM_002626.4	56	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	596/781	45744509	1,13003	2202	4300	6502	SO:0001583	missense	5211	exon17			GTCTTCGAGGACC		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.1786G>A	chr21.hg19:g.45744509G>A	ENSP00000269848:p.Glu596Lys	32.0	0.0	.		54.0	14.0	.	NM_002626	Q96A64|Q96IH4|Q9BR91	Missense_Mutation	SNP	ENST00000349048.4	hg19	CCDS33582.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066876	0.76301	0.0	1.16E-4	ENSG00000141959	ENST00000349048;ENST00000534847;ENST00000403390	D;D	0.93076	-3.16;-3.16	4.1	4.1	0.47936	Phosphofructokinase domain (2);	0.000000	0.85682	D	0.000000	D	0.97788	0.9274	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	D	0.99312	1.0904	10	0.87932	D	0	-38.3049	15.126	0.72483	0.0:0.0:1.0:0.0	.	596;643	P17858;P17858-2	K6PL_HUMAN;.	K	596;389;643	ENSP00000269848:E596K;ENSP00000384038:E643K	ENSP00000269848:E596K	E	+	1	0	PFKL	44568937	1.000000	0.71417	0.962000	0.40283	0.118000	0.20060	9.323000	0.96364	1.852000	0.53769	0.467000	0.42956	GAG	.	G|1.000;A|0.000	0.000	weak		0.652	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1		
SREBF2	6721	hgsc.bcm.edu	37	22	42301503	42301503	+	Missense_Mutation	SNP	C	C	T	rs372007376		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr22:42301503C>T	ENST00000361204.4	+	19	3431	c.3265C>T	c.(3265-3267)Cgc>Tgc	p.R1089C	SREBF2_ENST00000491541.1_3'UTR	NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	1089					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GCTGGCCTGCCGCCACCTGCC	0.692																																					p.R1089C		Atlas-SNP	.											.	SREBF2	99	.	0			c.C3265T						PASS	.						8.0	9.0	9.0					22																	42301503		2135	4233	6368	SO:0001583	missense	6721	exon19			GCCTGCCGCCACC	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.3265C>T	chr22.hg19:g.42301503C>T	ENSP00000354476:p.Arg1089Cys	43.0	0.0	.		39.0	8.0	.	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	hg19	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	C	34	5.301054	0.95601	.	.	ENSG00000198911	ENST00000361204;ENST00000457567;ENST00000543221	T	0.08370	3.1	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	L	0.41027	1.25	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00154	-1.1981	10	0.42905	T	0.14	-22.1429	19.9374	0.97146	0.0:1.0:0.0:0.0	.	1089	Q12772	SRBP2_HUMAN	C	1089;1089;163	ENSP00000354476:R1089C	ENSP00000354476:R1089C	R	+	1	0	SREBF2	40631449	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.772000	0.55325	2.711000	0.92665	0.655000	0.94253	CGC	.	.	.	weak		0.692	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
SBF1	6305	hgsc.bcm.edu	37	22	50903456	50903456	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr22:50903456A>G	ENST00000390679.3	-	12	1490	c.1306T>C	c.(1306-1308)Tac>Cac	p.Y436H	SBF1_ENST00000348911.6_Missense_Mutation_p.Y437H|SBF1_ENST00000380817.3_Missense_Mutation_p.Y436H			O95248	MTMR5_HUMAN	SET binding factor 1	436					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GTAGGGCGGTATGGGACCCCA	0.627																																					p.Y436H		Atlas-SNP	.											.	SBF1	211	.	0			c.T1306C						PASS	.						81.0	87.0	85.0					22																	50903456		2161	4249	6410	SO:0001583	missense	6305	exon12			GGCGGTATGGGAC	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.1306T>C	chr22.hg19:g.50903456A>G	ENSP00000375097:p.Tyr436His	41.0	0.0	.		43.0	8.0	.	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	hg19		.	.	.	.	.	.	.	.	.	.	A	16.91	3.251520	0.59212	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	D;D;D	0.86562	-2.14;-2.14;-2.14	3.93	3.93	0.45458	.	0.162423	0.42420	D	0.000712	D	0.91516	0.7321	M	0.65498	2.005	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.74023	0.982;0.93;0.961	D	0.91527	0.5239	10	0.51188	T	0.08	.	12.6118	0.56556	1.0:0.0:0.0:0.0	.	436;437;436	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	H	436;437;447;446;436	ENSP00000370196:Y436H;ENSP00000252027:Y437H;ENSP00000375097:Y436H	ENSP00000336522:Y446H	Y	-	1	0	SBF1	49250322	1.000000	0.71417	0.830000	0.32933	0.288000	0.27193	7.086000	0.76885	1.650000	0.50662	0.533000	0.62120	TAC	.	.	.	none		0.627	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
NUDT10	170685	hgsc.bcm.edu	37	X	51076122	51076122	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chrX:51076122A>T	ENST00000376006.3	+	2	525	c.305A>T	c.(304-306)gAg>gTg	p.E102V	NUDT10_ENST00000356450.2_Missense_Mutation_p.E102V	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	0					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					ACTGTCACGGAGCTGCTGGAG	0.562																																					p.E102V	NSCLC(90;1817 2035 37909 38249)	Atlas-SNP	.											.	NUDT10	28	.	0			c.A305T						PASS	.						70.0	65.0	67.0					X																	51076122		2203	4300	6503	SO:0001583	missense	170685	exon2			TCACGGAGCTGCT	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.305A>T	chrX.hg19:g.51076122A>T	ENSP00000365174:p.Glu102Val	216.0	0.0	.		222.0	107.0	.	NM_153183	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000376006.3	hg19	CCDS35278.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.151107	0.78001	.	.	ENSG00000122824	ENST00000376006;ENST00000356450	T;T	0.08370	3.1;3.1	3.14	3.14	0.36123	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.25865	0.0630	M	0.84433	2.695	0.42409	D	0.992596	D	0.61080	0.989	P	0.61874	0.895	T	0.43861	-0.9365	9	0.87932	D	0	-2.7732	8.9702	0.35901	1.0:0.0:0.0:0.0	.	102	Q8NFP7	NUD10_HUMAN	V	102	ENSP00000365174:E102V;ENSP00000348831:E102V	ENSP00000348831:E102V	E	+	2	0	NUDT10	51092862	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	6.591000	0.74090	1.295000	0.44724	0.350000	0.21858	GAG	.	.	.	none		0.562	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
NXT2	55916	hgsc.bcm.edu	37	X	108779141	108779141	+	5'Flank	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chrX:108779141G>A	ENST00000372106.1	+	0	0				NXT2_ENST00000372107.1_5'Flank|NXT2_ENST00000218004.1_Silent_p.Q10Q|NXT2_ENST00000372103.1_5'Flank	NM_001242617.1	NP_001229546.1	Q9NPJ8	NXT2_HUMAN	nuclear transport factor 2-like export factor 2						mRNA transport (GO:0051028)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	6						ACTGGTCTCAGGGAGACAGAG	0.403																																					p.Q10Q		Atlas-SNP	.											.	NXT2	16	.	0			c.G30A						PASS	.						60.0	54.0	56.0					X																	108779141		2203	4300	6503	SO:0001631	upstream_gene_variant	55916	exon1			GTCTCAGGGAGAC	AF246127	CCDS14546.1, CCDS56605.1, CCDS56606.1	Xq22.3	2008-02-05			ENSG00000101888	ENSG00000101888			18151	protein-coding gene	gene with protein product		300320				11073998	Standard	NM_018698		Approved	P15-2	uc004eoe.2	Q9NPJ8	OTTHUMG00000022185		chrX.hg19:g.108779141G>A	Exception_encountered	179.0	0.0	.		151.0	83.0	.	NM_018698	D3DUY1|Q0VAN8|Q5JYV5|Q5JYV6|Q5JYV7|Q9H8U0|Q9NQ64|Q9NRL7|Q9Y3M4|Q9Y3M5	Silent	SNP	ENST00000372106.1	hg19	CCDS56605.1																																																																																			.	.	.	none		0.403	NXT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057886.1	NM_018698	
F8	2157	hgsc.bcm.edu	37	X	154159622	154159622	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chrX:154159622G>A	ENST00000360256.4	-	14	2643	c.2443C>T	c.(2443-2445)Cag>Tag	p.Q815*		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	815	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GTAGGACTCTGTCGCAAGAGC	0.408																																					p.Q815X		Atlas-SNP	.											.	F8	646	.	0			c.C2443T	GRCh37	CM011329	F8	M		PASS	.						210.0	193.0	199.0					X																	154159622		2203	4299	6502	SO:0001587	stop_gained	2157	exon14			GACTCTGTCGCAA	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.2443C>T	chrX.hg19:g.154159622G>A	ENSP00000353393:p.Gln815*	122.0	0.0	.		122.0	52.0	.	NM_000132	Q14286|Q5HY69	Nonsense_Mutation	SNP	ENST00000360256.4	hg19	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	G	37	6.182840	0.97357	.	.	ENSG00000185010	ENST00000360256	.	.	.	5.37	4.49	0.54785	.	1.017170	0.07808	N	0.957575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-0.2379	11.2271	0.48890	0.0:0.1799:0.8201:0.0	.	.	.	.	X	815	.	ENSP00000353393:Q815X	Q	-	1	0	F8	153812816	0.652000	0.27349	0.868000	0.34077	0.032000	0.12392	1.555000	0.36277	1.028000	0.39785	0.544000	0.68410	CAG	.	.	.	none		0.408	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
ITSN2	50618	hgsc.bcm.edu	37	2	24535088	24535094	+	Frame_Shift_Del	DEL	AGCAGAA	AGCAGAA	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	AGCAGAA	AGCAGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:24535088_24535094delAGCAGAA	ENST00000355123.4	-	5	782_788	c.339_345delTTCTGCT	c.(337-345)atttctgctfs	p.ISA113fs	ITSN2_ENST00000407704.1_5'UTR|ITSN2_ENST00000361999.3_Frame_Shift_Del_p.ISA113fs|ITSN2_ENST00000406921.3_Frame_Shift_Del_p.ISA113fs	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	113					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACCAAAACGAGCAGAAATTAATGGAG	0.357																																					p.114_116del		Atlas-INDEL	.											.	ITSN2	224	.	0			c.340_346del						PASS	.																																			SO:0001589	frameshift_variant	50618	exon5			.	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.339_345delTTCTGCT	chr2.hg19:g.24535088_24535094delAGCAGAA	ENSP00000347244:p.Ile113fs	161.0	0.0	0		129.0	12.0	0.0930233	NM_147152	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Frame_Shift_Del	DEL	ENST00000355123.4	hg19	CCDS1710.2																																																																																			.	.	.	none		0.357	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
GK	2710	hgsc.bcm.edu	37	X	30671708	30671708	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chrX:30671708delG	ENST00000378941.3	+	1	54	c.54delG	c.(52-54)cagfs	p.Q18fs	GK_ENST00000378943.3_Frame_Shift_Del_p.Q18fs|GK_ENST00000378945.3_Frame_Shift_Del_p.Q18fs|GK_ENST00000378946.3_Frame_Shift_Del_p.Q18fs|GK_ENST00000427190.1_5'UTR			P32189	GLPK_HUMAN	glycerol kinase	18					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						CGGTGGACCAGGGCACCAGTT	0.657																																					p.Q18fs		Atlas-Indel,Pindel	.											.	GK	95	.	0			c.53delA						PASS	.						57.0	57.0	57.0					X																	30671708		2202	4300	6502	SO:0001589	frameshift_variant	2710	exon1			.	X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378941.3:c.54delG	chrX.hg19:g.30671708delG	ENSP00000368224:p.Gln18fs	108.0	0.0	0		95.0	51.0	0.536842	NM_203391	A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Frame_Shift_Del	DEL	ENST00000378941.3	hg19																																																																																				.	.	.	none		0.657	GK-005	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000056171.1	NM_000167	
ITSN2	50618	hgsc.bcm.edu	37	2	24535083	24535086	+	Frame_Shift_Del	DEL	AAAC	AAAC	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	AAAC	AAAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:24535083_24535086delAAAC	ENST00000355123.4	-	5	790_793	c.347_350delGTTT	c.(346-351)cgttttfs	p.RF116fs	ITSN2_ENST00000407704.1_5'UTR|ITSN2_ENST00000361999.3_Frame_Shift_Del_p.RF116fs|ITSN2_ENST00000406921.3_Frame_Shift_Del_p.RF116fs	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	116					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATACTTACCAAAACGAGCAGAAAT	0.353																																					p.116_117del		Atlas-INDEL	.											.	ITSN2	224	.	0			c.348_351del						PASS	.																																			SO:0001589	frameshift_variant	50618	exon5			.	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.347_350delGTTT	chr2.hg19:g.24535083_24535086delAAAC	ENSP00000347244:p.Arg116fs	155.0	0.0	0		127.0	12.0	0.0944882	NM_147152	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Frame_Shift_Del	DEL	ENST00000355123.4	hg19	CCDS1710.2																																																																																			.	.	.	none		0.353	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
LTBP2	4053	hgsc.bcm.edu	37	14	74976904	74976904	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:74976904delC	ENST00000261978.4	-	20	3427	c.3041delG	c.(3040-3042)tgtfs	p.C1014fs	LTBP2_ENST00000556690.1_Frame_Shift_Del_p.C1014fs	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1014	Cys-rich.|EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GGGAGTCAGACACTCATTCAC	0.577																																					p.C1014fs		Atlas-INDEL	.											.	LTBP2	158	.	0			c.3042delT						PASS	.						81.0	73.0	75.0					14																	74976904		2203	4300	6503	SO:0001589	frameshift_variant	4053	exon20			.		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3041delG	chr14.hg19:g.74976904delC	ENSP00000261978:p.Cys1014fs	25.0	0.0	0		35.0	15.0	0.428571	NM_000428	Q99907|Q9NS51	Frame_Shift_Del	DEL	ENST00000261978.4	hg19	CCDS9831.1																																																																																			.	.	.	none		0.577	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
ALOX12	239	hgsc.bcm.edu	37	17	6899465	6899465	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:6899465delC	ENST00000251535.6	+	1	82	c.29delC	c.(28-30)accfs	p.T10fs	AC027763.2_ENST00000399541.2_Intron|RP11-589P10.7_ENST00000572547.1_RNA|RP11-589P10.5_ENST00000573222.1_lincRNA	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	10	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CGCGTGGCCACCGGGGCCTGG	0.756																																					p.T10fs		Atlas-Indel,Pindel	.											.	ALOX12	49	.	0			c.28delA						PASS	.						4.0	4.0	4.0					17																	6899465		1668	3237	4905	SO:0001589	frameshift_variant	239	exon1			.	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.29delC	chr17.hg19:g.6899465delC	ENSP00000251535:p.Thr10fs	161.0	0.0	0		132.0	30.0	0.227273	NM_000697	O95569|Q6ISF8|Q9UQM4	Frame_Shift_Del	DEL	ENST00000251535.6	hg19	CCDS11084.1																																																																																			.	.	.	none		0.756	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2		
REM2	161253	hgsc.bcm.edu	37	14	23355339	23355339	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:23355339delC	ENST00000267396.4	+	4	749	c.626delC	c.(625-627)accfs	p.T209fs	REM2_ENST00000536884.1_Frame_Shift_Del_p.D184fs	NM_173527.2	NP_775798.2	Q8IYK8	REM2_HUMAN	RAS (RAD and GEM)-like GTP binding 2	209					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|large_intestine(2)|ovary(1)	5	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.012)		GTTCCAGAGACCCTACTTCGG	0.622																																					p.T209fs		Atlas-Indel,Pindel	.											REM2,NS,carcinoma,0,1	REM2	21	.	0			c.625delA						PASS	.						46.0	51.0	50.0					14																	23355339		1940	4134	6074	SO:0001589	frameshift_variant	161253	exon4			.		CCDS45082.1	14q11.2	2014-05-09	2006-12-14		ENSG00000139890	ENSG00000139890			20248	protein-coding gene	gene with protein product			"""RAS (RAD and GEM) like GTP binding 2"""			10727423	Standard	NM_173527		Approved	FLJ38964	uc001whf.1	Q8IYK8	OTTHUMG00000170277	ENST00000267396.4:c.626delC	chr14.hg19:g.23355339delC	ENSP00000267396:p.Thr209fs	60.0	0.0	0		69.0	20.0	0.289855	NM_173527	B7Z5P1|Q8N8R8	Frame_Shift_Del	DEL	ENST00000267396.4	hg19	CCDS45082.1																																																																																			.	.	.	none		0.622	REM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408290.1	NM_173527	
MAP2K4	6416	hgsc.bcm.edu	37	17	11985218	11985218	+	Intron	DEL	G	G	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr17:11985218delG	ENST00000353533.5	+	3	456				MIR744_ENST00000578242.1_RNA|MAP2K4_ENST00000581941.1_Intron|MAP2K4_ENST00000415385.3_Intron	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4						apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		ACACTGGGTTGGGCAAGGTGC	0.607			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																.		Atlas-Indel,Pindel	.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	.	.	.	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)	.						PASS	.						70.0	73.0	72.0					17																	11985218		1568	3581	5149	SO:0001627	intron_variant	100126313	.			.	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.393+371G>-	chr17.hg19:g.11985218delG		92.0	0.0	0		108.0	30.0	0.277778	.	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	RNA	DEL	ENST00000353533.5	hg19	CCDS11162.1																																																																																			.	.	.	none		0.607	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
SLC1A2	6506	hgsc.bcm.edu	37	11	35287253	35287254	+	In_Frame_Ins	INS	-	-	CCCCCC			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr11:35287253_35287254insCCCCCC	ENST00000278379.3	-	10	1755_1756	c.1473_1474insGGGGGG	c.(1471-1476)gggata>gggGGGGGGata	p.490_491insGG	SLC1A2_ENST00000479543.1_5'UTR|SLC1A2_ENST00000395750.1_In_Frame_Ins_p.481_482insGG|SLC1A2_ENST00000395753.1_In_Frame_Ins_p.481_482insGG|SLC1A2_ENST00000606205.1_In_Frame_Ins_p.490_491insGG	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	490					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.I492L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			TGATAGACTATCCCAGCCCCAA	0.45																																					p.I492delinsGGI	NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)	Atlas-Indel,Pindel	.											SLC1A2,colon,carcinoma,0,1	SLC1A2	54	.	1	Substitution - Missense(1)	large_intestine(1)	c.1474_1475insGGGGGG						PASS	.																																			SO:0001652	inframe_insertion	6506	exon10			.	AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1473_1474insGGGGGG	chr11.hg19:g.35287253_35287254insCCCCCC	ENSP00000278379:p.Ala490_Gly491insGlyGly	154.0	0.0	0		117.0	26.0	0.222222	NM_004171	B4DQE9|Q14417|Q541G6|U3KQQ4	In_Frame_Ins	INS	ENST00000278379.3	hg19	CCDS31459.1																																																																																			.	.	.	none		0.450	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258181.1	NM_004171	
LTBP2	4053	hgsc.bcm.edu	37	14	74976906	74976906	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:74976906delC	ENST00000261978.4	-	20	3425	c.3039delG	c.(3037-3039)gagfs	p.E1013fs	LTBP2_ENST00000556690.1_Frame_Shift_Del_p.E1013fs	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1013	Cys-rich.|EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GAGTCAGACACTCATTCACAT	0.582																																					p.C1014fs		Atlas-INDEL	.											.	LTBP2	158	.	0			c.3040delT						PASS	.						80.0	72.0	75.0					14																	74976906		2203	4300	6503	SO:0001589	frameshift_variant	4053	exon20			.		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3039delG	chr14.hg19:g.74976906delC	ENSP00000261978:p.Glu1013fs	25.0	0.0	0		35.0	15.0	0.428571	NM_000428	Q99907|Q9NS51	Frame_Shift_Del	DEL	ENST00000261978.4	hg19	CCDS9831.1																																																																																			.	.	.	none		0.582	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
NIPBL	25836	hgsc.bcm.edu	37	5	36976168	36976169	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr5:36976168_36976169insA	ENST00000282516.8	+	9	1658_1659	c.1159_1160insA	c.(1159-1161)gaafs	p.E387fs	NIPBL_ENST00000448238.2_Frame_Shift_Ins_p.E387fs|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	387					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CAATGTTTCAGAAAATGATATT	0.391																																					p.E387fs		Atlas-Indel,Pindel	.											.	NIPBL	513	.	0			c.1159_1160insA						PASS	.																																			SO:0001589	frameshift_variant	25836	exon9			.	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1163dupA	chr5.hg19:g.36976172_36976172dupA	ENSP00000282516:p.Glu387fs	126.0	0.0	0		122.0	32.0	0.262295	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Ins	INS	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.	.	none		0.391	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
ESRP2	80004	hgsc.bcm.edu	37	16	68267898	68267898	+	Splice_Site	DEL	T	T	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr16:68267898delT	ENST00000565858.1	-	3	526	c.440delA	c.(439-441)aag>ag	p.K147fs	ESRP2_ENST00000473183.2_Splice_Site_p.K147fs|RP11-96D1.6_ENST00000564147.1_RNA	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	147					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						GGAGCATACCTTCCTGGAGGC	0.622																																					p.K147fs		Atlas-INDEL	.											.	ESRP2	118	.	0			c.441delG						PASS	.						46.0	46.0	46.0					16																	68267898		2198	4300	6498	SO:0001630	splice_region_variant	80004	exon3			.	AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.441+1A>-	chr16.hg19:g.68267898delT		41.0	0.0	0		50.0	11.0	0.22	NM_024939	Q8N6H8|Q8WZ15|Q9H6I4	Frame_Shift_Del	DEL	ENST00000565858.1	hg19																																																																																				.	.	.	none		0.622	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	NM_024939	Frame_Shift_Del
ATRNL1	26033	hgsc.bcm.edu	37	10	116919947	116919947	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:116919947delA	ENST00000355044.3	+	6	1102	c.976delA	c.(976-978)aacfs	p.N326fs	ATRNL1_ENST00000527407.1_Frame_Shift_Del_p.N326fs|ATRNL1_ENST00000529665.1_3'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	326					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ATATACTTTTAACTACAGTTC	0.333																																					p.F325fs		Atlas-INDEL	.											.	ATRNL1	219	.	0			c.975delT						PASS	.						189.0	198.0	195.0					10																	116919947		2203	4300	6503	SO:0001589	frameshift_variant	26033	exon6			.	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.976delA	chr10.hg19:g.116919947delA	ENSP00000347152:p.Asn326fs	129.0	0.0	0		142.0	32.0	0.225352	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Frame_Shift_Del	DEL	ENST00000355044.3	hg19	CCDS7592.1																																																																																			.	.	.	none		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
CD1C	911	hgsc.bcm.edu	37	1	158262079	158262080	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:158262079_158262080insAA	ENST00000368170.3	+	3	813_814	c.534_535insAA	c.(535-537)aatfs	p.N179fs		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	179					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					AAACAGTGTATAATCTCATAAG	0.475																																					p.Y178fs		Atlas-Indel,Pindel	.											.	CD1C	100	.	0			c.534_535insAA						PASS	.																																			SO:0001589	frameshift_variant	911	exon3			.	M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.535_536dupAA	chr1.hg19:g.158262080_158262081dupAA	ENSP00000357152:p.Asn179fs	74.0	0.0	0		78.0	21.0	0.269231	NM_001765	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Frame_Shift_Ins	INS	ENST00000368170.3	hg19	CCDS1175.1																																																																																			.	.	.	none		0.475	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765	
ACSM2A	123876	hgsc.bcm.edu	37	16	20489924	20489925	+	Frame_Shift_Ins	INS	-	-	C	rs374997353		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr16:20489924_20489925insC	ENST00000573854.1	+	10	1320_1321	c.1206_1207insC	c.(1207-1209)cccfs	p.P403fs	ACSM2A_ENST00000575690.1_Frame_Shift_Ins_p.P403fs|ACSM2A_ENST00000536134.1_Frame_Shift_Ins_p.P175fs|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000219054.6_Frame_Shift_Ins_p.P403fs|ACSM2A_ENST00000417235.2_Frame_Shift_Ins_p.P324fs|ACSM2A_ENST00000396104.2_Frame_Shift_Ins_p.P403fs	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	403					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GCAACGTCCTGCCCCCCGGCAC	0.505																																					p.L402fs		Atlas-Indel,Pindel	.											.	ACSM2A	120	.	0			c.1206_1207insC						PASS	.																																			SO:0001589	frameshift_variant	123876	exon11			.	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1212dupC	chr16.hg19:g.20489930_20489930dupC	ENSP00000459451:p.Pro403fs	58.0	0.0	0		60.0	18.0	0.3	NM_001010845	B3KTT9|O75202	Frame_Shift_Ins	INS	ENST00000573854.1	hg19	CCDS32401.1																																																																																			.	.	.	none		0.505	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
C3AR1	719	hgsc.bcm.edu	37	12	8212016	8212016	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr12:8212016delA	ENST00000307637.4	-	2	969	c.766delT	c.(766-768)tctfs	p.S256fs		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	256					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		AATACATTAGAATACAGATTT	0.433																																					p.S256fs		Atlas-Indel,Pindel	.											.	C3AR1	61	.	0			c.767delC						PASS	.						64.0	66.0	66.0					12																	8212016		2203	4300	6503	SO:0001589	frameshift_variant	719	exon2			.	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.766delT	chr12.hg19:g.8212016delA	ENSP00000302079:p.Ser256fs	61.0	0.0	0		97.0	34.0	0.350515	NM_004054	O43771|Q92868	Frame_Shift_Del	DEL	ENST00000307637.4	hg19	CCDS8588.1																																																																																			.	.	.	none		0.433	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1		
THOC1	9984	hgsc.bcm.edu	37	18	267995	267995	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr18:267995delT	ENST00000261600.6	-	1	32	c.25delA	c.(25-27)agtfs	p.S9fs	RP11-705O1.8_ENST00000581677.1_lincRNA|THOC1_ENST00000582313.1_5'UTR	NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	9					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TCGGGCAAACTGAAGAGCGGC	0.647																																					p.S9fs		Atlas-Indel,Pindel	.											.	THOC1	43	.	0			c.26delG						PASS	.						18.0	23.0	21.0					18																	267995		1948	4131	6079	SO:0001589	frameshift_variant	9984	exon1			.	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.25delA	chr18.hg19:g.267995delT	ENSP00000261600:p.Ser9fs	44.0	0.0	0		58.0	16.0	0.275862	NM_005131	B2RBP6|Q15219|Q64I72|Q64I73	Frame_Shift_Del	DEL	ENST00000261600.6	hg19	CCDS45820.1																																																																																			.	.	.	none		0.647	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131	
SETX	23064	hgsc.bcm.edu	37	9	135203246	135203246	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr9:135203246delA	ENST00000224140.5	-	10	3921	c.3739delT	c.(3739-3741)tcafs	p.S1247fs	SETX_ENST00000393220.1_Frame_Shift_Del_p.S1247fs|SETX_ENST00000372169.2_Frame_Shift_Del_p.S1247fs	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1247					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTGGCATCTGAATGAGTTTTC	0.413																																					p.S1247X		Atlas-Indel,Pindel	.											.	SETX	234	.	0			c.3740delC						PASS	.						113.0	109.0	110.0					9																	135203246		2203	4300	6503	SO:0001589	frameshift_variant	23064	exon10			.	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.3739delT	chr9.hg19:g.135203246delA	ENSP00000224140:p.Ser1247fs	173.0	0.0	0		143.0	31.0	0.216783	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Frame_Shift_Del	DEL	ENST00000224140.5	hg19	CCDS6947.1																																																																																			.	.	.	none		0.413	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
CFAP43	80217	hgsc.bcm.edu	37	10	105926263	105926263	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:105926263delG	ENST00000357060.3	-	23	3137	c.3022delC	c.(3022-3024)caafs	p.Q1008fs	WDR96_ENST00000428666.1_Frame_Shift_Del_p.Q1009fs	NM_025145.5	NP_079421.5														NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AATATAATTTGGTTGATTTTC	0.383																																					p.Q1008fs		Atlas-Indel,Pindel	.											.	WDR96	183	.	0			c.3023delA						PASS	.						72.0	70.0	71.0					10																	105926263		2203	4300	6503	SO:0001589	frameshift_variant	80217	exon23			.																												ENST00000357060.3:c.3022delC	chr10.hg19:g.105926263delG	ENSP00000349568:p.Gln1008fs	88.0	0.0	0		94.0	26.0	0.276596	NM_025145		Frame_Shift_Del	DEL	ENST00000357060.3	hg19	CCDS31281.1																																																																																			.	.	.	none		0.383	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
NTRK2	4915	hgsc.bcm.edu	37	9	87359981	87359981	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr9:87359981delA	ENST00000323115.4	+	10	1642	c.1289delA	c.(1288-1290)catfs	p.H430fs	NTRK2_ENST00000376208.1_Frame_Shift_Del_p.H430fs|NTRK2_ENST00000304053.6_Frame_Shift_Del_p.H430fs|NTRK2_ENST00000359847.3_Frame_Shift_Del_p.H430fs|NTRK2_ENST00000277120.3_Frame_Shift_Del_p.H430fs|NTRK2_ENST00000376213.1_Frame_Shift_Del_p.H430fs|NTRK2_ENST00000395866.2_Frame_Shift_Del_p.H274fs|NTRK2_ENST00000376214.1_Frame_Shift_Del_p.H430fs|NTRK2_ENST00000395882.1_Frame_Shift_Del_p.H430fs			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	430					activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	GGTCGGGAACATCTCTCGGTG	0.433										TSP Lung(25;0.17)																											p.H430fs		Atlas-Indel,Pindel	.											.	NTRK2	331	.	0			c.1288delC						PASS	.						125.0	116.0	119.0					9																	87359981		2203	4300	6503	SO:0001589	frameshift_variant	4915	exon11			.	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1289delA	chr9.hg19:g.87359981delA	ENSP00000314586:p.His430fs	99.0	0.0	0		91.0	18.0	0.197802	NM_001018066	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Frame_Shift_Del	DEL	ENST00000323115.4	hg19	CCDS35050.1																																																																																			.	.	.	none		0.433	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
KIAA0232	9778	hgsc.bcm.edu	37	4	6863999	6864000	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr4:6863999_6864000insA	ENST00000307659.5	+	7	2345_2346	c.1890_1891insA	c.(1891-1893)aatfs	p.N631fs	KIAA0232_ENST00000425103.1_Frame_Shift_Ins_p.N631fs	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	631							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TGCTTGCTGGCAATCAAGAGCT	0.421																																					p.G630fs		Atlas-Indel,Pindel	.											.	KIAA0232	102	.	0			c.1890_1891insA						PASS	.																																			SO:0001589	frameshift_variant	9778	exon6			.	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.1892dupA	chr4.hg19:g.6864001_6864001dupA	ENSP00000303928:p.Asn631fs	84.0	0.0	0		79.0	22.0	0.278481	NM_001100590	A7E2D2	Frame_Shift_Ins	INS	ENST00000307659.5	hg19	CCDS43209.1																																																																																			.	.	.	none		0.421	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
DNAJC6	9829	hgsc.bcm.edu	37	1	65830460	65830461	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:65830460_65830461delTG	ENST00000395325.3	+	2	322_323	c.165_166delTG	c.(163-168)tctgtgfs	p.V56fs	DNAJC6_ENST00000371069.4_Frame_Shift_Del_p.V113fs|DNAJC6_ENST00000263441.7_Frame_Shift_Del_p.V43fs	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	56	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TGATACAATCTGTGACCAGGTA	0.45																																					p.112_112del		Atlas-Indel,Pindel	.											DNAJC6,NS,carcinoma,0,1	DNAJC6	104	.	0			c.335_336del						PASS	.																																			SO:0001589	frameshift_variant	9829	exon2			.	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.165_166delTG	chr1.hg19:g.65830462_65830463delTG	ENSP00000378735:p.Val56fs	41.0	0.0	0		47.0	11.0	0.234043	NM_001256864	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Frame_Shift_Del	DEL	ENST00000395325.3	hg19	CCDS30739.1																																																																																			.	.	.	none		0.450	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
FUBP1	8880	hgsc.bcm.edu	37	1	78425867	78425892	+	Splice_Site	DEL	CTTCTACCTGGATCAGGAGGAGCCTG	CTTCTACCTGGATCAGGAGGAGCCTG	-	rs149973677		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	CTTCTACCTGGATCAGGAGGAGCCTG	CTTCTACCTGGATCAGGAGGAGCCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr1:78425867_78425892delCTTCTACCTGGATCAGGAGGAGCCTG	ENST00000370768.2	-	16	1634_1658	c.1553_1577delCAGGCTCCTCCTGATCCAGGTAGAAG	c.(1552-1578)ccaggctcctcctgatccaggtagaag>cg	p.PGSS*SR*K518fs	FUBP1_ENST00000370767.1_Splice_Site_p.PGSS*SR*K518fs|FUBP1_ENST00000436586.2_Splice_Site_p.PGSS*SR*K539fs	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	518	Pro-rich.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.Q520*(1)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						AGCATCTTCTACCTGGATCAGGAGGAGCCTGCTGCTGCCAGTGTGG	0.403			"""F, N"""		oligodendroglioma																																p.520_526del		Atlas-INDEL	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	112	.	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	c.1559_1576del						PASS	.																																			SO:0001630	splice_region_variant	8880	exon16			.	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1576+1CAGGCTCCTCCTGATCCAGGTAGAAG>-	chr1.hg19:g.78425867_78425892delCTTCTACCTGGATCAGGAGGAGCCTG		117.0	0.0	0		89.0	11.0	0.123596	NM_003902	Q12828	In_Frame_Del	DEL	ENST00000370768.2	hg19	CCDS683.1																																																																																			.	.	.	none		0.403	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	Frame_Shift_Del
PYCRL	65263	hgsc.bcm.edu	37	8	144687925	144687956	+	Frame_Shift_Del	DEL	GTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGC	GTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGC	-	rs138226068|rs575409447|rs199825286|rs375748238		TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	GTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGC	GTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr8:144687925_144687956delGTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGC	ENST00000220966.6	-	6	804_835	c.775_806delGCCCTGGAGCAGGGCGGGCTGCGAGCAGCCAC	c.(775-807)gccctggagcagggcgggctgcgagcagccaccfs	p.ALEQGGLRAAT259fs	RP11-661A12.14_ENST00000606452.1_lincRNA|PYCRL_ENST00000495276.1_5'UTR|PYCRL_ENST00000377579.3_Frame_Shift_Del_p.ALEQGGLRAAT110fs	NM_023078.3	NP_075566.2	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	247					L-proline biosynthetic process (GO:0055129)		pyrroline-5-carboxylate reductase activity (GO:0004735)	p.A255V(1)|p.L248_A256delLEQGGLRAA(1)		central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		L-Proline(DB00172)	GGCGCTCATGGTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGCGTGGAGTCCA	0.677																																					p.259_269del		Pindel	.											.	PYCRL	14	.	2	Substitution - Missense(1)|Deletion - In frame(1)	ovary(1)|endometrium(1)	c.776_807del						PASS	.																																			SO:0001589	frameshift_variant	65263	exon6			.	AF086378	CCDS6407.2	8q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000104524	ENSG00000104524			25846	protein-coding gene	gene with protein product							Standard	NM_023078		Approved	FLJ13852	uc003yyy.3	Q53H96	OTTHUMG00000157010	ENST00000220966.6:c.775_806delGCCCTGGAGCAGGGCGGGCTGCGAGCAGCCAC	chr8.hg19:g.144687925_144687956delGTGGCTGCTCGCAGCCCGCCCTGCTCCAGGGC	ENSP00000220966:p.Ala259fs	96.0	0.0	.		89.0	11.0	0.124	NM_023078	B3KMB5|B4DVT6|H0Y6C3|Q8N3N9|Q96HX4|Q9H896	Frame_Shift_Del	DEL	ENST00000220966.6	hg19	CCDS6407.2																																																																																			.	.	.	none		0.677	PYCRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347081.2	NM_023078	
ITSN2	50618	hgsc.bcm.edu	37	2	24535083	24535094	+	In_Frame_Del	DEL	AAACGAGCAGAA	AAACGAGCAGAA	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	AAACGAGCAGAA	AAACGAGCAGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr2:24535083_24535094delAAACGAGCAGAA	ENST00000355123.4	-	5	782_793	c.339_350delTTCTGCTCGTTT	c.(337-351)atttctgctcgtttt>att	p.SARF114del	ITSN2_ENST00000407704.1_5'UTR|ITSN2_ENST00000361999.3_In_Frame_Del_p.SARF114del|ITSN2_ENST00000406921.3_In_Frame_Del_p.SARF114del	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	114					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATACTTACCAAAACGAGCAGAAATTAATGGAG	0.358																																					p.114_117del		Pindel	.											.	ITSN2	224	.	0			c.340_351del						PASS	.																																			SO:0001651	inframe_deletion	50618	exon5			.	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.339_350delTTCTGCTCGTTT	chr2.hg19:g.24535083_24535094delAAACGAGCAGAA	ENSP00000347244:p.Ser114_Phe117del	165.0	0.0	.		143.0	18.0	0.126	NM_147152	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	In_Frame_Del	DEL	ENST00000355123.4	hg19	CCDS1710.2																																																																																			.	.	.	none		0.358	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
LTBP2	4053	hgsc.bcm.edu	37	14	74976904	74976906	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr14:74976904_74976906delCAC	ENST00000261978.4	-	20	3425_3427	c.3039_3041delGTG	c.(3037-3042)gagtgt>gat	p.1013_1014EC>D	LTBP2_ENST00000556690.1_In_Frame_Del_p.1013_1014EC>D	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1013	Cys-rich.|EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GGGAGTCAGACACTCATTCACAT	0.581																																					p.1014_1014del		Pindel	.											.	LTBP2	158	.	0			c.3040_3042del						PASS	.																																			SO:0001651	inframe_deletion	4053	exon20			.		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3039_3041delGTG	chr14.hg19:g.74976904_74976906delCAC	ENSP00000261978:p.Glu1013_Cys1014delinsAsp	25.0	0.0	.		36.0	10.0	0.278	NM_000428	Q99907|Q9NS51	In_Frame_Del	DEL	ENST00000261978.4	hg19	CCDS9831.1																																																																																			.	.	.	none		0.581	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
ATRNL1	26033	hgsc.bcm.edu	37	10	116919943	116919943	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IA-A83S-01A-11D-A34Z-10	TCGA-IA-A83S-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	239993db-83a2-4300-9378-31070f75b60b	2d7ce817-8f00-4d31-b073-fca46cc77009	g.chr10:116919943delT	ENST00000355044.3	+	6	1098	c.972delT	c.(970-972)actfs	p.T324fs	ATRNL1_ENST00000527407.1_Frame_Shift_Del_p.T324fs|ATRNL1_ENST00000529665.1_3'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	324					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GTGGATATACTTTTAACTACA	0.343																																					p.T324fs		Pindel	.											.	ATRNL1	219	.	0			c.971delC						PASS	.						197.0	205.0	202.0					10																	116919943		2203	4300	6503	SO:0001589	frameshift_variant	26033	exon6			.	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.972delT	chr10.hg19:g.116919943delT	ENSP00000347152:p.Thr324fs	134.0	0.0	.		144.0	22.0	0.153	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Frame_Shift_Del	DEL	ENST00000355044.3	hg19	CCDS7592.1																																																																																			.	.	.	none		0.343	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
