#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF12	390999	hgsc.bcm.edu	37	1	12835275	12835275	+	Missense_Mutation	SNP	C	C	T	rs376821629		TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr1:12835275C>T	ENST00000357726.4	+	1	292	c.265C>T	c.(265-267)Ctt>Ttt	p.L89F		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	89					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGATGCACTGCTTGCCCAGAA	0.597																																					p.L89F		Atlas-SNP	.											.	PRAMEF12	69	.	0			c.C265T						PASS	.	C	PHE/LEU	0,4396		0,0,2198	75.0	78.0	77.0		265	2.7	0.1	1		77	2,8598		0,2,4298	no	missense	PRAMEF12	NM_001080830.1	22	0,2,6496	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	89/484	12835275	2,12994	2198	4300	6498	SO:0001583	missense	390999	exon1			GCACTGCTTGCCC		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.265C>T	chr1.hg19:g.12835275C>T	ENSP00000350358:p.Leu89Phe	74.0	0.0	.		83.0	25.0	.	NM_001080830		Missense_Mutation	SNP	ENST00000357726.4	hg19	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	13.29	2.193803	0.38707	0.0	2.33E-4	ENSG00000116726	ENST00000357726	T	0.06068	3.35	2.68	2.68	0.31781	.	0.378221	0.23234	N	0.050437	T	0.13884	0.0336	M	0.90369	3.11	0.09310	N	0.999999	P	0.35174	0.488	B	0.40506	0.331	T	0.09271	-1.0682	10	0.66056	D	0.02	.	5.5671	0.17177	0.0:0.8465:0.0:0.1535	.	89	O95522	PRA12_HUMAN	F	89	ENSP00000350358:L89F	ENSP00000350358:L89F	L	+	1	0	PRAMEF12	12757862	0.076000	0.21285	0.104000	0.21259	0.371000	0.29859	1.313000	0.33585	1.791000	0.52520	0.195000	0.17529	CTT	.	.	.	none		0.597	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760	
RPE65	6121	hgsc.bcm.edu	37	1	68910320	68910320	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr1:68910320T>A	ENST00000262340.5	-	5	442	c.389A>T	c.(388-390)gAc>gTc	p.D130V		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	130					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						AAGGGCATTGTCAGTAACCTC	0.378																																					p.D130V		Atlas-SNP	.											.	RPE65	87	.	0			c.A389T						PASS	.						71.0	74.0	73.0					1																	68910320		2203	4300	6503	SO:0001583	missense	6121	exon5			GCATTGTCAGTAA	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.389A>T	chr1.hg19:g.68910320T>A	ENSP00000262340:p.Asp130Val	134.0	0.0	.		126.0	28.0	.	NM_000329	A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	hg19	CCDS643.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373457	0.82573	.	.	ENSG00000116745	ENST00000262340	D	0.95412	-3.7	5.05	5.05	0.67936	.	0.124550	0.64402	D	0.000001	D	0.97813	0.9282	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98674	1.0689	10	0.66056	D	0.02	-19.5298	14.9454	0.71026	0.0:0.0:0.0:1.0	.	130	Q16518	RPE65_HUMAN	V	130	ENSP00000262340:D130V	ENSP00000262340:D130V	D	-	2	0	RPE65	68682908	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.525000	0.81892	2.122000	0.65172	0.533000	0.62120	GAC	.	.	.	none		0.378	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
CENPF	1063	hgsc.bcm.edu	37	1	214802436	214802436	+	Silent	SNP	T	T	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr1:214802436T>C	ENST00000366955.3	+	8	1284	c.1116T>C	c.(1114-1116)agT>agC	p.S372S		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAGATTTGAGTTGTCAGCGAC	0.313																																					p.S372S	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											.	CENPF	321	.	0			c.T1116C						PASS	.						64.0	69.0	68.0					1																	214802436		2203	4300	6503	SO:0001819	synonymous_variant	1063	exon8			TTTGAGTTGTCAG	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1116T>C	chr1.hg19:g.214802436T>C		301.0	0.0	.		340.0	14.0	.	NM_016343	Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	hg19	CCDS31023.1																																																																																			.	.	.	none		0.313	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
LBR	3930	hgsc.bcm.edu	37	1	225592163	225592163	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr1:225592163G>A	ENST00000338179.2	-	13	1755	c.1630C>T	c.(1630-1632)Cgc>Tgc	p.R544C	LBR_ENST00000272163.4_Missense_Mutation_p.R544C	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	544					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		TTGGGGTGGCGAACAAAGCCC	0.413																																					p.R544C		Atlas-SNP	.											.	LBR	54	.	0			c.C1630T						PASS	.						67.0	69.0	68.0					1																	225592163		2203	4300	6503	SO:0001583	missense	3930	exon13			GGTGGCGAACAAA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1630C>T	chr1.hg19:g.225592163G>A	ENSP00000339883:p.Arg544Cys	133.0	0.0	.		118.0	13.0	.	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	hg19	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	G	33	5.274431	0.95459	.	.	ENSG00000143815	ENST00000272163;ENST00000338179	D;D	0.98762	-5.12;-5.12	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.99557	0.9841	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97985	1.0351	10	0.87932	D	0	-19.7542	20.3316	0.98722	0.0:0.0:1.0:0.0	.	544	Q14739	LBR_HUMAN	C	544	ENSP00000272163:R544C;ENSP00000339883:R544C	ENSP00000272163:R544C	R	-	1	0	LBR	223658786	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.708000	0.98727	2.871000	0.98454	0.655000	0.94253	CGC	.	.	.	none		0.413	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
OTOF	9381	hgsc.bcm.edu	37	2	26781380	26781380	+	Silent	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr2:26781380G>A	ENST00000272371.2	-	1	186	c.60C>T	c.(58-60)atC>atT	p.I20I	OTOF_ENST00000403946.3_Silent_p.I20I	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	20					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCACTTTGGCGATCCGGTCGC	0.657																																					p.I20I	GBM(102;732 1451 20652 24062 31372)	Atlas-SNP	.											.	OTOF	524	.	0			c.C60T						PASS	.						58.0	57.0	58.0					2																	26781380		2203	4300	6503	SO:0001819	synonymous_variant	9381	exon1			TTTGGCGATCCGG	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.60C>T	chr2.hg19:g.26781380G>A		172.0	0.0	.		164.0	39.0	.	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	ENST00000272371.2	hg19	CCDS1725.1																																																																																			.	.	.	none		0.657	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
OTOF	9381	hgsc.bcm.edu	37	2	26781388	26781388	+	Missense_Mutation	SNP	C	C	A	rs376856990		TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr2:26781388C>A	ENST00000272371.2	-	1	178	c.52G>T	c.(52-54)Gac>Tac	p.D18Y	OTOF_ENST00000403946.3_Missense_Mutation_p.D18Y	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	18					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGATCCGGTCGCCCCTGCCC	0.662																																					p.D18Y	GBM(102;732 1451 20652 24062 31372)	Atlas-SNP	.											.	OTOF	524	.	0			c.G52T						PASS	.						57.0	56.0	57.0					2																	26781388		2203	4300	6503	SO:0001583	missense	9381	exon1			TCCGGTCGCCCCT	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.52G>T	chr2.hg19:g.26781388C>A	ENSP00000272371:p.Asp18Tyr	165.0	0.0	.		160.0	37.0	.	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	hg19	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974238	0.74246	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.79653	-1.29;-1.29	5.67	4.79	0.61399	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.87744	0.6254	M	0.70275	2.135	0.50813	D	0.999892	D	0.71674	0.998	D	0.69479	0.964	D	0.88796	0.3281	10	0.87932	D	0	-35.1014	12.7055	0.57058	0.0:0.9196:0.0:0.0804	.	18	Q9HC10	OTOF_HUMAN	Y	18	ENSP00000272371:D18Y;ENSP00000385255:D18Y	ENSP00000272371:D18Y	D	-	1	0	OTOF	26634892	0.989000	0.36119	0.990000	0.47175	0.896000	0.52359	3.138000	0.50570	1.386000	0.46466	0.650000	0.86243	GAC	.	.	.	alt		0.662	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
DCLK3	85443	hgsc.bcm.edu	37	3	36779671	36779671	+	Silent	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr3:36779671C>T	ENST00000416516.2	-	2	970	c.480G>A	c.(478-480)ggG>ggA	p.G160G		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	160						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						GCTCACTGGTCCCCAGAGAAA	0.547																																					p.G160G		Atlas-SNP	.											.	DCLK3	95	.	0			c.G480A						PASS	.						117.0	122.0	121.0					3																	36779671		1954	4150	6104	SO:0001819	synonymous_variant	85443	exon2			ACTGGTCCCCAGA	AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.480G>A	chr3.hg19:g.36779671C>T		142.0	0.0	.		160.0	27.0	.	NM_033403		Silent	SNP	ENST00000416516.2	hg19	CCDS43064.1																																																																																			.	.	.	none		0.547	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355	
SCN11A	11280	hgsc.bcm.edu	37	3	38908836	38908836	+	Silent	SNP	G	G	A	rs371852759		TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr3:38908836G>A	ENST00000302328.3	-	23	4125	c.3927C>T	c.(3925-3927)gaC>gaT	p.D1309D	SCN11A_ENST00000450244.1_Silent_p.D1309D|SCN11A_ENST00000456224.3_Silent_p.D1271D|SCN11A_ENST00000444237.2_Silent_p.D1309D	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1309					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGTTGAAGTTGTCAATGATAA	0.368																																					p.D1309D		Atlas-SNP	.											.	SCN11A	296	.	0			c.C3927T						PASS	.	G		1,4405	2.1+/-5.4	0,1,2202	150.0	140.0	144.0		3927	2.3	1.0	3		144	0,8600		0,0,4300	no	coding-synonymous	SCN11A	NM_014139.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1309/1792	38908836	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11280	exon23			GAAGTTGTCAATG	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3927C>T	chr3.hg19:g.38908836G>A		92.0	0.0	.		86.0	21.0	.	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	hg19	CCDS33737.1																																																																																			.	.	.	weak		0.368	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
C5orf42	65250	hgsc.bcm.edu	37	5	37185181	37185181	+	Splice_Site	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr5:37185181C>T	ENST00000508244.1	-	24	4283	c.4190G>A	c.(4189-4191)gGa>gAa	p.G1397E	C5orf42_ENST00000274258.7_Splice_Site_p.G278E|C5orf42_ENST00000425232.2_Splice_Site_p.G1397E			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1397						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AGTCTGGGGTCCTGGAAAGAA	0.398																																					p.G1397E		Atlas-SNP	.											.	C5orf42	422	.	0			c.G4190A						PASS	.						49.0	49.0	49.0					5																	37185181		2203	4300	6503	SO:0001630	splice_region_variant	65250	exon25			TGGGGTCCTGGAA		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.4190-1G>A	chr5.hg19:g.37185181C>T		191.0	0.0	.		193.0	47.0	.	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996523	0.93167	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.98	5.98	0.97165	.	0.081462	0.45126	D	0.000390	T	0.68054	0.2959	N	0.24115	0.695	0.43480	D	0.995705	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67768	-0.5585	10	0.45353	T	0.12	.	15.5265	0.75915	0.0:0.9324:0.0:0.0676	.	1397;278	E9PH94;Q9H799	.;CE042_HUMAN	E	1397;1397;278;445;278	ENSP00000421690:G1397E;ENSP00000389014:G1397E;ENSP00000274258:G278E;ENSP00000424223:G445E	ENSP00000274258:G278E	G	-	2	0	C5orf42	37220938	0.996000	0.38824	0.983000	0.44433	0.982000	0.71751	2.961000	0.49168	2.847000	0.97988	0.591000	0.81541	GGA	.	.	.	none		0.398	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	Missense_Mutation
CCNO	10309	hgsc.bcm.edu	37	5	54528321	54528321	+	Silent	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr5:54528321G>A	ENST00000282572.4	-	2	591	c.435C>T	c.(433-435)cgC>cgT	p.R145R	RP11-506H20.1_ENST00000506435.1_RNA	NM_021147.3	NP_066970.3	P22674	CCNO_HUMAN	cyclin O	145					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cell cycle (GO:0007049)|cell division (GO:0051301)|cilium assembly (GO:0042384)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)|embryo development (GO:0009790)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	uracil DNA N-glycosylase activity (GO:0004844)			endometrium(1)|lung(3)|skin(1)	5		Lung NSC(810;4.08e-05)|Breast(144;0.0735)|Prostate(74;0.183)	LUSC - Lung squamous cell carcinoma(15;0.142)|Lung(15;0.161)			GGCCGAATTGGCGGTGCACCG	0.667																																					p.R145R		Atlas-SNP	.											.	CCNO	17	.	0			c.C435T						PASS	.						71.0	60.0	64.0					5																	54528321		2203	4300	6503	SO:0001819	synonymous_variant	10309	exon2			GAATTGGCGGTGC	M87499	CCDS34157.1	5q11.2	2010-11-15	2007-07-26	2007-07-26	ENSG00000152669	ENSG00000152669			18576	protein-coding gene	gene with protein product		607752	"""cyclin U"""	CCNU			Standard	NR_125346		Approved	UDG2, FLJ22422, UNG2	uc003jpw.3	P22674	OTTHUMG00000162598	ENST00000282572.4:c.435C>T	chr5.hg19:g.54528321G>A		162.0	0.0	.		204.0	43.0	.	NM_021147	A8K1W5|Q0P6J2|Q9H6B0|Q9UMD5	Silent	SNP	ENST00000282572.4	hg19	CCDS34157.1																																																																																			.	.	.	none		0.667	CCNO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369707.1	NM_021147	
MAS1L	116511	hgsc.bcm.edu	37	6	29455103	29455103	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr6:29455103C>G	ENST00000377127.3	-	1	635	c.577G>C	c.(577-579)Gtc>Ctc	p.V193L		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	193					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						AGGGTGCAGACAACATTAGAT	0.463																																					p.V193L	NSCLC(153;755 1987 3859 11251 32945)	Atlas-SNP	.											.	MAS1L	66	.	0			c.G577C						PASS	.						68.0	59.0	62.0					6																	29455103		2203	4300	6503	SO:0001583	missense	116511	exon1			TGCAGACAACATT	S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.577G>C	chr6.hg19:g.29455103C>G	ENSP00000366331:p.Val193Leu	111.0	0.0	.		127.0	10.0	.	NM_052967	Q5SUN5	Missense_Mutation	SNP	ENST00000377127.3	hg19	CCDS4661.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.403256	0.25291	.	.	ENSG00000204687	ENST00000377127	T	0.34275	1.37	2.36	-1.09	0.09904	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.19208	0.0461	L	0.37800	1.135	0.09310	N	1	P	0.37500	0.597	P	0.51701	0.677	T	0.36720	-0.9736	9	0.51188	T	0.08	.	4.0133	0.09632	0.0:0.5369:0.1966:0.2665	.	193	P35410	MAS1L_HUMAN	L	193	ENSP00000366331:V193L	ENSP00000366331:V193L	V	-	1	0	MAS1L	29563082	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.056000	0.14256	-0.452000	0.07087	0.596000	0.82720	GTC	.	.	.	none		0.463	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967	
CASP8AP2	9994	hgsc.bcm.edu	37	6	90573481	90573481	+	RNA	SNP	A	A	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr6:90573481A>G	ENST00000551025.1	+	0	3490									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CCCATCTCCTATGGAAATACA	0.398																																					p.M685V	Colon(187;1656 2025 17045 31481 39901)	Atlas-SNP	.											.	CASP8AP2	108	.	0			c.A2053G						PASS	.						60.0	54.0	56.0					6																	90573481		1899	4122	6021			9994	exon7			TCTCCTATGGAAA	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		chr6.hg19:g.90573481A>G		86.0	0.0	.		110.0	25.0	.	NM_001137667		Missense_Mutation	SNP	ENST00000551025.1	hg19																																																																																				.	.	.	none		0.398	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
COQ3	51805	hgsc.bcm.edu	37	6	99817502	99817502	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr6:99817502C>A	ENST00000254759.3	-	7	1108	c.1084G>T	c.(1084-1086)Gct>Tct	p.A362S	COQ3_ENST00000369242.1_Missense_Mutation_p.A134S|COQ3_ENST00000369240.1_Missense_Mutation_p.A134S	NM_017421.3	NP_059117.3	Q9NZJ6	COQ3_HUMAN	coenzyme Q3 methyltransferase	362					glycerol metabolic process (GO:0006071)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2-polyprenyl-6-methoxy-1,4-benzoquinone methyltransferase activity (GO:0008425)|3-demethylubiquinone-9 3-O-methyltransferase activity (GO:0008689)|hexaprenyldihydroxybenzoate methyltransferase activity (GO:0004395)|O-methyltransferase activity (GO:0008171)			cervix(1)|lung(5)|upper_aerodigestive_tract(2)	8		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0625)		TCATGCACAGCTGGATTGGTG	0.393																																					p.A362S		Atlas-SNP	.											.	COQ3	19	.	0			c.G1084T						PASS	.						136.0	141.0	139.0					6																	99817502		2203	4300	6503	SO:0001583	missense	51805	exon7			GCACAGCTGGATT	AF193016	CCDS5042.1	6q21	2013-05-01	2013-05-01		ENSG00000132423	ENSG00000132423	2.1.1.114		18175	protein-coding gene	gene with protein product	"""polyprenyldihydroxybenzoate methyltransferase"""	605196	"""coenzyme Q3 homolog, methyltransferase (yeast)"", ""coenzyme Q3 homolog, methyltransferase (S. cerevisiae)"""			10777520	Standard	NM_017421		Approved	bA9819.1	uc003ppk.3	Q9NZJ6	OTTHUMG00000015264	ENST00000254759.3:c.1084G>T	chr6.hg19:g.99817502C>A	ENSP00000254759:p.Ala362Ser	169.0	0.0	.		181.0	41.0	.	NM_017421	B3KPX0|Q5T061|Q6P4F0|Q8IXG6|Q96BG1|Q9H0N1	Missense_Mutation	SNP	ENST00000254759.3	hg19	CCDS5042.1	.	.	.	.	.	.	.	.	.	.	C	7.031	0.560676	0.13498	.	.	ENSG00000132423	ENST00000254759;ENST00000369242;ENST00000369240	T;T;T	0.28454	2.03;1.61;1.61	4.74	1.85	0.25348	.	1.012920	0.07926	N	0.976816	T	0.03053	0.0090	N	0.02011	-0.69	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.42682	-0.9437	10	0.25751	T	0.34	-28.7078	4.1853	0.10395	0.0:0.5306:0.1727:0.2967	.	362	Q9NZJ6	COQ3_HUMAN	S	362;134;134	ENSP00000254759:A362S;ENSP00000358245:A134S;ENSP00000358243:A134S	ENSP00000254759:A362S	A	-	1	0	COQ3	99924223	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.606000	0.05654	0.132000	0.18615	0.650000	0.86243	GCT	.	.	.	none		0.393	COQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041602.1	NM_017421	
TNRC18	84629	hgsc.bcm.edu	37	7	5414035	5414035	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr7:5414035C>G	ENST00000430969.1	-	10	3228	c.2880G>C	c.(2878-2880)aaG>aaC	p.K960N	TNRC18_ENST00000399537.4_Missense_Mutation_p.K960N	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	960							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CCAGGCCAGCCTTGCCCGCAG	0.771																																					p.K960N		Atlas-SNP	.											.	TNRC18	311	.	0			c.G2880C						PASS	.						4.0	4.0	4.0					7																	5414035		1555	3371	4926	SO:0001583	missense	84629	exon10			GCCAGCCTTGCCC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2880G>C	chr7.hg19:g.5414035C>G	ENSP00000395538:p.Lys960Asn	28.0	0.0	.		50.0	16.0	.	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	C	4.254	0.046072	0.08243	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000327499	T;T	0.14022	2.54;2.54	5.34	-0.488	0.12056	.	.	.	.	.	T	0.28433	0.0703	M	0.66939	2.045	0.20307	N	0.999916	D	0.89917	1.0	D	0.85130	0.997	T	0.09618	-1.0666	9	0.87932	D	0	.	4.6366	0.12527	0.1483:0.4114:0.0:0.4403	.	960	O15417	TNC18_HUMAN	N	960;960;15;15	ENSP00000382452:K960N;ENSP00000395538:K960N	ENSP00000330383:K15N	K	-	3	2	TNRC18	5380561	0.986000	0.35501	0.689000	0.30133	0.036000	0.12997	0.120000	0.15647	-0.006000	0.14370	-0.224000	0.12420	AAG	.	.	.	none		0.771	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
VWC2	375567	hgsc.bcm.edu	37	7	49815638	49815638	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr7:49815638G>C	ENST00000340652.4	+	2	1163	c.607G>C	c.(607-609)Gac>Cac	p.D203H		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	203	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						CATCCACGTCGACACGAGCCA	0.677																																					p.D203H		Atlas-SNP	.											.	VWC2	30	.	0			c.G607C						PASS	.						13.0	18.0	16.0					7																	49815638		2147	4233	6380	SO:0001583	missense	375567	exon2			CACGTCGACACGA	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.607G>C	chr7.hg19:g.49815638G>C	ENSP00000341819:p.Asp203His	17.0	0.0	.		28.0	16.0	.	NM_198570	Q6UXE2	Missense_Mutation	SNP	ENST00000340652.4	hg19	CCDS5508.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580112	0.86645	.	.	ENSG00000188730	ENST00000340652	T	0.13778	2.56	4.81	4.81	0.61882	von Willebrand factor, type C (1);	0.000000	0.85682	D	0.000000	T	0.22085	0.0532	N	0.14661	0.345	0.58432	D	0.999998	D	0.67145	0.996	D	0.70016	0.967	T	0.13629	-1.0502	10	0.41790	T	0.15	.	18.301	0.90163	0.0:0.0:1.0:0.0	.	203	Q2TAL6	VWC2_HUMAN	H	203	ENSP00000341819:D203H	ENSP00000341819:D203H	D	+	1	0	VWC2	49786184	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.595000	0.98260	2.379000	0.81126	0.555000	0.69702	GAC	.	.	.	none		0.677	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570	
FAM83A	84985	hgsc.bcm.edu	37	8	124206353	124206353	+	Silent	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr8:124206353C>T	ENST00000518448.1	+	4	2752	c.738C>T	c.(736-738)atC>atT	p.I246I	FAM83A_ENST00000546351.1_Silent_p.I190I|FAM83A_ENST00000536633.1_Silent_p.I246I|FAM83A_ENST00000318462.6_Silent_p.I246I|FAM83A_ENST00000276699.6_Silent_p.I246I|FAM83A_ENST00000522648.1_Silent_p.I190I			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	246										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AGTTCATCATCTCGGACTGGA	0.507																																					p.I246I		Atlas-SNP	.											.	FAM83A	64	.	0			c.C738T						PASS	.						138.0	119.0	126.0					8																	124206353		2203	4300	6503	SO:0001819	synonymous_variant	84985	exon3			CATCATCTCGGAC	BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.738C>T	chr8.hg19:g.124206353C>T		59.0	0.0	.		64.0	15.0	.	NM_032899	Q71HL2|Q8N7I1|Q96I47	Silent	SNP	ENST00000518448.1	hg19	CCDS6340.1																																																																																			.	.	.	none		0.507	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381737.1	NM_032899	
HNRNPH3	3189	hgsc.bcm.edu	37	10	70098907	70098907	+	Silent	SNP	T	T	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr10:70098907T>C	ENST00000265866.7	+	5	612	c.447T>C	c.(445-447)ggT>ggC	p.G149G	HNRNPH3_ENST00000469172.1_3'UTR|HNRNPH3_ENST00000354695.5_Silent_p.G134G|HNRNPH3_ENST00000441000.2_Silent_p.G41G	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)	149	Gly-rich.				epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						GTTATGGAGGTTTTGATGACT	0.318																																					p.G149G		Atlas-SNP	.											.	HNRNPH3	33	.	0			c.T447C						PASS	.						135.0	145.0	142.0					10																	70098907		2203	4300	6503	SO:0001819	synonymous_variant	3189	exon5			TGGAGGTTTTGAT		CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349	ENST00000265866.7:c.447T>C	chr10.hg19:g.70098907T>C		123.0	0.0	.		131.0	38.0	.	NM_012207	A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	Silent	SNP	ENST00000265866.7	hg19	CCDS7278.1																																																																																			.	.	.	none		0.318	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090165.1		
PLAC9	219348	hgsc.bcm.edu	37	10	81901918	81901918	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr10:81901918C>G	ENST00000372263.3	+	2	187	c.145C>G	c.(145-147)Cta>Gta	p.L49V	PLAC9_ENST00000372270.2_Missense_Mutation_p.L7V|PLAC9_ENST00000372267.2_Missense_Mutation_p.L49V	NM_001012973.1	NP_001012991.1	Q5JTB6	PLAC9_HUMAN	placenta-specific 9	49						extracellular region (GO:0005576)				kidney(1)|ovary(1)	2	Prostate(51;0.0095)|all_epithelial(25;0.175)		Colorectal(32;0.109)			GCAACGCCGTCTAGATGTCAT	0.537																																					p.L49V		Atlas-SNP	.											.	PLAC9	9	.	0			c.C145G						PASS	.						128.0	89.0	102.0					10																	81901918		2203	4300	6503	SO:0001583	missense	219348	exon2			CGCCGTCTAGATG		CCDS31232.1	10q23.2	2008-02-04			ENSG00000189129	ENSG00000189129			19255	protein-coding gene	gene with protein product		612857					Standard	NM_001012973		Approved		uc001kbp.1	Q5JTB6	OTTHUMG00000018596	ENST00000372263.3:c.145C>G	chr10.hg19:g.81901918C>G	ENSP00000361337:p.Leu49Val	28.0	0.0	.		44.0	10.0	.	NM_001012973		Missense_Mutation	SNP	ENST00000372263.3	hg19	CCDS31232.1	.	.	.	.	.	.	.	.	.	.	C	2.210	-0.380998	0.05000	.	.	ENSG00000189129	ENST00000372270;ENST00000372267;ENST00000372263	.	.	.	3.74	0.113	0.14631	.	0.000000	0.31404	N	0.007712	T	0.54822	0.1882	.	.	.	0.09310	N	1	D	0.67145	0.996	D	0.79108	0.992	T	0.43015	-0.9417	8	0.66056	D	0.02	.	5.8715	0.18807	0.0:0.4521:0.0:0.5479	.	49	Q5JTB6	PLAC9_HUMAN	V	7;49;49	.	ENSP00000361337:L49V	L	+	1	2	PLAC9	81891898	0.003000	0.15002	0.001000	0.08648	0.033000	0.12548	0.053000	0.14184	0.011000	0.14865	0.537000	0.68136	CTA	.	.	.	none		0.537	PLAC9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049019.1	NM_001012973	
SORCS1	114815	hgsc.bcm.edu	37	10	108427453	108427453	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr10:108427453C>A	ENST00000263054.6	-	17	2304	c.2297G>T	c.(2296-2298)aGt>aTt	p.S766I	SORCS1_ENST00000369698.1_Missense_Mutation_p.S301I|SORCS1_ENST00000344440.6_Missense_Mutation_p.S766I	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	766					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TTACCCAGTACTATTGAGGTA	0.488																																					p.S766I		Atlas-SNP	.											.	SORCS1	534	.	0			c.G2297T						PASS	.						74.0	65.0	68.0					10																	108427453		2203	4300	6503	SO:0001583	missense	114815	exon17			CCAGTACTATTGA	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2297G>T	chr10.hg19:g.108427453C>A	ENSP00000263054:p.Ser766Ile	52.0	0.0	.		65.0	15.0	.	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240052	0.79912	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.27557	1.66;2.23;2.23	5.49	5.49	0.81192	VPS10 (1);	0.051681	0.85682	D	0.000000	T	0.63355	0.2504	M	0.87180	2.865	0.51233	D	0.999919	D;D;D;D;D	0.71674	0.994;0.998;0.998;0.997;0.998	D;D;D;D;D	0.76575	0.924;0.988;0.988;0.957;0.988	T	0.66952	-0.5793	9	.	.	.	-17.8618	19.7394	0.96219	0.0:1.0:0.0:0.0	.	766;766;766;766;766	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	I	301;766;766	ENSP00000358712:S301I;ENSP00000263054:S766I;ENSP00000345964:S766I	.	S	-	2	0	SORCS1	108417443	1.000000	0.71417	0.990000	0.47175	0.838000	0.47535	4.588000	0.60999	2.745000	0.94114	0.462000	0.41574	AGT	.	.	.	none		0.488	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
CSTF3	1479	hgsc.bcm.edu	37	11	33163206	33163206	+	Intron	SNP	T	T	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr11:33163206T>C	ENST00000323959.4	-	3	365				CSTF3_ENST00000438862.2_Missense_Mutation_p.I78V|CSTF3_ENST00000526480.1_Intron|CSTF3_ENST00000524827.1_Intron|CSTF3_ENST00000431742.2_3'UTR	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						TAAAATAAAATAGTAACCTCT	0.373																																					p.I78V		Atlas-SNP	.											.	CSTF3	59	.	0			c.A232G						PASS	.						41.0	40.0	40.0					11																	33163206		2202	4298	6500	SO:0001627	intron_variant	1479	exon3			ATAAAATAGTAAC	U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.225+6A>G	chr11.hg19:g.33163206T>C		119.0	0.0	.		147.0	9.0	.	NM_001033505	A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	ENST00000323959.4	hg19	CCDS7883.1	.	.	.	.	.	.	.	.	.	.	T	11.38	1.621909	0.28889	.	.	ENSG00000176102	ENST00000438862	T	0.33654	1.4	5.34	2.87	0.33458	.	.	.	.	.	T	0.20820	0.0501	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.04946	-1.0916	8	0.16896	T	0.51	.	7.5882	0.28006	0.1261:0.0714:0.0:0.8025	.	78	Q96QK4	.	V	78	ENSP00000388711:I78V	ENSP00000388711:I78V	I	-	1	0	CSTF3	33119782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.006000	0.70724	0.971000	0.38288	0.528000	0.53228	ATT	.	.	.	none		0.373	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388801.1	NM_001326	
GLYATL1	92292	hgsc.bcm.edu	37	11	58723454	58723454	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr11:58723454A>G	ENST00000317391.4	+	8	1203	c.863A>G	c.(862-864)gAg>gGg	p.E288G	GLYATL1_ENST00000300079.5_Missense_Mutation_p.E319G|RP11-142C4.6_ENST00000533954.1_RNA|RP11-142C4.6_ENST00000525714.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	288						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	GCCTCCTGTGAGTGGCACCAA	0.428																																					p.E319G		Atlas-SNP	.											.	GLYATL1	89	.	0			c.A956G						PASS	.						64.0	65.0	65.0					11																	58723454		2200	4295	6495	SO:0001583	missense	92292	exon7			CCTGTGAGTGGCA	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.863A>G	chr11.hg19:g.58723454A>G	ENSP00000322223:p.Glu288Gly	67.0	0.0	.		108.0	23.0	.	NM_080661	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	hg19	CCDS55768.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-2.002586	0.00431	.	.	ENSG00000166840	ENST00000444580;ENST00000317391;ENST00000300079	T;T	0.16743	2.32;2.32	1.97	-3.94	0.04130	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, C-terminal (1);	1.211330	0.06583	N	0.750716	T	0.04318	0.0119	N	0.01352	-0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.34950	-0.9808	10	0.18276	T	0.48	.	2.9615	0.05894	0.5318:0.0:0.2621:0.2061	.	319;288	Q969I3-2;Q969I3	.;GLYL1_HUMAN	G	265;288;319	ENSP00000322223:E288G;ENSP00000300079:E319G	ENSP00000300079:E319G	E	+	2	0	GLYATL1	58480030	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-1.929000	0.01558	-1.331000	0.02252	-0.526000	0.04340	GAG	.	.	.	none		0.428	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	NM_080661	
MS4A8	83661	hgsc.bcm.edu	37	11	60470856	60470856	+	Silent	SNP	C	C	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr11:60470856C>A	ENST00000300226.2	+	3	428	c.225C>A	c.(223-225)atC>atA	p.I75I		NM_031457.1	NP_113645.1	Q9BY19	M4A8_HUMAN	membrane-spanning 4-domains, subfamily A, member 8	75						integral component of membrane (GO:0016021)											GACAGGCCATCCAGATCATCA	0.493																																					p.I75I		Atlas-SNP	.											.	.	.	.	0			c.C225A						PASS	.						100.0	92.0	95.0					11																	60470856		2203	4300	6503	SO:0001819	synonymous_variant	83661	exon3			GGCCATCCAGATC	AF237905	CCDS7990.1	11q12	2013-03-01	2013-03-01	2013-03-01	ENSG00000166959	ENSG00000166959			13380	protein-coding gene	gene with protein product		606549	"""membrane-spanning 4-domains, subfamily A, member 8B"""	MS4A8B		11245982, 11401424	Standard	NM_031457		Approved	MS4A4, CD20L5	uc001npv.3	Q9BY19	OTTHUMG00000167686	ENST00000300226.2:c.225C>A	chr11.hg19:g.60470856C>A		141.0	0.0	.		160.0	17.0	.	NM_031457	Q8TCA5	Silent	SNP	ENST00000300226.2	hg19	CCDS7990.1	.	.	.	.	.	.	.	.	.	.	C	3.360	-0.130637	0.06753	.	.	ENSG00000166959	ENST00000525458	.	.	.	3.62	1.56	0.23342	.	.	.	.	.	T	0.58133	0.2101	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50533	-0.8817	4	.	.	.	-2.4498	9.6989	0.40173	0.0:0.5864:0.4136:0.0	.	.	.	.	Y	57	.	.	S	+	2	0	MS4A8B	60227432	0.962000	0.33011	0.728000	0.30774	0.348000	0.29142	0.877000	0.28106	0.123000	0.18342	0.491000	0.48974	TCC	.	.	.	none		0.493	MS4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395605.1		
TMEM134	80194	hgsc.bcm.edu	37	11	67232160	67232160	+	Silent	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr11:67232160G>A	ENST00000308022.2	-	7	554	c.513C>T	c.(511-513)caC>caT	p.H171H	CTC-1337H24.2_ENST00000602944.1_lincRNA|TMEM134_ENST00000541059.1_5'UTR|TMEM134_ENST00000393877.3_Silent_p.H156H	NM_001078651.1|NM_025124.2	NP_001072119.1|NP_079400.1	Q9H6X4	TM134_HUMAN	transmembrane protein 134	171						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						TGAAGATCACGTGATAGACTG	0.697																																					p.H171H		Atlas-SNP	.											.	TMEM134	4	.	0			c.C513T						PASS	.						22.0	25.0	24.0					11																	67232160		2121	4143	6264	SO:0001819	synonymous_variant	80194	exon7			GATCACGTGATAG	AK025402	CCDS8167.1, CCDS41678.1	11q13.2	2006-03-09			ENSG00000172663	ENSG00000172663			26142	protein-coding gene	gene with protein product							Standard	NM_025124		Approved	FLJ21749	uc001olq.2	Q9H6X4	OTTHUMG00000168034	ENST00000308022.2:c.513C>T	chr11.hg19:g.67232160G>A		82.0	0.0	.		105.0	6.0	.	NM_025124	Q08AK4|Q6PJN3	Silent	SNP	ENST00000308022.2	hg19	CCDS8167.1																																																																																			.	.	.	none		0.697	TMEM134-020	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398994.1	NM_025124	
ITPR2	3709	hgsc.bcm.edu	37	12	26639109	26639109	+	Silent	SNP	G	G	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr12:26639109G>C	ENST00000381340.3	-	41	6155	c.5739C>G	c.(5737-5739)ccC>ccG	p.P1913P		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1913					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.P1913P(2)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGGCAATTGCGGGACTCATTG	0.428																																					p.P1913P		Atlas-SNP	.											.	ITPR2	270	.	2	Substitution - coding silent(2)	lung(1)|kidney(1)	c.C5739G						PASS	.						226.0	213.0	217.0					12																	26639109		1915	4130	6045	SO:0001819	synonymous_variant	3709	exon41			AATTGCGGGACTC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5739C>G	chr12.hg19:g.26639109G>C		437.0	0.0	.		577.0	32.0	.	NM_002223	O94773	Silent	SNP	ENST00000381340.3	hg19	CCDS41764.1																																																																																			.	.	.	none		0.428	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
USP30	84749	hgsc.bcm.edu	37	12	109520853	109520853	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr12:109520853G>A	ENST00000257548.5	+	11	1247	c.1154G>A	c.(1153-1155)gGa>gAa	p.G385E	USP30_ENST00000392784.2_Missense_Mutation_p.G354E	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	385	USP.				mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						GATGGGCCGGGAGCCCCCACA	0.542																																					p.G385E		Atlas-SNP	.											.	USP30	48	.	0			c.G1154A						PASS	.						52.0	47.0	49.0					12																	109520853		2203	4300	6503	SO:0001583	missense	84749	exon11			GGCCGGGAGCCCC	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.1154G>A	chr12.hg19:g.109520853G>A	ENSP00000257548:p.Gly385Glu	59.0	0.0	.		96.0	7.0	.	NM_032663	Q8WTU7|Q96JX4|Q9BSS3	Missense_Mutation	SNP	ENST00000257548.5	hg19	CCDS9123.2	.	.	.	.	.	.	.	.	.	.	G	3.397	-0.122993	0.06795	.	.	ENSG00000135093	ENST00000392784;ENST00000257548	T;T	0.31247	1.51;1.5	4.91	4.01	0.46588	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.781706	0.12074	N	0.501919	T	0.12092	0.0294	N	0.00621	-1.32	0.09310	N	1	B;B	0.19073	0.033;0.0	B;B	0.23852	0.049;0.0	T	0.25950	-1.0117	10	0.41790	T	0.15	-0.8916	12.7132	0.57102	0.0:0.8311:0.1689:0.0	.	385;354	Q70CQ3;B3KUS5	UBP30_HUMAN;.	E	354;385	ENSP00000376535:G354E;ENSP00000257548:G385E	ENSP00000257548:G385E	G	+	2	0	USP30	108005236	0.005000	0.15991	0.003000	0.11579	0.009000	0.06853	1.864000	0.39469	1.208000	0.43306	-0.270000	0.10280	GGA	.	.	.	none		0.542	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257733.2	NM_032663	
FLT3	2322	hgsc.bcm.edu	37	13	28624244	28624244	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr13:28624244G>C	ENST00000241453.7	-	6	811	c.730C>G	c.(730-732)Ctg>Gtg	p.L244V	FLT3_ENST00000380982.4_Missense_Mutation_p.L244V|FLT3_ENST00000537084.1_Missense_Mutation_p.L244V	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	244					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATTGTGAACAGCCTGGTGCAT	0.423			"""Mis, O"""		"""AML, ALL"""																																p.L244V		Atlas-SNP	.		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	FLT3	15525	.	0			c.C730G						PASS	.						170.0	147.0	155.0					13																	28624244		2203	4300	6503	SO:0001583	missense	2322	exon6			TGAACAGCCTGGT	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.730C>G	chr13.hg19:g.28624244G>C	ENSP00000241453:p.Leu244Val	113.0	0.0	.		137.0	35.0	.	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	hg19	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562109	0.45590	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.77489	-1.03;-1.1;-0.84	5.64	5.64	0.86602	.	0.000000	0.53938	D	0.000047	T	0.74397	0.3711	L	0.29908	0.895	0.43118	D	0.994837	P;P	0.49358	0.923;0.521	P;B	0.48189	0.57;0.246	T	0.72730	-0.4205	10	0.30078	T	0.28	.	17.8943	0.88881	0.0:0.0:1.0:0.0	.	244;244	P36888-2;P36888	.;FLT3_HUMAN	V	244	ENSP00000241453:L244V;ENSP00000370369:L244V;ENSP00000438139:L244V	ENSP00000241453:L244V	L	-	1	2	FLT3	27522244	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	4.617000	0.61204	2.655000	0.90218	0.462000	0.41574	CTG	.	.	.	none		0.423	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
G2E3	55632	hgsc.bcm.edu	37	14	31061654	31061654	+	Splice_Site	SNP	G	G	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr14:31061654G>C	ENST00000206595.6	+	5	516		c.e5+1		G2E3_ENST00000544007.1_Splice_Site|G2E3_ENST00000553504.1_Splice_Site|G2E3_ENST00000438909.2_Splice_Site	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase						apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GCAATTTTGCGTGAGTTATTT	0.333																																					.		Atlas-SNP	.											.	G2E3	82	.	0			c.362+1G>C						PASS	.						89.0	86.0	87.0					14																	31061654		2203	4299	6502	SO:0001630	splice_region_variant	55632	exon5			TTTTGCGTGAGTT	AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.362+1G>C	chr14.hg19:g.31061654G>C		121.0	0.0	.		146.0	28.0	.	NM_017769	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Splice_Site	SNP	ENST00000206595.6	hg19	CCDS9638.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039163	0.75617	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504;ENST00000554714;ENST00000547532	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.091	0.97817	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	G2E3	30131405	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.206000	0.89745	2.755000	0.94549	0.591000	0.81541	.	.	.	.	none		0.333	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	Intron
CEP128	145508	hgsc.bcm.edu	37	14	81297497	81297497	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr14:81297497G>T	ENST00000555265.1	-	13	1574	c.1199C>A	c.(1198-1200)tCa>tAa	p.S400*	CEP128_ENST00000281129.3_Nonsense_Mutation_p.S400*|CEP128_ENST00000216517.6_Nonsense_Mutation_p.S400*			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	400						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CTCTACTTGTGATGCCAAATG	0.353																																					p.S400X		Atlas-SNP	.											CEP128,NS,carcinoma,0,1	CEP128	146	.	0			c.C1199A						PASS	.						218.0	197.0	204.0					14																	81297497		2203	4300	6503	SO:0001587	stop_gained	145508	exon12			ACTTGTGATGCCA	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.1199C>A	chr14.hg19:g.81297497G>T	ENSP00000451162:p.Ser400*	188.0	0.0	.		215.0	43.0	.	NM_152446	B9EK52|Q86X97|Q96ML4	Nonsense_Mutation	SNP	ENST00000555265.1	hg19	CCDS32130.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.102862|7.102862	0.98066|0.98066	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000554827|ENST00000281129;ENST00000555265;ENST00000393619;ENST00000216517	.|.	.|.	.|.	5.63|5.63	1.13|1.13	0.20643|0.20643	.|.	.|0.827576	.|0.10699	.|N	.|0.644299	T|.	0.30262|.	0.0759|.	.|.	.|.	.|.	0.53688|0.53688	D|D	0.999978|0.999978	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.17806|.	-1.0357|.	4|.	.|0.10636	.|T	.|0.68	.|.	1.9124|1.9124	0.03290|0.03290	0.2577:0.1381:0.4636:0.1406|0.2577:0.1381:0.4636:0.1406	.|.	.|.	.|.	.|.	N|X	279|400	.|.	.|ENSP00000216517:S400X	H|S	-|-	1|2	0|0	CEP128|CEP128	80367250|80367250	0.003000|0.003000	0.15002|0.15002	0.902000|0.902000	0.35471|0.35471	0.661000|0.661000	0.39034|0.39034	0.429000|0.429000	0.21412|0.21412	0.331000|0.331000	0.23511|0.23511	-0.282000|-0.282000	0.10007|0.10007	CAC|TCA	.	.	.	none		0.353	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
FAM181A	90050	hgsc.bcm.edu	37	14	94395093	94395093	+	Silent	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr14:94395093G>A	ENST00000267594.5	+	3	955	c.648G>A	c.(646-648)gaG>gaA	p.E216E	FAM181A_ENST00000557000.2_Silent_p.E154E|FAM181A_ENST00000556222.1_Silent_p.E154E|FAM181A_ENST00000557719.1_Silent_p.E154E|FAM181A-AS1_ENST00000554742.1_RNA	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	216										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						TGGGGCTGGAGGGGGGACTGG	0.622																																					p.E216E		Atlas-SNP	.											.	FAM181A	42	.	0			c.G648A						PASS	.						25.0	30.0	28.0					14																	94395093		2203	4299	6502	SO:0001819	synonymous_variant	90050	exon3			GCTGGAGGGGGGA	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.648G>A	chr14.hg19:g.94395093G>A		27.0	0.0	.		53.0	11.0	.	NM_138344	B2RD39|Q96GY1	Silent	SNP	ENST00000267594.5	hg19	CCDS9914.1																																																																																			.	.	.	none		0.622	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412840.1	NM_138344	
ZNF839	55778	hgsc.bcm.edu	37	14	102805492	102805492	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr14:102805492C>A	ENST00000558850.1	+	7	1861	c.1511C>A	c.(1510-1512)aCc>aAc	p.T504N	ZNF839_ENST00000420933.2_3'UTR|ZNF839_ENST00000559185.1_Missense_Mutation_p.T504N|ZNF839_ENST00000262236.5_Missense_Mutation_p.T504N|AL137229.1_ENST00000577622.1_RNA|ZNF839_ENST00000442396.2_Missense_Mutation_p.T620N	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839	504							metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						TCCAACGATACCACTGAATCT	0.552																																					p.T620N		Atlas-SNP	.											.	ZNF839	41	.	0			c.C1859A						PASS	.						50.0	53.0	52.0					14																	102805492		1933	4137	6070	SO:0001583	missense	55778	exon7			ACGATACCACTGA	AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.1511C>A	chr14.hg19:g.102805492C>A	ENSP00000453363:p.Thr504Asn	102.0	0.0	.		118.0	28.0	.	NM_018335	B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	Missense_Mutation	SNP	ENST00000558850.1	hg19	CCDS58336.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.618148	0.46736	.	.	ENSG00000022976	ENST00000442396;ENST00000262236;ENST00000398436;ENST00000420933	T;T	0.20200	2.09;2.09	4.29	-3.04	0.05412	.	2.167110	0.01436	N	0.014925	T	0.18676	0.0448	L	0.48642	1.525	0.09310	N	1	B;B;P;B	0.38020	0.11;0.021;0.615;0.11	B;B;B;B	0.39738	0.063;0.025;0.308;0.042	T	0.18871	-1.0323	10	0.66056	D	0.02	.	0.5543	0.00668	0.2964:0.209:0.2926:0.2019	.	620;504;383;504	A8K0R7-5;A8K0R7-2;Q9NT83;A8K0R7	.;.;.;ZN839_HUMAN	N	620;504;172;38	ENSP00000399863:T620N;ENSP00000262236:T504N	ENSP00000262236:T504N	T	+	2	0	ZNF839	101875245	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.397000	0.07269	-0.446000	0.07149	0.558000	0.71614	ACC	.	.	.	none		0.552	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415492.2	NM_018335	
OR4M2	390538	hgsc.bcm.edu	37	15	22369316	22369316	+	Silent	SNP	C	C	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr15:22369316C>G	ENST00000332663.2	+	1	839	c.741C>G	c.(739-741)acC>acG	p.T247T	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CCCACATTACCATTGTGGTGC	0.433																																					p.T247T		Atlas-SNP	.											.	OR4M2	140	.	0			c.C741G						PASS	.						265.0	195.0	218.0					15																	22369316		2203	4297	6500	SO:0001819	synonymous_variant	390538	exon1			CATTACCATTGTG	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.741C>G	chr15.hg19:g.22369316C>G		336.0	0.0	.		399.0	57.0	.	NM_001004719	B9EH16|Q6IEY2	Silent	SNP	ENST00000332663.2	hg19	CCDS32172.1																																																																																			.	.	.	none		0.433	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1		
CEP152	22995	hgsc.bcm.edu	37	15	49030644	49030644	+	Silent	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr15:49030644C>T	ENST00000380950.2	-	27	5122	c.4935G>A	c.(4933-4935)acG>acA	p.T1645T	CEP152_ENST00000399334.3_Silent_p.T1589T	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1645					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		GCTCCAAATACGTGGTTTCTT	0.388																																					p.T1645T		Atlas-SNP	.											CEP152,NS,carcinoma,0,1	CEP152	145	.	0			c.G4935A						PASS	.						194.0	187.0	189.0					15																	49030644		2010	4179	6189	SO:0001819	synonymous_variant	22995	exon27			CAAATACGTGGTT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4935G>A	chr15.hg19:g.49030644C>T		200.0	0.0	.		215.0	40.0	.	NM_001194998	E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	hg19	CCDS58361.1																																																																																			.	.	.	none		0.388	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
TRPM7	54822	hgsc.bcm.edu	37	15	50978726	50978726	+	Splice_Site	SNP	A	A	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr15:50978726A>G	ENST00000313478.7	-	1	285		c.e1+1		TRPM7_ENST00000560955.1_Splice_Site|RN7SL354P_ENST00000469282.2_RNA	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7						actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TGGGTCCAGTACCATTCTCCT	0.667																																					.		Atlas-SNP	.											.	TRPM7	145	.	0			c.3+2T>C						PASS	.						37.0	43.0	41.0					15																	50978726		2011	4163	6174	SO:0001630	splice_region_variant	54822	exon2			TCCAGTACCATTC	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.3+1T>C	chr15.hg19:g.50978726A>G		44.0	0.0	.		46.0	10.0	.	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Splice_Site	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.500279	0.64298	.	.	ENSG00000092439	ENST00000313478	.	.	.	4.36	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1097	0.42555	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPM7	48766018	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	3.683000	0.54663	1.951000	0.56629	0.374000	0.22700	.	.	.	.	none		0.667	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	Intron
UNKL	64718	hgsc.bcm.edu	37	16	1442978	1442978	+	Splice_Site	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr16:1442978C>T	ENST00000389221.4	-	8	928		c.e8-1		UNKL_ENST00000508903.2_Splice_Site|UNKL_ENST00000397462.1_Splice_Site	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				CCCAGGCTCTCTGCAAGGACA	0.642																																					.		Atlas-SNP	.											.	UNKL	46	.	0			c.938-1G>A						PASS	.																																			SO:0001630	splice_region_variant	64718	exon9			GGCTCTCTGCAAG	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.929-1G>A	chr16.hg19:g.1442978C>T		55.0	0.0	.		57.0	10.0	.	NM_001193388	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Splice_Site	SNP	ENST00000389221.4	hg19	CCDS53981.1	.	.	.	.	.	.	.	.	.	.	C	9.578	1.122865	0.20959	.	.	ENSG00000059145	ENST00000389221;ENST00000508903;ENST00000397462	.	.	.	4.17	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8543	0.52429	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UNKL	1382979	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	3.095000	0.50235	2.149000	0.67028	0.561000	0.74099	.	.	.	.	none		0.642	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	Intron
TNRC6A	27327	hgsc.bcm.edu	37	16	24801625	24801625	+	Silent	SNP	C	C	G	rs377201148		TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr16:24801625C>G	ENST00000395799.3	+	6	1791	c.1662C>G	c.(1660-1662)ggC>ggG	p.G554G	TNRC6A_ENST00000315183.7_Silent_p.G554G	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	554	Interaction with argonaute family proteins.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TGCAGCCTGGCGTAAATGGTC	0.473																																					p.G554G		Atlas-SNP	.											.	TNRC6A	171	.	0			c.C1662G						PASS	.						127.0	121.0	123.0					16																	24801625		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon6			GCCTGGCGTAAAT	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1662C>G	chr16.hg19:g.24801625C>G		115.0	0.0	.		124.0	29.0	.	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	.	.	alt		0.473	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
SMARCE1	6605	hgsc.bcm.edu	37	17	38793826	38793826	+	Splice_Site	SNP	T	T	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr17:38793826T>C	ENST00000348513.6	-	5	937		c.e5-2		SMARCE1_ENST00000377808.4_Splice_Site|SMARCE1_ENST00000431889.2_Splice_Site|SMARCE1_ENST00000400122.3_Splice_Site|KRT222_ENST00000476049.1_Intron|SMARCE1_ENST00000580419.1_Splice_Site|SMARCE1_ENST00000544009.1_Splice_Site|SMARCE1_ENST00000578044.1_Splice_Site	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1						ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)			large_intestine(1)	1		Breast(137;0.000812)				AGAGGATGCCTACGAAAGAGT	0.433																																					.		Atlas-SNP	.											.	SMARCE1	34	.	0			c.157-2A>G						PASS	.						91.0	83.0	86.0					17																	38793826		2203	4299	6502	SO:0001630	splice_region_variant	6605	exon6			GATGCCTACGAAA	AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.157-2A>G	chr17.hg19:g.38793826T>C		75.0	0.0	.		118.0	49.0	.	NM_003079	B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Splice_Site	SNP	ENST00000348513.6	hg19	CCDS11370.1	.	.	.	.	.	.	.	.	.	.	T	19.49	3.837887	0.71373	.	.	ENSG00000073584	ENST00000348513;ENST00000431889;ENST00000377808	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4053	0.83662	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMARCE1	36047352	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.997000	0.88414	2.333000	0.79357	0.482000	0.46254	.	.	.	.	none		0.433	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257203.1	NM_003079	Intron
GPS1	2873	hgsc.bcm.edu	37	17	80013100	80013100	+	Splice_Site	SNP	T	T	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr17:80013100T>C	ENST00000306823.6	+	6	783		c.e6+2		GPS1_ENST00000392358.2_Splice_Site|GPS1_ENST00000355130.2_Splice_Site|GPS1_ENST00000320548.4_Splice_Site|GPS1_ENST00000578552.1_Splice_Site			Q13098	CSN1_HUMAN	G protein pathway suppressor 1						cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GTGCCGCAGGTGAGGGCCTGG	0.637																																					.		Atlas-SNP	.											.	GPS1	30	.	0			c.760+2T>C						PASS	.						39.0	32.0	34.0					17																	80013100		2134	4212	6346	SO:0001630	splice_region_variant	2873	exon6			CGCAGGTGAGGGC		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.760+2T>C	chr17.hg19:g.80013100T>C		88.0	0.0	.		114.0	18.0	.	NM_004127	Q8NA10|Q9BWL1	Splice_Site	SNP	ENST00000306823.6	hg19	CCDS32774.1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.966042	0.34659	.	.	ENSG00000169727	ENST00000392358;ENST00000320548;ENST00000306823;ENST00000355130	.	.	.	4.13	4.13	0.48395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2976	0.60307	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPS1	77606389	1.000000	0.71417	0.985000	0.45067	0.355000	0.29361	5.275000	0.65575	1.743000	0.51761	0.482000	0.46254	.	.	.	.	none		0.637	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492	Intron
CCDC57	284001	hgsc.bcm.edu	37	17	80156212	80156212	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr17:80156212C>T	ENST00000389641.4	-	3	530	c.494G>A	c.(493-495)gGt>gAt	p.G165D	CCDC57_ENST00000392343.3_Missense_Mutation_p.G165D|CCDC57_ENST00000392347.1_Missense_Mutation_p.G165D			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	165										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			AGCAAGCTCACCGTCGAGCTC	0.498																																					p.G165D		Atlas-SNP	.											.	CCDC57	102	.	0			c.G494A						PASS	.						86.0	86.0	86.0					17																	80156212		1875	4097	5972	SO:0001583	missense	284001	exon3			AGCTCACCGTCGA	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.494G>A	chr17.hg19:g.80156212C>T	ENSP00000374292:p.Gly165Asp	130.0	0.0	.		172.0	32.0	.	NM_198082	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	hg19		.	.	.	.	.	.	.	.	.	.	C	7.170	0.587487	0.13812	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	T;T;T	0.24908	3.01;3.01;1.83	5.28	4.17	0.49024	.	0.257900	0.32444	N	0.006092	T	0.39489	0.1080	M	0.61703	1.905	0.42578	D	0.993207	D;P	0.55800	0.973;0.933	P;P	0.57283	0.817;0.659	T	0.17745	-1.0359	10	0.51188	T	0.08	-9.5475	9.5436	0.39266	0.0:0.8694:0.0:0.1306	.	165;165	Q2TAC2-2;Q2TAC2	.;CCD57_HUMAN	D	165	ENSP00000374292:G165D;ENSP00000376158:G165D;ENSP00000376154:G165D	ENSP00000374292:G165D	G	-	2	0	CCDC57	77749501	0.352000	0.24895	0.002000	0.10522	0.160000	0.22226	3.742000	0.55097	0.970000	0.38263	0.655000	0.94253	GGT	.	.	.	none		0.498	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
MUC16	94025	hgsc.bcm.edu	37	19	9016700	9016700	+	Silent	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:9016700G>A	ENST00000397910.4	-	28	38240	c.38037C>T	c.(38035-38037)gaC>gaT	p.D12679D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12681					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGACCCAAGGTCCACTGTGG	0.488																																					p.D12679D		Atlas-SNP	.											.	MUC16	4315	.	0			c.C38037T						PASS	.						56.0	55.0	56.0					19																	9016700		1884	4123	6007	SO:0001819	synonymous_variant	94025	exon28			CCCAAGGTCCACT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38037C>T	chr19.hg19:g.9016700G>A		97.0	0.0	.		89.0	24.0	.	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.	.	none		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu	37	19	9075870	9075870	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:9075870G>A	ENST00000397910.4	-	3	11779	c.11576C>T	c.(11575-11577)aCa>aTa	p.T3859I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3860	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCCTCTGTTGTAAGAGCTGT	0.473																																					p.T3859I		Atlas-SNP	.											.	MUC16	4315	.	0			c.C11576T						PASS	.						148.0	132.0	137.0					19																	9075870		2026	4193	6219	SO:0001583	missense	94025	exon3			TCTGTTGTAAGAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11576C>T	chr19.hg19:g.9075870G>A	ENSP00000381008:p.Thr3859Ile	157.0	0.0	.		167.0	43.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.304	0.241447	0.10077	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	1.52	0.439	0.16567	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.30068	0.267	B	0.21708	0.036	T	0.43032	-0.9416	8	0.87932	D	0	.	3.9495	0.09363	0.2362:0.0:0.7638:0.0	.	3859	B5ME49	.	I	3859	ENSP00000381008:T3859I	ENSP00000381008:T3859I	T	-	2	0	MUC16	8936870	0.010000	0.17322	0.057000	0.19452	0.459000	0.32528	0.103000	0.15292	0.202000	0.20498	0.205000	0.17691	ACA	.	.	.	none		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
GCDH	2639	hgsc.bcm.edu	37	19	13002330	13002330	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:13002330G>A	ENST00000222214.5	+	3	332	c.121G>A	c.(121-123)Gct>Act	p.A41T	GCDH_ENST00000457854.1_Missense_Mutation_p.A41T|GCDH_ENST00000422947.2_5'UTR|GCDH_ENST00000591470.1_Missense_Mutation_p.A41T			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	41					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	GAGCCAACTGGCTAAGTGTAA	0.597																																					p.R41R	GBM(123;875 1636 7726 16444 26754)	Atlas-SNP	.											.	GCDH	76	.	0			c.A121A						PASS	.						151.0	137.0	142.0					19																	13002330		2203	4300	6503	SO:0001583	missense	2639	exon3			CAACTGGCTAAGT	AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.121G>A	chr19.hg19:g.13002330G>A	ENSP00000222214:p.Ala41Thr	55.0	0.0	.		68.0	13.0	.	NM_013976	A8K2Z2|O14719	Silent	SNP	ENST00000222214.5	hg19	CCDS12286.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203936	0.38905	.	.	ENSG00000105607	ENST00000457854;ENST00000222214	D;D	0.97575	-4.37;-4.44	3.74	0.44	0.16572	.	2.183690	0.01751	N	0.029922	D	0.91341	0.7269	N	0.08118	0	0.19300	N	0.999978	B;B	0.11235	0.0;0.004	B;B	0.09377	0.002;0.004	D	0.85180	0.1003	10	0.27082	T	0.32	.	5.9903	0.19456	0.3389:0.0:0.6611:0.0	.	41;41	Q92947;Q92947-2	GCDH_HUMAN;.	T	41	ENSP00000394872:A41T;ENSP00000222214:A41T	ENSP00000222214:A41T	A	+	1	0	GCDH	12863330	0.000000	0.05858	0.003000	0.11579	0.448000	0.32197	-0.354000	0.07681	0.201000	0.20466	-0.448000	0.05591	GCT	.	.	.	none		0.597	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451897.1		
ZBTB32	27033	hgsc.bcm.edu	37	19	36206193	36206193	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:36206193C>T	ENST00000392197.2	+	3	983	c.665C>T	c.(664-666)tCt>tTt	p.S222F	KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_5'Flank|ZBTB32_ENST00000262630.3_Missense_Mutation_p.S222F|KMT2B_ENST00000222270.7_5'Flank			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	222					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCAGGGGGCTCTGAGGAAAGT	0.627																																					p.S222F		Atlas-SNP	.											.	ZBTB32	33	.	0			c.C665T						PASS	.						50.0	51.0	51.0					19																	36206193		2203	4300	6503	SO:0001583	missense	27033	exon2			GGGGCTCTGAGGA	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.665C>T	chr19.hg19:g.36206193C>T	ENSP00000376035:p.Ser222Phe	20.0	0.0	.		19.0	7.0	.	NM_014383	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	hg19	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215582	0.58452	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.10763	2.84;2.84	5.06	5.06	0.68205	.	0.000000	0.42964	D	0.000622	T	0.21921	0.0528	L	0.32530	0.975	0.39248	D	0.963974	D	0.71674	0.998	D	0.79784	0.993	T	0.01566	-1.1323	10	0.45353	T	0.12	-11.7321	13.9419	0.64059	0.0:1.0:0.0:0.0	.	222	Q9Y2Y4	ZBT32_HUMAN	F	222	ENSP00000262630:S222F;ENSP00000376035:S222F	ENSP00000262630:S222F	S	+	2	0	ZBTB32	40898033	0.998000	0.40836	1.000000	0.80357	0.471000	0.32888	2.812000	0.47994	2.359000	0.80004	0.561000	0.74099	TCT	.	.	.	none		0.627	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109491.3	NM_014383	
SRRM5	100170229	hgsc.bcm.edu	37	19	44118259	44118259	+	Silent	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:44118259C>T	ENST00000607544.1	+	3	2308	c.1986C>T	c.(1984-1986)ctC>ctT	p.L662L	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Silent_p.L662L|SRRM5_ENST00000526798.1_Silent_p.L677L			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	662	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						CAAGCAGTCTCAGTCAGAATA	0.537																																					p.L662L		Atlas-SNP	.											.	SRRM5	38	.	0			c.C1986T						PASS	.						117.0	115.0	116.0					19																	44118259		692	1591	2283	SO:0001819	synonymous_variant	100170229	exon1			CAGTCTCAGTCAG	AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1986C>T	chr19.hg19:g.44118259C>T		32.0	0.0	.		39.0	12.0	.	NM_001145641	B4DNF0	Silent	SNP	ENST00000607544.1	hg19	CCDS46095.1																																																																																			.	.	.	none		0.537	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000384398.2	NM_001145641	
BAX	581	hgsc.bcm.edu	37	19	49459013	49459013	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:49459013G>T	ENST00000345358.7	+	3	208	c.156G>T	c.(154-156)caG>caT	p.Q52H	BAX_ENST00000293288.8_Missense_Mutation_p.Q52H|BAX_ENST00000391871.3_Missense_Mutation_p.R35M|BAX_ENST00000539787.1_Missense_Mutation_p.Q52H|BAX_ENST00000354470.3_Intron|BAX_ENST00000415969.2_Missense_Mutation_p.Q52H	NM_138761.3|NM_138764.4	NP_620116.1|NP_620119.2	Q07812	BAX_HUMAN	BCL2-associated X protein	52					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell homeostatic proliferation (GO:0002358)|B cell negative selection (GO:0002352)|B cell receptor apoptotic signaling pathway (GO:1990117)|blood vessel remodeling (GO:0001974)|cellular response to organic substance (GO:0071310)|cellular response to UV (GO:0034644)|cerebral cortex development (GO:0021987)|development of secondary sexual characteristics (GO:0045136)|ectopic germ cell programmed cell death (GO:0035234)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells within a tissue (GO:0048873)|hypothalamus development (GO:0021854)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein binding (GO:0032091)|neuron apoptotic process (GO:0051402)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic DNA fragmentation (GO:1902512)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of developmental pigmentation (GO:0048087)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-embryonic camera-type eye morphogenesis (GO:0048597)|protein homooligomerization (GO:0051260)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)|protein oligomerization (GO:0051259)|regulation of cell cycle (GO:0051726)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|release of matrix enzymes from mitochondria (GO:0032976)|response to axon injury (GO:0048678)|response to gamma radiation (GO:0010332)|response to salt stress (GO:0009651)|response to toxic substance (GO:0009636)|retina development in camera-type eye (GO:0060041)|retinal cell apoptotic process (GO:1990009)|retinal cell programmed cell death (GO:0046666)|Sertoli cell proliferation (GO:0060011)|spermatid differentiation (GO:0048515)|T cell homeostatic proliferation (GO:0001777)|thymocyte apoptotic process (GO:0070242)|transformed cell apoptotic process (GO:0006927)|vagina development (GO:0060068)|viral process (GO:0016032)	BAX complex (GO:0097144)|Bcl-2 family protein complex (GO:0097136)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrial permeability transition pore complex (GO:0005757)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(4)	17		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		CGGTGCCTCAGGATGCGTCCA	0.622																																					p.Q52H		Atlas-SNP	.											.	BAX	69	.	0			c.G156T						PASS	.						54.0	52.0	53.0					19																	49459013		2203	4300	6503	SO:0001583	missense	581	exon3			GCCTCAGGATGCG		CCDS12742.1, CCDS12743.1, CCDS12744.1, CCDS12745.1, CCDS12745.2	19q13.3-q13.4	2014-03-07			ENSG00000087088	ENSG00000087088			959	protein-coding gene	gene with protein product		600040				8358790	Standard	NM_138761		Approved	BCL2L4	uc002plf.1	Q07812	OTTHUMG00000160476	ENST00000345358.7:c.156G>T	chr19.hg19:g.49459013G>T	ENSP00000263262:p.Gln52His	97.0	0.0	.		116.0	37.0	.	NM_004324	A8K4W1|P55269|Q07814|Q07815|Q8WZ49|Q9NR76|Q9NYG7|Q9UCZ6|Q9UCZ7|Q9UQD6	Missense_Mutation	SNP	ENST00000345358.7	hg19	CCDS12742.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.523|8.523	0.869294|0.869294	0.17322|0.17322	.|.	.|.	ENSG00000087088|ENSG00000087088	ENST00000539787;ENST00000345358;ENST00000415969;ENST00000293288|ENST00000391871	T;T;T;T|.	0.31247|.	2.61;1.5;2.85;2.81|.	4.21|4.21	0.963|0.963	0.19649|0.19649	.|.	0.765258|.	0.12506|.	N|.	0.462920|.	T|T	0.38161|0.38161	0.1030|0.1030	L|L	0.44542|0.44542	1.39|1.39	0.20563|0.20563	N|N	0.999888|0.999888	B;B;P|.	0.51653|.	0.315;0.383;0.947|.	B;B;B|.	0.40228|.	0.044;0.07;0.323|.	T|T	0.35475|0.35475	-0.9787|-0.9787	10|6	0.48119|0.87932	T|D	0.1|0	-4.6172|-4.6172	5.9709|5.9709	0.19351|0.19351	0.3253:0.0:0.6747:0.0|0.3253:0.0:0.6747:0.0	.|.	52;52;52|.	Q07812;Q07812-8;Q07812-2|.	BAX_HUMAN;.;.|.	H|M	52|35	ENSP00000441413:Q52H;ENSP00000263262:Q52H;ENSP00000389971:Q52H;ENSP00000293288:Q52H|.	ENSP00000293288:Q52H|ENSP00000375744:R35M	Q|R	+|+	3|2	2|0	BAX|BAX	54150825|54150825	1.000000|1.000000	0.71417|0.71417	0.570000|0.570000	0.28473|0.28473	0.556000|0.556000	0.35491|0.35491	2.007000|2.007000	0.40883|0.40883	0.331000|0.331000	0.23511|0.23511	-0.259000|-0.259000	0.10710|0.10710	CAG|AGG	.	.	.	none		0.622	BAX-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360767.1	NM_138763	
TTYH1	57348	hgsc.bcm.edu	37	19	54946848	54946848	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:54946848G>T	ENST00000376530.3	+	11	1355	c.1252G>T	c.(1252-1254)Gcc>Tcc	p.A418S	CTD-2587H19.3_ENST00000597355.1_lincRNA|TTYH1_ENST00000376531.3_Missense_Mutation_p.A418S|TTYH1_ENST00000489425.1_3'UTR|TTYH1_ENST00000301194.4_Missense_Mutation_p.A418S|AC008746.3_ENST00000457113.1_RNA|AC008746.12_ENST00000599382.1_lincRNA|TTYH1_ENST00000391739.3_Missense_Mutation_p.G448V|CTD-2587H19.2_ENST00000596631.1_RNA	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	418					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CCGAGCCTGGGCCCTCTTCCC	0.701																																					p.A418S		Atlas-SNP	.											.	TTYH1	78	.	0			c.G1252T						PASS	.						22.0	21.0	21.0					19																	54946848		2201	4295	6496	SO:0001583	missense	57348	exon11			GCCTGGGCCCTCT	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.1252G>T	chr19.hg19:g.54946848G>T	ENSP00000365713:p.Ala418Ser	85.0	0.0	.		108.0	38.0	.	NM_020659	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Missense_Mutation	SNP	ENST00000376530.3	hg19	CCDS12893.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.79|13.79	2.341380|2.341380	0.41498|0.41498	.|.	.|.	ENSG00000167614|ENSG00000167614	ENST00000301194;ENST00000376530;ENST00000376531|ENST00000391739	T;T;T|T	0.11385|0.29397	2.78;2.78;2.78|1.57	4.04|4.04	4.04|4.04	0.47022|0.47022	.|.	0.236204|.	0.37393|.	N|.	0.002102|.	T|T	0.43722|0.43722	0.1260|0.1260	L|L	0.60455|0.60455	1.87|1.87	0.47407|0.47407	D|D	0.999411|0.999411	D;D;D|D	0.69078|0.69078	0.99;0.978;0.997|0.997	P;P;D|P	0.79108|0.60789	0.744;0.738;0.992|0.879	T|T	0.40079|0.40079	-0.9582|-0.9582	10|9	0.10636|0.87932	T|D	0.68|0	-17.4112|-17.4112	8.0399|8.0399	0.30515|0.30515	0.1138:0.0:0.8862:0.0|0.1138:0.0:0.8862:0.0	.|.	418;418;418|448	Q9H313-2;Q9H313-3;Q9H313|B7Z1H9	.;.;TTYH1_HUMAN|.	S|V	418|448	ENSP00000301194:A418S;ENSP00000365713:A418S;ENSP00000365714:A418S|ENSP00000375619:G448V	ENSP00000301194:A418S|ENSP00000375619:G448V	A|G	+|+	1|2	0|0	TTYH1|TTYH1	59638660|59638660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	2.072000|2.072000	0.41510|0.41510	1.982000|1.982000	0.57802|0.57802	0.561000|0.561000	0.74099|0.74099	GCC|GGC	.	.	.	none		0.701	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1		
MMP24	10893	hgsc.bcm.edu	37	20	33862094	33862094	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr20:33862094G>T	ENST00000246186.6	+	9	1705	c.1620G>T	c.(1618-1620)aaG>aaT	p.K540N	MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000455178.1_RNA|MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000424358.1_RNA|MMP24-AS1_ENST00000435366.1_RNA|MMP24-AS1_ENST00000433764.1_RNA|EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000566203.2_RNA|MMP24-AS1_ENST00000453892.1_RNA|RP4-614O4.11_ENST00000444717.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	540					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	ATTTCTACAAGGGCCGGGACT	0.567																																					p.K540N		Atlas-SNP	.											.	MMP24	35	.	0			c.G1620T						PASS	.						90.0	104.0	99.0					20																	33862094		2049	4192	6241	SO:0001583	missense	10893	exon9			CTACAAGGGCCGG	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.1620G>T	chr20.hg19:g.33862094G>T	ENSP00000246186:p.Lys540Asn	15.0	0.0	.		32.0	11.0	.	NM_006690	B7ZBG8|Q9H440	Missense_Mutation	SNP	ENST00000246186.6	hg19	CCDS46593.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099273	0.56183	.	.	ENSG00000125966	ENST00000246186;ENST00000540655	T	0.04551	3.6	5.1	-0.206	0.13193	Hemopexin/matrixin (2);	0.215289	0.46145	D	0.000307	T	0.29914	0.0748	H	0.98027	4.13	0.58432	D	0.999997	D	0.76494	0.999	D	0.77004	0.989	T	0.30208	-0.9986	10	0.87932	D	0	.	10.0056	0.41955	0.5282:0.0:0.4718:0.0	.	540	Q9Y5R2	MMP24_HUMAN	N	540;488	ENSP00000246186:K540N	ENSP00000246186:K540N	K	+	3	2	MMP24	33325508	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	1.437000	0.34991	-0.268000	0.09312	-0.150000	0.13652	AAG	.	.	.	none		0.567	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078851.4	NM_006690	
KREMEN1	83999	hgsc.bcm.edu	37	22	29533423	29533423	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr22:29533423G>C	ENST00000407188.1	+	6	719	c.719G>C	c.(718-720)tGc>tCc	p.C240S	KREMEN1_ENST00000400335.4_Missense_Mutation_p.C242S|KREMEN1_ENST00000327813.5_Missense_Mutation_p.C242S|KREMEN1_ENST00000400338.2_Missense_Mutation_p.C242S			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	240	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						GGGAGGGTCTGCTACTGGACC	0.612																																					p.C242S		Atlas-SNP	.											.	KREMEN1	46	.	0			c.G725C						PASS	.						76.0	77.0	77.0					22																	29533423		1917	4125	6042	SO:0001583	missense	83999	exon6			GGGTCTGCTACTG	AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.719G>C	chr22.hg19:g.29533423G>C	ENSP00000385431:p.Cys240Ser	111.0	0.0	.		169.0	29.0	.	NM_001039570	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	ENST00000407188.1	hg19	CCDS43000.2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579944	0.86645	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.14	5.14	0.70334	CUB (5);	0.000000	0.64402	D	0.000002	D	0.85682	0.5753	H	0.96460	3.825	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.989	D;D;D	0.83275	0.994;0.996;0.985	D	0.90105	0.4187	10	0.87932	D	0	.	16.485	0.84182	0.0:0.0:1.0:0.0	.	240;242;242	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	S	242;242;242;240	ENSP00000383189:C242S;ENSP00000383192:C242S;ENSP00000331242:C242S;ENSP00000385431:C240S	ENSP00000331242:C242S	C	+	2	0	KREMEN1	27863423	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.476000	0.97823	2.587000	0.87381	0.591000	0.81541	TGC	.	.	.	none		0.612	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320947.1		
CABP7	164633	hgsc.bcm.edu	37	22	30123661	30123661	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr22:30123661G>T	ENST00000216144.3	+	2	461	c.120G>T	c.(118-120)gaG>gaT	p.E40D		NM_182527.2	NP_872333.1	Q86V35	CABP7_HUMAN	calcium binding protein 7	40	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			lung(1)|skin(3)	4			OV - Ovarian serous cystadenocarcinoma(5;0.00442)|Epithelial(10;0.215)|all cancers(5;0.233)			AGATCCGAGAGGCCTTCAAGG	0.607																																					p.E40D		Atlas-SNP	.											.	CABP7	9	.	0			c.G120T						PASS	.						136.0	126.0	130.0					22																	30123661		2203	4300	6503	SO:0001583	missense	164633	exon2			CCGAGAGGCCTTC	BC051805	CCDS13867.1	22q12.2	2013-01-10			ENSG00000100314	ENSG00000100314		"""EF-hand domain containing"""	20834	protein-coding gene	gene with protein product						11785943	Standard	NM_182527		Approved	MGC57793	uc003agl.3	Q86V35	OTTHUMG00000151282	ENST00000216144.3:c.120G>T	chr22.hg19:g.30123661G>T	ENSP00000216144:p.Glu40Asp	44.0	0.0	.		56.0	9.0	.	NM_182527		Missense_Mutation	SNP	ENST00000216144.3	hg19	CCDS13867.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.981132	0.93044	.	.	ENSG00000100314	ENST00000216144	T	0.72835	-0.69	5.59	4.58	0.56647	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.77246	0.4102	L	0.41079	1.255	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.79412	-0.1814	10	0.87932	D	0	-13.5271	12.9895	0.58610	0.0784:0.0:0.9215:0.0	.	40	Q86V35	CABP7_HUMAN	D	40	ENSP00000216144:E40D	ENSP00000216144:E40D	E	+	3	2	CABP7	28453661	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.603000	0.46266	1.366000	0.46076	0.561000	0.74099	GAG	.	.	.	none		0.607	CABP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322080.1	NM_182527	
TMEM184B	25829	hgsc.bcm.edu	37	22	38621517	38621517	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr22:38621517A>G	ENST00000361906.3	-	7	909	c.701T>C	c.(700-702)tTc>tCc	p.F234S	TMEM184B_ENST00000361684.4_Missense_Mutation_p.F234S|TMEM184B_ENST00000504337.1_5'Flank	NM_001195072.1|NM_012264.4	NP_001182001.1|NP_036396.2	Q9Y519	T184B_HUMAN	transmembrane protein 184B	234						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	8	Melanoma(58;0.045)					CCGGGTGGCGAAGTAGAAGAG	0.597																																					p.F234S		Atlas-SNP	.											.	TMEM184B	19	.	0			c.T701C						PASS	.						131.0	116.0	121.0					22																	38621517		2203	4300	6503	SO:0001583	missense	25829	exon7			GTGGCGAAGTAGA	AL096879	CCDS13969.2	22q12	2008-02-04	2007-07-11	2007-07-11	ENSG00000198792	ENSG00000198792			1310	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 5"""	C22orf5		10591208	Standard	NM_012264		Approved	HS5O6A, DKFZP586A1024, FM08	uc003avf.1	Q9Y519	OTTHUMG00000030557	ENST00000361906.3:c.701T>C	chr22.hg19:g.38621517A>G	ENSP00000355210:p.Phe234Ser	33.0	0.0	.		52.0	8.0	.	NM_001195071	A8K9D7|Q63HM8|Q7Z421|Q8NBM5|Q9UGT8|Q9UGT9|Q9UGV5	Missense_Mutation	SNP	ENST00000361906.3	hg19	CCDS13969.2	.	.	.	.	.	.	.	.	.	.	A	18.13	3.556279	0.65425	.	.	ENSG00000198792	ENST00000361906;ENST00000361684	T;T	0.40756	1.02;1.02	5.85	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.38532	0.1044	L	0.55743	1.74	0.80722	D	1	B	0.17465	0.022	B	0.18263	0.021	T	0.12578	-1.0542	10	0.32370	T	0.25	-14.3997	12.0788	0.53659	0.8709:0.0:0.0:0.1291	.	234	Q9Y519	T184B_HUMAN	S	234	ENSP00000355210:F234S;ENSP00000354441:F234S	ENSP00000354441:F234S	F	-	2	0	TMEM184B	36951463	1.000000	0.71417	0.732000	0.30844	0.884000	0.51177	9.339000	0.96797	0.982000	0.38575	0.533000	0.62120	TTC	.	.	.	none		0.597	TMEM184B-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075445.4	NM_012264	
MXRA5	25878	hgsc.bcm.edu	37	X	3229194	3229194	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chrX:3229194G>T	ENST00000217939.6	-	7	7204	c.7050C>A	c.(7048-7050)aaC>aaA	p.N2350K		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2350	Ig-like C2-type 8.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AGTAAGTCTTGTTCCGGATGG	0.562																																					p.N2350K		Atlas-SNP	.											.	MXRA5	815	.	0			c.C7050A						PASS	.						152.0	124.0	133.0					X																	3229194		2203	4300	6503	SO:0001583	missense	25878	exon7			AGTCTTGTTCCGG	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7050C>A	chrX.hg19:g.3229194G>T	ENSP00000217939:p.Asn2350Lys	37.0	0.0	.		38.0	4.0	.	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	hg19	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677795	0.29783	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.62941	-0.01	4.29	1.46	0.22682	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41294	U	0.000913	T	0.61825	0.2378	L	0.43152	1.355	0.33584	D	0.600307	D	0.59767	0.986	D	0.63381	0.914	T	0.63739	-0.6569	10	0.11182	T	0.66	.	7.8018	0.29178	0.4656:0.0:0.5344:0.0	.	2350	Q9NR99	MXRA5_HUMAN	K	2350	ENSP00000217939:N2350K	ENSP00000217939:N2350K	N	-	3	2	MXRA5	3239194	0.999000	0.42202	0.794000	0.32065	0.289000	0.27227	0.507000	0.22675	-0.097000	0.12307	0.597000	0.82753	AAC	.	.	.	none		0.562	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
AR	367	hgsc.bcm.edu	37	X	66765167	66765167	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chrX:66765167A>T	ENST00000374690.3	+	1	703	c.179A>T	c.(178-180)cAg>cTg	p.Q60L	AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Missense_Mutation_p.Q60L|AR_ENST00000396044.3_Missense_Mutation_p.Q60L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	60	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTgcagcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q60L		Atlas-SNP	.											.	AR	249	.	0			c.A179T	GRCh37	CI994028	AR	I		PASS	.						6.0	9.0	8.0					X																	66765167		1971	3901	5872	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.179A>T	chrX.hg19:g.66765167A>T	ENSP00000363822:p.Gln60Leu	34.0	0.0	.		48.0	6.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.27	1.588228	0.28357	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.57436	0.4;0.4;0.4	.	.	.	.	1.241110	0.06210	N	0.684797	T	0.29288	0.0729	N	0.19112	0.55	0.09310	N	0.999999	P;P;.	0.36048	0.534;0.534;.	B;B;.	0.29862	0.08;0.108;.	T	0.11494	-1.0585	8	0.12103	T	0.63	.	.	.	.	.	60;60;58	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	60	ENSP00000363822:Q60L;ENSP00000421155:Q60L;ENSP00000379359:Q60L	ENSP00000363822:Q60L	Q	+	2	0	AR	66681892	0.997000	0.39634	0.860000	0.33809	0.513000	0.34164	1.220000	0.32491	0.000000	0.14550	0.000000	0.15137	CAG	.	.	.	none		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
STAG2	10735	hgsc.bcm.edu	37	X	123229293	123229293	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chrX:123229293T>A	ENST00000371160.1	+	33	3956	c.3666T>A	c.(3664-3666)gaT>gaA	p.D1222E	STAG2_ENST00000371144.3_Missense_Mutation_p.D1222E|STAG2_ENST00000371145.3_Missense_Mutation_p.D1259E|STAG2_ENST00000354548.5_Missense_Mutation_p.D1153E|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.D1259E|STAG2_ENST00000371157.3_Missense_Mutation_p.D1222E	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	1222					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						CAATTATGGATGAATCAGTAG	0.393																																					p.D1259E		Atlas-SNP	.											.	STAG2	309	.	0			c.T3777A						PASS	.						107.0	95.0	99.0					X																	123229293		2203	4300	6503	SO:0001583	missense	10735	exon34			TATGGATGAATCA	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.3666T>A	chrX.hg19:g.123229293T>A	ENSP00000360202:p.Asp1222Glu	142.0	0.0	.		134.0	24.0	.	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	hg19	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.599001	0.66332	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.51817	1.46;0.76;0.69;0.69;1.46;0.69	4.94	3.77	0.43336	.	0.115346	0.56097	N	0.000023	T	0.51007	0.1649	L	0.41492	1.28	0.45403	D	0.998383	D;D	0.59767	0.984;0.986	P;P	0.60609	0.877;0.81	T	0.41378	-0.9512	10	0.36615	T	0.2	-11.9936	7.9773	0.30161	0.0:0.1694:0.0:0.8306	.	1259;1222	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	E	1259;1153;1222;1222;1259;1222	ENSP00000218089:D1259E;ENSP00000346555:D1153E;ENSP00000360202:D1222E;ENSP00000360199:D1222E;ENSP00000360187:D1259E;ENSP00000360186:D1222E	ENSP00000218089:D1259E	D	+	3	2	STAG2	123056974	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.616000	0.36933	0.558000	0.29135	-0.438000	0.05819	GAT	.	.	.	none		0.393	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
MAGEA4	4103	hgsc.bcm.edu	37	X	151092975	151092975	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chrX:151092975C>T	ENST00000360243.2	+	3	1106	c.839C>T	c.(838-840)gCt>gTt	p.A280V	MAGEA4_ENST00000393920.1_Missense_Mutation_p.A280V|MAGEA4_ENST00000370337.4_Missense_Mutation_p.A280V|MAGEA4_ENST00000370335.1_Missense_Mutation_p.A280V|MAGEA4_ENST00000276344.2_Missense_Mutation_p.A280V|MAGEA4_ENST00000370340.3_Missense_Mutation_p.A280V|MAGEA4_ENST00000393921.1_Missense_Mutation_p.A280V	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	280	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGCTCTGGCTGAAACCAGC	0.552																																					p.A280V		Atlas-SNP	.											.	MAGEA4	68	.	0			c.C839T						PASS	.						132.0	130.0	131.0					X																	151092975		2203	4300	6503	SO:0001583	missense	4103	exon3			CTCTGGCTGAAAC		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.839C>T	chrX.hg19:g.151092975C>T	ENSP00000353379:p.Ala280Val	67.0	0.0	.		85.0	46.0	.	NM_001011548	Q14798	Missense_Mutation	SNP	ENST00000360243.2	hg19	CCDS14702.1	.	.	.	.	.	.	.	.	.	.	C	9.150	1.016148	0.19355	.	.	ENSG00000147381	ENST00000276344;ENST00000393921;ENST00000370337;ENST00000393920;ENST00000370340;ENST00000370335;ENST00000360243	T;T;T;T;T;T;T	0.04809	3.55;3.55;3.55;3.55;3.55;3.55;3.55	2.55	0.688	0.18027	.	0.916903	0.09375	N	0.810810	T	0.05960	0.0155	M	0.64997	1.995	0.09310	N	1	B	0.20671	0.047	B	0.17722	0.019	T	0.41680	-0.9495	9	.	.	.	.	4.6093	0.12395	0.0:0.6542:0.0:0.3458	.	280	P43358	MAGA4_HUMAN	V	280	ENSP00000276344:A280V;ENSP00000377498:A280V;ENSP00000359362:A280V;ENSP00000377497:A280V;ENSP00000359365:A280V;ENSP00000359360:A280V;ENSP00000353379:A280V	.	A	+	2	0	MAGEA4	150843631	0.001000	0.12720	0.013000	0.15412	0.030000	0.12068	0.332000	0.19751	0.058000	0.16222	0.292000	0.19580	GCT	.	.	.	none		0.552	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362	
MT-CO1	4512	hgsc.bcm.edu	37	M	6853	6853	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chrM:6853G>A	ENST00000361624.2	+	1	950	c.950G>A	c.(949-951)gGc>gAc	p.G317D	MT-ATP8_ENST00000361851.1_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TD_ENST00000387419.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	317					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TATCCCCACCGGCGTCAAAGT	0.463																																					p.G317D		Atlas-SNP	.											.	.	.	.	0			c.G950A						PASS	.																																			SO:0001583	missense	5742	exon1			CCACCGGCGTCAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.950G>A	chrM.hg19:g.6853G>A	ENSP00000354499:p.Gly317Asp	24.0	0.0	.		41.0	12.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.463	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-CO3	4514	hgsc.bcm.edu	37	M	9819	9819	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chrM:9819G>A	ENST00000362079.2	+	1	613	c.613G>A	c.(613-615)Gga>Aga	p.G205R	MT-TS2_ENST00000387449.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	205					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						CAGGCTTCCACGGACTTCACG	0.458																																					p.G205X		Atlas-SNP	.											.	.	.	.	0			c.G613A						PASS	.																																			SO:0001583	missense	5742	exon1			TTCCACGGACTTC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.613G>A	chrM.hg19:g.9819G>A	ENSP00000354982:p.Gly205Arg	25.0	0.0	.		37.0	6.0	.	ENST00000362079	Q14Y83	Nonsense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	C|0.931;T|0.069	.	alt		0.458	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
KRTAP5-7	440050	hgsc.bcm.edu	37	11	71238734	71238760	+	In_Frame_Del	DEL	TGCTGCTGTTCCTCAGGCTGTGGGTCA	TGCTGCTGTTCCTCAGGCTGTGGGTCA	-	rs533945918|rs79842834	byFrequency	TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	TGCTGCTGTTCCTCAGGCTGTGGGTCA	TGCTGCTGTTCCTCAGGCTGTGGGTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr11:71238734_71238760delTGCTGCTGTTCCTCAGGCTGTGGGTCA	ENST00000398536.4	+	1	422_448	c.388_414delTGCTGCTGTTCCTCAGGCTGTGGGTCA	c.(388-414)tgctgctgttcctcaggctgtgggtcadel	p.CCCSSGCGS130del		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	130	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G137W(1)		breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						ctgtaagccctgctgctgttcctcaggctgtgggtcatcctgctgcc	0.604																																					p.129_138del		Atlas-INDEL	.											.	KRTAP5-7	23	.	1	Substitution - Missense(1)	lung(1)	c.387_413del						PASS	.																																			SO:0001651	inframe_deletion	440050	exon1			.	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.388_414delTGCTGCTGTTCCTCAGGCTGTGGGTCA	chr11.hg19:g.71238734_71238760delTGCTGCTGTTCCTCAGGCTGTGGGTCA	ENSP00000417330:p.Cys130_Ser138del	89.0	0.0	0		117.0	12.0	0.102564	NM_001012503	B2RNM3|Q701N5	In_Frame_Del	DEL	ENST00000398536.4	hg19	CCDS41682.1																																																																																			.	.	.	none		0.604	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1		
EPS15L1	58513	hgsc.bcm.edu	37	19	16545212	16545214	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:16545212_16545214delGAG	ENST00000248070.6	-	7	599_601	c.460_462delCTC	c.(460-462)ctcdel	p.L154del	EPS15L1_ENST00000594975.1_In_Frame_Del_p.L154del|EPS15L1_ENST00000597937.1_In_Frame_Del_p.L154del|EPS15L1_ENST00000602009.1_5'UTR|EPS15L1_ENST00000455140.2_In_Frame_Del_p.L154del|EPS15L1_ENST00000535753.2_In_Frame_Del_p.L154del	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	154	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TTGAGTTCATGAGGACTGGCTTG	0.512																																					p.154_155del		Atlas-Indel,Pindel	.											.	EPS15L1	81	.	0			c.461_463del						PASS	.																																			SO:0001651	inframe_deletion	58513	exon7			.	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.460_462delCTC	chr19.hg19:g.16545212_16545214delGAG	ENSP00000248070:p.Leu154del	83.0	0.0	0		61.0	11.0	0.180328	NM_021235	A2RRF3|A5PL29|B4DKA3	In_Frame_Del	DEL	ENST00000248070.6	hg19	CCDS32944.1																																																																																			.	.	.	none		0.512	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
C11orf94	143678	hgsc.bcm.edu	37	11	45928455	45928456	+	Frame_Shift_Ins	INS	-	-	G			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr11:45928455_45928456insG	ENST00000449465.1	-	2	175_176	c.139_140insC	c.(139-141)ctgfs	p.L47fs	RP11-618K13.2_ENST00000533218.1_RNA	NM_001080446.2	NP_001073915.2	C9JXX5	CK094_HUMAN	chromosome 11 open reading frame 94	47						extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|ovary(1)|pancreas(1)|prostate(1)	7						CGAGAGTTCCAGGGGGGCGGAA	0.619																																					p.L47fs		Atlas-Indel,Pindel	.											.	C11orf94	13	.	0			c.140_141insC						PASS	.																																			SO:0001589	frameshift_variant	143678	exon2			.		CCDS44577.1	11p11.2	2012-08-10			ENSG00000234776	ENSG00000234776			37213	protein-coding gene	gene with protein product							Standard	NM_001080446		Approved		uc001nbs.4	C9JXX5	OTTHUMG00000167004	ENST00000449465.1:c.140dupC	chr11.hg19:g.45928461_45928461dupG	ENSP00000401498:p.Leu47fs	37.0	0.0	0		57.0	12.0	0.210526	NM_001080446		Frame_Shift_Ins	INS	ENST00000449465.1	hg19	CCDS44577.1																																																																																			.	.	.	none		0.619	C11orf94-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392395.1	NM_001080446	
AFG3L2	10939	hgsc.bcm.edu	37	18	12359961	12359965	+	Frame_Shift_Del	DEL	ATTTT	ATTTT	-			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	ATTTT	ATTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr18:12359961_12359965delATTTT	ENST00000269143.3	-	7	944_948	c.713_717delAAAAT	c.(712-717)gaaaatfs	p.EN238fs		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	238					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CAGGCACCCGATTTTCTCCTTCTAT	0.395																																					p.238_240del		Atlas-Indel,Pindel	.											.	AFG3L2	60	.	0			c.714_718del						PASS	.																																			SO:0001589	frameshift_variant	10939	exon7			.	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.713_717delAAAAT	chr18.hg19:g.12359961_12359965delATTTT	ENSP00000269143:p.Glu238fs	100.0	0.0	0		123.0	14.0	0.113821	NM_006796	Q6P1L0	Frame_Shift_Del	DEL	ENST00000269143.3	hg19	CCDS11859.1																																																																																			.	.	.	none		0.395	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
RPE65	6121	hgsc.bcm.edu	37	1	68910331	68910343	+	Frame_Shift_Del	DEL	TACTCCTCGAAAG	TACTCCTCGAAAG	-	rs61752877		TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	TACTCCTCGAAAG	TACTCCTCGAAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr1:68910331_68910343delTACTCCTCGAAAG	ENST00000262340.5	-	5	419_431	c.366_378delCTTTCGAGGAGTA	c.(364-378)tactttcgaggagtafs	p.YFRGV122fs		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	122					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)	p.R124*(1)|p.R124L(1)		central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						CAGTAACCTCTACTCCTCGAAAGTAAGAAAAAA	0.371																																					p.123_127del		Atlas-Indel,Pindel	.											.	RPE65	87	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(1)|lung(1)	c.367_379del	GRCh37	CM983760	RPE65	M	rs61752877	PASS	.																																			SO:0001589	frameshift_variant	6121	exon5			.	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.366_378delCTTTCGAGGAGTA	chr1.hg19:g.68910331_68910343delTACTCCTCGAAAG	ENSP00000262340:p.Tyr122fs	128.0	0.0	0		116.0	24.0	0.206897	NM_000329	A8K1L0|Q5T9U3	Frame_Shift_Del	DEL	ENST00000262340.5	hg19	CCDS643.1																																																																																			.	.	.	none		0.371	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
OR1E1	8387	hgsc.bcm.edu	37	17	3301172	3301172	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr17:3301172delA	ENST00000322608.2	-	1	532	c.533delT	c.(532-534)ttcfs	p.F178fs		NM_003553.2	NP_003544.2	P30953	OR1E1_HUMAN	olfactory receptor, family 1, subfamily E, member 1	178				F -> L (in Ref. 6; AAA17447). {ECO:0000305}.	detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(2)|lung(5)	10						CATATCACAGAAAAAGTGGGG	0.483																																					p.F178fs		Atlas-Indel,Pindel	.											.	OR1E1	37	.	0			c.534delC						PASS	.						59.0	51.0	54.0					17																	3301172		2202	4300	6502	SO:0001589	frameshift_variant	8387	exon1			.	U04642	CCDS11024.1	17p13.3	2012-08-09			ENSG00000180016	ENSG00000180016		"""GPCR / Class A : Olfactory receptors"""	8189	protein-coding gene	gene with protein product				OR1E9P, OR1E5, OR1E6		8004088, 1370859	Standard	NM_003553		Approved	OR17-2, HGM071, OR17-32, OR13-66	uc002fvj.1	P30953	OTTHUMG00000090643	ENST00000322608.2:c.533delT	chr17.hg19:g.3301172delA	ENSP00000313384:p.Phe178fs	106.0	0.0	0		156.0	59.0	0.378205	NM_003553	O43884|P47882|P47885|Q6IFA9|Q6IFM5|Q9UBJ1|Q9UM60	Frame_Shift_Del	DEL	ENST00000322608.2	hg19	CCDS11024.1																																																																																			.	.	.	none		0.483	OR1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207303.1	NM_003553	
SCN11A	11280	hgsc.bcm.edu	37	3	38908838	38908838	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr3:38908838delC	ENST00000302328.3	-	23	4123	c.3925delG	c.(3925-3927)gacfs	p.D1309fs	SCN11A_ENST00000450244.1_Frame_Shift_Del_p.D1309fs|SCN11A_ENST00000456224.3_Frame_Shift_Del_p.D1271fs|SCN11A_ENST00000444237.2_Frame_Shift_Del_p.D1309fs	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1309					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGAAGTTGTCAATGATAACG	0.368																																					p.D1309fs		Atlas-INDEL	.											.	SCN11A	296	.	0			c.3926delA						PASS	.						149.0	141.0	144.0					3																	38908838		2203	4300	6503	SO:0001589	frameshift_variant	11280	exon23			.	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3925delG	chr3.hg19:g.38908838delC	ENSP00000307599:p.Asp1309fs	94.0	0.0	0		87.0	21.0	0.241379	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Frame_Shift_Del	DEL	ENST00000302328.3	hg19	CCDS33737.1																																																																																			.	.	.	none		0.368	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
SCFD2	152579	hgsc.bcm.edu	37	4	54140020	54140020	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr4:54140020delA	ENST00000401642.3	-	4	1417	c.1284delT	c.(1282-1284)tttfs	p.F428fs	SCFD2_ENST00000388940.4_Frame_Shift_Del_p.F428fs	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	428					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)					breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CAAAAGCCAGAAAGTTGTCCC	0.443																																					p.L429fs		Atlas-Indel,Pindel	.											.	SCFD2	78	.	0			c.1285delC						PASS	.						101.0	96.0	98.0					4																	54140020		2203	4300	6503	SO:0001589	frameshift_variant	152579	exon4			.	AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.1284delT	chr4.hg19:g.54140020delA	ENSP00000384182:p.Phe428fs	80.0	0.0	0		93.0	18.0	0.193548	NM_152540	Q8N5F3|Q8N8H0|Q96ED3	Frame_Shift_Del	DEL	ENST00000401642.3	hg19	CCDS33984.1																																																																																			.	.	.	none		0.443	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540	
MAP2K7	5609	hgsc.bcm.edu	37	19	7975668	7975757	+	Splice_Site	DEL	CTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA	CTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA	-	rs373789571|rs367903083|rs12609075|rs41285782|rs537403823|rs574489981|rs554660875|rs372316207|rs191490120|rs566635337|rs550936407|rs538578150|rs551097008|rs370462728|rs181230065|rs12610278	byFrequency	TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	CTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA	CTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr19:7975668_7975757delCTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA	ENST00000397979.3	+	6	709_729	c.655_675delCTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA	c.(655-675)ctgggcaagatgacagtggcgdel	p.LGKMTVA219del	MAP2K7_ENST00000397981.3_Splice_Site_p.LGKMTVA219del|MAP2K7_ENST00000545011.1_Splice_Site_p.LGKMTVA261del|CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000397983.3_Splice_Site_p.LGKMTVA235del	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	219	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						CGAGCGCATTCTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCACTGGGCAAGA	0.666																																					p.218_225del		Pindel	.											.	MAP2K7	66	.	0			c.654_675del						PASS	.																																			SO:0001630	splice_region_variant	5609	exon6			.	AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.675+1CTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA>-	chr19.hg19:g.7975668_7975757delCTGGGCAAGATGACAGTGGCGGTGAGTGACCAGGCGGGGCTTGCACTGGGCAGGATGACAGAGGCGGTGAGTGACCAGGCGGGGCGTGCA		65.0	0.0	.		56.0	18.0	0.321	NM_145185	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Frame_Shift_Del	DEL	ENST00000397979.3	hg19	CCDS42491.1																																																																																			.	.	.	none		0.666	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267980.1		In_Frame_Del
SCN11A	11280	hgsc.bcm.edu	37	3	38908836	38908839	+	Frame_Shift_Del	DEL	GTCA	GTCA	-	rs371852759		TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	GTCA	GTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr3:38908836_38908839delGTCA	ENST00000302328.3	-	23	4122_4125	c.3924_3927delTGAC	c.(3922-3927)attgacfs	p.ID1308fs	SCN11A_ENST00000450244.1_Frame_Shift_Del_p.ID1308fs|SCN11A_ENST00000456224.3_Frame_Shift_Del_p.ID1270fs|SCN11A_ENST00000444237.2_Frame_Shift_Del_p.ID1308fs	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1308					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGTTGAAGTTGTCAATGATAACGC	0.373																																					p.1309_1310del		Pindel	.											.	SCN11A	296	.	0			c.3925_3928del						PASS	.																																			SO:0001589	frameshift_variant	11280	exon23			.	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3924_3927delTGAC	chr3.hg19:g.38908836_38908839delGTCA	ENSP00000307599:p.Ile1308fs	93.0	0.0	.		88.0	18.0	0.205	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Frame_Shift_Del	DEL	ENST00000302328.3	hg19	CCDS33737.1																																																																																			.	.	.	none		0.373	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
KRT72	140807	hgsc.bcm.edu	37	12	52981529	52981549	+	In_Frame_Del	DEL	GCCTGGTGCAGGGCGCCCTCC	GCCTGGTGCAGGGCGCCCTCC	-	rs145882334	byFrequency	TCGA-IA-A83T-01A-11D-A34Z-10	TCGA-IA-A83T-11A-11D-A34Z-10	GCCTGGTGCAGGGCGCCCTCC	GCCTGGTGCAGGGCGCCCTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	580ff01c-dd91-46ed-a426-7b2afea92207	cfd3629b-47b9-4934-86ab-9695c9f95668	g.chr12:52981529_52981549delGCCTGGTGCAGGGCGCCCTCC	ENST00000537672.2	-	7	1186_1206	c.1176_1196delGGAGGGCGCCCTGCACCAGGC	c.(1174-1197)ctggagggcgccctgcaccaggcc>ctc	p.EGALHQA393del	KRT72_ENST00000354310.4_In_Frame_Del_p.EGALHQA351del|KRT72_ENST00000293745.2_In_Frame_Del_p.EGALHQA393del|KRT72_ENST00000398066.3_In_Frame_Del_p.EGALHQA205del	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	393	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CTCCTCCTTGGCCTGGTGCAGGGCGCCCTCCAGCTCATCCA	0.652																																					p.393_399del		Pindel	.											.	KRT72	70	.	0			c.1177_1197del						PASS	.																																			SO:0001651	inframe_deletion	140807	exon7			.	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1176_1196delGGAGGGCGCCCTGCACCAGGC	chr12.hg19:g.52981529_52981549delGCCTGGTGCAGGGCGCCCTCC	ENSP00000441160:p.Glu393_Ala399del	103.0	0.0	.		128.0	12.0	0.094	NM_001146225	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	In_Frame_Del	DEL	ENST00000537672.2	hg19	CCDS8833.1																																																																																			.	.	.	none		0.652	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
