#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HSPG2	3339	hgsc.bcm.edu	37	1	22173002	22173002	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:22173002C>G	ENST00000374695.3	-	63	8334	c.8255G>C	c.(8254-8256)gGg>gCg	p.G2752A	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2752	Ig-like C2-type 13.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ATGGGCCTGCCCGGGGACCAC	0.637																																					p.G2752A		Atlas-SNP	.											.	HSPG2	311	.	0			c.G8255C						PASS	.						63.0	65.0	64.0					1																	22173002		2203	4300	6503	SO:0001583	missense	3339	exon63			GCCTGCCCGGGGA	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8255G>C	chr1.hg19:g.22173002C>G	ENSP00000363827:p.Gly2752Ala	133.0	0.0	.		135.0	43.0	.	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156178	0.78114	.	.	ENSG00000142798	ENST00000374695;ENST00000453796	T;T	0.79141	-1.24;-1.24	4.94	4.94	0.65067	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40385	N	0.001115	D	0.89012	0.6594	M	0.86953	2.85	0.53688	D	0.999979	D;P	0.76494	0.999;0.861	D;P	0.73380	0.98;0.668	D	0.90625	0.4562	10	0.59425	D	0.04	.	15.683	0.77388	0.0:1.0:0.0:0.0	.	692;2752	Q59EG0;P98160	.;PGBM_HUMAN	A	2752;167	ENSP00000363827:G2752A;ENSP00000396310:G167A	ENSP00000363827:G2752A	G	-	2	0	HSPG2	22045589	0.643000	0.27269	0.987000	0.45799	0.931000	0.56810	5.418000	0.66429	2.292000	0.77174	0.561000	0.74099	GGG	.	.	.	none		0.637	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
LUZP1	7798	hgsc.bcm.edu	37	1	23418024	23418024	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:23418024C>G	ENST00000302291.4	-	4	3532	c.2731G>C	c.(2731-2733)Ggc>Cgc	p.G911R	LUZP1_ENST00000418342.1_Missense_Mutation_p.G911R|LUZP1_ENST00000374623.3_Missense_Mutation_p.G911R|LUZP1_ENST00000314174.5_Missense_Mutation_p.G911R			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	911					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TCTGAGAAGCCCACTTCTGAA	0.493																																					p.G911R		Atlas-SNP	.											.	LUZP1	83	.	0			c.G2731C						PASS	.						96.0	90.0	92.0					1																	23418024		2203	4300	6503	SO:0001583	missense	7798	exon4			AGAAGCCCACTTC	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2731G>C	chr1.hg19:g.23418024C>G	ENSP00000303758:p.Gly911Arg	132.0	0.0	.		148.0	31.0	.	NM_033631	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	ENST00000302291.4	hg19	CCDS30628.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.962845	0.34659	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.14266	2.74;2.74;2.74;2.52	5.28	4.37	0.52481	.	0.508271	0.16793	N	0.199305	T	0.14313	0.0346	L	0.36672	1.1	0.09310	N	1	P;P	0.46512	0.879;0.879	P;P	0.45167	0.472;0.472	T	0.07712	-1.0758	10	0.62326	D	0.03	.	9.6043	0.39624	0.0:0.8325:0.0:0.1675	.	911;911	Q86V48-2;Q86V48	.;LUZP1_HUMAN	R	911	ENSP00000393460:G911R;ENSP00000363752:G911R;ENSP00000303758:G911R;ENSP00000313705:G911R	ENSP00000303758:G911R	G	-	1	0	LUZP1	23290611	0.000000	0.05858	0.085000	0.20634	0.692000	0.40212	0.624000	0.24462	1.253000	0.44018	0.485000	0.47835	GGC	.	.	.	none		0.493	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631	
FAF1	11124	hgsc.bcm.edu	37	1	51253751	51253751	+	Silent	SNP	C	C	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:51253751C>T	ENST00000396153.2	-	4	739	c.288G>A	c.(286-288)agG>agA	p.R96R	FAF1_ENST00000371778.4_Silent_p.R96R	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	96					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(3)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		TCCGAGGTTGCCTTTCTACAA	0.458																																					p.R96R		Atlas-SNP	.											.	FAF1	64	.	3	Whole gene deletion(3)	thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	c.G288A						PASS	.						120.0	102.0	108.0					1																	51253751		2203	4300	6503	SO:0001819	synonymous_variant	11124	exon4			AGGTTGCCTTTCT	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.288G>A	chr1.hg19:g.51253751C>T		159.0	0.0	.		158.0	38.0	.	NM_007051	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Silent	SNP	ENST00000396153.2	hg19	CCDS554.1																																																																																			.	.	.	none		0.458	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051	
RPRD2	23248	hgsc.bcm.edu	37	1	150337220	150337220	+	Silent	SNP	T	T	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:150337220T>C	ENST00000369068.4	+	1	34	c.30T>C	c.(28-30)agT>agC	p.S10S	RPRD2_ENST00000492220.1_Intron|RPRD2_ENST00000401000.4_Silent_p.S10S|RPRD2_ENST00000369067.3_Silent_p.S10S|RPRD2_ENST00000539519.1_Silent_p.S10S	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	10	Gly/Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						GAGGCAGCAGTAAGGCCTCCT	0.667																																					p.S10S		Atlas-SNP	.											.	RPRD2	189	.	0			c.T30C						PASS	.						35.0	33.0	33.0					1																	150337220		692	1591	2283	SO:0001819	synonymous_variant	23248	exon1			CAGCAGTAAGGCC	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.30T>C	chr1.hg19:g.150337220T>C		53.0	0.0	.		45.0	5.0	.	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	ENST00000369068.4	hg19	CCDS44216.1																																																																																			.	.	.	none		0.667	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
TNFAIP8L2	79626	hgsc.bcm.edu	37	1	151131378	151131379	+	Missense_Mutation	DNP	AA	AA	GG			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:151131378_151131379AA>GG	ENST00000368910.3	+	2	331_332	c.205_206AA>GG	c.(205-207)AAg>GGg	p.K69G		NM_024575.4	NP_078851.2	Q6P589	TP8L2_HUMAN	tumor necrosis factor, alpha-induced protein 8-like 2	69					innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)				lung(1)|skin(2)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGTGGCCATCAAGGTGGCTGTG	0.624																																					p.K69E|p.K69R		Atlas-SNP	.											.	TNFAIP8L2	19	.	0			c.A205G|c.A206G						PASS	.																																			SO:0001583	missense	79626	exon2			GCCATCAAGGTGG|CCATCAAGGTGGC	BC063014	CCDS985.1	1q21.2	2008-02-05			ENSG00000163154	ENSG00000163154			26277	protein-coding gene	gene with protein product		612112					Standard	NM_024575		Approved	FLJ23467	uc001ewx.2	Q6P589	OTTHUMG00000012259	Exception_encountered	chr1.hg19:g.151131378_151131379delinsGG	ENSP00000357906:p.Lys69Gly	214.0	0.0	.		165.0|166.0	28.0|29.0	.	NM_024575	Q6I9Y0|Q9H2H7|Q9H5G2	Missense_Mutation	SNP	ENST00000368910.3	hg19	CCDS985.1																																																																																			.	.	.	none		0.624	TNFAIP8L2-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034069.2	NM_024575	
FMO1	2326	hgsc.bcm.edu	37	1	171254631	171254631	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:171254631A>G	ENST00000354841.4	+	8	1678	c.1547A>G	c.(1546-1548)aAa>aGa	p.K516R	FMO1_ENST00000402921.2_Missense_Mutation_p.K453R|FMO1_ENST00000367750.3_Missense_Mutation_p.K516R|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	516					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	AGTTTTCTTAAAGTCTTTAGC	0.403																																					p.K516R		Atlas-SNP	.											.	FMO1	79	.	0			c.A1547G						PASS	.						67.0	70.0	69.0					1																	171254631		2203	4300	6503	SO:0001583	missense	2326	exon9			TTCTTAAAGTCTT	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1547A>G	chr1.hg19:g.171254631A>G	ENSP00000346901:p.Lys516Arg	212.0	0.0	.		227.0	55.0	.	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	hg19	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.473896	0.43942	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.58060	0.36;0.36;0.36	5.61	3.27	0.37495	.	0.384897	0.27185	N	0.020536	T	0.24314	0.0589	L	0.58101	1.795	0.30209	N	0.7979	B;B	0.26672	0.053;0.156	B;B	0.30105	0.078;0.111	T	0.14924	-1.0455	10	0.22706	T	0.39	-12.9555	6.2625	0.20907	0.7559:0.1615:0.0825:0.0	.	453;516	B7Z3P4;Q01740	.;FMO1_HUMAN	R	516;453;516	ENSP00000356724:K516R;ENSP00000385543:K453R;ENSP00000346901:K516R	ENSP00000346901:K516R	K	+	2	0	FMO1	169521255	0.025000	0.19082	0.815000	0.32552	0.356000	0.29392	0.808000	0.27154	0.401000	0.25424	0.455000	0.32223	AAA	.	.	.	none		0.403	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
CENPF	1063	hgsc.bcm.edu	37	1	214832273	214832273	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:214832273C>A	ENST00000366955.3	+	19	9211	c.9043C>A	c.(9043-9045)Ctg>Atg	p.L3015M		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	3111	Sufficient for centromere localization.|Sufficient for nuclear localization.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CAGCCCCCGCCTGGCTGCACA	0.512											OREG0014250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L3015M	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											.	CENPF	321	.	0			c.C9043A						PASS	.						113.0	116.0	115.0					1																	214832273		2203	4300	6503	SO:0001583	missense	1063	exon19			CCCCGCCTGGCTG	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.9043C>A	chr1.hg19:g.214832273C>A	ENSP00000355922:p.Leu3015Met	86.0	0.0	.	2224	78.0	18.0	.	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025949	0.75390	.	.	ENSG00000117724	ENST00000366955	T	0.12879	2.64	5.63	4.7	0.59300	.	0.261378	0.20300	N	0.095055	T	0.34424	0.0897	M	0.65498	2.005	0.33693	D	0.613617	D	0.76494	0.999	D	0.66716	0.946	T	0.52525	-0.8564	10	0.87932	D	0	.	14.088	0.64971	0.0:0.9273:0.0:0.0727	.	3111	P49454	CENPF_HUMAN	M	3015	ENSP00000355922:L3015M	ENSP00000355922:L3015M	L	+	1	2	CENPF	212898896	0.801000	0.28930	0.995000	0.50966	0.940000	0.58332	1.933000	0.40153	1.351000	0.45789	0.655000	0.94253	CTG	.	.	.	none		0.512	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
CEP170	9859	hgsc.bcm.edu	37	1	243328302	243328302	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr1:243328302T>G	ENST00000366542.1	-	13	3011	c.2960A>C	c.(2959-2961)aAa>aCa	p.K987T	CEP170_ENST00000490813.1_5'Flank|RP11-261C10.4_ENST00000422938.1_RNA|RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000366544.1_Missense_Mutation_p.K889T|CEP170_ENST00000366543.1_Missense_Mutation_p.K889T	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	987	Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			CTTTTCCATTTTTTCCCTAGC	0.408																																					p.K987T		Atlas-SNP	.											.	CEP170	153	.	0			c.A2960C						PASS	.						41.0	40.0	40.0					1																	243328302		1832	4062	5894	SO:0001583	missense	9859	exon13			TCCATTTTTTCCC	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.2960A>C	chr1.hg19:g.243328302T>G	ENSP00000355500:p.Lys987Thr	629.0	0.0	.		571.0	79.0	.	NM_014812	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	hg19	CCDS44339.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.05|16.05	3.014245|3.014245	0.54468|0.54468	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000336415|ENST00000366542;ENST00000366544;ENST00000366543	T|T;T;T	0.48836|0.51325	0.8|0.75;0.73;0.71	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	0.048059|0.048059	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.57770|0.57770	0.2076|0.2076	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.997;0.996;0.996;0.999	.|D;D;D;D	.|0.80764	.|0.993;0.986;0.986;0.994	T|T	0.52290|0.52290	-0.8595|-0.8595	8|10	0.25751|0.20046	T|T	0.34|0.44	-17.5403|-17.5403	13.6896|13.6896	0.62537|0.62537	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|950;889;889;987	.|B1ARM6;Q5SW79-3;Q5SW79-2;Q5SW79	.|.;.;.;CE170_HUMAN	Q|T	951|987;889;889	ENSP00000338161:K951Q|ENSP00000355500:K987T;ENSP00000355502:K889T;ENSP00000355501:K889T	ENSP00000338161:K951Q|ENSP00000355500:K987T	K|K	-|-	1|2	0|0	CEP170|CEP170	241394925|241394925	1.000000|1.000000	0.71417|0.71417	0.941000|0.941000	0.38009|0.38009	0.962000|0.962000	0.63368|0.63368	5.584000|5.584000	0.67490|0.67490	1.823000|1.823000	0.53134|0.53134	0.454000|0.454000	0.30748|0.30748	AAA|AAA	.	.	.	none		0.408	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
TRMT61B	55006	hgsc.bcm.edu	37	2	29072767	29072767	+	3'UTR	SNP	A	A	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr2:29072767A>G	ENST00000306108.5	-	0	1755				SPDYA_ENST00000334056.5_Missense_Mutation_p.K301R|TRMT61B_ENST00000484060.1_5'Flank|SPDYA_ENST00000379579.4_Missense_Mutation_p.K301R	NM_017910.3	NP_060380.3	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B (S. cerevisiae)						mitochondrial tRNA methylation (GO:0070901)|protein homooligomerization (GO:0051260)	mitochondrion (GO:0005739)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	13						TTCTTGAAGAAAGACAAATCT	0.299																																					p.K301R		Atlas-SNP	.											.	SPDYA	41	.	0			c.A902G						PASS	.						50.0	55.0	53.0					2																	29072767		2203	4297	6500	SO:0001624	3_prime_UTR_variant	245711	exon7			TGAAGAAAGACAA	BC010365	CCDS1768.1	2p23.2	2009-01-09			ENSG00000171103	ENSG00000171103			26070	protein-coding gene	gene with protein product						11230166	Standard	NM_017910		Approved	FLJ20628	uc002rmm.3	Q9BVS5	OTTHUMG00000128433	ENST00000306108.5:c.*298T>C	chr2.hg19:g.29072767A>G		180.0	0.0	.		171.0	42.0	.	NM_001142634	Q9H0Q9|Q9NWS7	Missense_Mutation	SNP	ENST00000306108.5	hg19	CCDS1768.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.087655	0.36855	.	.	ENSG00000163806	ENST00000379579;ENST00000334056	.	.	.	5.63	3.16	0.36331	.	0.231056	0.21337	U	0.076194	T	0.42966	0.1226	L	0.44542	1.39	0.80722	D	1	B	0.24823	0.112	B	0.19148	0.024	T	0.13388	-1.0511	9	0.15066	T	0.55	-0.301	8.0324	0.30472	0.7234:0.1417:0.0:0.1349	.	301	Q5MJ70	SPDYA_HUMAN	R	301	.	ENSP00000335628:K301R	K	+	2	0	SPDYA	28926271	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.333000	0.43912	0.441000	0.26529	0.533000	0.62120	AAA	.	.	.	none		0.299	TRMT61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250224.1	NM_017910	
FBXO11	80204	hgsc.bcm.edu	37	2	48040432	48040432	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr2:48040432C>A	ENST00000403359.3	-	18	2240	c.2168G>T	c.(2167-2169)aGa>aTa	p.R723I	FBXO11_ENST00000434523.2_Missense_Mutation_p.R147I|FBXO11_ENST00000316377.4_Missense_Mutation_p.R639I|FBXO11_ENST00000402508.1_Missense_Mutation_p.R639I	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	723					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTTATTTCTTCTTAGTGTAGG	0.343			"""Mis, F, D"""		DLBCL																																p.R723I		Atlas-SNP	.		Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11	127	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.G2168T						PASS	.						120.0	123.0	122.0					2																	48040432		2203	4299	6502	SO:0001583	missense	80204	exon18			TTTCTTCTTAGTG	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.2168G>T	chr2.hg19:g.48040432C>A	ENSP00000384823:p.Arg723Ile	323.0	0.0	.		285.0	63.0	.	NM_001190274	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	hg19	CCDS54357.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.234868|5.234868	0.95207|0.95207	.|.	.|.	ENSG00000138081|ENSG00000138081	ENST00000493962|ENST00000402508;ENST00000403359;ENST00000316377;ENST00000434523	.|T;T;T;T	.|0.80214	.|-1.35;-1.35;-1.35;-1.35	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);F-box domain, Skp2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90386|0.90386	0.6991|0.6991	M|M	0.80616|0.80616	2.505|2.505	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.81914	.|0.987;0.995	D|D	0.91390|0.91390	0.5134|0.5134	5|10	.|0.87932	.|D	.|0	-9.8728|-9.8728	19.1978|19.1978	0.93696|0.93696	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|147;723	.|B3KUR1;Q86XK2	.|.;FBX11_HUMAN	N|I	514|639;723;639;147	.|ENSP00000385398:R639I;ENSP00000384823:R723I;ENSP00000323822:R639I;ENSP00000397359:R147I	.|ENSP00000323822:R639I	K|R	-|-	3|2	2|0	FBXO11|FBXO11	47893936|47893936	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.776000|7.776000	0.85560|0.85560	2.597000|2.597000	0.87782|0.87782	0.655000|0.655000	0.94253|0.94253	AAG|AGA	.	.	.	none		0.343	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
FER1L5	90342	hgsc.bcm.edu	37	2	97361397	97361397	+	RNA	SNP	T	T	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr2:97361397T>C	ENST00000457909.1	+	0	3396							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GTCCTCACAGTGGTAAGAGGC	0.612																																					p.V1325A		Atlas-SNP	.											.	FER1L5	113	.	0			c.T3974C						PASS	.						25.0	29.0	28.0					2																	97361397		1923	4122	6045			90342	exon34			TCACAGTGGTAAG	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		chr2.hg19:g.97361397T>C		73.0	0.0	.		75.0	21.0	.	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	hg19		.	.	.	.	.	.	.	.	.	.	T	7.763	0.705846	0.15172	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	4.25	4.25	0.50352	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.46600	0.1401	L	0.55017	1.72	.	.	.	P;P	0.50819	0.939;0.72	P;B	0.45232	0.474;0.261	T	0.63879	-0.6537	7	0.59425	D	0.04	-6.2493	10.9692	0.47431	0.0:0.0:0.0:1.0	.	1325;43	A0AVI2;A0AVI2-2	FR1L5_HUMAN;.	A	1325;1339;43	.	ENSP00000442027:V43A	V	+	2	0	FER1L5	96725124	1.000000	0.71417	0.869000	0.34112	0.194000	0.23727	4.797000	0.62503	1.788000	0.52465	0.379000	0.24179	GTG	.	.	.	none		0.612	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
DBR1	51163	hgsc.bcm.edu	37	3	137889003	137889003	+	Silent	SNP	A	A	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr3:137889003A>G	ENST00000260803.4	-	4	588	c.435T>C	c.(433-435)tcT>tcC	p.S145S	DBR1_ENST00000505015.2_5'UTR|DBR1_ENST00000463982.2_5'Flank	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	145					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TCCTGATTGTAGATGAATTAT	0.294																																					p.S145S		Atlas-SNP	.											.	DBR1	45	.	0			c.T435C						PASS	.						67.0	77.0	73.0					3																	137889003		2203	4297	6500	SO:0001819	synonymous_variant	51163	exon4			GATTGTAGATGAA	AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.435T>C	chr3.hg19:g.137889003A>G		65.0	0.0	.		64.0	14.0	.	NM_016216	Q96GH0|Q9NXQ6	Silent	SNP	ENST00000260803.4	hg19	CCDS33863.1																																																																																			.	.	.	none		0.294	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357585.1		
MED12L	116931	hgsc.bcm.edu	37	3	151148131	151148131	+	Silent	SNP	G	G	A	rs568498781	byFrequency	TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr3:151148131G>A	ENST00000474524.1	+	42	6386	c.6348G>A	c.(6346-6348)acG>acA	p.T2116T	MED12L_ENST00000273432.4_Silent_p.T1780T	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2116	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGCAGCAGACGGCCGCCTTGG	0.527													g|||	4	0.000798722	0.0	0.0	5008	,	,		16791	0.0		0.0	False		,,,				2504	0.0041				p.T2116T		Atlas-SNP	.											.	MED12L	271	.	0			c.G6348A						PASS	.						53.0	54.0	54.0					3																	151148131		2203	4300	6503	SO:0001819	synonymous_variant	116931	exon42			GCAGACGGCCGCC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6348G>A	chr3.hg19:g.151148131G>A		106.0	0.0	.		102.0	29.0	.	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	hg19	CCDS33876.1																																																																																			.	.	.	none		0.527	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
CCNL1	57018	hgsc.bcm.edu	37	3	156870895	156870895	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr3:156870895T>C	ENST00000295926.3	-	4	657	c.539A>G	c.(538-540)cAa>cGa	p.Q180R	CCNL1_ENST00000479052.1_5'UTR|Y_RNA_ENST00000364908.1_RNA|CCNL1_ENST00000461804.1_Missense_Mutation_p.Q180R	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	180	Cyclin-like 1.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			TTTGATAACTTGATTTTTGGT	0.383																																					p.Q180R		Atlas-SNP	.											.	CCNL1	53	.	0			c.A539G						PASS	.						115.0	102.0	106.0					3																	156870895		2203	4300	6503	SO:0001583	missense	57018	exon4			ATAACTTGATTTT	AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.539A>G	chr3.hg19:g.156870895T>C	ENSP00000295926:p.Gln180Arg	144.0	0.0	.		139.0	32.0	.	NM_020307	B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Missense_Mutation	SNP	ENST00000295926.3	hg19	CCDS3178.1	.	.	.	.	.	.	.	.	.	.	T	19.69	3.875402	0.72180	.	.	ENSG00000163660	ENST00000461804;ENST00000295926	T;T	0.12039	2.72;2.72	5.9	5.9	0.94986	Cyclin, N-terminal (1);Cyclin-like (3);	0.050844	0.85682	D	0.000000	T	0.22475	0.0542	L	0.37897	1.145	0.80722	D	1	B;P;P	0.36837	0.171;0.571;0.571	B;P;B	0.48738	0.124;0.588;0.386	T	0.01146	-1.1437	10	0.49607	T	0.09	-23.0591	16.3232	0.82961	0.0:0.0:0.0:1.0	.	180;180;180	Q9UK58-4;Q9UK58;C9JPL0	.;CCNL1_HUMAN;.	R	180	ENSP00000420277:Q180R;ENSP00000295926:Q180R	ENSP00000295926:Q180R	Q	-	2	0	CCNL1	158353589	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.587000	0.82613	2.254000	0.74563	0.482000	0.46254	CAA	.	.	.	none		0.383	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351859.1	NM_020307	
VCAN	1462	hgsc.bcm.edu	37	5	82817377	82817377	+	Silent	SNP	T	T	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr5:82817377T>A	ENST00000265077.3	+	7	3817	c.3252T>A	c.(3250-3252)tcT>tcA	p.S1084S	VCAN_ENST00000342785.4_Silent_p.S1084S|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000512590.2_Silent_p.S1036S|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1084	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TGACAGGTTCTGAGAGGGTCC	0.453																																					p.S1084S		Atlas-SNP	.											.	VCAN	498	.	0			c.T3252A						PASS	.						84.0	78.0	80.0					5																	82817377		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon7			AGGTTCTGAGAGG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3252T>A	chr5.hg19:g.82817377T>A		85.0	0.0	.		69.0	19.0	.	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	hg19	CCDS4060.1																																																																																			.	.	.	none		0.453	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
ERAP1	51752	hgsc.bcm.edu	37	5	96126038	96126038	+	Silent	SNP	A	A	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr5:96126038A>G	ENST00000443439.2	-	10	1551	c.1485T>C	c.(1483-1485)gaT>gaC	p.D495D	ERAP1_ENST00000296754.3_Silent_p.D495D	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	495					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		AGCAAAAGCCATCCATCCCTT	0.353																																					p.D495D		Atlas-SNP	.											.	ERAP1	59	.	0			c.T1485C						PASS	.						131.0	126.0	128.0					5																	96126038		2203	4300	6503	SO:0001819	synonymous_variant	51752	exon10			AAAGCCATCCATC	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.1485T>C	chr5.hg19:g.96126038A>G		71.0	0.0	.		69.0	16.0	.	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Silent	SNP	ENST00000443439.2	hg19	CCDS47250.1																																																																																			.	.	.	none		0.353	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
UBE2J1	51465	hgsc.bcm.edu	37	6	90047953	90047953	+	Silent	SNP	A	A	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr6:90047953A>T	ENST00000435041.2	-	5	677	c.399T>A	c.(397-399)acT>acA	p.T133T		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	133					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		TTTCCTCAGGAGTGTAATCTA	0.388																																					p.T133T		Atlas-SNP	.											.	UBE2J1	28	.	0			c.T399A						PASS	.						133.0	134.0	134.0					6																	90047953		2203	4300	6503	SO:0001819	synonymous_variant	51465	exon5			CTCAGGAGTGTAA	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.399T>A	chr6.hg19:g.90047953A>T		170.0	0.0	.		138.0	25.0	.	NM_016021	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Silent	SNP	ENST00000435041.2	hg19	CCDS5021.1																																																																																			.	.	.	none		0.388	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
POMT1	10585	hgsc.bcm.edu	37	9	134379628	134379628	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr9:134379628C>T	ENST00000372228.3	+	2	202	c.23C>T	c.(22-24)cCt>cTt	p.P8L	POMT1_ENST00000354713.4_Missense_Mutation_p.P8L|POMT1_ENST00000341012.7_Intron|POMT1_ENST00000541219.1_Intron|POMT1_ENST00000404875.2_Intron|POMT1_ENST00000423007.1_Missense_Mutation_p.P8L|POMT1_ENST00000419118.2_Intron|POMT1_ENST00000402686.3_Missense_Mutation_p.P8L	NM_007171.3	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1	8					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|mannosylation (GO:0097502)|multicellular organismal development (GO:0007275)|protein O-linked glycosylation (GO:0006493)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannosyltransferase activity (GO:0000030)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	31		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		TTGAAGCGCCCTGTAGTGGTG	0.597											OREG0019563	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P8L		Atlas-SNP	.											.	POMT1	59	.	0			c.C23T						PASS	.						175.0	148.0	157.0					9																	134379628		2203	4300	6503	SO:0001583	missense	10585	exon2			AGCGCCCTGTAGT	AF095136	CCDS6943.1, CCDS43894.1, CCDS43895.1, CCDS48045.1	9q34.1	2014-09-17			ENSG00000130714	ENSG00000130714	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	9202	protein-coding gene	gene with protein product	"""dolichyl-phosphate-mannose-protein mannosyltransferase"""	607423				10366449	Standard	NM_001077366		Approved	LGMD2K	uc004cav.3	Q9Y6A1	OTTHUMG00000020826	ENST00000372228.3:c.23C>T	chr9.hg19:g.134379628C>T	ENSP00000361302:p.Pro8Leu	254.0	0.0	.	1610	253.0	64.0	.	NM_001136113	B3KQG0|B4DIF0|Q5JT01|Q5JT06|Q5JT08|Q8NC91|Q8TCA9|Q9NX32|Q9NX82|Q9UNT2	Missense_Mutation	SNP	ENST00000372228.3	hg19	CCDS6943.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051297	0.55218	.	.	ENSG00000130714	ENST00000423007;ENST00000372228;ENST00000402686;ENST00000354713;ENST00000418774	D;D;D;D;T	0.90197	-1.61;-1.6;-1.61;-2.63;-1.18	5.02	5.02	0.67125	.	0.057319	0.64402	D	0.000001	D	0.94742	0.8303	M	0.73217	2.22	0.80722	D	1	D;D;D;P	0.89917	0.957;1.0;1.0;0.956	P;D;D;P	0.87578	0.463;0.998;0.998;0.664	D	0.94435	0.7653	10	0.45353	T	0.12	-20.8968	17.3307	0.87262	0.0:1.0:0.0:0.0	.	8;8;8;8	B4DTW4;B4DWD8;Q9Y6A1;Q9Y6A1-2	.;.;POMT1_HUMAN;.	L	8	ENSP00000404119:P8L;ENSP00000361302:P8L;ENSP00000385797:P8L;ENSP00000346748:P8L;ENSP00000390737:P8L	ENSP00000346748:P8L	P	+	2	0	POMT1	133369449	1.000000	0.71417	0.336000	0.25522	0.137000	0.21094	6.556000	0.73932	2.317000	0.78254	0.655000	0.94253	CCT	.	.	.	none		0.597	POMT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054737.1	NM_007171	
SFMBT2	57713	hgsc.bcm.edu	37	10	7423824	7423824	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr10:7423824G>A	ENST00000361972.4	-	2	127	c.37C>T	c.(37-39)Cct>Tct	p.P13S	SFMBT2_ENST00000379713.3_Missense_Mutation_p.P13S|SFMBT2_ENST00000379711.2_Missense_Mutation_p.P13S|SFMBT2_ENST00000397167.1_Missense_Mutation_p.P13S|SFMBT2_ENST00000397160.3_Missense_Mutation_p.P13S	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	13					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GAAGATGAAGGGTCTTGCATA	0.413																																					p.P13S		Atlas-SNP	.											.	SFMBT2	209	.	0			c.C37T						PASS	.						125.0	119.0	121.0					10																	7423824		2203	4300	6503	SO:0001583	missense	57713	exon2			ATGAAGGGTCTTG	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.37C>T	chr10.hg19:g.7423824G>A	ENSP00000355109:p.Pro13Ser	78.0	0.0	.		54.0	11.0	.	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	hg19	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	G	7.150	0.583667	0.13749	.	.	ENSG00000198879	ENST00000361972;ENST00000397167;ENST00000379713;ENST00000379711;ENST00000397160	T;T;T;T;T	0.29917	2.62;2.62;1.95;1.55;1.55	4.82	-3.95	0.04118	.	0.531028	0.16003	N	0.234228	T	0.11110	0.0271	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.28490	-1.0042	10	0.09843	T	0.71	.	0.1011	0.00048	0.27:0.2475:0.2071:0.2754	.	13;13	Q5T981;Q5VUG0	.;SMBT2_HUMAN	S	13	ENSP00000355109:P13S;ENSP00000380353:P13S;ENSP00000369035:P13S;ENSP00000369033:P13S;ENSP00000380346:P13S	ENSP00000355109:P13S	P	-	1	0	SFMBT2	7463830	0.552000	0.26505	0.000000	0.03702	0.043000	0.13939	0.403000	0.20982	-0.397000	0.07691	-0.158000	0.13435	CCT	.	.	.	none		0.413	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
FZD8	8325	hgsc.bcm.edu	37	10	35928674	35928674	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr10:35928674C>G	ENST00000374694.1	-	1	1688	c.1684G>C	c.(1684-1686)Gag>Cag	p.E562Q	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	562					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						TGCGTGGCCTCCCAGCGCGGG	0.667																																					p.E562Q		Atlas-SNP	.											.	FZD8	41	.	0			c.G1684C						PASS	.						35.0	34.0	34.0					10																	35928674		2198	4297	6495	SO:0001583	missense	8325	exon1			TGGCCTCCCAGCG	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.1684G>C	chr10.hg19:g.35928674C>G	ENSP00000363826:p.Glu562Gln	36.0	0.0	.		37.0	6.0	.	NM_031866		Missense_Mutation	SNP	ENST00000374694.1	hg19	CCDS7192.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861563	0.71949	.	.	ENSG00000177283	ENST00000374694	D	0.81996	-1.56	3.25	3.25	0.37280	GPCR, family 2-like (1);	0.000000	0.64402	U	0.000001	D	0.90055	0.6894	M	0.81802	2.56	0.54753	D	0.999984	D	0.69078	0.997	D	0.70227	0.968	D	0.90388	0.4393	10	0.42905	T	0.14	.	14.6096	0.68507	0.0:1.0:0.0:0.0	.	562	Q9H461	FZD8_HUMAN	Q	562	ENSP00000363826:E562Q	ENSP00000363826:E562Q	E	-	1	0	FZD8	35968680	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.179000	0.77665	1.807000	0.52817	0.289000	0.19496	GAG	.	.	.	none		0.667	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866	
CAPRIN1	4076	hgsc.bcm.edu	37	11	34118208	34118208	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr11:34118208A>T	ENST00000341394.4	+	16	2077	c.1888A>T	c.(1888-1890)Aat>Tat	p.N630Y	CAPRIN1_ENST00000530820.1_Missense_Mutation_p.N630Y|CAPRIN1_ENST00000533657.1_3'UTR|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.N630Y|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.N630Y|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.N549Y	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	630					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				GGGCCCTGCCAATGGATTCAG	0.403																																					p.N630Y		Atlas-SNP	.											.	CAPRIN1	110	.	0			c.A1888T						PASS	.						53.0	60.0	58.0					11																	34118208		2202	4298	6500	SO:0001583	missense	4076	exon16			CCTGCCAATGGAT	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1888A>T	chr11.hg19:g.34118208A>T	ENSP00000340329:p.Asn630Tyr	124.0	0.0	.		118.0	31.0	.	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	hg19	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.669325	0.88348	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	5.91	5.91	0.95273	.	0.041083	0.85682	D	0.000000	T	0.57169	0.2035	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.51934	-0.8642	10	0.18276	T	0.48	-8.4317	16.3453	0.83126	1.0:0.0:0.0:0.0	.	630;630	Q14444;Q14444-2	CAPR1_HUMAN;.	Y	630;630;630;630;549	ENSP00000340329:N630Y;ENSP00000374296:N630Y;ENSP00000434150:N630Y;ENSP00000434204:N630Y;ENSP00000431581:N549Y	ENSP00000340329:N630Y	N	+	1	0	CAPRIN1	34074784	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.919000	0.92770	2.261000	0.74972	0.533000	0.62120	AAT	.	.	.	none		0.403	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
KRTAP5-11	440051	hgsc.bcm.edu	37	11	71293623	71293623	+	Silent	SNP	G	G	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr11:71293623G>A	ENST00000398530.1	-	1	298	c.261C>T	c.(259-261)tgC>tgT	p.C87C	KRTAP5-11_ENST00000526239.1_Intron|AP000867.1_ENST00000343767.3_Intron	NM_001005405.2	NP_001005405.1	Q6L8G4	KR511_HUMAN	keratin associated protein 5-11	87	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						agGGCTTACAGCAGTTGGACT	0.627																																					p.C87C		Atlas-SNP	.											.	KRTAP5-11	36	.	0			c.C261T						PASS	.						86.0	111.0	102.0					11																	71293623		2200	4293	6493	SO:0001819	synonymous_variant	440051	exon1			CTTACAGCAGTTG	AB126080	CCDS41685.1	11q13.4	2008-11-06			ENSG00000204571	ENSG00000204571		"""Keratin associated proteins"""	23606	protein-coding gene	gene with protein product						15144888	Standard	NM_001005405		Approved	KRTAP5.11, KRTAP5-6	uc001oqu.3	Q6L8G4	OTTHUMG00000057586	ENST00000398530.1:c.261C>T	chr11.hg19:g.71293623G>A		74.0	0.0	.		73.0	18.0	.	NM_001005405		Silent	SNP	ENST00000398530.1	hg19	CCDS41685.1																																																																																			.	.	.	none		0.627	KRTAP5-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127969.1	NM_001005405	
RBP5	83758	hgsc.bcm.edu	37	12	7276771	7276771	+	Splice_Site	SNP	C	C	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr12:7276771C>A	ENST00000266560.3	-	4	521		c.e4-1		C1RL-AS1_ENST00000535078.1_RNA|C1RL-AS1_ENST00000545775.1_RNA|C1RL-AS1_ENST00000541775.1_RNA	NM_031491.2	NP_113679.1	P29762	RABP1_HUMAN	retinol binding protein 5, cellular						multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoic acid binding (GO:0001972)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			autonomic_ganglia(1)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)	10					Alitretinoin(DB00523)|Tretinoin(DB00755)	CAGTCAGTTCCTGGGGAGAGA	0.577																																					.		Atlas-SNP	.											.	RBP5	20	.	0			c.355-1G>T						PASS	.						64.0	55.0	58.0					12																	7276771		2203	4300	6503	SO:0001630	splice_region_variant	83758	exon5			CAGTTCCTGGGGA	AY007436	CCDS8574.1	12p13.31	2013-03-01	2001-11-28		ENSG00000139194	ENSG00000139194		"""Fatty acid binding protein family"""	15847	protein-coding gene	gene with protein product		611866	"""retinol-binding protein 5, cellular"""			11274389	Standard	NM_031491		Approved	CRBPIII	uc001qsq.3	P82980	OTTHUMG00000168165	ENST00000266560.3:c.355-1G>T	chr12.hg19:g.7276771C>A		52.0	0.0	.		42.0	6.0	.	NM_031491	Q6IAY7|Q8WTV5	Splice_Site	SNP	ENST00000266560.3	hg19	CCDS8574.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115989	0.56505	.	.	ENSG00000139194	ENST00000266560	.	.	.	3.67	3.67	0.42095	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2006	0.59765	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RBP5	7168045	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	4.017000	0.57167	2.347000	0.79759	0.462000	0.41574	.	.	.	.	none		0.577	RBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398554.1	NM_031491	Intron
ARHGEF25	115557	hgsc.bcm.edu	37	12	58010621	58010621	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr12:58010621C>G	ENST00000286494.4	+	15	2147	c.1687C>G	c.(1687-1689)Cca>Gca	p.P563A	AC025165.8_ENST00000444467.1_RNA|AC025165.8_ENST00000610219.1_RNA|ARHGEF25_ENST00000477314.1_3'UTR|AC025165.8_ENST00000356672.3_RNA|ARHGEF25_ENST00000333972.7_Missense_Mutation_p.P602A|AC025165.8_ENST00000593846.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	563						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						CTCTCCAACTCCAAAAACCCC	0.527																																					p.P602A		Atlas-SNP	.											.	ARHGEF25	111	.	0			c.C1804G						PASS	.						104.0	117.0	112.0					12																	58010621		2203	4300	6503	SO:0001583	missense	115557	exon16			CCAACTCCAAAAA		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.1687C>G	chr12.hg19:g.58010621C>G	ENSP00000286494:p.Pro563Ala	130.0	0.0	.		127.0	32.0	.	NM_001111270	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Missense_Mutation	SNP	ENST00000286494.4	hg19	CCDS8947.1	.	.	.	.	.	.	.	.	.	.	c	7.924	0.739308	0.15642	.	.	ENSG00000240771	ENST00000333972;ENST00000286494	T;T	0.38560	1.13;1.17	4.83	2.96	0.34315	.	0.955133	0.08554	N	0.928584	T	0.30070	0.0753	L	0.27053	0.805	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.15870	0.014;0.004	T	0.23368	-1.0190	10	0.34782	T	0.22	.	7.799	0.29164	0.0:0.7392:0.1704:0.0904	.	602;563	F8W7Z4;Q86VW2	.;ARHGP_HUMAN	A	602;563	ENSP00000335560:P602A;ENSP00000286494:P563A	ENSP00000286494:P563A	P	+	1	0	ARHGEF25	56296888	0.002000	0.14202	0.001000	0.08648	0.647000	0.38526	1.605000	0.36815	0.724000	0.32296	0.563000	0.77884	CCA	.	.	.	none		0.527	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	
FLT1	2321	hgsc.bcm.edu	37	13	28942739	28942739	+	Intron	SNP	T	T	C	rs371573097|rs558386334	byFrequency	TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr13:28942739T>C	ENST00000282397.4	-	15	2368				FLT1_ENST00000541932.1_Silent_p.S726S	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1						blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	atgatgacgatgatgatgatg	0.343																																					p.S726S		Atlas-SNP	.											.	FLT1	393	.	0			c.A2178G						PASS	.						289.0	303.0	299.0					13																	28942739		692	1591	2283	SO:0001627	intron_variant	2321	exon15			TGACGATGATGAT	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2117-10917A>G	chr13.hg19:g.28942739T>C		65.0	0.0	.		75.0	4.0	.	NM_001160030	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	hg19	CCDS9330.1																																																																																			.	.	.	none		0.343	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
MYH7	4625	hgsc.bcm.edu	37	14	23888454	23888454	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr14:23888454T>C	ENST00000355349.3	-	29	4066	c.3904A>G	c.(3904-3906)Acc>Gcc	p.T1302A	MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1302					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTGCCTCGGGTCAGCTGGGAG	0.607																																					p.T1302A		Atlas-SNP	.											.	MYH7	349	.	0			c.A3904G						PASS	.						96.0	83.0	88.0					14																	23888454		2203	4300	6503	SO:0001583	missense	4625	exon29			CTCGGGTCAGCTG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.3904A>G	chr14.hg19:g.23888454T>C	ENSP00000347507:p.Thr1302Ala	52.0	0.0	.		61.0	14.0	.	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.881046	0.72294	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.78364	-1.17	4.99	4.99	0.66335	Myosin tail (1);	.	.	.	.	D	0.83746	0.5321	M	0.75264	2.295	0.51233	D	0.999918	B	0.29378	0.243	P	0.46685	0.524	D	0.84607	0.0676	9	0.72032	D	0.01	.	11.2964	0.49280	0.136:0.0:0.0:0.864	.	1302	P12883	MYH7_HUMAN	A	1302;1307	ENSP00000347507:T1302A	ENSP00000347507:T1302A	T	-	1	0	MYH7	22958294	0.946000	0.32159	1.000000	0.80357	0.997000	0.91878	1.564000	0.36375	2.104000	0.64026	0.533000	0.62120	ACC	.	.	.	none		0.607	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
PSEN1	5663	hgsc.bcm.edu	37	14	73678584	73678584	+	Missense_Mutation	SNP	C	C	G	rs376433615		TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr14:73678584C>G	ENST00000324501.5	+	10	1335	c.1063C>G	c.(1063-1065)Cct>Gct	p.P355A	PSEN1_ENST00000357710.4_Missense_Mutation_p.P351A|PSEN1_ENST00000394164.1_Missense_Mutation_p.P351A|PSEN1_ENST00000261970.3_Intron|PSEN1_ENST00000406768.1_Missense_Mutation_p.P263A|PSEN1_ENST00000344094.3_3'UTR|PSEN1_ENST00000557511.1_Intron	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	355	Required for interaction with CTNNB1.				activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TCGCTCTACACCTGAGTCACG	0.512																																					p.P355A		Atlas-SNP	.											.	PSEN1	38	.	0			c.C1063G						PASS	.						125.0	106.0	113.0					14																	73678584		2203	4300	6503	SO:0001583	missense	5663	exon10			TCTACACCTGAGT	AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.1063C>G	chr14.hg19:g.73678584C>G	ENSP00000326366:p.Pro355Ala	99.0	0.0	.		79.0	18.0	.	NM_000021	B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Missense_Mutation	SNP	ENST00000324501.5	hg19	CCDS9812.1	.	.	.	.	.	.	.	.	.	.	C	2.251	-0.371435	0.05034	.	.	ENSG00000080815	ENST00000324501;ENST00000357710;ENST00000394164;ENST00000406768	D;D;D;D	0.99507	-6.04;-6.04;-6.04;-6.04	6.07	-4.33	0.03677	.	0.587506	0.19956	N	0.102313	D	0.95227	0.8452	N	0.17082	0.46	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	D	0.93070	0.6482	10	0.09338	T	0.73	0.404	4.5188	0.11949	0.1006:0.3795:0.3539:0.166	.	351;355	P49768-2;P49768	.;PSN1_HUMAN	A	355;351;351;263	ENSP00000326366:P355A;ENSP00000350342:P351A;ENSP00000377719:P351A;ENSP00000385948:P263A	ENSP00000326366:P355A	P	+	1	0	PSEN1	72748337	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	-0.084000	0.11268	-1.337000	0.02236	-0.150000	0.13652	CCT	.	.	.	alt		0.512	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280500.2		
ASB2	51676	hgsc.bcm.edu	37	14	94413717	94413717	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr14:94413717C>T	ENST00000315988.4	-	5	1374	c.886G>A	c.(886-888)Gcc>Acc	p.A296T	MIR4506_ENST00000584693.1_RNA|ASB2_ENST00000555019.1_Missense_Mutation_p.A344T|ASB2_ENST00000556337.1_Intron	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	296					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		TTCTTGGAGGCGATGTGCAGC	0.632																																					p.A344T		Atlas-SNP	.											.	ASB2	71	.	0			c.G1030A						PASS	.						158.0	129.0	139.0					14																	94413717		2203	4300	6503	SO:0001583	missense	51676	exon7			TGGAGGCGATGTG	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.886G>A	chr14.hg19:g.94413717C>T	ENSP00000320675:p.Ala296Thr	96.0	0.0	.		96.0	20.0	.	NM_001202429	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	hg19	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	C	35	5.593233	0.96602	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;D;T	0.86956	-1.46;-2.19;-0.31	5.19	5.19	0.71726	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.95906	0.8667	H	0.96175	3.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.97286	0.9921	10	0.87932	D	0	-25.2568	18.7174	0.91680	0.0:1.0:0.0:0.0	.	312;344;296	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	T	344;312;296;242;242	ENSP00000451575:A344T;ENSP00000320675:A296T;ENSP00000450940:A242T	ENSP00000320675:A296T	A	-	1	0	ASB2	93483470	1.000000	0.71417	0.948000	0.38648	0.953000	0.61014	7.818000	0.86416	2.417000	0.82017	0.462000	0.41574	GCC	.	.	.	none		0.632	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
DNAJC17	55192	hgsc.bcm.edu	37	15	41066037	41066037	+	Splice_Site	SNP	T	T	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr15:41066037T>A	ENST00000220496.4	-	10	712		c.e10-2			NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		AGCCAGCTCCTGCCAAACACA	0.562																																					.		Atlas-SNP	.											.	DNAJC17	18	.	0			c.682-2A>T						PASS	.						32.0	28.0	29.0					15																	41066037		2203	4300	6503	SO:0001630	splice_region_variant	55192	exon11			AGCTCCTGCCAAA	AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.682-2A>T	chr15.hg19:g.41066037T>A		58.0	0.0	.		82.0	21.0	.	NM_018163		Splice_Site	SNP	ENST00000220496.4	hg19	CCDS10065.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.880172	0.72294	.	.	ENSG00000104129	ENST00000220496	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8314	0.70151	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAJC17	38853329	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.416000	0.73332	2.181000	0.69327	0.459000	0.35465	.	.	.	.	none		0.562	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252356.2	NM_018163	Intron
IMP3	55272	hgsc.bcm.edu	37	15	75931982	75931982	+	Silent	SNP	C	C	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr15:75931982C>T	ENST00000314852.2	-	2	1471	c.528G>A	c.(526-528)gaG>gaA	p.E176E	IMP3_ENST00000565349.1_5'Flank|CTD-2026K11.2_ENST00000564683.1_RNA|IMP3_ENST00000403490.1_Silent_p.E176E			Q8TCT8	SPP2A_HUMAN	IMP3, U3 small nucleolar ribonucleoprotein	0					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			large_intestine(1)	1						AGTCATCGCGCTCCTCATTGT	0.537																																					p.E176E		Atlas-SNP	.											IMP3,NS,carcinoma,0,1	IMP3	10	.	0			c.G528A						PASS	.						95.0	82.0	86.0					15																	75931982		2197	4294	6491	SO:0001819	synonymous_variant	55272	exon1			ATCGCGCTCCTCA	AB051628	CCDS10282.1	15q24	2014-02-19	2014-02-19	2005-07-14	ENSG00000177971	ENSG00000177971			14497	protein-coding gene	gene with protein product		612980	"""mitochondrial ribosomal protein S4"", ""chromosome 15 open reading frame 12"", ""IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""	MRPS4, C15orf12		11543634, 12655004	Standard	NM_018285		Approved	FLJ10968, BRMS2	uc010bkl.2	Q9NV31	OTTHUMG00000142840	ENST00000314852.2:c.528G>A	chr15.hg19:g.75931982C>T		49.0	0.0	.		73.0	15.0	.	NM_018285	B2RDS0|Q8TAW1|Q96SZ8	Silent	SNP	ENST00000314852.2	hg19	CCDS10282.1																																																																																			.	.	.	none		0.537	IMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286476.1	NM_018285	
WDR24	84219	hgsc.bcm.edu	37	16	739631	739631	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr16:739631T>C	ENST00000248142.6	-	3	195	c.196A>G	c.(196-198)Atg>Gtg	p.M66V	WDR24_ENST00000293883.4_Missense_Mutation_p.M4V|LA16c-313D11.12_ENST00000566927.1_RNA			Q96S15	WDR24_HUMAN	WD repeat domain 24	66										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				ACACGGGACATCTTCTCCATG	0.632																																					p.M4V		Atlas-SNP	.											.	WDR24	111	.	0			c.A10G						PASS	.						30.0	25.0	26.0					16																	739631		2199	4299	6498	SO:0001583	missense	84219	exon1			GGGACATCTTCTC	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.196A>G	chr16.hg19:g.739631T>C	ENSP00000248142:p.Met66Val	67.0	0.0	.		89.0	36.0	.	NM_032259	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	ENST00000248142.6	hg19		.	.	.	.	.	.	.	.	.	.	t	11.89	1.772343	0.31411	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.76578	-1.03;0.32	4.09	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.75459	0.3852	L	0.44542	1.39	0.40630	D	0.98184	B	0.34399	0.452	P	0.44623	0.455	T	0.72934	-0.4141	10	0.27785	T	0.31	1.7223	12.0317	0.53401	0.0:0.0:0.0:1.0	.	4	Q96S15-2	.	V	66;4	ENSP00000248142:M66V;ENSP00000293883:M4V	ENSP00000248142:M66V	M	-	1	0	WDR24	679632	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.157000	0.77461	1.715000	0.51383	0.459000	0.35465	ATG	.	.	.	none		0.632	WDR24-201	KNOWN	basic	protein_coding	protein_coding		NM_032259	
C16orf62	57020	hgsc.bcm.edu	37	16	19584527	19584527	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr16:19584527C>G	ENST00000251143.5	+	4	384	c.372C>G	c.(370-372)atC>atG	p.I124M	C16orf62_ENST00000538853.1_Missense_Mutation_p.I213M|C16orf62_ENST00000542263.1_Missense_Mutation_p.I213M|C16orf62_ENST00000417362.2_Missense_Mutation_p.I124M|C16orf62_ENST00000438132.3_Missense_Mutation_p.I213M			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	124						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						GGGGAGAAATCCTTGCCCGGT	0.448																																					p.I213M		Atlas-SNP	.											.	C16orf62	164	.	0			c.C639G						PASS	.						136.0	135.0	135.0					16																	19584527		2197	4300	6497	SO:0001583	missense	57020	exon4			AGAAATCCTTGCC		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.372C>G	chr16.hg19:g.19584527C>G	ENSP00000251143:p.Ile124Met	67.0	0.0	.		66.0	10.0	.	NM_020314	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	ENST00000251143.5	hg19		.	.	.	.	.	.	.	.	.	.	C	25.5	4.639579	0.87760	.	.	ENSG00000103544	ENST00000438132;ENST00000538853;ENST00000542263;ENST00000251143;ENST00000417362	T;T;T;T;T	0.64803	1.56;-0.12;1.56;1.56;1.56	5.32	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.79936	0.4532	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.91635	0.994;0.996;0.999	T	0.81512	-0.0899	10	0.48119	T	0.1	-26.3365	12.4816	0.55847	0.0:0.9197:0.0:0.0803	.	213;124;213	F5H7K1;Q7Z3J2;E7EWW0	.;CP062_HUMAN;.	M	213;213;213;124;124	ENSP00000400815:I213M;ENSP00000444363:I213M;ENSP00000442468:I213M;ENSP00000251143:I124M;ENSP00000395973:I124M	ENSP00000251143:I124M	I	+	3	3	C16orf62	19492028	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.813000	0.55636	2.488000	0.83962	0.557000	0.71058	ATC	.	.	.	none		0.448	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314	
LONP2	83752	hgsc.bcm.edu	37	16	48296782	48296782	+	Splice_Site	SNP	T	T	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr16:48296782T>C	ENST00000285737.4	+	6	1074	c.981T>C	c.(979-981)acT>acC	p.T327T	LONP2_ENST00000535754.1_Splice_Site_p.T283T	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						AAAGTACAACTGGTAAGCCAA	0.358																																					p.T327T		Atlas-SNP	.											.	LONP2	63	.	0			c.T981C						PASS	.						62.0	61.0	61.0					16																	48296782		2200	4299	6499	SO:0001630	splice_region_variant	83752	exon6			TACAACTGGTAAG	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.982+1T>C	chr16.hg19:g.48296782T>C		149.0	0.0	.		155.0	48.0	.	NM_031490		Silent	SNP	ENST00000285737.4	hg19	CCDS10734.1																																																																																			.	.	.	none		0.358	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	Silent
FA2H	79152	hgsc.bcm.edu	37	16	74808459	74808459	+	Silent	SNP	C	C	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr16:74808459C>A	ENST00000219368.3	-	1	264	c.195G>T	c.(193-195)ccG>ccT	p.P65P	FA2H_ENST00000544337.1_5'UTR	NM_024306.4	NP_077282.3	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	65	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				cell death (GO:0008219)|central nervous system myelin maintenance (GO:0032286)|fatty acid biosynthetic process (GO:0006633)|lipid modification (GO:0030258)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of cell proliferation (GO:0042127)|regulation of hair cycle (GO:0042634)|sebaceous gland cell differentiation (GO:0001949)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	fatty acid alpha-hydroxylase activity (GO:0080132)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						GCCTGTGCGGCGGCCCGTCCA	0.751																																					p.P65P		Atlas-SNP	.											.	FA2H	21	.	0			c.G195T						PASS	.						4.0	4.0	4.0					16																	74808459		1728	3475	5203	SO:0001819	synonymous_variant	79152	exon1			GTGCGGCGGCCCG	BC002679	CCDS10911.1	16q23	2013-03-04	2003-10-29	2003-10-31	ENSG00000103089	ENSG00000103089		"""Fatty acid hydroxylase domain containing"""	21197	protein-coding gene	gene with protein product	"""fatty acid hydroxylase"""	611026	"""fatty acid hydroxylase domain containing 1"", ""spastic paraplegia 35 (autosomal recessive)"""	FAXDC1, SPG35		20104589	Standard	NM_024306		Approved	FAAH, FLJ25287	uc002fde.2	Q7L5A8	OTTHUMG00000137603	ENST00000219368.3:c.195G>T	chr16.hg19:g.74808459C>A		30.0	0.0	.		17.0	6.0	.	NM_024306	B7Z8T6|O75213|Q96DK1|Q9H1A5	Silent	SNP	ENST00000219368.3	hg19	CCDS10911.1																																																																																			.	.	.	none		0.751	FA2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269015.2	NM_024306	
THRA	7067	hgsc.bcm.edu	37	17	38249559	38249559	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr17:38249559A>G	ENST00000264637.4	+	10	1977	c.1397A>G	c.(1396-1398)gAg>gGg	p.E466G	NR1D1_ENST00000246672.3_Intron|THRA_ENST00000584985.1_Missense_Mutation_p.E427G|THRA_ENST00000394121.4_Missense_Mutation_p.E466G	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	466					cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GACAGCAGTGAGGCGGACTCC	0.662																																					p.E466G		Atlas-SNP	.											.	THRA	88	.	0			c.A1397G						PASS	.						28.0	31.0	30.0					17																	38249559		2203	4300	6503	SO:0001583	missense	7067	exon10			GCAGTGAGGCGGA	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.1397A>G	chr17.hg19:g.38249559A>G	ENSP00000264637:p.Glu466Gly	82.0	0.0	.		102.0	44.0	.	NM_003250	A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	ENST00000264637.4	hg19	CCDS11360.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.952359	0.53293	.	.	ENSG00000126351	ENST00000394121;ENST00000264637	D;D	0.94280	-3.39;-3.39	4.73	3.66	0.41972	.	0.355296	0.21196	N	0.078543	D	0.84817	0.5556	N	0.14661	0.345	0.80722	D	1	P;P	0.37330	0.59;0.455	B;B	0.35607	0.206;0.102	D	0.84397	0.0558	10	0.51188	T	0.08	.	8.2837	0.31915	0.9049:0.0:0.0951:0.0	.	427;466	P10827-3;P10827	.;THA_HUMAN	G	466	ENSP00000377679:E466G;ENSP00000264637:E466G	ENSP00000264637:E466G	E	+	2	0	THRA	35503085	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.912000	0.39946	2.117000	0.64856	0.460000	0.39030	GAG	.	.	.	none		0.662	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257160.2		
KANSL1	284058	hgsc.bcm.edu	37	17	44116537	44116537	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr17:44116537G>A	ENST00000262419.6	-	9	2718	c.2248C>T	c.(2248-2250)Cac>Tac	p.H750Y	KANSL1_ENST00000575318.1_Intron|KANSL1_ENST00000574590.1_Missense_Mutation_p.H750Y|KANSL1_ENST00000572904.1_Missense_Mutation_p.H750Y|KANSL1_ENST00000393476.3_Intron|KANSL1_ENST00000432791.1_Missense_Mutation_p.H750Y	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	750					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TCGTCTAAGTGCTGCCTGTGG	0.547																																					p.H750Y		Atlas-SNP	.											.	.	.	.	0			c.C2248T						PASS	.						103.0	94.0	97.0					17																	44116537		2203	4300	6503	SO:0001583	missense	284058	exon9			CTAAGTGCTGCCT	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2248C>T	chr17.hg19:g.44116537G>A	ENSP00000262419:p.His750Tyr	156.0	0.0	.		199.0	34.0	.	NM_001193466	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	hg19	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	G	3.887	-0.024870	0.07589	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.11821	2.74;2.74	5.8	4.83	0.62350	.	0.526646	0.20277	N	0.095526	T	0.05135	0.0137	N	0.08118	0	0.80722	D	1	B;P;P	0.35982	0.255;0.531;0.531	B;B;B	0.28849	0.095;0.065;0.065	T	0.25187	-1.0139	10	0.02654	T	1	-5.0476	11.2703	0.49136	0.0838:0.0:0.9162:0.0	.	81;750;750	Q7Z3B3-2;C9JHY2;Q7Z3B3	.;.;K1267_HUMAN	Y	750	ENSP00000262419:H750Y;ENSP00000387393:H750Y	ENSP00000262419:H750Y	H	-	1	0	KIAA1267	41472384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.235000	0.51328	2.758000	0.94735	0.561000	0.74099	CAC	.	.	.	none		0.547	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
CBX1	10951	hgsc.bcm.edu	37	17	46154301	46154301	+	Silent	SNP	C	C	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr17:46154301C>T	ENST00000393408.3	-	2	546	c.66G>A	c.(64-66)gtG>gtA	p.V22V	CBX1_ENST00000225603.4_Silent_p.V22V|CBX1_ENST00000495350.1_Silent_p.V22V	NM_006807.4	NP_006798.1	P83916	CBX1_HUMAN	chromobox homolog 1	22	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				negative regulation of transcription, DNA-templated (GO:0045892)	chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|pericentric heterochromatin (GO:0005721)|spindle (GO:0005819)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)			breast(1)|central_nervous_system(1)|kidney(1)|prostate(1)	4						CTTTTTCCACCACATATTCCT	0.473																																					p.V22V	NSCLC(136;694 2497 38792 39034)	Atlas-SNP	.											.	CBX1	18	.	0			c.G66A						PASS	.						314.0	258.0	277.0					17																	46154301		2203	4300	6503	SO:0001819	synonymous_variant	10951	exon2			TTCCACCACATAT	U35451	CCDS11525.1	17q21.32	2010-07-06	2010-06-24		ENSG00000108468	ENSG00000108468			1551	protein-coding gene	gene with protein product	"""HP1 beta homolog (Drosophila )"""	604511	"""chromobox homolog 1 (Drosophila HP1 beta)"""			9169582	Standard	NM_001127228		Approved	HP1Hs-beta, M31, MOD1, CBX, HP1-BETA	uc002ind.4	P83916	OTTHUMG00000150417	ENST00000393408.3:c.66G>A	chr17.hg19:g.46154301C>T		269.0	0.0	.		305.0	19.0	.	NM_006807	P23197	Silent	SNP	ENST00000393408.3	hg19	CCDS11525.1																																																																																			.	.	.	none		0.473	CBX1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318016.1	NM_006807	
MRPL38	64978	hgsc.bcm.edu	37	17	73897871	73897871	+	Silent	SNP	G	G	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr17:73897871G>T	ENST00000309352.3	-	4	1050	c.513C>A	c.(511-513)gtC>gtA	p.V171V	MRPL38_ENST00000409963.3_5'UTR|MRPL38_ENST00000585475.1_5'UTR|RP11-552F3.10_ENST00000587267.1_RNA	NM_032478.3	NP_115867.2	Q96DV4	RM38_HUMAN	mitochondrial ribosomal protein L38	171						mitochondrion (GO:0005739)|ribosome (GO:0005840)				ovary(1)|pancreas(1)|prostate(2)|skin(1)	5			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGTGCAGGGGGACTCGGGGCA	0.602																																					p.V171V		Atlas-SNP	.											.	MRPL38	26	.	0			c.C513A						PASS	.						87.0	66.0	73.0					17																	73897871		2203	4300	6503	SO:0001819	synonymous_variant	64978	exon4			CAGGGGGACTCGG	AB051345	CCDS11733.2	17q23-q25	2012-09-13			ENSG00000204316	ENSG00000204316		"""Mitochondrial ribosomal proteins / large subunits"""	14033	protein-coding gene	gene with protein product		611844				11543634	Standard	NM_032478		Approved	RPML3, MRP-L3, HSPC262, MGC4810	uc010wso.1	Q96DV4	OTTHUMG00000152977	ENST00000309352.3:c.513C>A	chr17.hg19:g.73897871G>T		59.0	0.0	.		71.0	32.0	.	NM_032478	B3KN96|Q96Q66|Q9P0B9	Silent	SNP	ENST00000309352.3	hg19	CCDS11733.2																																																																																			.	.	.	none		0.602	MRPL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328829.1	NM_032478	
MIDN	90007	hgsc.bcm.edu	37	19	1255541	1255541	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr19:1255541C>T	ENST00000591446.2	+	6	1386	c.977C>T	c.(976-978)tCg>tTg	p.S326L	MIDN_ENST00000300952.2_Missense_Mutation_p.S326L			Q504T8	MIDN_HUMAN	midnolin	326						cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGCCCCCTTCGCTGGCCCAG	0.716																																					p.S326L		Atlas-SNP	.											.	MIDN	34	.	0			c.C977T						PASS	.						30.0	27.0	28.0					19																	1255541		2199	4296	6495	SO:0001583	missense	90007	exon7			CCCCTTCGCTGGC	AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.977C>T	chr19.hg19:g.1255541C>T	ENSP00000467679:p.Ser326Leu	60.0	0.0	.		54.0	20.0	.	NM_177401	Q96BW8	Missense_Mutation	SNP	ENST00000591446.2	hg19	CCDS32864.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.080268	0.55753	.	.	ENSG00000167470	ENST00000300952	.	.	.	3.5	3.5	0.40072	.	0.000000	0.85682	D	0.000000	T	0.56630	0.1998	M	0.66939	2.045	0.48830	D	0.999716	B	0.23650	0.089	B	0.18871	0.023	T	0.61584	-0.7033	9	0.72032	D	0.01	-14.4784	8.6818	0.34214	0.0:0.8835:0.0:0.1165	.	326	Q504T8	MIDN_HUMAN	L	326	.	ENSP00000300952:S326L	S	+	2	0	MIDN	1206541	0.984000	0.35163	0.976000	0.42696	0.958000	0.62258	2.814000	0.48010	1.785000	0.52413	0.462000	0.41574	TCG	.	.	.	none		0.716	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449965.2		
MEF2B	100271849	hgsc.bcm.edu	37	19	19257425	19257425	+	Silent	SNP	G	G	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr19:19257425G>A	ENST00000602424.2	-	9	1434	c.708C>T	c.(706-708)tgC>tgT	p.C236C	MEF2BNB-MEF2B_ENST00000444486.3_Silent_p.C236C|MEF2BNB-MEF2B_ENST00000514819.3_Silent_p.C253C|MEF2B_ENST00000409224.1_Silent_p.C239C|MEF2B_ENST00000409447.2_Missense_Mutation_p.L192F|MEF2BNB-MEF2B_ENST00000602276.1_5'Flank|MEF2B_ENST00000410050.1_Silent_p.C236C|MEF2B_ENST00000162023.5_Silent_p.C236C|MEF2B_ENST00000424583.2_Silent_p.C236C	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	236					muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			TTGCAGTGGAGCAGGGGTTCT	0.667																																					p.C236C		Atlas-SNP	.											.	MEF2BNB-MEF2B	29	.	0			c.C708T						PASS	.						28.0	31.0	30.0					19																	19257425		2200	4297	6497	SO:0001819	synonymous_variant	4207	exon9			AGTGGAGCAGGGG	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.708C>T	chr19.hg19:g.19257425G>A		48.0	0.0	.		40.0	12.0	.	NM_005919	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Silent	SNP	ENST00000602424.2	hg19	CCDS12394.1	.	.	.	.	.	.	.	.	.	.	G	8.757	0.922660	0.18056	.	.	ENSG00000213999	ENST00000409447	.	.	.	4.49	2.35	0.29111	.	.	.	.	.	T	0.16769	0.0403	.	.	.	0.22591	N	0.998958	P	0.44578	0.838	B	0.30029	0.11	T	0.13980	-1.0489	7	0.62326	D	0.03	-6.4313	5.9893	0.19452	0.2352:0.0:0.7648:0.0	.	239	B8ZZJ5	.	F	239	.	ENSP00000386784:L239F	L	-	1	0	MEF2B	19118425	0.007000	0.16637	0.025000	0.17156	0.115000	0.19883	0.405000	0.21015	0.891000	0.36235	0.561000	0.74099	CTC	.	.	.	none		0.667	MEF2B-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_005919	
HSPB6	126393	hgsc.bcm.edu	37	19	36250862	36250862	+	5'Flank	SNP	T	T	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr19:36250862T>C	ENST00000592984.1	-	0	0				HSPB6_ENST00000587965.1_5'Flank|C19orf55_ENST00000536950.1_Missense_Mutation_p.L94P|C19orf55_ENST00000396908.4_Missense_Mutation_p.L94P|C19orf55_ENST00000537459.1_Missense_Mutation_p.L94P|HSPB6_ENST00000004982.3_5'Flank|C19orf55_ENST00000544099.1_Missense_Mutation_p.L94P|C19orf55_ENST00000421853.2_Intron			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCACCCACCCTGATTGACAGC	0.602																																					p.L94P		Atlas-SNP	.											.	C19orf55	39	.	0			c.T281C						PASS	.						25.0	27.0	26.0					19																	36250862		1954	4128	6082	SO:0001631	upstream_gene_variant	148137	exon3			CCACCCTGATTGA	AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		chr19.hg19:g.36250862T>C	Exception_encountered	75.0	0.0	.		49.0	6.0	.	NM_001039887	O14551|Q6NVI3|Q96MG9	Missense_Mutation	SNP	ENST00000592984.1	hg19	CCDS12475.1	.	.	.	.	.	.	.	.	.	.	T	3.312	-0.140508	0.06669	.	.	ENSG00000167595	ENST00000444637;ENST00000396908;ENST00000301165;ENST00000537459;ENST00000545674	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	3.65	1.5	0.22942	.	0.723756	0.10666	N	0.648169	T	0.38931	0.1059	L	0.55481	1.735	0.19945	N	0.999942	B;B;B	0.17667	0.008;0.023;0.023	B;B;B	0.17098	0.007;0.017;0.017	T	0.32981	-0.9886	10	0.39692	T	0.17	-2.0221	4.561	0.12160	0.0:0.324:0.0:0.676	.	94;94;94	E5RFB9;Q2NL68-3;Q2NL68-4	.;.;.	P	9;94;94;9;9	ENSP00000394231:L9P;ENSP00000380116:L94P;ENSP00000301165:L94P;ENSP00000440357:L9P	ENSP00000301165:L94P	L	+	2	0	C19orf55	40942702	0.002000	0.14202	0.003000	0.11579	0.045000	0.14185	1.163000	0.31798	0.284000	0.22305	0.383000	0.25322	CTG	.	.	.	none		0.602	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109498.3	NM_144617	
ZNF780A	284323	hgsc.bcm.edu	37	19	40589098	40589098	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr19:40589098T>A	ENST00000595687.2	-	4	265	c.56A>T	c.(55-57)gAg>gTg	p.E19V	AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000340963.5_Missense_Mutation_p.E19V|ZNF780A_ENST00000594395.1_Missense_Mutation_p.E19V|ZNF780A_ENST00000455521.1_Missense_Mutation_p.E19V|ZNF780A_ENST00000450241.2_5'UTR|ZNF780A_ENST00000414720.2_Missense_Mutation_p.E35V	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	19	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GCACTCCCACTCCTCCTGAGA	0.478																																					p.E35V		Atlas-SNP	.											.	ZNF780A	156	.	0			c.A104T						PASS	.						127.0	115.0	119.0					19																	40589098		2203	4297	6500	SO:0001583	missense	284323	exon5			TCCCACTCCTCCT	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.56A>T	chr19.hg19:g.40589098T>A	ENSP00000472189:p.Glu19Val	115.0	0.0	.		87.0	28.0	.	NM_001142579	E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	hg19	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410399	0.83340	.	.	ENSG00000197782	ENST00000443072;ENST00000450241;ENST00000414720;ENST00000455521;ENST00000340963	T;T;T	0.12361	2.69;2.69;2.69	1.65	1.65	0.23941	Krueppel-associated box (4);	.	.	.	.	T	0.54431	0.1858	H	0.99815	4.805	0.28205	N	0.927167	D;P;D	0.89917	0.975;0.789;1.0	D;B;D	0.91635	0.987;0.33;0.999	T	0.52290	-0.8595	9	0.87932	D	0	.	6.9604	0.24593	0.0:0.0:0.0:1.0	.	19;19;35	E9PB48;O75290;O75290-2	.;Z780A_HUMAN;.	V	19;19;35;19;19	ENSP00000416294:E35V;ENSP00000400997:E19V;ENSP00000341507:E19V	ENSP00000341507:E19V	E	-	2	0	ZNF780A	45280938	0.947000	0.32204	0.894000	0.35097	0.973000	0.67179	1.929000	0.40114	0.749000	0.32854	0.254000	0.18369	GAG	.	.	.	none		0.478	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880	
RUNX1	861	hgsc.bcm.edu	37	21	36206708	36206708	+	Splice_Site	SNP	C	C	T			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr21:36206708C>T	ENST00000344691.4	-	4	2300	c.723G>A	c.(721-723)caG>caA	p.Q241Q	RUNX1_ENST00000437180.1_Splice_Site_p.Q268Q|RUNX1_ENST00000399240.1_Intron|RUNX1_ENST00000358356.5_Splice_Site_p.Q241Q|RUNX1_ENST00000325074.5_Splice_Site_p.Q256Q|RUNX1_ENST00000300305.3_Splice_Site_p.Q268Q	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	241	Pro/Ser/Thr-rich.	Breakpoint for translocation to form AML1-EAP in T-MDS and CML and to form type II MACROD1-RUNX1 fusion protein.			behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						GGTACTTACCCTGCATCTGAC	0.637			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																p.Q268Q		Atlas-SNP	.		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	.	RUNX1	687	.	0			c.G804A						PASS	.						93.0	90.0	91.0					21																	36206708		2203	4300	6503	SO:0001630	splice_region_variant	861	exon7			CTTACCCTGCATC	X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.724+1G>A	chr21.hg19:g.36206708C>T		42.0	0.0	.		33.0	7.0	.	NM_001754	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Silent	SNP	ENST00000344691.4	hg19	CCDS42922.1																																																																																			.	.	.	none		0.637	RUNX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194230.1		Silent
SEPT5	5413	hgsc.bcm.edu	37	22	19709805	19709805	+	Silent	SNP	G	G	A			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr22:19709805G>A	ENST00000455784.2	+	11	1121	c.996G>A	c.(994-996)ctG>ctA	p.L332L	SEPT5_ENST00000383045.3_Silent_p.L341L|GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000406395.1_Missense_Mutation_p.A329T|SEPT5_ENST00000438754.2_Missense_Mutation_p.A338T	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	332					cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					TCCCGATCCTGCCGCTGCCCA	0.711																																					p.A338T		Atlas-SNP	.											.	SEPT5	32	.	0			c.G1012A						PASS	.						14.0	19.0	18.0					22																	19709805		2175	4265	6440	SO:0001819	synonymous_variant	5413	exon10			GATCCTGCCGCTG	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.996G>A	chr22.hg19:g.19709805G>A		115.0	0.0	.		81.0	24.0	.	NM_001009939	O15251|Q96MY5	Missense_Mutation	SNP	ENST00000455784.2	hg19	CCDS13764.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705363	0.48412	.	.	ENSG00000184702	ENST00000406395;ENST00000438754	T;T	0.55052	0.54;0.54	3.79	-0.381	0.12485	.	.	.	.	.	T	0.47451	0.1446	.	.	.	0.22226	N	0.999276	.	.	.	.	.	.	T	0.47328	-0.9126	6	0.87932	D	0	.	5.5224	0.16939	0.2298:0.1586:0.6116:0.0	.	.	.	.	T	329;338	ENSP00000384535:A329T;ENSP00000394541:A338T	ENSP00000384535:A329T	A	+	1	0	SEPT5	18089805	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	2.131000	0.42074	-0.176000	0.10707	0.297000	0.19635	GCC	.	.	.	none		0.711	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24381466	24381466	+	IGR	SNP	G	G	C			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chrX:24381466G>C								AC004552.1 (14443 upstream) : PDK3 (101871 downstream)																							GCTTCAGCTTGAGAGCCAGCT	0.478																																					p.E197Q		Atlas-SNP	.											.	.	.	.	0			c.G589C						PASS	.						149.0	126.0	133.0					X																	24381466		1568	3582	5150	SO:0001628	intergenic_variant	100130302	exon1			CAGCTTGAGAGCC																													chrX.hg19:g.24381466G>C		272.0	1.0	.		239.0	120.0	.	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.478								
BRCC3	79184	hgsc.bcm.edu	37	X	154299852	154299852	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chrX:154299852A>G	ENST00000369462.1	+	1	75	c.50A>G	c.(49-51)gAc>gGc	p.D17G	BRCC3_ENST00000399042.1_Missense_Mutation_p.D17G|CMC4_ENST00000369484.3_5'Flank|MTCP1_ENST00000369476.3_5'Flank|MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000369459.2_Missense_Mutation_p.D17G|BRCC3_ENST00000330045.7_Missense_Mutation_p.D17G|BRCC3_ENST00000340647.4_Missense_Mutation_p.D17G|MTCP1_ENST00000482244.1_5'Flank	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	17	MPN.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTCGAGTCTGACGCTTTCCTC	0.597																																					p.D17G		Atlas-SNP	.											.	BRCC3	44	.	0			c.A50G						PASS	.						50.0	68.0	62.0					X																	154299852		2130	4207	6337	SO:0001583	missense	79184	exon1			AGTCTGACGCTTT	X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.50A>G	chrX.hg19:g.154299852A>G	ENSP00000358474:p.Asp17Gly	57.0	0.0	.		43.0	25.0	.	NM_024332	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Missense_Mutation	SNP	ENST00000369462.1	hg19	CCDS56611.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334459	0.81801	.	.	ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000411985;ENST00000399042;ENST00000457026	T;T;T;T;T;T	0.64085	-0.08;0.4;0.4;0.4;0.4;0.4	3.96	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.74329	0.3702	M	0.80616	2.505	0.80722	D	1	D;D;D	0.63046	0.992;0.992;0.991	P;P;P	0.61592	0.891;0.891;0.881	T	0.76255	-0.3026	10	0.56958	D	0.05	-11.2441	8.8139	0.34985	1.0:0.0:0.0:0.0	.	17;17;17	P46736-3;P46736-2;P46736	.;.;BRCC3_HUMAN	G	17	ENSP00000344103:D17G;ENSP00000328641:D17G;ENSP00000358471:D17G;ENSP00000358474:D17G;ENSP00000413170:D17G;ENSP00000381998:D17G	ENSP00000328641:D17G	D	+	2	0	BRCC3	153953046	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	8.070000	0.89493	1.531000	0.49152	0.417000	0.27973	GAC	.	.	.	none		0.597	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058788.4	NM_024332	
NIPBL	25836	hgsc.bcm.edu	37	5	37020651	37020652	+	Frame_Shift_Del	DEL	TC	TC	-	rs139819353		TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr5:37020651_37020652delTC	ENST00000282516.8	+	26	5600_5601	c.5101_5102delTC	c.(5101-5103)tctfs	p.S1701fs	NIPBL_ENST00000448238.2_Frame_Shift_Del_p.S1701fs	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1701					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGAAGAATCATCTGAAGGAACA	0.361																																					p.1700_1701del		Atlas-Indel,Pindel	.											.	NIPBL	513	.	0			c.5100_5101del						PASS	.																																			SO:0001589	frameshift_variant	25836	exon26			.	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5101_5102delTC	chr5.hg19:g.37020651_37020652delTC	ENSP00000282516:p.Ser1701fs	202.0	0.0	0		194.0	44.0	0.226804	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Del	DEL	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.	.	none		0.361	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
MKI67	4288	hgsc.bcm.edu	37	10	129904689	129904689	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr10:129904689delT	ENST00000368654.3	-	13	5790	c.5415delA	c.(5413-5415)aaafs	p.K1805fs	MKI67_ENST00000368653.3_Frame_Shift_Del_p.K1445fs	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1805	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GCTGGTCCAGTTTCTGCACTG	0.493																																					p.L1806fs		Atlas-Indel,Pindel	.											.	MKI67	363	.	0			c.5416delC						PASS	.						170.0	163.0	165.0					10																	129904689		2203	4300	6503	SO:0001589	frameshift_variant	4288	exon13			.	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.5415delA	chr10.hg19:g.129904689delT	ENSP00000357643:p.Lys1805fs	381.0	0.0	0		349.0	81.0	0.232092	NM_002417	Q5VWH2	Frame_Shift_Del	DEL	ENST00000368654.3	hg19	CCDS7659.1																																																																																			.	.	.	none		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
TM7SF2	7108	hgsc.bcm.edu	37	11	64882832	64882832	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr11:64882832delT	ENST00000279263.7	+	8	1101	c.939delT	c.(937-939)actfs	p.T313fs	TM7SF2_ENST00000540748.1_Frame_Shift_Del_p.T197fs|TM7SF2_ENST00000345348.5_Intron|AP003068.12_ENST00000527789.1_RNA	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	313					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						AGAAAAACACTTTCCGAAAGA	0.567																																					p.T313fs		Atlas-Indel,Pindel	.											.	TM7SF2	30	.	0			c.938delC						PASS	.						128.0	129.0	129.0					11																	64882832		1910	4124	6034	SO:0001589	frameshift_variant	7108	exon8			.	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.939delT	chr11.hg19:g.64882832delT	ENSP00000279263:p.Thr313fs	101.0	0.0	0		89.0	23.0	0.258427	NM_003273	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Frame_Shift_Del	DEL	ENST00000279263.7	hg19	CCDS41669.1																																																																																			.	.	.	none		0.567	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
ZNF226	7769	hgsc.bcm.edu	37	19	44681813	44681816	+	Frame_Shift_Del	DEL	AAAT	AAAT	-			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	AAAT	AAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr19:44681813_44681816delAAAT	ENST00000590089.1	+	7	2765_2768	c.2398_2401delAAAT	c.(2398-2403)aaatctfs	p.KS800fs	ZNF226_ENST00000454662.2_Frame_Shift_Del_p.KS800fs|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000337433.5_Frame_Shift_Del_p.KS800fs			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	800					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				ACAGGAAAAAAAATCTATAAAATG	0.382																																					p.799_800del	Pancreas(115;581 1665 13228 19278 50070)	Atlas-Indel,Pindel	.											ZNF234_ENST00000454662,colon,carcinoma,0,1	.	.	.	0			c.2397_2400del						PASS	.																																			SO:0001589	frameshift_variant	7769	exon6			.	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.2398_2401delAAAT	chr19.hg19:g.44681813_44681816delAAAT	ENSP00000465121:p.Lys800fs	85.0	0.0	0		77.0	13.0	0.168831	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	Frame_Shift_Del	DEL	ENST00000590089.1	hg19	CCDS46102.1																																																																																			.	.	.	none		0.382	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
AARS2	57505	hgsc.bcm.edu	37	6	44278164	44278164	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr6:44278164delG	ENST00000244571.4	-	5	768	c.766delC	c.(766-768)ctgfs	p.L256fs	RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGGGGCTGCAGGCTTCCATCT	0.592																																					p.L256fs		Pindel	.											.	AARS2	77	.	0			c.767delT						PASS	.						84.0	71.0	76.0					6																	44278164		2203	4300	6503	SO:0001589	frameshift_variant	57505	exon5			.	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.766delC	chr6.hg19:g.44278164delG	ENSP00000244571:p.Leu256fs	53.0	0.0	.		56.0	10.0	0.179	NM_020745		Frame_Shift_Del	DEL	ENST00000244571.4	hg19	CCDS34464.1																																																																																			.	.	.	none		0.592	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
RANBP6	26953	hgsc.bcm.edu	37	9	6013047	6013047	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83V-01A-11D-A34Z-10	TCGA-IA-A83V-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3f9166f6-9ec6-4026-b8b0-23be6e2c7cdd	d632f44e-8673-43b1-9b56-519cdbbd3008	g.chr9:6013047delA	ENST00000259569.5	-	1	2571	c.2561delT	c.(2560-2562)ttgfs	p.L854fs	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	854					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		TAATGAGTGCAAAATATCTGA	0.333																																					p.L854fs		Pindel	.											.	RANBP6	127	.	0			c.2562delG						PASS	.						63.0	64.0	63.0					9																	6013047		2203	4300	6503	SO:0001589	frameshift_variant	26953	exon1			.	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2561delT	chr9.hg19:g.6013047delA	ENSP00000259569:p.Leu854fs	141.0	0.0	.		115.0	24.0	0.209	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Frame_Shift_Del	DEL	ENST00000259569.5	hg19	CCDS6467.1																																																																																			.	.	.	none		0.333	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
