#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VPS13D	55187	hgsc.bcm.edu	37	1	12567023	12567023	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr1:12567023A>G	ENST00000358136.3	+	69	13041	c.12911A>G	c.(12910-12912)tAc>tGc	p.Y4304C	VPS13D_ENST00000543766.1_Missense_Mutation_p.Y302C|VPS13D_ENST00000356315.4_Missense_Mutation_p.Y4279C|VPS13D_ENST00000471923.1_5'UTR|VPS13D_ENST00000496628.1_3'UTR|VPS13D_ENST00000543710.1_Missense_Mutation_p.Y108C|SNORA59A_ENST00000459326.1_RNA	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GAAGTCAAATACGATGACCTC	0.498																																					p.Y4304C		Atlas-SNP	.											.	VPS13D	316	.	0			c.A12911G						PASS	.						135.0	127.0	129.0					1																	12567023		2203	4300	6503	SO:0001583	missense	55187	exon69			TCAAATACGATGA	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.12911A>G	chr1.hg19:g.12567023A>G	ENSP00000350854:p.Tyr4304Cys	70.0	0.0	.		85.0	18.0	.	NM_015378		Missense_Mutation	SNP	ENST00000358136.3	hg19	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.479843|4.479843	0.84747|0.84747	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136;ENST00000543766;ENST00000543710	.|T;T;T	.|0.77750	.|0.54;0.53;-1.12	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85106|0.85106	0.5621|0.5621	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;0.998	.|D;D;D	.|0.74348	.|0.976;0.983;0.962	D|D	0.86187|0.86187	0.1610|0.1610	5|10	.|0.66056	.|D	.|0.02	.|.	16.2879|16.2879	0.82732|0.82732	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|302;4279;4303	.|F5GX56;Q5THJ4-2;Q5THJ4	.|.;.;VP13D_HUMAN	A|C	3126|4279;4304;302;108	.|ENSP00000348666:Y4279C;ENSP00000350854:Y4304C;ENSP00000441122:Y302C	.|ENSP00000348666:Y4279C	T|Y	+|+	1|2	0|0	VPS13D|VPS13D	12489610|12489610	1.000000|1.000000	0.71417|0.71417	0.754000|0.754000	0.31244|0.31244	0.978000|0.978000	0.69477|0.69477	8.882000|8.882000	0.92420|0.92420	2.242000|2.242000	0.73789|0.73789	0.533000|0.533000	0.62120|0.62120	ACG|TAC	.	.	.	none		0.498	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
COL11A1	1301	hgsc.bcm.edu	37	1	103471851	103471851	+	Silent	SNP	A	A	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr1:103471851A>G	ENST00000370096.3	-	16	2016	c.1704T>C	c.(1702-1704)ggT>ggC	p.G568G	COL11A1_ENST00000461720.1_5'UTR|COL11A1_ENST00000512756.1_Silent_p.G452G|COL11A1_ENST00000353414.4_Silent_p.G529G|COL11A1_ENST00000358392.2_Silent_p.G580G	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	568	Collagen-like 2.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GACCAGGGGGACCCTGGACGC	0.378																																					p.G580G		Atlas-SNP	.											.	COL11A1	972	.	0			c.T1740C						PASS	.						47.0	54.0	52.0					1																	103471851		2203	4300	6503	SO:0001819	synonymous_variant	1301	exon16			AGGGGGACCCTGG	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1704T>C	chr1.hg19:g.103471851A>G		163.0	0.0	.		174.0	7.0	.	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	hg19	CCDS778.1																																																																																			.	.	.	none		0.378	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
GABPB2	126626	hgsc.bcm.edu	37	1	151079554	151079554	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr1:151079554T>C	ENST00000368918.3	+	7	1109	c.778T>C	c.(778-780)Tca>Cca	p.S260P	GABPB2_ENST00000368916.1_Missense_Mutation_p.S222P|GABPB2_ENST00000467551.1_3'UTR|GABPB2_ENST00000368917.1_Missense_Mutation_p.S222P	NM_144618.2	NP_653219.1	Q8TAK5	GABP2_HUMAN	GA binding protein transcription factor, beta subunit 2	260					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(3)|liver(2)|lung(7)	15				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		CGTTGACTCATCAATCCAGCA	0.408																																					p.S260P		Atlas-SNP	.											.	GABPB2	41	.	0			c.T778C						PASS	.						74.0	74.0	74.0					1																	151079554		2203	4300	6503	SO:0001583	missense	126626	exon7			GACTCATCAATCC		CCDS983.1	1q21.2	2013-01-10			ENSG00000143458	ENSG00000143458		"""Ankyrin repeat domain containing"""	28441	protein-coding gene	gene with protein product						7958862	Standard	NM_144618		Approved	MGC29891	uc001ewr.2	Q8TAK5	OTTHUMG00000012193	ENST00000368918.3:c.778T>C	chr1.hg19:g.151079554T>C	ENSP00000357914:p.Ser260Pro	43.0	0.0	.		50.0	12.0	.	NM_144618	B1AVJ8|D3DV14|Q8NAR5	Missense_Mutation	SNP	ENST00000368918.3	hg19	CCDS983.1	.	.	.	.	.	.	.	.	.	.	T	18.66	3.671611	0.67928	.	.	ENSG00000143458	ENST00000368918;ENST00000368917;ENST00000368916	T;T;T	0.60548	0.18;0.24;0.24	5.41	4.27	0.50696	.	0.422547	0.26026	N	0.026794	T	0.37652	0.1011	L	0.50333	1.59	0.38047	D	0.935656	P;P;P	0.45715	0.534;0.865;0.668	B;B;B	0.43478	0.092;0.421;0.28	T	0.23833	-1.0177	10	0.28530	T	0.3	-6.6402	9.4384	0.38653	0.0:0.0:0.2761:0.7239	.	222;260;260	Q5SZG2;B2R924;Q8TAK5	.;.;GABP2_HUMAN	P	260;222;222	ENSP00000357914:S260P;ENSP00000357913:S222P;ENSP00000357912:S222P	ENSP00000357912:S222P	S	+	1	0	GABPB2	149346178	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	3.278000	0.51662	2.269000	0.75478	0.455000	0.32223	TCA	.	.	.	none		0.408	GABPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033700.2	NM_144618	
BIRC6	57448	hgsc.bcm.edu	37	2	32754825	32754825	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr2:32754825T>C	ENST00000421745.2	+	60	12162	c.12028T>C	c.(12028-12030)Tca>Cca	p.S4010P	MIR558_ENST00000384920.1_RNA	NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4010					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TAAATTGGGATCAAGAGTTAT	0.373																																					p.S4010P	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.T12028C						PASS	.						81.0	78.0	79.0					2																	32754825		2203	4300	6503	SO:0001583	missense	57448	exon60			TTGGGATCAAGAG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12028T>C	chr2.hg19:g.32754825T>C	ENSP00000393596:p.Ser4010Pro	87.0	0.0	.		80.0	36.0	.	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	24.7	4.557828	0.86231	.	.	ENSG00000115760	ENST00000421745	T	0.79940	-1.32	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.81498	0.4835	N	0.19112	0.55	0.80722	D	1	D	0.54601	0.967	D	0.63033	0.91	D	0.84394	0.0556	10	0.66056	D	0.02	.	15.073	0.72053	0.0:0.0:0.0:1.0	.	4010	Q9NR09	BIRC6_HUMAN	P	4010	ENSP00000393596:S4010P	ENSP00000393596:S4010P	S	+	1	0	BIRC6	32608329	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.608000	0.82898	1.975000	0.57531	0.477000	0.44152	TCA	.	.	.	none		0.373	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
ORC2	4999	hgsc.bcm.edu	37	2	201814321	201814321	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr2:201814321T>A	ENST00000234296.2	-	5	533	c.284A>T	c.(283-285)tAt>tTt	p.Y95F	ORC2_ENST00000467605.1_5'UTR	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	95					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						CTGAAAAGAATAAACTTTATT	0.284																																					p.Y95F		Atlas-SNP	.											.	ORC2	48	.	0			c.A284T						PASS	.						52.0	51.0	51.0					2																	201814321		2202	4290	6492	SO:0001583	missense	4999	exon5			AAAGAATAAACTT		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.284A>T	chr2.hg19:g.201814321T>A	ENSP00000234296:p.Tyr95Phe	200.0	0.0	.		181.0	64.0	.	NM_006190	Q13204|Q53TX5	Missense_Mutation	SNP	ENST00000234296.2	hg19	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.190690	0.38707	.	.	ENSG00000115942	ENST00000234296;ENST00000410039	T;T	0.47177	1.38;0.85	5.71	4.54	0.55810	.	0.062023	0.64402	D	0.000002	T	0.31420	0.0796	L	0.35723	1.085	0.38691	D	0.952751	B;B	0.16802	0.019;0.015	B;B	0.17098	0.017;0.01	T	0.15665	-1.0429	10	0.02654	T	1	-8.9205	9.1288	0.36833	0.1624:0.0:0.0:0.8376	.	95;95	B4DYU9;Q13416	.;ORC2_HUMAN	F	95	ENSP00000234296:Y95F;ENSP00000386390:Y95F	ENSP00000234296:Y95F	Y	-	2	0	ORC2	201522566	1.000000	0.71417	0.996000	0.52242	0.952000	0.60782	4.333000	0.59285	0.966000	0.38159	0.477000	0.44152	TAT	.	.	.	none		0.284	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	
IGFBP2	3485	hgsc.bcm.edu	37	2	217528687	217528687	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr2:217528687C>T	ENST00000233809.4	+	4	967	c.838C>T	c.(838-840)Cgt>Tgt	p.R280C	IGFBP2_ENST00000456764.1_Missense_Mutation_p.R136C	NM_000597.2	NP_000588	P18065	IBP2_HUMAN	insulin-like growth factor binding protein 2, 36kDa	280	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of activated T cell proliferation (GO:0042104)|regulation of cell growth (GO:0001558)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)			endometrium(2)|large_intestine(1)|lung(2)	5		Renal(323;0.0458)		Epithelial(149;2.9e-06)|all cancers(144;0.000223)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00968)		GAACGGGCAGCGTGGGGAGTG	0.612																																					p.R280C		Atlas-SNP	.											IGFBP2,NS,carcinoma,0,1	IGFBP2	25	.	0			c.C838T						PASS	.						36.0	44.0	41.0					2																	217528687		2054	4192	6246	SO:0001583	missense	3485	exon4			GGGCAGCGTGGGG		CCDS42815.1	2q35	2014-09-16	2002-08-29		ENSG00000115457	ENSG00000115457			5471	protein-coding gene	gene with protein product		146731	"""insulin-like growth factor binding protein 2 (36kD)"""	IBP2		1697583	Standard	NM_000597		Approved		uc021vwn.1	P18065	OTTHUMG00000155341	ENST00000233809.4:c.838C>T	chr2.hg19:g.217528687C>T	ENSP00000233809:p.Arg280Cys	138.0	0.0	.		118.0	35.0	.	NM_000597	Q14619|Q9UCL3	Missense_Mutation	SNP	ENST00000233809.4	hg19	CCDS42815.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029265	0.75504	.	.	ENSG00000115457	ENST00000233809;ENST00000456764	T;T	0.65916	-0.18;-0.18	4.78	4.78	0.61160	Thyroglobulin type-1 (6);	0.000000	0.85682	D	0.000000	D	0.83936	0.5362	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87978	0.2741	10	0.87932	D	0	-0.1858	17.3391	0.87291	0.0:1.0:0.0:0.0	.	280	P18065	IBP2_HUMAN	C	280;136	ENSP00000233809:R280C;ENSP00000389646:R136C	ENSP00000233809:R280C	R	+	1	0	IGFBP2	217236932	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.656000	0.46716	2.626000	0.88956	0.561000	0.74099	CGT	.	.	.	none		0.612	IGFBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339540.1	NM_000597	
STK11IP	114790	hgsc.bcm.edu	37	2	220477901	220477901	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr2:220477901G>A	ENST00000456909.1	+	20	2581	c.2491G>A	c.(2491-2493)Gtg>Atg	p.V831M	STK11IP_ENST00000295641.10_Missense_Mutation_p.V842M			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	842					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTTGTGGTTGTGTCTGACCG	0.597																																					p.V842M		Atlas-SNP	.											.	STK11IP	152	.	0			c.G2524A						PASS	.						82.0	87.0	85.0					2																	220477901		2038	4189	6227	SO:0001583	missense	114790	exon20			GTGGTTGTGTCTG	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.2491G>A	chr2.hg19:g.220477901G>A	ENSP00000389383:p.Val831Met	58.0	0.0	.		52.0	24.0	.	NM_052902	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	hg19		.	.	.	.	.	.	.	.	.	.	g	8.720	0.914062	0.17907	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	T;T	0.07908	3.15;3.15	4.46	1.67	0.24075	.	0.145417	0.45126	D	0.000383	T	0.08714	0.0216	M	0.64997	1.995	0.28916	N	0.892419	B	0.21905	0.062	B	0.24848	0.056	T	0.18967	-1.0320	10	0.72032	D	0.01	-6.4198	2.8496	0.05553	0.1011:0.1965:0.5231:0.1793	.	842	Q8N1F8	S11IP_HUMAN	M	831;842	ENSP00000389383:V831M;ENSP00000295641:V842M	ENSP00000295641:V842M	V	+	1	0	STK11IP	220186145	0.885000	0.30320	0.682000	0.30024	0.431000	0.31685	1.140000	0.31516	0.160000	0.19432	-0.509000	0.04479	GTG	.	.	.	none		0.597	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
BHLHE40	8553	hgsc.bcm.edu	37	3	5025187	5025187	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:5025187T>C	ENST00000256495.3	+	5	1652	c.1049T>C	c.(1048-1050)gTg>gCg	p.V350A		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	350					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						TCAGTGCCAGTGCTATACCCA	0.592																																					p.V350A		Atlas-SNP	.											.	BHLHE40	35	.	0			c.T1049C						PASS	.						169.0	143.0	152.0					3																	5025187		2203	4300	6503	SO:0001583	missense	8553	exon5			TGCCAGTGCTATA	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.1049T>C	chr3.hg19:g.5025187T>C	ENSP00000256495:p.Val350Ala	65.0	0.0	.		66.0	32.0	.	NM_003670	Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	hg19	CCDS2565.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057339	0.36277	.	.	ENSG00000134107	ENST00000256495	T	0.79749	-1.3	5.51	5.51	0.81932	.	0.385391	0.23815	N	0.044282	T	0.79633	0.4479	M	0.61703	1.905	0.18873	N	0.999988	B	0.12013	0.005	B	0.17098	0.017	T	0.71810	-0.4480	10	0.62326	D	0.03	.	15.6247	0.76845	0.0:0.0:0.0:1.0	.	350	O14503	BHE40_HUMAN	A	350	ENSP00000256495:V350A	ENSP00000256495:V350A	V	+	2	0	BHLHE40	5000187	0.997000	0.39634	0.027000	0.17364	0.972000	0.66771	6.116000	0.71571	2.093000	0.63338	0.533000	0.62120	GTG	.	.	.	none		0.592	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
SLC4A7	9497	hgsc.bcm.edu	37	3	27442329	27442329	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:27442329T>G	ENST00000295736.5	-	16	2396	c.2326A>C	c.(2326-2328)Aat>Cat	p.N776H	SLC4A7_ENST00000455077.1_Missense_Mutation_p.N657H|SLC4A7_ENST00000446700.1_Missense_Mutation_p.N768H|SLC4A7_ENST00000454389.1_Missense_Mutation_p.N785H|SLC4A7_ENST00000428386.1_Missense_Mutation_p.N652H|SLC4A7_ENST00000437179.1_Missense_Mutation_p.N657H|SLC4A7_ENST00000435667.2_Missense_Mutation_p.N661H|SLC4A7_ENST00000388777.4_Missense_Mutation_p.N326H|SLC4A7_ENST00000440156.1_Missense_Mutation_p.N772H|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000445684.1_Missense_Mutation_p.N772H	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	776					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	AGAGTTTCATTGCTGGGGTTT	0.323																																					p.N776H		Atlas-SNP	.											.	SLC4A7	119	.	0			c.A2326C						PASS	.						155.0	152.0	153.0					3																	27442329		2203	4298	6501	SO:0001583	missense	9497	exon16			TTTCATTGCTGGG	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.2326A>C	chr3.hg19:g.27442329T>G	ENSP00000295736:p.Asn776His	100.0	0.0	.		121.0	51.0	.	NM_003615	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	hg19	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831012	0.50845	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	5.42	4.24	0.50183	Bicarbonate transporter, C-terminal (1);	0.215214	0.47455	D	0.000230	D	0.87497	0.6192	M	0.82323	2.585	0.80722	D	1	D;P;P;D;D;P;P;D;D	0.64830	0.992;0.922;0.645;0.961;0.992;0.946;0.904;0.992;0.994	D;P;B;P;D;P;P;D;D	0.75020	0.969;0.906;0.411;0.905;0.985;0.843;0.847;0.969;0.93	D	0.88094	0.2815	10	0.87932	D	0	.	11.6564	0.51320	0.1331:0.0:0.0:0.8669	.	772;657;768;772;785;326;652;776;657	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	H	327;776;652;785;772;657;768;657;772;661;326;672	ENSP00000411031:N327H;ENSP00000295736:N776H;ENSP00000416368:N652H;ENSP00000390394:N785H;ENSP00000414797:N772H;ENSP00000394252:N657H;ENSP00000406605:N768H;ENSP00000407382:N657H;ENSP00000406804:N772H;ENSP00000395336:N661H;ENSP00000373429:N326H;ENSP00000388703:N672H	ENSP00000295736:N776H	N	-	1	0	SLC4A7	27417333	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	6.272000	0.72575	0.876000	0.35872	0.377000	0.23210	AAT	.	.	.	none		0.323	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	
GOLGA4	2803	hgsc.bcm.edu	37	3	37365357	37365357	+	Silent	SNP	A	A	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:37365357A>G	ENST00000361924.2	+	14	2354	c.1980A>G	c.(1978-1980)aaA>aaG	p.K660K	GOLGA4_ENST00000356847.4_Silent_p.K682K|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	660	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGAAAGACAAAGAGATTATCT	0.338																																					p.K682K		Atlas-SNP	.											.	GOLGA4	173	.	0			c.A2046G						PASS	.						45.0	48.0	47.0					3																	37365357		2203	4300	6503	SO:0001819	synonymous_variant	2803	exon15			AGACAAAGAGATT	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1980A>G	chr3.hg19:g.37365357A>G		125.0	0.0	.		124.0	39.0	.	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Silent	SNP	ENST00000361924.2	hg19	CCDS2666.1																																																																																			.	.	.	none		0.338	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
PBRM1	55193	hgsc.bcm.edu	37	3	52677267	52677267	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:52677267T>C	ENST00000296302.7	-	9	993	c.992A>G	c.(991-993)tAc>tGc	p.Y331C	PBRM1_ENST00000410007.1_Missense_Mutation_p.Y331C|PBRM1_ENST00000409057.1_Missense_Mutation_p.Y331C|PBRM1_ENST00000409114.3_Missense_Mutation_p.Y331C|PBRM1_ENST00000337303.4_Missense_Mutation_p.Y331C|PBRM1_ENST00000356770.4_Intron|PBRM1_ENST00000394830.3_Missense_Mutation_p.Y331C|PBRM1_ENST00000409767.1_Missense_Mutation_p.Y331C			Q86U86	PB1_HUMAN	polybromo 1	331					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTCTCACCGGTAATACTTGCT	0.443			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.Y331C		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.A992G						PASS	.						170.0	161.0	164.0					3																	52677267		2203	4300	6503	SO:0001583	missense	55193	exon10			CACCGGTAATACT	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.992A>G	chr3.hg19:g.52677267T>C	ENSP00000296302:p.Tyr331Cys	142.0	0.0	.		163.0	57.0	.	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	T	11.29	1.595409	0.28445	.	.	ENSG00000163939	ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T	0.34472	1.37;1.41;1.36;1.37;1.36;1.83;1.37;1.37;1.37	5.14	5.14	0.70334	Bromodomain (1);	0.546082	0.18050	N	0.153309	T	0.21103	0.0508	N	0.08118	0	0.27045	N	0.96393	P;B;P;P;P;P;B;P	0.49447	0.456;0.282;0.456;0.456;0.924;0.456;0.0;0.456	B;B;B;B;B;B;B;B	0.43360	0.178;0.163;0.178;0.178;0.417;0.247;0.001;0.115	T	0.03957	-1.0989	10	0.38643	T	0.18	.	9.497	0.38995	0.1569:0.0:0.0:0.8431	.	331;331;331;331;331;331;331;331	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.	C	331;331;331;331;331;331;331;331;275	ENSP00000378307:Y331C;ENSP00000296302:Y331C;ENSP00000338302:Y331C;ENSP00000386593:Y331C;ENSP00000386529:Y331C;ENSP00000386643:Y331C;ENSP00000386601:Y331C;ENSP00000387775:Y331C;ENSP00000397662:Y275C	ENSP00000296302:Y331C	Y	-	2	0	PBRM1	52652307	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.279000	0.43435	1.963000	0.57068	0.524000	0.50904	TAC	.	.	.	none		0.443	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
ATP6V1A	523	hgsc.bcm.edu	37	3	113505219	113505219	+	Silent	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:113505219T>C	ENST00000273398.3	+	6	813	c.705T>C	c.(703-705)gaT>gaC	p.D235D	ATP6V1A_ENST00000538620.1_Silent_p.D202D	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	235					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	GAGTCCTTGATGCCCTTTTTC	0.433																																					p.D235D		Atlas-SNP	.											.	ATP6V1A	71	.	0			c.T705C						PASS	.						222.0	203.0	209.0					3																	113505219		2203	4300	6503	SO:0001819	synonymous_variant	523	exon6			CCTTGATGCCCTT	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.705T>C	chr3.hg19:g.113505219T>C		94.0	0.0	.		142.0	65.0	.	NM_001690	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Silent	SNP	ENST00000273398.3	hg19	CCDS2976.1																																																																																			.	.	.	none		0.433	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690	
MSL2	55167	hgsc.bcm.edu	37	3	135870914	135870914	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:135870914A>G	ENST00000309993.2	-	2	1541	c.809T>C	c.(808-810)gTt>gCt	p.V270A	MSL2_ENST00000434835.2_Missense_Mutation_p.V196A	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	270					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						TACTTCCTCAACACTCAGTAA	0.443																																					p.V270A		Atlas-SNP	.											.	MSL2	63	.	0			c.T809C						PASS	.						62.0	68.0	66.0					3																	135870914		2203	4300	6503	SO:0001583	missense	55167	exon2			TCCTCAACACTCA	AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.809T>C	chr3.hg19:g.135870914A>G	ENSP00000311827:p.Val270Ala	51.0	0.0	.		71.0	14.0	.	NM_018133	B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	ENST00000309993.2	hg19	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.266033	0.59540	.	.	ENSG00000174579	ENST00000309993;ENST00000434835	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.59662	0.2210	L	0.34521	1.04	0.58432	D	0.99999	D	0.60160	0.987	P	0.56088	0.791	T	0.53809	-0.8386	9	0.17832	T	0.49	-9.5412	16.0034	0.80327	1.0:0.0:0.0:0.0	.	270	Q9HCI7	MSL2_HUMAN	A	270;196	.	ENSP00000311827:V270A	V	-	2	0	MSL2	137353604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.389000	0.90172	2.371000	0.80710	0.533000	0.62120	GTT	.	.	.	none		0.443	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133	
OPA1	4976	hgsc.bcm.edu	37	3	193335033	193335033	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:193335033T>C	ENST00000392438.3	+	4	749	c.515T>C	c.(514-516)aTt>aCt	p.I172T	OPA1-AS1_ENST00000444085.1_RNA|OPA1_ENST00000361715.2_Intron|OPA1_ENST00000361150.2_Intron|OPA1_ENST00000361510.2_Missense_Mutation_p.I172T|OPA1-AS1_ENST00000433105.1_RNA|OPA1_ENST00000487986.1_3'UTR|OPA1_ENST00000361828.2_Missense_Mutation_p.I172T|OPA1_ENST00000361908.3_Missense_Mutation_p.I172T	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	172					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TTTGACAAGATTGTTGAAAGC	0.333																																					p.I172T		Atlas-SNP	.											.	OPA1	79	.	0			c.T515C						PASS	.						63.0	67.0	66.0					3																	193335033		2202	4296	6498	SO:0001583	missense	4976	exon4			ACAAGATTGTTGA	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.515T>C	chr3.hg19:g.193335033T>C	ENSP00000376233:p.Ile172Thr	266.0	0.0	.		313.0	36.0	.	NM_130836	D3DNW4	Missense_Mutation	SNP	ENST00000392438.3	hg19	CCDS43186.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.300951	0.60195	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361828;ENST00000419435;ENST00000392436	D;D;D;D;T;T	0.94897	-3.25;-3.35;-3.55;-3.15;1.49;-1.36	5.86	5.86	0.93980	.	0.115123	0.64402	D	0.000016	D	0.91250	0.7242	L	0.43152	1.355	0.80722	D	1	B;B;B;B	0.28552	0.079;0.181;0.0;0.215	B;B;B;B	0.26517	0.07;0.068;0.001;0.064	D	0.88625	0.3165	10	0.23302	T	0.38	-14.9597	15.4463	0.75232	0.0:0.0:0.0:1.0	.	172;172;172;172	O60313;E5KLJ6;E5KLJ7;E5KLJ5	OPA1_HUMAN;.;.;.	T	172;172;172;172;48;172	ENSP00000354681:I172T;ENSP00000376233:I172T;ENSP00000355324:I172T;ENSP00000354429:I172T;ENSP00000399877:I48T;ENSP00000376231:I172T	ENSP00000355324:I172T	I	+	2	0	OPA1	194817727	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	6.940000	0.75917	2.241000	0.73720	0.528000	0.53228	ATT	.	.	.	none		0.333	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
POU5F2	134187	hgsc.bcm.edu	37	5	93077053	93077053	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr5:93077053G>A	ENST00000510627.4	-	1	290	c.217C>T	c.(217-219)Cgg>Tgg	p.R73W	FAM172A_ENST00000509163.1_Intron|POU5F2_ENST00000606183.1_5'Flank|RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000509739.1_Intron|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000505869.1_Intron	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	73					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		ATCCAGCCCCGGAATTCGTGT	0.692																																					p.R73W		Atlas-SNP	.											.	POU5F2	10	.	0			c.C217T						PASS	.						15.0	18.0	17.0					5																	93077053		1888	4105	5993	SO:0001583	missense	134187	exon1			AGCCCCGGAATTC		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.217C>T	chr5.hg19:g.93077053G>A	ENSP00000464890:p.Arg73Trp	35.0	0.0	.		50.0	18.0	.	NM_153216	Q15169|Q6MZL7|Q8N748	Missense_Mutation	SNP	ENST00000510627.4	hg19	CCDS59489.1																																																																																			.	.	.	none		0.692	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216	
FAM153B	202134	hgsc.bcm.edu	37	5	175530235	175530235	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr5:175530235A>T	ENST00000253490.4	+	13	727	c.670A>T	c.(670-672)Atc>Ttc	p.I224F	FAM153B_ENST00000510151.1_Missense_Mutation_p.I147F|FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000515817.1_Missense_Mutation_p.I147F			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	224										endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		CCTAGTTCTGATCAGGGATGT	0.507																																					p.I147F		Atlas-SNP	.											.	FAM153B	28	.	0			c.A439T						PASS	.						165.0	174.0	171.0					5																	175530235		2203	4300	6503	SO:0001583	missense	202134	exon12			GTTCTGATCAGGG	AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.670A>T	chr5.hg19:g.175530235A>T	ENSP00000253490:p.Ile224Phe	643.0	0.0	.		678.0	136.0	.	NM_001265615	A8MTI1	Missense_Mutation	SNP	ENST00000253490.4	hg19		.	.	.	.	.	.	.	.	.	.	A	9.135	1.012435	0.19277	.	.	ENSG00000182230	ENST00000515817;ENST00000253490	.	.	.	1.26	-2.53	0.06326	.	.	.	.	.	T	0.08714	0.0216	N	0.08118	0	0.09310	N	1	P	0.46020	0.871	B	0.31245	0.126	T	0.21827	-1.0234	8	0.87932	D	0	.	5.9593	0.19291	0.3919:0.6081:0.0:0.0	.	224	P0C7A2	F153B_HUMAN	F	147;224	.	ENSP00000253490:I224F	I	+	1	0	FAM153B	175462841	0.002000	0.14202	0.000000	0.03702	0.005000	0.04900	0.742000	0.26216	-0.649000	0.05430	0.145000	0.16022	ATC	.	.	.	none		0.507	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001079529	
JARID2	3720	hgsc.bcm.edu	37	6	15513599	15513599	+	Silent	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr6:15513599G>A	ENST00000341776.2	+	16	3640	c.3396G>A	c.(3394-3396)ttG>ttA	p.L1132L	JARID2_ENST00000397311.3_Silent_p.L960L	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	1132					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GGCTGCAGTTGGAGACGTCAG	0.637																																					p.L1132L		Atlas-SNP	.											.	JARID2	135	.	0			c.G3396A						PASS	.						66.0	59.0	61.0					6																	15513599		2203	4300	6503	SO:0001819	synonymous_variant	3720	exon16			GCAGTTGGAGACG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.3396G>A	chr6.hg19:g.15513599G>A		49.0	0.0	.		34.0	17.0	.	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Silent	SNP	ENST00000341776.2	hg19	CCDS4533.1																																																																																			.	.	.	none		0.637	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
CCND3	896	hgsc.bcm.edu	37	6	41908179	41908179	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr6:41908179C>G	ENST00000372991.4	-	2	541	c.343G>C	c.(343-345)Gag>Cag	p.E115Q	CCND3_ENST00000511686.1_Intron|CCND3_ENST00000511642.1_Missense_Mutation_p.E34Q|CCND3_ENST00000372987.4_Missense_Mutation_p.E65Q|CCND3_ENST00000372988.4_Missense_Mutation_p.E34Q|CCND3_ENST00000414200.2_Intron|CCND3_ENST00000510503.1_Missense_Mutation_p.E34Q|CCND3_ENST00000415497.2_Intron	NM_001760.3	NP_001751.1	P30281	CCND3_HUMAN	cyclin D3	115	Cyclin N-terminal.				cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(13)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	20	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGCGTGGTCTCGCGCAGCTTG	0.632			T	IGH@	MM																																p.E115Q		Atlas-SNP	.		Dom	yes		6	6p21	896	cyclin D3		L	CCND3,NS,carcinoma,0,1	CCND3	40	.	0			c.G343C						PASS	.						110.0	103.0	105.0					6																	41908179		2203	4300	6503	SO:0001583	missense	896	exon2			TGGTCTCGCGCAG		CCDS4863.1, CCDS47425.1, CCDS47426.1, CCDS47427.1, CCDS75452.1	6p21	2008-08-26			ENSG00000112576	ENSG00000112576			1585	protein-coding gene	gene with protein product		123834				1386335	Standard	NM_001136125		Approved		uc003orn.3	P30281	OTTHUMG00000014690	ENST00000372991.4:c.343G>C	chr6.hg19:g.41908179C>G	ENSP00000362082:p.Glu115Gln	49.0	0.0	.		59.0	23.0	.	NM_001760	B2RD63|B3KQ22|E9PAS4|E9PB36|Q5T8J0|Q6FG62|Q96F49	Missense_Mutation	SNP	ENST00000372991.4	hg19	CCDS4863.1	.	.	.	.	.	.	.	.	.	.	c	31	5.074437	0.94000	.	.	ENSG00000112576	ENST00000372991;ENST00000511642;ENST00000372987;ENST00000372988;ENST00000510503;ENST00000505064;ENST00000502771	T;T;T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06;2.06;2.06	4.26	4.26	0.50523	Cyclin, N-terminal (1);Cyclin-like (3);	0.115517	0.37761	N	0.001951	T	0.48241	0.1489	M	0.92219	3.285	0.58432	D	0.999999	D;D;D	0.69078	0.971;0.995;0.997	P;D;D	0.69654	0.856;0.931;0.965	T	0.64214	-0.6460	10	0.87932	D	0	.	16.4266	0.83816	0.0:1.0:0.0:0.0	.	34;115;65	B4E0N5;P30281;Q5T8J1	.;CCND3_HUMAN;.	Q	115;34;65;34;34;34;34	ENSP00000362082:E115Q;ENSP00000426212:E34Q;ENSP00000362078:E65Q;ENSP00000362079:E34Q;ENSP00000425986:E34Q;ENSP00000425830:E34Q;ENSP00000425334:E34Q	ENSP00000362078:E65Q	E	-	1	0	CCND3	42016157	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.604000	0.82830	2.199000	0.70637	0.462000	0.41574	GAG	.	.	.	none		0.632	CCND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040540.2	NM_001760	
GCM1	8521	hgsc.bcm.edu	37	6	52993306	52993306	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr6:52993306A>G	ENST00000259803.7	-	6	1220	c.1009T>C	c.(1009-1011)Ttt>Ctt	p.F337L	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	337					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					TGCTGGTAAAAGGGTTCTGAA	0.473																																					p.F337L		Atlas-SNP	.											.	GCM1	47	.	0			c.T1009C						PASS	.						67.0	73.0	71.0					6																	52993306		2203	4300	6503	SO:0001583	missense	8521	exon6			GGTAAAAGGGTTC	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.1009T>C	chr6.hg19:g.52993306A>G	ENSP00000259803:p.Phe337Leu	54.0	0.0	.		61.0	15.0	.	NM_003643	Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	ENST00000259803.7	hg19	CCDS4950.1	.	.	.	.	.	.	.	.	.	.	A	7.813	0.716023	0.15306	.	.	ENSG00000137270	ENST00000259803	T	0.72505	-0.66	5.73	-1.06	0.10002	.	1.093520	0.06892	N	0.804337	T	0.21022	0.0506	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07635	-1.0762	10	0.10902	T	0.67	-22.1899	2.5637	0.04778	0.2555:0.1237:0.0831:0.5377	.	337	Q9NP62	GCM1_HUMAN	L	337	ENSP00000259803:F337L	ENSP00000259803:F337L	F	-	1	0	GCM1	53101265	0.017000	0.18338	0.001000	0.08648	0.964000	0.63967	0.200000	0.17257	0.085000	0.17107	0.482000	0.46254	TTT	.	.	.	none		0.473	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1		
KLHL31	401265	hgsc.bcm.edu	37	6	53516723	53516723	+	Silent	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr6:53516723G>A	ENST00000407079.1	-	2	1577	c.1578C>T	c.(1576-1578)cgC>cgT	p.R526R	KLHL31_ENST00000370905.3_Silent_p.R526R			Q9H511	KLH31_HUMAN	kelch-like family member 31	526					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					CGCGCTCCCCGCGCGGCCCCA	0.731																																					p.R526R		Atlas-SNP	.											.	KLHL31	48	.	0			c.C1578T						PASS	.						6.0	7.0	7.0					6																	53516723		2131	4169	6300	SO:0001819	synonymous_variant	401265	exon3			CTCCCCGCGCGGC		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1578C>T	chr6.hg19:g.53516723G>A		22.0	0.0	.		24.0	8.0	.	NM_001003760	A6N9J2|B2RP49	Silent	SNP	ENST00000407079.1	hg19	CCDS34478.1																																																																																			.	.	.	none		0.731	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760	
GJC3	349149	hgsc.bcm.edu	37	7	99527002	99527002	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr7:99527002A>G	ENST00000312891.2	-	1	241	c.242T>C	c.(241-243)gTc>gCc	p.V81A	RP4-604G5.1_ENST00000456499.1_RNA	NM_181538.2	NP_853516.1	Q8NFK1	CXG3_HUMAN	gap junction protein, gamma 3, 30.2kDa	81					cell communication (GO:0007154)|myelination (GO:0042552)|sensory perception of sound (GO:0007605)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	9	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CACCAAGATGACCTGGAAGAC	0.577																																					p.V81A		Atlas-SNP	.											GJC3,colon,carcinoma,0,1	GJC3	18	.	0			c.T242C						PASS	.						98.0	102.0	101.0					7																	99527002		2203	4300	6503	SO:0001583	missense	349149	exon1			AAGATGACCTGGA	AF503615	CCDS34697.1	7q22.1	2008-09-04	2007-11-06	2007-11-06	ENSG00000176402	ENSG00000176402		"""Ion channels / Gap junction proteins (connexins)"""	17495	protein-coding gene	gene with protein product	"""connexin 30.2"""	611925	"""gap junction protein, epsilon 1, 29kDa"""	GJE1			Standard	NM_181538		Approved	CX30.2	uc011kjd.2	Q8NFK1	OTTHUMG00000156649	ENST00000312891.2:c.242T>C	chr7.hg19:g.99527002A>G	ENSP00000325775:p.Val81Ala	47.0	0.0	.		48.0	23.0	.	NM_181538	A4D296|Q86XI9	Missense_Mutation	SNP	ENST00000312891.2	hg19	CCDS34697.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.143140	0.77888	.	.	ENSG00000176402	ENST00000312891	D	0.99186	-5.53	4.73	4.73	0.59995	Connexin, N-terminal (1);	0.366774	0.19830	N	0.105106	D	0.98601	0.9532	M	0.76574	2.34	0.41351	D	0.987367	D	0.56746	0.977	P	0.51453	0.67	D	0.99204	1.0874	10	0.87932	D	0	.	12.5098	0.56000	1.0:0.0:0.0:0.0	.	81	Q8NFK1	CXG3_HUMAN	A	81	ENSP00000325775:V81A	ENSP00000325775:V81A	V	-	2	0	GJC3	99364938	1.000000	0.71417	0.973000	0.42090	0.714000	0.41099	7.017000	0.76399	2.128000	0.65567	0.533000	0.62120	GTC	.	.	.	none		0.577	GJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345052.1	NM_181538	
MET	4233	hgsc.bcm.edu	37	7	116423474	116423474	+	Missense_Mutation	SNP	T	T	C	rs121913245		TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr7:116423474T>C	ENST00000318493.6	+	19	3990	c.3803T>C	c.(3802-3804)aTg>aCg	p.M1268T	MET_ENST00000539704.1_Missense_Mutation_p.M120T|MET_ENST00000397752.3_Missense_Mutation_p.M1250T			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M1268T(4)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GTGAAGTGGATGGCTTTGGAA	0.393			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.M1268T		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,rectum,carcinoma,+1,5	MET	412	.	4	Substitution - Missense(4)	kidney(4)	c.T3803C	GRCh37	CM992181	MET	M	rs121913245	PASS	.						93.0	92.0	92.0					7																	116423474		1872	4102	5974	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	AGTGGATGGCTTT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3803T>C	chr7.hg19:g.116423474T>C	ENSP00000317272:p.Met1268Thr	79.0	0.0	.		83.0	34.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740165	0.69304	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.37752	1.18;1.18;1.18	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;1.0	T	0.65734	-0.6096	10	0.87932	D	0	.	16.2225	0.82267	0.0:0.0:0.0:1.0	.	1268;1250	P08581-2;P08581	.;MET_HUMAN	T	1250;1268;120	ENSP00000380860:M1250T;ENSP00000317272:M1268T;ENSP00000445020:M120T	ENSP00000317272:M1268T	M	+	2	0	MET	116210710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.289000	0.77006	0.460000	0.39030	ATG	.	.	.	weak		0.393	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
PPP2R2A	5520	hgsc.bcm.edu	37	8	26220333	26220333	+	Silent	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr8:26220333G>A	ENST00000380737.3	+	7	1100	c.771G>A	c.(769-771)agG>agA	p.R257R	PPP2R2A_ENST00000315985.7_Silent_p.R267R	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	257					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		GTGACATGAGGGCATCTGCCC	0.373																																					p.R267R		Atlas-SNP	.											.	PPP2R2A	44	.	0			c.G801A						PASS	.						82.0	75.0	77.0					8																	26220333		2203	4300	6503	SO:0001819	synonymous_variant	5520	exon7			CATGAGGGCATCT	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.771G>A	chr8.hg19:g.26220333G>A		49.0	0.0	.		76.0	25.0	.	NM_001177591	B2RBU8|B4E1T7|P50409|Q00007	Silent	SNP	ENST00000380737.3	hg19	CCDS34867.1																																																																																			.	.	.	none		0.373	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375954.2	NM_002717	
PRDM14	63978	hgsc.bcm.edu	37	8	70964477	70964477	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr8:70964477G>T	ENST00000276594.2	-	8	1752	c.1551C>A	c.(1549-1551)ttC>ttA	p.F517L		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	517					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			ACTTGCATTTGAAGGGCTTCT	0.507																																					p.F517L	NSCLC(129;99 1813 5906 40656 46114)	Atlas-SNP	.											.	PRDM14	102	.	0			c.C1551A						PASS	.						153.0	143.0	146.0					8																	70964477		2203	4300	6503	SO:0001583	missense	63978	exon8			GCATTTGAAGGGC	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1551C>A	chr8.hg19:g.70964477G>T	ENSP00000276594:p.Phe517Leu	117.0	0.0	.		83.0	34.0	.	NM_024504	Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	hg19	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477602	0.84640	.	.	ENSG00000147596	ENST00000276594	T	0.21932	1.98	6.08	4.3	0.51218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.38983	0.1061	L	0.61387	1.9	0.58432	D	0.999998	D	0.67145	0.996	D	0.65443	0.935	T	0.17776	-1.0358	10	0.56958	D	0.05	-32.8024	10.6211	0.45481	0.2001:0.0:0.7999:0.0	.	517	Q9GZV8	PRD14_HUMAN	L	517	ENSP00000276594:F517L	ENSP00000276594:F517L	F	-	3	2	PRDM14	71127031	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.692000	0.54727	1.590000	0.49995	0.655000	0.94253	TTC	.	.	.	none		0.507	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
KANK1	23189	hgsc.bcm.edu	37	9	744586	744586	+	Silent	SNP	T	T	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr9:744586T>G	ENST00000382303.1	+	15	4645	c.3993T>G	c.(3991-3993)tcT>tcG	p.S1331S	KANK1_ENST00000382293.3_Silent_p.S1173S|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Silent_p.S1331S	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1331					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		AAGCCCAGTCTCCGGTCAGTG	0.498																																					p.S1331S		Atlas-SNP	.											.	KANK1	231	.	0			c.T3993G						PASS	.						139.0	116.0	124.0					9																	744586		2203	4300	6503	SO:0001819	synonymous_variant	23189	exon15			CCAGTCTCCGGTC	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3993T>G	chr9.hg19:g.744586T>G		68.0	0.0	.		89.0	31.0	.	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	hg19	CCDS34976.1																																																																																			.	.	.	none		0.498	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
TESK1	7016	hgsc.bcm.edu	37	9	35605737	35605737	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr9:35605737T>A	ENST00000336395.5	+	1	371	c.121T>A	c.(121-123)Tac>Aac	p.Y41N	MIR4667_ENST00000578933.1_RNA|TESK1_ENST00000498522.1_3'UTR	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	41					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ccccTCCTCCTACCGGGCTCT	0.751																																					p.Y41N		Atlas-SNP	.											.	TESK1	46	.	0			c.T121A						PASS	.						6.0	6.0	6.0					9																	35605737		2011	4058	6069	SO:0001583	missense	7016	exon1			TCCTCCTACCGGG	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.121T>A	chr9.hg19:g.35605737T>A	ENSP00000338127:p.Tyr41Asn	19.0	0.0	.		17.0	9.0	.	NM_006285	Q8IXZ8	Missense_Mutation	SNP	ENST00000336395.5	hg19	CCDS6580.1	.	.	.	.	.	.	.	.	.	.	T	19.96	3.923903	0.73213	.	.	ENSG00000107140	ENST00000336395	T	0.76578	-1.03	4.01	2.75	0.32379	Protein kinase-like domain (1);	0.000000	0.33691	N	0.004652	T	0.71626	0.3362	N	0.08118	0	0.45704	D	0.998617	D	0.64830	0.994	D	0.66602	0.945	T	0.74630	-0.3601	10	0.87932	D	0	-8.0246	8.4095	0.32636	0.0:0.0:0.1975:0.8025	.	41	Q15569	TESK1_HUMAN	N	41	ENSP00000338127:Y41N	ENSP00000338127:Y41N	Y	+	1	0	TESK1	35595737	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	3.246000	0.51414	1.581000	0.49865	0.448000	0.29417	TAC	.	.	.	none		0.751	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285	
FAM53B	9679	hgsc.bcm.edu	37	10	126384767	126384767	+	Silent	SNP	C	C	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr10:126384767C>T	ENST00000337318.3	-	3	304	c.93G>A	c.(91-93)aaG>aaA	p.K31K	FAM53B_ENST00000280780.6_Silent_p.K31K|RP11-12J10.3_ENST00000494792.1_3'UTR|FAM53B_ENST00000392754.3_Silent_p.K31K	NM_014661.3	NP_055476.3	Q14153	FA53B_HUMAN	family with sequence similarity 53, member B	31								p.K31N(1)		cervix(1)|lung(5)|ovary(2)|pancreas(1)	9		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		CTTGACTCATCTTCTTTGGCG	0.448																																					p.K31K		Atlas-SNP	.											FAM53B,NS,carcinoma,0,1	FAM53B	22	.	1	Substitution - Missense(1)	cervix(1)	c.G93A						PASS	.						224.0	211.0	215.0					10																	126384767		2203	4300	6503	SO:0001819	synonymous_variant	9679	exon3			ACTCATCTTCTTT	D50930	CCDS7641.1	10q26.13	2004-11-24	2004-11-24	2004-11-24	ENSG00000189319	ENSG00000189319			28968	protein-coding gene	gene with protein product			"""KIAA0140"""	KIAA0140		8590280	Standard	NM_014661		Approved	bA12J10.2	uc001lhv.1	Q14153	OTTHUMG00000019215	ENST00000337318.3:c.93G>A	chr10.hg19:g.126384767C>T		63.0	0.0	.		54.0	15.0	.	NM_014661	D3DRF1|Q5VUW1|Q5VUW2|Q8N5S6	Silent	SNP	ENST00000337318.3	hg19	CCDS7641.1																																																																																			.	.	.	none		0.448	FAM53B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050879.1	NM_014661	
OSBPL5	114879	hgsc.bcm.edu	37	11	3114204	3114204	+	Silent	SNP	C	C	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr11:3114204C>T	ENST00000263650.7	-	18	2184	c.2025G>A	c.(2023-2025)gaG>gaA	p.E675E	OSBPL5_ENST00000348039.5_Silent_p.E607E|OSBPL5_ENST00000478260.1_Silent_p.E129E|OSBPL5_ENST00000389989.3_Silent_p.E607E|OSBPL5_ENST00000525498.1_Silent_p.E586E|OSBPL5_ENST00000542243.1_Silent_p.E306E	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	675					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GCCGCTGTGCCTCCTCCAGTG	0.662																																					p.E675E		Atlas-SNP	.											.	OSBPL5	78	.	0			c.G2025A						PASS	.						49.0	38.0	42.0					11																	3114204		2200	4293	6493	SO:0001819	synonymous_variant	114879	exon18			CTGTGCCTCCTCC	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.2025G>A	chr11.hg19:g.3114204C>T		43.0	0.0	.		42.0	21.0	.	NM_020896	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Silent	SNP	ENST00000263650.7	hg19	CCDS31344.1																																																																																			.	.	.	none		0.662	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2		
GUCY1A2	2977	hgsc.bcm.edu	37	11	106810476	106810476	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr11:106810476G>A	ENST00000526355.2	-	4	1384	c.916C>T	c.(916-918)Cca>Tca	p.P306S	GUCY1A2_ENST00000347596.2_Missense_Mutation_p.P306S|GUCY1A2_ENST00000282249.2_Missense_Mutation_p.P306S	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	306					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	GTTCCCTGTGGAAGGTTCTTC	0.423																																					p.P306S		Atlas-SNP	.											.	GUCY1A2	180	.	0			c.C916T						PASS	.						79.0	76.0	77.0					11																	106810476		2201	4298	6499	SO:0001583	missense	2977	exon4			CCTGTGGAAGGTT	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.916C>T	chr11.hg19:g.106810476G>A	ENSP00000431245:p.Pro306Ser	69.0	0.0	.		80.0	30.0	.	NM_000855	A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	hg19	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	G	4.058	0.008459	0.07912	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.86627	-1.82;-2.15;-1.82	5.77	2.74	0.32292	.	0.000000	0.44902	U	0.000408	T	0.77558	0.4148	L	0.27053	0.805	0.44067	D	0.99681	B;B;B	0.30763	0.038;0.007;0.294	B;B;B	0.24974	0.009;0.016;0.057	T	0.67868	-0.5559	10	0.13853	T	0.58	.	16.0098	0.80391	0.0:0.382:0.618:0.0	.	306;306;306	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	S	306	ENSP00000431245:P306S;ENSP00000282249:P306S;ENSP00000344874:P306S	ENSP00000282249:P306S	P	-	1	0	GUCY1A2	106315686	1.000000	0.71417	0.174000	0.22961	0.028000	0.11728	2.943000	0.49026	0.300000	0.22699	-0.282000	0.10007	CCA	.	.	.	none		0.423	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2		
TBRG1	84897	hgsc.bcm.edu	37	11	124494840	124494840	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr11:124494840T>C	ENST00000441174.3	+	2	368	c.164T>C	c.(163-165)aTt>aCt	p.I55T	TBRG1_ENST00000375005.4_5'UTR	NM_032811.2	NP_116200.2	Q3YBR2	TBRG1_HUMAN	transforming growth factor beta regulator 1	55					cell cycle arrest (GO:0007050)|DNA replication (GO:0006260)|negative regulation of cell proliferation (GO:0008285)|nucleolus to nucleoplasm transport (GO:0032066)|protein stabilization (GO:0050821)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				kidney(1)|prostate(1)	2	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0218)		AATGCTGCTATTTGTGATGAA	0.313																																					p.I55T		Atlas-SNP	.											.	TBRG1	13	.	0			c.T164C						PASS	.						113.0	102.0	105.0					11																	124494840		692	1591	2283	SO:0001583	missense	84897	exon2			CTGCTATTTGTGA	AK074140	CCDS8448.2	11q24.2	2008-02-05			ENSG00000154144	ENSG00000154144			29551	protein-coding gene	gene with protein product	"""nuclear interactor of ARF and MDM2"""	610614				7654366, 17110379	Standard	NM_032811		Approved	FLJ14621, TB-5, NIAM	uc001qak.4	Q3YBR2	OTTHUMG00000153024	ENST00000441174.3:c.164T>C	chr11.hg19:g.124494840T>C	ENSP00000409016:p.Ile55Thr	204.0	0.0	.		240.0	87.0	.	NM_032811	Q53GJ5|Q66ZJ6|Q69YS7|Q8TCS4|Q8TEI4|Q96SV0	Missense_Mutation	SNP	ENST00000441174.3	hg19	CCDS8448.2	.	.	.	.	.	.	.	.	.	.	T	17.33	3.362644	0.61403	.	.	ENSG00000154144	ENST00000441174	D	0.81739	-1.53	5.46	5.46	0.80206	.	0.140838	0.48286	D	0.000187	T	0.73916	0.3648	L	0.43152	1.355	0.80722	D	1	B	0.32245	0.361	B	0.28139	0.086	T	0.75909	-0.3151	10	0.87932	D	0	-5.4942	13.5458	0.61702	0.0:0.0:0.0:1.0	.	55	Q3YBR2	TBRG1_HUMAN	T	55	ENSP00000409016:I55T	ENSP00000284290:I55T	I	+	2	0	TBRG1	124000050	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.617000	0.74210	2.291000	0.77112	0.533000	0.62120	ATT	.	.	.	none		0.313	TBRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329057.2	NM_032811	
KRT6A	3853	hgsc.bcm.edu	37	12	52884675	52884675	+	Silent	SNP	G	G	A	rs398542		TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr12:52884675G>A	ENST00000330722.6	-	4	947	c.879C>T	c.(877-879)gaC>gaT	p.D293D		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	293	Coil 1B.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.D293D(4)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGTTGATCTCGTCTGTGAGAG	0.498																																					p.D293D		Atlas-SNP	.											KRT6A,NS,carcinoma,0,3	KRT6A	89	.	4	Substitution - coding silent(4)	kidney(2)|lung(1)|endometrium(1)	c.C879T						PASS	.						196.0	172.0	180.0					12																	52884675		2203	4300	6503	SO:0001819	synonymous_variant	3853	exon4			GATCTCGTCTGTG	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.879C>T	chr12.hg19:g.52884675G>A		79.0	0.0	.		167.0	7.0	.	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Silent	SNP	ENST00000330722.6	hg19	CCDS41786.1																																																																																			.	G|1.000;|0.000	.	weak		0.498	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
MAPKBP1	23005	hgsc.bcm.edu	37	15	42111022	42111022	+	Splice_Site	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr15:42111022T>C	ENST00000456763.2	+	21	2372	c.2176T>C	c.(2176-2178)Tgc>Cgc	p.C726R	MAPKBP1_ENST00000457542.2_Splice_Site_p.C720R|MAPKBP1_ENST00000221214.6_Splice_Site_p.C603R|MAPKBP1_ENST00000260357.7_Splice_Site_p.C559R|MAPKBP1_ENST00000514566.1_Splice_Site_p.C720R	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	726										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TTACCCCAGCTGCATATTTGT	0.602																																					p.C726R		Atlas-SNP	.											.	MAPKBP1	120	.	0			c.T2176C						PASS	.						51.0	44.0	46.0					15																	42111022		2203	4300	6503	SO:0001630	splice_region_variant	23005	exon21			CCCAGCTGCATAT	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.2175-1T>C	chr15.hg19:g.42111022T>C		77.0	0.0	.		76.0	22.0	.	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	hg19	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	t	25.7	4.667026	0.88251	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.040834	0.85682	D	0.000000	T	0.64057	0.2564	N	0.20685	0.6	0.80722	D	1	D;D;P;D;D	0.89917	1.0;0.962;0.947;1.0;1.0	D;D;P;D;D	0.97110	0.999;0.953;0.58;1.0;0.999	T	0.69555	-0.5114	10	0.87932	D	0	-17.5168	15.5731	0.76354	0.0:0.0:0.0:1.0	.	559;603;720;726;720	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	R	720;603;559;726;720	ENSP00000397570:C720R;ENSP00000221214:C603R;ENSP00000260357:C559R;ENSP00000393099:C726R;ENSP00000426154:C720R	ENSP00000221214:C603R	C	+	1	0	MAPKBP1	39898314	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.855000	0.86950	2.160000	0.67779	0.454000	0.30748	TGC	.	.	.	none		0.602	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	Missense_Mutation
MEX3B	84206	hgsc.bcm.edu	37	15	82337942	82337942	+	Silent	SNP	C	C	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr15:82337942C>T	ENST00000329713.4	-	1	540	c.105G>A	c.(103-105)caG>caA	p.Q35Q	MEX3B_ENST00000558133.1_Silent_p.Q35Q|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	35					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						CGAGCGCGAGCTGCAGGGCTC	0.687																																					p.Q35Q		Atlas-SNP	.											.	MEX3B	50	.	0			c.G105A						PASS	.						23.0	18.0	20.0					15																	82337942		2200	4299	6499	SO:0001819	synonymous_variant	84206	exon1			CGCGAGCTGCAGG	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.105G>A	chr15.hg19:g.82337942C>T		25.0	0.0	.		31.0	12.0	.	NM_032246	Q4G0W1|Q8IVG2|Q9H0J0	Silent	SNP	ENST00000329713.4	hg19	CCDS10319.1																																																																																			.	.	.	none		0.687	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304000.1	XM_290645	
IL32	9235	hgsc.bcm.edu	37	16	3119039	3119039	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr16:3119039G>A	ENST00000534507.1	+	6	599	c.388G>A	c.(388-390)Ggc>Agc	p.G130S	IL32_ENST00000548476.1_Missense_Mutation_p.G130S|IL32_ENST00000396887.3_Missense_Mutation_p.G84S|IL32_ENST00000549213.1_Missense_Mutation_p.G84S|IL32_ENST00000529699.1_Missense_Mutation_p.G64S|IL32_ENST00000530890.1_Missense_Mutation_p.G64S|IL32_ENST00000528163.2_Missense_Mutation_p.G84S|IL32_ENST00000530538.2_Missense_Mutation_p.G84S|IL32_ENST00000444393.3_Missense_Mutation_p.G84S|IL32_ENST00000396890.2_Missense_Mutation_p.G130S|IL32_ENST00000008180.9_Missense_Mutation_p.G64S|IL32_ENST00000325568.5_Missense_Mutation_p.G84S|IL32_ENST00000440815.3_Missense_Mutation_p.G84S|IL32_ENST00000548652.1_Missense_Mutation_p.G75S|IL32_ENST00000551122.1_Missense_Mutation_p.G84S|IL32_ENST00000548246.1_Missense_Mutation_p.G44S|IL32_ENST00000552936.1_Missense_Mutation_p.G108S|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000552664.1_Missense_Mutation_p.G84S|IL32_ENST00000531965.1_Missense_Mutation_p.G74S|IL32_ENST00000529550.1_Missense_Mutation_p.G84S|IL32_ENST00000382213.3_Missense_Mutation_p.G75S|IL32_ENST00000526464.2_Missense_Mutation_p.G84S|IL32_ENST00000525643.2_Missense_Mutation_p.G84S|IL32_ENST00000533097.2_Missense_Mutation_p.G84S|IL32_ENST00000551513.1_Missense_Mutation_p.G121S|IL32_ENST00000552356.1_Missense_Mutation_p.G64S			P24001	IL32_HUMAN	interleukin 32	130					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						ACGGTGCCGAGGCAACAGATC	0.562																																					p.G84S		Atlas-SNP	.											IL32,colon,carcinoma,-1,1	IL32	32	.	0			c.G250A						PASS	.						8.0	11.0	10.0					16																	3119039		2078	4205	6283	SO:0001583	missense	9235	exon7			TGCCGAGGCAACA	M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.388G>A	chr16.hg19:g.3119039G>A	ENSP00000431775:p.Gly130Ser	187.0	1.0	.		193.0	25.0	.	NM_004221	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Missense_Mutation	SNP	ENST00000534507.1	hg19		.	.	.	.	.	.	.	.	.	.	G	10.98	1.503057	0.26949	.	.	ENSG00000008517	ENST00000325568;ENST00000534507;ENST00000531965;ENST00000396887;ENST00000529699;ENST00000526464;ENST00000440815;ENST00000529550;ENST00000551122;ENST00000525643;ENST00000548807;ENST00000528163;ENST00000530890;ENST00000444393;ENST00000533097;ENST00000008180;ENST00000396890;ENST00000525228;ENST00000548652;ENST00000530538;ENST00000549213;ENST00000552936;ENST00000548476;ENST00000552664;ENST00000552356;ENST00000551513;ENST00000382213;ENST00000548246	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.74002	0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;0.9;-0.8;-0.8;0.9;0.9;0.9;0.9;0.9;0.9;0.9;-0.8;0.9	1.63	-0.842	0.10748	.	.	.	.	.	T	0.67411	0.2890	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;D	0.76494	0.311;0.311;0.311;0.311;0.311;0.311;0.999	B;B;B;B;B;B;D	0.70716	0.036;0.048;0.048;0.048;0.048;0.048;0.97	T	0.55522	-0.8128	9	0.40728	T	0.16	.	2.5712	0.04795	0.236:0.313:0.451:0.0	.	44;64;75;64;130;84;84	B8Q191;C6GKH1;A6NNM0;A8MPX0;P24001;P24001-2;P24001-4	.;.;.;.;IL32_HUMAN;.;.	S	84;130;74;84;64;84;84;84;84;84;130;84;64;84;84;64;130;55;75;84;84;108;130;84;64;121;75;44	ENSP00000324742:G84S;ENSP00000431775:G130S;ENSP00000433177:G74S;ENSP00000380096:G84S;ENSP00000436937:G64S;ENSP00000450364:G84S;ENSP00000405063:G84S;ENSP00000437020:G84S;ENSP00000447496:G84S;ENSP00000432218:G84S;ENSP00000448354:G130S;ENSP00000432850:G84S;ENSP00000433747:G64S;ENSP00000411958:G84S;ENSP00000432917:G84S;ENSP00000008180:G64S;ENSP00000380099:G130S;ENSP00000431740:G55S;ENSP00000446624:G75S;ENSP00000436929:G84S;ENSP00000447812:G84S;ENSP00000447033:G108S;ENSP00000449483:G130S;ENSP00000448683:G84S;ENSP00000446978:G64S;ENSP00000449147:G121S;ENSP00000371648:G75S;ENSP00000447979:G44S	ENSP00000008180:G64S	G	+	1	0	IL32	3059040	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.184000	0.01254	-0.162000	0.10964	0.543000	0.68304	GGC	.	.	.	none		0.562	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221	
CNTNAP4	85445	hgsc.bcm.edu	37	16	76574667	76574667	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr16:76574667T>C	ENST00000476707.1	+	20	3570	c.3431T>C	c.(3430-3432)cTg>cCg	p.L1144P	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.L1092P|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.L1068P|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.L1140P			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1141	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GTCAAATCTCTGGTATTGGGC	0.368																																					p.L1068P		Atlas-SNP	.											.	CNTNAP4	600	.	0			c.T3203C						PASS	.						76.0	70.0	72.0					16																	76574667		1895	4124	6019	SO:0001583	missense	85445	exon20			AATCTCTGGTATT	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3431T>C	chr16.hg19:g.76574667T>C	ENSP00000417628:p.Leu1144Pro	68.0	0.0	.		91.0	30.0	.	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	hg19		.	.	.	.	.	.	.	.	.	.	T	23.1	4.370884	0.82573	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	5.65	5.65	0.86999	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.35495	N	0.003164	D	0.92519	0.7624	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.93393	0.6753	9	0.87932	D	0	.	16.0399	0.80667	0.0:0.0:0.0:1.0	.	1068;1144;1141	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	P	1140;1092;1068;1144	ENSP00000306893:L1140P;ENSP00000439733:L1092P;ENSP00000418741:L1068P;ENSP00000417628:L1144P	ENSP00000306893:L1140P	L	+	2	0	CNTNAP4	75132168	1.000000	0.71417	0.893000	0.35052	0.988000	0.76386	7.293000	0.78740	2.371000	0.80710	0.533000	0.62120	CTG	.	.	.	none		0.368	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
TLDC1	57707	hgsc.bcm.edu	37	16	84529314	84529314	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr16:84529314G>A	ENST00000343629.6	-	3	541	c.359C>T	c.(358-360)cCc>cTc	p.P120L	TLDC1_ENST00000561807.1_5'UTR|RP11-517C16.4_ENST00000568771.1_RNA|TLDC1_ENST00000535580.1_Missense_Mutation_p.P93L	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	120						lysosomal membrane (GO:0005765)											GGCCTTCACGGGACCTTCTGT	0.537																																					p.P120L		Atlas-SNP	.											.	KIAA1609	39	.	0			c.C359T						PASS	.						105.0	99.0	101.0					16																	84529314		2200	4300	6500	SO:0001583	missense	57707	exon3			TTCACGGGACCTT	AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.359C>T	chr16.hg19:g.84529314G>A	ENSP00000343635:p.Pro120Leu	105.0	0.0	.		92.0	6.0	.	NM_020947	Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	hg19	CCDS32498.1	.	.	.	.	.	.	.	.	.	.	G	8.563	0.878146	0.17395	.	.	ENSG00000140950	ENST00000343629;ENST00000535580	T;T	0.13901	2.55;2.55	4.46	4.46	0.54185	.	0.708586	0.14302	N	0.328228	T	0.19087	0.0458	M	0.66939	2.045	0.21697	N	0.999581	B;B	0.26258	0.145;0.121	B;B	0.23852	0.049;0.031	T	0.06588	-1.0818	10	0.49607	T	0.09	-9.2031	15.1519	0.72706	0.0:0.0:1.0:0.0	.	93;120	F5GWS3;Q6P9B6	.;K1609_HUMAN	L	120;93	ENSP00000343635:P120L;ENSP00000441997:P93L	ENSP00000343635:P120L	P	-	2	0	KIAA1609	83086815	0.964000	0.33143	0.005000	0.12908	0.086000	0.17979	5.657000	0.67996	2.402000	0.81655	0.563000	0.77884	CCC	.	.	.	none		0.537	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947	
MYH10	4628	hgsc.bcm.edu	37	17	8404148	8404148	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr17:8404148T>G	ENST00000269243.4	-	27	3785	c.3647A>C	c.(3646-3648)aAg>aCg	p.K1216T	MYH10_ENST00000360416.3_Missense_Mutation_p.K1247T|MYH10_ENST00000396239.1_Missense_Mutation_p.K1237T|MYH10_ENST00000379980.4_Missense_Mutation_p.K1232T	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1216					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CCTTACCCGCTTGGCCTGTTC	0.542																																					p.K1247T		Atlas-SNP	.											.	MYH10	148	.	0			c.A3740C						PASS	.						144.0	128.0	134.0					17																	8404148		2203	4300	6503	SO:0001583	missense	4628	exon29			ACCCGCTTGGCCT	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.3647A>C	chr17.hg19:g.8404148T>G	ENSP00000269243:p.Lys1216Thr	61.0	0.0	.		49.0	17.0	.	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	hg19	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.689612	0.68271	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.71	4.71	0.59529	Myosin tail (1);	0.100830	0.64402	D	0.000003	D	0.86826	0.6026	M	0.78456	2.415	0.80722	D	1	D;D;D	0.55605	0.972;0.965;0.972	D;P;D	0.64410	0.925;0.877;0.925	D	0.88793	0.3279	10	0.87932	D	0	.	14.3623	0.66782	0.0:0.0:0.0:1.0	.	1225;1247;1216	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	T	1216;1247;1237;1232	ENSP00000269243:K1216T;ENSP00000353590:K1247T;ENSP00000379539:K1237T;ENSP00000369315:K1232T	ENSP00000269243:K1216T	K	-	2	0	MYH10	8344873	1.000000	0.71417	0.132000	0.22025	0.733000	0.41908	4.643000	0.61390	1.954000	0.56735	0.533000	0.62120	AAG	.	.	.	none		0.542	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
DNAH9	1770	hgsc.bcm.edu	37	17	11696924	11696924	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr17:11696924A>T	ENST00000262442.4	+	42	8234	c.8166A>T	c.(8164-8166)gaA>gaT	p.E2722D	DNAH9_ENST00000454412.2_Missense_Mutation_p.E2722D	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2722					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGGTAGAAGAAAAGGACTTTG	0.348																																					p.E2722D		Atlas-SNP	.											.	DNAH9	695	.	0			c.A8166T						PASS	.						118.0	120.0	119.0					17																	11696924		2203	4300	6503	SO:0001583	missense	1770	exon42			AGAAGAAAAGGAC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8166A>T	chr17.hg19:g.11696924A>T	ENSP00000262442:p.Glu2722Asp	137.0	0.0	.		160.0	55.0	.	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	7.177	0.588782	0.13812	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.39997	1.05;1.05	5.76	2.04	0.26737	.	0.172799	0.50627	D	0.000109	T	0.24547	0.0595	L	0.31065	0.9	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.06127	-1.0844	10	0.13470	T	0.59	.	7.0036	0.24823	0.7388:0.1231:0.1382:0.0	.	2722	Q9NYC9	DYH9_HUMAN	D	2722;2722;1304	ENSP00000262442:E2722D;ENSP00000414874:E2722D	ENSP00000262442:E2722D	E	+	3	2	DNAH9	11637649	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	0.979000	0.29500	0.394000	0.25230	-0.264000	0.10439	GAA	.	.	.	none		0.348	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
PCGF2	7703	hgsc.bcm.edu	37	17	36891741	36891741	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr17:36891741T>C	ENST00000580830.1	-	12	1471	c.770A>G	c.(769-771)gAg>gGg	p.E257G	PCGF2_ENST00000360797.2_Missense_Mutation_p.E257G|PCGF2_ENST00000579882.1_Nonstop_Mutation_p.*258W|PCGF2_ENST00000585100.1_Nonstop_Mutation_p.*258W|PCGF2_ENST00000581345.1_Missense_Mutation_p.E257G|PCGF2_ENST00000578109.1_Nonstop_Mutation_p.*204W			P35227	PCGF2_HUMAN	polycomb group ring finger 2	257	Pro/Ser-rich.				anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					GCTGACTGACTCACACTCGGA	0.687											OREG0024367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E257G		Atlas-SNP	.											.	PCGF2	24	.	0			c.A770G						PASS	.						20.0	18.0	18.0					17																	36891741		2193	4292	6485	SO:0001583	missense	7703	exon11			ACTGACTCACACT	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.770A>G	chr17.hg19:g.36891741T>C	ENSP00000461961:p.Glu257Gly	51.0	0.0	.	866	50.0	25.0	.	NM_007144	A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	hg19	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.144822	0.57044	.	.	ENSG00000056661	ENST00000360797	T	0.33654	1.4	4.82	4.82	0.62117	.	0.057727	0.64402	D	0.000002	T	0.33644	0.0870	L	0.29908	0.895	0.49483	D	0.999793	D	0.55605	0.972	P	0.47673	0.554	T	0.12477	-1.0546	10	0.54805	T	0.06	-25.0052	13.3514	0.60603	0.0:0.0:0.0:1.0	.	257	P35227	PCGF2_HUMAN	G	257	ENSP00000354033:E257G	ENSP00000354033:E257G	E	-	2	0	PCGF2	34145267	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.130000	0.77235	2.035000	0.60131	0.459000	0.35465	GAG	.	.	.	none		0.687	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144	
ACSF2	80221	hgsc.bcm.edu	37	17	48541192	48541192	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr17:48541192T>C	ENST00000300441.4	+	9	1164	c.1060T>C	c.(1060-1062)Tat>Cat	p.Y354H	ACSF2_ENST00000427954.2_Missense_Mutation_p.Y379H|ACSF2_ENST00000502667.1_Missense_Mutation_p.Y341H|ACSF2_ENST00000504392.1_Missense_Mutation_p.Y311H|ACSF2_ENST00000541920.1_Missense_Mutation_p.Y194H	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	354					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CACCTTCCTGTATGGTACCCC	0.552																																					p.Y354H		Atlas-SNP	.											.	ACSF2	46	.	0			c.T1060C						PASS	.						140.0	135.0	137.0					17																	48541192		2203	4300	6503	SO:0001583	missense	80221	exon9			TTCCTGTATGGTA	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1060T>C	chr17.hg19:g.48541192T>C	ENSP00000300441:p.Tyr354His	59.0	0.0	.		70.0	17.0	.	NM_025149	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	ENST00000300441.4	hg19	CCDS11567.1	.	.	.	.	.	.	.	.	.	.	T	10.66	1.413740	0.25465	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	4.8	4.8	0.61643	AMP-dependent synthetase/ligase (1);	0.125162	0.56097	D	0.000030	T	0.41073	0.1143	L	0.28274	0.84	0.47698	D	0.999499	P;P;P;P	0.42357	0.632;0.777;0.632;0.632	P;P;P;P	0.53266	0.582;0.722;0.582;0.582	T	0.31752	-0.9932	10	0.07813	T	0.8	-5.2894	7.5258	0.27653	0.0:0.1322:0.0:0.8678	.	341;379;311;354	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	H	354;194;311;379;341	ENSP00000300441:Y354H;ENSP00000437987:Y194H;ENSP00000425964:Y311H;ENSP00000401831:Y379H;ENSP00000421884:Y341H	ENSP00000300441:Y354H	Y	+	1	0	ACSF2	45896191	0.981000	0.34729	0.997000	0.53966	0.768000	0.43524	3.223000	0.51231	2.016000	0.59253	0.533000	0.62120	TAT	.	.	.	none		0.552	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367423.3	NM_025149	
ALPK2	115701	hgsc.bcm.edu	37	18	56246675	56246675	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr18:56246675C>T	ENST00000361673.3	-	4	1546	c.1333G>A	c.(1333-1335)Gaa>Aaa	p.E445K	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	445						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CTCCCCTGTTCTGTCACTGAA	0.522											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E445K		Atlas-SNP	.											.	ALPK2	487	.	0			c.G1333A						PASS	.						119.0	119.0	119.0					18																	56246675		2203	4300	6503	SO:0001583	missense	115701	exon4			CCTGTTCTGTCAC	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1333G>A	chr18.hg19:g.56246675C>T	ENSP00000354991:p.Glu445Lys	111.0	0.0	.	1014	90.0	36.0	.	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	hg19	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742506	0.30865	.	.	ENSG00000198796	ENST00000361673	T	0.51817	0.69	5.39	5.39	0.77823	.	1.454940	0.04982	N	0.465878	T	0.41696	0.1170	L	0.34521	1.04	0.09310	N	1	P	0.38922	0.651	B	0.33521	0.165	T	0.41395	-0.9511	10	0.87932	D	0	-2.3006	12.1567	0.54081	0.0:0.9211:0.0:0.0789	.	445	Q86TB3	ALPK2_HUMAN	K	445	ENSP00000354991:E445K	ENSP00000354991:E445K	E	-	1	0	ALPK2	54397655	0.869000	0.29996	0.009000	0.14445	0.219000	0.24729	1.808000	0.38912	2.542000	0.85734	0.561000	0.74099	GAA	.	.	.	none		0.522	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
MUC16	94025	hgsc.bcm.edu	37	19	8993026	8993026	+	Silent	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr19:8993026G>A	ENST00000397910.4	-	67	41936	c.41733C>T	c.(41731-41733)agC>agT	p.S13911S	MUC16_ENST00000380951.5_Silent_p.S552S	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13936				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGGTACAGAGCTCCGATGGG	0.537																																					p.S13911S		Atlas-SNP	.											.	MUC16	4315	.	0			c.C41733T						PASS	.						129.0	118.0	121.0					19																	8993026		1912	4130	6042	SO:0001819	synonymous_variant	94025	exon67			TACAGAGCTCCGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41733C>T	chr19.hg19:g.8993026G>A		59.0	0.0	.		72.0	20.0	.	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	3.206	-0.162630	0.06502	.	.	ENSG00000181143	ENST00000542240	.	.	.	2.64	-1.81	0.07882	.	.	.	.	.	T	0.25680	0.0625	.	.	.	.	.	.	.	.	.	.	.	.	T	0.30119	-0.9989	3	.	.	.	.	2.8138	0.05450	0.2886:0.0:0.496:0.2154	.	.	.	.	V	751	.	.	A	-	2	0	MUC16	8854026	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	-0.235000	0.09016	-0.398000	0.07679	0.400000	0.26472	GCT	.	.	.	none		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
BRD4	23476	hgsc.bcm.edu	37	19	15349622	15349622	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr19:15349622G>A	ENST00000263377.2	-	19	4173	c.3952C>T	c.(3952-3954)Cag>Tag	p.Q1318*	AC004257.3_ENST00000602793.1_lincRNA	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1318	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			AGCATGGACTGGGGCTGGGAG	0.697			T	C15orf55	lethal midline carcinoma of young people																																p.Q1318X		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172	.	0			c.C3952T						PASS	.						10.0	13.0	12.0					19																	15349622		2197	4292	6489	SO:0001587	stop_gained	23476	exon19			TGGACTGGGGCTG	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3952C>T	chr19.hg19:g.15349622G>A	ENSP00000263377:p.Gln1318*	70.0	0.0	.		82.0	35.0	.	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Nonsense_Mutation	SNP	ENST00000263377.2	hg19	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	g	44	11.038961	0.99507	.	.	ENSG00000141867	ENST00000263377	.	.	.	5.16	5.16	0.70880	.	0.000000	0.47455	D	0.000226	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-17.7226	15.5799	0.76425	0.0:0.0:1.0:0.0	.	.	.	.	X	1318	.	ENSP00000263377:Q1318X	Q	-	1	0	BRD4	15210622	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.219000	0.89770	2.396000	0.81511	0.645000	0.84053	CAG	.	.	.	none		0.697	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
ACTN4	81	hgsc.bcm.edu	37	19	39214666	39214666	+	Silent	SNP	C	C	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr19:39214666C>T	ENST00000252699.2	+	14	1717	c.1641C>T	c.(1639-1641)gcC>gcT	p.A547A	ACTN4_ENST00000390009.3_Silent_p.A328A|ACTN4_ENST00000424234.2_Silent_p.A157A	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	547					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGAGAGCGCCATGGAGGACC	0.607																																					p.A547A	Colon(168;199 1940 10254 46213 46384)	Atlas-SNP	.											.	ACTN4	69	.	0			c.C1641T						PASS	.						57.0	59.0	59.0					19																	39214666		2203	4300	6503	SO:0001819	synonymous_variant	81	exon14			GAGCGCCATGGAG	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1641C>T	chr19.hg19:g.39214666C>T		40.0	0.0	.		43.0	14.0	.	NM_004924	A4K467|D6PXK4|O76048	Silent	SNP	ENST00000252699.2	hg19	CCDS12518.1																																																																																			.	.	.	none		0.607	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1		
APCDD1L	164284	hgsc.bcm.edu	37	20	57035951	57035951	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr20:57035951C>A	ENST00000371149.3	-	4	1631	c.1401G>T	c.(1399-1401)caG>caT	p.Q467H	APCDD1L_ENST00000491015.1_5'Flank|APCDD1L_ENST00000439429.1_Missense_Mutation_p.Q478H	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	467						integral component of membrane (GO:0016021)				large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			ATGGCCTGTGCTGCGGTGGCC	0.632																																					p.Q467H		Atlas-SNP	.											.	APCDD1L	48	.	0			c.G1401T						PASS	.						62.0	60.0	60.0					20																	57035951		2203	4300	6503	SO:0001583	missense	164284	exon4			CCTGTGCTGCGGT	AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.1401G>T	chr20.hg19:g.57035951C>A	ENSP00000360191:p.Gln467His	43.0	0.0	.		45.0	14.0	.	NM_153360		Missense_Mutation	SNP	ENST00000371149.3	hg19	CCDS13467.1	.	.	.	.	.	.	.	.	.	.	C	7.052	0.564739	0.13498	.	.	ENSG00000198768	ENST00000371149;ENST00000439429	T;T	0.14516	2.51;2.5	3.68	-4.72	0.03269	.	1.125310	0.06733	U	0.777012	T	0.06917	0.0176	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37663	-0.9696	10	0.41790	T	0.15	.	0.9016	0.01275	0.4548:0.1971:0.1255:0.2226	.	478;467	F5H6V6;Q8NCL9	.;APCDL_HUMAN	H	467;478	ENSP00000360191:Q467H;ENSP00000413261:Q478H	ENSP00000360191:Q467H	Q	-	3	2	APCDD1L	56469357	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.983000	0.03759	-1.079000	0.03113	-0.657000	0.03884	CAG	.	.	.	none		0.632	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
N6AMT1	29104	hgsc.bcm.edu	37	21	30257571	30257571	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr21:30257571A>T	ENST00000303775.5	-	1	122	c.97T>A	c.(97-99)Ttg>Atg	p.L33M	N6AMT1_ENST00000351429.3_Missense_Mutation_p.L33M	NM_013240.4	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1 (putative)	33					positive regulation of cell growth (GO:0030307)|protein methylation (GO:0006479)	protein complex (GO:0043234)	nucleic acid binding (GO:0003676)|protein methyltransferase activity (GO:0008276)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)	12						AGCGCGTTCAAAAGCAGAAAC	0.657																																					p.L33M		Atlas-SNP	.											.	N6AMT1	31	.	0			c.T97A						PASS	.						53.0	63.0	60.0					21																	30257571		2202	4296	6498	SO:0001583	missense	29104	exon1			CGTTCAAAAGCAG	AF139682	CCDS33525.1, CCDS33526.1	21q21.3	2006-12-14	2006-12-14	2006-12-14	ENSG00000156239	ENSG00000156239	2.1.1.72		16021	protein-coding gene	gene with protein product		614553	"""chromosome 21 open reading frame 127"", ""HemK methyltransferase family member 2"""	C21orf127, HEMK2			Standard	NM_013240		Approved	PRED28, N6AMT, MTQ2	uc002ymo.2	Q9Y5N5	OTTHUMG00000078750	ENST00000303775.5:c.97T>A	chr21.hg19:g.30257571A>T	ENSP00000303584:p.Leu33Met	68.0	0.0	.		95.0	43.0	.	NM_182749	Q96F73	Missense_Mutation	SNP	ENST00000303775.5	hg19	CCDS33526.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.454935	0.26161	.	.	ENSG00000156239	ENST00000303775;ENST00000351429	T;T	0.19806	2.37;2.12	5.18	0.254	0.15557	Methyltransferase small (1);	0.142986	0.49305	D	0.000141	T	0.15652	0.0377	L	0.39020	1.185	0.35178	D	0.772183	B;P	0.35944	0.295;0.529	B;B	0.38921	0.101;0.285	T	0.16012	-1.0417	10	0.46703	T	0.11	-9.2302	7.7917	0.29125	0.4453:0.0:0.5547:0.0	.	33;33	Q9Y5N5-2;Q9Y5N5	.;HEMK2_HUMAN	M	33	ENSP00000303584:L33M;ENSP00000286764:L33M	ENSP00000303584:L33M	L	-	1	2	N6AMT1	29179442	0.997000	0.39634	0.967000	0.41034	0.171000	0.22731	1.076000	0.30729	0.096000	0.17463	-1.013000	0.02462	TTG	.	.	.	none		0.657	N6AMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171738.1	NM_013240	
CHD8	57680	hgsc.bcm.edu	37	14	21860710	21860710	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr14:21860710delG	ENST00000557364.1	-	34	6990	c.6727delC	c.(6727-6729)cgcfs	p.R2244fs	SNORD9_ENST00000362566.1_RNA|CHD8_ENST00000399982.2_Frame_Shift_Del_p.R2244fs|CHD8_ENST00000555962.1_5'Flank|CHD8_ENST00000430710.3_Frame_Shift_Del_p.R1965fs			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2244					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ATGCCTCGGCGAAGTTTGGTG	0.522																																					p.R2243fs		Atlas-Indel,Pindel	.											.	CHD8	339	.	0			c.6728delG						PASS	.						146.0	150.0	149.0					14																	21860710		2091	4228	6319	SO:0001589	frameshift_variant	57680	exon33			.	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.6727delC	chr14.hg19:g.21860710delG	ENSP00000451601:p.Arg2244fs	82.0	0.0	0		80.0	22.0	0.275	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Frame_Shift_Del	DEL	ENST00000557364.1	hg19	CCDS53885.1																																																																																			.	.	.	none		0.522	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
MIB1	57534	hgsc.bcm.edu	37	18	19438539	19438539	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr18:19438539delA	ENST00000261537.6	+	20	3076	c.2812delA	c.(2812-2814)aagfs	p.K938fs	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	938					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			ACAAAAGGACAAGGATAATAC	0.299																																					p.D937fs		Atlas-Indel,Pindel	.											MIB1,NS,carcinoma,0,1	MIB1	87	.	0			c.2811delC						PASS	.						110.0	115.0	114.0					18																	19438539		2203	4299	6502	SO:0001589	frameshift_variant	57534	exon20			.	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2812delA	chr18.hg19:g.19438539delA	ENSP00000261537:p.Lys938fs	241.0	0.0	0		238.0	80.0	0.336134	NM_020774	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Frame_Shift_Del	DEL	ENST00000261537.6	hg19	CCDS11871.1																																																																																			.	.	.	none		0.299	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	
RPL18A	6142	hgsc.bcm.edu	37	19	17974057	17974058	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr19:17974057_17974058insA	ENST00000222247.5	+	5	597_598	c.516_517insA	c.(517-519)aacfs	p.N173fs	SNORA68_ENST00000384437.1_RNA|RPL18A_ENST00000599870.1_Frame_Shift_Ins_p.N144fs|RPL18A_ENST00000599898.1_Frame_Shift_Ins_p.N134fs|RPL18A_ENST00000600147.1_Frame_Shift_Ins_p.N151fs	NM_000980.3	NP_000971.1	Q02543	RL18A_HUMAN	ribosomal protein L18a	173					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(1)	5						CCAAGAGGCCCAACACCTTCTT	0.609																																					p.P172fs		Atlas-INDEL	.											.	RPL18A	15	.	0			c.516_517insA						PASS	.																																			SO:0001589	frameshift_variant	6142	exon5			.	AB007175	CCDS12367.1	19p13.11	2011-04-06			ENSG00000105640	ENSG00000105640		"""L ribosomal proteins"""	10311	protein-coding gene	gene with protein product	"""60S ribosomal protein L18a"", ""ribosomal protein L18a-like protein"""	604178				9582194	Standard	NM_000980		Approved	L18A	uc002nhp.3	Q02543		ENST00000222247.5:c.518dupA	chr19.hg19:g.17974059_17974059dupA	ENSP00000222247:p.Asn173fs	44.0	0.0	0		50.0	13.0	0.26	NM_000980		Frame_Shift_Ins	INS	ENST00000222247.5	hg19	CCDS12367.1																																																																																			.	.	.	none		0.609	RPL18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466679.1	NM_000980	
OR8B2	26595	hgsc.bcm.edu	37	11	124252506	124252516	+	Frame_Shift_Del	DEL	ACATGAGAGCT	ACATGAGAGCT	-	rs370946771		TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	ACATGAGAGCT	ACATGAGAGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr11:124252506_124252516delACATGAGAGCT	ENST00000375013.2	-	1	742_752	c.724_734delAGCTCTCATGT	c.(724-735)agctctcatgtcfs	p.SSHV242fs		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CAGAGCAATGACATGAGAGCTACAAGTACTG	0.384																																					p.242_245del		Atlas-Indel,Pindel	.											.	OR8B2	42	.	0			c.725_735del						PASS	.																																			SO:0001589	frameshift_variant	26595	exon1			.	AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.724_734delAGCTCTCATGT	chr11.hg19:g.124252506_124252516delACATGAGAGCT	ENSP00000364152:p.Ser242fs	196.0	0.0	0		219.0	35.0	0.159817	NM_001005468	Q8NGH2	Frame_Shift_Del	DEL	ENST00000375013.2	hg19	CCDS31708.1																																																																																			.	.	.	none		0.384	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387290.1	NM_001005468	
FBXO31	79791	hgsc.bcm.edu	37	16	87367551	87367551	+	Frame_Shift_Del	DEL	G	G	-	rs139174683	byFrequency	TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr16:87367551delG	ENST00000311635.7	-	8	1350	c.1338delC	c.(1336-1338)ttcfs	p.F446fs	RP11-178L8.4_ENST00000568879.1_Frame_Shift_Del_p.S110fs	NM_001282683.1|NM_024735.3	NP_001269612.1|NP_079011.3	Q5XUX0	FBX31_HUMAN	F-box protein 31	446					cellular response to DNA damage stimulus (GO:0006974)|cyclin catabolic process (GO:0008054)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0272)		CGGGCAGCACGAACGGCTGCC	0.677																																					p.V447fs		Atlas-Indel,Pindel	.											.	FBXO31	82	.	0			c.1339delG						PASS	.						32.0	39.0	37.0					16																	87367551		2196	4296	6492	SO:0001589	frameshift_variant	79791	exon8			.	BC002985	CCDS32501.1, CCDS73922.1	16q24	2008-12-18	2004-05-27			ENSG00000103264		"""F-boxes /  ""other"""""	16510	protein-coding gene	gene with protein product		609102	"""F-box only protein 31"""				Standard	NM_024735		Approved	FBX14, FBXO14, Fbx31, MGC15419	uc002fjw.3	Q5XUX0		ENST00000311635.7:c.1338delC	chr16.hg19:g.87367551delG	ENSP00000310841:p.Phe446fs	54.0	0.0	0		60.0	22.0	0.366667	NM_024735	Q5K680|Q8WYV1|Q96D73|Q9UFV4	Frame_Shift_Del	DEL	ENST00000311635.7	hg19	CCDS32501.1																																																																																			.	.	.	none		0.677	FBXO31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430799.2	NM_024735	
IFT80	57560	hgsc.bcm.edu	37	3	160018773	160018773	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr3:160018773delA	ENST00000326448.7	-	12	1645	c.1213delT	c.(1213-1215)tcafs	p.S406fs	IFT80_ENST00000496589.1_Frame_Shift_Del_p.S269fs|RP11-432B6.3_ENST00000483754.1_Frame_Shift_Del_p.S577fs|IFT80_ENST00000483465.1_Frame_Shift_Del_p.S269fs	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	406					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTTGGAGATGAAATAAAGCGC	0.318																																					p.S405fs		Atlas-Indel,Pindel	.											.	IFT80	68	.	0			c.1214delC						PASS	.						50.0	54.0	53.0					3																	160018773		2202	4292	6494	SO:0001589	frameshift_variant	57560	exon12			.	AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1213delT	chr3.hg19:g.160018773delA	ENSP00000312778:p.Ser406fs	252.0	0.0	0		325.0	167.0	0.513846	NM_020800	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Frame_Shift_Del	DEL	ENST00000326448.7	hg19	CCDS3188.1																																																																																			.	.	.	none		0.318	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
NAGLU	4669	hgsc.bcm.edu	37	17	40695970	40695970	+	Frame_Shift_Del	DEL	G	G	-	rs527236038		TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr17:40695970delG	ENST00000225927.2	+	6	2047	c.1946delG	c.(1945-1947)tggfs	p.W649fs	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	649			W -> C (in MPS3B; no enzyme activity; synthesizes a polypeptide with a molecular size similar to that of the wild-type). {ECO:0000269|PubMed:11153910}.		carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	CTGACCTTGTGGGGGCCAGAA	0.627																																					p.W649fs		Atlas-Indel,Pindel	.											.	NAGLU	36	.	0			c.1945delT						PASS	.						31.0	25.0	27.0					17																	40695970		2202	4300	6502	SO:0001589	frameshift_variant	4669	exon6			.		CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1946delG	chr17.hg19:g.40695970delG	ENSP00000225927:p.Trp649fs	29.0	0.0	0		33.0	16.0	0.484848	NM_000263		Frame_Shift_Del	DEL	ENST00000225927.2	hg19	CCDS11427.1																																																																																			.	.	.	none		0.627	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
SMYD4	114826	hgsc.bcm.edu	37	17	1704144	1704148	+	Frame_Shift_Del	DEL	CATCT	CATCT	-	rs139571127|rs372624455	byFrequency	TCGA-IA-A83W-01A-11D-A34Z-10	TCGA-IA-A83W-11A-11D-A34Z-10	CATCT	CATCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b5bc3d4-904a-4ece-a4fb-4263014e4b39	da2fe768-0f46-492c-99cc-6b417fd4a40c	g.chr17:1704144_1704148delCATCT	ENST00000305513.7	-	5	707_711	c.540_544delAGATG	c.(538-546)gcagatgtcfs	p.DV181fs		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	181							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						TGAGGGAGGACATCTGCTAGGGCTG	0.517																																					p.181_182del		Pindel	.											.	SMYD4	50	.	0			c.541_545del						PASS	.																																			SO:0001589	frameshift_variant	114826	exon5			.	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.540_544delAGATG	chr17.hg19:g.1704144_1704148delCATCT	ENSP00000304360:p.Asp181fs	121.0	0.0	.		109.0	31.0	0.284	NM_052928	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Frame_Shift_Del	DEL	ENST00000305513.7	hg19	CCDS11013.1																																																																																			.	.	.	none		0.517	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	XM_056082	
