#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	hgsc.bcm.edu	37	1	2418423	2418423	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:2418423G>A	ENST00000419816.2	+	6	1168	c.894G>A	c.(892-894)ggG>ggA	p.G298G	PLCH2_ENST00000449969.1_Silent_p.G271G|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378486.3_Silent_p.G298G|PLCH2_ENST00000378488.3_Silent_p.G298G			O75038	PLCH2_HUMAN	phospholipase C, eta 2	298					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		AGAGTAAGGGGCTGCTGGGCA	0.632																																					p.G298G		Atlas-SNP	.											.	PLCH2	131	.	0			c.G894A						PASS	.						55.0	59.0	57.0					1																	2418423		2096	4214	6310	SO:0001819	synonymous_variant	9651	exon6			TAAGGGGCTGCTG	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.894G>A	chr1.hg19:g.2418423G>A		52.0	0.0	.		45.0	10.0	.	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	ENST00000419816.2	hg19																																																																																				.	.	.	none		0.632	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
CASZ1	54897	hgsc.bcm.edu	37	1	10714628	10714628	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:10714628G>A	ENST00000377022.3	-	10	2003	c.1686C>T	c.(1684-1686)taC>taT	p.Y562Y	CASZ1_ENST00000344008.5_Silent_p.Y562Y|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	562					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		ACGTGCTCGTGTACACCTTGT	0.597																																					p.Y562Y		Atlas-SNP	.											.	CASZ1	150	.	0			c.C1686T						PASS	.						210.0	193.0	199.0					1																	10714628		2203	4300	6503	SO:0001819	synonymous_variant	54897	exon10			GCTCGTGTACACC	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.1686C>T	chr1.hg19:g.10714628G>A		158.0	0.0	.		165.0	52.0	.	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	ENST00000377022.3	hg19	CCDS41246.1																																																																																			.	.	.	none		0.597	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
KDM1A	23028	hgsc.bcm.edu	37	1	23380289	23380289	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:23380289G>A	ENST00000356634.3	+	4	836	c.687G>A	c.(685-687)ctG>ctA	p.L229L	RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000400181.4_Silent_p.L249L|KDM1A_ENST00000542151.1_Silent_p.L249L	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	229	SWIRM. {ECO:0000255|PROSITE- ProRule:PRU00247}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AGATTCAGCTGACATTTGAGG	0.323																																					p.L249L		Atlas-SNP	.											.	KDM1A	49	.	0			c.G747A						PASS	.						92.0	84.0	87.0					1																	23380289		2203	4300	6503	SO:0001819	synonymous_variant	23028	exon5			TCAGCTGACATTT	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.687G>A	chr1.hg19:g.23380289G>A		314.0	1.0	.		133.0	47.0	.	NM_001009999	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Silent	SNP	ENST00000356634.3	hg19	CCDS30627.1																																																																																			.	.	.	none		0.323	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013	
TESK2	10420	hgsc.bcm.edu	37	1	45812448	45812448	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:45812448A>T	ENST00000372086.3	-	9	1196	c.796T>A	c.(796-798)Ttc>Atc	p.F266I	TESK2_ENST00000538496.1_Missense_Mutation_p.F183I|TESK2_ENST00000341771.6_Intron|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Intron	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					TCCAGCCCGAAATTCTGTGGA	0.502																																					p.F266I		Atlas-SNP	.											.	TESK2	60	.	0			c.T796A						PASS	.						79.0	82.0	81.0					1																	45812448		1949	4153	6102	SO:0001583	missense	10420	exon9			GCCCGAAATTCTG	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.796T>A	chr1.hg19:g.45812448A>T	ENSP00000361158:p.Phe266Ile	107.0	0.0	.		116.0	47.0	.	NM_007170	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	ENST00000372086.3	hg19	CCDS41323.1	.	.	.	.	.	.	.	.	.	.	A	34	5.297190	0.95574	.	.	ENSG00000070759	ENST00000372086;ENST00000372083;ENST00000538496	D;D	0.81579	-1.51;-1.51	6.08	6.08	0.98989	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.86573	0.5965	L	0.42581	1.335	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87288	0.2297	10	0.62326	D	0.03	-8.8357	16.6438	0.85155	1.0:0.0:0.0:0.0	.	266	Q96S53	TESK2_HUMAN	I	266;250;183	ENSP00000361158:F266I;ENSP00000441746:F183I	ENSP00000361155:F250I	F	-	1	0	TESK2	45585035	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.317000	0.96327	2.333000	0.79357	0.533000	0.62120	TTC	.	.	.	none		0.502	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170	
MCOLN3	55283	hgsc.bcm.edu	37	1	85506767	85506767	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:85506767C>G	ENST00000370589.2	-	3	374	c.322G>C	c.(322-324)Gac>Cac	p.D108H	MCOLN3_ENST00000341115.4_Intron|MCOLN3_ENST00000370587.1_Missense_Mutation_p.D108H|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	108					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		TCCATTCGGTCCATATATCCT	0.378																																					p.D108H		Atlas-SNP	.											.	MCOLN3	74	.	0			c.G322C						PASS	.						235.0	209.0	217.0					1																	85506767		2203	4300	6503	SO:0001583	missense	55283	exon3			TTCGGTCCATATA	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.322G>C	chr1.hg19:g.85506767C>G	ENSP00000359621:p.Asp108His	213.0	0.0	.		125.0	44.0	.	NM_018298	Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	ENST00000370589.2	hg19	CCDS701.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712652	0.68730	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370587	T;T	0.62364	0.03;0.03	5.76	5.76	0.90799	.	0.048278	0.85682	D	0.000000	T	0.77239	0.4101	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.69824	0.966;0.965	T	0.77608	-0.2524	10	0.56958	D	0.05	-2.0809	19.9857	0.97347	0.0:1.0:0.0:0.0	.	108;108	B1ANB7;Q8TDD5	.;MCLN3_HUMAN	H	108	ENSP00000359621:D108H;ENSP00000359619:D108H	ENSP00000304843:D108H	D	-	1	0	MCOLN3	85279355	1.000000	0.71417	0.506000	0.27664	0.660000	0.38997	5.767000	0.68850	2.706000	0.92434	0.655000	0.94253	GAC	.	.	.	none		0.378	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
TRIM45	80263	hgsc.bcm.edu	37	1	117660955	117660955	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:117660955T>G	ENST00000256649.4	-	2	1449	c.923A>C	c.(922-924)aAt>aCt	p.N308T	TRIM45_ENST00000369464.3_Missense_Mutation_p.N308T|TRIM45_ENST00000369461.3_Missense_Mutation_p.N251T	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	308					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		CTGCAGGGAATTTTCCTTCTG	0.567																																					p.N308T		Atlas-SNP	.											.	TRIM45	55	.	0			c.A923C						PASS	.						76.0	74.0	74.0					1																	117660955		2203	4300	6503	SO:0001583	missense	80263	exon2			AGGGAATTTTCCT		CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.923A>C	chr1.hg19:g.117660955T>G	ENSP00000256649:p.Asn308Thr	101.0	0.0	.		99.0	33.0	.	NM_001145635	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Missense_Mutation	SNP	ENST00000256649.4	hg19	CCDS893.1	.	.	.	.	.	.	.	.	.	.	T	10.44	1.352209	0.24512	.	.	ENSG00000134253	ENST00000256649;ENST00000369464;ENST00000369461	D;D;D	0.85629	-2.01;-2.01;-2.01	5.11	3.96	0.45880	.	0.242716	0.47852	N	0.000216	T	0.66557	0.2801	L	0.35723	1.085	0.44254	D	0.997108	B;B	0.16802	0.019;0.011	B;B	0.15870	0.014;0.006	T	0.63594	-0.6602	10	0.37606	T	0.19	-26.5032	11.6751	0.51425	0.0:0.0:0.1477:0.8522	.	308;308	Q9H8W5-2;Q9H8W5	.;TRI45_HUMAN	T	308;308;251	ENSP00000256649:N308T;ENSP00000358476:N308T;ENSP00000358473:N251T	ENSP00000256649:N308T	N	-	2	0	TRIM45	117462478	1.000000	0.71417	0.823000	0.32752	0.520000	0.34377	2.680000	0.46918	0.932000	0.37266	0.533000	0.62120	AAT	.	.	.	none		0.567	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033503.1	NM_025188	
ZNF281	23528	hgsc.bcm.edu	37	1	200378264	200378264	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:200378264C>T	ENST00000294740.3	-	2	694	c.570G>A	c.(568-570)caG>caA	p.Q190Q	ZNF281_ENST00000367353.1_Silent_p.Q190Q|ZNF281_ENST00000367352.3_Silent_p.Q154Q	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	190					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						CACGGTGGTGCTGGGCTGGTT	0.562																																					p.Q190Q		Atlas-SNP	.											.	ZNF281	74	.	0			c.G570A						PASS	.						101.0	97.0	98.0					1																	200378264		2203	4300	6503	SO:0001819	synonymous_variant	23528	exon2			GTGGTGCTGGGCT	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.570G>A	chr1.hg19:g.200378264C>T		78.0	0.0	.		87.0	35.0	.	NM_012482	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Silent	SNP	ENST00000294740.3	hg19	CCDS1402.1																																																																																			.	.	.	none		0.562	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482	
LBR	3930	hgsc.bcm.edu	37	1	225600280	225600280	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:225600280A>C	ENST00000338179.2	-	8	1085	c.960T>G	c.(958-960)caT>caG	p.H320Q	AC092811.1_ENST00000366845.2_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.H320Q	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	320					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		TGTACACGTAATGAAACTCTA	0.413																																					p.H320Q		Atlas-SNP	.											.	LBR	54	.	0			c.T960G						PASS	.						79.0	80.0	80.0					1																	225600280		2203	4300	6503	SO:0001583	missense	3930	exon8			CACGTAATGAAAC	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.960T>G	chr1.hg19:g.225600280A>C	ENSP00000339883:p.His320Gln	540.0	1.0	.		407.0	97.0	.	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	hg19	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.434732	0.25813	.	.	ENSG00000143815	ENST00000272163;ENST00000338179	D;D	0.97811	-4.55;-4.55	6.07	-0.357	0.12579	.	1.680490	0.02408	N	0.081343	D	0.92440	0.7600	N	0.04203	-0.255	0.09310	N	1	B	0.23128	0.08	B	0.18263	0.021	D	0.86742	0.1955	10	0.29301	T	0.29	3.4658	9.9056	0.41375	0.6743:0.0:0.3257:0.0	.	320	Q14739	LBR_HUMAN	Q	320	ENSP00000272163:H320Q;ENSP00000339883:H320Q	ENSP00000272163:H320Q	H	-	3	2	LBR	223666903	0.080000	0.21391	0.000000	0.03702	0.029000	0.11900	0.526000	0.22971	-0.299000	0.08909	0.533000	0.62120	CAT	.	.	.	none		0.413	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
GMCL1	64395	hgsc.bcm.edu	37	2	70096993	70096993	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:70096993T>G	ENST00000282570.3	+	12	1612	c.1361T>G	c.(1360-1362)tTt>tGt	p.F454C		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	454					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						AGCATAGCATTTAGGTAGGAT	0.398																																					p.F454C		Atlas-SNP	.											.	GMCL1	50	.	0			c.T1361G						PASS	.						138.0	118.0	125.0					2																	70096993		2203	4300	6503	SO:0001583	missense	64395	exon12			TAGCATTTAGGTA	AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.1361T>G	chr2.hg19:g.70096993T>G	ENSP00000282570:p.Phe454Cys	63.0	0.0	.		56.0	20.0	.	NM_178439	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	ENST00000282570.3	hg19	CCDS1895.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.723230	0.48728	.	.	ENSG00000087338	ENST00000282570	T	0.56103	0.48	5.22	5.22	0.72569	.	0.108148	0.64402	D	0.000004	T	0.63534	0.2519	L	0.44542	1.39	0.46113	D	0.99887	D	0.76494	0.999	D	0.70227	0.968	T	0.64478	-0.6398	10	0.51188	T	0.08	-38.9046	13.3387	0.60533	0.0:0.0:0.0:1.0	.	454	Q96IK5	GMCL1_HUMAN	C	454	ENSP00000282570:F454C	ENSP00000282570:F454C	F	+	2	0	GMCL1	69950497	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.799000	0.55529	2.090000	0.63153	0.533000	0.62120	TTT	.	.	.	none		0.398	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439	
CFAP221	200373	hgsc.bcm.edu	37	2	120362785	120362785	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:120362785A>C	ENST00000413369.3	+	11	1140	c.1053A>C	c.(1051-1053)aaA>aaC	p.K351N	PCDP1_ENST00000602047.1_Missense_Mutation_p.K65N|PCDP1_ENST00000597189.1_3'UTR	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					AAATTTCAAAAACGAGACAGA	0.383																																					p.K351N		Atlas-SNP	.											.	.	.	.	0			c.A1053C						PASS	.						67.0	70.0	69.0					2																	120362785		2203	4300	6503	SO:0001583	missense	0	exon11			TTCAAAAACGAGA																												ENST00000413369.3:c.1053A>C	chr2.hg19:g.120362785A>C	ENSP00000393222:p.Lys351Asn	419.0	0.0	.		280.0	80.0	.	NM_001271049		Missense_Mutation	SNP	ENST00000413369.3	hg19	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	A	14.44	2.535164	0.45176	.	.	ENSG00000163075	ENST00000295220;ENST00000413369	T	0.19938	2.11	5.22	2.87	0.33458	.	0.239906	0.36338	N	0.002660	T	0.12433	0.0302	L	0.34521	1.04	0.80722	D	1	P;B	0.35011	0.48;0.291	B;B	0.27715	0.082;0.082	T	0.13872	-1.0493	10	0.27082	T	0.32	-25.951	8.4885	0.33086	0.8403:0.0:0.1597:0.0	.	195;351	Q4G0U5-3;Q4G0U5	.;PCDP1_HUMAN	N	65;351	ENSP00000393222:K351N	ENSP00000295220:K65N	K	+	3	2	AC069154.2	120079255	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.660000	0.37397	0.460000	0.27045	0.533000	0.62120	AAA	.	.	.	none		0.383	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
PTPN23	25930	hgsc.bcm.edu	37	3	47452317	47452317	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:47452317C>G	ENST00000265562.4	+	20	3106	c.3029C>G	c.(3028-3030)cCg>cGg	p.P1010R	PTPN23_ENST00000431726.1_Missense_Mutation_p.P884R	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1010	His.|Pro-rich.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGGGGCAGCCGCCACCCCCC	0.687																																					p.P1010R		Atlas-SNP	.											.	PTPN23	85	.	0			c.C3029G						PASS	.						15.0	20.0	18.0					3																	47452317		2139	4247	6386	SO:0001583	missense	25930	exon20			GGCAGCCGCCACC	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.3029C>G	chr3.hg19:g.47452317C>G	ENSP00000265562:p.Pro1010Arg	108.0	0.0	.		130.0	35.0	.	NM_015466	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	hg19	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923200	0.33908	.	.	ENSG00000076201	ENST00000265562	T	0.02763	4.17	4.29	3.18	0.36537	.	0.362779	0.25154	N	0.032736	T	0.02342	0.0072	N	0.19112	0.55	0.41800	D	0.989917	P;P	0.37824	0.609;0.609	B;B	0.39738	0.308;0.308	T	0.62310	-0.6881	10	0.37606	T	0.19	-4.7843	6.2976	0.21095	0.0:0.6978:0.0:0.3022	.	884;1010	B4DST5;Q9H3S7	.;PTN23_HUMAN	R	1010	ENSP00000265562:P1010R	ENSP00000265562:P1010R	P	+	2	0	PTPN23	47427321	0.000000	0.05858	0.892000	0.35008	0.632000	0.37999	0.244000	0.18124	0.976000	0.38417	0.557000	0.71058	CCG	.	.	.	none		0.687	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466	
IL17RD	54756	hgsc.bcm.edu	37	3	57136553	57136553	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:57136553C>T	ENST00000296318.7	-	10	1021	c.933G>A	c.(931-933)tcG>tcA	p.S311S	IL17RD_ENST00000320057.5_Silent_p.S167S|IL17RD_ENST00000463523.1_Silent_p.S167S|IL17RD_ENST00000427856.2_Silent_p.S287S	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	311					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		TCGCGAATGCCGATATGACTA	0.547																																					p.S311S		Atlas-SNP	.											.	IL17RD	93	.	0			c.G933A						PASS	.						70.0	69.0	69.0					3																	57136553		2203	4300	6503	SO:0001819	synonymous_variant	54756	exon10			GAATGCCGATATG	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.933G>A	chr3.hg19:g.57136553C>T		145.0	0.0	.		138.0	37.0	.	NM_017563	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Silent	SNP	ENST00000296318.7	hg19	CCDS2880.2																																																																																			.	.	.	none		0.547	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
DNAJC13	23317	hgsc.bcm.edu	37	3	132207851	132207851	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:132207851T>C	ENST00000260818.6	+	31	3702	c.3454T>C	c.(3454-3456)Ttc>Ctc	p.F1152L		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1152					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CAAACAGGCTTTCAAGTCAGA	0.333																																					p.F1152L		Atlas-SNP	.											.	DNAJC13	253	.	0			c.T3454C						PASS	.						64.0	65.0	64.0					3																	132207851		2203	4300	6503	SO:0001583	missense	23317	exon31			CAGGCTTTCAAGT	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.3454T>C	chr3.hg19:g.132207851T>C	ENSP00000260818:p.Phe1152Leu	106.0	0.0	.		44.0	13.0	.	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	hg19	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.653771	0.88056	.	.	ENSG00000138246	ENST00000260818	T	0.18174	2.23	5.57	5.57	0.84162	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.16171	0.0389	L	0.47716	1.5	0.80722	D	1	P	0.52463	0.953	B	0.39217	0.294	T	0.04708	-1.0932	10	0.25106	T	0.35	.	15.7007	0.77538	0.0:0.0:0.0:1.0	.	1152	O75165	DJC13_HUMAN	L	1152	ENSP00000260818:F1152L	ENSP00000260818:F1152L	F	+	1	0	DNAJC13	133690541	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.807000	0.75201	2.236000	0.73375	0.528000	0.53228	TTC	.	.	.	none		0.333	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
WHSC1	7468	hgsc.bcm.edu	37	4	1977074	1977074	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:1977074G>C	ENST00000382895.3	+	22	3999	c.3568G>C	c.(3568-3570)Gtc>Ctc	p.V1190L	WHSC1_ENST00000382888.3_Missense_Mutation_p.V538L|WHSC1_ENST00000382892.2_Missense_Mutation_p.V1190L|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382891.5_Missense_Mutation_p.V1190L|WHSC1_ENST00000508803.1_Missense_Mutation_p.V1190L|SCARNA22_ENST00000503991.1_RNA	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1190	Post-SET. {ECO:0000255|PROSITE- ProRule:PRU00155}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TGAAAAAACGGTCTGCCGGTG	0.532			T	IGH@	MM																																p.V1190L		Atlas-SNP	.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1	180	.	0			c.G3568C						PASS	.						101.0	93.0	96.0					4																	1977074		2203	4300	6503	SO:0001583	missense	7468	exon20			AAAACGGTCTGCC	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3568G>C	chr4.hg19:g.1977074G>C	ENSP00000372351:p.Val1190Leu	99.0	0.0	.		111.0	24.0	.	NM_133335	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	hg19	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627438	0.46944	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.97066	-3.61;-3.61;-3.61;-3.61;-4.23	4.91	4.91	0.64330	Post-SET domain (2);	0.000000	0.49916	D	0.000140	D	0.93523	0.7933	L	0.42008	1.315	0.80722	D	1	B;B	0.30361	0.009;0.277	B;B	0.21151	0.012;0.033	D	0.91080	0.4899	10	0.30854	T	0.27	.	12.0537	0.53522	0.0793:0.0:0.9207:0.0	.	538;1190	A2A2T2;O96028	.;NSD2_HUMAN	L	1190;1190;1190;1190;538	ENSP00000423972:V1190L;ENSP00000372347:V1190L;ENSP00000372348:V1190L;ENSP00000372351:V1190L;ENSP00000372344:V538L	ENSP00000372344:V538L	V	+	1	0	WHSC1	1946872	1.000000	0.71417	0.974000	0.42286	0.874000	0.50279	5.102000	0.64572	2.719000	0.93026	0.655000	0.94253	GTC	.	.	.	none		0.532	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
WDR19	57728	hgsc.bcm.edu	37	4	39205336	39205336	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:39205336A>C	ENST00000399820.3	+	7	751	c.597A>C	c.(595-597)gaA>gaC	p.E199D	WDR19_ENST00000288634.7_Missense_Mutation_p.E39D|WDR19_ENST00000506503.1_Missense_Mutation_p.E199D	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	199					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						CTGCTGCTGAAAGCATGGTAA	0.353																																					p.E199D		Atlas-SNP	.											.	WDR19	96	.	0			c.A597C						PASS	.						92.0	83.0	86.0					4																	39205336		1872	4111	5983	SO:0001583	missense	57728	exon7			TGCTGAAAGCATG	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.597A>C	chr4.hg19:g.39205336A>C	ENSP00000382717:p.Glu199Asp	133.0	0.0	.		66.0	21.0	.	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	hg19	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.488399	0.44249	.	.	ENSG00000157796	ENST00000399820;ENST00000509560;ENST00000512112;ENST00000288634;ENST00000506503;ENST00000399836	T;T;T;T	0.66099	3.42;2.2;-0.19;3.42	5.64	1.62	0.23740	WD40 repeat-like-containing domain (1);	0.134922	0.64402	D	0.000003	T	0.51941	0.1704	M	0.64080	1.96	0.38720	D	0.953425	B;B	0.19445	0.002;0.036	B;B	0.20767	0.007;0.031	T	0.38714	-0.9648	10	0.23891	T	0.37	-17.3314	6.2227	0.20691	0.6749:0.1242:0.2008:0.0	.	199;199	Q8NEZ3;D6R9P6	WDR19_HUMAN;.	D	199;140;39;39;199;198	ENSP00000382717:E199D;ENSP00000426918:E140D;ENSP00000288634:E39D;ENSP00000423491:E199D	ENSP00000288634:E39D	E	+	3	2	WDR19	38881731	1.000000	0.71417	0.974000	0.42286	0.955000	0.61496	0.886000	0.28241	0.111000	0.17947	0.455000	0.32223	GAA	.	.	.	none		0.353	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
EXOC1	55763	hgsc.bcm.edu	37	4	56737307	56737307	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:56737307A>C	ENST00000381295.2	+	7	1220	c.872A>C	c.(871-873)cAg>cCg	p.Q291P	EXOC1_ENST00000349598.6_Missense_Mutation_p.Q291P|EXOC1_ENST00000346134.7_Missense_Mutation_p.Q291P	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	291					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					AAGGCCCTTCAGGAAGGAGAT	0.453																																					p.Q291P		Atlas-SNP	.											.	EXOC1	103	.	0			c.A872C						PASS	.						95.0	83.0	87.0					4																	56737307		2203	4300	6503	SO:0001583	missense	55763	exon7			CCCTTCAGGAAGG	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.872A>C	chr4.hg19:g.56737307A>C	ENSP00000370695:p.Gln291Pro	98.0	0.0	.		53.0	18.0	.	NM_018261	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	hg19	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	A	14.67	2.604708	0.46423	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.97	4.77	0.60923	.	0.224009	0.46758	D	0.000269	T	0.57489	0.2057	L	0.53249	1.67	0.54753	D	0.999985	P;P	0.47191	0.891;0.626	P;P	0.46885	0.466;0.53	T	0.54200	-0.8329	9	0.30854	T	0.27	.	12.5014	0.55957	0.8746:0.0:0.0:0.1254	.	291;291	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	P	291	.	ENSP00000326514:Q291P	Q	+	2	0	EXOC1	56432064	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	5.837000	0.69381	1.053000	0.40415	-0.480000	0.04831	CAG	.	.	.	none		0.453	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
PABPC4L	132430	hgsc.bcm.edu	37	4	135121148	135121148	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:135121148C>A	ENST00000421491.3	-	2	1283	c.1027G>T	c.(1027-1029)Gag>Tag	p.E343*	PABPC4L_ENST00000529122.2_Nonsense_Mutation_p.E401*			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	343	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						GTAGCATCCTCAGGAGAGGAG	0.458																																					p.E401X		Atlas-SNP	.											.	PABPC4L	60	.	0			c.G1201T						PASS	.						113.0	94.0	100.0					4																	135121148		692	1591	2283	SO:0001587	stop_gained	132430	exon2			CATCCTCAGGAGA	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.1027G>T	chr4.hg19:g.135121148C>A	ENSP00000463233:p.Glu343*	146.0	0.0	.		105.0	29.0	.	NM_001114734		Nonsense_Mutation	SNP	ENST00000421491.3	hg19																																																																																				.	.	.	none		0.458	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
DDX60L	91351	hgsc.bcm.edu	37	4	169315621	169315621	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:169315621T>A	ENST00000511577.1	-	28	4052	c.3805A>T	c.(3805-3807)Att>Ttt	p.I1269F	DDX60L_ENST00000260184.7_Missense_Mutation_p.I1269F|DDX60L_ENST00000505890.1_Missense_Mutation_p.I1270F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1269	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CCTACCCTAATAAGCCCTTTT	0.323																																					p.I1269F		Atlas-SNP	.											.	DDX60L	116	.	0			c.A3805T						PASS	.						67.0	62.0	63.0					4																	169315621		1803	4068	5871	SO:0001583	missense	91351	exon28			CCCTAATAAGCCC	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.3805A>T	chr4.hg19:g.169315621T>A	ENSP00000422423:p.Ile1269Phe	95.0	0.0	.		46.0	12.0	.	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.62|13.62	2.293047|2.293047	0.40594|0.40594	.|.	.|.	ENSG00000181381|ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890|ENST00000514580	T;T;T|.	0.59224|.	0.28;0.28;0.28|.	3.16|3.16	1.95|1.95	0.26073|0.26073	Helicase, C-terminal (3);|.	0.000000|.	0.36591|.	U|.	0.002501|.	T|T	0.60183|0.60183	0.2249|0.2249	M|M	0.87682|0.87682	2.9|2.9	0.09310|0.09310	N|N	0.999999|0.999999	D;D|.	0.71674|.	0.994;0.998|.	D;D|.	0.65773|.	0.922;0.938|.	T|T	0.52961|0.52961	-0.8505|-0.8505	10|5	0.66056|.	D|.	0.02|.	.|.	7.0872|7.0872	0.25264|0.25264	0.0:0.118:0.0:0.882|0.0:0.118:0.0:0.882	.|.	1270;1269|.	D6R906;Q5H9U9|.	.;DDX6L_HUMAN|.	F|F	1269;1269;1270|156	ENSP00000260184:I1269F;ENSP00000422423:I1269F;ENSP00000422202:I1270F|.	ENSP00000260184:I1269F|.	I|Y	-|-	1|2	0|0	DDX60L|DDX60L	169552196|169552196	0.721000|0.721000	0.28007|0.28007	0.002000|0.002000	0.10522|0.10522	0.093000|0.093000	0.18481|0.18481	1.244000|1.244000	0.32778|0.32778	0.248000|0.248000	0.21435|0.21435	0.383000|0.383000	0.25322|0.25322	ATT|TAT	.	.	.	none		0.323	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
DMXL1	1657	hgsc.bcm.edu	37	5	118479556	118479556	+	Silent	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr5:118479556T>C	ENST00000311085.8	+	14	2477	c.2397T>C	c.(2395-2397)ttT>ttC	p.F799F	DMXL1_ENST00000539542.1_Silent_p.F799F	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	799										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GTGAAGTCTTTAACATCGTCA	0.299																																					p.F799F		Atlas-SNP	.											.	DMXL1	268	.	0			c.T2397C						PASS	.						110.0	116.0	114.0					5																	118479556		2201	4299	6500	SO:0001819	synonymous_variant	1657	exon14			AGTCTTTAACATC	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2397T>C	chr5.hg19:g.118479556T>C		601.0	1.0	.		303.0	97.0	.	NM_005509		Silent	SNP	ENST00000311085.8	hg19	CCDS4125.1																																																																																			.	.	.	none		0.299	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
MEGF10	84466	hgsc.bcm.edu	37	5	126705695	126705695	+	Splice_Site	SNP	G	G	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr5:126705695G>T	ENST00000274473.6	+	6	679		c.e6+1		MEGF10_ENST00000508365.1_Splice_Site|MEGF10_ENST00000418761.2_Splice_Site|MEGF10_ENST00000503335.2_Splice_Site	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10						homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGCTCCAGTGGTAAGTTTCCA	0.537																																					.		Atlas-SNP	.											.	MEGF10	152	.	0			c.412+1G>T						PASS	.						176.0	140.0	152.0					5																	126705695		2203	4300	6503	SO:0001630	splice_region_variant	84466	exon5			CCAGTGGTAAGTT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.412+1G>T	chr5.hg19:g.126705695G>T		33.0	0.0	.		42.0	13.0	.	NM_001256545	Q68DE5|Q8WUL3	Splice_Site	SNP	ENST00000274473.6	hg19	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749510	0.89753	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1131	0.93326	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MEGF10	126733594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.844000	0.99494	2.506000	0.84524	0.558000	0.71614	.	.	.	.	none		0.537	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	Intron
RAB11FIP1	80223	hgsc.bcm.edu	37	8	37729061	37729061	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr8:37729061G>C	ENST00000330843.4	-	4	3271	c.3259C>G	c.(3259-3261)Cct>Gct	p.P1087A	RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	1087					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			GATGTGCCAGGAGGCGGGCTT	0.552											OREG0018713	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1087A		Atlas-SNP	.											.	RAB11FIP1	105	.	0			c.C3259G						PASS	.						190.0	202.0	198.0					8																	37729061		2203	4300	6503	SO:0001583	missense	80223	exon4			TGCCAGGAGGCGG	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.3259C>G	chr8.hg19:g.37729061G>C	ENSP00000331342:p.Pro1087Ala	45.0	0.0	.	872	69.0	30.0	.	NM_001002814	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	hg19	CCDS34882.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.368051	0.24771	.	.	ENSG00000156675	ENST00000330843	T	0.11712	2.75	5.24	0.717	0.18196	.	0.271342	0.26499	N	0.024035	T	0.05823	0.0152	L	0.36672	1.1	0.09310	N	0.999994	P;B	0.37101	0.582;0.057	B;B	0.33392	0.163;0.02	T	0.32481	-0.9905	10	0.19590	T	0.45	-8.4888	3.2151	0.06696	0.4377:0.2192:0.3431:0.0	.	416;1087	Q67C35;Q6WKZ4	.;RFIP1_HUMAN	A	1087	ENSP00000331342:P1087A	ENSP00000331342:P1087A	P	-	1	0	RAB11FIP1	37848219	0.746000	0.28272	0.013000	0.15412	0.003000	0.03518	1.420000	0.34804	0.206000	0.20587	-0.136000	0.14681	CCT	.	.	.	none		0.552	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
DOCK8	81704	hgsc.bcm.edu	37	9	441958	441958	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:441958C>T	ENST00000453981.1	+	42	5551	c.5439C>T	c.(5437-5439)gtC>gtT	p.V1813V	DOCK8_ENST00000432829.2_Silent_p.V1745V|DOCK8_ENST00000382329.1_Silent_p.V1280V|DOCK8_ENST00000469391.1_Silent_p.V1713V			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1813	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGGAGTTTGTCTACAAAGAGC	0.403																																					p.V1813V		Atlas-SNP	.											.	DOCK8	401	.	0			c.C5439T						PASS	.						111.0	106.0	108.0					9																	441958		2203	4300	6503	SO:0001819	synonymous_variant	81704	exon42			GTTTGTCTACAAA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.5439C>T	chr9.hg19:g.441958C>T		141.0	0.0	.		83.0	35.0	.	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	ENST00000453981.1	hg19	CCDS6440.2																																																																																			.	.	.	none		0.403	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
SHB	6461	hgsc.bcm.edu	37	9	37956019	37956019	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:37956019A>G	ENST00000377707.3	-	4	1652	c.1087T>C	c.(1087-1089)Tcc>Ccc	p.S363P	RP11-613M10.9_ENST00000540557.1_3'UTR	NM_003028.2	NP_003019.2	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein B	363	Mediates interaction with LAT, PTK2/FAK1, JAK1 and JAK3.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(4)|lung(1)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)	11		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		GGTGAGGGGGATGACTGCCGC	0.602																																					p.S363P		Atlas-SNP	.											SHB,colon,carcinoma,0,1	SHB	31	.	0			c.T1087C						PASS	.						39.0	33.0	35.0					9																	37956019		1990	4146	6136	SO:0001583	missense	6461	exon4			AGGGGGATGACTG		CCDS43806.1	9p13.2	2013-09-23	2005-05-24		ENSG00000107338	ENSG00000107338		"""SH2 domain containing"""	10838	protein-coding gene	gene with protein product		600314	"""SHB adaptor protein (a Src homology 2 protein)"", ""SHB (Src homology 2 domain containing) adaptor protein B"""			7713524	Standard	NM_003028		Approved		uc004aax.3	Q15464	OTTHUMG00000019936	ENST00000377707.3:c.1087T>C	chr9.hg19:g.37956019A>G	ENSP00000366936:p.Ser363Pro	105.0	0.0	.		86.0	4.0	.	NM_003028	B9EGM0|D3DRQ5|Q504U5|Q5VUM8	Missense_Mutation	SNP	ENST00000377707.3	hg19	CCDS43806.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827960	0.50845	.	.	ENSG00000107338	ENST00000377707	T	0.36520	1.25	5.68	5.68	0.88126	.	0.117982	0.39341	N	0.001400	T	0.33760	0.0874	N	0.12182	0.205	0.80722	D	1	D	0.61697	0.99	P	0.53649	0.731	T	0.24297	-1.0164	10	0.52906	T	0.07	-16.6295	13.8702	0.63615	1.0:0.0:0.0:0.0	.	363	Q15464	SHB_HUMAN	P	363	ENSP00000366936:S363P	ENSP00000366936:S363P	S	-	1	0	SHB	37946019	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	6.114000	0.71560	2.161000	0.67846	0.460000	0.39030	TCC	.	.	.	none		0.602	SHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052490.1		
PRKACG	5568	hgsc.bcm.edu	37	9	71628289	71628289	+	Silent	SNP	G	G	A	rs140133619		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:71628289G>A	ENST00000377276.2	-	1	750	c.720C>T	c.(718-720)taC>taT	p.Y240Y		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)	p.Y240Y(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GCTGGTCGGCGTAGAAGGGTG	0.602																																					p.Y240Y	Esophageal Squamous(110;2236 2623 32146)	Atlas-SNP	.											PRKACG,mouth,carcinoma,0,1	PRKACG	65	.	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C720T						PASS	.						70.0	68.0	68.0					9																	71628289		2203	4300	6503	SO:0001819	synonymous_variant	5568	exon1			GTCGGCGTAGAAG	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.720C>T	chr9.hg19:g.71628289G>A		90.0	0.0	.		91.0	28.0	.	NM_002732	O60850|Q5VZ02|Q86YI1	Silent	SNP	ENST00000377276.2	hg19	CCDS6625.1																																																																																			.	G|1.000;C|0.000	.	alt		0.602	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1		
MAMDC4	158056	hgsc.bcm.edu	37	9	139748712	139748712	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:139748712C>T	ENST00000317446.2	+	7	770	c.720C>T	c.(718-720)gtC>gtT	p.V240V	MAMDC4_ENST00000445819.1_Silent_p.V240V|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		AGAACAAGGTCTGCGTGGAGC	0.667																																					p.V240V		Atlas-SNP	.											.	MAMDC4	117	.	0			c.C720T						PASS	.						25.0	27.0	26.0					9																	139748712		2193	4296	6489	SO:0001819	synonymous_variant	158056	exon7			CAAGGTCTGCGTG	AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.720C>T	chr9.hg19:g.139748712C>T		106.0	0.0	.		130.0	38.0	.	NM_206920		Silent	SNP	ENST00000317446.2	hg19	CCDS7010.1																																																																																			.	.	.	none		0.667	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254642.3	NM_206920	
GPAM	57678	hgsc.bcm.edu	37	10	113913352	113913352	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr10:113913352G>A	ENST00000348367.4	-	22	2640	c.2443C>T	c.(2443-2445)Cga>Tga	p.R815*	GPAM_ENST00000423155.1_Nonsense_Mutation_p.R815*			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	815					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		AGTTTTTGTCGGTTGCATTGA	0.383																																					p.R815X	Ovarian(161;1017 2606 18293 52943)	Atlas-SNP	.											.	GPAM	68	.	0			c.C2443T						PASS	.						126.0	131.0	129.0					10																	113913352		2203	4300	6503	SO:0001587	stop_gained	57678	exon22			TTTGTCGGTTGCA	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2443C>T	chr10.hg19:g.113913352G>A	ENSP00000265276:p.Arg815*	106.0	0.0	.		91.0	30.0	.	NM_001244949	Q5VW51|Q86TA3	Nonsense_Mutation	SNP	ENST00000348367.4	hg19	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	G	40	8.137750	0.98672	.	.	ENSG00000119927	ENST00000348367;ENST00000423155	.	.	.	5.59	4.63	0.57726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.7284	11.4195	0.49974	0.0:0.0:0.7192:0.2808	.	.	.	.	X	815	.	ENSP00000265276:R815X	R	-	1	2	GPAM	113903342	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.487000	0.45268	2.640000	0.89533	0.655000	0.94253	CGA	.	.	.	none		0.383	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
TRIM66	9866	hgsc.bcm.edu	37	11	8639493	8639493	+	Nonstop_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr11:8639493A>G	ENST00000299550.6	-	20	3843	c.3649T>C	c.(3649-3651)Tga>Cga	p.*1217R	TRIM66_ENST00000402157.2_Nonstop_Mutation_p.*1246R	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	0						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						TTTGGCTCTCACACCTGAGAG	0.438																																					p.X1217R		Atlas-SNP	.											.	TRIM66	45	.	0			c.T3649C						PASS	.						160.0	146.0	150.0					11																	8639493		692	1591	2283	SO:0001578	stop_lost	9866	exon20			GCTCTCACACCTG	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.3649T>C	chr11.hg19:g.8639493A>G	ENSP00000299550:p.*1217Glyext*33	95.0	0.0	.		57.0	14.0	.	NM_014818	Q9BQQ4	Missense_Mutation	SNP	ENST00000299550.6	hg19		.	.	.	.	.	.	.	.	.	.	A	11.74	1.730043	0.30684	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3527	0.60611	1.0:0.0:0.0:0.0	.	.	.	.	R	1217;1246	.	.	X	-	1	0	TRIM66	8596069	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	5.164000	0.64954	2.141000	0.66446	0.440000	0.28878	TGA	.	.	.	none		0.438	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_084529	
IGSF22	283284	hgsc.bcm.edu	37	11	18731076	18731076	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr11:18731076C>A	ENST00000513874.1	-	18	2995	c.2856G>T	c.(2854-2856)aaG>aaT	p.K952N	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	851										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						AGATGGGGATCTTTGTGCACT	0.577																																					p.K952N		Atlas-SNP	.											.	IGSF22	211	.	0			c.G2856T						PASS	.						100.0	105.0	104.0					11																	18731076		1974	4152	6126	SO:0001583	missense	283284	exon18			GGGGATCTTTGTG	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2856G>T	chr11.hg19:g.18731076C>A	ENSP00000421191:p.Lys952Asn	97.0	0.0	.		102.0	34.0	.	NM_173588	A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	hg19	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345544	0.41498	.	.	ENSG00000179057	ENST00000513874	T	0.56776	0.44	4.39	2.46	0.29980	.	.	.	.	.	T	0.47948	0.1473	N	0.12182	0.205	0.09310	N	0.999997	D	0.69078	0.997	D	0.80764	0.994	T	0.34104	-0.9842	9	0.18276	T	0.48	.	7.069	0.25167	0.0:0.7288:0.1744:0.0969	.	952	D6RGV7	.	N	952	ENSP00000421191:K952N	ENSP00000322422:K851N	K	-	3	2	IGSF22	18687652	0.000000	0.05858	0.578000	0.28575	0.994000	0.84299	-0.453000	0.06778	0.464000	0.27142	0.655000	0.94253	AAG	.	.	.	none		0.577	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
GRIN2B	2904	hgsc.bcm.edu	37	12	13768093	13768093	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:13768093T>C	ENST00000609686.1	-	7	1818	c.1609A>G	c.(1609-1611)Atg>Gtg	p.M537V		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	537					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGTGACACCATGACACTGATG	0.517																																					p.M537V		Atlas-SNP	.											.	GRIN2B	303	.	0			c.A1609G						PASS	.						195.0	151.0	166.0					12																	13768093		2203	4300	6503	SO:0001583	missense	2904	exon7			ACACCATGACACT		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1609A>G	chr12.hg19:g.13768093T>C	ENSP00000477455:p.Met537Val	93.0	0.0	.		82.0	21.0	.	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	hg19	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.266041	0.80358	.	.	ENSG00000150086	ENST00000279593	T	0.22134	1.97	6.17	6.17	0.99709	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	L	0.53780	1.695	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	T	0.21655	-1.0239	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	537	Q13224	NMDE2_HUMAN	V	537	ENSP00000279593:M537V	ENSP00000279593:M537V	M	-	1	0	GRIN2B	13659360	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.035000	0.88872	2.371000	0.80710	0.533000	0.62120	ATG	.	.	.	none		0.517	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
AMHR2	269	hgsc.bcm.edu	37	12	53825014	53825014	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:53825014A>T	ENST00000257863.4	+	11	1559	c.1479A>T	c.(1477-1479)gaA>gaT	p.E493D	AMHR2_ENST00000550311.1_3'UTR|AMHR2_ENST00000379791.3_Missense_Mutation_p.E398D	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	493	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	CAGACCCAGAAGCACGGCTGA	0.607																																					p.E493D		Atlas-SNP	.											.	AMHR2	61	.	0			c.A1479T						PASS	.						88.0	84.0	86.0					12																	53825014		2203	4300	6503	SO:0001583	missense	269	exon11			CCCAGAAGCACGG	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.1479A>T	chr12.hg19:g.53825014A>T	ENSP00000257863:p.Glu493Asp	59.0	0.0	.		68.0	22.0	.	NM_020547	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	hg19	CCDS8858.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.844229	0.71488	.	.	ENSG00000135409	ENST00000257863;ENST00000379791	T;D	0.93659	-0.22;-3.26	4.86	3.72	0.42706	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.38959	N	0.001503	D	0.92512	0.7622	N	0.25094	0.71	0.29470	N	0.857082	D	0.76494	0.999	D	0.80764	0.994	D	0.87493	0.2428	10	0.62326	D	0.03	.	8.3026	0.32023	0.9085:0.0:0.0915:0.0	.	493	Q16671	AMHR2_HUMAN	D	493;398	ENSP00000257863:E493D;ENSP00000369117:E398D	ENSP00000257863:E493D	E	+	3	2	AMHR2	52111281	0.998000	0.40836	0.998000	0.56505	0.971000	0.66376	0.443000	0.21644	0.998000	0.38996	0.460000	0.39030	GAA	.	.	.	none		0.607	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547	
NPFF	8620	hgsc.bcm.edu	37	12	53899840	53899840	+	IGR	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:53899840T>C	ENST00000267017.3	-	0	592				TARBP2_ENST00000266987.2_Missense_Mutation_p.C337R|TARBP2_ENST00000456234.2_Missense_Mutation_p.C316R|TARBP2_ENST00000552857.1_3'UTR|TARBP2_ENST00000394357.2_Missense_Mutation_p.C316R	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GGCCACTGTGTGTCATGGCTC	0.632																																					p.C337R		Atlas-SNP	.											.	TARBP2	35	.	0			c.T1009C						PASS	.						48.0	44.0	46.0					12																	53899840		2203	4300	6503	SO:0001628	intergenic_variant	6895	exon9			ACTGTGTGTCATG	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		chr12.hg19:g.53899840T>C		78.0	0.0	.		71.0	20.0	.	NM_134323	Q3SXL4	Missense_Mutation	SNP	ENST00000267017.3	hg19	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.437352	0.83885	.	.	ENSG00000139546	ENST00000266987;ENST00000456234;ENST00000394357	D;D;D	0.82255	-1.59;-1.59;-1.59	5.15	5.15	0.70609	Double-stranded RNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.91047	0.7183	M	0.83223	2.63	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.92199	0.5766	10	0.66056	D	0.02	-6.1074	14.2562	0.66053	0.0:0.0:0.0:1.0	.	337	Q15633	TRBP2_HUMAN	R	337;316;316	ENSP00000266987:C337R;ENSP00000416077:C316R;ENSP00000377885:C316R	ENSP00000266987:C337R	C	+	1	0	TARBP2	52186107	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.900000	0.63252	2.075000	0.62263	0.402000	0.26972	TGT	.	.	.	none		0.632	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717	
SBNO1	55206	hgsc.bcm.edu	37	12	123815855	123815855	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:123815855C>G	ENST00000602398.1	-	8	1104	c.977G>C	c.(976-978)gGa>gCa	p.G326A	SBNO1_ENST00000420886.2_Missense_Mutation_p.G326A|SBNO1_ENST00000602750.1_Missense_Mutation_p.G325A|SBNO1_ENST00000267176.4_Missense_Mutation_p.G325A			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	326					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CCTTCCTTTTCCTACACCGGC	0.408																																					p.G326A		Atlas-SNP	.											.	SBNO1	138	.	0			c.G977C						PASS	.						152.0	138.0	143.0					12																	123815855		2203	4300	6503	SO:0001583	missense	55206	exon7			CCTTTTCCTACAC	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.977G>C	chr12.hg19:g.123815855C>G	ENSP00000473665:p.Gly326Ala	92.0	0.0	.		94.0	33.0	.	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	hg19	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	C	32	5.164386	0.94727	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	D;D	0.99940	-8.38;-8.38	5.83	5.83	0.93111	Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	D	0.99955	0.9981	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.91635	0.999;0.993;0.998	D	0.96352	0.9259	10	0.87932	D	0	-27.8907	20.1218	0.97964	0.0:1.0:0.0:0.0	.	326;325;324	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	A	326;325;325	ENSP00000387361:G326A;ENSP00000267176:G325A	ENSP00000267176:G325A	G	-	2	0	SBNO1	122381808	1.000000	0.71417	0.958000	0.39756	0.998000	0.95712	7.794000	0.85869	2.763000	0.94921	0.561000	0.74099	GGA	.	.	.	none		0.408	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
ABHD13	84945	hgsc.bcm.edu	37	13	108882148	108882149	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr13:108882148_108882149GG>TT	ENST00000375898.3	+	2	883_884	c.582_583GG>TT	c.(580-585)ttGGgt>ttTTgt	p.194_195LG>FC		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	194						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GCCGTTCCTTGGGTGGAGCAGT	0.406																																					p.L194F|p.G195C	Pancreas(22;506 789 38166 45896 51596)	Atlas-SNP	.											.	ABHD13	39	.	0			c.G582T|c.G583T						PASS	.																																			SO:0001583	missense	84945	exon2			TTCCTTGGGTGGA|TCCTTGGGTGGAG	AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	Exception_encountered	chr13.hg19:g.108882148_108882149delinsTT	ENSP00000365063:p.L194_G195delinsFC	129.0	0.0	.		90.0|89.0	25.0	.	NM_032859	B3KWE7|Q8NBW1|Q96JX9	Missense_Mutation	SNP	ENST00000375898.3	hg19	CCDS32007.1																																																																																			.	.	.	none		0.406	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859	
SNX6	58533	hgsc.bcm.edu	37	14	35062293	35062293	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr14:35062293C>A	ENST00000362031.4	-	8	742	c.712G>T	c.(712-714)Gat>Tat	p.D238Y	SNX6_ENST00000396526.3_Missense_Mutation_p.D110Y|SNX6_ENST00000355110.5_Missense_Mutation_p.D114Y|SNX6_ENST00000396534.3_Missense_Mutation_p.D110Y	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	226					intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		GCAGATGCATCCTTAACTCGG	0.299																																					p.D238Y		Atlas-SNP	.											.	SNX6	21	.	0			c.G712T						PASS	.						75.0	74.0	74.0					14																	35062293		2202	4298	6500	SO:0001583	missense	58533	exon8			ATGCATCCTTAAC	AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.712G>T	chr14.hg19:g.35062293C>A	ENSP00000355217:p.Asp238Tyr	269.0	0.0	.		127.0	31.0	.	NM_152233	C0H5W9|Q9Y449	Missense_Mutation	SNP	ENST00000362031.4	hg19	CCDS41942.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345615	0.82022	.	.	ENSG00000129515	ENST00000396526;ENST00000396534;ENST00000362031;ENST00000355110;ENST00000557265	T;T;T;T;T	0.54071	1.5;1.5;1.5;1.5;0.59	4.69	4.69	0.59074	Vps5 C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75317	0.3833	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.80360	-0.1415	10	0.87932	D	0	-17.283	17.6053	0.88036	0.0:1.0:0.0:0.0	.	114;226	B4DJS7;Q9UNH7	.;SNX6_HUMAN	Y	110;110;238;114;201	ENSP00000379779:D110Y;ENSP00000379785:D110Y;ENSP00000355217:D238Y;ENSP00000347230:D114Y;ENSP00000452577:D201Y	ENSP00000347230:D114Y	D	-	1	0	SNX6	34132044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.993000	0.76245	2.340000	0.79590	0.561000	0.74099	GAT	.	.	.	none		0.299	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276642.3		
LTBP2	4053	hgsc.bcm.edu	37	14	75019017	75019017	+	Silent	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr14:75019017C>G	ENST00000261978.4	-	6	1658	c.1272G>C	c.(1270-1272)ggG>ggC	p.G424G	LTBP2_ENST00000557425.1_Intron|LTBP2_ENST00000556690.1_Silent_p.G424G|CTD-2207P18.1_ENST00000554552.1_lincRNA	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	424	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GGCAGAACTTCCCGGTGGAGT	0.652																																					p.G424G		Atlas-SNP	.											.	LTBP2	158	.	0			c.G1272C						PASS	.						39.0	41.0	40.0					14																	75019017		2203	4300	6503	SO:0001819	synonymous_variant	4053	exon6			GAACTTCCCGGTG		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1272G>C	chr14.hg19:g.75019017C>G		67.0	0.0	.		83.0	26.0	.	NM_000428	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	hg19	CCDS9831.1																																																																																			.	.	.	none		0.652	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
TJP1	7082	hgsc.bcm.edu	37	15	30019082	30019082	+	Silent	SNP	T	T	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr15:30019082T>G	ENST00000346128.6	-	17	2688	c.2214A>C	c.(2212-2214)acA>acC	p.T738T	TJP1_ENST00000400011.2_Silent_p.T742T|RP11-680F8.4_ENST00000560740.1_RNA|TJP1_ENST00000545208.2_Silent_p.T738T|TJP1_ENST00000356107.6_Silent_p.T738T	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	738	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCATTCTCATTGTTTTTACTC	0.363																																					p.T738T	Melanoma(77;681 1843 6309 6570)	Atlas-SNP	.											.	TJP1	140	.	0			c.A2214C						PASS	.						161.0	147.0	151.0					15																	30019082		1861	4096	5957	SO:0001819	synonymous_variant	7082	exon17			TCTCATTGTTTTT		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.2214A>C	chr15.hg19:g.30019082T>G		131.0	0.0	.		110.0	26.0	.	NM_175610	B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	ENST00000346128.6	hg19	CCDS42007.1																																																																																			.	.	.	none		0.363	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
HMG20A	10363	hgsc.bcm.edu	37	15	77750833	77750833	+	Silent	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr15:77750833C>G	ENST00000381714.3	+	3	512	c.84C>G	c.(82-84)acC>acG	p.T28T	HMG20A_ENST00000336216.4_Silent_p.T28T	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	28					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ATCTGGCTACCACTGGGTAAG	0.453																																					p.T28T		Atlas-SNP	.											.	HMG20A	48	.	0			c.C84G						PASS	.						92.0	88.0	89.0					15																	77750833		2196	4294	6490	SO:0001819	synonymous_variant	10363	exon3			GGCTACCACTGGG	AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.84C>G	chr15.hg19:g.77750833C>G		64.0	0.0	.		45.0	15.0	.	NM_018200	A6NHY3|D3DW78|Q53G31|Q9NSF6	Silent	SNP	ENST00000381714.3	hg19	CCDS10295.1																																																																																			.	.	.	none		0.453	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	
APOBR	55911	hgsc.bcm.edu	37	16	28509637	28509637	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr16:28509637C>G	ENST00000431282.1	+	4	3174	c.3164C>G	c.(3163-3165)cCg>cGg	p.P1055R	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.P1064R|APOBR_ENST00000328423.5_Intron|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	1055					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GATGGGACCCCGGTGCCAGCC	0.672																																					p.P1064R		Atlas-SNP	.											.	APOBR	89	.	0			c.C3191G						PASS	.						16.0	21.0	19.0					16																	28509637		1941	4148	6089	SO:0001583	missense	55911	exon3			GGACCCCGGTGCC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.3164C>G	chr16.hg19:g.28509637C>G	ENSP00000416094:p.Pro1055Arg	55.0	0.0	.		93.0	10.0	.	NM_018690	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.49	2.251925	0.39797	.	.	ENSG00000184730	ENST00000431282	T	0.61742	0.08	4.84	4.84	0.62591	.	.	.	.	.	T	0.62962	0.2471	L	0.34521	1.04	0.34997	D	0.755616	D;D	0.71674	0.998;0.998	D;D	0.64687	0.928;0.928	T	0.69026	-0.5254	8	.	.	.	-4.4525	13.4548	0.61193	0.0:1.0:0.0:0.0	.	1055;1055	Q0VD83;Q9NS13	APOBR_HUMAN;.	R	1055	ENSP00000416094:P1055R	.	P	+	2	0	APOBR	28417138	0.950000	0.32346	0.996000	0.52242	0.736000	0.42039	2.535000	0.45685	2.236000	0.73375	0.457000	0.33378	CCG	.	.	.	none		0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
SF3B3	23450	hgsc.bcm.edu	37	16	70605581	70605581	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr16:70605581G>A	ENST00000302516.5	+	26	3730	c.3519G>A	c.(3517-3519)gtG>gtA	p.V1173V		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	1173					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CTTAGAATGTGATTGATGGAG	0.428																																					p.V1173V		Atlas-SNP	.											.	SF3B3	99	.	0			c.G3519A						PASS	.						51.0	48.0	49.0					16																	70605581		2198	4300	6498	SO:0001819	synonymous_variant	23450	exon26			GAATGTGATTGAT	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.3519G>A	chr16.hg19:g.70605581G>A		73.0	0.0	.		93.0	24.0	.	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	ENST00000302516.5	hg19	CCDS10894.1																																																																																			.	.	.	none		0.428	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
GID4	79018	hgsc.bcm.edu	37	17	17962263	17962263	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:17962263T>A	ENST00000268719.4	+	4	861	c.688T>A	c.(688-690)Tac>Aac	p.Y230N		NM_024052.4	NP_076957.3	Q8IVV7	GID4_HUMAN	GID complex subunit 4	230																	GAATGGAGACTACGTCTTCAT	0.458																																					p.Y230N		Atlas-SNP	.											.	.	.	.	0			c.T688A						PASS	.						75.0	68.0	71.0					17																	17962263		2203	4300	6503	SO:0001583	missense	79018	exon4			GGAGACTACGTCT	AK127580	CCDS11190.1	17p11.2	2013-07-31	2013-07-31	2012-07-20	ENSG00000141034	ENSG00000141034			28453	protein-coding gene	gene with protein product	"""vacuolar import and degradation 24"""		"""chromosome 17 open reading frame 39"", ""GID complex subunit 4, VID24 homolog (S. cerevisiae)"""	C17orf39		11997338	Standard	NM_024052		Approved	VID24	uc002gsg.1	Q8IVV7	OTTHUMG00000059398	ENST00000268719.4:c.688T>A	chr17.hg19:g.17962263T>A	ENSP00000268719:p.Tyr230Asn	111.0	0.0	.		125.0	33.0	.	NM_024052	Q8TEB5|Q9BW50	Missense_Mutation	SNP	ENST00000268719.4	hg19	CCDS11190.1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.995621	0.54147	.	.	ENSG00000141034	ENST00000268719	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.55862	0.1947	L	0.48642	1.525	0.80722	D	1	B	0.24317	0.101	B	0.20184	0.028	T	0.51387	-0.8712	9	0.23302	T	0.38	-15.1166	16.1549	0.81657	0.0:0.0:0.0:1.0	.	230	Q8IVV7	CQ039_HUMAN	N	230	.	ENSP00000268719:Y230N	Y	+	1	0	C17orf39	17902988	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.797000	0.85911	2.209000	0.71365	0.533000	0.62120	TAC	.	.	.	none		0.458	GID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132071.2	NM_024052	
FASN	2194	hgsc.bcm.edu	37	17	80047603	80047603	+	Splice_Site	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:80047603C>G	ENST00000306749.2	-	12	2089		c.e12-1			NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase						acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CAGGACAAGCCTATGGCAGAG	0.652																																					.	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.1871-1G>C						PASS	.						16.0	15.0	16.0					17																	80047603		2171	4272	6443	SO:0001630	splice_region_variant	2194	exon13			ACAAGCCTATGGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.1871-1G>C	chr17.hg19:g.80047603C>G		84.0	0.0	.		92.0	15.0	.	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Splice_Site	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865470	0.51588	.	.	ENSG00000169710	ENST00000306749	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9623	0.86275	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FASN	77640892	1.000000	0.71417	0.168000	0.22838	0.067000	0.16453	5.505000	0.66981	1.997000	0.58415	0.561000	0.74099	.	.	.	.	none		0.652	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	Intron
MUC16	94025	hgsc.bcm.edu	37	19	9057871	9057871	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:9057871G>A	ENST00000397910.4	-	3	29778	c.29575C>T	c.(29575-29577)Cct>Tct	p.P9859S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9861	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGAAGGCAGGATTTGATGTG	0.478																																					p.P9859S		Atlas-SNP	.											.	MUC16	4315	.	0			c.C29575T						PASS	.						147.0	138.0	141.0					19																	9057871		1987	4169	6156	SO:0001583	missense	94025	exon3			AGGCAGGATTTGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29575C>T	chr19.hg19:g.9057871G>A	ENSP00000381008:p.Pro9859Ser	140.0	0.0	.		123.0	36.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.787	-0.044427	0.07452	.	.	ENSG00000181143	ENST00000397910	T	0.26223	1.75	2.62	0.396	0.16309	.	.	.	.	.	T	0.23330	0.0564	N	0.14661	0.345	.	.	.	D	0.54207	0.965	P	0.59703	0.862	T	0.26503	-1.0101	8	0.87932	D	0	.	3.8274	0.08859	0.1494:0.2545:0.5961:0.0	.	9859	B5ME49	.	S	9859	ENSP00000381008:P9859S	ENSP00000381008:P9859S	P	-	1	0	MUC16	8918871	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.124000	0.03260	0.181000	0.19994	-1.109000	0.02080	CCT	.	.	.	none		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF45	7596	hgsc.bcm.edu	37	19	44419046	44419046	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:44419046A>C	ENST00000269973.5	-	10	1632	c.542T>G	c.(541-543)aTt>aGt	p.I181S	ZNF45_ENST00000589703.1_Missense_Mutation_p.I181S|RP11-15A1.2_ENST00000586247.1_RNA	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	181					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						CCTTTGGTTAATTTGAAGATG	0.443																																					p.I181S		Atlas-SNP	.											.	ZNF45	51	.	0			c.T542G						PASS	.						126.0	128.0	127.0					19																	44419046		2203	4300	6503	SO:0001583	missense	7596	exon10			TGGTTAATTTGAA	M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.542T>G	chr19.hg19:g.44419046A>C	ENSP00000269973:p.Ile181Ser	86.0	0.0	.		74.0	25.0	.	NM_003425	P17016|P78472|Q9P1U9	Missense_Mutation	SNP	ENST00000269973.5	hg19	CCDS12632.1	.	.	.	.	.	.	.	.	.	.	A	6.279	0.419509	0.11928	.	.	ENSG00000124459	ENST00000269973;ENST00000328762	T	0.15139	2.45	3.91	-3.04	0.05412	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	2.004110	0.02863	N	0.130523	T	0.07279	0.0184	N	0.13299	0.325	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18178	-1.0345	10	0.08179	T	0.78	0.9799	0.481	0.00547	0.3318:0.133:0.2741:0.2611	.	181	Q02386	ZNF45_HUMAN	S	181	ENSP00000269973:I181S	ENSP00000269973:I181S	I	-	2	0	ZNF45	49110886	0.000000	0.05858	0.000000	0.03702	0.251000	0.25915	-5.448000	0.00121	-0.856000	0.04120	0.260000	0.18958	ATT	.	.	.	none		0.443	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425	
ZNF534	147658	hgsc.bcm.edu	37	19	52941044	52941044	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:52941044T>A	ENST00000332323.6	+	4	431	c.370T>A	c.(370-372)Tta>Ata	p.L124I	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.L111I	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						TCAACATGGATTAACTCTTCA	0.353																																					p.L124I		Atlas-SNP	.											.	ZNF534	105	.	0			c.T370A						PASS	.						71.0	60.0	63.0					19																	52941044		1568	3582	5150	SO:0001583	missense	147658	exon4			CATGGATTAACTC	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.370T>A	chr19.hg19:g.52941044T>A	ENSP00000327538:p.Leu124Ile	455.0	0.0	.		257.0	82.0	.	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	hg19	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	T	9.193	1.026520	0.19512	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.07444	3.19;3.23	1.69	1.69	0.24217	.	.	.	.	.	T	0.11750	0.0286	M	0.62723	1.935	0.09310	N	1	P;P	0.44344	0.833;0.524	P;B	0.45276	0.475;0.095	T	0.14309	-1.0477	9	0.45353	T	0.12	.	6.6481	0.22947	0.0:0.0:0.0:1.0	.	111;124	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	I	124;111;123	ENSP00000327538:L124I;ENSP00000391358:L111I	ENSP00000327538:L124I	L	+	1	2	ZNF534	57632856	0.001000	0.12720	0.012000	0.15200	0.302000	0.27658	-0.032000	0.12266	0.751000	0.32900	0.172000	0.16884	TTA	.	.	.	none		0.353	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
CRNKL1	51340	hgsc.bcm.edu	37	20	20033152	20033152	+	Silent	SNP	G	G	A	rs140622884		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr20:20033152G>A	ENST00000377340.2	-	2	349	c.318C>T	c.(316-318)gcC>gcT	p.A106A	C20orf26_ENST00000245957.5_5'Flank|CRNKL1_ENST00000377327.4_Silent_p.A94A|C20orf26_ENST00000377309.2_5'Flank|C20orf26_ENST00000389656.3_5'Flank|C20orf26_ENST00000377306.1_5'Flank|CRNKL1_ENST00000536226.1_5'Flank	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	106					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						CCGTGACGGAGGCGGCACCGT	0.607																																					p.A106A		Atlas-SNP	.											.	CRNKL1	101	.	0			c.C318T						PASS	.	G		1,4405	2.1+/-5.4	0,1,2202	74.0	70.0	71.0		318	-9.0	0.0	20	dbSNP_134	71	0,8600		0,0,4300	no	coding-synonymous	CRNKL1	NM_016652.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		106/849	20033152	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51340	exon2			GACGGAGGCGGCA	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.318C>T	chr20.hg19:g.20033152G>A		86.0	0.0	.		131.0	38.0	.	NM_016652	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Silent	SNP	ENST00000377340.2	hg19	CCDS33446.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.607	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000127787.1		
TM9SF4	9777	hgsc.bcm.edu	37	20	30730877	30730877	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr20:30730877C>T	ENST00000398022.2	+	6	856	c.621C>T	c.(619-621)ttC>ttT	p.F207F	TM9SF4_ENST00000217315.5_Silent_p.F190F	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	207						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TCGTCCGCTTCGAGGTGATTC	0.597																																					p.F207F		Atlas-SNP	.											TM9SF4,NS,carcinoma,0,1	TM9SF4	65	.	0			c.C621T						PASS	.						151.0	107.0	122.0					20																	30730877		2203	4300	6503	SO:0001819	synonymous_variant	9777	exon6			CCGCTTCGAGGTG	BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.621C>T	chr20.hg19:g.30730877C>T		97.0	0.0	.		69.0	17.0	.	NM_014742	B0QYT7|Q9NUA3	Silent	SNP	ENST00000398022.2	hg19	CCDS13196.2																																																																																			.	.	.	none		0.597	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
ATP7A	538	hgsc.bcm.edu	37	X	77268391	77268391	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chrX:77268391T>A	ENST00000341514.6	+	10	2343	c.2188T>A	c.(2188-2190)Tac>Aac	p.Y730N	ATP7A_ENST00000343533.5_Intron|ATP7A_ENST00000350425.4_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	730					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CGGAGGCTGGTACTTCTACAT	0.343																																					p.Y730N		Atlas-SNP	.											.	ATP7A	248	.	0			c.T2188A						PASS	.						139.0	122.0	127.0					X																	77268391		2203	4296	6499	SO:0001583	missense	538	exon10			GGCTGGTACTTCT	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.2188T>A	chrX.hg19:g.77268391T>A	ENSP00000345728:p.Tyr730Asn	48.0	0.0	.		38.0	22.0	.	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	hg19	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.309564	0.60414	.	.	ENSG00000165240	ENST00000341514	T	0.75938	-0.98	5.64	-1.38	0.09027	.	0.505078	0.21943	N	0.066860	T	0.73345	0.3575	L	0.51422	1.61	0.80722	D	1	P	0.38729	0.644	P	0.48654	0.585	T	0.71629	-0.4535	10	0.59425	D	0.04	-15.6701	11.7399	0.51786	0.0:0.5586:0.0:0.4414	.	730	Q04656	ATP7A_HUMAN	N	730	ENSP00000345728:Y730N	ENSP00000345728:Y730N	Y	+	1	0	ATP7A	77155047	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	0.785000	0.26830	-0.249000	0.09569	0.381000	0.24937	TAC	.	.	.	none		0.343	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
SETDB1	9869	hgsc.bcm.edu	37	1	150900339	150900347	+	In_Frame_Del	DEL	AGATGGATT	AGATGGATT	-	rs201917860|rs200122173		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	AGATGGATT	AGATGGATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:150900339_150900347delAGATGGATT	ENST00000271640.5	+	2	339_347	c.149_157delAGATGGATT	c.(148-159)aagatggattgt>agt	p.50_53KMDC>S	SETDB1_ENST00000459773.1_3'UTR|SETDB1_ENST00000368963.1_In_Frame_Del_p.50_53KMDC>S|SETDB1_ENST00000368969.4_In_Frame_Del_p.50_53KMDC>S|SETDB1_ENST00000368962.2_In_Frame_Del_p.50_53KMDC>S	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	50					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAACTGGAGAAGATGGATTGTGTACAGCA	0.474																																					p.50_52del		Atlas-Indel,Pindel	.											.	SETDB1	204	.	0			c.148_156del						PASS	.																																			SO:0001651	inframe_deletion	9869	exon2			.	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.149_157delAGATGGATT	chr1.hg19:g.150900339_150900347delAGATGGATT	ENSP00000271640:p.Lys50_Cys53delinsSer	261.0	0.0	0		219.0	59.0	0.269406	NM_012432	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	In_Frame_Del	DEL	ENST00000271640.5	hg19	CCDS44217.1																																																																																			.	.	.	none		0.474	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
ANKRD29	147463	hgsc.bcm.edu	37	18	21214112	21214112	+	Splice_Site	DEL	T	T	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr18:21214112delT	ENST00000592179.1	-	5	486	c.332delA	c.(331-333)gac>gc	p.D111fs	ANKRD29_ENST00000284207.7_Splice_Site_p.D111fs|ANKRD29_ENST00000322980.9_Splice_Site_p.D111fs	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	111										breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GGTGCCCCCGTCCTATGGACA	0.498																																					p.D111fs		Atlas-INDEL	.											.	ANKRD29	24	.	0			c.333delC						PASS	.						74.0	59.0	64.0					18																	21214112		2203	4300	6503	SO:0001630	splice_region_variant	147463	exon5			.	AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.331-1A>-	chr18.hg19:g.21214112delT		55.0	0.0	0		53.0	16.0	0.301887	NM_173505	B2R972|Q6ZWE8|Q96LU9	Frame_Shift_Del	DEL	ENST00000592179.1	hg19	CCDS11879.1																																																																																			.	.	.	none		0.498	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505	Frame_Shift_Del
MEFV	4210	hgsc.bcm.edu	37	16	3304171	3304171	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr16:3304171delT	ENST00000219596.1	-	2	936	c.897delA	c.(895-897)gaafs	p.E299fs	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	299					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						tgacCGAATGTTCTGGATTTC	0.562																																					p.H300fs		Atlas-Indel,Pindel	.											.	MEFV	170	.	0			c.898delC						PASS	.						53.0	56.0	55.0					16																	3304171		2197	4300	6497	SO:0001589	frameshift_variant	4210	exon2			.	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.897delA	chr16.hg19:g.3304171delT	ENSP00000219596:p.Glu299fs	53.0	0.0	0		62.0	14.0	0.225806	NM_000243	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Frame_Shift_Del	DEL	ENST00000219596.1	hg19	CCDS10498.1																																																																																			.	.	.	none		0.562	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
TOP2A	7153	hgsc.bcm.edu	37	17	38562843	38562844	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:38562843_38562844insT	ENST00000423485.1	-	15	1993_1994	c.1835_1836insA	c.(1834-1836)tatfs	p.Y612fs		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	612					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	AACCTTTGTAATATTTGACTTT	0.317																																					p.Y612_Y613delinsX		Atlas-Indel,Pindel	.											.	TOP2A	124	.	0			c.1836_1837insA						PASS	.																																			SO:0001589	frameshift_variant	7153	exon15			.		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.1836dupA	chr17.hg19:g.38562844_38562844dupT	ENSP00000411532:p.Tyr612fs	103.0	0.0	0		70.0	31.0	0.442857	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Frame_Shift_Ins	INS	ENST00000423485.1	hg19	CCDS45672.1																																																																																			.	.	.	none		0.317	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
PIK3CG	5294	hgsc.bcm.edu	37	7	106508582	106508582	+	Frame_Shift_Del	DEL	C	C	-	rs377396894		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr7:106508582delC	ENST00000359195.3	+	2	886	c.576delC	c.(574-576)gacfs	p.D192fs	PIK3CG_ENST00000440650.2_Frame_Shift_Del_p.D192fs|PIK3CG_ENST00000496166.1_Frame_Shift_Del_p.D192fs	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	192					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						CCAGCCGCGACCCCAAGCTCT	0.617																																					p.D192fs		Atlas-Indel,Pindel	.											.	PIK3CG	279	.	0			c.575delA						PASS	.						70.0	74.0	73.0					7																	106508582		2203	4300	6503	SO:0001589	frameshift_variant	5294	exon2			.		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.576delC	chr7.hg19:g.106508582delC	ENSP00000352121:p.Asp192fs	49.0	0.0	0		82.0	22.0	0.268293	NM_002649	A4D0Q6|Q8IV23|Q9BZC8	Frame_Shift_Del	DEL	ENST00000359195.3	hg19	CCDS5739.1																																																																																			.	.	.	none		0.617	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
NACAD	23148	hgsc.bcm.edu	37	7	45125173	45125173	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr7:45125173delA	ENST00000490531.2	-	2	625	c.606delT	c.(604-606)gctfs	p.A202fs		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	202					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CCCGCAGCTCAGCCTCTGAGT	0.667																																					p.E203fs		Atlas-Indel,Pindel	.											.	NACAD	44	.	0			c.607delG						PASS	.						15.0	20.0	19.0					7																	45125173		692	1590	2282	SO:0001589	frameshift_variant	23148	exon2			.	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.606delT	chr7.hg19:g.45125173delA	ENSP00000420477:p.Ala202fs	89.0	0.0	0		107.0	25.0	0.233645	NM_001146334		Frame_Shift_Del	DEL	ENST00000490531.2	hg19	CCDS47582.1																																																																																			.	.	.	none		0.667	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
TEX14	56155	hgsc.bcm.edu	37	17	56676917	56676918	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:56676917_56676918delGA	ENST00000240361.8	-	14	1891_1892	c.1806_1807delTC	c.(1804-1809)gctcctfs	p.P603fs	TEX14_ENST00000349033.5_Frame_Shift_Del_p.P597fs|TEX14_ENST00000389934.3_Frame_Shift_Del_p.P597fs			Q8IWB6	TEX14_HUMAN	testis expressed 14	603					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCAGGGCAAGGAGCATCTTGAT	0.53																																					p.603_603del		Atlas-Indel,Pindel	.											.	TEX14	343	.	0			c.1807_1808del						PASS	.																																			SO:0001589	frameshift_variant	56155	exon14			.	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.1806_1807delTC	chr17.hg19:g.56676917_56676918delGA	ENSP00000240361:p.Pro603fs	62.0	0.0	0		81.0	35.0	0.432099	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Frame_Shift_Del	DEL	ENST00000240361.8	hg19	CCDS56042.1																																																																																			.	.	.	none		0.530	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
DCHS1	8642	hgsc.bcm.edu	37	11	6652589	6652589	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr11:6652589delT	ENST00000299441.3	-	8	4136	c.3725delA	c.(3724-3726)aagfs	p.K1242fs	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1242	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCTGGATCCTTCGCCTGCAG	0.552																																					p.K1242fs		Atlas-Indel,Pindel	.											.	DCHS1	277	.	0			c.3726delG						PASS	.						206.0	169.0	181.0					11																	6652589		2201	4296	6497	SO:0001589	frameshift_variant	8642	exon8			.	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3725delA	chr11.hg19:g.6652589delT	ENSP00000299441:p.Lys1242fs	78.0	0.0	0		77.0	21.0	0.272727	NM_003737	O15098	Frame_Shift_Del	DEL	ENST00000299441.3	hg19	CCDS7771.1																																																																																			.	.	.	none		0.552	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
ELTD1	64123	hgsc.bcm.edu	37	1	79470814	79470814	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:79470814delC	ENST00000370742.3	-	2	176	c.113delG	c.(112-114)ggafs	p.G38fs		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	38	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G38E(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GGCTTCAATTCCATTGCGTAT	0.348																																					p.G38fs		Atlas-Indel,Pindel	.											.	ELTD1	143	.	1	Substitution - Missense(1)	endometrium(1)	c.114delA						PASS	.						140.0	127.0	131.0					1																	79470814		1864	4103	5967	SO:0001589	frameshift_variant	64123	exon2			.	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.113delG	chr1.hg19:g.79470814delC	ENSP00000359778:p.Gly38fs	175.0	0.0	0		82.0	20.0	0.243902	NM_022159	B1AR71|Q5KU34	Frame_Shift_Del	DEL	ENST00000370742.3	hg19	CCDS41352.1																																																																																			.	.	.	none		0.348	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
CFAP57	149465	hgsc.bcm.edu	37	1	43675436	43675439	+	Frame_Shift_Del	DEL	TTGA	TTGA	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	TTGA	TTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:43675436_43675439delTTGA	ENST00000372492.4	+	11	2102_2105	c.1778_1781delTTGA	c.(1777-1782)tttgatfs	p.FD593fs	WDR65_ENST00000528956.1_Frame_Shift_Del_p.FD593fs	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		593										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATATCGGCGTTTGATGTCACCTAC	0.574																																					p.593_594del		Atlas-Indel,Pindel	.											.	WDR65	76	.	0			c.1777_1780del						PASS	.																																			SO:0001589	frameshift_variant	149465	exon11			.																												ENST00000372492.4:c.1778_1781delTTGA	chr1.hg19:g.43675436_43675439delTTGA	ENSP00000361570:p.Phe593fs	59.0	0.0	0		67.0	19.0	0.283582	NM_152498	A6NKQ3|Q17RI9|Q5TAI0	Frame_Shift_Del	DEL	ENST00000372492.4	hg19																																																																																				.	.	.	none		0.574	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
SULT6B1	391365	hgsc.bcm.edu	37	2	37414574	37414575	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:37414574_37414575insT	ENST00000535679.1	-	2	234_235	c.235_236insA	c.(235-237)atafs	p.I79fs	SULT6B1_ENST00000260637.3_Frame_Shift_Ins_p.I41fs|SULT6B1_ENST00000407963.1_Frame_Shift_Ins_p.I41fs|SULT6B1_ENST00000379149.2_Frame_Shift_Ins_p.I79fs			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	79						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				AACAGCATATATTAATTCACTG	0.327																																					p.I41fs		Pindel	.											.	SULT6B1	46	.	0			c.122_123insA						PASS	.																																			SO:0001589	frameshift_variant	391365	exon2			.	AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.236dupA	chr2.hg19:g.37414576_37414576dupT	ENSP00000444081:p.Ile79fs	166.0	0.0	.		104.0	30.0	0.288	NM_001032377	B2RTS7	Frame_Shift_Ins	INS	ENST00000535679.1	hg19																																																																																				.	.	.	none		0.327	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001032377	
MON2	23041	hgsc.bcm.edu	37	12	62931886	62931886	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:62931886delG	ENST00000393632.2	+	17	2520	c.2129delG	c.(2128-2130)tggfs	p.W710fs	MON2_ENST00000552738.1_Frame_Shift_Del_p.W687fs|MON2_ENST00000552115.1_Frame_Shift_Del_p.W710fs|MON2_ENST00000393630.3_Frame_Shift_Del_p.W710fs|MON2_ENST00000546600.1_Frame_Shift_Del_p.W710fs|MON2_ENST00000280379.6_Frame_Shift_Del_p.W710fs|MON2_ENST00000393629.2_Frame_Shift_Del_p.W710fs	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	710					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		CATCTTGTGTGGATTCTGGGA	0.353																																					p.W710fs		Pindel	.											.	MON2	160	.	0			c.2128delT						PASS	.						43.0	49.0	47.0					12																	62931886		2202	4300	6502	SO:0001589	frameshift_variant	23041	exon17			.		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2129delG	chr12.hg19:g.62931886delG	ENSP00000377252:p.Trp710fs	163.0	0.0	.		90.0	10.0	0.111	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Frame_Shift_Del	DEL	ENST00000393632.2	hg19	CCDS31849.1																																																																																			.	.	.	none		0.353	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
