#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CLSTN1	22883	hgsc.bcm.edu	37	1	9809529	9809529	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:9809529G>A	ENST00000377298.4	-	7	1767	c.975C>T	c.(973-975)caC>caT	p.H325H	CLSTN1_ENST00000361311.4_Silent_p.H315H|CLSTN1_ENST00000377288.3_Silent_p.H325H	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	325					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CACAGAGCCGGTGGAGGGACT	0.557																																					p.H325H		Atlas-SNP	.											.	CLSTN1	88	.	0			c.C975T						PASS	.						100.0	102.0	101.0					1																	9809529		2203	4300	6503	SO:0001819	synonymous_variant	22883	exon7			GAGCCGGTGGAGG	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.975C>T	chr1.hg19:g.9809529G>A		89.0	0.0	.		74.0	32.0	.	NM_001009566	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	hg19	CCDS30580.1																																																																																			.	.	.	none		0.557	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1		
IFFO2	126917	hgsc.bcm.edu	37	1	19282228	19282228	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:19282228G>A	ENST00000455833.2	-	1	952	c.599C>T	c.(598-600)cCg>cTg	p.P200L		NM_001136265.1	NP_001129737.1	Q5TF58	IFFO2_HUMAN	intermediate filament family orphan 2	200						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)	2						GCGGATCTCCGGCGTGATGGT	0.736																																					p.P200L		Atlas-SNP	.											.	IFFO2	28	.	0			c.C599T						PASS	.						6.0	8.0	7.0					1																	19282228		672	1561	2233	SO:0001583	missense	126917	exon1			ATCTCCGGCGTGA	AK024480, AL080251	CCDS44076.1	1p36.13	2013-10-11			ENSG00000169991	ENSG00000169991		"""Intermediate filament family orphans"""	27006	protein-coding gene	gene with protein product						14702039	Standard	NM_001136265		Approved		uc001bbd.2	Q5TF58	OTTHUMG00000002499	ENST00000455833.2:c.599C>T	chr1.hg19:g.19282228G>A	ENSP00000387941:p.Pro200Leu	43.0	0.0	.		34.0	8.0	.	NM_001136265	Q9H7K0	Missense_Mutation	SNP	ENST00000455833.2	hg19	CCDS44076.1	.	.	.	.	.	.	.	.	.	.	G	33	5.256100	0.95336	.	.	ENSG00000169991	ENST00000304963;ENST00000455833	T	0.70164	-0.46	4.4	4.4	0.53042	.	0.203730	0.42420	D	0.000711	T	0.78880	0.4353	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81536	-0.0888	10	0.72032	D	0.01	.	15.899	0.79359	0.0:0.0:1.0:0.0	.	200	Q5TF58	IFFO2_HUMAN	L	191;200	ENSP00000387941:P200L	ENSP00000305144:P191L	P	-	2	0	IFFO2	19154815	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.480000	0.73604	2.180000	0.69256	0.313000	0.20887	CCG	.	.	.	none		0.736	IFFO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007099.2	NM_001136265	
CSDE1	7812	hgsc.bcm.edu	37	1	115277116	115277116	+	Missense_Mutation	SNP	T	T	A	rs200868850		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:115277116T>A	ENST00000358528.4	-	7	955	c.529A>T	c.(529-531)Atg>Ttg	p.M177L	CSDE1_ENST00000369530.1_Missense_Mutation_p.M192L|CSDE1_ENST00000438362.2_Missense_Mutation_p.M223L|CSDE1_ENST00000339438.6_Missense_Mutation_p.M146L|CSDE1_ENST00000261443.5_Missense_Mutation_p.M146L|CSDE1_ENST00000534699.1_Missense_Mutation_p.M177L|CSDE1_ENST00000530886.1_Missense_Mutation_p.M47L	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	177	CSD 2; truncated.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCAACAGCATAATGTTGCGA	0.388																																					p.M223L		Atlas-SNP	.											.	CSDE1	145	.	0			c.A667T						PASS	.						80.0	80.0	80.0					1																	115277116		2203	4300	6503	SO:0001583	missense	7812	exon8			ACAGCATAATGTT		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.529A>T	chr1.hg19:g.115277116T>A	ENSP00000351329:p.Met177Leu	389.0	0.0	.		295.0	34.0	.	NM_001242891	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	hg19	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	T	15.16	2.752407	0.49362	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699;ENST00000529046	.	.	.	5.82	4.67	0.58626	Nucleic acid-binding, OB-fold-like (1);	0.141721	0.64402	D	0.000006	T	0.42337	0.1198	L	0.29908	0.895	0.36744	D	0.882387	B;B;B	0.29805	0.04;0.0;0.257	B;B;P	0.44623	0.008;0.0;0.455	T	0.48198	-0.9056	9	0.42905	T	0.14	-0.4958	13.0463	0.58928	0.0:0.0:0.1344:0.8656	.	192;177;223	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	L	146;223;177;146;47;192;177;47	.	ENSP00000261443:M146L	M	-	1	0	CSDE1	115078639	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.781000	0.55394	0.999000	0.39023	0.460000	0.39030	ATG	.	.	.	alt		0.388	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
RPRD2	23248	hgsc.bcm.edu	37	1	150443766	150443766	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:150443766A>C	ENST00000369068.4	+	11	2346	c.2342A>C	c.(2341-2343)gAg>gCg	p.E781A	RPRD2_ENST00000539519.1_Missense_Mutation_p.E755A|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.E755A	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	781	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TACCCCCGAGAGCTCTCCAAT	0.498																																					p.E781A		Atlas-SNP	.											.	RPRD2	189	.	0			c.A2342C						PASS	.						84.0	79.0	81.0					1																	150443766		1895	4111	6006	SO:0001583	missense	23248	exon11			CCCGAGAGCTCTC	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2342A>C	chr1.hg19:g.150443766A>C	ENSP00000358064:p.Glu781Ala	127.0	0.0	.		109.0	43.0	.	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	hg19	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	A	18.04	3.534839	0.64972	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.53206	0.63;0.63;0.63	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000001	T	0.22781	0.0550	N	0.24115	0.695	0.32162	N	0.582853	B;P;P	0.46784	0.319;0.816;0.884	B;B;B	0.40477	0.048;0.177;0.33	T	0.14035	-1.0487	10	0.59425	D	0.04	-7.9453	15.2872	0.73835	1.0:0.0:0.0:0.0	.	755;781;755	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	A	755;755;781	ENSP00000383785:E755A;ENSP00000445482:E755A;ENSP00000358064:E781A	ENSP00000358064:E781A	E	+	2	0	RPRD2	148710390	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.543000	0.73874	2.194000	0.70268	0.529000	0.55759	GAG	.	.	.	none		0.498	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
KDM5B	10765	hgsc.bcm.edu	37	1	202701002	202701002	+	Nonsense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:202701002A>C	ENST00000367265.3	-	24	5139	c.3975T>G	c.(3973-3975)taT>taG	p.Y1325*	KDM5B_ENST00000367264.2_Nonsense_Mutation_p.Y1361*	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1325					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GGGAGTGCAAATATGAGGTTC	0.408																																					p.Y1325X		Atlas-SNP	.											.	KDM5B	166	.	0			c.T3975G						PASS	.						111.0	106.0	108.0					1																	202701002		2203	4300	6503	SO:0001587	stop_gained	10765	exon24			GTGCAAATATGAG	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3975T>G	chr1.hg19:g.202701002A>C	ENSP00000356234:p.Tyr1325*	61.0	0.0	.		70.0	21.0	.	NM_006618	O95811|Q15752|Q9Y3Q5	Nonsense_Mutation	SNP	ENST00000367265.3	hg19	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	A	47	13.303743	0.99733	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	.	.	.	5.78	3.41	0.39046	.	0.229878	0.47093	D	0.000247	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4004	7.269	0.26246	0.7476:0.1297:0.1226:0.0	.	.	.	.	X	1325;1167;1361;1167	.	ENSP00000235790:Y1167X	Y	-	3	2	KDM5B	200967625	0.999000	0.42202	0.375000	0.26029	0.998000	0.95712	1.112000	0.31172	1.096000	0.41439	0.533000	0.62120	TAT	.	.	.	none		0.408	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
PLXNA2	5362	hgsc.bcm.edu	37	1	208234136	208234136	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:208234136A>T	ENST00000367033.3	-	13	3390	c.2633T>A	c.(2632-2634)aTc>aAc	p.I878N		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	878	IPT/TIG 1.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CACGCCATGGATGGTCACTCG	0.582																																					p.I878N		Atlas-SNP	.											.	PLXNA2	178	.	0			c.T2633A						PASS	.						64.0	59.0	60.0					1																	208234136		2203	4300	6503	SO:0001583	missense	5362	exon13			CCATGGATGGTCA	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2633T>A	chr1.hg19:g.208234136A>T	ENSP00000356000:p.Ile878Asn	128.0	0.0	.		89.0	39.0	.	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.751914	0.89753	.	.	ENSG00000076356	ENST00000367033	T	0.70869	-0.52	4.75	4.75	0.60458	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87744	0.6254	H	0.94847	3.59	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.91215	0.5002	10	0.87932	D	0	.	14.2819	0.66219	1.0:0.0:0.0:0.0	.	878	O75051	PLXA2_HUMAN	N	878	ENSP00000356000:I878N	ENSP00000356000:I878N	I	-	2	0	PLXNA2	206300759	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.956000	0.93066	1.787000	0.52448	0.533000	0.62120	ATC	.	.	.	none		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
PLXNA2	5362	hgsc.bcm.edu	37	1	208234142	208234142	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:208234142A>G	ENST00000367033.3	-	13	3384	c.2627T>C	c.(2626-2628)gTg>gCg	p.V876A		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	876	IPT/TIG 1.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ATGGATGGTCACTCGCGTCCC	0.587																																					p.V876A		Atlas-SNP	.											.	PLXNA2	178	.	0			c.T2627C						PASS	.						62.0	57.0	59.0					1																	208234142		2203	4300	6503	SO:0001583	missense	5362	exon13			ATGGTCACTCGCG	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2627T>C	chr1.hg19:g.208234142A>G	ENSP00000356000:p.Val876Ala	121.0	0.0	.		84.0	38.0	.	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.008254	0.93346	.	.	ENSG00000076356	ENST00000367033	T	0.66815	-0.23	4.75	4.75	0.60458	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81917	0.4924	M	0.91920	3.255	0.80722	D	1	D	0.54397	0.966	P	0.55824	0.785	D	0.86680	0.1916	10	0.87932	D	0	.	14.2819	0.66219	1.0:0.0:0.0:0.0	.	876	O75051	PLXA2_HUMAN	A	876	ENSP00000356000:V876A	ENSP00000356000:V876A	V	-	2	0	PLXNA2	206300765	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.956000	0.93066	1.787000	0.52448	0.533000	0.62120	GTG	.	.	.	none		0.587	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
PTPN14	5784	hgsc.bcm.edu	37	1	214557537	214557537	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:214557537C>T	ENST00000366956.5	-	13	1855	c.1661G>A	c.(1660-1662)aGc>aAc	p.S554N	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	554					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GTGGGCCGTGCTGTAGTTATG	0.632																																					p.S554N	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.G1661A						PASS	.						67.0	69.0	68.0					1																	214557537		2203	4300	6503	SO:0001583	missense	5784	exon13			GCCGTGCTGTAGT	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1661G>A	chr1.hg19:g.214557537C>T	ENSP00000355923:p.Ser554Asn	61.0	0.0	.		50.0	20.0	.	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	5.545	0.285458	0.10513	.	.	ENSG00000152104	ENST00000366956	T	0.67523	-0.27	5.51	-1.94	0.07571	.	0.544215	0.22141	N	0.064056	T	0.36635	0.0974	N	0.11560	0.145	0.28282	N	0.923954	B	0.02656	0.0	B	0.01281	0.0	T	0.21759	-1.0236	10	0.14252	T	0.57	.	6.8274	0.23891	0.113:0.4191:0.0:0.468	.	554	Q15678	PTN14_HUMAN	N	554	ENSP00000355923:S554N	ENSP00000355923:S554N	S	-	2	0	PTPN14	212624160	0.001000	0.12720	0.056000	0.19401	0.764000	0.43329	-0.747000	0.04823	-0.259000	0.09432	0.650000	0.86243	AGC	.	.	.	none		0.632	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
DNAJC5G	285126	hgsc.bcm.edu	37	2	27500675	27500675	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:27500675T>A	ENST00000296097.3	+	4	585	c.167T>A	c.(166-168)cTg>cAg	p.L56Q	DNAJC5G_ENST00000404433.1_Missense_Mutation_p.L40Q|SLC30A3_ENST00000447008.2_5'Flank|DNAJC5G_ENST00000406962.1_Intron|DNAJC5G_ENST00000402462.1_Missense_Mutation_p.L56Q	NM_173650.1	NP_775921.1	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 gamma	56	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					membrane (GO:0016020)				cervix(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTAGGAAACTGGCCTTGCGG	0.488																																					p.L56Q		Atlas-SNP	.											.	DNAJC5G	19	.	0			c.T167A						PASS	.						107.0	102.0	104.0					2																	27500675		2203	4300	6503	SO:0001583	missense	285126	exon4			GGAAACTGGCCTT	AF368277	CCDS1744.1	2p23	2011-09-02			ENSG00000163793	ENSG00000163793		"""Heat shock proteins / DNAJ (HSP40)"""	24844	protein-coding gene	gene with protein product		613946					Standard	NM_173650		Approved	FLJ40417, CSP-gamma	uc002rjl.1	Q8N7S2	OTTHUMG00000097079	ENST00000296097.3:c.167T>A	chr2.hg19:g.27500675T>A	ENSP00000296097:p.Leu56Gln	108.0	0.0	.		79.0	21.0	.	NM_173650	B4DY29|Q53SY5|Q8IYQ4|Q96RJ8	Missense_Mutation	SNP	ENST00000296097.3	hg19	CCDS1744.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.492169	0.64074	.	.	ENSG00000163793	ENST00000296097;ENST00000402462;ENST00000404433	T;T;T	0.46819	0.86;0.86;0.86	5.09	5.09	0.68999	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.40554	N	0.001066	T	0.65780	0.2724	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69247	-0.5195	10	0.72032	D	0.01	.	12.8356	0.57771	0.0:0.0:0.0:1.0	.	56	Q8N7S2	DNJ5G_HUMAN	Q	56;56;40	ENSP00000296097:L56Q;ENSP00000384305:L56Q;ENSP00000385829:L40Q	ENSP00000296097:L56Q	L	+	2	0	DNAJC5G	27354179	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	7.834000	0.86773	1.926000	0.55796	0.455000	0.32223	CTG	.	.	.	none		0.488	DNAJC5G-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214200.1	NM_173650	
POTEE	445582	hgsc.bcm.edu	37	2	131976330	131976330	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:131976330G>A	ENST00000356920.5	+	1	449	c.355G>A	c.(355-357)Gct>Act	p.A119T	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_Missense_Mutation_p.A119T	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	119					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CAAGGTGGGCGCTTGGGGAGA	0.597																																					p.A119T		Atlas-SNP	.											.	.	.	.	0			c.G355A						PASS	.						121.0	119.0	120.0					2																	131976330		2203	4300	6503	SO:0001583	missense	445582	exon1			GTGGGCGCTTGGG	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.355G>A	chr2.hg19:g.131976330G>A	ENSP00000439189:p.Ala119Thr	239.0	0.0	.		230.0	80.0	.	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	hg19	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	9.510	1.105419	0.20632	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.76839	-1.05;1.61	0.399	0.399	0.16325	.	.	.	.	.	T	0.49983	0.1589	N	0.12746	0.255	0.09310	N	1	P	0.52463	0.953	B	0.32149	0.141	T	0.44236	-0.9341	8	0.36615	T	0.2	.	.	.	.	.	119	Q6S8J3	POTEE_HUMAN	T	119	ENSP00000439189:A119T;ENSP00000443049:A119T	ENSP00000439189:A119T	A	+	1	0	AC131180.1	131692800	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	-0.980000	0.03770	0.440000	0.26502	0.162000	0.16502	GCT	.	.	.	none		0.597	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
GPR39	2863	hgsc.bcm.edu	37	2	133403162	133403162	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:133403162C>A	ENST00000329321.3	+	2	1814	c.1345C>A	c.(1345-1347)Cag>Aag	p.Q449K	LYPD1_ENST00000397463.2_3'UTR|GPR39_ENST00000470071.1_3'UTR	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	449					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAATGGTTTTCAGGAGCATGA	0.532																																					p.Q449K		Atlas-SNP	.											.	GPR39	60	.	0			c.C1345A						PASS	.						54.0	58.0	57.0					2																	133403162		2203	4300	6503	SO:0001583	missense	2863	exon2			GGTTTTCAGGAGC	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.1345C>A	chr2.hg19:g.133403162C>A	ENSP00000327417:p.Gln449Lys	58.0	0.0	.		64.0	30.0	.	NM_001508	B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	hg19	CCDS2170.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.834578	0.00579	.	.	ENSG00000183840	ENST00000329321	T	0.65178	-0.14	5.15	3.18	0.36537	.	3.248910	0.01165	N	0.006739	T	0.56992	0.2023	L	0.57536	1.79	0.37755	D	0.926099	B	0.02656	0.0	B	0.01281	0.0	T	0.51741	-0.8667	10	0.16896	T	0.51	.	4.3592	0.11194	0.4322:0.446:0.0:0.1219	.	449	O43194	GPR39_HUMAN	K	449	ENSP00000327417:Q449K	ENSP00000327417:Q449K	Q	+	1	0	GPR39	133119632	0.326000	0.24669	0.628000	0.29241	0.050000	0.14768	0.714000	0.25808	1.393000	0.46605	-0.188000	0.12872	CAG	.	.	.	none		0.532	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1		
NEB	4703	hgsc.bcm.edu	37	2	152382499	152382499	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:152382499G>A	ENST00000172853.10	-	122	17178	c.17031C>T	c.(17029-17031)gtC>gtT	p.V5677V	NEB_ENST00000427231.2_Silent_p.V7378V|NEB_ENST00000409198.1_Silent_p.V5677V|NEB_ENST00000397345.3_Silent_p.V7378V|NEB_ENST00000603639.1_Silent_p.V7378V|NEB_ENST00000604864.1_Silent_p.V7378V			P20929	NEBU_HUMAN	nebulin	5677					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.V5677V(1)|p.V7378V(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCACTTCCTTGACGTGAACAG	0.483																																					p.V7413V		Atlas-SNP	.											NEB_ENST00000427231,NS,carcinoma,0,3	NEB	1697	.	2	Substitution - coding silent(2)	lung(2)	c.C22239T						PASS	.						300.0	294.0	296.0					2																	152382499		2038	4201	6239	SO:0001819	synonymous_variant	4703	exon151			TTCCTTGACGTGA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.17031C>T	chr2.hg19:g.152382499G>A		126.0	0.0	.		102.0	25.0	.	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	G	10.46	1.355381	0.24512	.	.	ENSG00000183091	ENST00000434685	.	.	.	6.07	5.2	0.72013	.	.	.	.	.	T	0.63885	0.2549	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62756	-0.6787	4	.	.	.	.	12.0778	0.53653	0.0656:0.1214:0.813:0.0	.	.	.	.	L	1	.	.	S	-	2	0	NEB	152090745	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.792000	0.62467	1.582000	0.49881	0.655000	0.94253	TCA	.	.	.	none		0.483	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
COL3A1	1281	hgsc.bcm.edu	37	2	189867767	189867767	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:189867767C>T	ENST00000304636.3	+	36	2702	c.2532C>T	c.(2530-2532)ccC>ccT	p.P844P	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	844	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TTGCAGGACCCCCTGGAGGTT	0.493																																					p.P844P		Atlas-SNP	.											.	COL3A1	292	.	0			c.C2532T						PASS	.						51.0	61.0	58.0					2																	189867767		2068	4020	6088	SO:0001819	synonymous_variant	1281	exon36			AGGACCCCCTGGA	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2532C>T	chr2.hg19:g.189867767C>T		103.0	0.0	.		79.0	26.0	.	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Silent	SNP	ENST00000304636.3	hg19	CCDS2297.1																																																																																			.	.	.	none		0.493	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
IQCJ-SCHIP1	100505385	hgsc.bcm.edu	37	3	159606614	159606614	+	Silent	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:159606614A>T	ENST00000460298.1	+	6	1321	c.1080A>T	c.(1078-1080)ccA>ccT	p.P360P	SCHIP1_ENST00000482804.1_Silent_p.P173P|IQCJ-SCHIP1_ENST00000337808.6_Silent_p.P400P|IQCJ-SCHIP1_ENST00000476809.1_Silent_p.P449P|IQCJ-SCHIP1_ENST00000527095.1_Silent_p.P168P|IQCJ-SCHIP1_ENST00000485419.1_Silent_p.P476P|SCHIP1_ENST00000445224.2_Silent_p.P157P|IQCJ-SCHIP1_ENST00000412423.2_Silent_p.P387P					IQCJ-SCHIP1 readthrough											central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(7)	12						TTCAGCTGCCACACATGCCTC	0.433																																					p.P476P		Atlas-SNP	.											.	IQCJ-SCHIP1	40	.	0			c.A1428T						PASS	.						138.0	130.0	132.0					3																	159606614		2203	4300	6503	SO:0001819	synonymous_variant	100505385	exon9			GCTGCCACACATG		CCDS56289.1, CCDS56291.1	3q25.33	2011-03-24			ENSG00000250588	ENSG00000250588			38842	other	readthrough							Standard	NM_001197113		Approved		uc003fcq.2		OTTHUMG00000162426	ENST00000460298.1:c.1080A>T	chr3.hg19:g.159606614A>T		92.0	0.0	.		81.0	63.0	.	NM_001197113		Silent	SNP	ENST00000460298.1	hg19																																																																																				.	.	.	none		0.433	IQCJ-SCHIP1-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000352558.2	NM_001197113	
FAM193A	8603	hgsc.bcm.edu	37	4	2632748	2632748	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:2632748T>A	ENST00000324666.5	+	3	368	c.17T>A	c.(16-18)cTc>cAc	p.L6H	FAM193A_ENST00000545951.1_Missense_Mutation_p.L6H|FAM193A_ENST00000505311.1_Missense_Mutation_p.L6H|FAM193A_ENST00000382839.3_Missense_Mutation_p.L6H|FAM193A_ENST00000502458.1_Missense_Mutation_p.L6H	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	6										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GTCCGCCTGCTCCGGCAGCTG	0.632																																					p.L6H		Atlas-SNP	.											.	FAM193A	103	.	0			c.T17A						PASS	.						42.0	45.0	44.0					4																	2632748		2202	4300	6502	SO:0001583	missense	8603	exon3			GCCTGCTCCGGCA	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.17T>A	chr4.hg19:g.2632748T>A	ENSP00000324587:p.Leu6His	76.0	0.0	.		60.0	18.0	.	NM_003704	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	hg19	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.881897	0.91740	.	.	ENSG00000125386	ENST00000509050;ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458	T;T;T;T	0.53640	0.63;1.02;0.61;0.67	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.996;0.999	T	0.68534	-0.5383	10	0.87932	D	0	-27.2496	14.8927	0.70620	0.0:0.0:0.0:1.0	.	6;6;6;6;6	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	H	6	ENSP00000372290:L6H;ENSP00000324587:L6H;ENSP00000443617:L6H;ENSP00000427505:L6H	ENSP00000324587:L6H	L	+	2	0	FAM193A	2602546	1.000000	0.71417	0.996000	0.52242	0.879000	0.50718	7.680000	0.84062	2.108000	0.64289	0.533000	0.62120	CTC	.	.	.	none		0.632	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
LNX1	84708	hgsc.bcm.edu	37	4	54343069	54343069	+	Silent	SNP	T	T	C	rs151307935		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:54343069T>C	ENST00000263925.7	-	9	2057	c.1743A>G	c.(1741-1743)acA>acG	p.T581T	LNX1_ENST00000306888.2_Silent_p.T485T|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	581	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TCGAGGATGATGTTCTTTTCA	0.512																																					p.T581T		Atlas-SNP	.											.	LNX1	139	.	0			c.A1743G						PASS	.						180.0	180.0	180.0					4																	54343069		2203	4300	6503	SO:0001819	synonymous_variant	84708	exon9			GGATGATGTTCTT	AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1743A>G	chr4.hg19:g.54343069T>C		69.0	0.0	.		46.0	21.0	.	NM_001126328	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	ENST00000263925.7	hg19	CCDS47057.1																																																																																			.	T|1.000;G|0.000	.	alt		0.512	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
CEP135	9662	hgsc.bcm.edu	37	4	56876035	56876035	+	Missense_Mutation	SNP	A	A	G	rs148279836		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:56876035A>G	ENST00000257287.4	+	19	2595	c.2471A>G	c.(2470-2472)cAa>cGa	p.Q824R		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	824					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					AGAAGACTGCAAGATGACCTG	0.388																																					p.Q824R		Atlas-SNP	.											.	CEP135	115	.	0			c.A2471G						PASS	.	A	ARG/GLN	1,4405	2.1+/-5.4	0,1,2202	83.0	82.0	82.0		2471	5.5	1.0	4	dbSNP_134	82	0,8600		0,0,4300	no	missense	CEP135	NM_025009.3	43	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	824/1141	56876035	1,13005	2203	4300	6503	SO:0001583	missense	9662	exon19			GACTGCAAGATGA	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2471A>G	chr4.hg19:g.56876035A>G	ENSP00000257287:p.Gln824Arg	251.0	0.0	.		144.0	45.0	.	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	hg19	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.375961	0.82682	2.27E-4	0.0	ENSG00000174799	ENST00000257287	T	0.09911	2.93	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.30854	0.0778	M	0.66939	2.045	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	T	0.01508	-1.1337	10	0.28530	T	0.3	.	15.8895	0.79286	1.0:0.0:0.0:0.0	.	824	Q66GS9	CP135_HUMAN	R	824	ENSP00000257287:Q824R	ENSP00000257287:Q824R	Q	+	2	0	CEP135	56570792	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	8.565000	0.90730	2.207000	0.71202	0.533000	0.62120	CAA	.	A|1.000;G|0.000	0.000	weak		0.388	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
ANKHD1	54882	hgsc.bcm.edu	37	5	139781730	139781730	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr5:139781730G>A	ENST00000360839.2	+	1	332	c.178G>A	c.(178-180)Ggc>Agc	p.G60S	ANKHD1_ENST00000297183.6_Missense_Mutation_p.G60S|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.G60S|ANKHD1_ENST00000394723.3_Missense_Mutation_p.G60S|ANKHD1_ENST00000394722.3_Missense_Mutation_p.G60S|CTC-329D1.2_ENST00000507521.1_RNA	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	60	Gly-rich.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cggcagcagcggcggcggcgg	0.756																																					p.G60S		Atlas-SNP	.											ANKHD1-EIF4EBP3,NS,carcinoma,0,2	ANKHD1	233	.	0			c.G178A						PASS	.																																			SO:0001583	missense	54882	exon1			AGCAGCGGCGGCG	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.178G>A	chr5.hg19:g.139781730G>A	ENSP00000354085:p.Gly60Ser	69.0	1.0	.		59.0	3.0	.	NM_017978	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	hg19	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663652	0.47572	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000511151;ENST00000394722;ENST00000532219	T;T;T;T;T;T;T	0.66815	-0.12;-0.17;-0.14;-0.1;-0.23;-0.01;-0.17	4.8	1.98	0.26296	.	0.127893	0.34555	N	0.003870	T	0.61451	0.2348	N	0.24115	0.695	0.22366	N	0.999162	D;D;D;D;P	0.71674	0.998;0.996;0.996;0.998;0.836	D;P;P;D;B	0.65443	0.935;0.862;0.862;0.935;0.038	T	0.52586	-0.8556	10	0.17369	T	0.5	.	6.4517	0.21908	0.4177:0.0:0.5823:0.0	.	60;60;60;60;60	Q8IWZ3-5;Q8IWZ2;Q8IWZ3;Q8IWZ3-3;Q8IWZ3-2	.;.;ANKH1_HUMAN;.;.	S	60;74;60;60;60;60;60;60;60	ENSP00000354085:G60S;ENSP00000297183:G60S;ENSP00000394489:G60S;ENSP00000378212:G60S;ENSP00000421069:G60S;ENSP00000378211:G60S;ENSP00000432016:G60S	ENSP00000432016:G60S	G	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139761914	0.926000	0.31397	0.971000	0.41717	0.367000	0.29736	0.608000	0.24223	0.224000	0.20940	0.505000	0.49811	GGC	.	.	.	none		0.756	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
DNAH8	1769	hgsc.bcm.edu	37	6	38825504	38825504	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:38825504A>G	ENST00000359357.3	+	40	5547	c.5293A>G	c.(5293-5295)Att>Gtt	p.I1765V	DNAH8_ENST00000449981.2_Missense_Mutation_p.I1982V|DNAH8_ENST00000441566.1_Missense_Mutation_p.I1765V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1765					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TCAGAGAGATATTTTTGATGA	0.308																																					p.I1982V		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A5944G						PASS	.						110.0	106.0	107.0					6																	38825504		2203	4300	6503	SO:0001583	missense	1769	exon42			AGAGATATTTTTG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5293A>G	chr6.hg19:g.38825504A>G	ENSP00000352312:p.Ile1765Val	130.0	0.0	.		111.0	53.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	A	21.7	4.181365	0.78677	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.20332	2.09;2.09;2.08	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.21590	0.0520	L	0.46670	1.46	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.06862	-1.0803	10	0.02654	T	1	.	16.0707	0.80928	1.0:0.0:0.0:0.0	.	1765	Q96JB1	DYH8_HUMAN	V	1970;1970;1765;1765	ENSP00000333363:I1970V;ENSP00000352312:I1765V;ENSP00000402294:I1765V	ENSP00000333363:I1970V	I	+	1	0	DNAH8	38933482	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.271000	0.95698	2.194000	0.70268	0.533000	0.62120	ATT	.	.	.	none		0.308	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
EZR	7430	hgsc.bcm.edu	37	6	159188095	159188095	+	Missense_Mutation	SNP	G	G	C	rs367907031		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:159188095G>C	ENST00000367075.3	-	14	1780	c.1612C>G	c.(1612-1614)Ctg>Gtg	p.L538V	EZR_ENST00000337147.7_Missense_Mutation_p.L538V|EZR_ENST00000392177.4_Missense_Mutation_p.L506V|MIR3918_ENST00000581555.1_RNA	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	538	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GCCTGGGACAGCTCGCTGCTC	0.562			T	ROS1	NSCLC																																p.L538V		Atlas-SNP	.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR	44	.	0			c.C1612G						PASS	.						180.0	157.0	165.0					6																	159188095		2203	4300	6503	SO:0001583	missense	7430	exon13			GGGACAGCTCGCT	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1612C>G	chr6.hg19:g.159188095G>C	ENSP00000356042:p.Leu538Val	89.0	0.0	.		95.0	32.0	.	NM_003379	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	ENST00000367075.3	hg19	CCDS5258.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747324	0.69533	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.88586	-2.4;-2.4;-2.4	5.37	0.447	0.16608	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.067471	0.64402	D	0.000011	D	0.92074	0.7488	M	0.87617	2.895	0.58432	D	0.999996	D;D	0.71674	0.998;0.989	D;D	0.75484	0.986;0.976	D	0.91442	0.5174	10	0.87932	D	0	.	9.9553	0.41663	0.3142:0.0:0.6858:0.0	.	506;538	E7EQR4;P15311	.;EZRI_HUMAN	V	538;538;506	ENSP00000338934:L538V;ENSP00000356042:L538V;ENSP00000376016:L506V	ENSP00000338934:L538V	L	-	1	2	EZR	159108083	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	3.249000	0.51437	0.007000	0.14760	0.561000	0.74099	CTG	.	.	.	alt		0.562	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						PASS	.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		47.0	0.0	.		41.0	5.0	.	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.	.	none		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
AUTS2	26053	hgsc.bcm.edu	37	7	70255844	70255844	+	Silent	SNP	A	A	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:70255844A>G	ENST00000342771.4	+	19	3963	c.3642A>G	c.(3640-3642)acA>acG	p.T1214T	AUTS2_ENST00000406775.2_Silent_p.T1190T	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1214										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCCCTCCGACAGCAGCGCTGA	0.672																																					p.T1214T		Atlas-SNP	.											.	AUTS2	173	.	0			c.A3642G						PASS	.						41.0	45.0	43.0					7																	70255844		2203	4299	6502	SO:0001819	synonymous_variant	26053	exon19			TCCGACAGCAGCG	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3642A>G	chr7.hg19:g.70255844A>G		80.0	0.0	.		106.0	30.0	.	NM_015570	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	hg19	CCDS5539.1																																																																																			.	.	.	none		0.672	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
MTFR1	9650	hgsc.bcm.edu	37	8	66617127	66617127	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:66617127A>C	ENST00000262146.4	+	5	606	c.480A>C	c.(478-480)aaA>aaC	p.K160N	MTFR1_ENST00000458689.2_Missense_Mutation_p.K127N|MTFR1_ENST00000517944.1_3'UTR	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	160					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AGATTGCCAAAATTGTGACCC	0.458																																					p.K160N		Atlas-SNP	.											.	MTFR1	26	.	0			c.A480C						PASS	.						27.0	28.0	27.0					8																	66617127		2203	4300	6503	SO:0001583	missense	9650	exon5			TGCCAAAATTGTG		CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.480A>C	chr8.hg19:g.66617127A>C	ENSP00000262146:p.Lys160Asn	122.0	0.0	.		127.0	51.0	.	NM_014637	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	ENST00000262146.4	hg19	CCDS6182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.72|19.72	3.879273|3.879273	0.72294|0.72294	.|.	.|.	ENSG00000066855|ENSG00000066855	ENST00000518609;ENST00000262146;ENST00000458689|ENST00000518800	T;T|T	0.50813|0.49432	0.73;0.73|0.78	5.24|5.24	1.59|1.59	0.23543|0.23543	.|.	0.095465|0.095465	0.64402|0.64402	D|D	0.000001|0.000001	T|T	0.59932|0.59932	0.2230|0.2230	M|M	0.84683|0.84683	2.71|2.71	0.44789|0.44789	D|D	0.997793|0.997793	P;D;D;D|.	0.76494|.	0.947;0.992;0.998;0.999|.	P;D;D;D|.	0.74674|.	0.905;0.954;0.94;0.984|.	T|T	0.56044|0.56044	-0.8044|-0.8044	10|8	0.42905|0.41790	T|T	0.14|0.15	-28.337|-28.337	7.9704|7.9704	0.30124|0.30124	0.6814:0.0:0.3186:0.0|0.6814:0.0:0.3186:0.0	.|.	160;144;127;160|.	B4E3G8;E5RJS5;E7EP84;Q15390|.	.;.;.;MTFR1_HUMAN|.	N|T	144;160;127|118	ENSP00000262146:K160N;ENSP00000391502:K127N|ENSP00000430621:K118T	ENSP00000262146:K160N|ENSP00000430621:K118T	K|K	+|+	3|2	2|0	MTFR1|MTFR1	66779681|66779681	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.987000|0.987000	0.75469|0.75469	1.601000|1.601000	0.36773|0.36773	0.035000|0.035000	0.15519|0.15519	0.460000|0.460000	0.39030|0.39030	AAA|AAA	.	.	.	none		0.458	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378894.1	NM_014637	
SULF1	23213	hgsc.bcm.edu	37	8	70488224	70488224	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:70488224C>G	ENST00000260128.4	+	6	909	c.192C>G	c.(190-192)aaC>aaG	p.N64K	SULF1_ENST00000419716.3_Missense_Mutation_p.N64K|SULF1_ENST00000458141.2_Missense_Mutation_p.N64K|SULF1_ENST00000402687.4_Missense_Mutation_p.N64K	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	64					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AAGTCATGAACAAAACGAGAA	0.522																																					p.N64K		Atlas-SNP	.											.	SULF1	153	.	0			c.C192G						PASS	.						80.0	67.0	71.0					8																	70488224		2203	4300	6503	SO:0001583	missense	23213	exon6			CATGAACAAAACG	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.192C>G	chr8.hg19:g.70488224C>G	ENSP00000260128:p.Asn64Lys	91.0	0.0	.		89.0	33.0	.	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	hg19	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648999	0.29336	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000529134;ENST00000402687;ENST00000419716;ENST00000528783;ENST00000525999	D;D;D;D;D;T;D	0.96265	-3.96;-3.96;-3.23;-3.96;-3.96;0.86;-3.96	5.23	2.96	0.34315	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	M	0.67397	2.05	0.53688	D	0.999974	B	0.06786	0.001	B	0.10450	0.005	D	0.89996	0.4111	10	0.22109	T	0.4	.	10.5049	0.44828	0.0:0.7019:0.0:0.2981	.	64	Q8IWU6	SULF1_HUMAN	K	64	ENSP00000403040:N64K;ENSP00000260128:N64K;ENSP00000432178:N64K;ENSP00000385704:N64K;ENSP00000390315:N64K;ENSP00000436949:N64K;ENSP00000431753:N64K	ENSP00000260128:N64K	N	+	3	2	SULF1	70650778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.135000	0.31454	1.123000	0.41961	0.650000	0.86243	AAC	.	.	.	none		0.522	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
CSMD3	114788	hgsc.bcm.edu	37	8	114326898	114326898	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:114326898A>C	ENST00000297405.5	-	2	547	c.303T>G	c.(301-303)aaT>aaG	p.N101K	CSMD3_ENST00000352409.3_Missense_Mutation_p.N101K|CSMD3_ENST00000343508.3_Missense_Mutation_p.N61K|CSMD3_ENST00000455883.2_Missense_Mutation_p.N101K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	101	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N101N(1)|p.N61N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTTGTATTCTATTTCGTTCTT	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.N101K		Atlas-SNP	.											CSMD3_ENST00000343508,NS,carcinoma,0,2	CSMD3	2325	.	2	Substitution - coding silent(2)	lung(2)	c.T303G						PASS	.						171.0	162.0	165.0					8																	114326898		2203	4300	6503	SO:0001583	missense	114788	exon2			TATTCTATTTCGT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.303T>G	chr8.hg19:g.114326898A>C	ENSP00000297405:p.Asn101Lys	136.0	0.0	.		131.0	52.0	.	NM_052900	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621352	0.46736	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	5.72	3.38	0.38709	CUB (5);	0.077066	0.47455	D	0.000223	T	0.24699	0.0599	L	0.28740	0.885	0.28547	N	0.911799	P;P;D;P;B	0.69078	0.827;0.93;0.997;0.77;0.395	B;P;P;B;B	0.61132	0.275;0.526;0.884;0.253;0.341	T	0.09796	-1.0658	10	0.09338	T	0.73	.	4.6113	0.12404	0.5913:0.0:0.4087:0.0	.	101;101;101;101;61	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407;Q7Z407-2	.;.;.;CSMD3_HUMAN;.	K	61;101;101;101	ENSP00000345799:N61K;ENSP00000297405:N101K;ENSP00000412263:N101K;ENSP00000343124:N101K	ENSP00000297405:N101K	N	-	3	2	CSMD3	114396074	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.778000	0.55371	0.998000	0.38996	0.455000	0.32223	AAT	.	.	.	none		0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
SIGMAR1	10280	hgsc.bcm.edu	37	9	34637563	34637563	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:34637563C>G	ENST00000277010.4	-	1	205	c.132G>C	c.(130-132)caG>caC	p.Q44H	SIGMAR1_ENST00000477726.1_Missense_Mutation_p.Q44H|SIGMAR1_ENST00000461426.1_5'UTR|SIGMAR1_ENST00000378892.1_5'UTR	NM_001282208.1|NM_005866.2	NP_001269137.1|NP_005857.1	Q99720	SGMR1_HUMAN	sigma non-opioid intracellular receptor 1	44					cell death (GO:0008219)|lipid transport (GO:0006869)|nervous system development (GO:0007399)|regulation of neuron apoptotic process (GO:0043523)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|nuclear envelope (GO:0005635)	drug binding (GO:0008144)|opioid receptor activity (GO:0004985)			large_intestine(1)|lung(1)	2					Amitriptyline(DB00321)|Dextromethorphan(DB00514)|Nortriptyline(DB00540)|Pentazocine(DB00652)|Remoxipride(DB00409)	GCCGCGCCAACTGCGCTATCT	0.701																																					p.Q44H		Atlas-SNP	.											.	SIGMAR1	6	.	0			c.G132C						PASS	.						15.0	18.0	17.0					9																	34637563		2195	4292	6487	SO:0001583	missense	10280	exon1			CGCCAACTGCGCT	BC004899	CCDS6562.1, CCDS6563.1	9p13.3	2008-12-18	2008-12-18	2008-12-18	ENSG00000147955	ENSG00000147955			8157	protein-coding gene	gene with protein product		601978	"""opioid receptor, sigma 1"""	OPRS1		8954936, 9453537	Standard	NM_005866		Approved	SR-BP1	uc003zvb.3	Q99720	OTTHUMG00000019829	ENST00000277010.4:c.132G>C	chr9.hg19:g.34637563C>G	ENSP00000277010:p.Gln44His	37.0	0.0	.		33.0	7.0	.	NM_005866	D3DRM7|O00673|O00725|Q0Z9W6|Q153Z1|Q2TSD1|Q53GN2|Q7Z653|Q8N7H3|Q9NYX0	Missense_Mutation	SNP	ENST00000277010.4	hg19	CCDS6562.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641021	0.47153	.	.	ENSG00000147955	ENST00000277010;ENST00000477726	T;T	0.64618	-0.11;-0.11	4.7	3.8	0.43715	.	0.332724	0.31519	N	0.007517	T	0.63757	0.2538	L	0.52011	1.625	0.29794	N	0.832985	D;D;P	0.59357	0.958;0.985;0.879	P;P;P	0.52598	0.574;0.703;0.559	T	0.63897	-0.6533	10	0.56958	D	0.05	-7.6325	9.982	0.41819	0.3691:0.6309:0.0:0.0	.	44;44;44	B4DR71;A2A3U5;Q99720	.;.;SGMR1_HUMAN	H	44	ENSP00000277010:Q44H;ENSP00000420022:Q44H	ENSP00000277010:Q44H	Q	-	3	2	SIGMAR1	34627563	0.996000	0.38824	1.000000	0.80357	0.969000	0.65631	1.763000	0.38461	1.194000	0.43101	0.561000	0.74099	CAG	.	.	.	none		0.701	SIGMAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052204.1	NM_005866	
TMOD1	7111	hgsc.bcm.edu	37	9	100286582	100286582	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:100286582G>A	ENST00000259365.4	+	2	325	c.112G>A	c.(112-114)Gac>Aac	p.D38N	TMOD1_ENST00000395211.2_Missense_Mutation_p.D38N	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	38					adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)		p.D38N(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		GGATGAGCTGGACCCTGATGT	0.512																																					p.D38N		Atlas-SNP	.											TMOD1,NS,carcinoma,0,1	TMOD1	29	.	1	Substitution - Missense(1)	kidney(1)	c.G112A						PASS	.						138.0	112.0	121.0					9																	100286582		2203	4300	6503	SO:0001583	missense	7111	exon2			GAGCTGGACCCTG		CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.112G>A	chr9.hg19:g.100286582G>A	ENSP00000259365:p.Asp38Asn	101.0	0.0	.		77.0	30.0	.	NM_001166116	B2RB77|Q5T7W3|Q9BUF1	Missense_Mutation	SNP	ENST00000259365.4	hg19	CCDS6726.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821210	0.90873	.	.	ENSG00000136842	ENST00000395211;ENST00000259365	T;T	0.54279	0.58;0.58	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.76814	0.4040	M	0.87097	2.86	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.81468	-0.0919	10	0.87932	D	0	-31.3023	17.3565	0.87337	0.0:0.0:1.0:0.0	.	38	P28289	TMOD1_HUMAN	N	38	ENSP00000378637:D38N;ENSP00000259365:D38N	ENSP00000259365:D38N	D	+	1	0	TMOD1	99326403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.283000	0.78640	2.534000	0.85438	0.585000	0.79938	GAC	.	.	.	none		0.512	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053320.2	NM_003275	
PRDM12	59335	hgsc.bcm.edu	37	9	133556745	133556745	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:133556745C>T	ENST00000253008.2	+	5	853	c.793C>T	c.(793-795)Cac>Tac	p.H265Y		NM_021619.2	NP_067632.2	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	265					neurogenesis (GO:0022008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		CATGCGCATCCACACGCTGGA	0.711																																					p.H265Y		Atlas-SNP	.											.	PRDM12	24	.	0			c.C793T						PASS	.						11.0	13.0	12.0					9																	133556745		2188	4269	6457	SO:0001583	missense	59335	exon5			CGCATCCACACGC	AY004252	CCDS6934.1	9q33-q34	2013-01-08			ENSG00000130711	ENSG00000130711		"""Zinc fingers, C2H2-type"""	13997	protein-coding gene	gene with protein product	"""PR-domain containing protein 12"", ""PR-domain zinc finger protein 12"""					14523459	Standard	NM_021619		Approved		uc004bzt.1	Q9H4Q4	OTTHUMG00000020808	ENST00000253008.2:c.793C>T	chr9.hg19:g.133556745C>T	ENSP00000253008:p.His265Tyr	77.0	0.0	.		73.0	29.0	.	NM_021619	A3KFK9	Missense_Mutation	SNP	ENST00000253008.2	hg19	CCDS6934.1	.	.	.	.	.	.	.	.	.	.	C	35	5.424499	0.96111	.	.	ENSG00000130711	ENST00000253008	T	0.67523	-0.27	4.31	4.31	0.51392	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.84120	0.5402	M	0.89353	3.025	0.54753	D	0.999986	D	0.76494	0.999	D	0.87578	0.998	D	0.88039	0.2780	10	0.87932	D	0	-38.3997	15.763	0.78101	0.0:1.0:0.0:0.0	.	265	Q9H4Q4	PRD12_HUMAN	Y	265	ENSP00000253008:H265Y	ENSP00000253008:H265Y	H	+	1	0	PRDM12	132546566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.432000	0.80349	1.954000	0.56735	0.561000	0.74099	CAC	.	.	.	none		0.711	PRDM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054664.1	NM_021619	
GDI2	2665	hgsc.bcm.edu	37	10	5855180	5855180	+	Silent	SNP	C	C	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:5855180C>A	ENST00000380191.4	-	1	332	c.42G>T	c.(40-42)ctG>ctT	p.L14L	GDI2_ENST00000380181.3_Silent_p.L14L|GDI2_ENST00000380132.4_5'UTR|RP11-318E3.9_ENST00000608273.1_lincRNA	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	14					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						CGCCCACCGTCAGGCCGGTGC	0.751																																					p.L14L		Atlas-SNP	.											.	GDI2	26	.	0			c.G42T						PASS	.						8.0	9.0	9.0					10																	5855180		2144	4238	6382	SO:0001819	synonymous_variant	2665	exon1			CACCGTCAGGCCG	D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.42G>T	chr10.hg19:g.5855180C>A		66.0	0.0	.		50.0	24.0	.	NM_001115156	O43928|Q5SX88|Q9UQM6	Silent	SNP	ENST00000380191.4	hg19	CCDS7071.1																																																																																			.	.	.	none		0.751	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046580.1	NM_001494	
WDFY4	57705	hgsc.bcm.edu	37	10	49986698	49986698	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:49986698C>T	ENST00000325239.5	+	17	3245	c.3218C>T	c.(3217-3219)tCc>tTc	p.S1073F	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1073						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTGACCTTCTCCTGCTGGTTC	0.627																																					p.S1073F		Atlas-SNP	.											.	WDFY4	205	.	0			c.C3218T						PASS	.						39.0	46.0	44.0					10																	49986698		692	1591	2283	SO:0001583	missense	57705	exon18			CCTTCTCCTGCTG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.3218C>T	chr10.hg19:g.49986698C>T	ENSP00000320563:p.Ser1073Phe	25.0	0.0	.		26.0	9.0	.	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	hg19	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999280	0.74818	.	.	ENSG00000128815	ENST00000426033;ENST00000325239	T	0.55760	0.5	5.23	5.23	0.72850	.	.	.	.	.	T	0.72128	0.3422	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.72561	-0.4256	8	.	.	.	.	17.7936	0.88562	0.0:1.0:0.0:0.0	.	1073	Q6ZS81	WDFY4_HUMAN	F	1073	ENSP00000320563:S1073F	.	S	+	2	0	WDFY4	49656704	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	5.681000	0.68175	2.417000	0.82017	0.563000	0.77884	TCC	.	.	.	none		0.627	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
COL17A1	1308	hgsc.bcm.edu	37	10	105795252	105795252	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:105795252T>G	ENST00000353479.5	-	49	3778	c.3488A>C	c.(3487-3489)gAg>gCg	p.E1163A	COL17A1_ENST00000369733.3_Missense_Mutation_p.E1118A	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1163	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGAGAGGAGCTCCTCATAGGA	0.627																																					p.E1163A		Atlas-SNP	.											.	COL17A1	149	.	0			c.A3488C						PASS	.						29.0	33.0	32.0					10																	105795252		2203	4300	6503	SO:0001583	missense	1308	exon49			AGGAGCTCCTCAT	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3488A>C	chr10.hg19:g.105795252T>G	ENSP00000340937:p.Glu1163Ala	116.0	0.0	.		105.0	16.0	.	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	hg19	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	T	10.22	1.290516	0.23478	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.91740	-2.9;-2.8	4.83	3.68	0.42216	.	0.150217	0.30329	N	0.009864	D	0.84633	0.5515	L	0.34521	1.04	0.80722	D	1	B	0.30406	0.278	B	0.30179	0.112	T	0.76542	-0.2921	10	0.10902	T	0.67	-20.9225	9.6783	0.40054	0.1549:0.0:0.0:0.8451	.	1163	Q9UMD9	COHA1_HUMAN	A	1163;1118	ENSP00000340937:E1163A;ENSP00000358748:E1118A	ENSP00000340937:E1163A	E	-	2	0	COL17A1	105785242	1.000000	0.71417	1.000000	0.80357	0.007000	0.05969	2.356000	0.44116	0.845000	0.35118	-0.695000	0.03696	GAG	.	.	.	none		0.627	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
SMPD1	6609	hgsc.bcm.edu	37	11	6412728	6412728	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:6412728G>A	ENST00000342245.4	+	2	601	c.433G>A	c.(433-435)Gtg>Atg	p.V145M	SMPD1_ENST00000527275.1_Missense_Mutation_p.V144M|SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000356761.2_Missense_Mutation_p.V145M|SMPD1_ENST00000299397.3_Missense_Mutation_p.V145M	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	143	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	GGATGACATGGTGGAGGTGTG	0.582																																					p.V145M		Atlas-SNP	.											.	SMPD1	108	.	0			c.G433A						PASS	.						76.0	63.0	68.0					11																	6412728		2201	4296	6497	SO:0001583	missense	6609	exon2			GACATGGTGGAGG	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.433G>A	chr11.hg19:g.6412728G>A	ENSP00000340409:p.Val145Met	55.0	0.0	.		52.0	19.0	.	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	hg19	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553731	0.65425	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51	5.11	5.11	0.69529	Saposin-like (2);Saposin B (2);	0.178891	0.37857	N	0.001919	D	0.96892	0.8985	L	0.54323	1.7	0.42449	D	0.99274	P;P;P	0.46706	0.818;0.883;0.579	B;P;P	0.51516	0.366;0.672;0.472	D	0.96137	0.9097	10	0.49607	T	0.09	-7.0221	9.6331	0.39791	0.0956:0.0:0.9044:0.0	.	144;145;143	E9PKS3;G3XAB5;P17405	.;.;ASM_HUMAN	M	145;145;145;144	ENSP00000299397:V145M;ENSP00000349203:V145M;ENSP00000340409:V145M;ENSP00000435350:V144M	ENSP00000299397:V145M	V	+	1	0	SMPD1	6369304	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.869000	0.48444	2.382000	0.81193	0.650000	0.86243	GTG	.	.	.	none		0.582	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
PEX16	9409	hgsc.bcm.edu	37	11	45936221	45936221	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:45936221G>A	ENST00000378750.5	-	6	718	c.475C>T	c.(475-477)Cct>Tct	p.P159S	PEX16_ENST00000532554.1_5'UTR|PEX16_ENST00000532681.1_Missense_Mutation_p.P64S|PEX16_ENST00000241041.3_Missense_Mutation_p.P159S			Q9Y5Y5	PEX16_HUMAN	peroxisomal biogenesis factor 16	159					ER-dependent peroxisome organization (GO:0032581)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)|protein localization to endoplasmic reticulum (GO:0070972)|protein targeting to peroxisome (GO:0006625)|protein to membrane docking (GO:0022615)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)	p.P159T(1)		large_intestine(2)|lung(2)|ovary(2)|skin(1)	7				GBM - Glioblastoma multiforme(35;0.223)		TGGTTGCCAGGGCTGTGGTCA	0.582																																					p.P159S		Atlas-SNP	.											PEX16,colon,carcinoma,0,1	PEX16	24	.	1	Substitution - Missense(1)	large_intestine(1)	c.C475T						PASS	.						154.0	129.0	137.0					11																	45936221		2203	4299	6502	SO:0001583	missense	9409	exon6			TGCCAGGGCTGTG	AF118240	CCDS7917.1, CCDS31472.1	11p	2007-12-14			ENSG00000121680	ENSG00000121680			8857	protein-coding gene	gene with protein product		603360				9922452	Standard	NM_057174		Approved		uc001nbt.3	Q9Y5Y5	OTTHUMG00000167005	ENST00000378750.5:c.475C>T	chr11.hg19:g.45936221G>A	ENSP00000368024:p.Pro159Ser	51.0	0.0	.		59.0	21.0	.	NM_004813	Q9BWB9	Missense_Mutation	SNP	ENST00000378750.5	hg19	CCDS31472.1	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.248308	0.01469	.	.	ENSG00000121680	ENST00000241041;ENST00000378750;ENST00000532681;ENST00000533151;ENST00000525192	T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16	6.04	-5.2	0.02823	.	1.274680	0.04746	N	0.423709	T	0.05868	0.0153	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.28744	-1.0034	10	0.06236	T	0.91	2.692	1.5964	0.02665	0.2746:0.3442:0.2067:0.1744	.	159;159	Q9Y5Y5;Q9Y5Y5-2	PEX16_HUMAN;.	S	159;159;64;55;64	ENSP00000241041:P159S;ENSP00000368024:P159S;ENSP00000434654:P64S;ENSP00000433045:P55S;ENSP00000431309:P64S	ENSP00000241041:P159S	P	-	1	0	PEX16	45892797	0.000000	0.05858	0.001000	0.08648	0.474000	0.32979	-1.251000	0.02882	-0.602000	0.05775	0.561000	0.74099	CCT	.	.	.	none		0.582	PEX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392398.1	NM_057174	
DNAJC22	79962	hgsc.bcm.edu	37	12	49745201	49745201	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr12:49745201G>T	ENST00000549441.2	+	4	2146	c.942G>T	c.(940-942)gaG>gaT	p.E314D	DNAJC22_ENST00000395069.3_Missense_Mutation_p.E314D			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	314	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						ACCAGACAGAGGAGGCACAGA	0.547																																					p.E314D		Atlas-SNP	.											.	DNAJC22	29	.	0			c.G942T						PASS	.						59.0	59.0	59.0					12																	49745201		2203	4300	6503	SO:0001583	missense	79962	exon3			GACAGAGGAGGCA	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.942G>T	chr12.hg19:g.49745201G>T	ENSP00000446830:p.Glu314Asp	132.0	0.0	.		120.0	5.0	.	NM_024902	B3KP54	Missense_Mutation	SNP	ENST00000549441.2	hg19	CCDS8785.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564963	0.65651	.	.	ENSG00000178401	ENST00000549441;ENST00000395069	T;T	0.33438	1.41;1.41	5.5	3.53	0.40419	Heat shock protein DnaJ, N-terminal (5);	0.154813	0.56097	D	0.000021	T	0.18882	0.0453	N	0.20357	0.565	0.47511	D	0.999446	P	0.36354	0.549	B	0.40038	0.317	T	0.05517	-1.0880	10	0.37606	T	0.19	-7.4243	4.2702	0.10783	0.1957:0.0:0.6268:0.1776	.	314	Q8N4W6	DJC22_HUMAN	D	314	ENSP00000446830:E314D;ENSP00000378508:E314D	ENSP00000378508:E314D	E	+	3	2	DNAJC22	48031468	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	0.731000	0.26058	0.748000	0.32831	0.555000	0.69702	GAG	.	.	.	none		0.547	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
TMTC4	84899	hgsc.bcm.edu	37	13	101287091	101287091	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr13:101287091T>G	ENST00000376234.3	-	11	1606	c.1417A>C	c.(1417-1419)Agt>Cgt	p.S473R	TMTC4_ENST00000328767.5_Missense_Mutation_p.S362R|TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000342624.5_Missense_Mutation_p.S492R	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	473						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GACAGAGCACTTCTGAAAAGC	0.493																																					p.S492R		Atlas-SNP	.											.	TMTC4	103	.	0			c.A1474C						PASS	.						135.0	140.0	139.0					13																	101287091		2203	4300	6503	SO:0001583	missense	84899	exon12			GAGCACTTCTGAA		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1417A>C	chr13.hg19:g.101287091T>G	ENSP00000365408:p.Ser473Arg	95.0	0.0	.		62.0	21.0	.	NM_032813	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	hg19	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428259	0.83667	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.52526	0.66;0.66;0.66	5.55	5.55	0.83447	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.75406	0.3845	M	0.91663	3.23	0.80722	D	1	D;D;D;P	0.89917	1.0;0.999;1.0;0.737	D;D;D;P	0.97110	0.997;0.994;1.0;0.565	T	0.81901	-0.0720	10	0.87932	D	0	.	15.7439	0.77922	0.0:0.0:0.0:1.0	.	362;473;473;492	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	R	473;492;362	ENSP00000365408:S473R;ENSP00000343871:S492R;ENSP00000365409:S362R	ENSP00000365409:S362R	S	-	1	0	TMTC4	100085092	1.000000	0.71417	0.954000	0.39281	0.652000	0.38707	7.590000	0.82653	2.134000	0.65973	0.456000	0.33151	AGT	.	.	.	none		0.493	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
MTA1	9112	hgsc.bcm.edu	37	14	105927271	105927271	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr14:105927271C>T	ENST00000331320.7	+	10	1137	c.923C>T	c.(922-924)aCg>aTg	p.T308M	MTA1_ENST00000435036.2_5'Flank|MTA1_ENST00000405646.1_Missense_Mutation_p.T291M|MTA1_ENST00000406191.1_Missense_Mutation_p.T308M	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	308	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		AAGGATTTCACGGACATTCAG	0.597																																					p.T308M		Atlas-SNP	.											.	MTA1	61	.	0			c.C923T						PASS	.						109.0	108.0	109.0					14																	105927271		2203	4300	6503	SO:0001583	missense	9112	exon10			ATTTCACGGACAT	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.923C>T	chr14.hg19:g.105927271C>T	ENSP00000333633:p.Thr308Met	155.0	0.0	.		98.0	4.0	.	NM_004689	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	ENST00000331320.7	hg19	CCDS32169.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860017	0.71834	.	.	ENSG00000182979	ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000498644;ENST00000434050	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	4.38	3.47	0.39725	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.053947	0.85682	D	0.000000	T	0.41096	0.1144	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;0.977	D;P	0.67382	0.951;0.571	T	0.47774	-0.9091	10	0.66056	D	0.02	-8.7686	12.2148	0.54400	0.172:0.828:0.0:0.0	.	100;308	Q59FW1;Q13330	.;MTA1_HUMAN	M	217;308;308;291;222;100	ENSP00000333633:T308M;ENSP00000385702:T308M;ENSP00000384180:T291M;ENSP00000394106:T100M	ENSP00000333633:T308M	T	+	2	0	MTA1	104998316	0.994000	0.37717	0.923000	0.36655	0.976000	0.68499	3.151000	0.50670	0.814000	0.34374	0.655000	0.94253	ACG	.	.	.	none		0.597	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15		
PDPR	55066	hgsc.bcm.edu	37	16	70163023	70163023	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:70163023A>T	ENST00000288050.4	+	6	1562	c.605A>T	c.(604-606)aAt>aTt	p.N202I	PDPR_ENST00000398122.3_Missense_Mutation_p.N102I|PDPR_ENST00000568530.1_Missense_Mutation_p.N202I	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	202					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		GCCTCCCAAAATGGTGAGCAG	0.512																																					p.N202I		Atlas-SNP	.											.	PDPR	66	.	0			c.A605T						PASS	.						111.0	104.0	106.0					16																	70163023		1953	4159	6112	SO:0001583	missense	55066	exon6			CCCAAAATGGTGA		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.605A>T	chr16.hg19:g.70163023A>T	ENSP00000288050:p.Asn202Ile	379.0	0.0	.		473.0	124.0	.	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	hg19	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.196035	0.38806	.	.	ENSG00000090857	ENST00000288050;ENST00000398122	D;D	0.82167	-1.58;-1.58	4.5	3.4	0.38934	FAD dependent oxidoreductase (1);	0.236187	0.40385	N	0.001112	T	0.77765	0.4179	L	0.55213	1.73	0.80722	D	1	B	0.23806	0.091	B	0.28784	0.094	T	0.69224	-0.5201	10	0.31617	T	0.26	.	9.0915	0.36614	0.9111:0.0:0.0889:0.0	.	202	Q8NCN5	PDPR_HUMAN	I	202;102	ENSP00000288050:N202I;ENSP00000381190:N102I	ENSP00000288050:N202I	N	+	2	0	PDPR	68720524	1.000000	0.71417	0.967000	0.41034	0.965000	0.64279	5.368000	0.66133	0.581000	0.29539	0.455000	0.32223	AAT	.	.	.	none		0.512	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
KARS	3735	hgsc.bcm.edu	37	16	75678300	75678300	+	Intron	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:75678300A>T	ENST00000302445.3	-	2	102				KARS_ENST00000319410.5_Silent_p.L9L|KARS_ENST00000568378.1_Silent_p.L9L	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase						cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	ACCCCCTAACAAGCCTTACAG	0.552																																					p.L9L		Atlas-SNP	.											.	KARS	77	.	0			c.T27A						PASS	.						50.0	47.0	48.0					16																	75678300		1568	3582	5150	SO:0001627	intron_variant	3735	exon2			CCTAACAAGCCTT	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.63-2679T>A	chr16.hg19:g.75678300A>T		87.0	0.0	.		96.0	54.0	.	NM_001130089	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Silent	SNP	ENST00000302445.3	hg19	CCDS10923.1																																																																																			.	.	.	none		0.552	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1	NM_005548	
MYH4	4622	hgsc.bcm.edu	37	17	10358389	10358389	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:10358389G>T	ENST00000255381.2	-	21	2414	c.2304C>A	c.(2302-2304)ttC>ttA	p.F768L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	768	Actin-binding. {ECO:0000250}.|Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CAGCTTTGAAGAAAACCTTAT	0.403																																					p.F768L		Atlas-SNP	.											.	MYH4	349	.	0			c.C2304A						PASS	.						169.0	108.0	129.0					17																	10358389		2203	4300	6503	SO:0001583	missense	4622	exon21			TTTGAAGAAAACC		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2304C>A	chr17.hg19:g.10358389G>T	ENSP00000255381:p.Phe768Leu	104.0	0.0	.		115.0	31.0	.	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962237	0.74016	.	.	ENSG00000141048	ENST00000255381	D	0.94280	-3.39	5.04	5.04	0.67666	Myosin head, motor domain (2);	0.000000	0.39475	U	0.001344	D	0.97340	0.9130	H	0.96691	3.865	0.58432	D	0.999998	P	0.40794	0.729	P	0.51229	0.663	D	0.98383	1.0559	10	0.62326	D	0.03	.	18.7298	0.91731	0.0:0.0:1.0:0.0	.	768	Q9Y623	MYH4_HUMAN	L	768	ENSP00000255381:F768L	ENSP00000255381:F768L	F	-	3	2	MYH4	10299114	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	3.989000	0.56958	2.497000	0.84241	0.313000	0.20887	TTC	.	.	.	none		0.403	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
ADPRM	56985	hgsc.bcm.edu	37	17	10608594	10608594	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:10608594T>G	ENST00000379774.4	+	2	442	c.351T>G	c.(349-351)agT>agG	p.S117R	ADPRM_ENST00000609540.1_Missense_Mutation_p.S117R	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	117							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)										ATAACTTCAGTAGAGAGTATT	0.358																																					p.S117R		Atlas-SNP	.											.	.	.	.	0			c.T351G						PASS	.						83.0	78.0	80.0					17																	10608594		2203	4300	6503	SO:0001583	missense	56985	exon2			CTTCAGTAGAGAG	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.351T>G	chr17.hg19:g.10608594T>G	ENSP00000369099:p.Ser117Arg	113.0	0.0	.		149.0	81.0	.	NM_020233	A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Missense_Mutation	SNP	ENST00000379774.4	hg19	CCDS11159.2	.	.	.	.	.	.	.	.	.	.	T	13.35	2.211314	0.39102	.	.	ENSG00000170222	ENST00000379774	D	0.84800	-1.9	5.64	-3.05	0.05396	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.80919	0.4716	M	0.65498	2.005	0.80722	D	1	B	0.22080	0.064	B	0.27380	0.079	T	0.67264	-0.5714	10	0.21014	T	0.42	-25.0558	14.2725	0.66159	0.0:0.7691:0.1179:0.113	.	117	Q3LIE5	ADPRM_HUMAN	R	117	ENSP00000369099:S117R	ENSP00000369099:S117R	S	+	3	2	C17orf48	10549319	0.999000	0.42202	0.983000	0.44433	0.902000	0.53008	0.629000	0.24538	-0.424000	0.07382	-0.299000	0.09455	AGT	.	.	.	none		0.358	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233	
SUPT6H	6830	hgsc.bcm.edu	37	17	27014486	27014486	+	Silent	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:27014486G>T	ENST00000314616.6	+	23	3286	c.3003G>T	c.(3001-3003)ctG>ctT	p.L1001L	SUPT6H_ENST00000347486.4_Silent_p.L1001L	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1001	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CCCACCTCCTGAAGGTAGGAT	0.458																																					p.L1001L		Atlas-SNP	.											.	SUPT6H	165	.	0			c.G3003T						PASS	.						46.0	41.0	43.0					17																	27014486		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon23			CCTCCTGAAGGTA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3003G>T	chr17.hg19:g.27014486G>T		45.0	0.0	.		44.0	10.0	.	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	hg19	CCDS32596.1																																																																																			.	.	.	none		0.458	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
CACNB1	782	hgsc.bcm.edu	37	17	37341119	37341119	+	Splice_Site	SNP	T	T	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:37341119T>A	ENST00000394303.3	-	8	856		c.e8-2		CACNB1_ENST00000344140.5_Splice_Site|CACNB1_ENST00000582877.1_5'Flank|CACNB1_ENST00000394310.3_Splice_Site	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit						axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ATGCTCTGTCTGGGGGGGGAA	0.627																																					.	Esophageal Squamous(5;100 366 38393 41452 45827)	Atlas-SNP	.											.	CACNB1	89	.	0			c.649-2A>T						PASS	.						33.0	30.0	31.0					17																	37341119		2203	4300	6503	SO:0001630	splice_region_variant	782	exon9			TCTGTCTGGGGGG		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.649-2A>T	chr17.hg19:g.37341119T>A		102.0	0.0	.		83.0	50.0	.	NM_000723	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Splice_Site	SNP	ENST00000394303.3	hg19	CCDS42311.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618558	0.66787	.	.	ENSG00000067191	ENST00000539338;ENST00000394303;ENST00000344140;ENST00000394310;ENST00000536613	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1992	0.65690	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CACNB1	34594645	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.867000	0.87062	1.992000	0.58205	0.454000	0.30748	.	.	.	.	weak		0.627	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3		Intron
ERBB2	2064	hgsc.bcm.edu	37	17	37883597	37883597	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:37883597C>T	ENST00000269571.5	+	26	3368	c.3209C>T	c.(3208-3210)gCc>gTc	p.A1070V	MIEN1_ENST00000474210.1_5'Flank|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000541774.1_Missense_Mutation_p.A1055V|ERBB2_ENST00000584450.1_Intron|ERBB2_ENST00000445658.2_Missense_Mutation_p.A794V|ERBB2_ENST00000540147.1_Missense_Mutation_p.A1040V|ERBB2_ENST00000406381.2_Missense_Mutation_p.A1040V|ERBB2_ENST00000584601.1_Missense_Mutation_p.A1040V			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	1070					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GAAGAGGAGGCCCCCAGGTCT	0.617		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.A1070V		Atlas-SNP	.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2	429	.	0			c.C3209T						PASS	.						35.0	39.0	38.0					17																	37883597		2203	4300	6503	SO:0001583	missense	2064	exon26			AGGAGGCCCCCAG	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.3209C>T	chr17.hg19:g.37883597C>T	ENSP00000269571:p.Ala1070Val	73.0	0.0	.		74.0	21.0	.	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	hg19	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978099	0.34942	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.75704	-0.95;-0.95;-0.93;-0.96;-0.95	5.41	5.41	0.78517	.	.	.	.	.	T	0.63260	0.2496	L	0.29908	0.895	0.58432	D	0.99999	B;B;B	0.19817	0.017;0.019;0.039	B;B;B	0.18561	0.01;0.022;0.01	T	0.57854	-0.7739	9	0.17369	T	0.5	.	15.9084	0.79447	0.0:1.0:0.0:0.0	.	794;1055;1070	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	V	1040;1055;794;1070;1040	ENSP00000385185:A1040V;ENSP00000446466:A1055V;ENSP00000404047:A794V;ENSP00000269571:A1070V;ENSP00000443562:A1040V	ENSP00000269571:A1070V	A	+	2	0	ERBB2	35137123	0.667000	0.27484	0.997000	0.53966	0.976000	0.68499	2.804000	0.47931	2.515000	0.84797	0.561000	0.74099	GCC	.	.	.	none		0.617	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
C17orf77	146723	hgsc.bcm.edu	37	17	72588562	72588562	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:72588562G>T	ENST00000392620.1	+	3	739	c.377G>T	c.(376-378)tGc>tTc	p.C126F	C17orf77_ENST00000328023.2_Missense_Mutation_p.C126F|CD300LD_ENST00000375352.1_5'Flank	NM_152460.2	NP_689673.2	Q96MU5	CQ077_HUMAN	chromosome 17 open reading frame 77	126	Cys-rich.					extracellular region (GO:0005576)				breast(2)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11						TGCAAGGTGTGCCCAAACTTT	0.458																																					p.C126F		Atlas-SNP	.											.	C17orf77	31	.	0			c.G377T						PASS	.						151.0	143.0	145.0					17																	72588562		2203	4300	6503	SO:0001583	missense	146723	exon3			AGGTGTGCCCAAA		CCDS32721.1	17q25.1	2006-01-16			ENSG00000182352	ENSG00000182352			26480	protein-coding gene	gene with protein product							Standard	NM_152460		Approved	FLJ31882	uc002jla.1	Q96MU5	OTTHUMG00000067611	ENST00000392620.1:c.377G>T	chr17.hg19:g.72588562G>T	ENSP00000376396:p.Cys126Phe	70.0	0.0	.		65.0	18.0	.	NM_152460		Missense_Mutation	SNP	ENST00000392620.1	hg19	CCDS32721.1	.	.	.	.	.	.	.	.	.	.	G	2.196	-0.384056	0.04966	.	.	ENSG00000182352	ENST00000392620;ENST00000328023	T;T	0.55760	0.5;0.5	2.64	1.62	0.23740	.	.	.	.	.	T	0.39436	0.1078	N	0.08118	0	0.09310	N	1	D	0.59767	0.986	P	0.53861	0.736	T	0.18650	-1.0330	8	.	.	.	.	7.2654	0.26227	0.0:0.2771:0.7229:0.0	.	126	Q96MU5	CQ077_HUMAN	F	126	ENSP00000376396:C126F;ENSP00000329353:C126F	.	C	+	2	0	C17orf77	70100157	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.150000	0.16263	0.651000	0.30788	0.609000	0.83330	TGC	.	.	.	none		0.458	C17orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145090.2	NM_152460	
MARCH2	51257	hgsc.bcm.edu	37	19	8503277	8503277	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr19:8503277C>T	ENST00000602117.1	+	5	1043	c.588C>T	c.(586-588)tcC>tcT	p.S196S	MARCH2_ENST00000215555.2_Silent_p.S196S|MARCH2_ENST00000381035.4_Silent_p.S126S|MARCH2_ENST00000601283.1_Intron|MARCH2_ENST00000393944.1_Silent_p.S196S			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	196					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						CACAGGTCTCCTTCCGCTACC	0.637																																					p.S196S		Atlas-SNP	.											.	MARCH2	17	.	0			c.C588T						PASS	.						54.0	54.0	54.0					19																	8503277		2203	4300	6503	SO:0001819	synonymous_variant	51257	exon5			GGTCTCCTTCCGC	AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.588C>T	chr19.hg19:g.8503277C>T		87.0	0.0	.		62.0	22.0	.	NM_001005415	A6NP10|Q5H785|Q8N5A3|Q96B78	Silent	SNP	ENST00000602117.1	hg19	CCDS12202.1																																																																																			.	.	.	none		0.637	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460361.2	NM_016496	
MAG	4099	hgsc.bcm.edu	37	19	35804347	35804347	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr19:35804347G>T	ENST00000392213.3	+	11	2030	c.1871G>T	c.(1870-1872)cGg>cTg	p.R624L	MAG_ENST00000361922.4_3'UTR|MAG_ENST00000537831.2_Missense_Mutation_p.R599L	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	624					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GCTGAAATCCGGGTCAAGTGA	0.627																																					p.R624L		Atlas-SNP	.											MAG_ENST00000392213,colon,carcinoma,0,1	MAG	172	.	0			c.G1871T						PASS	.						53.0	44.0	47.0					19																	35804347		2203	4300	6503	SO:0001583	missense	4099	exon11			AAATCCGGGTCAA	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1871G>T	chr19.hg19:g.35804347G>T	ENSP00000376048:p.Arg624Leu	35.0	0.0	.		37.0	2.0	.	NM_002361	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	hg19	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.992488	0.74703	.	.	ENSG00000105695	ENST00000262624;ENST00000392213;ENST00000537831	T;T	0.70399	-0.48;-0.38	4.43	4.43	0.53597	.	0.205101	0.40554	N	0.001064	T	0.64193	0.2576	N	0.19112	0.55	0.36382	D	0.861966	D	0.63880	0.993	P	0.51229	0.663	T	0.74247	-0.3727	10	0.72032	D	0.01	.	12.4	0.55407	0.0:0.0:1.0:0.0	.	624	P20916	MAG_HUMAN	L	661;624;599	ENSP00000376048:R624L;ENSP00000440695:R599L	ENSP00000262624:R661L	R	+	2	0	MAG	40496187	1.000000	0.71417	0.939000	0.37840	0.958000	0.62258	5.034000	0.64152	2.274000	0.75844	0.462000	0.41574	CGG	.	.	.	none		0.627	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
MORC2	22880	hgsc.bcm.edu	37	22	31345772	31345772	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr22:31345772T>G	ENST00000397641.3	-	5	691	c.283A>C	c.(283-285)Act>Cct	p.T95P	MORC2_ENST00000215862.4_Missense_Mutation_p.T33P			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	95						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CCAATCTGAGTAGACTCAGGT	0.463																																					p.T33P		Atlas-SNP	.											.	MORC2	78	.	0			c.A97C						PASS	.						139.0	127.0	131.0					22																	31345772		2203	4300	6503	SO:0001583	missense	22880	exon6			TCTGAGTAGACTC	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.283A>C	chr22.hg19:g.31345772T>G	ENSP00000380763:p.Thr95Pro	82.0	0.0	.		59.0	23.0	.	NM_014941	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	hg19		.	.	.	.	.	.	.	.	.	.	T	26.9	4.777606	0.90195	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	D;D	0.95205	-3.64;-3.64	5.62	5.62	0.85841	ATPase-like, ATP-binding domain (4);	0.050861	0.85682	D	0.000000	D	0.94968	0.8372	L	0.35341	1.055	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	D	0.94117	0.7376	10	0.30854	T	0.27	.	15.8169	0.78608	0.0:0.0:0.0:1.0	.	95	Q9Y6X9	MORC2_HUMAN	P	95;33	ENSP00000380763:T95P;ENSP00000215862:T33P	ENSP00000215862:T33P	T	-	1	0	MORC2	29675772	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.698000	0.84413	2.151000	0.67156	0.482000	0.46254	ACT	.	.	.	none		0.463	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
MAGED2	10916	hgsc.bcm.edu	37	X	54841947	54841947	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chrX:54841947C>T	ENST00000375068.1	+	12	1886	c.1653C>T	c.(1651-1653)gcC>gcT	p.A551A	MAGED2_ENST00000396224.1_Silent_p.A551A|MAGED2_ENST00000375062.4_Silent_p.A466A|MAGED2_ENST00000347546.4_Silent_p.A533A|MAGED2_ENST00000375053.2_Silent_p.A551A|SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000218439.4_Silent_p.A551A|MAGED2_ENST00000375060.1_Silent_p.A466A|MAGED2_ENST00000375058.1_Silent_p.A551A			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	551						membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						gcactggtgccagtaccagta	0.602																																					p.A551A		Atlas-SNP	.											.	MAGED2	74	.	0			c.C1653T						PASS	.						35.0	28.0	30.0					X																	54841947		2197	4291	6488	SO:0001819	synonymous_variant	10916	exon12			TGGTGCCAGTACC	AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1653C>T	chrX.hg19:g.54841947C>T		48.0	0.0	.		47.0	4.0	.	NM_201222	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Silent	SNP	ENST00000375068.1	hg19	CCDS14362.1																																																																																			.	.	.	none		0.602	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	NM_014599	
TCEAL4	79921	hgsc.bcm.edu	37	X	102841929	102841929	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chrX:102841929A>T	ENST00000472745.1	+	3	878	c.326A>T	c.(325-327)gAa>gTa	p.E109V	TCEAL4_ENST00000494801.1_Missense_Mutation_p.E109V|TCEAL4_ENST00000415568.2_Missense_Mutation_p.E109V|TCEAL4_ENST00000468024.1_Missense_Mutation_p.E109V|TCEAL4_ENST00000472484.1_Missense_Mutation_p.E109V|TCEAL4_ENST00000372629.4_Missense_Mutation_p.E252V			Q96EI5	TCAL4_HUMAN	transcription elongation factor A (SII)-like 4	109	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|skin(2)	6						CCAGGGAGTGAAACAAGGGCT	0.507																																					p.E109V		Atlas-SNP	.											.	TCEAL4	18	.	0			c.A326T						PASS	.						67.0	67.0	67.0					X																	102841929		2203	4300	6503	SO:0001583	missense	79921	exon3			GGAGTGAAACAAG	AF314542	CCDS14510.2, CCDS76004.1	Xq22.2	2014-03-21			ENSG00000133142	ENSG00000133142			26121	protein-coding gene	gene with protein product						14702039, 16221301	Standard	XM_005262192		Approved	FLJ21174, WEX7	uc004ekn.3	Q96EI5	OTTHUMG00000022103	ENST00000472745.1:c.326A>T	chrX.hg19:g.102841929A>T	ENSP00000424314:p.Glu109Val	153.0	1.0	.		126.0	104.0	.	NM_001006935	Q8WY12|Q9H2H1|Q9H775	Missense_Mutation	SNP	ENST00000472745.1	hg19	CCDS14510.2	.	.	.	.	.	.	.	.	.	.	A	10.28	1.307826	0.23821	.	.	ENSG00000133142	ENST00000372629;ENST00000468024;ENST00000472484;ENST00000415568;ENST00000414064;ENST00000472745;ENST00000494801;ENST00000469586	T;T;T;T;T;T;T	0.35973	1.32;1.28;1.28;1.28;1.28;1.28;1.44	3.99	1.55	0.23275	.	0.216564	0.23312	N	0.049559	T	0.38214	0.1032	M	0.63843	1.955	0.09310	N	1	P	0.38250	0.624	P	0.45577	0.486	T	0.25187	-1.0139	10	0.56958	D	0.05	.	5.2758	0.15649	0.7556:0.0:0.2444:0.0	.	109	Q96EI5	TCAL4_HUMAN	V	252;109;109;109;80;109;109;109	ENSP00000361712:E252V;ENSP00000421857:E109V;ENSP00000421156:E109V;ENSP00000415564:E109V;ENSP00000424314:E109V;ENSP00000427494:E109V;ENSP00000427053:E109V	ENSP00000361712:E252V	E	+	2	0	TCEAL4	102728585	0.003000	0.15002	0.001000	0.08648	0.387000	0.30353	1.156000	0.31712	0.221000	0.20879	-0.681000	0.03757	GAA	.	.	.	none		0.507	TCEAL4-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252339.2	NM_024863	
SLC25A5	292	hgsc.bcm.edu	37	X	118603720	118603720	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chrX:118603720T>G	ENST00000317881.8	+	2	324	c.208T>G	c.(208-210)Ttc>Gtc	p.F70V	SLC25A5_ENST00000460013.1_3'UTR|SLC25A5-AS1_ENST00000446986.1_RNA	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	70					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	AGTTCTGTCCTTCTGGCGCGG	0.498																																					p.F70V		Atlas-SNP	.											.	SLC25A5	33	.	0			c.T208G						PASS	.						166.0	157.0	160.0					X																	118603720		2203	4300	6503	SO:0001583	missense	292	exon2			CTGTCCTTCTGGC	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.208T>G	chrX.hg19:g.118603720T>G	ENSP00000360671:p.Phe70Val	40.0	0.0	.		63.0	45.0	.	NM_001152	B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	hg19	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.010876	0.75046	.	.	ENSG00000005022	ENST00000317881	T	0.80214	-1.35	4.18	4.18	0.49190	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.90290	0.6963	M	0.90198	3.095	0.58432	D	0.999999	D	0.63880	0.993	D	0.69824	0.966	D	0.91908	0.5537	10	0.87932	D	0	.	12.1849	0.54231	0.0:0.0:0.0:1.0	.	70	P05141	ADT2_HUMAN	V	70	ENSP00000360671:F70V	ENSP00000360671:F70V	F	+	1	0	SLC25A5	118487748	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.575000	0.82447	1.622000	0.50330	0.430000	0.28490	TTC	.	.	.	none		0.498	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2	NM_001152	
LMO7	4008	hgsc.bcm.edu	37	13	76395479	76395497	+	Frame_Shift_Del	DEL	AAAGAAGATTCTACCACTT	AAAGAAGATTCTACCACTT	-	rs200351536|rs532984694|rs149099643	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	AAAGAAGATTCTACCACTT	AAAGAAGATTCTACCACTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr13:76395479_76395497delAAAGAAGATTCTACCACTT	ENST00000321797.8	+	12	2396_2414	c.1675_1693delAAAGAAGATTCTACCACTT	c.(1675-1695)aaagaagattctaccacttttfs	p.KEDSTTF559fs	LMO7_ENST00000465261.2_Frame_Shift_Del_p.KEDSTTF559fs|LMO7_ENST00000357063.3_Frame_Shift_Del_p.KEDSTTF844fs|LMO7_ENST00000377534.3_Frame_Shift_Del_p.KEDSTTF844fs|LMO7_ENST00000341547.4_Frame_Shift_Del_p.KEDSTTF510fs|LMO7_ENST00000526202.1_Frame_Shift_Del_p.KEDSTTF409fs			Q8WWI1	LMO7_HUMAN	LIM domain 7	844					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AGAAATTCCCAAAGAAGATTCTACCACTTTTGCAAAAAG	0.457																																					p.558_564del		Atlas-Indel,Pindel	.											.	LMO7	334	.	0			c.1674_1692del						PASS	.																																			SO:0001589	frameshift_variant	4008	exon11			.	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.1675_1693delAAAGAAGATTCTACCACTT	chr13.hg19:g.76395479_76395497delAAAGAAGATTCTACCACTT	ENSP00000317802:p.Lys559fs	161.0	0.0	0		104.0	28.0	0.269231	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Frame_Shift_Del	DEL	ENST00000321797.8	hg19																																																																																				.	.	.	none		0.457	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
EPB41L1	2036	hgsc.bcm.edu	37	20	34765954	34765956	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr20:34765954_34765956delCTT	ENST00000338074.2	+	4	584_586	c.423_425delCTT	c.(421-426)accttc>acc	p.F142del	EPB41L1_ENST00000373946.3_In_Frame_Del_p.F111del|EPB41L1_ENST00000373950.2_Intron|EPB41L1_ENST00000441639.1_In_Frame_Del_p.F80del|EPB41L1_ENST00000373941.1_In_Frame_Del_p.F142del|EPB41L1_ENST00000202028.5_In_Frame_Del_p.F80del	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	142	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TCGGCCTGACCTTCTGTGATGCT	0.576																																					p.141_142del		Atlas-Indel,Pindel	.											.	EPB41L1	111	.	0			c.422_424del						PASS	.																																			SO:0001651	inframe_deletion	2036	exon5			.	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.423_425delCTT	chr20.hg19:g.34765954_34765956delCTT	ENSP00000337168:p.Phe142del	64.0	0.0	0		50.0	20.0	0.4	NM_001258329	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	In_Frame_Del	DEL	ENST00000338074.2	hg19	CCDS13271.1																																																																																			.	.	.	none		0.576	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
KIAA1614	57710	hgsc.bcm.edu	37	1	180885446	180885457	+	In_Frame_Del	DEL	TCCCAGGGTATG	TCCCAGGGTATG	-	rs377550267		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	TCCCAGGGTATG	TCCCAGGGTATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:180885446_180885457delTCCCAGGGTATG	ENST00000367588.4	+	2	262_273	c.207_218delTCCCAGGGTATG	c.(205-219)cctcccagggtatgg>ccg	p.PRVW70del		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	70										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CCCCCCAGCCTCCCAGGGTATGGGGAGTACAG	0.599																																					p.69_73del		Atlas-Indel,Pindel	.											KIAA1614,NS,chondrosarcoma,0,1	KIAA1614	75	.	0			c.206_217del						PASS	.																																			SO:0001651	inframe_deletion	57710	exon2			.	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.207_218delTCCCAGGGTATG	chr1.hg19:g.180885446_180885457delTCCCAGGGTATG	ENSP00000356560:p.Pro70_Trp73del	67.0	0.0	0		53.0	17.0	0.320755	NM_020950	Q5VZ45|Q9HCF8	In_Frame_Del	DEL	ENST00000367588.4	hg19	CCDS41442.1																																																																																			.	.	.	none		0.599	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
C11orf57	55216	hgsc.bcm.edu	37	11	111953315	111953315	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:111953315delC	ENST00000280352.9	+	6	1134	c.498delC	c.(496-498)cacfs	p.H166fs	C11orf57_ENST00000393047.3_Frame_Shift_Del_p.H167fs|TIMM8B_ENST00000507614.1_5'Flank|C11orf57_ENST00000420986.2_Frame_Shift_Del_p.H166fs|C11orf57_ENST00000532163.1_Frame_Shift_Del_p.H138fs	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	166	Lys-rich.									autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AAAGGTCACACAAAAAACAGA	0.413																																					p.H167fs		Atlas-Indel,Pindel	.											.	C11orf57	41	.	0			c.500delA						PASS	.						99.0	105.0	103.0					11																	111953315		2201	4297	6498	SO:0001589	frameshift_variant	55216	exon6			.	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.498delC	chr11.hg19:g.111953315delC	ENSP00000339076:p.His166fs	256.0	0.0	0		209.0	79.0	0.37799	NM_001082969	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Frame_Shift_Del	DEL	ENST00000280352.9	hg19	CCDS41715.1																																																																																			.	.	.	none		0.413	C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195	
DPYS	1807	hgsc.bcm.edu	37	8	105393497	105393499	+	In_Frame_Del	DEL	CTT	CTT	-	rs148864394	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:105393497_105393499delCTT	ENST00000351513.2	-	9	1619_1621	c.1487_1489delAAG	c.(1486-1491)gaagtc>gtc	p.E496del	DPYS_ENST00000521601.1_5'UTR	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	496					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AGTGTGGCGACTTCTCCCTTATA	0.483																																					p.496_497del		Atlas-Indel,Pindel	.											.	DPYS	107	.	0			c.1488_1490del						PASS	.																																			SO:0001651	inframe_deletion	1807	exon9			.	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.1487_1489delAAG	chr8.hg19:g.105393497_105393499delCTT	ENSP00000276651:p.Glu496del	69.0	0.0	0		55.0	26.0	0.472727	NM_001385		In_Frame_Del	DEL	ENST00000351513.2	hg19	CCDS6302.1																																																																																			.	.	.	none		0.483	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	
RFX8	731220	hgsc.bcm.edu	37	2	102018936	102018936	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:102018936delT	ENST00000376826.2	-	14	1545	c.1546delA	c.(1546-1548)atcfs	p.I516fs	RFX8_ENST00000428343.1_Frame_Shift_Del_p.I403fs			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						AAGCCCAGGATCCTGAGGACC	0.607																																					p.I403fs		Atlas-INDEL	.											.	RFX8	16	.	0			c.1208delT						PASS	.						44.0	43.0	43.0					2																	102018936		692	1591	2283	SO:0001589	frameshift_variant	731220	exon11			.	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1546delA	chr2.hg19:g.102018936delT	ENSP00000366022:p.Ile516fs	107.0	0.0	0		89.0	38.0	0.426966	NM_001145664	B4DQ32	Frame_Shift_Del	DEL	ENST00000376826.2	hg19																																																																																				.	.	.	none		0.607	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
CNOT1	23019	hgsc.bcm.edu	37	16	58592566	58592570	+	Frame_Shift_Del	DEL	CAAGA	CAAGA	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	CAAGA	CAAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:58592566_58592570delCAAGA	ENST00000317147.5	-	18	2471_2475	c.2139_2143delTCTTG	c.(2137-2145)cctcttgctfs	p.LA714fs	CNOT1_ENST00000569240.1_Frame_Shift_Del_p.LA714fs|CNOT1_ENST00000441024.2_Frame_Shift_Del_p.LA714fs|CNOT1_ENST00000569732.1_5'Flank|SNORA50_ENST00000384225.2_RNA	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	714					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GTCATTCCAGCAAGAGGGTCAATCT	0.4																																					p.714_715del		Atlas-Indel,Pindel	.											CNOT1_ENST00000441024,NS,lymphoid_neoplasm,0,2	CNOT1	359	.	0			c.2140_2144del						PASS	.																																			SO:0001589	frameshift_variant	23019	exon18			.	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2139_2143delTCTTG	chr16.hg19:g.58592566_58592570delCAAGA	ENSP00000320949:p.Leu714fs	102.0	0.0	0		97.0	46.0	0.474227	NM_001265612	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Del	DEL	ENST00000317147.5	hg19	CCDS10799.1																																																																																			.	.	.	none		0.400	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CFAP46	54777	hgsc.bcm.edu	37	10	134738376	134738376	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:134738376delG	ENST00000368586.5	-	11	1180	c.1080delC	c.(1078-1080)atcfs	p.I361fs	TTC40_ENST00000368582.2_Frame_Shift_Del_p.I361fs	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCCTCTGTATGATATCCAGCT	0.687																																					p.I361fs		Atlas-Indel,Pindel	.											.	TTC40	100	.	0			c.1081delA						PASS	.																																			SO:0001589	frameshift_variant	54777	exon11			.																												ENST00000368586.5:c.1080delC	chr10.hg19:g.134738376delG	ENSP00000357575:p.Ile361fs	129.0	0.0	0		82.0	39.0	0.47561	NM_001200049		Frame_Shift_Del	DEL	ENST00000368586.5	hg19	CCDS58101.1																																																																																			.	.	.	none		0.687	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
NUFIP1	26747	hgsc.bcm.edu	37	13	45563329	45563329	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr13:45563329delG	ENST00000379161.4	-	1	289	c.243delC	c.(241-243)ttcfs	p.F81fs	GPALPP1_ENST00000379151.4_5'Flank|RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000361121.2_5'Flank	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	81	Pro-rich.				box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TCTGGGCGTCGAAGGGGGGCG	0.657																																					p.D82fs		Atlas-INDEL	.											.	NUFIP1	41	.	0			c.244delG						PASS	.						14.0	17.0	16.0					13																	45563329		2189	4285	6474	SO:0001589	frameshift_variant	26747	exon1			.	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.243delC	chr13.hg19:g.45563329delG	ENSP00000368459:p.Phe81fs	130.0	0.0	0		113.0	22.0	0.19469	NM_012345	Q8WVM5|Q96SG1	Frame_Shift_Del	DEL	ENST00000379161.4	hg19	CCDS9393.1																																																																																			.	.	.	none		0.657	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
ABCB9	23457	hgsc.bcm.edu	37	12	123465766	123465770	+	5'UTR	DEL	AGAGC	AGAGC	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	AGAGC	AGAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr12:123465766_123465770delAGAGC	ENST00000542678.1	-	0	426_430				ARL6IP4_ENST00000454885.2_Frame_Shift_Del_p.KS27fs|ARL6IP4_ENST00000412505.2_Frame_Shift_Del_p.KS27fs|ARL6IP4_ENST00000439686.2_Frame_Shift_Del_p.KS27fs|ARL6IP4_ENST00000543566.1_Frame_Shift_Del_p.KS150fs|ARL6IP4_ENST00000426960.2_Frame_Shift_Del_p.KS27fs|RP11-197N18.2_ENST00000540866.2_RNA|ARL6IP4_ENST00000315580.5_Frame_Shift_Del_p.KS150fs|ARL6IP4_ENST00000453766.2_Frame_Shift_Del_p.KS150fs|ARL6IP4_ENST00000392435.2_Frame_Shift_Del_p.KS150fs|ARL6IP4_ENST00000357866.4_Frame_Shift_Del_p.KS27fs			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9						peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		AGAAAGAAGAAGAGCAGGAAAGACA	0.683																																					p.150_151del	Ovarian(49;786 1333 9175 38236)	Atlas-Indel,Pindel	.											.	ARL6IP4	14	.	0			c.448_452del						PASS	.																																			SO:0001623	5_prime_UTR_variant	51329	exon2			.	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.-2413GCTCT>-	chr12.hg19:g.123465766_123465770delAGAGC		155.0	0.0	0		144.0	31.0	0.215278	NM_018694	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Frame_Shift_Del	DEL	ENST00000542678.1	hg19	CCDS9241.1																																																																																			.	.	.	none		0.683	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624	
RFX8	731220	hgsc.bcm.edu	37	2	102018936	102018937	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:102018936_102018937delTC	ENST00000376826.2	-	14	1544_1545	c.1545_1546delGA	c.(1543-1548)aggatcfs	p.RI515fs	RFX8_ENST00000428343.1_Frame_Shift_Del_p.RI402fs			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						AAGCCCAGGATCCTGAGGACCA	0.609																																					p.403_403del		Pindel	.											.	RFX8	16	.	0			c.1207_1208del						PASS	.																																			SO:0001589	frameshift_variant	731220	exon11			.	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1545_1546delGA	chr2.hg19:g.102018936_102018937delTC	ENSP00000366022:p.Arg515fs	109.0	0.0	.		90.0	27.0	0.300	NM_001145664	B4DQ32	Frame_Shift_Del	DEL	ENST00000376826.2	hg19																																																																																				.	.	.	none		0.609	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
