#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SFN	2810	hgsc.bcm.edu	37	1	27189915	27189915	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:27189915A>G	ENST00000339276.4	+	1	283	c.212A>G	c.(211-213)gAg>gGg	p.E71G		NM_006142.3	NP_006133.1	Q9Y3B8	ORN_HUMAN	stratifin	0	Exonuclease.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide metabolic process (GO:0009117)	focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	9		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		AAAAGCAACGAGGAGGGCTCG	0.627																																					p.E71G		Atlas-SNP	.											.	SFN	20	.	0			c.A212G						PASS	.						69.0	74.0	72.0					1																	27189915		2203	4300	6503	SO:0001583	missense	2810	exon1			GCAACGAGGAGGG	BC023552	CCDS288.1	1p36.11	2008-02-05			ENSG00000175793	ENSG00000175793			10773	protein-coding gene	gene with protein product	"""14-3-3 sigma"""	601290				8515476	Standard	NM_006142		Approved	YWHAS	uc001bnc.1	P31947	OTTHUMG00000004093	ENST00000339276.4:c.212A>G	chr1.hg19:g.27189915A>G	ENSP00000340989:p.Glu71Gly	106.0	0.0	.		116.0	46.0	.	NM_006142	B2R532|Q32Q18|Q53FT1|Q6FIC6|Q9UFY7	Missense_Mutation	SNP	ENST00000339276.4	hg19	CCDS288.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535187	0.27475	.	.	ENSG00000175793	ENST00000339276;ENST00000538651	T	0.39787	1.06	5.96	5.96	0.96718	14-3-3 domain (4);	0.106868	0.41396	D	0.000892	T	0.16938	0.0407	N	0.00873	-1.125	0.27459	N	0.9532	B	0.02656	0.0	B	0.04013	0.001	T	0.13818	-1.0495	10	0.54805	T	0.06	-27.1227	12.0125	0.53295	0.8558:0.1442:0.0:0.0	.	71	P31947	1433S_HUMAN	G	71	ENSP00000340989:E71G	ENSP00000340989:E71G	E	+	2	0	SFN	27062502	1.000000	0.71417	0.994000	0.49952	0.719000	0.41307	4.148000	0.58085	2.270000	0.75569	0.533000	0.62120	GAG	.	.	.	none		0.627	SFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011709.1	NM_006142	
PIAS3	10401	hgsc.bcm.edu	37	1	145578967	145578967	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:145578967C>T	ENST00000393045.2	+	4	635	c.545C>T	c.(544-546)gCc>gTc	p.A182V	PIAS3_ENST00000369298.1_Missense_Mutation_p.A147V|PIAS3_ENST00000369299.3_Missense_Mutation_p.A173V	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	182	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTGCCAGGAGCCAAATGTGAT	0.527																																					p.A182V		Atlas-SNP	.											.	PIAS3	96	.	0			c.C545T						PASS	.						109.0	97.0	101.0					1																	145578967		2203	4300	6503	SO:0001583	missense	10401	exon4			CAGGAGCCAAATG	AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.545C>T	chr1.hg19:g.145578967C>T	ENSP00000376765:p.Ala182Val	126.0	0.0	.		131.0	48.0	.	NM_006099	Q9UFI3	Missense_Mutation	SNP	ENST00000393045.2	hg19	CCDS920.2	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478871	0.44044	.	.	ENSG00000131788	ENST00000393046;ENST00000369299;ENST00000393045;ENST00000369298	T;T;T;T	0.44881	0.93;0.91;1.54;1.51	4.33	4.33	0.51752	PINIT domain (1);	0.000000	0.49916	D	0.000123	T	0.13841	0.0335	N	0.17474	0.49	0.38130	D	0.938123	B;P	0.47841	0.024;0.901	B;B	0.41088	0.061;0.347	T	0.03240	-1.1057	10	0.13108	T	0.6	-12.7129	14.3972	0.67020	0.0:1.0:0.0:0.0	.	173;182	F8WA94;Q9Y6X2	.;PIAS3_HUMAN	V	173;173;182;147	ENSP00000376766:A173V;ENSP00000358305:A173V;ENSP00000376765:A182V;ENSP00000358304:A147V	ENSP00000358304:A147V	A	+	2	0	PIAS3	144290324	0.999000	0.42202	1.000000	0.80357	0.582000	0.36321	1.616000	0.36933	2.230000	0.72887	0.655000	0.94253	GCC	.	.	.	none		0.527	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038533.4	NM_006099	
TSACC	128229	hgsc.bcm.edu	37	1	156309583	156309583	+	Splice_Site	SNP	G	G	C	rs113369857		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:156309583G>C	ENST00000368255.3	+	2	394		c.e2+1		TSACC_ENST00000470342.1_Splice_Site|CCT3_ENST00000368261.3_5'Flank|CCT3_ENST00000472765.2_5'Flank|CCT3_ENST00000295688.3_5'Flank|TSACC_ENST00000368253.2_Splice_Site|CCT3_ENST00000368256.3_5'Flank|TSACC_ENST00000481479.1_Splice_Site|TSACC_ENST00000368252.1_Splice_Site|TSACC_ENST00000368254.1_Splice_Site|TSACC_ENST00000368251.1_Splice_Site|TSACC_ENST00000466306.1_Splice_Site|CCT3_ENST00000368259.2_5'Flank	NM_144627.3	NP_653228.1	Q96A04	TSACC_HUMAN	TSSK6 activating co-chaperone							cytoplasm (GO:0005737)	chaperone binding (GO:0051087)										AACAGAAAAGGTGTGTGTTGG	0.483																																					.		Atlas-SNP	.											.	.	.	.	0			c.34+1G>C						PASS	.						147.0	127.0	134.0					1																	156309583		2203	4300	6503	SO:0001630	splice_region_variant	128229	exon2			GAAAAGGTGTGTG	AY048672	CCDS1141.1	1q22	2012-08-16	2012-08-16	2012-08-16	ENSG00000163467	ENSG00000163467			30636	protein-coding gene	gene with protein product	"""SSTK-interacting protein"""		"""chromosome 1 open reading frame 182"""	C1orf182		20829357	Standard	NM_144627		Approved	SSTK-IP, SIP	uc001foo.3	Q96A04	OTTHUMG00000024060	ENST00000368255.3:c.34+1G>C	chr1.hg19:g.156309583G>C		68.0	0.0	.		59.0	17.0	.	NM_144627	D3DVB9	Splice_Site	SNP	ENST00000368255.3	hg19	CCDS1141.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792835	0.50102	.	.	ENSG00000163467	ENST00000368255;ENST00000368254;ENST00000368253;ENST00000368252;ENST00000368251	.	.	.	2.76	2.76	0.32466	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1866	0.37174	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf182	154576207	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	2.090000	0.41682	1.852000	0.53769	0.467000	0.42956	.	.	.	.	alt		0.483	TSACC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060594.1	NM_144627	Intron
CALCRL	10203	hgsc.bcm.edu	37	2	188245425	188245425	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:188245425A>G	ENST00000409998.1	-	7	1055	c.274T>C	c.(274-276)Ttt>Ctt	p.F92L	AC007319.1_ENST00000453517.1_RNA|CALCRL_ENST00000392370.3_Missense_Mutation_p.F92L|CALCRL_ENST00000410068.1_Missense_Mutation_p.F92L|AC007319.1_ENST00000412276.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	92					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			AAGTCCTGAAAGTAATCAGGG	0.418																																					p.F92L		Atlas-SNP	.											.	CALCRL	73	.	0			c.T274C						PASS	.						68.0	66.0	67.0					2																	188245425		2203	4300	6503	SO:0001583	missense	10203	exon5			CCTGAAAGTAATC	U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.274T>C	chr2.hg19:g.188245425A>G	ENSP00000386972:p.Phe92Leu	41.0	0.0	.		67.0	34.0	.	NM_001271751	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	hg19	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	A	31	5.083990	0.94100	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.64803	-0.12;-0.12;-0.12	5.29	5.29	0.74685	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.64402	D	0.000002	T	0.54886	0.1886	L	0.42008	1.315	0.80722	D	1	P	0.46220	0.874	B	0.42495	0.389	T	0.53041	-0.8494	10	0.25751	T	0.34	.	13.2254	0.59912	1.0:0.0:0.0:0.0	.	92	Q16602	CALRL_HUMAN	L	92	ENSP00000376177:F92L;ENSP00000386972:F92L;ENSP00000387190:F92L	ENSP00000376177:F92L	F	-	1	0	CALCRL	187953670	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.861000	0.75478	2.221000	0.72209	0.455000	0.32223	TTT	.	.	.	none		0.418	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
WDR12	55759	hgsc.bcm.edu	37	2	203762106	203762106	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:203762106C>T	ENST00000261015.4	-	5	1120	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	WDR12_ENST00000477723.1_5'Flank	NM_018256.3	NP_060726.3			WD repeat domain 12											endometrium(3)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)	13						GGACCAGATCCGAGAAGTCTT	0.383																																					p.R124Q		Atlas-SNP	.											.	WDR12	35	.	0			c.G371A						PASS	.						105.0	97.0	100.0					2																	203762106		2203	4300	6503	SO:0001583	missense	55759	exon5			CAGATCCGAGAAG	AF242546	CCDS2356.1	2q33.1	2013-01-09			ENSG00000138442	ENSG00000138442		"""WD repeat domain containing"""	14098	protein-coding gene	gene with protein product						16043514, 17353269	Standard	NM_018256		Approved	YTM1, FLJ10881	uc002uzl.3	Q9GZL7	OTTHUMG00000132855	ENST00000261015.4:c.371G>A	chr2.hg19:g.203762106C>T	ENSP00000261015:p.Arg124Gln	120.0	0.0	.		107.0	26.0	.	NM_018256		Missense_Mutation	SNP	ENST00000261015.4	hg19	CCDS2356.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695498	0.48202	.	.	ENSG00000138442	ENST00000261015	T	0.67865	-0.29	5.33	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056455	0.64402	N	0.000001	T	0.70570	0.3239	M	0.87827	2.91	0.53688	D	0.999978	B;B	0.21753	0.06;0.06	B;B	0.13407	0.009;0.009	T	0.71034	-0.4709	10	0.56958	D	0.05	-7.5369	13.8674	0.63596	0.0:0.9263:0.0:0.0737	.	124;124	Q53T99;Q9GZL7	.;WDR12_HUMAN	Q	124	ENSP00000261015:R124Q	ENSP00000261015:R124Q	R	-	2	0	WDR12	203470351	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.869000	0.63028	1.229000	0.43630	-0.218000	0.12543	CGG	.	.	.	none		0.383	WDR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256329.4	NM_018256	
COL4A3	1285	hgsc.bcm.edu	37	2	228145271	228145271	+	Missense_Mutation	SNP	G	G	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:228145271G>T	ENST00000396578.3	+	30	2501	c.2339G>T	c.(2338-2340)gGa>gTa	p.G780V	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000439598.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	780	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GGTCTCCCTGGAACTCCAGGA	0.498																																					p.G780V		Atlas-SNP	.											.	COL4A3	293	.	0			c.G2339T	GRCh37	CM034405	COL4A3	M		PASS	.						102.0	104.0	103.0					2																	228145271		1895	4117	6012	SO:0001583	missense	1285	exon30			TCCCTGGAACTCC		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.2339G>T	chr2.hg19:g.228145271G>T	ENSP00000379823:p.Gly780Val	175.0	0.0	.		198.0	66.0	.	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	hg19	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249670	0.59212	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.99353	-5.77	5.49	5.49	0.81192	.	0.000000	0.56097	D	0.000033	D	0.99542	0.9836	M	0.93016	3.37	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98235	1.0485	10	0.87932	D	0	.	16.2931	0.82759	0.0:0.0:1.0:0.0	.	780;780;780;780	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	V	780	ENSP00000379823:G780V	ENSP00000323334:G780V	G	+	2	0	COL4A3	227853515	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.405000	0.66351	2.596000	0.87737	0.557000	0.71058	GGA	.	.	.	none		0.498	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
FBXO36	130888	hgsc.bcm.edu	37	2	230875429	230875429	+	Silent	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr2:230875429A>G	ENST00000283946.3	+	4	414	c.396A>G	c.(394-396)aaA>aaG	p.K132K	FBXO36_ENST00000409992.1_Silent_p.K112K|FBXO36_ENST00000373652.3_Silent_p.K101K	NM_174899.4	NP_777559.3	Q8NEA4	FBX36_HUMAN	F-box protein 36	132	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.									endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	7		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGTCTGATAAACTGTGGGAAC	0.532																																					p.K132K		Atlas-SNP	.											.	FBXO36	22	.	0			c.A396G						PASS	.						63.0	56.0	58.0					2																	230875429		2203	4300	6503	SO:0001819	synonymous_variant	130888	exon4			TGATAAACTGTGG	BC033935	CCDS2472.1	2q37.1	2008-02-05	2004-06-15		ENSG00000153832	ENSG00000153832		"""F-boxes /  ""other"""""	27020	protein-coding gene	gene with protein product		609105	"""F-box only protein 36"""			12477932	Standard	NM_174899		Approved	Fbx36, FLJ37592	uc002vqa.3	Q8NEA4	OTTHUMG00000133206	ENST00000283946.3:c.396A>G	chr2.hg19:g.230875429A>G		46.0	0.0	.		64.0	17.0	.	NM_174899	B3KVQ6|Q53TE6|Q8WWD4	Silent	SNP	ENST00000283946.3	hg19	CCDS2472.1																																																																																			.	.	.	none		0.532	FBXO36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256919.2	NM_174899	
TWF2	11344	hgsc.bcm.edu	37	3	52269098	52269098	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr3:52269098A>G	ENST00000305533.5	-	2	293	c.50T>C	c.(49-51)tTt>tCt	p.F17S	TLR9_ENST00000597542.1_5'UTR|TWF2_ENST00000499914.2_Missense_Mutation_p.F17S	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	17	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGCCTTGGCAAAGAATTCCTT	0.572																																					p.F17S		Atlas-SNP	.											.	TWF2	33	.	0			c.T50C						PASS	.						112.0	98.0	103.0					3																	52269098		2203	4300	6503	SO:0001583	missense	11344	exon2			TTGGCAAAGAATT	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.50T>C	chr3.hg19:g.52269098A>G	ENSP00000303908:p.Phe17Ser	80.0	0.0	.		103.0	33.0	.	NM_007284	Q9Y3F5	Missense_Mutation	SNP	ENST00000305533.5	hg19	CCDS2849.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727062	0.89390	.	.	ENSG00000247596	ENST00000305533;ENST00000499914	T;T	0.46063	0.88;0.88	4.58	4.58	0.56647	Actin-binding, cofilin/tropomyosin type (2);	.	.	.	.	T	0.71863	0.3390	M	0.93375	3.41	0.48288	D	0.999623	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80141	-0.1506	9	0.87932	D	0	.	13.2613	0.60106	1.0:0.0:0.0:0.0	.	17;17	D6RG15;Q6IBS0	.;TWF2_HUMAN	S	17	ENSP00000303908:F17S;ENSP00000426464:F17S	ENSP00000303908:F17S	F	-	2	0	TWF2	52244138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.871000	0.92346	1.927000	0.55829	0.459000	0.35465	TTT	.	.	.	none		0.572	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		
KALRN	8997	hgsc.bcm.edu	37	3	124438147	124438147	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr3:124438147A>G	ENST00000291478.5	+	27	3863	c.3700A>G	c.(3700-3702)Aca>Gca	p.T1234A	KALRN_ENST00000360013.3_Missense_Mutation_p.T2931A|KALRN_ENST00000428018.2_Missense_Mutation_p.T1202A	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2930					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CACAGCAGCCACATGCTTGCA	0.532																																					p.T2931A		Atlas-SNP	.											.	KALRN	556	.	0			c.A8791G						PASS	.						49.0	52.0	51.0					3																	124438147		2203	4300	6503	SO:0001583	missense	8997	exon60			GCAGCCACATGCT	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.3700A>G	chr3.hg19:g.124438147A>G	ENSP00000291478:p.Thr1234Ala	91.0	0.0	.		105.0	5.0	.	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	hg19	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	A	8.186	0.794821	0.16327	.	.	ENSG00000160145	ENST00000360013;ENST00000291478;ENST00000428018	T;T;T	0.38560	1.13;1.13;1.13	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.136740	0.50627	D	0.000115	T	0.16896	0.0406	N	0.01209	-0.955	0.29636	N	0.845117	B;B	0.13594	0.008;0.001	B;B	0.14023	0.01;0.003	T	0.05666	-1.0871	10	0.09843	T	0.71	.	15.4077	0.74893	1.0:0.0:0.0:0.0	.	1234;2930	C9JQ37;O60229	.;KALRN_HUMAN	A	2931;1234;1202	ENSP00000353109:T2931A;ENSP00000291478:T1234A;ENSP00000402419:T1202A	ENSP00000291478:T1234A	T	+	1	0	KALRN	125920837	0.999000	0.42202	1.000000	0.80357	0.478000	0.33099	1.735000	0.38176	2.225000	0.72522	0.460000	0.39030	ACA	.	.	.	none		0.532	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
FNDC3B	64778	hgsc.bcm.edu	37	3	172025192	172025192	+	Silent	SNP	C	C	G	rs145255541		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr3:172025192C>G	ENST00000336824.4	+	10	1200	c.1101C>G	c.(1099-1101)tcC>tcG	p.S367S	FNDC3B_ENST00000416957.1_Silent_p.S367S|FNDC3B_ENST00000415807.2_Silent_p.S367S	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	367	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		GATCCTGCTCCGAGCCTGTTA	0.502																																					p.S367S		Atlas-SNP	.											.	FNDC3B	118	.	0			c.C1101G						PASS	.						154.0	129.0	138.0					3																	172025192		2203	4300	6503	SO:0001819	synonymous_variant	64778	exon10			CTGCTCCGAGCCT	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1101C>G	chr3.hg19:g.172025192C>G		106.0	0.0	.		131.0	39.0	.	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	hg19	CCDS3217.1																																																																																			.	C|1.000;T|0.000	.	alt		0.502	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
TBC1D14	57533	hgsc.bcm.edu	37	4	7026865	7026865	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:7026865C>A	ENST00000409757.4	+	13	2016	c.1892C>A	c.(1891-1893)aCc>aAc	p.T631N	TBC1D14_ENST00000451522.2_Missense_Mutation_p.T351N|TBC1D14_ENST00000448507.1_Missense_Mutation_p.T631N|TBC1D14_ENST00000446947.2_Missense_Mutation_p.T278N|TBC1D14_ENST00000410031.1_Missense_Mutation_p.T403N	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	631					negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						GACATCCTGACCAAGATGGAC	0.612																																					p.T631N		Atlas-SNP	.											.	TBC1D14	110	.	0			c.C1892A						PASS	.						145.0	117.0	127.0					4																	7026865		2203	4300	6503	SO:0001583	missense	57533	exon13			TCCTGACCAAGAT	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1892C>A	chr4.hg19:g.7026865C>A	ENSP00000386921:p.Thr631Asn	134.0	0.0	.		168.0	45.0	.	NM_001113361	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	ENST00000409757.4	hg19	CCDS3394.2	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681226	0.47886	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522;ENST00000446947	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.15	5.15	0.70609	Rab-GAP/TBC domain (2);	0.162937	0.53938	D	0.000045	T	0.19287	0.0463	N	0.08118	0	0.58432	D	0.999994	B;B;B	0.34372	0.451;0.02;0.187	B;B;B	0.43838	0.242;0.104;0.433	T	0.25082	-1.0142	10	0.66056	D	0.02	-12.687	17.6366	0.88124	0.0:1.0:0.0:0.0	.	278;351;631	F5GXK4;Q9P2M4-2;Q9P2M4	.;.;TBC14_HUMAN	N	631;631;403;351;278	ENSP00000404041:T631N;ENSP00000386921:T631N;ENSP00000386343:T403N;ENSP00000388886:T351N;ENSP00000405875:T278N	ENSP00000386921:T631N	T	+	2	0	TBC1D14	7077766	0.256000	0.24012	1.000000	0.80357	0.994000	0.84299	1.090000	0.30902	2.409000	0.81822	0.561000	0.74099	ACC	.	.	.	none		0.612	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773	
PDLIM5	10611	hgsc.bcm.edu	37	4	95496927	95496927	+	Missense_Mutation	SNP	C	C	G	rs200734812		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:95496927C>G	ENST00000317968.4	+	5	588	c.452C>G	c.(451-453)aCc>aGc	p.T151S	PDLIM5_ENST00000514743.1_Intron|PDLIM5_ENST00000538141.1_Intron|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000318007.5_Intron|PDLIM5_ENST00000450793.1_Intron|PDLIM5_ENST00000508216.1_Intron|PDLIM5_ENST00000542407.1_Missense_Mutation_p.T29S|PDLIM5_ENST00000380180.3_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	151					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TCTGCCTTCACCCCAGCCCAT	0.542																																					p.T151S		Atlas-SNP	.											.	PDLIM5	76	.	0			c.C452G						PASS	.						332.0	281.0	299.0					4																	95496927		2203	4300	6503	SO:0001583	missense	10611	exon5			CCTTCACCCCAGC	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.452C>G	chr4.hg19:g.95496927C>G	ENSP00000321746:p.Thr151Ser	346.0	0.0	.		408.0	111.0	.	NM_006457	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	ENST00000317968.4	hg19	CCDS3641.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981800	0.53827	.	.	ENSG00000163110	ENST00000317968;ENST00000542407	T;T	0.58940	0.72;0.3	5.25	5.25	0.73442	.	0.106561	0.64402	D	0.000004	T	0.72566	0.3476	M	0.65975	2.015	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.66337	-0.5949	10	0.13470	T	0.59	.	19.2104	0.93751	0.0:1.0:0.0:0.0	.	151	Q96HC4	PDLI5_HUMAN	S	151;29	ENSP00000321746:T151S;ENSP00000442187:T29S	ENSP00000321746:T151S	T	+	2	0	PDLIM5	95715950	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.993000	0.63895	2.590000	0.87494	0.655000	0.94253	ACC	.	C|0.999;T|0.001	.	alt		0.542	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1		
SH3RF1	57630	hgsc.bcm.edu	37	4	170028338	170028338	+	Silent	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr4:170028338A>G	ENST00000284637.9	-	11	2499	c.2158T>C	c.(2158-2160)Ttg>Ctg	p.L720L		NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	720					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		AGCAACTTCAACAAACCCTTT	0.468																																					p.L720L		Atlas-SNP	.											.	SH3RF1	60	.	0			c.T2158C						PASS	.						26.0	30.0	29.0					4																	170028338		2196	4289	6485	SO:0001819	synonymous_variant	57630	exon11			ACTTCAACAAACC	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2158T>C	chr4.hg19:g.170028338A>G		63.0	0.0	.		77.0	23.0	.	NM_020870	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Silent	SNP	ENST00000284637.9	hg19	CCDS34099.1																																																																																			.	.	.	none		0.468	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870	
HINT1	3094	hgsc.bcm.edu	37	5	130500845	130500845	+	Silent	SNP	G	G	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:130500845G>T	ENST00000304043.5	-	1	333	c.54C>A	c.(52-54)atC>atA	p.I18I	HINT1_ENST00000506908.1_Silent_p.I18I|HINT1_ENST00000508488.1_Silent_p.I18I|HINT1_ENST00000513012.1_Silent_p.I18I|HINT1_ENST00000506207.1_Intron	NM_005340.6	NP_005331.1	P49773	HINT1_HUMAN	histidine triad nucleotide binding protein 1	18	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|purine ribonucleotide catabolic process (GO:0009154)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|protein kinase C binding (GO:0005080)			endometrium(1)|large_intestine(1)|lung(3)	5		all_cancers(142;0.0452)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Adenosine monophosphate(DB00131)	TCTTCCCAAAGATCGTGTCGC	0.587																																					p.I18I		Atlas-SNP	.											.	HINT1	7	.	0			c.C54A						PASS	.						83.0	74.0	77.0					5																	130500845		2203	4300	6503	SO:0001819	synonymous_variant	3094	exon1			CCCAAAGATCGTG	BC007090	CCDS4147.1	5q31.2	2010-03-30	2001-11-28	2002-03-08	ENSG00000169567	ENSG00000169567			4912	protein-coding gene	gene with protein product		601314	"""histidine triad nucleotide-binding protein"""	PRKCNH1, HINT		8812426	Standard	NM_005340		Approved	PKCI-1	uc003kve.4	P49773	OTTHUMG00000128995	ENST00000304043.5:c.54C>A	chr5.hg19:g.130500845G>T		70.0	0.0	.		107.0	40.0	.	NM_005340	Q9H5W8	Silent	SNP	ENST00000304043.5	hg19	CCDS4147.1																																																																																			.	.	.	none		0.587	HINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250984.1	NM_005340	
TBC1D9B	23061	hgsc.bcm.edu	37	5	179326225	179326225	+	Silent	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:179326225C>T	ENST00000356834.3	-	3	349	c.312G>A	c.(310-312)gaG>gaA	p.E104E	TBC1D9B_ENST00000355235.3_Silent_p.E104E	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	104						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGATATCTTCCTCACTGTCGA	0.478																																					p.E104E		Atlas-SNP	.											.	TBC1D9B	157	.	0			c.G312A						PASS	.						186.0	155.0	166.0					5																	179326225		2203	4300	6503	SO:0001819	synonymous_variant	23061	exon3			ATCTTCCTCACTG	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.312G>A	chr5.hg19:g.179326225C>T		45.0	0.0	.		59.0	19.0	.	NM_198868	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Silent	SNP	ENST00000356834.3	hg19	CCDS43408.1																																																																																			.	.	.	none		0.478	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
CDKAL1	54901	hgsc.bcm.edu	37	6	20846322	20846322	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:20846322A>G	ENST00000378610.1	+	7	665	c.655A>G	c.(655-657)Acc>Gcc	p.T219A	CDKAL1_ENST00000378624.4_Missense_Mutation_p.T149A|CDKAL1_ENST00000274695.4_Missense_Mutation_p.T219A			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	219					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CAATGCTTGTACCTACTGCAA	0.343																																					p.T219A		Atlas-SNP	.											.	CDKAL1	55	.	0			c.A655G						PASS	.						75.0	75.0	75.0					6																	20846322		2203	4300	6503	SO:0001583	missense	54901	exon9			GCTTGTACCTACT	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.655A>G	chr6.hg19:g.20846322A>G	ENSP00000367873:p.Thr219Ala	73.0	0.0	.		69.0	23.0	.	NM_017774	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	hg19	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.612488	0.87258	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.24151	1.87;1.87;1.87	5.81	5.81	0.92471	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Methylthiotransferase, conserved site (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	M	0.66378	2.025	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.951	T	0.42378	-0.9455	10	0.87932	D	0	.	16.1616	0.81721	1.0:0.0:0.0:0.0	.	149;219	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	A	219;149;219	ENSP00000274695:T219A;ENSP00000367889:T149A;ENSP00000367873:T219A	ENSP00000274695:T219A	T	+	1	0	CDKAL1	20954301	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.971000	0.76105	2.218000	0.71995	0.377000	0.23210	ACC	.	.	.	none		0.343	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774	
TJAP1	93643	hgsc.bcm.edu	37	6	43472653	43472653	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:43472653A>G	ENST00000372445.5	+	11	1110	c.734A>G	c.(733-735)aAt>aGt	p.N245S	TJAP1_ENST00000438588.2_Missense_Mutation_p.N245S|TJAP1_ENST00000372444.2_Missense_Mutation_p.N235S|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000436109.2_Missense_Mutation_p.N235S|TJAP1_ENST00000372452.1_Missense_Mutation_p.N235S|TJAP1_ENST00000372449.1_Missense_Mutation_p.N245S|TJAP1_ENST00000259751.1_Missense_Mutation_p.N235S	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	245					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTACTGCTCAATTCAGCCCAG	0.637																																					p.N245S		Atlas-SNP	.											.	TJAP1	35	.	0			c.A734G						PASS	.						88.0	89.0	88.0					6																	43472653		2203	4300	6503	SO:0001583	missense	93643	exon11			TGCTCAATTCAGC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.734A>G	chr6.hg19:g.43472653A>G	ENSP00000361522:p.Asn245Ser	161.0	0.0	.		182.0	20.0	.	NM_001146016	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	hg19	CCDS55004.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.681816	0.68042	.	.	ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588	T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.21022	0.0506	L	0.31664	0.95	0.58432	D	0.999999	D;D	0.89917	0.998;1.0	D;D	0.83275	0.987;0.996	T	0.05037	-1.0910	10	0.20046	T	0.44	-53.1615	14.9298	0.70906	1.0:0.0:0.0:0.0	.	245;235	Q5JTD0;Q5JTD0-2	TJAP1_HUMAN;.	S	235;245;235;235;235;235;245;245	ENSP00000361521:N235S;ENSP00000361522:N245S;ENSP00000407080:N235S;ENSP00000259751:N235S;ENSP00000361530:N235S;ENSP00000361527:N245S;ENSP00000408769:N245S	ENSP00000259751:N235S	N	+	2	0	TJAP1	43580631	1.000000	0.71417	0.995000	0.50966	0.806000	0.45545	8.900000	0.92551	1.912000	0.55364	0.459000	0.35465	AAT	.	.	.	none		0.637	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
THBS2	7058	hgsc.bcm.edu	37	6	169642014	169642014	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:169642014C>G	ENST00000366787.3	-	6	983	c.734G>C	c.(733-735)cGc>cCc	p.R245P	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	245					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CGGACCCAGGCGCAGCGTCTC	0.647																																					p.R245P	Esophageal Squamous(91;219 1934 18562 44706)	Atlas-SNP	.											.	THBS2	230	.	0			c.G734C						PASS	.						50.0	45.0	47.0					6																	169642014		2202	4300	6502	SO:0001583	missense	7058	exon6			CCCAGGCGCAGCG		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.734G>C	chr6.hg19:g.169642014C>G	ENSP00000355751:p.Arg245Pro	92.0	0.0	.		91.0	34.0	.	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	hg19	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	6.539	0.467797	0.12402	.	.	ENSG00000186340	ENST00000366787	T	0.80994	-1.44	4.75	0.174	0.15040	.	0.371764	0.19184	U	0.120604	T	0.47525	0.1450	N	0.22421	0.69	0.22412	N	0.999129	B	0.26845	0.161	B	0.25506	0.061	T	0.44922	-0.9296	10	0.46703	T	0.11	-42.5921	9.6944	0.40147	0.0:0.2486:0.0:0.7513	.	245	P35442	TSP2_HUMAN	P	245	ENSP00000355751:R245P	ENSP00000355751:R245P	R	-	2	0	THBS2	169383939	0.998000	0.40836	0.177000	0.23020	0.004000	0.04260	0.342000	0.19926	0.182000	0.20032	-0.658000	0.03865	CGC	.	.	.	none		0.647	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
ZNF679	168417	hgsc.bcm.edu	37	7	63726979	63726979	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr7:63726979C>G	ENST00000421025.1	+	5	1237	c.968C>G	c.(967-969)cCc>cGc	p.P323R	ZNF679_ENST00000255746.4_Missense_Mutation_p.P323R	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GGAGAGAAACCCTACACATGT	0.398																																					p.P323R		Atlas-SNP	.											.	ZNF679	80	.	0			c.C968G						PASS	.						26.0	27.0	27.0					7																	63726979		692	1591	2283	SO:0001583	missense	168417	exon5			AGAAACCCTACAC	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.968C>G	chr7.hg19:g.63726979C>G	ENSP00000416809:p.Pro323Arg	36.0	0.0	.		99.0	34.0	.	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	hg19	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576050	0.28092	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.17213	2.29;2.29	0.81	0.81	0.18732	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28962	0.0719	L	0.46819	1.47	0.37644	D	0.922144	D	0.89917	1.0	D	0.97110	1.0	T	0.11641	-1.0579	9	0.72032	D	0.01	.	6.9761	0.24677	0.0:1.0:0.0:0.0	.	323	Q8IYX0	ZN679_HUMAN	R	323	ENSP00000416809:P323R;ENSP00000255746:P323R	ENSP00000255746:P323R	P	+	2	0	ZNF679	63364414	0.775000	0.28604	0.437000	0.26809	0.440000	0.31957	3.755000	0.55197	0.181000	0.19994	0.184000	0.17185	CCC	.	.	.	none		0.398	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
RELN	5649	hgsc.bcm.edu	37	7	103292216	103292216	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr7:103292216G>C	ENST00000428762.1	-	15	1943	c.1784C>G	c.(1783-1785)aCc>aGc	p.T595S	RELN_ENST00000343529.5_Missense_Mutation_p.T595S|RELN_ENST00000424685.2_Missense_Mutation_p.T595S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	595					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCCATGGTTGGTAGAAAATTC	0.463																																					p.T595S	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.C1784G						PASS	.						64.0	52.0	56.0					7																	103292216		2203	4300	6503	SO:0001583	missense	5649	exon15			TGGTTGGTAGAAA		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1784C>G	chr7.hg19:g.103292216G>C	ENSP00000392423:p.Thr595Ser	29.0	0.0	.		90.0	43.0	.	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	hg19	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770518	0.90108	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.25085	1.82;1.82;1.82	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.47801	0.1465	L	0.46157	1.445	0.58432	D	0.999998	D;D	0.76494	0.999;0.982	D;D	0.77557	0.99;0.952	T	0.34279	-0.9835	10	0.66056	D	0.02	.	20.0693	0.97712	0.0:0.0:1.0:0.0	.	595;595	P78509-2;P78509	.;RELN_HUMAN	S	595	ENSP00000392423:T595S;ENSP00000345694:T595S;ENSP00000388446:T595S	ENSP00000345694:T595S	T	-	2	0	RELN	103079452	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.476000	0.97823	2.758000	0.94735	0.563000	0.77884	ACC	.	.	.	none		0.463	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
JPH1	56704	hgsc.bcm.edu	37	8	75227665	75227665	+	Silent	SNP	G	G	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr8:75227665G>A	ENST00000342232.4	-	2	610	c.570C>T	c.(568-570)cgC>cgT	p.R190R		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	190					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CGAAACCGCCGCGGGTGCCGG	0.682																																					p.R190R		Atlas-SNP	.											.	JPH1	77	.	0			c.C570T						PASS	.						14.0	18.0	16.0					8																	75227665		2161	4223	6384	SO:0001819	synonymous_variant	56704	exon2			ACCGCCGCGGGTG	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.570C>T	chr8.hg19:g.75227665G>A		54.0	0.0	.		73.0	24.0	.	NM_020647	B2RTZ0	Silent	SNP	ENST00000342232.4	hg19	CCDS6217.1																																																																																			.	.	.	none		0.682	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
FAM135B	51059	hgsc.bcm.edu	37	8	139180285	139180285	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr8:139180285T>C	ENST00000395297.1	-	12	1281	c.1111A>G	c.(1111-1113)Acg>Gcg	p.T371A		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	371										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGGCTGTGCGTCTGTATCCTG	0.587										HNSCC(54;0.14)																											p.T371A		Atlas-SNP	.											.	FAM135B	423	.	0			c.A1111G						PASS	.						84.0	91.0	89.0					8																	139180285		2108	4234	6342	SO:0001583	missense	51059	exon12			TGTGCGTCTGTAT	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1111A>G	chr8.hg19:g.139180285T>C	ENSP00000378710:p.Thr371Ala	114.0	0.0	.		167.0	7.0	.	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	hg19	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	T	12.75	2.032813	0.35893	.	.	ENSG00000147724	ENST00000395297	D	0.88201	-2.35	5.66	3.16	0.36331	.	0.611892	0.17190	N	0.183555	D	0.85852	0.5793	M	0.63428	1.95	0.27501	N	0.951993	B	0.19817	0.039	B	0.16722	0.016	T	0.75422	-0.3323	10	0.38643	T	0.18	-6.9288	10.1146	0.42583	0.2674:0.0:0.0:0.7326	.	371	Q49AJ0	F135B_HUMAN	A	371	ENSP00000378710:T371A	ENSP00000276737:T371A	T	-	1	0	FAM135B	139249467	0.993000	0.37304	0.963000	0.40424	0.275000	0.26752	2.562000	0.45914	0.433000	0.26313	0.533000	0.62120	ACG	.	.	.	none		0.587	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
CYP11B1	1584	hgsc.bcm.edu	37	8	143956729	143956729	+	Splice_Site	SNP	C	C	G			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr8:143956729C>G	ENST00000292427.4	-	7	1154		c.e7-1		CYP11B1_ENST00000517471.1_Splice_Site|CYP11B1_ENST00000377675.3_Splice_Site	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1						aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	AGGGTAGAGCCTGGAGGTGGG	0.602									Familial Hyperaldosteronism type I																												.		Atlas-SNP	.											.	CYP11B1	128	.	0			c.1122-1G>C						PASS	.						39.0	43.0	41.0					8																	143956729		2203	4300	6503	SO:0001630	splice_region_variant	1584	exon8	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	TAGAGCCTGGAGG	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1122-1G>C	chr8.hg19:g.143956729C>G		35.0	0.0	.		40.0	16.0	.	NM_001026213	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Splice_Site	SNP	ENST00000292427.4	hg19	CCDS6392.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.78|13.78	2.338412|2.338412	0.41398|0.41398	.|.	.|.	ENSG00000160882|ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675|ENST00000519285	.|D	.|0.97480	.|-4.4	3.12|3.12	3.12|3.12	0.35913|0.35913	.|.	.|.	.|.	.|.	.|.	.|D	.|0.96836	.|0.8967	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.95728	.|0.8772	.|5	.|.	.|.	.|.	.|.	12.4777|12.4777	0.55823|0.55823	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|T	-1|52	.|ENSP00000430144:R52T	.|.	.|R	-|-	.|2	.|0	CYP11B1|CYP11B1	143953731|143953731	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.194000|0.194000	0.23727|0.23727	4.120000|4.120000	0.57897|0.57897	2.055000|2.055000	0.61198|0.61198	0.555000|0.555000	0.69702|0.69702	.|AGG	.	.	.	none		0.602	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		Intron
SCRIB	23513	hgsc.bcm.edu	37	8	144895667	144895667	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr8:144895667C>A	ENST00000320476.3	-	5	482	c.476G>T	c.(475-477)cGg>cTg	p.R159L	SCRIB_ENST00000356994.2_Missense_Mutation_p.R159L|SCRIB_ENST00000377533.3_Missense_Mutation_p.R78L|MIR937_ENST00000401271.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	159	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CAGGTTCTCCCGGAGCTCCAG	0.647																																					p.R159L	Pancreas(51;966 1133 10533 14576 29674)	Atlas-SNP	.											.	SCRIB	192	.	0			c.G476T						PASS	.						41.0	39.0	40.0					8																	144895667		2203	4300	6503	SO:0001583	missense	23513	exon5			TTCTCCCGGAGCT	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.476G>T	chr8.hg19:g.144895667C>A	ENSP00000322938:p.Arg159Leu	45.0	0.0	.		76.0	4.0	.	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	hg19	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	C	35	5.538622	0.96474	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.11277	2.79;2.79;2.79	4.55	4.55	0.56014	.	.	.	.	.	T	0.30417	0.0764	L	0.60012	1.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.03503	-1.1030	9	0.87932	D	0	.	16.6416	0.85128	0.0:1.0:0.0:0.0	.	159;159	Q14160;Q14160-3	SCRIB_HUMAN;.	L	159;159;78	ENSP00000349486:R159L;ENSP00000322938:R159L;ENSP00000366756:R78L	ENSP00000322938:R159L	R	-	2	0	SCRIB	144967655	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.446000	0.60014	2.222000	0.72286	0.563000	0.77884	CGG	.	.	.	none		0.647	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
MLLT3	4300	hgsc.bcm.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000429426.2_Silent_p.S154S|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,4	MLLT3	125	.	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T						PASS	.						9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	chr9.hg19:g.20414373G>A		42.0	0.0	.		56.0	4.0	.	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	hg19	CCDS6494.1																																																																																			.	.	.	none		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
DGKH	160851	hgsc.bcm.edu	37	13	42742631	42742632	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr13:42742631_42742632GG>AT	ENST00000337343.4	+	10	1195_1196	c.1174_1175GG>AT	c.(1174-1176)GGa>ATa	p.G392I	DGKH_ENST00000379274.2_Missense_Mutation_p.G256I|DGKH_ENST00000538674.1_Missense_Mutation_p.G147I|DGKH_ENST00000261491.5_Missense_Mutation_p.G392I|DGKH_ENST00000536612.1_Missense_Mutation_p.G256I|DGKH_ENST00000540693.1_Missense_Mutation_p.G392I|DGKH_ENST00000498255.2_3'UTR	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	392	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TGGAGGCGATGGAAGTGTAGGT	0.322																																					p.G392R|p.G392V		Atlas-SNP	.											.	DGKH	106	.	0			c.G1174A|c.G1175T						PASS	.																																			SO:0001583	missense	160851	exon11			GGCGATGGAAGTG|GCGATGGAAGTGT	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	Exception_encountered	chr13.hg19:g.42742631_42742632delinsAT	ENSP00000337572:p.Gly392Ile	82.0|80.0	0.0	.		69.0	19.0	.	NM_001204504	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	hg19	CCDS9381.1																																																																																			.	.	.	none		0.322	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
HAUS4	54930	hgsc.bcm.edu	37	14	23415759	23415759	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:23415759T>A	ENST00000206474.7	-	10	1319	c.1067A>T	c.(1066-1068)cAg>cTg	p.Q356L	HAUS4_ENST00000541587.1_Missense_Mutation_p.Q356L|HAUS4_ENST00000554446.1_5'UTR|HAUS4_ENST00000555367.1_Missense_Mutation_p.Q311L|HAUS4_ENST00000342454.8_Missense_Mutation_p.Q311L|RP11-298I3.1_ENST00000548322.1_RNA|RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000397409.4_Missense_Mutation_p.Q230L|RP11-298I3.5_ENST00000555074.1_Silent_p.P185P|HAUS4_ENST00000490506.1_Missense_Mutation_p.Q232L|HAUS4_ENST00000347758.2_Missense_Mutation_p.Q230L|HAUS4_ENST00000555986.1_Missense_Mutation_p.Q311L			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	356					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						GCTGAACTCCTGGAGGGCCCA	0.562																																					p.Q356L		Atlas-SNP	.											.	HAUS4	34	.	0			c.A1067T						PASS	.						71.0	64.0	66.0					14																	23415759		2203	4300	6503	SO:0001583	missense	54930	exon10			AACTCCTGGAGGG	AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.1067A>T	chr14.hg19:g.23415759T>A	ENSP00000206474:p.Gln356Leu	90.0	0.0	.		89.0	5.0	.	NM_001166269	B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Missense_Mutation	SNP	ENST00000206474.7	hg19	CCDS9580.1	.	.	.	.	.	.	.	.	.	.	T	13.26	2.185415	0.38609	.	.	ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000092036;ENSG00000259132	ENST00000206474;ENST00000490506;ENST00000541587;ENST00000342454;ENST00000347758;ENST00000397409;ENST00000555367;ENST00000555986;ENST00000555074	.	.	.	5.8	3.46	0.39613	.	0.358284	0.32328	N	0.006245	T	0.33904	0.0879	L	0.50333	1.59	0.30627	N	0.757909	B;P;B	0.42518	0.0;0.782;0.001	B;B;B	0.40256	0.003;0.324;0.004	T	0.40136	-0.9579	9	0.52906	T	0.07	-10.115	5.9375	0.19173	0.1466:0.0786:0.0:0.7748	.	311;230;356	Q9H6D7-4;Q9H6D7-2;Q9H6D7	.;.;HAUS4_HUMAN	L	356;232;356;311;230;230;311;311;133	.	ENSP00000206474:Q356L	Q	-	2	0	RP11-298I3.5;HAUS4	22485599	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	0.712000	0.25779	1.014000	0.39417	-0.409000	0.06214	CAG	.	.	.	none		0.562	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071680.3		
ACIN1	22985	hgsc.bcm.edu	37	14	23549776	23549776	+	Silent	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:23549776T>C	ENST00000262710.1	-	6	1269	c.942A>G	c.(940-942)gtA>gtG	p.V314V	ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Silent_p.V314V|ACIN1_ENST00000605057.1_Silent_p.V256V|ACIN1_ENST00000457657.1_Silent_p.V274V	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	314	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CCTCTGGTTTTACTCTAGGTA	0.453																																					p.V314V		Atlas-SNP	.											.	ACIN1	147	.	0			c.A942G						PASS	.						246.0	213.0	224.0					14																	23549776		2203	4300	6503	SO:0001819	synonymous_variant	22985	exon6			TGGTTTTACTCTA	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.942A>G	chr14.hg19:g.23549776T>C		160.0	0.0	.		182.0	54.0	.	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	ENST00000262710.1	hg19	CCDS9587.1																																																																																			.	.	.	none		0.453	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
ADCY4	196883	hgsc.bcm.edu	37	14	24793367	24793367	+	Silent	SNP	C	C	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:24793367C>A	ENST00000310677.4	-	17	2060	c.1947G>T	c.(1945-1947)ctG>ctT	p.L649L	ADCY4_ENST00000418030.2_Silent_p.L649L|ADCY4_ENST00000396747.3_Silent_p.L342L|ADCY4_ENST00000554068.2_Silent_p.L649L	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	649					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		ACAGTGCAGGCAGCCAGTGCA	0.612																																					p.L649L		Atlas-SNP	.											.	ADCY4	86	.	0			c.G1947T						PASS	.						64.0	63.0	63.0					14																	24793367		2203	4300	6503	SO:0001819	synonymous_variant	196883	exon17			TGCAGGCAGCCAG	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.1947G>T	chr14.hg19:g.24793367C>A		66.0	0.0	.		80.0	6.0	.	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	hg19	CCDS9627.1																																																																																			.	.	.	none		0.612	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
JKAMP	51528	hgsc.bcm.edu	37	14	59965574	59965574	+	Silent	SNP	T	T	C			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr14:59965574T>C	ENST00000261247.9	+	5	735	c.588T>C	c.(586-588)ctT>ctC	p.L196L	JKAMP_ENST00000425728.2_Silent_p.L190L|JKAMP_ENST00000356057.5_Silent_p.L204L|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000554271.1_Silent_p.L210L	NM_001098625.1|NM_001284203.1|NM_016475.3	NP_001092095.1|NP_001271132.1|NP_057559.2	Q9P055	JKAMP_HUMAN	JNK1/MAPK8-associated membrane protein	211					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|kidney(1)|lung(3)	6						ATGCTGCACTTTACTTCTTCC	0.373																																					p.L196L		Atlas-SNP	.											.	JKAMP	49	.	0			c.T588C						PASS	.						125.0	113.0	117.0					14																	59965574		1831	4097	5928	SO:0001819	synonymous_variant	51528	exon5			TGCACTTTACTTC	AF212245	CCDS45116.1, CCDS45117.1, CCDS61462.1, CCDS61463.1	14q22.3	2014-02-14	2009-08-13	2009-08-13	ENSG00000050130	ENSG00000050130			20184	protein-coding gene	gene with protein product	"""Jun N-terminal kinase 1-associated membrane protein"""	611176	"""chromosome 14 open reading frame 100"""	C14orf100		16166642, 19269966	Standard	NM_001284202		Approved	HSPC213, JAMP, HSPC327, CDA06	uc001xef.4	Q9P055	OTTHUMG00000171054	ENST00000261247.9:c.588T>C	chr14.hg19:g.59965574T>C		19.0	0.0	.		31.0	12.0	.	NM_016475	B4DP67|Q6FIB6|Q6IAJ2|Q7Z5D4|Q86SY6|Q9H0Q6|Q9H2W0|Q9HAH5|Q9P0R3	Silent	SNP	ENST00000261247.9	hg19	CCDS45116.1																																																																																			.	.	.	none		0.373	JKAMP-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411430.1	NM_001098625	
SBK1	388228	hgsc.bcm.edu	37	16	28330355	28330355	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr16:28330355C>T	ENST00000341901.4	+	3	1055	c.266C>T	c.(265-267)aCc>aTc	p.T89I		NM_001024401.2	NP_001019572.1	Q52WX2	SBK1_HUMAN	SH3 domain binding kinase 1	89	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(3)|ovary(1)	5						AAGAGCAAAACCAAGCTGAAG	0.532																																					p.T89I		Atlas-SNP	.											.	SBK1	36	.	0			c.C266T						PASS	.						170.0	156.0	161.0					16																	28330355		2197	4300	6497	SO:0001583	missense	388228	exon3			GCAAAACCAAGCT		CCDS32416.1	16p11.2	2013-09-27	2013-09-27			ENSG00000188322			17699	protein-coding gene	gene with protein product			"""SH3-binding domain kinase 1"""				Standard	XM_005255315		Approved	Sbk	uc002dpd.3	Q52WX2		ENST00000341901.4:c.266C>T	chr16.hg19:g.28330355C>T	ENSP00000343248:p.Thr89Ile	211.0	0.0	.		250.0	85.0	.	NM_001024401		Missense_Mutation	SNP	ENST00000341901.4	hg19	CCDS32416.1	.	.	.	.	.	.	.	.	.	.	c	20.4	3.991381	0.74703	.	.	ENSG00000188322	ENST00000341901	T	0.65549	-0.16	4.98	4.03	0.46877	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	L	0.33339	1.005	0.54753	D	0.999985	D	0.52996	0.957	P	0.57324	0.818	T	0.59958	-0.7356	10	0.35671	T	0.21	-23.5445	11.1208	0.48289	0.0:0.9084:0.0:0.0916	.	89	Q52WX2	SBK1_HUMAN	I	89	ENSP00000343248:T89I	ENSP00000343248:T89I	T	+	2	0	SBK1	28237856	1.000000	0.71417	0.989000	0.46669	0.901000	0.52897	7.769000	0.85360	1.089000	0.41292	-0.141000	0.14075	ACC	.	.	.	none		0.532	SBK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387677.1	XM_370948	
PSG2	5670	hgsc.bcm.edu	37	19	43585217	43585217	+	Nonsense_Mutation	SNP	A	A	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr19:43585217A>T	ENST00000406487.1	-	2	344	c.246T>A	c.(244-246)taT>taA	p.Y82*	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	82	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				CGTCTACTACATATGATGTAA	0.438																																					p.Y82X		Atlas-SNP	.											.	PSG2	84	.	0			c.T246A						PASS	.						170.0	174.0	173.0					19																	43585217		2203	4298	6501	SO:0001587	stop_gained	5670	exon2			TACTACATATGAT		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.246T>A	chr19.hg19:g.43585217A>T	ENSP00000385706:p.Tyr82*	456.0	0.0	.		513.0	141.0	.	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Nonsense_Mutation	SNP	ENST00000406487.1	hg19	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	N	10.75	1.438722	0.25900	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	.	.	.	0.569	-0.723	0.11181	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	82	.	ENSP00000332984:Y82X	Y	-	3	2	PSG2	48277057	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.017000	0.12590	-0.394000	0.07727	0.155000	0.16302	TAT	.	.	.	none		0.438	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
TGM6	343641	hgsc.bcm.edu	37	20	2384361	2384361	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr20:2384361C>T	ENST00000202625.2	+	9	1289	c.1228C>T	c.(1228-1230)Cgg>Tgg	p.R410W	TGM6_ENST00000381423.1_Missense_Mutation_p.R410W	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	410					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GGATGAGAGCCGGGAGCGTGT	0.582																																					p.R410W		Atlas-SNP	.											.	TGM6	126	.	0			c.C1228T						PASS	.						117.0	102.0	107.0					20																	2384361		2203	4300	6503	SO:0001583	missense	343641	exon9			GAGAGCCGGGAGC	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1228C>T	chr20.hg19:g.2384361C>T	ENSP00000202625:p.Arg410Trp	109.0	0.0	.		126.0	6.0	.	NM_198994	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	hg19	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707089	0.48412	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	T;T	0.74526	-0.85;-0.85	4.84	2.82	0.32997	.	0.503753	0.20705	N	0.087198	T	0.76905	0.4053	L	0.49126	1.545	0.25334	N	0.989007	D;D	0.71674	0.998;0.997	P;P	0.56916	0.809;0.628	T	0.67933	-0.5542	10	0.66056	D	0.02	-13.0667	10.1216	0.42623	0.3642:0.6358:0.0:0.0	.	410;410	O95932-2;O95932	.;TGM3L_HUMAN	W	410	ENSP00000202625:R410W;ENSP00000370831:R410W	ENSP00000202625:R410W	R	+	1	2	TGM6	2332361	0.001000	0.12720	0.983000	0.44433	0.361000	0.29550	0.639000	0.24690	0.711000	0.32018	0.549000	0.68633	CGG	.	.	.	none		0.582	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
COL6A2	1292	hgsc.bcm.edu	37	21	47542788	47542788	+	Splice_Site	SNP	G	G	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr21:47542788G>A	ENST00000300527.4	+	21	1712		c.e21-1		COL6A2_ENST00000357838.4_Splice_Site|COL6A2_ENST00000397763.1_Splice_Site|COL6A2_ENST00000409416.1_Splice_Site|COL6A2_ENST00000310645.5_Splice_Site	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCCTGTCACAGGGAGGCCGAG	0.547																																					.		Atlas-SNP	.											.	COL6A2	351	.	0			c.1609-1G>A						PASS	.						86.0	75.0	79.0					21																	47542788		2203	4298	6501	SO:0001630	splice_region_variant	1292	exon21			GTCACAGGGAGGC	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1609-1G>A	chr21.hg19:g.47542788G>A		91.0	0.0	.		93.0	31.0	.	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Splice_Site	SNP	ENST00000300527.4	hg19	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073193	0.36566	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	.	.	.	3.54	3.54	0.40534	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9711	0.80019	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL6A2	46367216	1.000000	0.71417	0.991000	0.47740	0.337000	0.28794	7.524000	0.81866	1.909000	0.55274	0.491000	0.48974	.	.	.	.	none		0.547	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		Intron
PCNT	5116	hgsc.bcm.edu	37	21	47809247	47809247	+	Missense_Mutation	SNP	A	A	T			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr21:47809247A>T	ENST00000359568.5	+	19	3848	c.3741A>T	c.(3739-3741)gaA>gaT	p.E1247D	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1247					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TGAGCCCAGAAAGTGTGCGGG	0.587																																					p.E1247D		Atlas-SNP	.											.	PCNT	283	.	0			c.A3741T						PASS	.						95.0	94.0	94.0					21																	47809247		2203	4300	6503	SO:0001583	missense	5116	exon19			CCCAGAAAGTGTG	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.3741A>T	chr21.hg19:g.47809247A>T	ENSP00000352572:p.Glu1247Asp	208.0	0.0	.		197.0	71.0	.	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	hg19	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.761428	0.49468	.	.	ENSG00000160299	ENST00000359568	T	0.02032	4.49	5.44	-10.3	0.00346	.	.	.	.	.	T	0.07279	0.0184	M	0.70275	2.135	0.09310	N	1	B;D	0.76494	0.193;0.999	B;D	0.78314	0.08;0.991	T	0.02269	-1.1185	9	0.66056	D	0.02	.	8.9466	0.35762	0.6619:0.2264:0.1118:0.0	.	1129;1247	O95613-2;O95613	.;PCNT_HUMAN	D	1247	ENSP00000352572:E1247D	ENSP00000352572:E1247D	E	+	3	2	PCNT	46633675	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-1.857000	0.01660	-1.903000	0.01093	-0.456000	0.05471	GAA	.	.	.	none		0.587	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
OSBP2	23762	hgsc.bcm.edu	37	22	31137192	31137192	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr22:31137192T>A	ENST00000332585.6	+	2	793	c.689T>A	c.(688-690)cTg>cAg	p.L230Q	OSBP2_ENST00000446658.2_Missense_Mutation_p.L230Q|OSBP2_ENST00000382310.3_Missense_Mutation_p.L230Q|OSBP2_ENST00000403222.3_Missense_Mutation_p.L65Q|OSBP2_ENST00000407373.1_Missense_Mutation_p.L57Q	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	230	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						ACCATCAACCTGTCCACCGCG	0.567																																					p.L230Q		Atlas-SNP	.											.	OSBP2	52	.	0			c.T689A						PASS	.						51.0	53.0	53.0					22																	31137192		2028	4163	6191	SO:0001583	missense	23762	exon2			TCAACCTGTCCAC		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.689T>A	chr22.hg19:g.31137192T>A	ENSP00000332576:p.Leu230Gln	71.0	0.0	.		79.0	4.0	.	NM_030758	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	ENST00000332585.6	hg19	CCDS43002.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.662468	0.88251	.	.	ENSG00000184792	ENST00000438716;ENST00000403222;ENST00000407373;ENST00000332585;ENST00000382310;ENST00000446658	T;T;D;D;D	0.84146	-0.42;-0.41;-1.81;-1.81;-1.81	5.38	5.38	0.77491	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000005	D	0.95943	0.8679	H	0.99516	4.605	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;1.0	D;D;D;D;D	0.81914	0.989;0.98;0.98;0.995;0.995	D	0.97875	1.0288	10	0.87932	D	0	-22.7415	15.0591	0.71939	0.0:0.0:0.0:1.0	.	230;65;57;230;230	B4DFA8;B4DKE4;Q6ZN50;Q0VF99;Q969R2	.;.;.;.;OSBP2_HUMAN	Q	65;65;57;230;230;230	ENSP00000384213:L65Q;ENSP00000385237:L57Q;ENSP00000332576:L230Q;ENSP00000371747:L230Q;ENSP00000392080:L230Q	ENSP00000332576:L230Q	L	+	2	0	OSBP2	29467192	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.040000	0.89188	2.040000	0.60383	0.379000	0.24179	CTG	.	.	.	none		0.567	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718336	142718336	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chrX:142718336C>A	ENST00000381779.4	-	2	814	c.589G>T	c.(589-591)Ggg>Tgg	p.G197W	SLITRK4_ENST00000356928.1_Missense_Mutation_p.G197W|SLITRK4_ENST00000338017.4_Missense_Mutation_p.G197W	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	197						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGAACCCCGATATAAGGG	0.433																																					p.G197W		Atlas-SNP	.											.	SLITRK4	162	.	0			c.G589T						PASS	.						78.0	76.0	77.0					X																	142718336		2203	4300	6503	SO:0001583	missense	139065	exon2			GAACCCCGATATA	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.589G>T	chrX.hg19:g.142718336C>A	ENSP00000371198:p.Gly197Trp	64.0	0.0	.		94.0	4.0	.	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315367	0.60524	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.55413	0.52;0.52;0.52	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84122	0.0407	10	0.87932	D	0	-6.8478	17.0529	0.86524	0.0:1.0:0.0:0.0	.	197	Q8IW52	SLIK4_HUMAN	W	197	ENSP00000371198:G197W;ENSP00000349400:G197W;ENSP00000336627:G197W	ENSP00000336627:G197W	G	-	1	0	SLITRK4	142546002	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.818000	0.86416	2.347000	0.79759	0.600000	0.82982	GGG	.	.	.	none		0.433	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
GIN1	54826	hgsc.bcm.edu	37	5	102444326	102444335	+	Frame_Shift_Del	DEL	AGTGTAGTTG	AGTGTAGTTG	-	rs371302288		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	AGTGTAGTTG	AGTGTAGTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr5:102444326_102444335delAGTGTAGTTG	ENST00000399004.2	-	2	171_180	c.77_86delCAACTACACT	c.(76-87)tcaactacactgfs	p.STTL26fs	GIN1_ENST00000508629.1_Frame_Shift_Del_p.STTL26fs	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	26					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		CTCACTTGGCAGTGTAGTTGAATGATATTC	0.343																																					p.26_29del		Atlas-INDEL	.											.	GIN1	53	.	0			c.78_87del						PASS	.																																			SO:0001589	frameshift_variant	54826	exon2			.	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.77_86delCAACTACACT	chr5.hg19:g.102444326_102444335delAGTGTAGTTG	ENSP00000381970:p.Ser26fs	67.0	0.0	0		71.0	16.0	0.225352	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Frame_Shift_Del	DEL	ENST00000399004.2	hg19	CCDS43349.1																																																																																			.	.	.	none		0.343	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
ING4	51147	hgsc.bcm.edu	37	12	6761549	6761549	+	Frame_Shift_Del	DEL	C	C	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr12:6761549delC	ENST00000396807.4	-	6	574	c.536delG	c.(535-537)ggcfs	p.G179fs	ING4_ENST00000423703.2_Intron|ING4_ENST00000446105.2_Frame_Shift_Del_p.G175fs|ING4_ENST00000486287.1_Intron|ING4_ENST00000444704.2_Frame_Shift_Del_p.G155fs|ING4_ENST00000412586.2_Frame_Shift_Del_p.G176fs|ING4_ENST00000341550.4_Frame_Shift_Del_p.G178fs	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	179					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						GTGGACACTGCCAAAGGTCAC	0.512																																					p.G179fs		Atlas-INDEL	.											.	ING4	31	.	0			c.537delC						PASS	.						186.0	161.0	169.0					12																	6761549		2203	4300	6503	SO:0001589	frameshift_variant	51147	exon6			.	AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.536delG	chr12.hg19:g.6761549delC	ENSP00000380024:p.Gly179fs	189.0	0.0	0		169.0	49.0	0.289941	NM_001127582	A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Frame_Shift_Del	DEL	ENST00000396807.4	hg19	CCDS44813.1																																																																																			.	.	.	none		0.512	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280467.2	NM_198287	
ZDHHC14	79683	hgsc.bcm.edu	37	6	158093775	158093785	+	Frame_Shift_Del	DEL	TTCAGAGCACC	TTCAGAGCACC	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	TTCAGAGCACC	TTCAGAGCACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr6:158093775_158093785delTTCAGAGCACC	ENST00000359775.5	+	9	1977_1987	c.1088_1098delTTCAGAGCACC	c.(1087-1098)attcagagcaccfs	p.IQST363fs	ZDHHC14_ENST00000341375.8_3'UTR|ZDHHC14_ENST00000414563.2_Intron			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	363					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		GACCAGTGCATTCAGAGCACCAAATTCGTTT	0.664																																					p.363_366del		Atlas-INDEL	.											.	ZDHHC14	39	.	0			c.1087_1097del						PASS	.																																			SO:0001589	frameshift_variant	79683	exon9			.	AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.1088_1098delTTCAGAGCACC	chr6.hg19:g.158093775_158093785delTTCAGAGCACC	ENSP00000352821:p.Ile363fs	63.0	0.0	0		71.0	11.0	0.15493	NM_024630	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Frame_Shift_Del	DEL	ENST00000359775.5	hg19	CCDS5252.1																																																																																			.	.	.	none		0.664	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746	
ACY1	95	hgsc.bcm.edu	37	3	52020519	52020519	+	Splice_Site	DEL	G	G	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr3:52020519delG	ENST00000404366.2	+	7	671	c.525delG	c.(523-525)gag>ga	p.E175fs	ACY1_ENST00000476854.1_Splice_Site_p.E175fs|ABHD14A-ACY1_ENST00000463937.1_Splice_Site_p.E276fs|ACY1_ENST00000458031.2_Splice_Site_p.E265fs|ACY1_ENST00000476351.1_Splice_Site_p.E140fs|ACY1_ENST00000494103.1_Intron	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	175					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CCCTGGATGAGGGTGAGCAGG	0.612																																					p.E175fs		Atlas-INDEL	.											.	ACY1	35	.	0			c.524delA						PASS	.						60.0	60.0	60.0					3																	52020519		2203	4300	6503	SO:0001630	splice_region_variant	95	exon7			.	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.526+1G>-	chr3.hg19:g.52020519delG		72.0	0.0	0		85.0	37.0	0.435294	NM_001198895	C9J6I6|C9J9D8|C9JWD4	Frame_Shift_Del	DEL	ENST00000404366.2	hg19	CCDS2844.1																																																																																			.	.	.	none		0.612	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666	Frame_Shift_Del
ZNF347	84671	hgsc.bcm.edu	37	19	53643573	53643575	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr19:53643573_53643575delTGA	ENST00000334197.7	-	5	2574_2576	c.2506_2508delTCA	c.(2506-2508)tcadel	p.S836del	ZNF347_ENST00000601469.2_In_Frame_Del_p.S837del|ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000452676.2_In_Frame_Del_p.S837del	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	836					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		ATGAATTCTGTGATGGCTTGCAA	0.394																																					p.837_838del	Melanoma(64;205 1597 17324 45721)	Atlas-INDEL	.											.	ZNF347	87	.	0			c.2510_2512del						PASS	.																																			SO:0001651	inframe_deletion	84671	exon5			.	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2506_2508delTCA	chr19.hg19:g.53643573_53643575delTGA	ENSP00000334146:p.Ser836del	193.0	0.0	0		170.0	46.0	0.270588	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	In_Frame_Del	DEL	ENST00000334197.7	hg19	CCDS33097.1																																																																																			.	.	.	none		0.394	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
GPR3	2827	hgsc.bcm.edu	37	1	27720330	27720350	+	In_Frame_Del	DEL	GCCTGGCTCTCAGCTGGCTCA	GCCTGGCTCTCAGCTGGCTCA	-			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	GCCTGGCTCTCAGCTGGCTCA	GCCTGGCTCTCAGCTGGCTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr1:27720330_27720350delGCCTGGCTCTCAGCTGGCTCA	ENST00000374024.3	+	2	127_147	c.28_48delGCCTGGCTCTCAGCTGGCTCA	c.(28-48)gcctggctctcagctggctcadel	p.AWLSAGS10del		NM_005281.3	NP_005272.1	P46089	GPR3_HUMAN	G protein-coupled receptor 3	10					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|regulation of meiosis (GO:0040020)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(3)|ovary(1)|skin(1)	8		Breast(348;1.53e-05)|Ovarian(437;0.0606)|all_lung(284;0.157)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.81e-26)|Colorectal(126;1.24e-08)|KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;4.45e-06)|Lung(427;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|LUSC - Lung squamous cell carcinoma(448;0.008)|READ - Rectum adenocarcinoma(331;0.0419)		CAGCCCTCTGGCCTGGCTCTCAGCTGGCTCAGGCAACGTGA	0.633																																					p.9_16del		Atlas-INDEL	.											.	GPR3	23	.	0			c.27_47del						PASS	.																																			SO:0001651	inframe_deletion	2827	exon2			.	BC032702	CCDS303.1	1p36.1-p35	2012-08-21			ENSG00000181773	ENSG00000181773		"""GPCR / Class A : Orphans"""	4484	protein-coding gene	gene with protein product		600241				7851889	Standard	NM_005281		Approved	ACCA	uc001bod.4	P46089	OTTHUMG00000003397	ENST00000374024.3:c.28_48delGCCTGGCTCTCAGCTGGCTCA	chr1.hg19:g.27720330_27720350delGCCTGGCTCTCAGCTGGCTCA	ENSP00000363136:p.Ala10_Ser16del	232.0	0.0	0		213.0	24.0	0.112676	NM_005281	A8K570	In_Frame_Del	DEL	ENST00000374024.3	hg19	CCDS303.1																																																																																			.	.	.	none		0.633	GPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009522.1	NM_005281	
FGD4	121512	hgsc.bcm.edu	37	12	32777967	32777968	+	In_Frame_Ins	INS	-	-	TTTTTT			TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr12:32777967_32777968insTTTTTT	ENST00000427716.2	+	13	2024_2025	c.1600_1601insTTTTTT	c.(1600-1602)att>aTTTTTTtt	p.534_535insFF	FGD4_ENST00000534526.2_In_Frame_Ins_p.671_672insFF|FGD4_ENST00000546442.1_In_Frame_Ins_p.441_442insFF|FGD4_ENST00000266482.3_In_Frame_Ins_p.286_287insFF|FGD4_ENST00000525053.1_In_Frame_Ins_p.646_647insFF|FGD4_ENST00000531134.1_In_Frame_Ins_p.619_620insFF	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	534					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CAGAAATGCAATTGCAAAGGAT	0.347																																					p.I534delinsIFF		Atlas-INDEL	.											.	FGD4	86	.	0			c.1600_1601insTTTTTT						PASS	.																																			SO:0001652	inframe_insertion	121512	exon13			.	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	Exception_encountered	chr12.hg19:g.32777967_32777968insTTTTTT	ENSP00000394487:p.Ile534_Ala535insPhePhe	194.0	0.0	0		186.0	19.0	0.102151	NM_139241	Q6ULS2|Q8TCP6	In_Frame_Ins	INS	ENST00000427716.2	hg19	CCDS8727.1																																																																																			.	.	.	none		0.347	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
TTLL12	23170	hgsc.bcm.edu	37	22	43579135	43579149	+	In_Frame_Del	DEL	CACTTCCCCAGCGTC	CACTTCCCCAGCGTC	-	rs146360108|rs571455195		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	CACTTCCCCAGCGTC	CACTTCCCCAGCGTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr22:43579135_43579149delCACTTCCCCAGCGTC	ENST00000216129.6	-	2	247_261	c.184_198delGACGCTGGGGAAGTG	c.(184-198)gacgctggggaagtgdel	p.DAGEV62del		NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	62					cellular protein modification process (GO:0006464)			p.D62D(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				TGATCCCAAACACTTCCCCAGCGTCGAAAACCTGG	0.637																																					p.62_67del		Atlas-INDEL	.											.	TTLL12	50	.	1	Substitution - coding silent(1)	large_intestine(1)	c.185_199del						PASS	.																																			SO:0001651	inframe_deletion	23170	exon2			.	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.184_198delGACGCTGGGGAAGTG	chr22.hg19:g.43579135_43579149delCACTTCCCCAGCGTC	ENSP00000216129:p.Asp62_Val66del	192.0	0.0	0		195.0	16.0	0.0820513	NM_015140	Q20WK5|Q9UGU3	In_Frame_Del	DEL	ENST00000216129.6	hg19	CCDS14047.1																																																																																			.	.	.	none		0.637	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140	
CEMIP	57214	hgsc.bcm.edu	37	15	81221510	81221511	+	Frame_Shift_Del	DEL	AG	AG	-	rs201251202		TCGA-J7-6720-01A-11D-2136-08	TCGA-J7-6720-10A-01D-2136-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4f51e571-67b3-4e0a-a5b5-bdc9a788d1d1	ee153c70-16dc-47aa-b326-e5341dc09b2f	g.chr15:81221510_81221511delAG	ENST00000394685.3	+	21	3026_3027	c.2607_2608delAG	c.(2605-2610)ataggcfs	p.IG869fs	RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Frame_Shift_Del_p.IG869fs|KIAA1199_ENST00000356249.5_Frame_Shift_Del_p.IG869fs			Q8WUJ3	CEMIP_HUMAN		869					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CCCTCCCTATAGGCCAGTAGGT	0.51																																					p.869_869del		Atlas-INDEL	.											.	KIAA1199	118	.	0			c.2606_2607del						PASS	.																																			SO:0001589	frameshift_variant	57214	exon20			.																												ENST00000394685.3:c.2607_2608delAG	chr15.hg19:g.81221510_81221511delAG	ENSP00000378177:p.Ile869fs	97.0	0.0	0		141.0	54.0	0.382979	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Frame_Shift_Del	DEL	ENST00000394685.3	hg19	CCDS10315.1																																																																																			.	.	.	none		0.510	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
