#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DMRTA2	63950	hgsc.bcm.edu	37	1	50885395	50885395	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr1:50885395G>C	ENST00000404795.3	-	3	963	c.571C>G	c.(571-573)Cag>Gag	p.Q191E	DMRTA2_ENST00000418121.1_Missense_Mutation_p.Q191E	NM_032110.2	NP_115486.1	Q96SC8	DMTA2_HUMAN	DMRT-like family A2	191	Gly-rich.				cerebral cortex regionalization (GO:0021796)|dopaminergic neuron differentiation (GO:0071542)|neuron fate specification (GO:0048665)|positive regulation of neuroblast proliferation (GO:0002052)|skeletal muscle cell differentiation (GO:0035914)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(4)|pancreas(1)	6						TCAAACTTCTGCAACTTGGCC	0.617																																					p.Q191E	Colon(196;1651 2045 3292 36497 38236)|Esophageal Squamous(2;257 258 11567 27043 43804)	Atlas-SNP	.											.	DMRTA2	17	.	0			c.C571G						PASS	.						14.0	15.0	15.0					1																	50885395		1951	4137	6088	SO:0001583	missense	63950	exon3			ACTTCTGCAACTT	AJ301580	CCDS44141.1	1p33	2008-08-04			ENSG00000142700	ENSG00000142700			13908	protein-coding gene	gene with protein product		614804				11863363	Standard	NM_032110		Approved		uc010onb.2	Q96SC8	OTTHUMG00000007884	ENST00000404795.3:c.571C>G	chr1.hg19:g.50885395G>C	ENSP00000383909:p.Gln191Glu	175.0	0.0	.		171.0	9.0	.	NM_032110	Q5TFQ3	Missense_Mutation	SNP	ENST00000404795.3	hg19	CCDS44141.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372316	0.24857	.	.	ENSG00000142700	ENST00000404795;ENST00000418121	T;T	0.32023	1.47;1.47	3.98	3.98	0.46160	.	0.740013	0.12457	N	0.467217	T	0.27454	0.0674	L	0.52573	1.65	0.49915	D	0.999837	P	0.44090	0.826	B	0.40940	0.344	T	0.13926	-1.0491	10	0.02654	T	1	-9.7172	15.3449	0.74327	0.0:0.0:1.0:0.0	.	191	Q96SC8	DMTA2_HUMAN	E	191	ENSP00000383909:Q191E;ENSP00000399370:Q191E	ENSP00000383909:Q191E	Q	-	1	0	DMRTA2	50657982	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.385000	0.90163	2.194000	0.70268	0.462000	0.41574	CAG	.	.	.	none		0.617	DMRTA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351074.1	NM_032110	
PPAP2B	8613	hgsc.bcm.edu	37	1	56989998	56989998	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr1:56989998T>A	ENST00000371250.3	-	3	1077	c.526A>T	c.(526-528)Att>Ttt	p.I176F		NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	176					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						TAGTTCTGAATGTAGCCTTCA	0.527																																					p.I176F		Atlas-SNP	.											.	PPAP2B	30	.	0			c.A526T						PASS	.						144.0	141.0	142.0					1																	56989998		2203	4300	6503	SO:0001583	missense	8613	exon3			TCTGAATGTAGCC	AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.526A>T	chr1.hg19:g.56989998T>A	ENSP00000360296:p.Ile176Phe	145.0	0.0	.		150.0	74.0	.	NM_003713	B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Missense_Mutation	SNP	ENST00000371250.3	hg19	CCDS604.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.131509	0.77549	.	.	ENSG00000162407	ENST00000371250	T	0.36340	1.26	5.56	3.21	0.36854	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.156720	0.56097	D	0.000033	T	0.55625	0.1932	M	0.78637	2.42	0.80722	D	1	P	0.45212	0.853	P	0.62885	0.908	T	0.57004	-0.7885	10	0.87932	D	0	.	8.5688	0.33556	0.0:0.2073:0.0:0.7927	.	176	O14495	LPP3_HUMAN	F	176	ENSP00000360296:I176F	ENSP00000360296:I176F	I	-	1	0	PPAP2B	56762586	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.446000	0.52928	0.926000	0.37118	0.533000	0.62120	ATT	.	.	.	none		0.527	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022334.2	NM_003713	
TPO	7173	hgsc.bcm.edu	37	2	1481209	1481209	+	Silent	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:1481209C>T	ENST00000345913.4	+	8	1262	c.1171C>T	c.(1171-1173)Ctg>Ttg	p.L391L	TPO_ENST00000329066.4_Silent_p.L391L|TPO_ENST00000382201.3_Silent_p.L391L|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Silent_p.L391L|TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Silent_p.L391L	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	391					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCCCTGCTTCCTGGCCGGAGA	0.771																																					p.L391L		Atlas-SNP	.											.	TPO	224	.	0			c.C1171T						PASS	.						1.0	1.0	1.0					2																	1481209		1216	2495	3711	SO:0001819	synonymous_variant	7173	exon8			TGCTTCCTGGCCG		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1171C>T	chr2.hg19:g.1481209C>T		672.0	1.0	.		626.0	273.0	.	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	hg19	CCDS1643.1																																																																																			.	.	.	none		0.771	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
KCNF1	3754	hgsc.bcm.edu	37	2	11053663	11053663	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:11053663G>A	ENST00000295082.1	+	1	1601	c.1111G>A	c.(1111-1113)Gtc>Atc	p.V371I		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	371					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		CATGACCACCGTCGGCTACGG	0.607																																					p.V371I		Atlas-SNP	.											.	KCNF1	70	.	0			c.G1111A						PASS	.						126.0	97.0	106.0					2																	11053663		2203	4300	6503	SO:0001583	missense	3754	exon1			ACCACCGTCGGCT	AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.1111G>A	chr2.hg19:g.11053663G>A	ENSP00000295082:p.Val371Ile	61.0	0.0	.		74.0	40.0	.	NM_002236	O43527|Q585L3	Missense_Mutation	SNP	ENST00000295082.1	hg19	CCDS1676.1	.	.	.	.	.	.	.	.	.	.	g	24.4	4.523021	0.85600	.	.	ENSG00000162975	ENST00000295082	D	0.97575	-4.44	5.32	5.32	0.75619	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98327	0.9445	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.99316	1.0905	10	0.87932	D	0	.	19.3693	0.94479	0.0:0.0:1.0:0.0	.	371	Q9H3M0	KCNF1_HUMAN	I	371	ENSP00000295082:V371I	ENSP00000295082:V371I	V	+	1	0	KCNF1	10971114	1.000000	0.71417	0.399000	0.26333	0.996000	0.88848	9.813000	0.99286	2.640000	0.89533	0.651000	0.88453	GTC	.	.	.	none		0.607	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236	
SLC5A6	8884	hgsc.bcm.edu	37	2	27435095	27435095	+	De_novo_Start_OutOfFrame	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:27435095C>T	ENST00000310574.3	-	0	59				SLC5A6_ENST00000408041.1_5'Flank|ATRAID_ENST00000405489.3_5'Flank|ATRAID_ENST00000380171.3_Silent_p.H8H|ATRAID_ENST00000606999.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6						biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CAGAGCTCCACGAGCAGGAAA	0.701																																					p.H8H		Atlas-SNP	.											.	.	.	.	0			c.C24T						PASS	.						6.0	8.0	7.0					2																	27435095		2097	4118	6215			51374	exon1			GCTCCACGAGCAG	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.-415G>A	chr2.hg19:g.27435095C>T		374.0	0.0	.		349.0	166.0	.	NM_080592	B2RB85|D6W549|Q969Y5	Silent	SNP	ENST00000310574.3	hg19	CCDS1740.1																																																																																			.	.	.	none		0.701	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
ALK	238	hgsc.bcm.edu	37	2	29456516	29456516	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:29456516A>G	ENST00000389048.3	-	14	3308	c.2402T>C	c.(2401-2403)aTa>aCa	p.I801T	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	801					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	TTCTTCTTCTATCACATTGTT	0.478			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.I801T		Atlas-SNP	.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	533	.	0			c.T2402C						PASS	.						193.0	177.0	182.0					2																	29456516		2203	4300	6503	SO:0001583	missense	238	exon14	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	TCTTCTATCACAT	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2402T>C	chr2.hg19:g.29456516A>G	ENSP00000373700:p.Ile801Thr	123.0	0.0	.		124.0	61.0	.	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	hg19	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.405704	0.62288	.	.	ENSG00000171094	ENST00000389048	T	0.41065	1.01	5.29	5.29	0.74685	.	0.000000	0.51477	D	0.000085	T	0.44808	0.1311	L	0.49126	1.545	0.80722	D	1	P	0.38250	0.624	B	0.43445	0.42	T	0.31558	-0.9939	9	.	.	.	.	15.2522	0.73556	1.0:0.0:0.0:0.0	.	801	Q9UM73	ALK_HUMAN	T	801	ENSP00000373700:I801T	.	I	-	2	0	ALK	29310020	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.230000	0.65321	2.007000	0.58848	0.459000	0.35465	ATA	.	.	.	none		0.478	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
PNPT1	87178	hgsc.bcm.edu	37	2	55870498	55870498	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:55870498T>C	ENST00000447944.2	-	24	2055	c.1969A>G	c.(1969-1971)Atg>Gtg	p.M657V		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	657	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCCTCATGCATAGCACTGGGT	0.313																																					p.M657V		Atlas-SNP	.											.	PNPT1	68	.	0			c.A1969G						PASS	.						142.0	134.0	137.0					2																	55870498		2203	4300	6503	SO:0001583	missense	87178	exon24			CATGCATAGCACT	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1969A>G	chr2.hg19:g.55870498T>C	ENSP00000400646:p.Met657Val	435.0	0.0	.		420.0	162.0	.	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	hg19	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.753568	0.69648	.	.	ENSG00000138035	ENST00000447944	T	0.17370	2.28	5.17	4.01	0.46588	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.084629	0.85682	D	0.000000	T	0.30947	0.0781	M	0.62154	1.92	0.58432	D	0.999999	P	0.47604	0.898	P	0.57548	0.823	T	0.01688	-1.1295	10	0.26408	T	0.33	-22.0783	11.4955	0.50406	0.1346:0.0:0.0:0.8654	.	657	Q8TCS8	PNPT1_HUMAN	V	657	ENSP00000400646:M657V	ENSP00000393953:M657V	M	-	1	0	PNPT1	55724002	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.814000	0.69208	0.811000	0.34303	-0.544000	0.04233	ATG	.	.	.	none		0.313	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
ALMS1	7840	hgsc.bcm.edu	37	2	73680351	73680351	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:73680351A>G	ENST00000264448.6	+	8	6805	c.6694A>G	c.(6694-6696)Ata>Gta	p.I2232V	ALMS1_ENST00000409009.1_Missense_Mutation_p.I2190V|ALMS1_ENST00000377715.1_Missense_Mutation_p.I2232V	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2232					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CAGAGTTGTAATAAATAAACC	0.353																																					p.I2232V		Atlas-SNP	.											.	ALMS1	384	.	0			c.A6694G						PASS	.						54.0	53.0	53.0					2																	73680351		1831	4094	5925	SO:0001583	missense	7840	exon8			GTTGTAATAAATA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.6694A>G	chr2.hg19:g.73680351A>G	ENSP00000264448:p.Ile2232Val	147.0	0.0	.		159.0	74.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	10.19	1.282885	0.23392	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.15017	3.34;3.34;2.46	6.03	3.6	0.41247	.	0.109289	0.41712	D	0.000822	T	0.13543	0.0328	L	0.48642	1.525	0.09310	N	1	B;B;B	0.33940	0.23;0.433;0.433	B;B;B	0.32677	0.15;0.134;0.134	T	0.19160	-1.0314	10	0.46703	T	0.11	.	5.3339	0.15947	0.7629:0.0:0.0823:0.1548	.	2232;2190;2232	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	V	2190;2232;2232	ENSP00000386627:I2190V;ENSP00000264448:I2232V;ENSP00000366944:I2232V	ENSP00000264448:I2232V	I	+	1	0	ALMS1	73533859	0.183000	0.23186	0.175000	0.22980	0.402000	0.30811	1.065000	0.30592	0.485000	0.27652	0.533000	0.62120	ATA	.	.	.	none		0.353	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
CLASP1	23332	hgsc.bcm.edu	37	2	122216460	122216460	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:122216460T>C	ENST00000263710.4	-	13	1659	c.1270A>G	c.(1270-1272)Att>Gtt	p.I424V	CLASP1_ENST00000455322.2_Missense_Mutation_p.I424V|CLASP1_ENST00000545861.1_Missense_Mutation_p.I192V|CLASP1_ENST00000397587.3_Missense_Mutation_p.I424V|CLASP1_ENST00000409078.3_Missense_Mutation_p.I424V|CLASP1_ENST00000430234.1_5'Flank|CLASP1_ENST00000541859.1_Missense_Mutation_p.I193V|CLASP1_ENST00000541377.1_Missense_Mutation_p.I424V	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	424					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					GTGGCCATAATTTTGGCACTG	0.378																																					p.I424V		Atlas-SNP	.											.	CLASP1	135	.	0			c.A1270G						PASS	.						102.0	102.0	102.0					2																	122216460		1850	4097	5947	SO:0001583	missense	23332	exon13			CCATAATTTTGGC	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.1270A>G	chr2.hg19:g.122216460T>C	ENSP00000263710:p.Ile424Val	109.0	0.0	.		128.0	63.0	.	NM_001207051	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	hg19		.	.	.	.	.	.	.	.	.	.	T	3.808	-0.040404	0.07497	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.35	4.19	0.49359	Armadillo-like helical (1);Armadillo-type fold (1);CLASP N-terminal domain (1);	0.150369	0.64402	D	0.000012	T	0.12305	0.0299	N	0.00422	-1.515	0.33312	D	0.566265	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.002;0.001;0.002;0.004	T	0.28170	-1.0052	10	0.02654	T	1	-1.4012	7.7836	0.29078	0.0:0.2102:0.0:0.7898	.	424;424;424;424	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	V	424;424;424;424;193;424;192	ENSP00000263710:I424V;ENSP00000389372:I424V;ENSP00000380717:I424V;ENSP00000441625:I424V;ENSP00000441770:I193V;ENSP00000386442:I424V;ENSP00000438620:I192V	ENSP00000263710:I424V	I	-	1	0	CLASP1	121932930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.415000	0.44635	0.971000	0.38288	0.533000	0.62120	ATT	.	.	.	none		0.378	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
TSN	7247	hgsc.bcm.edu	37	2	122513374	122513374	+	Missense_Mutation	SNP	T	T	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:122513374T>A	ENST00000389682.3	+	1	266	c.19T>A	c.(19-21)Ttc>Atc	p.F7I	TSN_ENST00000498545.1_3'UTR|TSN_ENST00000536142.1_Missense_Mutation_p.F7I|TSN_ENST00000409193.1_5'Flank	NM_001261401.1|NM_004622.2	NP_001248330.1|NP_004613.1	Q15631	TSN_HUMAN	translin	7					DNA recombination (GO:0006310)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|sequence-specific DNA binding (GO:0043565)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)|skin(1)	12		Ovarian(717;0.0563)|Prostate(154;0.116)				GAGCGAGATCTTCGTGGAGCT	0.612																																					p.F7I		Atlas-SNP	.											.	TSN	31	.	0			c.T19A						PASS	.						78.0	80.0	79.0					2																	122513374		2203	4300	6503	SO:0001583	missense	7247	exon1			GAGATCTTCGTGG	X78627	CCDS33284.1, CCDS58723.1	2q21.1	2008-05-23			ENSG00000211460	ENSG00000211460			12379	protein-coding gene	gene with protein product	"""recombination hotspot associated factor"""	600575				7947454, 9244443	Standard	NM_004622		Approved	TRSLN, BCLF-1, REHF-1	uc002tnl.3	Q15631	OTTHUMG00000153334	ENST00000389682.3:c.19T>A	chr2.hg19:g.122513374T>A	ENSP00000374332:p.Phe7Ile	27.0	0.0	.		33.0	16.0	.	NM_004622	B7Z3X8|Q5U0K7	Missense_Mutation	SNP	ENST00000389682.3	hg19	CCDS33284.1	.	.	.	.	.	.	.	.	.	.	T	34	5.366476	0.95900	.	.	ENSG00000211460	ENST00000389682;ENST00000536142;ENST00000413418	.	.	.	4.18	4.18	0.49190	Translin, N-terminal (1);	0.225178	0.46758	D	0.000261	T	0.80303	0.4598	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.83027	-0.0164	9	0.59425	D	0.04	-0.0926	11.0851	0.48082	0.0:0.0:0.0:1.0	.	7;7	B7Z3X8;Q15631	.;TSN_HUMAN	I	7	.	ENSP00000374332:F7I	F	+	1	0	TSN	122229844	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.462000	0.60121	1.761000	0.52028	0.460000	0.39030	TTC	.	.	.	none		0.612	TSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330767.1	NM_004622	
NFE2L2	4780	hgsc.bcm.edu	37	2	178096314	178096314	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:178096314G>C	ENST00000397062.3	-	5	1571	c.1017C>G	c.(1015-1017)ttC>ttG	p.F339L	NFE2L2_ENST00000446151.2_Missense_Mutation_p.F316L|NFE2L2_ENST00000464747.1_Missense_Mutation_p.F323L|NFE2L2_ENST00000397063.4_Missense_Mutation_p.F323L	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	339					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CAGAATCATTGAATTCTGCTG	0.453			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.F339L		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	225	.	0			c.C1017G						PASS	.						131.0	136.0	134.0					2																	178096314		2196	4299	6495	SO:0001583	missense	4780	exon5			ATCATTGAATTCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.1017C>G	chr2.hg19:g.178096314G>C	ENSP00000380252:p.Phe339Leu	171.0	0.0	.		216.0	94.0	.	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	G	6.841	0.524426	0.13066	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627	T;T;T;T	0.29142	2.3;2.3;2.3;1.58	5.83	2.66	0.31614	.	0.423208	0.29846	N	0.011059	T	0.23727	0.0574	L	0.53249	1.67	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.05750	-1.0866	10	0.09843	T	0.71	-2.2964	9.1144	0.36748	0.3416:0.0:0.6584:0.0	.	316;339	E9PGJ7;Q16236	.;NF2L2_HUMAN	L	323;339;316;67	ENSP00000380253:F323L;ENSP00000380252:F339L;ENSP00000411575:F316L;ENSP00000391590:F67L	ENSP00000380252:F339L	F	-	3	2	NFE2L2	177804560	0.997000	0.39634	0.999000	0.59377	0.988000	0.76386	0.667000	0.25112	0.823000	0.34589	0.563000	0.77884	TTC	.	.	.	none		0.453	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
PLEKHA3	65977	hgsc.bcm.edu	37	2	179358605	179358605	+	Silent	SNP	G	G	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr2:179358605G>T	ENST00000234453.5	+	4	741	c.339G>T	c.(337-339)ctG>ctT	p.L113L	PLEKHA3_ENST00000461474.1_3'UTR	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3	113						Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			GTGAATCGCTGAAAACCAAAA	0.323																																					p.L113L		Atlas-SNP	.											.	PLEKHA3	25	.	0			c.G339T						PASS	.						77.0	72.0	74.0					2																	179358605		2203	4300	6503	SO:0001819	synonymous_variant	65977	exon4			ATCGCTGAAAACC	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.339G>T	chr2.hg19:g.179358605G>T		288.0	1.0	.		284.0	125.0	.	NM_019091	Q4ZG69|Q86TQ1|Q9NXT3	Silent	SNP	ENST00000234453.5	hg19	CCDS33336.1																																																																																			.	.	.	none		0.323	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335241.2	NM_019091	
SGOL1	151648	hgsc.bcm.edu	37	3	20215950	20215950	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr3:20215950C>G	ENST00000263753.4	-	6	1212	c.1073G>C	c.(1072-1074)aGa>aCa	p.R358T	SGOL1-AS1_ENST00000448208.1_RNA|SGOL1_ENST00000425061.1_Intron|SGOL1_ENST00000421451.1_Missense_Mutation_p.R358T|SGOL1_ENST00000383774.1_Intron|SGOL1_ENST00000412997.1_Missense_Mutation_p.R358T|SGOL1_ENST00000419233.2_Intron|SGOL1_ENST00000443724.1_Intron|SGOL1_ENST00000442720.1_Intron|SGOL1_ENST00000437051.1_Intron|SGOL1_ENST00000429446.3_Intron|SGOL1_ENST00000417364.1_Intron|SGOL1-AS1_ENST00000441442.1_RNA|SGOL1_ENST00000412868.1_Missense_Mutation_p.R358T|SGOL1_ENST00000306698.2_Intron|SGOL1_ENST00000452020.1_Intron	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)	358					attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)			kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						GTTTTCTTCTCTATTAGAGTC	0.398																																					p.R358T		Atlas-SNP	.											.	SGOL1	55	.	0			c.G1073C						PASS	.						142.0	129.0	134.0					3																	20215950		2203	4300	6503	SO:0001583	missense	151648	exon6			TCTTCTCTATTAG	BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.1073G>C	chr3.hg19:g.20215950C>G	ENSP00000263753:p.Arg358Thr	154.0	0.0	.		187.0	78.0	.	NM_001012409	Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	Missense_Mutation	SNP	ENST00000263753.4	hg19	CCDS33716.1	.	.	.	.	.	.	.	.	.	.	C	3.154	-0.173522	0.06421	.	.	ENSG00000129810	ENST00000263753;ENST00000421451;ENST00000412997;ENST00000412868	T;T;T;T	0.31769	1.48;1.48;1.5;1.5	5.76	-0.651	0.11454	.	0.794180	0.11812	N	0.527060	T	0.16342	0.0393	L	0.38838	1.175	0.20196	N	0.999927	B;B	0.21381	0.055;0.055	B;B	0.15052	0.012;0.012	T	0.25398	-1.0133	10	0.19590	T	0.45	.	0.7717	0.01025	0.2512:0.323:0.1118:0.314	.	358;358	B5BUA4;Q5FBB7	.;SGOL1_HUMAN	T	358	ENSP00000263753:R358T;ENSP00000414129:R358T;ENSP00000410458:R358T;ENSP00000406880:R358T	ENSP00000263753:R358T	R	-	2	0	SGOL1	20190954	0.000000	0.05858	0.024000	0.17045	0.228000	0.25075	-0.798000	0.04565	0.030000	0.15379	0.561000	0.74099	AGA	.	.	.	none		0.398	SGOL1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340498.1	NM_138484	
KIAA2018	205717	hgsc.bcm.edu	37	3	113383247	113383247	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr3:113383247T>C	ENST00000478658.1	-	4	186	c.169A>G	c.(169-171)Atg>Gtg	p.M57V	KIAA2018_ENST00000316407.4_Missense_Mutation_p.M57V|KIAA2018_ENST00000491165.1_Missense_Mutation_p.M57V			Q68DE3	K2018_HUMAN	KIAA2018	57	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TCCAGGATCATATTCTTGCTC	0.318																																					p.M57V		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A169G						PASS	.						84.0	77.0	79.0					3																	113383247		1794	4067	5861	SO:0001583	missense	205717	exon6			GGATCATATTCTT	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.169A>G	chr3.hg19:g.113383247T>C	ENSP00000420721:p.Met57Val	107.0	0.0	.		103.0	40.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	hg19	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	T	16.86	3.238796	0.58995	.	.	ENSG00000176542	ENST00000491165;ENST00000316407;ENST00000478658	D;D;D	0.97906	-4.6;-4.6;-4.6	4.83	4.83	0.62350	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.97120	0.9059	N	0.20685	0.6	0.58432	D	0.999998	D	0.76494	0.999	D	0.79108	0.992	D	0.98417	1.0575	10	0.87932	D	0	-13.03	14.8689	0.70441	0.0:0.0:0.0:1.0	.	57	Q68DE3	K2018_HUMAN	V	57	ENSP00000420752:M57V;ENSP00000320794:M57V;ENSP00000420721:M57V	ENSP00000320794:M57V	M	-	1	0	KIAA2018	114865937	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.431000	0.80335	2.167000	0.68274	0.528000	0.53228	ATG	.	.	.	none		0.318	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
CCDC37	348807	hgsc.bcm.edu	37	3	126137471	126137471	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr3:126137471G>C	ENST00000352312.1	+	7	603	c.504G>C	c.(502-504)aaG>aaC	p.K168N	CCDC37_ENST00000505024.1_Missense_Mutation_p.K169N|CCDC37_ENST00000393425.1_Missense_Mutation_p.K169N	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	168										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		TGGATGTCAAGCGGAGAGAGA	0.672																																					p.K168N		Atlas-SNP	.											.	CCDC37	69	.	0			c.G504C						PASS	.						29.0	32.0	31.0					3																	126137471		2200	4298	6498	SO:0001583	missense	348807	exon7			TGTCAAGCGGAGA	AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.504G>C	chr3.hg19:g.126137471G>C	ENSP00000344749:p.Lys168Asn	73.0	0.0	.		75.0	5.0	.	NM_182628	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	ENST00000352312.1	hg19	CCDS3037.1	.	.	.	.	.	.	.	.	.	.	G	9.840	1.190832	0.21954	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.23754	1.89;1.89;1.89	4.74	1.94	0.25998	.	0.000000	0.85682	D	0.000000	T	0.52837	0.1759	M	0.89840	3.065	0.44762	D	0.997769	D;D	0.76494	0.999;0.999	D;D	0.80764	0.99;0.994	T	0.50955	-0.8766	10	0.52906	T	0.07	-39.2628	9.3746	0.38275	0.3372:0.0:0.6628:0.0	.	169;168	Q494V2-2;Q494V2	.;CCD37_HUMAN	N	168;169;169	ENSP00000344749:K168N;ENSP00000377076:K169N;ENSP00000423046:K169N	ENSP00000344749:K168N	K	+	3	2	CCDC37	127620161	0.996000	0.38824	0.111000	0.21465	0.005000	0.04900	1.465000	0.35299	-0.116000	0.11893	-1.579000	0.00862	AAG	.	.	.	none		0.672	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4	NM_182628	
FGFR3	2261	hgsc.bcm.edu	37	4	1806099	1806099	+	Missense_Mutation	SNP	A	A	G	rs121913485		TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr4:1806099A>G	ENST00000260795.2	+	8	1220	c.1118A>G	c.(1117-1119)tAt>tGt	p.Y373C	FGFR3_ENST00000412135.2_Intron|FGFR3_ENST00000340107.4_Missense_Mutation_p.Y375C|FGFR3_ENST00000481110.2_Missense_Mutation_p.Y373C|FGFR3_ENST00000352904.1_Intron|FGFR3_ENST00000440486.2_Missense_Mutation_p.Y373C			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	373			Y -> C (in KERSEB and TD1; disulfide- linked dimer with constitutive kinase activation). {ECO:0000269|PubMed:10360402, ECO:0000269|PubMed:15772091, ECO:0000269|PubMed:8845844, ECO:0000269|PubMed:9207791}.		alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.Y373C(395)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	GGCAGTGTGTATGCAGGCATC	0.682	Y373C(KMS11_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.Y375C		Atlas-SNP	.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	FGFR3_ENST00000340107,bladder,carcinoma,0,407	FGFR3	3320	.	395	Substitution - Missense(395)	urinary_tract(371)|skin(16)|haematopoietic_and_lymphoid_tissue(8)	c.A1124G	GRCh37	CM960657	FGFR3	M	rs121913485	PASS	.						141.0	134.0	137.0					4																	1806099		2203	4300	6503	SO:0001583	missense	2261	exon9	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GTGTGTATGCAGG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1118A>G	chr4.hg19:g.1806099A>G	ENSP00000260795:p.Tyr373Cys	44.0	0.0	.		54.0	24.0	.	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	hg19	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	a	12.61	1.990190	0.35131	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000260795	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	4.68	1.93	0.25924	.	0.343855	0.31061	N	0.008340	D	0.93148	0.7818	M	0.82517	2.595	0.80722	A	1	D;D;D	0.76494	0.992;0.994;0.999	D;P;D	0.72625	0.94;0.896;0.978	D	0.94049	0.7316	9	0.72032	D	0.01	.	8.9873	0.36001	0.7079:0.0:0.0:0.2921	.	375;373;373	P22607-2;P22607;F8W9L4	.;FGFR3_HUMAN;.	C	373;375;373;373	ENSP00000420533:Y373C;ENSP00000339824:Y375C;ENSP00000414914:Y373C;ENSP00000260795:Y373C	ENSP00000260795:Y373C	Y	+	2	0	FGFR3	1775897	0.999000	0.42202	0.495000	0.27527	0.084000	0.17831	4.274000	0.58921	0.715000	0.32103	0.379000	0.24179	TAT	.	.	.	weak		0.682	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
ABLIM2	84448	hgsc.bcm.edu	37	4	8082456	8082456	+	Silent	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr4:8082456G>A	ENST00000341937.5	-	5	592	c.528C>T	c.(526-528)ggC>ggT	p.G176G	ABLIM2_ENST00000546334.1_Silent_p.G176G|ABLIM2_ENST00000447017.2_Silent_p.G176G|ABLIM2_ENST00000545242.1_Silent_p.G176G|ABLIM2_ENST00000407564.3_Silent_p.G176G|ABLIM2_ENST00000361581.5_Silent_p.G176G|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000296372.8_Silent_p.G176G|ABLIM2_ENST00000428004.2_Silent_p.G176G|ABLIM2_ENST00000361737.5_Silent_p.G176G|ABLIM2_ENST00000505872.1_Silent_p.G176G	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	176	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						ACTTAAAACAGCCCAAGTGCC	0.557																																					p.G176G		Atlas-SNP	.											.	ABLIM2	59	.	0			c.C528T						PASS	.						65.0	70.0	68.0					4																	8082456		1977	4158	6135	SO:0001819	synonymous_variant	84448	exon5			AAAACAGCCCAAG	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.528C>T	chr4.hg19:g.8082456G>A		141.0	0.0	.		145.0	67.0	.	NM_001130083	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Silent	SNP	ENST00000341937.5	hg19	CCDS47013.1																																																																																			.	.	.	none		0.557	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083	
PCDH18	54510	hgsc.bcm.edu	37	4	138451594	138451594	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr4:138451594C>G	ENST00000344876.4	-	1	2035	c.1649G>C	c.(1648-1650)gGa>gCa	p.G550A	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.G330A|PCDH18_ENST00000412923.2_Missense_Mutation_p.G550A|PCDH18_ENST00000511115.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	550	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CGGGCTTCCTCCATCTCTTGC	0.443																																					p.G550A		Atlas-SNP	.											.	PCDH18	229	.	0			c.G1649C						PASS	.						140.0	138.0	139.0					4																	138451594		2203	4300	6503	SO:0001583	missense	54510	exon1			CTTCCTCCATCTC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1649G>C	chr4.hg19:g.138451594C>G	ENSP00000355082:p.Gly550Ala	80.0	0.0	.		76.0	26.0	.	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	hg19	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	5.574	0.290786	0.10567	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.50277	0.75;0.75;0.75	5.93	5.93	0.95920	Cadherin (4);Cadherin-like (1);	0.000000	0.42420	D	0.000720	T	0.42291	0.1196	L	0.39566	1.225	0.80722	D	1	B;B;P	0.35628	0.145;0.016;0.513	B;B;B	0.35470	0.141;0.049;0.203	T	0.17715	-1.0360	10	0.13853	T	0.58	.	20.3437	0.98782	0.0:1.0:0.0:0.0	.	330;550;550	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	A	550;550;330	ENSP00000355082:G550A;ENSP00000390688:G550A;ENSP00000425903:G330A	ENSP00000355082:G550A	G	-	2	0	PCDH18	138671044	0.994000	0.37717	0.999000	0.59377	0.339000	0.28857	2.566000	0.45948	2.802000	0.96397	0.563000	0.77884	GGA	.	.	.	none		0.443	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
FBXW7	55294	hgsc.bcm.edu	37	4	153273874	153273874	+	Intron	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr4:153273874G>A	ENST00000281708.4	-	3	1731				FBXW7_ENST00000603841.1_Intron|FBXW7_ENST00000263981.5_Silent_p.V3V|FBXW7_ENST00000603548.1_Intron|FBXW7_ENST00000296555.5_Intron	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CGCTTCTCGGGACACACATAC	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.V3V		Atlas-SNP	.		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	FBXW7	2157	.	0			c.C9T						PASS	.						66.0	63.0	64.0					4																	153273874		2203	4300	6503	SO:0001627	intron_variant	55294	exon1			TCTCGGGACACAC	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.502-2598C>T	chr4.hg19:g.153273874G>A		59.0	0.0	.		59.0	31.0	.	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Silent	SNP	ENST00000281708.4	hg19	CCDS3777.1																																																																																			.	.	.	none		0.468	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
MAP1B	4131	hgsc.bcm.edu	37	5	71403432	71403432	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr5:71403432C>T	ENST00000296755.7	+	1	372	c.74C>T	c.(73-75)tCg>tTg	p.S25L	MAP1B_ENST00000504183.1_3'UTR	NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	25					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GCGTCCACCTCGCCTAGCCTG	0.682																																					p.S25L	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.C74T						PASS	.						28.0	25.0	26.0					5																	71403432		2201	4299	6500	SO:0001583	missense	4131	exon1			CCACCTCGCCTAG	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.74C>T	chr5.hg19:g.71403432C>T	ENSP00000296755:p.Ser25Leu	74.0	0.0	.		72.0	35.0	.	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	hg19	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696927	0.88830	.	.	ENSG00000131711	ENST00000512974;ENST00000296755;ENST00000511641	T;T	0.06449	3.86;3.3	5.02	5.02	0.67125	.	0.000000	0.47455	D	0.000230	T	0.19005	0.0456	L	0.50333	1.59	0.58432	D	0.999996	D	0.76494	0.999	P	0.61275	0.886	T	0.00144	-1.1994	10	0.66056	D	0.02	-7.1031	18.5265	0.90974	0.0:1.0:0.0:0.0	.	25	P46821	MAP1B_HUMAN	L	25	ENSP00000296755:S25L;ENSP00000423444:S25L	ENSP00000296755:S25L	S	+	2	0	MAP1B	71439188	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.355000	0.66046	2.606000	0.88127	0.561000	0.74099	TCG	.	.	.	none		0.682	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
SCIN	85477	hgsc.bcm.edu	37	7	12689143	12689143	+	Missense_Mutation	SNP	G	G	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr7:12689143G>T	ENST00000297029.5	+	14	2034	c.1933G>T	c.(1933-1935)Gtc>Ttc	p.V645F	SCIN_ENST00000519209.1_Missense_Mutation_p.V398F|SCIN_ENST00000445618.2_Missense_Mutation_p.V398F	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	645	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TGAAGATGATGTCATGTTACT	0.353																																					p.V645F		Atlas-SNP	.											.	SCIN	105	.	0			c.G1933T						PASS	.						98.0	92.0	94.0					7																	12689143		1869	4107	5976	SO:0001583	missense	85477	exon14			GATGATGTCATGT	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1933G>T	chr7.hg19:g.12689143G>T	ENSP00000297029:p.Val645Phe	110.0	0.0	.		158.0	69.0	.	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	hg19	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872781	0.91587	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.30448	1.53;1.53;1.53	5.6	5.6	0.85130	Gelsolin domain (1);	0.058409	0.64402	D	0.000003	T	0.70842	0.3270	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80169	-0.1494	10	0.87932	D	0	-21.0868	20.0086	0.97443	0.0:0.0:1.0:0.0	.	645	Q9Y6U3	ADSV_HUMAN	F	645;398;398	ENSP00000297029:V645F;ENSP00000430997:V398F;ENSP00000390189:V398F	ENSP00000297029:V645F	V	+	1	0	SCIN	12655668	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.174000	0.94824	2.814000	0.96858	0.655000	0.94253	GTC	.	.	.	none		0.353	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
RALA	5898	hgsc.bcm.edu	37	7	39736427	39736427	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr7:39736427C>T	ENST00000005257.2	+	4	847	c.467C>T	c.(466-468)aCa>aTa	p.T156I	RALA_ENST00000468201.1_3'UTR	NM_005402.3	NP_005393.2	P11233	RALA_HUMAN	v-ral simian leukemia viral oncogene homolog A (ras related)	156					actin cytoskeleton reorganization (GO:0031532)|chemotaxis (GO:0006935)|cytokinesis (GO:0000910)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|membrane raft localization (GO:0051665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of filopodium assembly (GO:0051491)|Ras protein signal transduction (GO:0007265)|regulation of exocytosis (GO:0017157)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(9)|skin(3)	16						TACGTGGAAACATCTGCTAAA	0.378																																					p.T156I		Atlas-SNP	.											.	RALA	39	.	0			c.C467T						PASS	.						108.0	99.0	102.0					7																	39736427		2203	4300	6503	SO:0001583	missense	5898	exon4			TGGAAACATCTGC		CCDS5460.1	7p22-p15	2014-05-09			ENSG00000006451	ENSG00000006451			9839	protein-coding gene	gene with protein product	"""RAS-like protein A"", ""Ras-related protein Ral-A"", ""Ras family small GTP binding protein RALA"", ""ras related GTP binding protein A"""	179550		RAL		3292391	Standard	NM_005402		Approved		uc003thd.3	P11233	OTTHUMG00000128775	ENST00000005257.2:c.467C>T	chr7.hg19:g.39736427C>T	ENSP00000005257:p.Thr156Ile	308.0	0.0	.		318.0	137.0	.	NM_005402	A4D1W3	Missense_Mutation	SNP	ENST00000005257.2	hg19	CCDS5460.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750870	0.89753	.	.	ENSG00000006451	ENST00000005257	T	0.80653	-1.4	4.84	4.84	0.62591	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91136	0.7209	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92791	0.6248	10	0.87932	D	0	.	18.3322	0.90274	0.0:1.0:0.0:0.0	.	156	P11233	RALA_HUMAN	I	156	ENSP00000005257:T156I	ENSP00000005257:T156I	T	+	2	0	RALA	39702952	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.814000	0.86154	2.396000	0.81511	0.563000	0.77884	ACA	.	.	.	none		0.378	RALA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250696.2	NM_005402	
COL14A1	7373	hgsc.bcm.edu	37	8	121243856	121243856	+	Splice_Site	SNP	C	C	T	rs145606030		TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr8:121243856C>T	ENST00000297848.3	+	19	2618	c.2348C>T	c.(2347-2349)aCg>aTg	p.T783M	COL14A1_ENST00000247781.3_Splice_Site_p.T688M|COL14A1_ENST00000309791.4_Splice_Site_p.T783M|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000537875.1_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GTCATAGGAACGGTCTGTATA	0.443																																					p.T783M		Atlas-SNP	.											.	COL14A1	292	.	0			c.C2348T						PASS	.	C	MET/THR	2,4404	4.2+/-10.8	0,2,2201	78.0	72.0	74.0		2348	3.7	1.0	8	dbSNP_134	74	0,8600		0,0,4300	yes	missense-near-splice	COL14A1	NM_021110.1	81	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	783/1797	121243856	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	7373	exon19			TAGGAACGGTCTG		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2349+1C>T	chr8.hg19:g.121243856C>T		126.0	0.0	.		112.0	54.0	.	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	hg19	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.063760	0.55432	4.54E-4	0.0	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.55	3.66	0.41972	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.236035	0.30109	N	0.010396	T	0.59142	0.2172	L	0.36672	1.1	0.80722	D	1	D;B	0.71674	0.998;0.359	P;B	0.58660	0.843;0.142	T	0.58612	-0.7606	10	0.62326	D	0.03	.	8.7818	0.34795	0.0:0.8126:0.0:0.1874	.	783;783	Q05707-2;Q05707	.;COEA1_HUMAN	M	783;783;688;596	ENSP00000311809:T783M;ENSP00000297848:T783M;ENSP00000247781:T688M;ENSP00000409461:T596M	ENSP00000247781:T688M	T	+	2	0	COL14A1	121313037	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	0.599000	0.24089	0.640000	0.30582	-0.367000	0.07326	ACG	.	C|1.000;T|0.000	0.000	weak		0.443	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	Missense_Mutation
EPPK1	83481	hgsc.bcm.edu	37	8	144946578	144946578	+	Nonsense_Mutation	SNP	C	C	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr8:144946578C>A	ENST00000525985.1	-	2	915	c.844G>T	c.(844-846)Gag>Tag	p.E282*				P58107	EPIPL_HUMAN	epiplakin 1	282						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCGGTACCCTCCAGGTAGCGC	0.687																																					p.E282X		Atlas-SNP	.											.	EPPK1	199	.	0			c.G844T						PASS	.						20.0	26.0	24.0					8																	144946578		2160	4242	6402	SO:0001587	stop_gained	83481	exon1			TACCCTCCAGGTA	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.844G>T	chr8.hg19:g.144946578C>A	ENSP00000436337:p.Glu282*	54.0	0.0	.		54.0	21.0	.	NM_031308	Q76E58|Q9NSU9	Nonsense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	C	18.67	3.673779	0.67928	.	.	ENSG00000227184	ENST00000525985	.	.	.	4.81	-0.522	0.11928	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	11.5156	0.50520	0.0:0.2877:0.6244:0.0879	.	.	.	.	X	282	.	ENSP00000436337:E282X	E	-	1	0	EPPK1	145018566	0.000000	0.05858	0.799000	0.32177	0.177000	0.22998	-0.810000	0.04505	-0.304000	0.08843	0.511000	0.50034	GAG	.	.	.	none		0.687	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
HKDC1	80201	hgsc.bcm.edu	37	10	71010157	71010157	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr10:71010157T>C	ENST00000354624.5	+	11	1815	c.1682T>C	c.(1681-1683)aTc>aCc	p.I561T	HKDC1_ENST00000395086.2_Missense_Mutation_p.I561T	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	561	Hexokinase type-1 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						ATCTTCGCCATCCCCCTGGAG	0.592																																					p.I561T		Atlas-SNP	.											.	HKDC1	98	.	0			c.T1682C						PASS	.						114.0	99.0	104.0					10																	71010157		2203	4300	6503	SO:0001583	missense	80201	exon11			TCGCCATCCCCCT		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1682T>C	chr10.hg19:g.71010157T>C	ENSP00000346643:p.Ile561Thr	79.0	0.0	.		86.0	5.0	.	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	hg19	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.417035	0.83449	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98717	-5.09;-5.09	4.98	4.98	0.66077	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99217	0.9728	M	0.90542	3.125	0.54753	D	0.999989	P	0.48230	0.907	D	0.69479	0.964	D	0.99075	1.0835	10	0.72032	D	0.01	-20.7428	14.8099	0.69985	0.0:0.0:0.0:1.0	.	561	Q2TB90	HKDC1_HUMAN	T	561	ENSP00000346643:I561T;ENSP00000378521:I561T	ENSP00000346643:I561T	I	+	2	0	HKDC1	70680163	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.831000	0.86748	2.090000	0.63153	0.459000	0.35465	ATC	.	.	.	none		0.592	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
USP47	55031	hgsc.bcm.edu	37	11	11971443	11971443	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr11:11971443A>G	ENST00000399455.2	+	24	3536	c.3416A>G	c.(3415-3417)aAg>aGg	p.K1139R	USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Missense_Mutation_p.K1119R|USP47_ENST00000339865.5_Missense_Mutation_p.K1051R	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	1139					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TAGCCATGCAAGTTTCTGCTA	0.323																																					p.K1051R		Atlas-SNP	.											.	USP47	91	.	0			c.A3152G						PASS	.						113.0	102.0	105.0					11																	11971443		1857	4090	5947	SO:0001583	missense	55031	exon22			CATGCAAGTTTCT	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.3416A>G	chr11.hg19:g.11971443A>G	ENSP00000382382:p.Lys1139Arg	115.0	0.0	.		130.0	43.0	.	NM_017944	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Missense_Mutation	SNP	ENST00000399455.2	hg19		.	.	.	.	.	.	.	.	.	.	A	12.79	2.044265	0.36085	.	.	ENSG00000170242	ENST00000339865;ENST00000527733;ENST00000399455	D;D;D	0.94687	-3.49;-3.49;-3.49	5.37	4.22	0.49857	.	0.045749	0.85682	D	0.000000	D	0.94873	0.8343	L	0.40543	1.245	0.80722	D	1	D;D	0.63880	0.993;0.974	D;D	0.70935	0.971;0.969	D	0.94365	0.7591	10	0.51188	T	0.08	.	11.5397	0.50659	0.9251:0.0:0.0749:0.0	.	1119;1051	E9PM46;Q96K76-2	.;.	R	1051;1119;1139	ENSP00000339957:K1051R;ENSP00000433146:K1119R;ENSP00000382382:K1139R	ENSP00000339957:K1051R	K	+	2	0	USP47	11928019	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.423000	0.80229	2.138000	0.66242	0.533000	0.62120	AAG	.	.	.	none		0.323	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
SLC22A24	283238	hgsc.bcm.edu	37	11	62911071	62911071	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr11:62911071C>T	ENST00000417740.1	-	1	622	c.181G>A	c.(181-183)Gac>Aac	p.D61N	SLC22A10_ENST00000525620.1_Intron|SLC22A24_ENST00000326192.5_Missense_Mutation_p.D61N	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	61					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						GTATCATTGTCAGACACAGTG	0.517																																					p.D61N		Atlas-SNP	.											.	SLC22A24	31	.	0			c.G181A						PASS	.						109.0	108.0	108.0					11																	62911071		692	1591	2283	SO:0001583	missense	283238	exon1			CATTGTCAGACAC		CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.181G>A	chr11.hg19:g.62911071C>T	ENSP00000396586:p.Asp61Asn	124.0	0.0	.		108.0	49.0	.	NM_001136506		Missense_Mutation	SNP	ENST00000417740.1	hg19		.	.	.	.	.	.	.	.	.	.	C	2.174	-0.389127	0.04932	.	.	ENSG00000197658	ENST00000417740;ENST00000531535;ENST00000326192	T;T	0.34859	1.34;1.34	2.29	-0.153	0.13403	.	2.737860	0.02513	N	0.091716	T	0.31638	0.0803	L	0.42686	1.345	0.09310	N	1	B	0.23442	0.085	B	0.23852	0.049	T	0.19549	-1.0302	10	0.17832	T	0.49	.	9.282	0.37733	0.0:0.5823:0.4177:0.0	.	61	C9JC66	.	N	61	ENSP00000396586:D61N;ENSP00000321549:D61N	ENSP00000321549:D61N	D	-	1	0	SLC22A24	62667647	0.000000	0.05858	0.024000	0.17045	0.632000	0.37999	-0.569000	0.05902	0.298000	0.22638	-0.890000	0.02929	GAC	.	.	.	none		0.517	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000383747.1	NM_173586	
NPAS4	266743	hgsc.bcm.edu	37	11	66190272	66190272	+	Silent	SNP	C	C	T	rs569596792		TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr11:66190272C>T	ENST00000311034.2	+	4	734	c.558C>T	c.(556-558)ccC>ccT	p.P186P		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	186					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CAGGAAATCCCGTGTTCACAG	0.637																																					p.P186P		Atlas-SNP	.											.	NPAS4	133	.	0			c.C558T						PASS	.						104.0	102.0	103.0					11																	66190272		2200	4295	6495	SO:0001819	synonymous_variant	266743	exon4			AAATCCCGTGTTC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.558C>T	chr11.hg19:g.66190272C>T		88.0	0.0	.		88.0	47.0	.	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	ENST00000311034.2	hg19	CCDS8138.1																																																																																			.	.	.	none		0.637	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
YAP1	10413	hgsc.bcm.edu	37	11	102033201	102033201	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr11:102033201C>T	ENST00000282441.5	+	3	975	c.587C>T	c.(586-588)aCa>aTa	p.T196I	YAP1_ENST00000524575.1_Missense_Mutation_p.T18I|YAP1_ENST00000531439.1_Missense_Mutation_p.T196I|YAP1_ENST00000345877.2_Missense_Mutation_p.T196I|YAP1_ENST00000526343.1_Missense_Mutation_p.T196I|YAP1_ENST00000537274.1_Missense_Mutation_p.T196I	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	196	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		ATCGATCAGACAACAACATGG	0.473																																					p.T196I	Colon(50;247 1103 7861 28956)	Atlas-SNP	.											.	YAP1	45	.	0			c.C587T						PASS	.						184.0	181.0	182.0					11																	102033201		2203	4299	6502	SO:0001583	missense	10413	exon3			ATCAGACAACAAC		CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.587C>T	chr11.hg19:g.102033201C>T	ENSP00000282441:p.Thr196Ile	67.0	0.0	.		88.0	37.0	.	NM_001130145	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Missense_Mutation	SNP	ENST00000282441.5	hg19	CCDS44716.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791911	0.50102	.	.	ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575	D;D;D;D;D;T	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;0.86	5.59	5.59	0.84812	WW/Rsp5/WWP (6);	0.000000	0.85682	D	0.000000	D	0.84483	0.5482	L	0.37750	1.13	0.80722	D	1	P;B;B;P;D	0.61080	0.915;0.151;0.167;0.822;0.989	P;B;B;P;P	0.53450	0.653;0.129;0.053;0.494;0.726	D	0.84620	0.0683	10	0.48119	T	0.1	.	19.5866	0.95492	0.0:1.0:0.0:0.0	.	111;196;196;196;196	F5GWC5;E9PRV2;P46937-2;P46937;P46937-3	.;.;.;YAP1_HUMAN;.	I	196;196;196;196;111;196;18	ENSP00000434134:T196I;ENSP00000282441:T196I;ENSP00000445635:T196I;ENSP00000331023:T196I;ENSP00000431574:T196I;ENSP00000435602:T18I	ENSP00000282441:T196I	T	+	2	0	YAP1	101538411	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.463000	0.73530	2.620000	0.88729	0.555000	0.69702	ACA	.	.	.	none		0.473	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394151.1	NM_006106	
SH2B3	10019	hgsc.bcm.edu	37	12	111885593	111885593	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr12:111885593G>A	ENST00000341259.2	+	7	1727	c.1370G>A	c.(1369-1371)cGg>cAg	p.R457Q	SH2B3_ENST00000538307.1_Missense_Mutation_p.R255Q	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	457	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	TGTGATGTCCGGCTCTCCAGC	0.632																																					p.R457Q		Atlas-SNP	.											.	SH2B3	62	.	0			c.G1370A						PASS	.						69.0	61.0	64.0					12																	111885593		2203	4300	6503	SO:0001583	missense	10019	exon7			ATGTCCGGCTCTC	AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1370G>A	chr12.hg19:g.111885593G>A	ENSP00000345492:p.Arg457Gln	89.0	0.0	.		82.0	43.0	.	NM_005475	B9EGG5|O95184	Missense_Mutation	SNP	ENST00000341259.2	hg19	CCDS9153.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577538	0.45902	.	.	ENSG00000111252	ENST00000341259;ENST00000551001;ENST00000538307	T;T	0.53857	0.6;0.6	4.96	3.81	0.43845	SH2 motif (1);	0.405045	0.26251	N	0.025457	T	0.26666	0.0652	N	0.08118	0	0.32839	D	0.505132	B;B;B	0.31351	0.123;0.222;0.32	B;B;B	0.28465	0.04;0.013;0.09	T	0.28618	-1.0038	10	0.26408	T	0.33	.	7.2579	0.26187	0.2705:0.0:0.7295:0.0	.	255;321;457	F5GYM4;Q59H48;Q9UQQ2	.;.;SH2B3_HUMAN	Q	457;267;255	ENSP00000345492:R457Q;ENSP00000440597:R255Q	ENSP00000345492:R457Q	R	+	2	0	SH2B3	110369976	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	3.131000	0.50515	2.474000	0.83562	0.462000	0.41574	CGG	.	.	.	none		0.632	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475	
HECTD4	283450	hgsc.bcm.edu	37	12	112607423	112607423	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr12:112607423G>C	ENST00000430131.2	-	69	11971	c.10826C>G	c.(10825-10827)gCt>gGt	p.A3609G	HECTD4_ENST00000550722.1_Missense_Mutation_p.A3885G|HECTD4_ENST00000377560.5_Missense_Mutation_p.A3859G			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3609					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CTGCCTGGCAGCCTGACAGAA	0.602																																					p.A3897G		Atlas-SNP	.											.	.	.	.	0			c.C11690G						PASS	.						46.0	53.0	50.0					12																	112607423		2042	4189	6231	SO:0001583	missense	283450	exon70			CTGGCAGCCTGAC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10826C>G	chr12.hg19:g.112607423G>C	ENSP00000404379:p.Ala3609Gly	46.0	0.0	.		48.0	24.0	.	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	G	33	5.232023	0.95207	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547085	T;T;T	0.50813	0.73;0.74;0.73	5.88	5.88	0.94601	.	.	.	.	.	T	0.58192	0.2105	N	0.24115	0.695	0.58432	D	0.999999	D	0.58970	0.984	D	0.68192	0.956	T	0.61197	-0.7111	9	0.87932	D	0	.	20.2207	0.98324	0.0:0.0:1.0:0.0	.	3609	Q9Y4D8	K0614_HUMAN	G	3859;3609;3885;74	ENSP00000366783:A3859G;ENSP00000404379:A3609G;ENSP00000449784:A3885G	ENSP00000366783:A3859G	A	-	2	0	C12orf51	111091806	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.240000	0.95396	2.790000	0.95986	0.591000	0.81541	GCT	.	.	.	none		0.602	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
LPAR6	10161	hgsc.bcm.edu	37	13	48985593	48985593	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr13:48985593C>T	ENST00000378434.4	-	7	2591	c.967G>A	c.(967-969)Gag>Aag	p.E323K	LPAR6_ENST00000345941.2_Missense_Mutation_p.E323K|RB1_ENST00000267163.4_Intron	NM_005767.5	NP_005758.2	P43657	LPAR6_HUMAN	lysophosphatidic acid receptor 6	323						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.0?(15)|p.?(4)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	14						ATAAAATTCTCTGCACCATGA	0.358																																					p.E323K		Atlas-SNP	.											.	LPAR6	38	.	19	Whole gene deletion(15)|Unknown(4)	bone(10)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.G967A						PASS	.						79.0	85.0	83.0					13																	48985593		2203	4300	6503	SO:0001583	missense	10161	exon5			AATTCTCTGCACC	AF000546	CCDS9410.1	13q14	2012-08-08	2009-06-23	2009-06-23	ENSG00000139679	ENSG00000139679		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	15520	protein-coding gene	gene with protein product		609239	"""purinergic receptor P2Y, G-protein coupled, 5"""	P2RY5		11004484, 9755289, 19386608	Standard	NM_005767		Approved	P2Y5	uc010acu.3	P43657	OTTHUMG00000016895	ENST00000378434.4:c.967G>A	chr13.hg19:g.48985593C>T	ENSP00000367691:p.Glu323Lys	145.0	0.0	.		151.0	53.0	.	NM_001162497	A4FTW9|B3KVF2|F2YGU4|O15133|Q3KPF5|Q53FA0|Q5VW44|Q7Z3S0|Q7Z3S6	Missense_Mutation	SNP	ENST00000378434.4	hg19	CCDS9410.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426889	0.43020	.	.	ENSG00000139679	ENST00000378434;ENST00000345941	T;T	0.63913	-0.07;-0.07	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.38772	0.1053	N	0.08118	0	0.49687	D	0.999819	P	0.34562	0.457	B	0.27608	0.081	T	0.44544	-0.9321	10	0.06236	T	0.91	.	19.6656	0.95891	0.0:1.0:0.0:0.0	.	323	P43657	LPAR6_HUMAN	K	323	ENSP00000367691:E323K;ENSP00000344353:E323K	ENSP00000344353:E323K	E	-	1	0	LPAR6	47883594	1.000000	0.71417	0.971000	0.41717	0.477000	0.33069	7.445000	0.80570	2.713000	0.92767	0.455000	0.32223	GAG	.	.	.	none		0.358	LPAR6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276280.2	NM_005767	
DZIP1	22873	hgsc.bcm.edu	37	13	96264392	96264392	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr13:96264392C>G	ENST00000376829.2	-	11	2064	c.1213G>C	c.(1213-1215)Gat>Cat	p.D405H	DZIP1_ENST00000361156.3_Missense_Mutation_p.D405H|DZIP1_ENST00000347108.3_Missense_Mutation_p.D405H|DZIP1_ENST00000361396.2_Missense_Mutation_p.D405H	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	405					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			tttagatcatctatcattgAG	0.393																																					p.D405H		Atlas-SNP	.											.	DZIP1	195	.	0			c.G1213C						PASS	.						132.0	127.0	129.0					13																	96264392		2203	4300	6503	SO:0001583	missense	22873	exon11			GATCATCTATCAT	AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.1213G>C	chr13.hg19:g.96264392C>G	ENSP00000366025:p.Asp405His	55.0	0.0	.		65.0	24.0	.	NM_014934	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	ENST00000376829.2	hg19	CCDS9478.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309415	0.60414	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.88	5.03	0.67393	.	0.467342	0.23349	N	0.049157	T	0.43743	0.1261	L	0.47716	1.5	0.28469	N	0.915509	D;P	0.53151	0.958;0.855	P;B	0.48627	0.584;0.38	T	0.43426	-0.9392	10	0.59425	D	0.04	-3.0786	11.3767	0.49733	0.0:0.914:0.0:0.086	.	405;405	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	H	405	ENSP00000257312:D405H;ENSP00000355018:D405H;ENSP00000355175:D405H;ENSP00000366025:D405H	ENSP00000257312:D405H	D	-	1	0	DZIP1	95062393	0.996000	0.38824	0.977000	0.42913	0.780000	0.44128	1.178000	0.31981	1.458000	0.47871	0.655000	0.94253	GAT	.	.	.	none		0.393	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
HIF1A	3091	hgsc.bcm.edu	37	14	62213681	62213681	+	Missense_Mutation	SNP	A	A	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr14:62213681A>G	ENST00000337138.4	+	15	2624	c.2359A>G	c.(2359-2361)Atg>Gtg	p.M787V	HIF1A-AS2_ENST00000554254.1_lincRNA|RP11-618G20.1_ENST00000555937.1_RNA|HIF1A_ENST00000394997.1_Missense_Mutation_p.M788V|HIF1A_ENST00000539097.1_Missense_Mutation_p.M811V|HIF1A_ENST00000323441.6_3'UTR|HIF1A_ENST00000557538.1_Missense_Mutation_p.M728V	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	787	CTAD.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	GGGGCAATCAATGGATGAAAG	0.378																																					p.M811V		Atlas-SNP	.											.	HIF1A	120	.	0			c.A2431G						PASS	.						176.0	166.0	169.0					14																	62213681		2203	4300	6503	SO:0001583	missense	3091	exon15			CAATCAATGGATG	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.2359A>G	chr14.hg19:g.62213681A>G	ENSP00000338018:p.Met787Val	100.0	0.0	.		125.0	61.0	.	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	hg19	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	A	7.232	0.599557	0.13939	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000557538;ENST00000539097	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.61	4.44	0.53790	HIF-1 alpha, transactivation domain, C-terminal (1);	0.904790	0.09913	N	0.739514	T	0.25827	0.0629	N	0.08118	0	0.33434	D	0.581479	B;B	0.16802	0.019;0.019	B;B	0.24701	0.055;0.055	T	0.28332	-1.0047	10	0.41790	T	0.15	.	8.144	0.31100	0.7257:0.1403:0.0:0.134	.	788;787	A8MYV6;Q16665	.;HIF1A_HUMAN	V	538;728;787;788;728;811	ENSP00000338018:M787V;ENSP00000378446:M788V;ENSP00000451696:M728V;ENSP00000437955:M811V	ENSP00000338018:M787V	M	+	1	0	HIF1A	61283434	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.513000	0.45494	1.028000	0.39785	0.533000	0.62120	ATG	.	.	.	none		0.378	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
TRPM7	54822	hgsc.bcm.edu	37	15	50866612	50866612	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr15:50866612T>C	ENST00000313478.7	-	36	5448	c.5167A>G	c.(5167-5169)Atg>Gtg	p.M1723V	TRPM7_ENST00000561443.1_5'UTR|TRPM7_ENST00000560955.1_Missense_Mutation_p.M1722V	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1723	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TCTCCAGTCATACATTCTTCC	0.348																																					p.M1723V		Atlas-SNP	.											TRPM7,colon,carcinoma,0,2	TRPM7	145	.	0			c.A5167G						PASS	.						60.0	57.0	58.0					15																	50866612		1807	4073	5880	SO:0001583	missense	54822	exon36			CAGTCATACATTC	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.5167A>G	chr15.hg19:g.50866612T>C	ENSP00000320239:p.Met1723Val	77.0	0.0	.		85.0	33.0	.	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.292013	0.40594	.	.	ENSG00000092439	ENST00000313478	T	0.13657	2.57	4.98	4.98	0.66077	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.044676	0.85682	D	0.000000	T	0.14614	0.0353	L	0.37630	1.12	0.45295	D	0.998291	B	0.30193	0.272	B	0.33196	0.159	T	0.04320	-1.0960	10	0.87932	D	0	-18.4568	14.8475	0.70270	0.0:0.0:0.0:1.0	.	1723	Q96QT4	TRPM7_HUMAN	V	1723	ENSP00000320239:M1723V	ENSP00000320239:M1723V	M	-	1	0	TRPM7	48653904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.942000	0.70203	2.074000	0.62210	0.528000	0.53228	ATG	.	.	.	none		0.348	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
TRPM7	54822	hgsc.bcm.edu	37	15	50904864	50904864	+	Missense_Mutation	SNP	C	C	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr15:50904864C>A	ENST00000313478.7	-	16	2214	c.1933G>T	c.(1933-1935)Ggt>Tgt	p.G645C	TRPM7_ENST00000560955.1_Missense_Mutation_p.G645C	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	645					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.G645C(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GATTCTTCACCATGTTGCCAT	0.413																																					p.G645C		Atlas-SNP	.											TRPM7,NS,carcinoma,0,1	TRPM7	145	.	1	Substitution - Missense(1)	lung(1)	c.G1933T						PASS	.						163.0	152.0	156.0					15																	50904864		1884	4115	5999	SO:0001583	missense	54822	exon16			CTTCACCATGTTG	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.1933G>T	chr15.hg19:g.50904864C>A	ENSP00000320239:p.Gly645Cys	129.0	0.0	.		109.0	50.0	.	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.878977	0.91740	.	.	ENSG00000092439	ENST00000313478	T	0.73681	-0.77	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.87406	0.6169	M	0.87381	2.88	0.80722	D	1	D	0.67145	0.996	P	0.61940	0.896	D	0.89507	0.3768	10	0.87932	D	0	-7.094	19.1653	0.93555	0.0:1.0:0.0:0.0	.	645	Q96QT4	TRPM7_HUMAN	C	645	ENSP00000320239:G645C	ENSP00000320239:G645C	G	-	1	0	TRPM7	48692156	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.730000	0.84881	2.603000	0.88011	0.585000	0.79938	GGT	.	.	.	none		0.413	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
SPPL2A	84888	hgsc.bcm.edu	37	15	51014331	51014331	+	Silent	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr15:51014331C>T	ENST00000261854.5	-	13	1591	c.1317G>A	c.(1315-1317)tcG>tcA	p.S439S	SPPL2A_ENST00000559293.1_5'Flank	NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	439					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		CAACTGTAGACGAAACATAGT	0.294																																					p.S439S	Melanoma(50;790 1209 4069 22965 33125)	Atlas-SNP	.											.	SPPL2A	26	.	0			c.G1317A						PASS	.						72.0	70.0	71.0					15																	51014331		2196	4294	6490	SO:0001819	synonymous_variant	84888	exon13			TGTAGACGAAACA		CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.1317G>A	chr15.hg19:g.51014331C>T		78.0	0.0	.		68.0	27.0	.	NM_032802	B2RDS0|Q8TAW1|Q96SZ8	Silent	SNP	ENST00000261854.5	hg19	CCDS10138.1																																																																																			.	.	.	none		0.294	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254543.3	NM_032802	
NEDD4	4734	hgsc.bcm.edu	37	15	56207684	56207684	+	Missense_Mutation	SNP	T	T	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr15:56207684T>C	ENST00000508342.1	-	1	1645	c.1346A>G	c.(1345-1347)aAc>aGc	p.N449S	NEDD4_ENST00000506154.1_Missense_Mutation_p.N449S|NEDD4_ENST00000338963.2_Missense_Mutation_p.N449S|NEDD4_ENST00000435532.3_Intron	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	449					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AATACCATGGTTTTTGTTCAT	0.378																																					p.N449S		Atlas-SNP	.											.	NEDD4	167	.	0			c.A1346G						PASS	.						121.0	120.0	120.0					15																	56207684		2193	4292	6485	SO:0001583	missense	4734	exon1			CCATGGTTTTTGT	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1346A>G	chr15.hg19:g.56207684T>C	ENSP00000424827:p.Asn449Ser	122.0	0.0	.		149.0	70.0	.	NM_198400	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000508342.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.169|0.169	-1.073075|-1.073075	0.01918|0.01918	.|.	.|.	ENSG00000069869|ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154|ENST00000508871	T;T;T|.	0.18174|.	2.24;2.23;2.24|.	5.46|5.46	-0.0555|-0.0555	0.13809|0.13809	.|.	.|.	.|.	.|.	.|.	T|T	0.36880|0.36880	0.0983|0.0983	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.06405|.	0.002;0.001;0.001|.	T|T	0.31641|0.31641	-0.9936|-0.9936	9|5	0.46703|.	T|.	0.11|.	.|.	6.7263|6.7263	0.23359|0.23359	0.0:0.28:0.1625:0.5575|0.0:0.28:0.1625:0.5575	.|.	449;449;449|.	P46934-2;P46934;P46934-3|.	.;NEDD4_HUMAN;.|.	S|A	449|57	ENSP00000424827:N449S;ENSP00000345530:N449S;ENSP00000422705:N449S|.	ENSP00000345530:N449S|.	N|T	-|-	2|1	0|0	NEDD4|NEDD4	53994976|53994976	0.533000|0.533000	0.26354|0.26354	0.362000|0.362000	0.25862|0.25862	0.881000|0.881000	0.50899|0.50899	-0.132000|-0.132000	0.10467|0.10467	0.072000|0.072000	0.16694|0.16694	0.377000|0.377000	0.23210|0.23210	AAC|ACC	.	.	.	none		0.378	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
HERC1	8925	hgsc.bcm.edu	37	15	63956789	63956789	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr15:63956789C>T	ENST00000443617.2	-	43	8647	c.8560G>A	c.(8560-8562)Gat>Aat	p.D2854N		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2854					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCCAAATTATCAGGGCTACAA	0.413																																					p.D2854N		Atlas-SNP	.											HERC1_ENST00000443617,right_upper_lobe,carcinoma,0,2	HERC1	624	.	0			c.G8560A						PASS	.						78.0	76.0	77.0					15																	63956789		1915	4128	6043	SO:0001583	missense	8925	exon43			AATTATCAGGGCT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8560G>A	chr15.hg19:g.63956789C>T	ENSP00000390158:p.Asp2854Asn	90.0	0.0	.		81.0	32.0	.	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578366	0.86645	.	.	ENSG00000103657	ENST00000443617	T	0.24151	1.87	5.79	5.79	0.91817	.	0.063428	0.64402	D	0.000010	T	0.21022	0.0506	N	0.22421	0.69	0.80722	D	1	P	0.34522	0.455	B	0.30105	0.111	T	0.02781	-1.1111	10	0.54805	T	0.06	.	20.024	0.97514	0.0:1.0:0.0:0.0	.	2854	Q15751	HERC1_HUMAN	N	2854	ENSP00000390158:D2854N	ENSP00000390158:D2854N	D	-	1	0	HERC1	61743842	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.638000	0.74309	2.718000	0.92993	0.655000	0.94253	GAT	.	.	.	none		0.413	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HERC1	8925	hgsc.bcm.edu	37	15	63958332	63958332	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr15:63958332C>T	ENST00000443617.2	-	42	8428	c.8341G>A	c.(8341-8343)Gat>Aat	p.D2781N		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2781					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTCTGGGCATCAGCCTCTCCC	0.502																																					p.D2781N		Atlas-SNP	.											.	HERC1	624	.	0			c.G8341A						PASS	.						32.0	33.0	33.0					15																	63958332		1999	4164	6163	SO:0001583	missense	8925	exon42			GGGCATCAGCCTC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8341G>A	chr15.hg19:g.63958332C>T	ENSP00000390158:p.Asp2781Asn	146.0	0.0	.		169.0	73.0	.	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.978618	0.92982	.	.	ENSG00000103657	ENST00000443617	T	0.36340	1.26	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.52661	0.1748	L	0.40543	1.245	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	T	0.34551	-0.9824	10	0.30078	T	0.28	.	19.8218	0.96599	0.0:1.0:0.0:0.0	.	2781	Q15751	HERC1_HUMAN	N	2781	ENSP00000390158:D2781N	ENSP00000390158:D2781N	D	-	1	0	HERC1	61745385	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.800000	0.85949	2.678000	0.91216	0.655000	0.94253	GAT	.	.	.	none		0.502	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
BCL2A1	597	hgsc.bcm.edu	37	15	80263200	80263200	+	Silent	SNP	T	T	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr15:80263200T>G	ENST00000267953.3	-	1	588	c.262A>C	c.(262-264)Aga>Cga	p.R88R	BCL2A1_ENST00000335661.6_Silent_p.R88R	NM_004049.3	NP_004040.1	Q16548	B2LA1_HUMAN	BCL2-related protein A1	88					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	12						GTTACAATTCTTCCCCAGTTA	0.393																																					p.R88R		Atlas-SNP	.											.	BCL2A1	28	.	0			c.A262C						PASS	.						206.0	195.0	199.0					15																	80263200		2203	4300	6503	SO:0001819	synonymous_variant	597	exon1			CAATTCTTCCCCA		CCDS10312.1, CCDS45322.1	15q24.3	2014-05-20			ENSG00000140379	ENSG00000140379			991	protein-coding gene	gene with protein product		601056		HBPA1		8589678, 12771180	Standard	NM_004049		Approved	GRS, BFL1, BCL2L5, ACC-1, ACC-2	uc002bfc.4	Q16548	OTTHUMG00000144173	ENST00000267953.3:c.262A>C	chr15.hg19:g.80263200T>G		187.0	0.0	.		166.0	11.0	.	NM_001114735	Q6FGZ4|Q6FH19|Q86W13|Q99524	Silent	SNP	ENST00000267953.3	hg19	CCDS10312.1																																																																																			.	.	.	none		0.393	BCL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291372.1	NM_004049	
ABCC12	94160	hgsc.bcm.edu	37	16	48180293	48180293	+	Nonsense_Mutation	SNP	G	G	A	rs561243035	byFrequency	TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr16:48180293G>A	ENST00000311303.3	-	1	388	c.43C>T	c.(43-45)Cga>Tga	p.R15*	ABCC12_ENST00000448542.1_Nonsense_Mutation_p.R15*|ABCC12_ENST00000416054.1_Nonsense_Mutation_p.R15*	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	15						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CGCCGGCCTCGCTGGTCCAGA	0.562													G|||	2	0.000399361	0.0	0.0	5008	,	,		20388	0.002		0.0	False		,,,				2504	0.0				p.R15X		Atlas-SNP	.											.	ABCC12	190	.	0			c.C43T						PASS	.						120.0	106.0	110.0					16																	48180293		2201	4300	6501	SO:0001587	stop_gained	94160	exon1			GGCCTCGCTGGTC	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.43C>T	chr16.hg19:g.48180293G>A	ENSP00000311030:p.Arg15*	79.0	0.0	.		85.0	35.0	.	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Nonsense_Mutation	SNP	ENST00000311303.3	hg19	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994178	0.74703	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054;ENST00000527640	.	.	.	5.55	-6.59	0.01830	.	0.286455	0.31484	N	0.007571	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	12.0598	0.53557	0.0767:0.0:0.1475:0.7758	.	.	.	.	X	15	.	ENSP00000311030:R15X	R	-	1	2	ABCC12	46737794	0.056000	0.20664	0.885000	0.34714	0.786000	0.44442	0.094000	0.15107	-0.795000	0.04462	-0.243000	0.11985	CGA	.	.	.	none		0.562	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
LLGL1	3996	hgsc.bcm.edu	37	17	18137219	18137219	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr17:18137219C>G	ENST00000316843.4	+	5	616	c.520C>G	c.(520-522)Cag>Gag	p.Q174E		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	174					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					GCTCGAGGGGCAGACGCTTGC	0.647																																					p.Q174E		Atlas-SNP	.											.	LLGL1	61	.	0			c.C520G						PASS	.						60.0	61.0	61.0					17																	18137219		2203	4300	6503	SO:0001583	missense	3996	exon5			GAGGGGCAGACGC		CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.520C>G	chr17.hg19:g.18137219C>G	ENSP00000321537:p.Gln174Glu	42.0	0.0	.		27.0	23.0	.	NM_004140	A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	ENST00000316843.4	hg19	CCDS32586.1	.	.	.	.	.	.	.	.	.	.	C	6.290	0.421674	0.11928	.	.	ENSG00000131899	ENST00000316843	T	0.04502	3.61	5.87	4.89	0.63831	WD40 repeat-like-containing domain (1);	0.513993	0.23041	N	0.052615	T	0.04770	0.0129	L	0.29908	0.895	0.29734	N	0.837684	B	0.18013	0.025	B	0.15870	0.014	T	0.17319	-1.0373	10	0.23891	T	0.37	-18.3441	13.5421	0.61681	0.3898:0.6102:0.0:0.0	.	174	Q15334	L2GL1_HUMAN	E	174	ENSP00000321537:Q174E	ENSP00000321537:Q174E	Q	+	1	0	LLGL1	18077944	0.397000	0.25270	0.996000	0.52242	0.797000	0.45037	0.360000	0.20250	1.470000	0.48102	0.650000	0.86243	CAG	.	.	.	none		0.647	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132067.3		
HOXB2	3212	hgsc.bcm.edu	37	17	46622084	46622084	+	Nonsense_Mutation	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr17:46622084G>A	ENST00000330070.4	-	1	1357	c.190C>T	c.(190-192)Cag>Tag	p.Q64*	HOXB-AS1_ENST00000435312.1_RNA|HOXB2_ENST00000504772.3_5'Flank|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000502764.2_RNA|HOXB-AS1_ENST00000504972.3_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	64					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						CTGGGTCTCTGAAGGGTGGAG	0.637																																					p.Q64X		Atlas-SNP	.											.	HOXB2	23	.	0			c.C190T						PASS	.						24.0	32.0	29.0					17																	46622084		2202	4300	6502	SO:0001587	stop_gained	3212	exon1			GTCTCTGAAGGGT		CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.190C>T	chr17.hg19:g.46622084G>A	ENSP00000331741:p.Gln64*	121.0	0.0	.		161.0	105.0	.	NM_002145	P10913|P17485	Nonsense_Mutation	SNP	ENST00000330070.4	hg19	CCDS11527.1	.	.	.	.	.	.	.	.	.	.	G	47	13.489855	0.99745	.	.	ENSG00000173917	ENST00000330070	.	.	.	5.05	5.05	0.67936	.	0.154045	0.46442	D	0.000285	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	17.3735	0.87385	0.0:0.0:1.0:0.0	.	.	.	.	X	64	.	ENSP00000331741:Q64X	Q	-	1	0	HOXB2	43977083	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.950000	0.56676	2.629000	0.89072	0.650000	0.86243	CAG	.	.	.	none		0.637	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358384.2		
UBE2O	63893	hgsc.bcm.edu	37	17	74393911	74393911	+	Missense_Mutation	SNP	G	G	C			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr17:74393911G>C	ENST00000319380.7	-	13	2148	c.2084C>G	c.(2083-2085)gCt>gGt	p.A695G	UBE2O_ENST00000587581.1_5'UTR	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	695					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						TGAGTTGTCAGCCCACACCAC	0.642											OREG0024751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A695G		Atlas-SNP	.											.	UBE2O	207	.	0			c.C2084G						PASS	.						137.0	126.0	130.0					17																	74393911		2203	4300	6503	SO:0001583	missense	63893	exon13			TTGTCAGCCCACA	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.2084C>G	chr17.hg19:g.74393911G>C	ENSP00000323687:p.Ala695Gly	79.0	0.0	.	1152	80.0	27.0	.	NM_022066	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	ENST00000319380.7	hg19	CCDS32742.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497940	0.85069	.	.	ENSG00000175931	ENST00000319380	T	0.75477	-0.94	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.83954	0.5366	M	0.70595	2.14	0.50813	D	0.999893	D	0.67145	0.996	P	0.58266	0.836	D	0.83575	0.0114	10	0.46703	T	0.11	-10.7482	19.7404	0.96228	0.0:0.0:1.0:0.0	.	695	Q9C0C9	UBE2O_HUMAN	G	695	ENSP00000323687:A695G	ENSP00000323687:A695G	A	-	2	0	UBE2O	71905506	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.906000	0.87423	2.661000	0.90470	0.650000	0.86243	GCT	.	.	.	none		0.642	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066	
SETBP1	26040	hgsc.bcm.edu	37	18	42531807	42531807	+	Silent	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr18:42531807G>A	ENST00000282030.5	+	4	2798	c.2502G>A	c.(2500-2502)ctG>ctA	p.L834L		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	834						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CACCCAGACTGATGGCCAACT	0.537									Schinzel-Giedion syndrome																												p.L834L		Atlas-SNP	.											.	SETBP1	577	.	0			c.G2502A						PASS	.						95.0	73.0	80.0					18																	42531807		2203	4300	6503	SO:0001819	synonymous_variant	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	CAGACTGATGGCC	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2502G>A	chr18.hg19:g.42531807G>A		62.0	0.0	.		55.0	24.0	.	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	hg19	CCDS11923.2																																																																																			.	.	.	none		0.537	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
ANKRD27	84079	hgsc.bcm.edu	37	19	33119054	33119054	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr19:33119054G>A	ENST00000306065.4	-	15	1513	c.1355C>T	c.(1354-1356)tCa>tTa	p.S452L		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	452					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					AGTGACAACTGAGGGATCATT	0.542																																					p.S452L		Atlas-SNP	.											.	ANKRD27	86	.	0			c.C1355T						PASS	.						117.0	112.0	114.0					19																	33119054		2203	4300	6503	SO:0001583	missense	84079	exon15			ACAACTGAGGGAT	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1355C>T	chr19.hg19:g.33119054G>A	ENSP00000304292:p.Ser452Leu	84.0	0.0	.		89.0	41.0	.	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	hg19	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677180	0.88445	.	.	ENSG00000105186	ENST00000306065	T	0.65916	-0.18	5.37	5.37	0.77165	Ankyrin repeat-containing domain (1);	0.000000	0.50627	D	0.000113	T	0.69441	0.3111	L	0.31120	0.905	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.65529	-0.6146	10	0.26408	T	0.33	-14.3157	19.1028	0.93281	0.0:0.0:1.0:0.0	.	452	Q96NW4	ANR27_HUMAN	L	452	ENSP00000304292:S452L	ENSP00000304292:S452L	S	-	2	0	ANKRD27	37810894	1.000000	0.71417	0.242000	0.24170	0.787000	0.44495	8.928000	0.92853	2.511000	0.84671	0.655000	0.94253	TCA	.	.	.	none		0.542	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
FKBP1A	2280	hgsc.bcm.edu	37	20	1352846	1352846	+	Silent	SNP	T	T	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr20:1352846T>G	ENST00000400137.4	-	4	400	c.237A>C	c.(235-237)ccA>ccC	p.P79P	SDCBP2-AS1_ENST00000609285.1_RNA|SDCBP2-AS1_ENST00000609470.1_RNA|FKBP1A_ENST00000381724.3_Silent_p.P74P|FKBP1A_ENST00000460490.1_5'Flank|FKBP1A_ENST00000381719.3_Silent_p.P79P|FKBP1A_ENST00000381715.1_Silent_p.P74P|SDCBP2-AS1_ENST00000446423.1_RNA|FKBP1A_ENST00000439640.2_Silent_p.P63P	NM_000801.4	NP_000792.1	P62942	FKB1A_HUMAN	FK506 binding protein 1A, 12kDa	79	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				'de novo' protein folding (GO:0006458)|amyloid fibril formation (GO:1990000)|calcium ion transmembrane transport (GO:0070588)|chaperone-mediated protein folding (GO:0061077)|extracellular fibril organization (GO:0043206)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|protein peptidyl-prolyl isomerization (GO:0000413)|protein refolding (GO:0042026)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of amyloid precursor protein catabolic process (GO:1902991)|regulation of immune response (GO:0050776)|regulation of protein localization (GO:0032880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|SMAD protein complex assembly (GO:0007183)|T cell activation (GO:0042110)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|terminal cisterna (GO:0014802)|Z disc (GO:0030018)	activin binding (GO:0048185)|FK506 binding (GO:0005528)|ion channel binding (GO:0044325)|macrolide binding (GO:0005527)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|type I transforming growth factor beta receptor binding (GO:0034713)			central_nervous_system(1)|lung(1)|upper_aerodigestive_tract(1)	3					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	AGGCATAATCTGGAGATATAG	0.498																																					p.P79P		Atlas-SNP	.											.	FKBP1A	6	.	0			c.A237C						PASS	.						72.0	62.0	66.0					20																	1352846		2203	4298	6501	SO:0001819	synonymous_variant	2280	exon4			ATAATCTGGAGAT	M92423	CCDS13014.1, CCDS74688.1	20p13	2013-03-20	2002-08-29		ENSG00000088832	ENSG00000088832			3711	protein-coding gene	gene with protein product	"""calstabin 1"""	186945	"""FK506-binding protein 1A (12kD)"""	FKBP1		1930186	Standard	NM_000801		Approved	FKBP-12, FKBP12, PKC12, PPIASE, FKBP12C	uc002wey.3	P62942	OTTHUMG00000031666	ENST00000400137.4:c.237A>C	chr20.hg19:g.1352846T>G		177.0	0.0	.		286.0	170.0	.	NM_054014	D3DVW6|P20071|Q4VC47|Q6FGD9|Q6LEU3|Q9H103|Q9H566	Silent	SNP	ENST00000400137.4	hg19	CCDS13014.1																																																																																			.	.	.	none		0.498	FKBP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077534.2		
CEP250	11190	hgsc.bcm.edu	37	20	34099427	34099427	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr20:34099427C>T	ENST00000397527.1	+	35	8021	c.7301C>T	c.(7300-7302)cCc>cTc	p.P2434L	CEP250_ENST00000342580.4_Missense_Mutation_p.P2378L	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2434					centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CACCCCAGCCCCAGCACTACC	0.627																																					p.P2434L		Atlas-SNP	.											.	CEP250	141	.	0			c.C7301T						PASS	.						38.0	39.0	39.0					20																	34099427		2203	4300	6503	SO:0001583	missense	11190	exon35			CCAGCCCCAGCAC	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.7301C>T	chr20.hg19:g.34099427C>T	ENSP00000380661:p.Pro2434Leu	100.0	0.0	.		119.0	72.0	.	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	hg19	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494922	0.44352	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.48836	2.76;2.74;0.8	4.65	2.7	0.31948	.	0.277119	0.25890	N	0.027635	T	0.29882	0.0747	L	0.38838	1.175	0.31610	N	0.651583	B	0.02656	0.0	B	0.06405	0.002	T	0.17531	-1.0366	10	0.20046	T	0.44	.	3.6764	0.08294	0.1943:0.5961:0.0:0.2096	.	2434	Q9BV73	CP250_HUMAN	L	2434;2378;869	ENSP00000380661:P2434L;ENSP00000341541:P2378L;ENSP00000395992:P869L	ENSP00000341541:P2378L	P	+	2	0	CEP250	33562841	0.729000	0.28090	0.775000	0.31657	0.850000	0.48378	1.914000	0.39966	0.561000	0.29186	0.561000	0.74099	CCC	.	.	.	none		0.627	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
LAMA5	3911	hgsc.bcm.edu	37	20	60906117	60906117	+	Silent	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr20:60906117G>A	ENST00000252999.3	-	29	3687	c.3621C>T	c.(3619-3621)atC>atT	p.I1207I	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1207	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.I1207I(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CGTGGCTGCTGATGCAGCTGA	0.692																																					p.I1207I		Atlas-SNP	.											LAMA5,NS,carcinoma,-2,1	LAMA5	268	.	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C3621T						PASS	.						22.0	25.0	24.0					20																	60906117		2197	4298	6495	SO:0001819	synonymous_variant	3911	exon29			GCTGCTGATGCAG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.3621C>T	chr20.hg19:g.60906117G>A		184.0	0.0	.		241.0	166.0	.	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	hg19	CCDS33502.1																																																																																			.	.	.	none		0.692	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
SLC37A1	54020	hgsc.bcm.edu	37	21	43979172	43979172	+	Missense_Mutation	SNP	C	C	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr21:43979172C>G	ENST00000352133.2	+	11	1936	c.954C>G	c.(952-954)atC>atG	p.I318M	AP001625.6_ENST00000442605.1_RNA|SLC37A1_ENST00000398341.3_Missense_Mutation_p.I318M			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	318					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						CGGCCGCCATCAGCTTCACAG	0.592																																					p.I318M		Atlas-SNP	.											.	SLC37A1	48	.	0			c.C954G						PASS	.						45.0	45.0	45.0					21																	43979172		2203	4300	6503	SO:0001583	missense	54020	exon12			CGCCATCAGCTTC	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.954C>G	chr21.hg19:g.43979172C>G	ENSP00000344648:p.Ile318Met	82.0	0.0	.		97.0	45.0	.	NM_018964	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	hg19	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.543831	0.45280	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.59364	0.27;0.27	5.7	5.7	0.88788	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.054132	0.64402	D	0.000001	T	0.79724	0.4495	M	0.91818	3.245	0.58432	D	0.999993	D	0.76494	0.999	D	0.75484	0.986	D	0.83363	0.0003	10	0.72032	D	0.01	-27.3918	12.3411	0.55095	0.1685:0.8315:0.0:0.0	.	318	P57057	GLPT_HUMAN	M	318	ENSP00000381383:I318M;ENSP00000344648:I318M	ENSP00000344648:I318M	I	+	3	3	SLC37A1	42852241	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	2.026000	0.41069	2.688000	0.91661	0.655000	0.94253	ATC	.	.	.	none		0.592	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1		
LIF	3976	hgsc.bcm.edu	37	22	30639798	30639798	+	Missense_Mutation	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr22:30639798C>T	ENST00000249075.3	-	3	606	c.451G>A	c.(451-453)Gtg>Atg	p.V151M	RP1-102K2.8_ENST00000608354.1_RNA|LIF_ENST00000403987.3_3'UTR|RP1-102K2.8_ENST00000593843.1_RNA	NM_002309.4	NP_002300.1	P15018	LIF_HUMAN	leukemia inhibitory factor	151					blood vessel remodeling (GO:0001974)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|immune response (GO:0006955)|leukemia inhibitory factor signaling pathway (GO:0048861)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|multicellular organismal development (GO:0007275)|muscle organ morphogenesis (GO:0048644)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|neuron development (GO:0048666)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cell proliferation (GO:0008284)|positive regulation of histone H3-K27 acetylation (GO:1901676)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|spongiotrophoblast differentiation (GO:0060708)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|leukemia inhibitory factor receptor binding (GO:0005146)|receptor binding (GO:0005102)|RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001135)			breast(1)|lung(3)|skin(3)	7			Epithelial(10;0.171)			CGGCACAGCACGTTGCTAAGG	0.612																																					p.V151M		Atlas-SNP	.											LIF,NS,carcinoma,0,1	LIF	18	.	0			c.G451A						PASS	.						202.0	172.0	182.0					22																	30639798		2203	4300	6503	SO:0001583	missense	3976	exon3			ACAGCACGTTGCT		CCDS13872.1, CCDS58799.1	22q12.2	2012-02-09	2012-02-09		ENSG00000128342	ENSG00000128342			6596	protein-coding gene	gene with protein product	"""differentiation inhibitory activity"", ""differentiation-inducing factor"", ""hepatocyte-stimulating factor III"", ""cholinergic differentiation factor"", ""human interleukin in DA cells"""	159540				1714745, 8058719	Standard	NM_002309		Approved	CDF, DIA, HILDA	uc003agz.3	P15018	OTTHUMG00000150910	ENST00000249075.3:c.451G>A	chr22.hg19:g.30639798C>T	ENSP00000249075:p.Val151Met	107.0	0.0	.		91.0	27.0	.	NM_002309	B2RCW7|B5MC23|Q52LZ2	Missense_Mutation	SNP	ENST00000249075.3	hg19	CCDS13872.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.886813	0.72410	.	.	ENSG00000128342	ENST00000249075	T	0.80304	-1.36	4.99	3.93	0.45458	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.095837	0.44688	D	0.000429	D	0.85999	0.5828	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86414	0.1750	10	0.66056	D	0.02	-23.106	10.622	0.45484	0.0:0.6769:0.3231:0.0	.	151	P15018	LIF_HUMAN	M	151	ENSP00000249075:V151M	ENSP00000249075:V151M	V	-	1	0	LIF	28969798	0.967000	0.33354	0.998000	0.56505	0.932000	0.56968	1.735000	0.38176	2.294000	0.77228	0.561000	0.74099	GTG	.	.	.	none		0.612	LIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320508.1	NM_002309	
APEX2	27301	hgsc.bcm.edu	37	X	55033281	55033281	+	Silent	SNP	C	C	T			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chrX:55033281C>T	ENST00000374987.3	+	6	1036	c.970C>T	c.(970-972)Ctg>Ttg	p.L324L	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	324					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						GTGCCCACCTCTGTGCACCCG	0.577								Other BER factors																													p.L324L		Atlas-SNP	.											.	APEX2	50	.	0			c.C970T						PASS	.						55.0	47.0	49.0					X																	55033281		2203	4300	6503	SO:0001819	synonymous_variant	27301	exon6			CCACCTCTGTGCA	AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.970C>T	chrX.hg19:g.55033281C>T		76.0	0.0	.		62.0	57.0	.	NM_014481	Q9Y5X7	Silent	SNP	ENST00000374987.3	hg19	CCDS14365.1																																																																																			.	.	.	none		0.577	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056845.1		
ZMYM3	9203	hgsc.bcm.edu	37	X	70472979	70472979	+	Nonsense_Mutation	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chrX:70472979G>A	ENST00000353904.2	-	2	314	c.127C>T	c.(127-129)Cga>Tga	p.R43*	ZMYM3_ENST00000373988.1_Nonsense_Mutation_p.R43*|ZMYM3_ENST00000314425.5_Nonsense_Mutation_p.R43*|ZMYM3_ENST00000373978.1_Nonsense_Mutation_p.R43*|ZMYM3_ENST00000373981.1_Nonsense_Mutation_p.R43*|ZMYM3_ENST00000373998.1_Nonsense_Mutation_p.R43*|ZMYM3_ENST00000373982.1_Nonsense_Mutation_p.R43*|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373984.3_Nonsense_Mutation_p.R43*	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	43					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					GCCCATCCTCGAGTTGGGGCA	0.592											OREG0019858	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R43X		Atlas-SNP	.											.	ZMYM3	137	.	0			c.C127T						PASS	.						13.0	15.0	15.0					X																	70472979		2155	4235	6390	SO:0001587	stop_gained	9203	exon2			ATCCTCGAGTTGG	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.127C>T	chrX.hg19:g.70472979G>A	ENSP00000343909:p.Arg43*	276.0	2.0	.	1122	224.0	207.0	.	NM_005096	D3DVV3|O15089|Q96E26	Nonsense_Mutation	SNP	ENST00000353904.2	hg19	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	g	36	5.732897	0.96856	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	.	.	.	4.64	4.64	0.57946	.	0.369189	0.19624	N	0.109848	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5077	15.0413	0.71793	0.0:0.0:1.0:0.0	.	.	.	.	X	43	.	ENSP00000322845:R43X	R	-	1	2	ZMYM3	70389704	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	4.218000	0.58554	1.898000	0.54952	0.287000	0.19450	CGA	.	.	.	none		0.592	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057154.1	NM_201599	
MT-ND1	4535	hgsc.bcm.edu	37	M	3860	3860	+	Silent	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chrM:3860G>A	ENST00000361390.2	+	1	554	c.554G>A	c.(553-555)tGa>tAa	p.*185*	MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	185					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GGCCATAATATGATTTATCTC	0.483																																					p.W185X		Atlas-SNP	.											.	.	.	.	0			c.G554A						PASS	.																																			SO:0001819	synonymous_variant	10625	exon1			TAATATGATTTAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.554G>A	chrM.hg19:g.3860G>A		13.0	0.0	.		24.0	7.0	.	ENST00000361390	C0JKH6|Q37523	Nonsense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.	.	none		0.483	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-ND4	4538	hgsc.bcm.edu	37	M	11168	11168	+	Missense_Mutation	SNP	G	G	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chrM:11168G>A	ENST00000361381.2	+	1	409	c.409G>A	c.(409-411)Ggc>Agc	p.G137S	MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	137					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						TCACCCGATGAGGCAACCAGC	0.438																																					p.G137S		Atlas-SNP	.											.	.	.	.	0			c.G409A						PASS	.																																			SO:0001583	missense	0	exon1			CGATGAGGCAACC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.409G>A	chrM.hg19:g.11168G>A	ENSP00000354961:p.Gly137Ser	23.0	0.0	.		26.0	9.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	G|0.004;A|0.996	0.996	weak		0.438	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
KDM6A	7403	hgsc.bcm.edu	37	X	44970638	44970638	+	Frame_Shift_Del	DEL	A	A	-			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chrX:44970638delA	ENST00000377967.4	+	29	4229	c.4188delA	c.(4186-4188)ttafs	p.L1396fs	KDM6A_ENST00000382899.4_Frame_Shift_Del_p.L1403fs|KDM6A_ENST00000536777.1_Frame_Shift_Del_p.L1351fs|KDM6A_ENST00000543216.1_Frame_Shift_Del_p.L1317fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1396					canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						CTCCTCCATTACCATCCGCCT	0.373			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.L1396fs	Colon(129;1273 1667 15230 27352 52914)	Atlas-Indel,Pindel	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)	c.4187delT						PASS	.						178.0	147.0	158.0					X																	44970638		2203	4300	6503	SO:0001589	frameshift_variant	7403	exon29			.	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.4188delA	chrX.hg19:g.44970638delA	ENSP00000367203:p.Leu1396fs	38.0	0.0	0		47.0	43.0	0.914894	NM_021140	Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	hg19	CCDS14265.1																																																																																			.	.	.	none		0.373	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
KLC2	64837	hgsc.bcm.edu	37	11	66026154	66026155	+	Frame_Shift_Del	DEL	CT	CT	-	rs546719017		TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr11:66026154_66026155delCT	ENST00000417856.1	+	2	332_333	c.89_90delCT	c.(88-90)actfs	p.T30fs	KLC2_ENST00000421552.1_Frame_Shift_Del_p.T30fs|KLC2_ENST00000394067.2_Frame_Shift_Del_p.T30fs|KLC2_ENST00000394065.2_5'Flank|KLC2_ENST00000316924.5_Frame_Shift_Del_p.T30fs|RP11-755F10.3_ENST00000533576.1_RNA|KLC2_ENST00000394066.2_Frame_Shift_Del_p.T30fs|KLC2_ENST00000394078.1_Frame_Shift_Del_p.T30fs	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	30					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						GGACTGGAGACTCTGCGTGGGG	0.653											OREG0021097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.30_30del		Atlas-Indel,Pindel	.											.	KLC2	50	.	0			c.88_89del						PASS	.																																			SO:0001589	frameshift_variant	64837	exon2			.	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.89_90delCT	chr11.hg19:g.66026156_66026157delCT	ENSP00000399403:p.Thr30fs	103.0	0.0	0	1088	103.0	50.0	0.485437	NM_001134774	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Frame_Shift_Del	DEL	ENST00000417856.1	hg19	CCDS8130.1																																																																																			.	.	.	none		0.653	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1	NM_022822	
SIX1	6495	hgsc.bcm.edu	37	14	61115779	61115780	+	Frame_Shift_Ins	INS	-	-	A			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr14:61115779_61115780insA	ENST00000247182.6	-	1	400_401	c.128_129insT	c.(127-129)ctgfs	p.L43fs	SIX1_ENST00000554986.1_Intron	NM_005982.3	NP_005973.1	Q15475	SIX1_HUMAN	SIX homeobox 1	43					aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|branching involved in ureteric bud morphogenesis (GO:0001658)|cochlea morphogenesis (GO:0090103)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial cell differentiation (GO:0030855)|facial nerve morphogenesis (GO:0021610)|generation of neurons (GO:0048699)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesonephric tubule formation (GO:0072172)|metanephric mesenchyme development (GO:0072075)|middle ear morphogenesis (GO:0042474)|myoblast migration (GO:0051451)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|organ induction (GO:0001759)|otic vesicle development (GO:0071599)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|protein localization to nucleus (GO:0034504)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of neuron differentiation (GO:0045664)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		CGTTCTTGTGCAGGTGGTCGCA	0.634																																					p.L43fs		Atlas-Indel,Pindel	.											.	SIX1	40	.	0			c.129_130insT						PASS	.																																			SO:0001589	frameshift_variant	6495	exon1			.	X91868	CCDS9748.1	14q23.1	2011-06-20	2007-07-13		ENSG00000126778	ENSG00000126778		"""Homeoboxes / SINE class"""	10887	protein-coding gene	gene with protein product		601205	"""sine oculis homeobox (Drosophila) homolog 1"", ""sine oculis homeobox homolog 1 (Drosophila)"", ""deafness, autosomal dominant 23"""	DFNA23		8617500, 15141091	Standard	NM_005982		Approved		uc001xfb.4	Q15475	OTTHUMG00000140334	ENST00000247182.6:c.129dupT	chr14.hg19:g.61115780_61115780dupA	ENSP00000247182:p.Leu43fs	100.0	0.0	0		79.0	33.0	0.417722	NM_005982	Q53Y16|Q96H64	Frame_Shift_Ins	INS	ENST00000247182.6	hg19	CCDS9748.1																																																																																			.	.	.	none		0.634	SIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276951.3		
EP300	2033	hgsc.bcm.edu	37	22	41553171	41553201	+	Splice_Site	DEL	GAGTAATGTTTGATGTCACTTGTCTTTCTAG	GAGTAATGTTTGATGTCACTTGTCTTTCTAG	-			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	GAGTAATGTTTGATGTCACTTGTCTTTCTAG	GAGTAATGTTTGATGTCACTTGTCTTTCTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr22:41553171_41553201delGAGTAATGTTTGATGTCACTTGTCTTTCTAG	ENST00000263253.7	+	18	4480_4509	c.3261_3290delGAGTAATGTTTGATGTCACTTGTCTTTCTAG	c.(3259-3291)ccgagtaatgtttgatgtcacttgtctttctag>ccg	p.SNV*CHLSF*1088fs		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1088	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.F1090L(1)|p.S1095I(1)|p.?(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TTGTCTTTCTAGGATTACTTTGATATTGTGAAGAGCCCCATGGATCTTTCT	0.385			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												.		Atlas-Indel,Pindel	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	3	Substitution - Missense(2)|Unknown(1)	urinary_tract(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	.						PASS	.																																			SO:0001630	splice_region_variant	2033	.	Familial Cancer Database	Broad Thumb-Hallux syndrome	.	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3262-1GAGTAATGTTTGATGTCACTTGTCTTTCTAG>-	chr22.hg19:g.41553171_41553201delGAGTAATGTTTGATGTCACTTGTCTTTCTAG		94.0	0.0	0		91.0	27.0	0.296703	.	B1AKC2	Splice_Site	DEL	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.385	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	Frame_Shift_Del
GGT7	2686	hgsc.bcm.edu	37	20	33447370	33447371	+	Frame_Shift_Ins	INS	-	-	G			TCGA-J7-A8I2-01A-12D-A35Z-10	TCGA-J7-A8I2-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9aace64d-14b2-435a-ab63-3891e2ae6bca	643d9c03-6b50-48da-aab4-0d369ca2392c	g.chr20:33447370_33447371insG	ENST00000336431.5	-	7	933_934	c.889_890insC	c.(889-891)cgcfs	p.R297fs		NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	297					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.R297H(1)		NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						TAGTGGCGGGCGGCCCGATGGC	0.688																																					p.R297fs		Atlas-INDEL	.											GGT7,NS,carcinoma,0,1	GGT7	41	.	1	Substitution - Missense(1)	lung(1)	c.890_891insC						PASS	.																																			SO:0001589	frameshift_variant	2686	exon7			.	AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.890dupC	chr20.hg19:g.33447372_33447372dupG	ENSP00000338964:p.Arg297fs	96.0	0.0	0		123.0	10.0	0.0813008	NM_178026	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Frame_Shift_Ins	INS	ENST00000336431.5	hg19	CCDS13242.2																																																																																			.	.	.	none		0.688	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2	NM_178026	
