#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MRGPRX3	117195	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	18159150	18159150	+	Missense_Mutation	SNP	G	G	A	rs139790666	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr11:18159150G>A	ENST00000396275.2	+	3	762	c.401G>A	c.(400-402)cGc>cAc	p.R134H		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CACTGCCGCCGCCCCAGATAC	0.572													g|||	2	0.000399361	0.0	0.0	5008	,	,		19932	0.0		0.002	False		,,,				2504	0.0					.											0								G	HIS/ARG	1,4399	2.1+/-5.4	0,1,2199	118.0	111.0	113.0		401	-2.9	0.0	11	dbSNP_134	113	4,8582	3.7+/-12.6	0,4,4289	yes	missense	MRGPRX3	NM_054031.3	29	0,5,6488	AA,AG,GG		0.0466,0.0227,0.0385	probably-damaging	134/323	18159150	5,12981	2200	4293	6493	SO:0001583	missense	117195				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.401G>A	11.37:g.18159150G>A	ENSP00000379571:p.Arg134His		B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	ENST00000396275.2	37	CCDS7830.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	13.44	2.237392	0.39498	2.27E-4	4.66E-4	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.39787	1.06;1.06	1.46	-2.9	0.05648	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	T	0.58293	0.2112	M	0.90252	3.1	0.09310	N	0.999997	D	0.55800	0.973	P	0.60068	0.868	T	0.54649	-0.8262	10	0.62326	D	0.03	.	7.087	0.25264	0.3591:0.0:0.6409:0.0	.	134	Q96LB0	MRGX3_HUMAN	H	134	ENSP00000379571:R134H;ENSP00000436242:R134H	ENSP00000379571:R134H	R	+	2	0	MRGPRX3	18115726	0.029000	0.19370	0.002000	0.10522	0.003000	0.03518	2.129000	0.42055	-0.874000	0.04027	-1.179000	0.01719	CGC		0.572	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031	
NCAPD3	23310	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	134073605	134073605	+	Missense_Mutation	SNP	C	C	T	rs146266771	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr11:134073605C>T	ENST00000534548.2	-	11	1476	c.1412G>A	c.(1411-1413)tGt>tAt	p.C471Y		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	471					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CAACTCCAGACAGTGTGCAAA	0.488																																						.											0													62.0	61.0	62.0					11																	134073605		2201	4297	6498	SO:0001583	missense	23310			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1412G>A	11.37:g.134073605C>T	ENSP00000433681:p.Cys471Tyr		A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.369032	0.61624	.	.	ENSG00000151503	ENST00000534548	T	0.65178	-0.14	5.88	4.96	0.65561	Armadillo-like helical (1);Armadillo-type fold (1);	0.085655	0.85682	D	0.000000	T	0.70228	0.3200	M	0.76328	2.33	0.80722	D	1	D	0.59357	0.985	P	0.49528	0.614	T	0.72290	-0.4337	10	0.37606	T	0.19	-15.444	17.0555	0.86532	0.0:0.873:0.127:0.0	.	471	P42695	CNDD3_HUMAN	Y	471	ENSP00000433681:C471Y	ENSP00000431612:C471Y	C	-	2	0	NCAPD3	133578815	1.000000	0.71417	0.737000	0.30932	0.704000	0.40688	6.297000	0.72757	1.461000	0.47929	0.655000	0.94253	TGT		0.488	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
MROH9	80133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	170993854	170993854	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr1:170993854A>T	ENST00000367759.4	+	19	2280	c.2126A>T	c.(2125-2127)aAa>aTa	p.K709I		NM_001163629.1	NP_001157101.1	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	0																	CGTTTGCTCAAAGATGAAAAT	0.353																																						.											0													67.0	59.0	61.0					1																	170993854		692	1591	2283	SO:0001583	missense	80133			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367759.4:c.2126A>T	1.37:g.170993854A>T	ENSP00000356733:p.Lys709Ile		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367759.4	37	CCDS53429.1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.885530	0.51908	.	.	ENSG00000117501	ENST00000367759	T	0.67865	-0.29	5.51	0.0654	0.14356	.	.	.	.	.	T	0.22205	0.0535	L	0.27053	0.805	0.09310	N	1	P	0.41524	0.753	B	0.37304	0.246	T	0.07947	-1.0746	9	0.20519	T	0.43	.	2.082	0.03637	0.4381:0.3205:0.0867:0.1547	.	709	F5GWX6	.	I	709	ENSP00000356733:K709I	ENSP00000356733:K709I	K	+	2	0	C1orf129	169260478	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	0.386000	0.20702	0.100000	0.17581	0.533000	0.62120	AAA		0.353	MROH9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_025063	
CACNA1C	775	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	2783696	2783696	+	Silent	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr12:2783696C>T	ENST00000344100.3	+	39	4839	c.4839C>T	c.(4837-4839)ttC>ttT	p.F1613F	CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000399644.1_Intron|CACNA1C_ENST00000399641.1_Intron|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000402845.3_Silent_p.F1591F|CACNA1C_ENST00000347598.4_Intron|CACNA1C_ENST00000399606.1_Intron|CACNA1C_ENST00000399595.1_Silent_p.F1580F|CACNA1C_ENST00000399637.1_Silent_p.F1591F|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000399591.1_Silent_p.F1580F|CACNA1C_ENST00000399601.1_Intron|CACNA1C_ENST00000327702.7_Intron|CACNA1C_ENST00000399621.1_Silent_p.F1591F|CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000399649.1_Silent_p.F1578F|CACNA1C_ENST00000399638.1_Intron|CACNA1C_ENST00000399629.1_Intron|CACNA1C-AS2_ENST00000545526.1_RNA			Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1623					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGATCCTTTCCGCCCTGCAG	0.602																																						.											0													19.0	25.0	23.0					12																	2783696		2155	4255	6410	SO:0001819	synonymous_variant	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000344100.3:c.4839C>T	12.37:g.2783696C>T			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000344100.3	37	CCDS44792.1																																																																																				0.602	CACNA1C-021	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317040.1	NM_000719	
PLEKHH1	57475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	14	68052685	68052685	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr14:68052685C>A	ENST00000329153.5	+	28	3936	c.3804C>A	c.(3802-3804)taC>taA	p.Y1268*	PLEKHH1_ENST00000417684.2_Nonsense_Mutation_p.Y133*	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	1268	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		ACATCACTTACCCCTACTCTT	0.498																																						.											0													250.0	248.0	249.0					14																	68052685		2023	4187	6210	SO:0001587	stop_gained	57475			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.3804C>A	14.37:g.68052685C>A	ENSP00000330278:p.Tyr1268*		A6H8X6|Q6PJL4|Q6ZWC7	Nonsense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	C	43	9.867434	0.99283	.	.	ENSG00000054690	ENST00000329153;ENST00000417684	.	.	.	5.53	1.65	0.23941	.	0.122742	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8137	0.40840	0.0:0.5563:0.0:0.4437	.	.	.	.	X	1268;133	.	ENSP00000330278:Y1268X	Y	+	3	2	PLEKHH1	67122438	0.604000	0.26932	0.999000	0.59377	0.998000	0.95712	-0.064000	0.11636	0.132000	0.18615	0.655000	0.94253	TAC		0.498	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
ALDH1A3	220	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	15	101427815	101427815	+	Silent	SNP	C	C	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr15:101427815C>A	ENST00000329841.5	+	3	775	c.243C>A	c.(241-243)gcC>gcA	p.A81A	RP11-66B24.8_ENST00000558568.1_lincRNA|ALDH1A3_ENST00000346623.6_Silent_p.A81A|ALDH1A3_ENST00000560555.1_3'UTR	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	81					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	CACAGGTTGCCTTCCAGAGGG	0.637																																						.											0													83.0	84.0	84.0					15																	101427815		2203	4300	6503	SO:0001819	synonymous_variant	220			U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.243C>A	15.37:g.101427815C>A			Q6NT64	Silent	SNP	ENST00000329841.5	37	CCDS10389.1																																																																																				0.637	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2		
HAS3	3038	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	16	69148916	69148916	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr16:69148916G>A	ENST00000306560.1	+	4	1565	c.1409G>A	c.(1408-1410)gGc>gAc	p.G470D	HAS3_ENST00000219322.3_Intron|HAS3_ENST00000569188.1_Missense_Mutation_p.G470D	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	470					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GGCACCTCTGGCCGAAAAACC	0.532																																						.											0													156.0	143.0	147.0					16																	69148916		2198	4300	6498	SO:0001583	missense	3038			BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1409G>A	16.37:g.69148916G>A	ENSP00000304440:p.Gly470Asp		A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	ENST00000306560.1	37	CCDS10871.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438313	0.83885	.	.	ENSG00000103044	ENST00000306560	T	0.51071	0.72	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.74222	0.3688	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76634	-0.2887	10	0.72032	D	0.01	0.7811	19.9192	0.97079	0.0:0.0:1.0:0.0	.	470	O00219	HAS3_HUMAN	D	470	ENSP00000304440:G470D	ENSP00000304440:G470D	G	+	2	0	HAS3	67706417	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.751000	0.98889	2.882000	0.98803	0.655000	0.94253	GGC		0.532	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612	
ACBD4	79777	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	43215198	43215198	+	Splice_Site	SNP	G	G	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr17:43215198G>A	ENST00000376955.4	+	7	870		c.e7+1		ACBD4_ENST00000586346.1_Splice_Site|ACBD4_ENST00000431281.1_Splice_Site|ACBD4_ENST00000591136.1_Splice_Site|ACBD4_ENST00000321854.8_Splice_Site|ACBD4_ENST00000398322.3_Splice_Site|ACBD4_ENST00000592162.1_Splice_Site|ACBD4_ENST00000591859.1_Splice_Site	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4								fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			kidney(1)|lung(3)|ovary(1)	5						GCCTGAGCTGGTGAGCCCAGT	0.607																																						.											0													84.0	92.0	89.0					17																	43215198		2067	4211	6278	SO:0001630	splice_region_variant	79777			BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.573+1G>A	17.37:g.43215198G>A			D3DX64|Q8IUT1|Q9H8Q4	Splice_Site	SNP	ENST00000376955.4	37	CCDS45711.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.718556	0.68844	.	.	ENSG00000181513	ENST00000431281;ENST00000321854;ENST00000398322;ENST00000376955	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6437	0.77029	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACBD4	40570724	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.418000	0.80167	2.294000	0.77228	0.555000	0.69702	.		0.607	ACBD4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000449816.1	NM_024722	Intron
SERPINB12	89777	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	61223519	61223519	+	Missense_Mutation	SNP	C	C	T	rs199538877	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr18:61223519C>T	ENST00000269491.1	+	1	127	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	SERPINB12_ENST00000382768.1_Missense_Mutation_p.R43C	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	43					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						TGGTATGGTACGCTTGGGTGC	0.453													C|||	2	0.000399361	0.0015	0.0	5008	,	,		22058	0.0		0.0	False		,,,				2504	0.0					.											0								C	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	196.0	184.0	188.0		127	3.1	1.0	18		188	0,8600		0,0,4300	yes	missense	SERPINB12	NM_080474.1	180	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	43/406	61223519	2,13004	2203	4300	6503	SO:0001583	missense	89777			AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.127C>T	18.37:g.61223519C>T	ENSP00000269491:p.Arg43Cys		Q3SYB4	Missense_Mutation	SNP	ENST00000269491.1	37	CCDS11984.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.14	1.550237	0.27652	4.54E-4	0.0	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.82711	-1.64;-1.64	5.13	3.09	0.35607	Serpin domain (3);	0.311822	0.28388	N	0.015534	D	0.86875	0.6038	M	0.70595	2.14	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.69824	0.963;0.966	T	0.76366	-0.2985	10	0.56958	D	0.05	.	4.0413	0.09753	0.1525:0.5687:0.1318:0.147	.	43;43	Q3SYB4;Q96P63	.;SPB12_HUMAN	C	43	ENSP00000269491:R43C;ENSP00000372218:R43C	ENSP00000269491:R43C	R	+	1	0	SERPINB12	59374499	0.002000	0.14202	0.969000	0.41365	0.134000	0.20937	1.015000	0.29963	1.139000	0.42245	0.655000	0.94253	CGC		0.453	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256197.1	NM_080474	
CNDP1	84735	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	72238436	72238436	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr18:72238436C>A	ENST00000358821.3	+	7	1000	c.772C>A	c.(772-774)Cag>Aag	p.Q258K	CNDP1_ENST00000582365.1_Missense_Mutation_p.Q215K	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	258						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		ATGCAGAGACCAGGATTTTCA	0.408																																					Melanoma(32;1029 1042 25286 38395 44237)	.											0													195.0	171.0	179.0					18																	72238436		2203	4300	6503	SO:0001583	missense	84735				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.772C>A	18.37:g.72238436C>A	ENSP00000351682:p.Gln258Lys		Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Missense_Mutation	SNP	ENST00000358821.3	37	CCDS12007.1	.	.	.	.	.	.	.	.	.	.	C	3.515	-0.098898	0.07010	.	.	ENSG00000150656	ENST00000358821	T	0.54279	0.58	5.82	5.82	0.92795	Peptidase M20, dimerisation (1);	0.177016	0.49916	D	0.000127	T	0.30510	0.0767	N	0.11000	0.08	0.44168	D	0.996974	B	0.32717	0.381	B	0.34242	0.178	T	0.22277	-1.0221	10	0.05620	T	0.96	-22.3205	12.8776	0.57999	0.2657:0.7343:0.0:0.0	.	258	Q96KN2	CNDP1_HUMAN	K	258	ENSP00000351682:Q258K	ENSP00000351682:Q258K	Q	+	1	0	CNDP1	70389416	0.926000	0.31397	0.996000	0.52242	0.822000	0.46500	1.507000	0.35758	2.765000	0.95021	0.591000	0.81541	CAG		0.408	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1	NM_032649	
ZNF560	147741	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	9578613	9578613	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr19:9578613A>T	ENST00000301480.4	-	10	1223	c.1010T>A	c.(1009-1011)gTa>gAa	p.V337E		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V337A(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TTCAACATTTACAGCATGGCT	0.393																																						.											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											181.0	159.0	166.0					19																	9578613		2203	4300	6503	SO:0001583	missense	147741			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1010T>A	19.37:g.9578613A>T	ENSP00000301480:p.Val337Glu		Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	A	10.41	1.342909	0.24339	.	.	ENSG00000198028	ENST00000301480	T	0.06933	3.24	1.68	-2.74	0.05932	.	.	.	.	.	T	0.03915	0.0110	L	0.32530	0.975	0.09310	N	1	B	0.30634	0.288	B	0.26416	0.069	T	0.42616	-0.9441	9	0.02654	T	1	.	3.5508	0.07845	0.4454:0.355:0.0:0.1996	.	337	Q96MR9	ZN560_HUMAN	E	337	ENSP00000301480:V337E	ENSP00000301480:V337E	V	-	2	0	ZNF560	9439613	0.000000	0.05858	0.000000	0.03702	0.170000	0.22686	-1.280000	0.02804	-0.728000	0.04882	0.402000	0.26972	GTA		0.393	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
MYT1	4661	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	20	62839675	62839675	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr20:62839675G>A	ENST00000328439.1	+	7	1490	c.1126G>A	c.(1126-1128)Gga>Aga	p.G376R	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.G376R	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GATGACCCGGGGAAACCTGGG	0.637																																					GBM(59;481 1041 20555 21139 33705)	.											0													68.0	62.0	64.0					20																	62839675		2203	4300	6503	SO:0001583	missense	4661			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1126G>A	20.37:g.62839675G>A	ENSP00000327465:p.Gly376Arg		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	g	19.02	3.746509	0.69418	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.28255	2.57;1.62	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.97110	1.0;0.957	T	0.67245	-0.5719	10	0.87932	D	0	-33.6868	17.157	0.86794	0.0:0.0:1.0:0.0	.	376;376	F5H7M8;Q01538	.;MYT1_HUMAN	R	376	ENSP00000327465:G376R;ENSP00000442412:G376R	ENSP00000327465:G376R	G	+	1	0	MYT1	62310119	1.000000	0.71417	0.926000	0.36857	0.963000	0.63663	9.529000	0.98049	2.051000	0.60960	0.450000	0.29827	GGA		0.637	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
NRP2	8828	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	206605324	206605324	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr2:206605324C>T	ENST00000357785.5	+	8	1259	c.1228C>T	c.(1228-1230)Cgc>Tgc	p.R410C	NRP2_ENST00000360409.3_Missense_Mutation_p.R410C|NRP2_ENST00000540841.1_Missense_Mutation_p.R410C|NRP2_ENST00000540178.1_Missense_Mutation_p.R410C|NRP2_ENST00000355117.4_Missense_Mutation_p.R410C|NRP2_ENST00000417189.1_Missense_Mutation_p.R410C|NRP2_ENST00000412873.2_Missense_Mutation_p.R410C|NRP2_ENST00000357118.4_Missense_Mutation_p.R410C|NRP2_ENST00000272849.3_Missense_Mutation_p.R410C			Q99435	NELL2_HUMAN	neuropilin 2	0	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R410C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						TGTTAGAATCCGCCCTCAGAC	0.557																																						.											1	Substitution - Missense(1)	prostate(1)											127.0	106.0	113.0					2																	206605324		2203	4300	6503	SO:0001583	missense	8828			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1228C>T	2.37:g.206605324C>T	ENSP00000350432:p.Arg410Cys		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000357785.5	37	CCDS46496.1	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780182	0.70222	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000355117;ENST00000417189;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	D;D;D;D;D;D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33	5.97	5.1	0.69264	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.97851	0.9294	L	0.60904	1.88	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.998;0.999;0.996;0.996;0.993	D	0.98708	1.0703	10	0.72032	D	0.01	-25.332	15.1719	0.72881	0.0:0.9326:0.0:0.0674	.	410;410;410;410;410;410	O60462-2;O60462-3;O60462;O60462-4;O60462-5;E9PF66	.;.;NRP2_HUMAN;.;.;.	C	410	ENSP00000353582:R410C;ENSP00000439658:R410C;ENSP00000439261:R410C;ENSP00000347238:R410C;ENSP00000387519:R410C;ENSP00000349632:R410C;ENSP00000350432:R410C;ENSP00000407626:R410C;ENSP00000272849:R410C	ENSP00000272849:R410C	R	+	1	0	NRP2	206313569	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	2.780000	0.47742	1.546000	0.49388	-0.136000	0.14681	CGC		0.557	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1		
SREK1IP1	285672	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	64023984	64023984	+	Missense_Mutation	SNP	C	C	A	rs578186041	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr5:64023984C>A	ENST00000513458.4	-	4	395	c.228G>T	c.(226-228)aaG>aaT	p.K76N		NM_173829.3	NP_776190.1	Q8N9Q2	SR1IP_HUMAN	SREK1-interacting protein 1	76	Lys-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)		nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6						tttctttcttcttttcctctt	0.274																																						.											0													18.0	21.0	20.0					5																	64023984		2157	4236	6393	SO:0001583	missense	285672			AK094073	CCDS34171.1	5q12.3	2010-09-20	2010-09-20	2010-09-20	ENSG00000153006	ENSG00000153006			26716	protein-coding gene	gene with protein product	"""p18 splicing regulatory protein"""		"""SFRS12-interacting protein 1"""	SFRS12IP1		15456940	Standard	NM_173829		Approved	FLJ36754, P18SRP	uc003jtk.3	Q8N9Q2	OTTHUMG00000162291	ENST00000513458.4:c.228G>T	5.37:g.64023984C>A	ENSP00000427401:p.Lys76Asn		Q32NC8	Missense_Mutation	SNP	ENST00000513458.4	37	CCDS34171.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437539	0.43224	.	.	ENSG00000153006	ENST00000513458	.	.	.	4.07	3.12	0.35913	.	0.194626	0.53938	D	0.000051	T	0.56963	0.2021	M	0.68593	2.085	0.40136	D	0.976778	B	0.22414	0.069	B	0.19946	0.027	T	0.63747	-0.6567	9	0.72032	D	0.01	-9.3035	9.1429	0.36914	0.0:0.7764:0.2236:0.0	.	76	Q8N9Q2	SR1IP_HUMAN	N	76	.	ENSP00000427401:K76N	K	-	3	2	SREK1IP1	64059740	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.683000	0.37638	2.266000	0.75297	0.655000	0.94253	AAG		0.274	SREK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368457.4	NM_173829	
TRIM52	84851	hgsc.bcm.edu	37	5	180687431	180687431	+	Silent	SNP	T	T	C	rs200454506|rs78075294|rs3073543|rs33972170	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr5:180687431T>C	ENST00000327767.4	-	1	688	c.384A>G	c.(382-384)gaA>gaG	p.E128E	CTC-338M12.4_ENST00000417281.2_RNA|CTC-338M12.4_ENST00000505151.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000507434.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	128	Glu-rich.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		GATCTTCCTCTTCTTCTTCTT	0.458																																						.											0													60.0	124.0	102.0					5																	180687431		2203	4300	6503	SO:0001819	synonymous_variant	84851				CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.384A>G	5.37:g.180687431T>C				Silent	SNP	ENST00000327767.4	37	CCDS4467.1																																																																																				0.458	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253572.3	NM_032765	
FAM20C	56975	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	208958	208958	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr7:208958C>T	ENST00000313766.5	+	3	1076	c.845C>T	c.(844-846)gCg>gTg	p.A282V		NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	282				MTFQNYGQALFKPMK -> FLSDKPFLFLSCFLR (in Ref. 6; CAB99089). {ECO:0000305}.	dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		TACGGGCAAGCGCTGTTCAAA	0.627																																						.											0													56.0	59.0	58.0					7																	208958		2062	4183	6245	SO:0001583	missense	56975			BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.845C>T	7.37:g.208958C>T	ENSP00000322323:p.Ala282Val		A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Missense_Mutation	SNP	ENST00000313766.5	37	CCDS47522.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496368	0.64186	.	.	ENSG00000177706	ENST00000313766	D	0.89617	-2.54	5.23	5.23	0.72850	.	0.300145	0.21112	N	0.079975	D	0.92668	0.7670	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	D	0.91794	0.5446	10	0.39692	T	0.17	.	17.5659	0.87919	0.0:1.0:0.0:0.0	.	282	Q8IXL6	DMP4_HUMAN	V	282	ENSP00000322323:A282V	ENSP00000322323:A282V	A	+	2	0	FAM20C	304041	1.000000	0.71417	0.958000	0.39756	0.536000	0.34869	4.838000	0.62803	2.439000	0.82584	0.655000	0.94253	GCG		0.627	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	
FKBP9	11328	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	7	33028128	33028128	+	Silent	SNP	G	G	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr7:33028128G>A	ENST00000242209.4	+	6	1072	c.903G>A	c.(901-903)cgG>cgA	p.R301R	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538443.1_Silent_p.R163R|FKBP9_ENST00000538336.1_Silent_p.R354R|FKBP9_ENST00000490776.2_Silent_p.R69R|FKBP9_ENST00000489038.1_3'UTR	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	301	PPIase FKBP-type 3. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			GCTACTCTCGGAACCGCACGT	0.483																																						.											0													130.0	118.0	122.0					7																	33028128		2203	4300	6503	SO:0001819	synonymous_variant	11328			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.903G>A	7.37:g.33028128G>A			B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	ENST00000242209.4	37	CCDS5439.1																																																																																				0.483	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
UPK3B	80761	hgsc.bcm.edu	37	7	76144557	76144557	+	Missense_Mutation	SNP	C	C	G	rs376925113		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr7:76144557C>G	ENST00000257632.5	+	4	1080	c.952C>G	c.(952-954)Cgc>Ggc	p.R318G	UPK3B_ENST00000394849.1_Missense_Mutation_p.R263G|UPK3B_ENST00000448265.3_Missense_Mutation_p.R318G|UPK3B_ENST00000443097.2_3'UTR|UPK3B_ENST00000334348.3_3'UTR|UPK3B_ENST00000419923.2_Missense_Mutation_p.R318G			Q9BT76	UPK3B_HUMAN	uroplakin 3B	318					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				GGAGATGGGGCGCTGGGAGTG	0.697													.|||	1	0.000199681	0.0008	0.0	5008	,	,		14305	0.0		0.0	False		,,,				2504	0.0					.											0													12.0	13.0	13.0					7																	76144557		2193	4284	6477	SO:0001583	missense	80761			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.952C>G	7.37:g.76144557C>G	ENSP00000257632:p.Arg318Gly		A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Missense_Mutation	SNP	ENST00000257632.5	37	CCDS5588.1	.	.	.	.	.	.	.	.	.	.	.	6.900	0.535551	0.13188	.	.	ENSG00000243566	ENST00000419923;ENST00000448265;ENST00000257632;ENST00000394849	T;T;T;T	0.38560	1.13;1.13;1.13;1.21	2.57	-5.13	0.02884	.	1.939240	0.02462	N	0.086707	T	0.20333	0.0489	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12553	-1.0543	10	0.87932	D	0	-0.2282	1.9041	0.03273	0.1404:0.4598:0.1916:0.2082	.	263;318	Q9BT76-2;Q9BT76	.;UPK3B_HUMAN	G	318;318;318;263	ENSP00000441602:R318G;ENSP00000441284:R318G;ENSP00000257632:R318G;ENSP00000378319:R263G	ENSP00000257632:R318G	R	+	1	0	UPK3B	75982493	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.998000	0.01469	-1.903000	0.01093	-0.676000	0.03789	CGC		0.697	UPK3B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313978.2	NM_030570	
INVS	27130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	9	103004868	103004868	+	Silent	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr9:103004868C>T	ENST00000262457.2	+	7	998	c.813C>T	c.(811-813)gtC>gtT	p.V271V	INVS_ENST00000541287.1_Silent_p.V175V|INVS_ENST00000262456.2_Silent_p.V271V	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	271					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				CACAGATTGTCCATCTCCTTT	0.343																																						.											0													108.0	110.0	110.0					9																	103004868		2203	4300	6503	SO:0001819	synonymous_variant	27130			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.813C>T	9.37:g.103004868C>T			A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Silent	SNP	ENST00000262457.2	37	CCDS6746.1																																																																																				0.343	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053407.1	NM_014425	
CD52	1043	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	26644516	26644516	+	Missense_Mutation	SNP	G	G	A	rs570039509		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr1:26644516G>A	ENST00000374213.2	+	1	69	c.8G>A	c.(7-9)cGc>cAc	p.R3H	CD52_ENST00000492808.1_3'UTR|UBXN11_ENST00000374222.1_Intron|UBXN11_ENST00000374217.2_Intron	NM_001803.2	NP_001794.2	P31358	CD52_HUMAN	CD52 molecule	3					positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory burst (GO:0045730)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				large_intestine(1)	1		all_cancers(24;5.02e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.56e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0137)|READ - Rectum adenocarcinoma(331;0.0649)	Alemtuzumab(DB00087)	AAAATGAAGCGCTTCCTCTTC	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		19805	0.0		0.0	False		,,,				2504	0.001					.											0													260.0	192.0	215.0					1																	26644516		2203	4300	6503	SO:0001583	missense	1043				CCDS30647.1	1p36	2008-02-05	2006-03-28	2005-02-07	ENSG00000169442	ENSG00000169442		"""CD molecules"""	1804	protein-coding gene	gene with protein product		114280	"""CD52 antigen (CAMPATH-1 antigen)"""	CDW52		1711975	Standard	NM_001803		Approved		uc001bmc.3	P31358	OTTHUMG00000003491	ENST00000374213.2:c.8G>A	1.37:g.26644516G>A	ENSP00000363330:p.Arg3His		Q5T138|Q9BW46	Missense_Mutation	SNP	ENST00000374213.2	37	CCDS30647.1	.	.	.	.	.	.	.	.	.	.	G	11.30	1.597022	0.28445	.	.	ENSG00000169442	ENST00000374213	T	0.36340	1.26	4.05	2.14	0.27477	.	0.788204	0.10392	N	0.680354	T	0.34454	0.0898	.	.	.	0.23309	N	0.997936	D	0.62365	0.991	P	0.48982	0.597	T	0.13019	-1.0525	9	0.37606	T	0.19	.	5.8326	0.18588	0.1075:0.1951:0.6974:0.0	.	3	P31358	CD52_HUMAN	H	3	ENSP00000363330:R3H	ENSP00000363330:R3H	R	+	2	0	CD52	26517103	0.998000	0.40836	0.985000	0.45067	0.154000	0.21943	1.196000	0.32198	0.642000	0.30620	-0.324000	0.08512	CGC		0.517	CD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009704.1	NM_001803	
MAP1A	4130	hgsc.bcm.edu;bcgsc.ca	37	15	43819747	43819747	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr15:43819747C>T	ENST00000300231.5	+	4	6526	c.6076C>T	c.(6076-6078)Ctc>Ttc	p.L2026F	MAP1A_ENST00000382031.1_Missense_Mutation_p.L2264F|MAP1A_ENST00000399453.1_Missense_Mutation_p.L2026F			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2026					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	ACCCAAGAGCCTCCAGTCTGA	0.607																																						.											0													62.0	66.0	65.0					15																	43819747		2022	4187	6209	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.6076C>T	15.37:g.43819747C>T	ENSP00000300231:p.Leu2026Phe		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025026	0.35701	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01446	4.88;4.88;4.88	4.9	2.89	0.33648	.	0.590783	0.12936	N	0.426958	T	0.02767	0.0083	L	0.32530	0.975	0.24938	N	0.991877	P	0.45176	0.852	P	0.50896	0.653	T	0.45469	-0.9259	10	0.12430	T	0.62	-5.1836	10.2687	0.43470	0.354:0.646:0.0:0.0	.	2026	P78559	MAP1A_HUMAN	F	2264;2026;2026	ENSP00000371462:L2264F;ENSP00000382380:L2026F;ENSP00000300231:L2026F	ENSP00000300231:L2026F	L	+	1	0	MAP1A	41607039	0.295000	0.24389	0.952000	0.39060	0.993000	0.82548	0.962000	0.29280	1.249000	0.43950	0.655000	0.94253	CTC		0.607	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
BIRC6	57448	hgsc.bcm.edu	37	2	32718631	32718631	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr2:32718631A>G	ENST00000421745.2	+	45	8499	c.8365A>G	c.(8365-8367)Atg>Gtg	p.M2789V		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2789					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TACACAAGCTATGCAAGAATT	0.318																																					Pancreas(94;175 1509 16028 18060 45422)	.											0													167.0	167.0	167.0					2																	32718631		2203	4300	6503	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.8365A>G	2.37:g.32718631A>G	ENSP00000393596:p.Met2789Val		Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	12.11	1.838356	0.32513	.	.	ENSG00000115760	ENST00000421745	T	0.72835	-0.69	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.53981	0.1830	N	0.14661	0.345	0.45718	D	0.998624	B	0.15141	0.012	B	0.10450	0.005	T	0.50092	-0.8868	10	0.18710	T	0.47	.	15.6548	0.77124	1.0:0.0:0.0:0.0	.	2789	Q9NR09	BIRC6_HUMAN	V	2789	ENSP00000393596:M2789V	ENSP00000393596:M2789V	M	+	1	0	BIRC6	32572135	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.820000	0.75267	2.162000	0.67917	0.377000	0.23210	ATG		0.318	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
MECOM	2122	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	168834235	168834235	+	Missense_Mutation	SNP	A	A	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:168834235A>C	ENST00000464456.1	-	7	2061	c.861T>G	c.(859-861)caT>caG	p.H287Q	MECOM_ENST00000460814.1_Missense_Mutation_p.H287Q|MECOM_ENST00000433243.2_Missense_Mutation_p.H288Q|MECOM_ENST00000264674.3_Missense_Mutation_p.H352Q|MECOM_ENST00000472280.1_Missense_Mutation_p.H288Q|MECOM_ENST00000392736.3_Missense_Mutation_p.H287Q|MECOM_ENST00000468789.1_Missense_Mutation_p.H287Q|MECOM_ENST00000494292.1_Missense_Mutation_p.H475Q	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GACCAGCAGGATGCCTATTGG	0.493																																						.											0													328.0	284.0	299.0					3																	168834235		2203	4300	6503	SO:0001583	missense	2122			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.861T>G	3.37:g.168834235A>C	ENSP00000419770:p.His287Gln		Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	37	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.111995	0.37242	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.06449	3.36;3.34;3.31;3.45;3.3;3.34;3.3;3.45	6.03	2.42	0.29668	.	0.000000	0.64402	D	0.000001	T	0.17704	0.0425	L	0.57536	1.79	0.53688	D	0.999976	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.83275	0.996;0.996;0.991;0.996;0.991	T	0.00119	-1.2031	10	0.49607	T	0.09	-13.3669	9.5611	0.39369	0.8039:0.0:0.1961:0.0	.	475;288;475;352;287	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	Q	352;287;287;288;475;287;287;288	ENSP00000264674:H352Q;ENSP00000376493:H287Q;ENSP00000419770:H287Q;ENSP00000420048:H288Q;ENSP00000417899:H475Q;ENSP00000419995:H287Q;ENSP00000420466:H287Q;ENSP00000394302:H288Q	ENSP00000264674:H352Q	H	-	3	2	MECOM	170316929	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.789000	0.47813	0.187000	0.20147	-0.250000	0.11733	CAT		0.493	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
ANKRD17	26057	hgsc.bcm.edu	37	4	73956951	73956951	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr4:73956951C>T	ENST00000358602.4	-	29	6510	c.6394G>A	c.(6394-6396)Gaa>Aaa	p.E2132K	ANKRD17_ENST00000509867.2_Missense_Mutation_p.E2019K|ANKRD17_ENST00000330838.6_Missense_Mutation_p.E1881K	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2132					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTCTAACTTCCGGGGGAGGA	0.517																																						.											0													115.0	121.0	119.0					4																	73956951		2203	4300	6503	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.6394G>A	4.37:g.73956951C>T	ENSP00000351416:p.Glu2132Lys		E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	C	7.126	0.578957	0.13686	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.65364	-0.15;-0.12;-0.12	5.17	5.17	0.71159	.	0.392312	0.24368	N	0.039137	T	0.42404	0.1201	N	0.08118	0	0.26174	N	0.979828	B;B;B;B	0.25809	0.135;0.135;0.083;0.008	B;B;B;B	0.21917	0.037;0.037;0.016;0.004	T	0.40421	-0.9564	10	0.48119	T	0.1	.	13.7865	0.63112	0.1532:0.8468:0.0:0.0	.	2131;1881;2132;2019	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	K	2132;1539;1881;2019;516	ENSP00000351416:E2132K;ENSP00000332265:E1881K;ENSP00000427151:E2019K	ENSP00000332265:E1881K	E	-	1	0	ANKRD17	74175815	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.190000	0.65104	2.694000	0.91930	0.650000	0.86243	GAA		0.517	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
SOX13	9580	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204092909	204092909	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr1:204092909A>G	ENST00000367204.1	+	12	1461	c.1352A>G	c.(1351-1353)aAc>aGc	p.N451S		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	451					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			GACATGCACAACTCCAGCATC	0.572											OREG0014126	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													62.0	66.0	65.0					1																	204092909		2198	4300	6498	SO:0001583	missense	9580				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1352A>G	1.37:g.204092909A>G	ENSP00000356172:p.Asn451Ser	2142	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.886738	0.91814	.	.	ENSG00000143842	ENST00000367204	D	0.98150	-4.75	5.26	5.26	0.73747	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.98535	0.9511	M	0.77406	2.37	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.996	D	0.99795	1.1033	10	0.87932	D	0	.	14.8475	0.70270	1.0:0.0:0.0:0.0	.	318;318;451	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	S	451	ENSP00000356172:N451S	ENSP00000356172:N451S	N	+	2	0	SOX13	202359532	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	1.991000	0.58162	0.533000	0.62120	AAC		0.572	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2	NM_005686	
ITGA8	8516	broad.mit.edu;bcgsc.ca	37	10	15719635	15719635	+	Splice_Site	SNP	T	T	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr10:15719635T>C	ENST00000378076.3	-	6	985	c.632A>G	c.(631-633)aAt>aGt	p.N211S		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	211					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AAGGTCTCCATTCTACAAAAC	0.368																																						.											0													116.0	107.0	110.0					10																	15719635		2203	4300	6503	SO:0001630	splice_region_variant	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.631-1A>G	10.37:g.15719635T>C			B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.285795	0.40394	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.22134	1.97	5.58	4.45	0.53987	.	0.185108	0.64402	N	0.000019	T	0.18923	0.0454	N	0.24115	0.695	0.45035	D	0.998057	P;P	0.48694	0.914;0.86	P;B	0.46825	0.528;0.328	T	0.01464	-1.1348	10	0.49607	T	0.09	.	11.4986	0.50424	0.0:0.0704:0.0:0.9296	.	211;211	F5H818;P53708	.;ITA8_HUMAN	S	211	ENSP00000367316:N211S	ENSP00000367316:N211S	N	-	2	0	ITGA8	15759641	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.590000	0.67530	0.955000	0.37878	0.455000	0.32223	AAT		0.368	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	Missense_Mutation
OR5M1	390168	broad.mit.edu	37	11	56380362	56380363	+	Frame_Shift_Del	DEL	TT	TT	-	rs186713638	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr11:56380362_56380363delTT	ENST00000526538.1	-	1	615_616	c.616_617delAA	c.(616-618)aatfs	p.N206fs		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						GCTTGAGAGATTAAAGCCTGCA	0.441																																						.											0																																										SO:0001589	frameshift_variant	390168			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.616_617delAA	11.37:g.56380362_56380363delTT	ENSP00000435416:p.Asn206fs		Q6IF60|Q96RB6	Frame_Shift_Del	DEL	ENST00000526538.1	37	CCDS53631.1																																																																																				0.441	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740	
APOBEC1	339	broad.mit.edu;mdanderson.org	37	12	7802197	7802197	+	Silent	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr12:7802197C>T	ENST00000229304.4	-	5	677	c.657G>A	c.(655-657)ccG>ccA	p.P219P		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	219					cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						GGATGTGTGGCGGAATCGTTT	0.408																																					Pancreas(135;929 1826 4531 10527 41012)	.											0													177.0	160.0	166.0					12																	7802197		2203	4300	6503	SO:0001819	synonymous_variant	339			U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.657G>A	12.37:g.7802197C>T			Q9UE64|Q9UM71	Silent	SNP	ENST00000229304.4	37	CCDS8579.1																																																																																				0.408	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280523.1	NM_001644	
PCDH20	64881	broad.mit.edu;mdanderson.org	37	13	61989199	61989199	+	Silent	SNP	T	T	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr13:61989199T>G	ENST00000409186.1	-	4	2198	c.93A>C	c.(91-93)ctA>ctC	p.L31L	PCDH20_ENST00000409204.4_Silent_p.L31L			Q8N6Y1	PCD20_HUMAN	protocadherin 20	31					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TGGGACGATGTAGACGCCCCA	0.642																																						.											0													33.0	28.0	30.0					13																	61989199		2203	4298	6501	SO:0001819	synonymous_variant	64881			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.93A>C	13.37:g.61989199T>G			A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	ENST00000409186.1	37	CCDS9442.2																																																																																				0.642	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
STON2	85439	broad.mit.edu	37	14	81737175	81737175	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr14:81737175C>T	ENST00000267540.2	-	5	2652	c.2452G>A	c.(2452-2454)Ggc>Agc	p.G818S	STON2_ENST00000555447.1_Missense_Mutation_p.G818S	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	818	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CGGTCAGAGCCGAGTTCAAGG	0.498																																						.											0													99.0	85.0	90.0					14																	81737175		2203	4300	6503	SO:0001583	missense	85439			AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2452G>A	14.37:g.81737175C>T	ENSP00000267540:p.Gly818Ser		G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	C	34	5.381129	0.95945	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.18338	2.22;2.22	5.79	5.79	0.91817	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.36580	0.0972	L	0.39633	1.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.01397	-1.1365	10	0.49607	T	0.09	-28.5503	20.0371	0.97565	0.0:1.0:0.0:0.0	.	818;818	Q8WXE9;G3V2T7	STON2_HUMAN;.	S	818;830;818	ENSP00000450857:G818S;ENSP00000267540:G818S	ENSP00000267540:G818S	G	-	1	0	STON2	80806928	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.231000	0.78106	2.734000	0.93682	0.655000	0.94253	GGC		0.498	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
HERC2P2	400322	broad.mit.edu	37	15	23285556	23285556	+	RNA	SNP	G	G	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr15:23285556G>A	ENST00000560464.1	-	0	5097									hect domain and RLD 2 pseudogene 2																		CCACCCCGGCGTGATTGTGAC	0.498																																						.											0																																												400322			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23285556G>A				RNA	SNP	ENST00000560464.1	37																																																																																					0.498	HERC2P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415936.1		
GALK2	2585	broad.mit.edu	37	15	49493438	49493438	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr15:49493438A>G	ENST00000560031.1	+	2	440	c.133A>G	c.(133-135)Aac>Gac	p.N45D	GALK2_ENST00000559454.1_Missense_Mutation_p.N21D|GALK2_ENST00000327171.3_Missense_Mutation_p.N34D|GALK2_ENST00000544523.1_Missense_Mutation_p.N21D|GALK2_ENST00000396509.2_Missense_Mutation_p.N21D|GALK2_ENST00000543495.1_5'UTR|RN7SL307P_ENST00000490342.2_RNA			Q01415	GALK2_HUMAN	galactokinase 2	45					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		AGGAAGAGTCAACATAATAGG	0.284																																						.											0													65.0	62.0	63.0					15																	49493438		2196	4293	6489	SO:0001583	missense	2585				CCDS32236.1, CCDS42034.1, CCDS73724.1	15q21.1-q21.2	2013-09-20			ENSG00000156958	ENSG00000156958	2.7.1.6		4119	protein-coding gene	gene with protein product		137028					Standard	XM_005254279		Approved	GK2	uc001zxj.1	Q01415	OTTHUMG00000172325	ENST00000560031.1:c.133A>G	15.37:g.49493438A>G	ENSP00000453129:p.Asn45Asp		Q7Z4Q4	Missense_Mutation	SNP	ENST00000560031.1	37	CCDS42034.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.075302	0.76415	.	.	ENSG00000156958	ENST00000327171;ENST00000396509;ENST00000544523	D;D	0.95238	-3.65;-3.65	5.17	5.17	0.71159	Ribosomal protein S5 domain 2-type fold (1);Galactokinase, conserved site (1);Galactokinase galactose-binding domain (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.97841	0.9291	M	0.93328	3.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98842	1.0755	10	0.72032	D	0.01	0.2608	14.2904	0.66273	1.0:0.0:0.0:0.0	.	45;34	Q01415;Q7Z4Q4	GALK2_HUMAN;.	D	34;45;21	ENSP00000316632:N34D;ENSP00000440312:N21D	ENSP00000316632:N34D	N	+	1	0	GALK2	47280730	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.522000	0.67092	2.077000	0.62373	0.379000	0.24179	AAC		0.284	GALK2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417854.1		
TTLL6	284076	broad.mit.edu	37	17	46882179	46882179	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr17:46882179A>G	ENST00000393382.3	-	2	419	c.278T>C	c.(277-279)cTt>cCt	p.L93P	TTLL6_ENST00000470462.2_5'Flank	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						GGCATTCTGAAGTCCGTTTTG	0.498											OREG0024527	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													75.0	67.0	70.0					17																	46882179		692	1591	2283	SO:0001583	missense	284076			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.278T>C	17.37:g.46882179A>G	ENSP00000377043:p.Leu93Pro	942		Missense_Mutation	SNP	ENST00000393382.3	37	CCDS45724.1	.	.	.	.	.	.	.	.	.	.	A	1.864	-0.461996	0.04508	.	.	ENSG00000170703	ENST00000440941;ENST00000393382;ENST00000456415;ENST00000418322	.	.	.	5.08	1.37	0.22104	.	0.740636	0.10225	U	0.700467	T	0.41811	0.1175	M	0.65975	2.015	0.18873	N	0.999983	B	0.15141	0.012	B	0.15052	0.012	T	0.46830	-0.9163	9	0.87932	D	0	.	2.7808	0.05360	0.5947:0.0:0.2178:0.1875	.	45	Q8N841	TTLL6_HUMAN	P	93;45;45;95	.	ENSP00000365871:L45P	L	-	2	0	TTLL6	44237178	0.982000	0.34865	0.005000	0.12908	0.002000	0.02628	2.401000	0.44513	0.478000	0.27488	-0.290000	0.09829	CTT		0.498	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
ZNF561	93134	broad.mit.edu	37	19	9724753	9724753	+	Missense_Mutation	SNP	G	G	A	rs144117005	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr19:9724753G>A	ENST00000302851.3	-	5	631	c.268C>T	c.(268-270)Cgg>Tgg	p.R90W	ZNF561_ENST00000495503.1_5'UTR|ZNF561_ENST00000424629.1_Missense_Mutation_p.R21W|ZNF561_ENST00000354661.4_Intron|ZNF561_ENST00000326044.5_Intron	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	90	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						AGTGATGACCGTTTGGTTCTA	0.313													g|||	5	0.000998403	0.0023	0.0	5008	,	,		17928	0.001		0.0	False		,,,				2504	0.001					.											0								G	TRP/ARG	2,4404	2.1+/-5.4	0,2,2201	124.0	125.0	125.0		268	-3.4	0.0	19	dbSNP_134	125	0,8600		0,0,4300	no	missense	ZNF561	NM_152289.2	101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	90/487	9724753	2,13004	2203	4300	6503	SO:0001583	missense	93134			AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.268C>T	19.37:g.9724753G>A	ENSP00000303915:p.Arg90Trp		B4E2Q8|Q6PJS0	Missense_Mutation	SNP	ENST00000302851.3	37	CCDS12216.2	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	2.871	-0.233968	0.05983	4.54E-4	0.0	ENSG00000171469	ENST00000424629;ENST00000302851;ENST00000444611	T;T;T	0.08720	3.06;5.67;5.67	1.69	-3.38	0.04883	Krueppel-associated box (3);	.	.	.	.	T	0.04452	0.0122	L	0.47190	1.495	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32798	-0.9893	9	0.36615	T	0.2	.	4.5719	0.12214	0.3643:0.2443:0.3914:0.0	.	90	Q8N587	ZN561_HUMAN	W	21;90;96	ENSP00000393074:R21W;ENSP00000303915:R90W;ENSP00000392013:R96W	ENSP00000303915:R90W	R	-	1	2	ZNF561	9585753	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-4.901000	0.00172	-1.810000	0.01230	-1.011000	0.02470	CGG		0.313	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347272.2	NM_152289	
TOP1	7150	broad.mit.edu	37	20	39708803	39708803	+	Silent	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr20:39708803A>G	ENST00000361337.2	+	6	664	c.414A>G	c.(412-414)agA>agG	p.R138R		NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	138	Lys-rich.				chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	CATTAAAGAGACCTCGAGATG	0.318			T	NUP98	AML*																																	.		Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	0													72.0	70.0	71.0					20																	39708803		2203	4299	6502	SO:0001819	synonymous_variant	7150				CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.414A>G	20.37:g.39708803A>G			A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Silent	SNP	ENST00000361337.2	37	CCDS13312.1																																																																																				0.318	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2		
PKDREJ	10343	broad.mit.edu	37	22	46657795	46657795	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr22:46657795T>A	ENST00000253255.5	-	1	1424	c.1425A>T	c.(1423-1425)agA>agT	p.R475S		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	475	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ACAAAGAAAATCTATCAGAGA	0.393																																						.											0													98.0	103.0	101.0					22																	46657795		2203	4300	6503	SO:0001583	missense	10343			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.1425A>T	22.37:g.46657795T>A	ENSP00000253255:p.Arg475Ser		B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.084923	0.36758	.	.	ENSG00000130943	ENST00000253255	T	0.71461	-0.57	5.18	0.561	0.17285	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.142710	0.31020	N	0.008419	T	0.77824	0.4188	M	0.62723	1.935	0.33455	D	0.584177	D	0.89917	1.0	D	0.91635	0.999	T	0.78079	-0.2344	10	0.27785	T	0.31	-15.3402	10.8303	0.46656	0.0:0.4797:0.0:0.5203	.	475	Q9NTG1	PKDRE_HUMAN	S	475	ENSP00000253255:R475S	ENSP00000253255:R475S	R	-	3	2	PKDREJ	45036459	0.928000	0.31464	0.128000	0.21923	0.007000	0.05969	-0.015000	0.12634	-0.159000	0.11021	-0.274000	0.10170	AGA		0.393	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
ITGA9	3680	broad.mit.edu	37	3	37523097	37523097	+	Splice_Site	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:37523097A>G	ENST00000264741.5	+	4	799	c.543A>G	c.(541-543)gaA>gaG	p.E181E	ITGA9_ENST00000422441.1_Splice_Site_p.E181E	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	181					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		CTTGCTATGAAGGTGAGCATG	0.542																																						.											0													211.0	174.0	186.0					3																	37523097		2203	4300	6503	SO:0001630	splice_region_variant	3680			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.544+1A>G	3.37:g.37523097A>G			Q14638	Silent	SNP	ENST00000264741.5	37	CCDS2669.1																																																																																				0.542	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	Silent
ROBO2	6092	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	77526693	77526693	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:77526693C>T	ENST00000461745.1	+	3	1417	c.517C>T	c.(517-519)Cga>Tga	p.R173*	ROBO2_ENST00000332191.8_Nonsense_Mutation_p.R173*|ROBO2_ENST00000487694.3_Nonsense_Mutation_p.R189*	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	173	Ig-like C2-type 2.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AGACAAAGTTCGAATTGATGA	0.423																																						.											0													66.0	66.0	66.0					3																	77526693		1826	4079	5905	SO:0001587	stop_gained	6092			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.517C>T	3.37:g.77526693C>T	ENSP00000417164:p.Arg173*		O43608|Q19AB4|Q19AB5	Nonsense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	C	37	6.079931	0.97267	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	.	.	.	5.58	5.58	0.84498	.	0.000000	0.38164	N	0.001783	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	14.7339	0.69402	0.1447:0.8552:0.0:0.0	.	.	.	.	X	189;189;189;173;173	.	ENSP00000327536:R173X	R	+	1	2	ROBO2	77609383	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.043000	0.49823	2.789000	0.95967	0.655000	0.94253	CGA		0.423	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
MCM2	4171	broad.mit.edu	37	3	127317314	127317314	+	Splice_Site	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:127317314C>T	ENST00000265056.7	+	1	249	c.5C>T	c.(4-6)gCg>gTg	p.A2V		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	2	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						ACTGCTATGGCGGTGAGCGCG	0.692																																						.											0													68.0	62.0	64.0					3																	127317314		2201	4300	6501	SO:0001630	splice_region_variant	4171			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.6+1C>T	3.37:g.127317314C>T			Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	37	CCDS3043.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.902057	0.72754	.	.	ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142	T	0.02345	4.33	4.09	4.09	0.47781	.	1.936480	0.03942	U	0.287041	T	0.06735	0.0172	N	0.08118	0	0.50171	D	0.999859	D	0.76494	0.999	D	0.65874	0.939	T	0.44065	-0.9352	10	0.59425	D	0.04	-0.0334	12.1747	0.54178	0.0:1.0:0.0:0.0	.	2	P49736	MCM2_HUMAN	V	2	ENSP00000265056:A2V	ENSP00000265056:A2V	A	+	2	0	MCM2	128800004	1.000000	0.71417	1.000000	0.80357	0.212000	0.24457	4.102000	0.57776	1.998000	0.58463	0.484000	0.47621	GCG		0.692	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		Missense_Mutation
MCF2L2	23101	broad.mit.edu	37	3	183028733	183028733	+	Silent	SNP	T	T	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:183028733T>C	ENST00000328913.3	-	9	1260	c.963A>G	c.(961-963)caA>caG	p.Q321Q	MCF2L2_ENST00000447025.2_Silent_p.Q321Q|MCF2L2_ENST00000414362.2_Silent_p.Q321Q|MCF2L2_ENST00000473233.1_Silent_p.Q321Q	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	321							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			AATGCTGTAGTTGTAGGCACT	0.393																																						.											0													112.0	109.0	110.0					3																	183028733		2203	4300	6503	SO:0001819	synonymous_variant	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.963A>G	3.37:g.183028733T>C			O94942|Q6P2B8|Q6ZVJ5|Q8N318	Silent	SNP	ENST00000328913.3	37	CCDS3243.1																																																																																				0.393	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
ETV5	2119	broad.mit.edu	37	3	185783822	185783822	+	Silent	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:185783822A>G	ENST00000306376.5	-	8	936	c.690T>C	c.(688-690)ccT>ccC	p.P230P	ETV5_ENST00000434744.1_Silent_p.P230P|ETV5_ENST00000537818.1_Silent_p.P272P|ETV5_ENST00000480706.1_5'Flank	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	230					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			CTGGCTGAGGAGGGAAGGGGT	0.488			T	"""TMPRSS2, SCL45A3"""	Prostate																																	.		Dom	yes		3	3q28	2119	ets variant gene 5		E	0													66.0	73.0	71.0					3																	185783822		2203	4300	6503	SO:0001819	synonymous_variant	2119			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.690T>C	3.37:g.185783822A>G			A6NH46|B7Z7D7|Q6IBN5	Silent	SNP	ENST00000306376.5	37	CCDS33906.1																																																																																				0.488	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
SKIV2L2	23517	broad.mit.edu	37	5	54654428	54654428	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr5:54654428T>C	ENST00000230640.5	+	15	1815	c.1561T>C	c.(1561-1563)Tct>Cct	p.S521P	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.S420P	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	521	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				CATTCAGATGTCTGGTCGTGC	0.323																																					Melanoma(2;92 134 23744 29976 33782)	.											0													97.0	96.0	96.0					5																	54654428		2203	4300	6503	SO:0001583	missense	23517			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1561T>C	5.37:g.54654428T>C	ENSP00000230640:p.Ser521Pro		Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.942479	0.92526	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.44083	0.93;0.93	5.96	5.96	0.96718	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.73860	0.3641	M	0.93898	3.47	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79784	0.943;0.993	T	0.81473	-0.0917	10	0.87932	D	0	-16.8786	16.4484	0.83959	0.0:0.0:0.0:1.0	.	420;521	F5H7E2;P42285	.;SK2L2_HUMAN	P	521;420	ENSP00000230640:S521P;ENSP00000442583:S420P	ENSP00000230640:S521P	S	+	1	0	SKIV2L2	54690185	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.957000	0.87870	2.285000	0.76669	0.533000	0.62120	TCT		0.323	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
PCDHA8	56140	broad.mit.edu;mdanderson.org	37	5	140221819	140221819	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr5:140221819C>T	ENST00000531613.1	+	1	913	c.913C>T	c.(913-915)Cgg>Tgg	p.R305W	PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.R305W|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	305	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATAGTGATTCGGGGTAATTT	0.408																																						.											0													40.0	45.0	43.0					5																	140221819		2197	4296	6493	SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.913C>T	5.37:g.140221819C>T	ENSP00000434655:p.Arg305Trp		B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.592776	0.66219	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.01767	4.65;4.65	3.69	-3.36	0.04913	Cadherin (4);Cadherin-like (1);	3.067170	0.02200	U	0.062209	T	0.06826	0.0174	L	0.56769	1.78	0.09310	N	1	D;D	0.64830	0.994;0.993	P;P	0.61070	0.883;0.814	T	0.41980	-0.9478	10	0.38643	T	0.18	.	11.8028	0.52137	0.6764:0.2263:0.0973:0.0	.	305;305	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	W	305	ENSP00000434655:R305W;ENSP00000367363:R305W	ENSP00000367363:R305W	R	+	1	2	PCDHA8	140202003	0.000000	0.05858	0.000000	0.03702	0.488000	0.33401	-0.980000	0.03770	-0.560000	0.06102	0.456000	0.33151	CGG		0.408	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
NKX3-1	4824	broad.mit.edu	37	8	23538897	23538897	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr8:23538897C>T	ENST00000380871.4	-	2	579	c.542G>A	c.(541-543)cGa>cAa	p.R181Q	NKX3-1_ENST00000523261.1_Missense_Mutation_p.R106Q	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	181					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		GAGCTGCTTTCGCTTAGTCTT	0.582																																						.											0													152.0	150.0	151.0					8																	23538897		2203	4300	6503	SO:0001583	missense	4824				CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.542G>A	8.37:g.23538897C>T	ENSP00000370253:p.Arg181Gln		O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	ENST00000380871.4	37	CCDS6042.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.017281	0.93404	.	.	ENSG00000167034	ENST00000380871;ENST00000300332;ENST00000523261	D;D	0.96396	-4.0;-4.0	5.87	5.87	0.94306	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.56097	D	0.000038	D	0.98353	0.9453	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98842	1.0755	10	0.87932	D	0	.	18.0718	0.89410	0.0:1.0:0.0:0.0	.	181	Q99801	NKX31_HUMAN	Q	181;137;106	ENSP00000370253:R181Q;ENSP00000429729:R106Q	ENSP00000300332:R137Q	R	-	2	0	NKX3-1	23594842	0.997000	0.39634	0.997000	0.53966	0.571000	0.35966	7.754000	0.85163	2.941000	0.99782	0.655000	0.94253	CGA		0.582	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215141.2		
SCARA5	286133	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	27779572	27779572	+	Silent	SNP	G	G	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr8:27779572G>A	ENST00000354914.3	-	4	917	c.432C>T	c.(430-432)ggC>ggT	p.G144G	SCARA5_ENST00000518030.1_Silent_p.G101G|SCARA5_ENST00000380385.2_Intron|SCARA5_ENST00000524352.1_Silent_p.G144G|SCARA5_ENST00000301906.4_Silent_p.G101G	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	144					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GCTGCACTGCGCCCGCCAGCG	0.726																																						.											0																																										SO:0001819	synonymous_variant	286133			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.432C>T	8.37:g.27779572G>A			Q6UXZ1|Q7Z4A1|Q8N4Z7	Silent	SNP	ENST00000354914.3	37	CCDS6064.1																																																																																				0.726	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
UBQLN1	29979	broad.mit.edu	37	9	86322500	86322500	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr9:86322500delG	ENST00000376395.4	-	1	618	c.95delC	c.(94-96)gcgfs	p.A32fs	UBQLN1_ENST00000257468.7_Frame_Shift_Del_p.A32fs|RP11-522I20.3_ENST00000531661.1_RNA|RP11-522I20.3_ENST00000524818.1_RNA	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	32					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						TTTGGGCTCCGCGGAGGCAGC	0.672																																					Melanoma(186;1284 2073 12755 14558 18426)	.											0													14.0	15.0	15.0					9																	86322500		2196	4288	6484	SO:0001589	frameshift_variant	29979			AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.95delC	9.37:g.86322500delG	ENSP00000365576:p.Ala32fs		Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Del	DEL	ENST00000376395.4	37	CCDS6663.1																																																																																				0.672	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
UBQLN1	29979	broad.mit.edu	37	9	86322502	86322505	+	Frame_Shift_Del	DEL	GGAG	GGAG	-	rs201847758		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	GGAG	GGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr9:86322502_86322505delGGAG	ENST00000376395.4	-	1	613_616	c.90_93delCTCC	c.(88-93)gcctccfs	p.AS30fs	UBQLN1_ENST00000257468.7_Frame_Shift_Del_p.AS30fs|RP11-522I20.3_ENST00000531661.1_RNA|RP11-522I20.3_ENST00000524818.1_RNA	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	30					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						TGGGCTCCGCGGAGGCAGCGGCCG	0.676																																					Melanoma(186;1284 2073 12755 14558 18426)	.											0																																										SO:0001589	frameshift_variant	29979			AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.90_93delCTCC	9.37:g.86322502_86322505delGGAG	ENSP00000365576:p.Ala30fs		Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Del	DEL	ENST00000376395.4	37	CCDS6663.1																																																																																				0.676	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
PRH2	5555	broad.mit.edu	37	12	11083460	11083461	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr12:11083460_11083461insC	ENST00000396400.3	+	3	338_339	c.300_301insC	c.(301-303)cccfs	p.P101fs	PRR4_ENST00000536668.1_Intron|PRH2_ENST00000381847.3_Frame_Shift_Ins_p.P101fs	NM_001110213.1	NP_001103683.1	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 2	101						extracellular space (GO:0005615)				breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	13						AGGGAGGCCATCCCCCTCCTCC	0.644																																						.											0																																										SO:0001589	frameshift_variant	5555				CCDS8636.1	12p13.2	2012-10-02				ENSG00000134551			9367	protein-coding gene	gene with protein product	"""parotid proline-rich protein"", ""acidic salivary proline-rich protein, HaeIII type, 2"""	168790				3009472	Standard	NM_005042		Approved	Pr	uc001qzi.4	P02810		ENST00000396400.3:c.305dupC	12.37:g.11083465_11083465dupC	ENSP00000379682:p.Pro101fs		A2VCM0|A3KN66|A5D902|B2RMW2|Q4VBP2|Q53XA2|Q6P2F6	Frame_Shift_Ins	INS	ENST00000396400.3	37	CCDS8636.1																																																																																				0.644	PRH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400231.1	NM_001110213	
CLN3	1201	broad.mit.edu	37	16	28503050	28503051	+	Frame_Shift_Ins	INS	-	-	C	rs374055075		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr16:28503050_28503051insC	ENST00000569430.1	-	3	849_850	c.30_31insG	c.(28-33)cgctttfs	p.F11fs	APOBR_ENST00000328423.5_5'Flank|CLN3_ENST00000395653.4_5'UTR|CLN3_ENST00000567963.1_Frame_Shift_Ins_p.F11fs|CLN3_ENST00000565316.1_Frame_Shift_Ins_p.F11fs|CLN3_ENST00000333496.9_Frame_Shift_Ins_p.F11fs|CLN3_ENST00000357076.5_Frame_Shift_Ins_p.F11fs|CLN3_ENST00000354630.5_Frame_Shift_Ins_p.F11fs|CLN3_ENST00000535392.1_5'UTR|APOBR_ENST00000564831.1_5'Flank|CLN3_ENST00000357806.7_Frame_Shift_Ins_p.F11fs|CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000568224.1_5'UTR|CLN3_ENST00000357857.9_5'UTR|CLN3_ENST00000360019.2_Frame_Shift_Ins_p.F11fs|CLN3_ENST00000359984.7_Frame_Shift_Ins_p.F11fs|APOBR_ENST00000431282.1_5'Flank|CLN3_ENST00000355477.5_Frame_Shift_Ins_p.F11fs			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	11					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GAATCCGAAAAGCGCCGCCGCG	0.653											OREG0023706	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0																																										SO:0001589	frameshift_variant	1201			U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.30_31insG	16.37:g.28503050_28503051insC	ENSP00000454229:p.Phe11fs	802	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Frame_Shift_Ins	INS	ENST00000569430.1	37	CCDS10632.1																																																																																				0.653	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2		
LHX1	3975	broad.mit.edu	37	17	35297586	35297587	+	Splice_Site	INS	-	-	C	rs199890217		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr17:35297586_35297587insC	ENST00000254457.5	+	2	1581_1582		c.e2-1		RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				cccccCCGCAGGTGTTTCGGTA	0.644																																						.											0																																										SO:0001630	splice_region_variant	3975			U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.171-1->C	17.37:g.35297586_35297587insC			Q3MIW0	Splice_Site	INS	ENST00000254457.5	37	CCDS11316.1																																																																																				0.644	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256704.3	NM_005568	Intron
MUC16	94025	broad.mit.edu	37	19	9054266	9054267	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr19:9054266_9054267insG	ENST00000397910.4	-	4	31558_31559	c.31355_31356insC	c.(31354-31356)cctfs	p.P10452fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10454	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGATGTCTGAGGGCCTTTGAC	0.47																																						.											0																																										SO:0001589	frameshift_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31356dupC	19.37:g.9054269_9054269dupG	ENSP00000381008:p.Pro10452fs		Q6ZQW5|Q96RK2	Frame_Shift_Ins	INS	ENST00000397910.4	37	CCDS54212.1																																																																																				0.470	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
FAM184A	79632	broad.mit.edu	37	6	119399412	119399413	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr6:119399412_119399413insC	ENST00000338891.7	-	1	495_496	c.52_53insG	c.(52-54)gccfs	p.A18fs	FAM184A_ENST00000368475.4_Intron|FAM184A_ENST00000352896.5_Intron|FAM184A_ENST00000521531.1_Frame_Shift_Ins_p.A18fs|FAM184A_ENST00000522284.1_Intron	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	18						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						CGCGAATTTGGCCGCCGAGCCG	0.658																																						.											0																																										SO:0001589	frameshift_variant	79632			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.53dupG	6.37:g.119399414_119399414dupC	ENSP00000342604:p.Ala18fs		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Frame_Shift_Ins	INS	ENST00000338891.7	37	CCDS43499.1																																																																																				0.658	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
UBQLN1	29979	broad.mit.edu	37	9	86322497	86322498	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr9:86322497_86322498insC	ENST00000376395.4	-	1	620_621	c.97_98insG	c.(97-99)gagfs	p.E33fs	UBQLN1_ENST00000257468.7_Frame_Shift_Ins_p.E33fs|RP11-522I20.3_ENST00000531661.1_RNA|RP11-522I20.3_ENST00000524818.1_RNA	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	33					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						GATTTTGGGCTCCGCGGAGGCA	0.673																																					Melanoma(186;1284 2073 12755 14558 18426)	.											0																																										SO:0001589	frameshift_variant	29979			AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.98dupG	9.37:g.86322499_86322499dupC	ENSP00000365576:p.Glu33fs		Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Ins	INS	ENST00000376395.4	37	CCDS6663.1																																																																																				0.673	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
ACTA2	59	ucsc.edu	37	10	90701565	90701565	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr10:90701565A>G	ENST00000458208.1	-	5	905	c.431T>C	c.(430-432)cTc>cCc	p.L144P	ACTA2-AS1_ENST00000596007.1_RNA|ACTA2-AS1_ENST00000437930.4_RNA|STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000480297.1_5'UTR|ACTA2_ENST00000224784.6_Missense_Mutation_p.L144P	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	144					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		AGAGGCATAGAGAGACAGCAC	0.532																																						.											0													60.0	51.0	54.0					10																	90701565		2203	4300	6503	SO:0001583	missense	59			X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.431T>C	10.37:g.90701565A>G	ENSP00000402373:p.Leu144Pro		B2R8A4|P03996|P04108|Q6FI19	Missense_Mutation	SNP	ENST00000458208.1	37	CCDS7392.1	.	.	.	.	.	.	.	.	.	.	A	17.74	3.462891	0.63513	.	.	ENSG00000107796	ENST00000224784;ENST00000458208;ENST00000544901;ENST00000415557;ENST00000458159	D;D;D;D	0.97850	-4.57;-4.57;-3.65;-3.65	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	D	0.99420	0.9795	H	0.99940	5	0.80722	D	1	P	0.38642	0.641	P	0.57152	0.814	D	0.97506	1.0063	10	0.87932	D	0	.	14.628	0.68635	1.0:0.0:0.0:0.0	.	144	P62736	ACTA_HUMAN	P	144;144;99;144;144	ENSP00000224784:L144P;ENSP00000402373:L144P;ENSP00000396730:L144P;ENSP00000398239:L144P	ENSP00000224784:L144P	L	-	2	0	ACTA2	90691545	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.395000	0.79876	2.192000	0.70111	0.533000	0.62120	CTC		0.532	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049264.1	NM_001613	
DPY19L4	286148	ucsc.edu	37	8	95793373	95793373	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr8:95793373T>C	ENST00000414645.2	+	16	1793	c.1694T>C	c.(1693-1695)gTg>gCg	p.V565A		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	565						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					CCAGATACAGTGGAACTTATG	0.308																																						.											0													70.0	74.0	72.0					8																	95793373		2203	4296	6499	SO:0001583	missense	286148				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.1694T>C	8.37:g.95793373T>C	ENSP00000389630:p.Val565Ala		Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	ENST00000414645.2	37	CCDS34924.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076103	0.76415	.	.	ENSG00000156162	ENST00000414645	T	0.54675	0.56	5.34	4.16	0.48862	.	0.063541	0.64402	D	0.000008	T	0.67998	0.2953	M	0.76170	2.325	0.47214	D	0.999355	D	0.76494	0.999	D	0.73380	0.98	T	0.65175	-0.6232	10	0.20046	T	0.44	-13.497	12.3442	0.55111	0.0:0.0:0.1412:0.8588	.	565	Q7Z388	D19L4_HUMAN	A	565	ENSP00000389630:V565A	ENSP00000389630:V565A	V	+	2	0	DPY19L4	95862549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.415000	0.66411	0.833000	0.34828	0.455000	0.32223	GTG		0.308	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379339.1	NM_181787	
IRX2	153572	ucsc.edu	37	5	2748604	2748604	+	Silent	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr5:2748604A>G	ENST00000382611.6	-	3	1466	c.1218T>C	c.(1216-1218)ggT>ggC	p.G406G	IRX2_ENST00000502957.1_5'Flank|IRX2_ENST00000302057.5_Silent_p.G406G	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	406					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		ACCGCAGGAGACCCTGGCCCT	0.721																																						.											0													30.0	31.0	30.0					5																	2748604		2183	4282	6465	SO:0001819	synonymous_variant	153572			AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.1218T>C	5.37:g.2748604A>G			Q68A19|Q7Z2I7	Silent	SNP	ENST00000382611.6	37	CCDS3868.1																																																																																				0.721	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206749.2		
MMP26	56547	ucsc.edu	37	11	5010912	5010912	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr11:5010912A>G	ENST00000380390.1	+	3	350	c.134A>G	c.(133-135)gAg>gGg	p.E45G	MMP26_ENST00000300762.1_Missense_Mutation_p.E45G|MMP26_ENST00000477339.1_3'UTR			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26	45					collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	ACCAAGAAGGAGTCGCCACTC	0.463																																						.											0													58.0	50.0	53.0					11																	5010912		2201	4298	6499	SO:0001583	missense	56547			AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.134A>G	11.37:g.5010912A>G	ENSP00000369753:p.Glu45Gly		Q3MJ78|Q9GZS2|Q9NR87	Missense_Mutation	SNP	ENST00000380390.1	37	CCDS7752.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621616	0.46736	.	.	ENSG00000167346	ENST00000380390;ENST00000300762	T;T	0.38077	1.16;1.16	3.73	2.56	0.30785	Metallopeptidase, catalytic domain (1);	40.292300	0.00166	U	0.000011	T	0.32734	0.0839	L	0.50333	1.59	0.09310	N	1	P	0.43477	0.808	B	0.33799	0.17	T	0.31641	-0.9936	10	0.59425	D	0.04	-8.2391	7.0247	0.24934	0.7669:0.2331:0.0:0.0	.	45	Q9NRE1	MMP26_HUMAN	G	45	ENSP00000369753:E45G;ENSP00000300762:E45G	ENSP00000300762:E45G	E	+	2	0	MMP26	4967488	0.446000	0.25665	0.120000	0.21714	0.348000	0.29142	0.970000	0.29383	0.309000	0.22966	0.455000	0.32223	GAG		0.463	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142058.3	NM_021801	
CROCC	9696	mdanderson.org	37	1	17277573	17277573	+	Missense_Mutation	SNP	C	C	T	rs3969856		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr1:17277573C>T	ENST00000375541.5	+	20	3031	c.2962C>T	c.(2962-2964)Cgg>Tgg	p.R988W	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GCGGGAGCAGCGGGCAGCTCA	0.592																																						.											0													15.0	16.0	16.0					1																	17277573		2201	4293	6494	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2962C>T	1.37:g.17277573C>T	ENSP00000364691:p.Arg988Trp			Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183903	0.57800	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.23147	1.92	4.83	3.91	0.45181	.	.	.	.	.	T	0.41581	0.1165	L	0.50333	1.59	0.32100	N	0.59074	D;D	0.76494	0.999;0.999	D;D	0.66196	0.942;0.942	T	0.51810	-0.8658	9	0.72032	D	0.01	.	11.1907	0.48683	0.1842:0.8158:0.0:0.0	rs3969856	291;988	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	W	988;869	ENSP00000364691:R988W	ENSP00000364691:R988W	R	+	1	2	CROCC	17150160	0.999000	0.42202	1.000000	0.80357	0.970000	0.65996	1.759000	0.38420	1.347000	0.45714	0.556000	0.70494	CGG		0.592	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
FRG1B	284802	mdanderson.org	37	20	29628270	29628270	+	Missense_Mutation	SNP	G	G	A	rs545391756	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr20:29628270G>A	ENST00000278882.3	+	6	652	c.272G>A	c.(271-273)tGc>tAc	p.C91Y	FRG1B_ENST00000358464.4_Missense_Mutation_p.C91Y|FRG1B_ENST00000439954.2_Missense_Mutation_p.C96Y			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	91										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTTATTAGATGCAATGAAGCA	0.363													.|||	3	0.000599042	0.0	0.0029	5008	,	,		60821	0.001		0.0	False		,,,				2504	0.0					.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.272G>A	20.37:g.29628270G>A	ENSP00000278882:p.Cys91Tyr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	4.726	0.135070	0.09032	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.43294	0.95	2.08	2.08	0.27032	Actin cross-linking (1);	0.051706	0.85682	D	0.000000	T	0.39545	0.1082	.	.	.	0.29852	N	0.828316	B;P	0.40970	0.008;0.734	B;P	0.46850	0.036;0.529	T	0.31668	-0.9935	9	0.34782	T	0.22	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	96;91	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	Y	91;96;91	ENSP00000408863:C96Y	ENSP00000278882:C91Y	C	+	2	0	FRG1B	28241931	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.129000	0.64739	1.475000	0.48197	0.423000	0.28283	TGC		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628273	29628273	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr20:29628273A>G	ENST00000278882.3	+	6	655	c.275A>G	c.(274-276)aAt>aGt	p.N92S	FRG1B_ENST00000358464.4_Missense_Mutation_p.N92S|FRG1B_ENST00000439954.2_Missense_Mutation_p.N97S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	92										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATTAGATGCAATGAAGCAGGG	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.275A>G	20.37:g.29628273A>G	ENSP00000278882:p.Asn92Ser		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	5.285	0.237973	0.10023	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.41400	1.0	2.08	2.08	0.27032	Actin cross-linking (1);	0.091289	0.85682	D	0.000000	T	0.23649	0.0572	.	.	.	0.35235	D	0.777251	B;B	0.12630	0.001;0.006	B;B	0.14578	0.005;0.011	T	0.17319	-1.0373	9	0.16420	T	0.52	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	97;92	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	S	92;97;92	ENSP00000408863:N97S	ENSP00000278882:N92S	N	+	2	0	FRG1B	28241934	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.067000	0.71193	1.208000	0.43306	0.347000	0.21830	AAT		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628282	29628282	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr20:29628282G>A	ENST00000278882.3	+	6	664	c.284G>A	c.(283-285)gGg>gAg	p.G95E	FRG1B_ENST00000358464.4_Missense_Mutation_p.G95E|FRG1B_ENST00000439954.2_Missense_Mutation_p.G100E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATGAAGCAGGGGACATAGAA	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.284G>A	20.37:g.29628282G>A	ENSP00000278882:p.Gly95Glu		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.02	3.529440	0.64860	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56103	0.48	2.08	2.08	0.27032	Actin cross-linking (1);	0.051750	0.85682	D	0.000000	T	0.52092	0.1713	.	.	.	0.58432	D	0.999996	B;P	0.39940	0.309;0.696	P;P	0.46543	0.492;0.52	T	0.54221	-0.8326	9	0.45353	T	0.12	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	100;95	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	E	95;100;95	ENSP00000408863:G100E	ENSP00000278882:G95E	G	+	2	0	FRG1B	28241943	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GGG		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
GLTSCR2	29997	mdanderson.org	37	19	48258772	48258772	+	Silent	SNP	G	G	A	rs11083895	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr19:48258772G>A	ENST00000246802.5	+	9	1259	c.1221G>A	c.(1219-1221)ggG>ggA	p.G407G	CTD-2571L23.6_ENST00000602048.1_RNA|SNORD23_ENST00000408876.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	407						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		GAAGGCTGGGGCGGCTCAAGT	0.716													G|||	2618	0.522764	0.2315	0.5519	5008	,	,		7627	0.5575		0.672	False		,,,				2504	0.7065				Colon(58;613 1041 9473 10089 15241)	.											0								G		1117,1057		287,543,257	1.0	2.0	2.0		1221	2.9	1.0	19	dbSNP_120	2	4101,1193		1647,807,193	no	coding-synonymous	GLTSCR2	NM_015710.4		1934,1350,450	AA,AG,GG		22.5349,48.6201,30.1285		407/479	48258772	5218,2250	1087	2647	3734	SO:0001819	synonymous_variant	29997			AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1221G>A	19.37:g.48258772G>A			Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Silent	SNP	ENST00000246802.5	37	CCDS12705.1																																																																																				0.716	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
MUC4	4585	mdanderson.org	37	3	195506914	195506914	+	Missense_Mutation	SNP	G	G	A	rs186560307	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:195506914G>A	ENST00000463781.3	-	2	11996	c.11537C>T	c.(11536-11538)cCt>cTt	p.P3846L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3846L|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGGGATGGTGAC	0.582													.|||	658	0.13139	0.3699	0.0778	5008	,	,		7843	0.0129		0.0795	False		,,,				2504	0.0225					.											0													7.0	7.0	7.0					3																	195506914		367	1249	1616	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11537C>T	3.37:g.195506914G>A	ENSP00000417498:p.Pro3846Leu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	336	0.15384615384615385	81	0.16463414634146342	50	0.13812154696132597	110	0.19230769230769232	95	0.12532981530343007	g	4.937	0.174064	0.09391	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.51;1.45	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.15141	0.012	B	0.01281	0.0	T	0.40136	-0.9579	6	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3718	E7ESK3	.	L	3846	ENSP00000417498:P3846L;ENSP00000420243:P3846L	.	P	-	2	0	MUC4	196991693	0.043000	0.20138	0.054000	0.19295	0.054000	0.15201	1.244000	0.32778	0.064000	0.16427	0.064000	0.15345	CCT		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507683	195507683	+	Missense_Mutation	SNP	C	C	T	rs71187742	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:195507683C>T	ENST00000463781.3	-	2	11227	c.10768G>A	c.(10768-10770)Gct>Act	p.A3590T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3590T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.592													.|||	1596	0.31869	0.4054	0.2709	5008	,	,		10670	0.2857		0.2952	False		,,,				2504	0.2935					.											0													4.0	4.0	4.0					3																	195507683		535	1341	1876	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10768G>A	3.37:g.195507683C>T	ENSP00000417498:p.Ala3590Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	8.407	0.843310	0.16963	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33654	1.48;1.4	1.02	-2.03	0.07365	.	.	.	.	.	T	0.17662	0.0424	N	0.19112	0.55	0.09310	N	1	B	0.14805	0.011	B	0.04013	0.001	T	0.14420	-1.0473	8	.	.	.	.	3.5185	0.07734	0.0:0.2242:0.329:0.4468	.	3462	E7ESK3	.	T	3590	ENSP00000417498:A3590T;ENSP00000420243:A3590T	.	A	-	1	0	MUC4	196992462	0.005000	0.15991	0.001000	0.08648	0.065000	0.16274	-0.324000	0.07986	-2.638000	0.00430	-2.088000	0.00374	GCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195508133	195508133	+	Missense_Mutation	SNP	G	G	A	rs202065387		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:195508133G>A	ENST00000463781.3	-	2	10777	c.10318C>T	c.(10318-10320)Cct>Tct	p.P3440S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3440S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3440S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAACAGGGGTGGCGTGA	0.592																																						.											2	Substitution - Missense(2)	endometrium(2)											30.0	24.0	26.0					3																	195508133		685	1583	2268	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10318C>T	3.37:g.195508133G>A	ENSP00000417498:p.Pro3440Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	3.286	-0.146045	0.06627	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.58;1.55	.	.	.	.	.	.	.	.	T	0.22003	0.0530	N	0.14661	0.345	0.09310	N	1	P	0.48350	0.909	P	0.50440	0.641	T	0.15809	-1.0424	6	.	.	.	.	.	.	.	.	3312	E7ESK3	.	S	3440	ENSP00000417498:P3440S;ENSP00000420243:P3440S	.	P	-	1	0	MUC4	196992912	0.016000	0.18221	0.006000	0.13384	0.005000	0.04900	-0.684000	0.05173	0.088000	0.17205	0.089000	0.15464	CCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195515134	195515134	+	Missense_Mutation	SNP	G	G	T	rs374418206		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr3:195515134G>T	ENST00000463781.3	-	2	3776	c.3317C>A	c.(3316-3318)cCt>cAt	p.P1106H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1106H|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	538					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P1106H(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.572																																						.											2	Substitution - Missense(2)	skin(2)											8.0	7.0	7.0					3																	195515134		649	1454	2103	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3317C>A	3.37:g.195515134G>T	ENSP00000417498:p.Pro1106His		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.963	0.178958	0.09443	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34072	1.38;1.38	0.814	0.814	0.18756	.	.	.	.	.	T	0.38427	0.1040	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.21655	-1.0239	8	.	.	.	.	7.6132	0.28142	0.0:0.0:1.0:0.0	.	1106	E7ESK3	.	H	1106	ENSP00000417498:P1106H;ENSP00000420243:P1106H	.	P	-	2	0	MUC4	196999529	0.103000	0.21917	0.003000	0.11579	0.286000	0.27126	3.387000	0.52501	0.776000	0.33473	0.064000	0.15345	CCT		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1017710	1017710	+	Missense_Mutation	SNP	G	G	T	rs113964902		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr11:1017710G>T	ENST00000421673.2	-	31	5141	c.5091C>A	c.(5089-5091)caC>caA	p.H1697Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1697	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGAGGAAGTGTGTGAATGTA	0.552																																						.											0								T	GLN/HIS	175,4229	48.2+/-83.0	0,175,2027	827.0	810.0	816.0		5091	-2.9	0.0	11	dbSNP_132	816	52,8538	4.3+/-15.6	0,52,4243	yes	missense	MUC6	NM_005961.2	24	0,227,6270	TT,TG,GG		0.6054,3.9737,1.747	benign	1697/2440	1017710	227,12767	2202	4295	6497	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5091C>A	11.37:g.1017710G>T	ENSP00000406861:p.His1697Gln		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.248714	0.00268	0.039737	0.006054	ENSG00000184956	ENST00000421673	T	0.18657	2.2	1.46	-2.91	0.05631	.	.	.	.	.	T	0.01320	0.0043	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13072	-1.0523	9	0.05525	T	0.97	.	3.8678	0.09024	0.2346:0.0:0.4719:0.2935	.	1697	Q6W4X9	MUC6_HUMAN	Q	1697	ENSP00000406861:H1697Q	ENSP00000406861:H1697Q	H	-	3	2	MUC6	1007710	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-7.346000	0.00038	-4.248000	0.00062	-3.681000	0.00024	CAC		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OCEL1	79629	mdanderson.org	37	19	17337557	17337557	+	Missense_Mutation	SNP	G	G	T	rs10425488	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr19:17337557G>T	ENST00000215061.4	+	2	169	c.125G>T	c.(124-126)cGc>cTc	p.R42L	OCEL1_ENST00000601529.1_Missense_Mutation_p.R42L|OCEL1_ENST00000601576.1_3'UTR|OCEL1_ENST00000597836.1_5'UTR	NM_024578.1	NP_078854.1	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	42	Pro-rich.		R -> L (in dbSNP:rs10425488).							central_nervous_system(2)|endometrium(2)|kidney(1)|lung(2)	7						CGCAGGACCCGCCCATCAGCC	0.746													G|||	385	0.076877	0.115	0.0836	5008	,	,		10155	0.001		0.0755	False		,,,				2504	0.1002					.											0								G	LEU/ARG	300,3398		14,272,1563	4.0	6.0	6.0		125	3.0	0.1	19	dbSNP_119	6	480,6968		14,452,3258	no	missense	OCEL1	NM_024578.1	102	28,724,4821	TT,TG,GG		6.4447,8.1125,6.998	possibly-damaging	42/265	17337557	780,10366	1849	3724	5573	SO:0001583	missense	79629			BC029361	CCDS12351.1	19p13.11	2008-02-05				ENSG00000099330			26221	protein-coding gene	gene with protein product						12477932	Standard	NM_024578		Approved	FLJ22709	uc002nfp.3	Q9H607		ENST00000215061.4:c.125G>T	19.37:g.17337557G>T	ENSP00000215061:p.Arg42Leu			Missense_Mutation	SNP	ENST00000215061.4	37	CCDS12351.1	142	0.06501831501831502	54	0.10975609756097561	30	0.08287292817679558	0	0.0	58	0.07651715039577836	G	16.23	3.063736	0.55432	0.081125	0.064447	ENSG00000099330	ENST00000215061	T	0.32988	1.43	3.01	3.01	0.34805	.	0.596543	0.14714	N	0.302724	T	0.00666	0.0022	N	0.19112	0.55	0.80722	P	0.0	D	0.76494	0.999	D	0.79108	0.992	T	0.04855	-1.0922	9	0.39692	T	0.17	-18.151	6.1073	0.20081	0.1412:0.0:0.8588:0.0	rs10425488	42	Q9H607	OCEL1_HUMAN	L	42	ENSP00000215061:R42L	ENSP00000215061:R42L	R	+	2	0	OCEL1	17198557	0.003000	0.15002	0.067000	0.19924	0.403000	0.30841	0.226000	0.17776	2.001000	0.58596	0.491000	0.48974	CGC		0.746	OCEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463307.1	NM_024578	
PRAMEF11	440560	mdanderson.org	37	1	12885127	12885127	+	Silent	SNP	G	G	A	rs201757978	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr1:12885127G>A	ENST00000535591.1	-	4	1179	c.984C>T	c.(982-984)aaC>aaT	p.N328N	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	328					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GCAGGATGGCGTTGACTTGGG	0.517																																						.											0													11.0	8.0	9.0					1																	12885127		692	1569	2261	SO:0001819	synonymous_variant	440560			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.984C>T	1.37:g.12885127G>A				Silent	SNP	ENST00000535591.1	37	CCDS53268.1																																																																																				0.517	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
PRSS3	5646	mdanderson.org	37	9	33796801	33796801	+	Splice_Site	SNP	G	G	A	rs143707562		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr9:33796801G>A	ENST00000361005.5	+	2	371		c.e2+1		PRSS3_ENST00000379405.3_Splice_Site|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000429677.3_Splice_Site|PRSS3_ENST00000342836.4_Splice_Site	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			GCTACAAGACGTAAGTGTGGG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		18879	0.001		0.0	False		,,,				2504	0.0					.											0													70.0	70.0	70.0					9																	33796801		2203	4300	6503	SO:0001630	splice_region_variant	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.371+1G>A	9.37:g.33796801G>A			A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Splice_Site	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	G	7.509	0.654290	0.14580	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	.	.	.	3.21	2.29	0.28610	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1922	0.31374	0.1286:0.0:0.8714:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRSS3	33786801	1.000000	0.71417	0.775000	0.31657	0.032000	0.12392	8.277000	0.89896	0.482000	0.27582	0.306000	0.20318	.		0.597	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	Intron
PSG1	5669	mdanderson.org	37	19	43383680	43383680	+	Silent	SNP	G	G	T	rs1141653	byFrequency	TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr19:43383680G>T	ENST00000436291.2	-	1	170	c.54C>A	c.(52-54)ctC>ctA	p.L18L	PSG1_ENST00000595124.1_Silent_p.L18L|PSG1_ENST00000312439.6_Silent_p.L18L|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000244296.2_Silent_p.L18L|PSG1_ENST00000595356.1_Silent_p.L18L|PSG1_ENST00000403380.3_Silent_p.L18L	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	18					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CTGTGAGCAGGAGCCCCTTCC	0.552													.|||	1633	0.326078	0.4614	0.2046	5008	,	,		18648	0.4167		0.1014	False		,,,				2504	0.3671					.											0								G	,,	1275,1745		292,691,527	157.0	140.0	146.0		54,54,54	0.4	0.1	19	dbSNP_86	146	576,4838		45,486,2176	no	coding-synonymous,coding-synonymous,coding-synonymous	PSG1	NM_001184825.1,NM_001184826.1,NM_006905.2	,,	337,1177,2703	TT,TG,GG		10.6391,42.2185,21.9469	,,	18/420,18/418,18/427	43383680	1851,6583	1510	2707	4217	SO:0001819	synonymous_variant	5669				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.54C>A	19.37:g.43383680G>T			O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	ENST00000436291.2	37	CCDS54275.1																																																																																				0.552	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
TAS2R30	259293	mdanderson.org	37	12	11286797	11286797	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr12:11286797A>G	ENST00000539585.1	-	1	446	c.47T>C	c.(46-48)aTa>aCa	p.I16T	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	16					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						AATAACAAATATAACCACTAT	0.328																																						.											0													37.0	36.0	36.0					12																	11286797		1857	4109	5966	SO:0001583	missense	259293			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.47T>C	12.37:g.11286797A>G	ENSP00000444736:p.Ile16Thr		Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	3.387	-0.125111	0.06795	.	.	ENSG00000256188	ENST00000539585	T	0.43294	0.95	3.32	-6.27	0.02026	.	.	.	.	.	T	0.17323	0.0416	N	0.16307	0.4	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20638	-1.0269	9	0.21540	T	0.41	.	1.1532	0.01790	0.4816:0.113:0.1571:0.2483	.	16	P59541	T2R30_HUMAN	T	16	ENSP00000444736:I16T	ENSP00000444736:I16T	I	-	2	0	TAS2R30	11178064	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.252000	0.08806	-0.959000	0.03618	-0.756000	0.03474	ATA		0.328	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
TAS2R30	259293	mdanderson.org	37	12	11286807	11286807	+	Missense_Mutation	SNP	T	T	C	rs113282241		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr12:11286807T>C	ENST00000539585.1	-	1	436	c.37A>G	c.(37-39)Ata>Gta	p.I13V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	13					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						ATAACCACTATTAGAATGGAA	0.333																																						.											0													34.0	32.0	33.0					12																	11286807		1831	4096	5927	SO:0001583	missense	259293			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.37A>G	12.37:g.11286807T>C	ENSP00000444736:p.Ile13Val		Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.759083	0.00657	.	.	ENSG00000256188	ENST00000539585	T	0.37058	1.22	3.32	-6.48	0.01896	.	.	.	.	.	T	0.11067	0.0270	N	0.10707	0.03	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34254	-0.9836	9	0.05351	T	0.99	.	3.7014	0.08384	0.4494:0.2835:0.0:0.2671	.	13	P59541	T2R30_HUMAN	V	13	ENSP00000444736:I13V	ENSP00000444736:I13V	I	-	1	0	TAS2R30	11178074	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-6.625000	0.00059	-0.746000	0.04766	-1.972000	0.00464	ATA		0.333	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
TAS2R30	259293	mdanderson.org	37	12	11286820	11286820	+	Silent	SNP	A	A	T	rs111958076		TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr12:11286820A>T	ENST00000539585.1	-	1	423	c.24T>A	c.(22-24)atT>atA	p.I8I	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	8					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						GAATGGAAAAAATGATGGGCA	0.328																																						.											0													30.0	28.0	29.0					12																	11286820		1816	4079	5895	SO:0001819	synonymous_variant	259293			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.24T>A	12.37:g.11286820A>T			Q645X7	Silent	SNP	ENST00000539585.1	37	CCDS53750.1																																																																																				0.328	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
SPTA1	6708	bcgsc.ca	37	1	158646033	158646033	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr1:158646033T>C	ENST00000368147.4	-	8	1190	c.1010A>G	c.(1009-1011)gAt>gGt	p.D337G		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	337					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTGAGGTGCATCTGAAGGATG	0.463																																						.											0													214.0	203.0	206.0					1																	158646033		1927	4146	6073	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1010A>G	1.37:g.158646033T>C	ENSP00000357129:p.Asp337Gly		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.264331	0.80358	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.37584	1.19;1.19	4.91	4.91	0.64330	.	0.511732	0.14639	N	0.307348	T	0.22551	0.0544	L	0.28400	0.85	0.43381	D	0.995486	B	0.29115	0.233	B	0.39465	0.3	T	0.13442	-1.0509	10	0.56958	D	0.05	.	13.5333	0.61633	0.0:0.0:0.0:1.0	.	337	P02549	SPTA1_HUMAN	G	337	ENSP00000357130:D337G;ENSP00000357129:D337G	ENSP00000357129:D337G	D	-	2	0	SPTA1	156912657	1.000000	0.71417	0.373000	0.26003	0.971000	0.66376	6.818000	0.75257	2.033000	0.60031	0.533000	0.62120	GAT		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SYMPK	8189	bcgsc.ca	37	19	46319186	46319186	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr19:46319186A>G	ENST00000245934.7	-	26	3854	c.3610T>C	c.(3610-3612)Ttc>Ctc	p.F1204L	RSPH6A_ENST00000597055.1_5'Flank|SYMPK_ENST00000598155.1_5'UTR|RSPH6A_ENST00000221538.3_5'Flank	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1204					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		ATGCTGATGAAGATGCCCGGG	0.687																																						.											0													16.0	17.0	17.0					19																	46319186		2185	4264	6449	SO:0001583	missense	8189			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3610T>C	19.37:g.46319186A>G	ENSP00000245934:p.Phe1204Leu		O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	37	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463226	0.84425	.	.	ENSG00000125755	ENST00000245934	.	.	.	4.24	4.24	0.50183	.	0.360544	0.26163	N	0.025976	T	0.36552	0.0971	N	0.24115	0.695	0.39418	D	0.966874	B	0.29037	0.231	B	0.24701	0.055	T	0.40701	-0.9549	9	0.87932	D	0	.	9.7033	0.40200	1.0:0.0:0.0:0.0	.	1204	Q92797	SYMPK_HUMAN	L	1204	.	ENSP00000245934:F1204L	F	-	1	0	SYMPK	51011026	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	3.177000	0.50871	1.795000	0.52594	0.241000	0.17934	TTC		0.687	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
NIPBL	25836	bcgsc.ca	37	5	37016193	37016193	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr5:37016193T>C	ENST00000282516.8	+	23	5196	c.4697T>C	c.(4696-4698)gTt>gCt	p.V1566A	NIPBL_ENST00000448238.2_Missense_Mutation_p.V1566A	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1566					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GAAAATTTTGTTCAAGACCTT	0.378																																						.											0													101.0	94.0	97.0					5																	37016193		2203	4300	6503	SO:0001583	missense	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4697T>C	5.37:g.37016193T>C	ENSP00000282516:p.Val1566Ala		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.774543	0.90108	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.67698	-0.28;-0.28	5.97	5.97	0.96955	Armadillo-like helical (1);Armadillo-type fold (1);	0.064966	0.64402	D	0.000012	T	0.72930	0.3522	M	0.81802	2.56	0.58432	D	0.999996	P;P	0.45212	0.77;0.853	B;B	0.43536	0.242;0.423	T	0.78275	-0.2267	10	0.87932	D	0	.	16.4534	0.84003	0.0:0.0:0.0:1.0	.	1566;1566	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	A	1566	ENSP00000282516:V1566A;ENSP00000406266:V1566A	ENSP00000282516:V1566A	V	+	2	0	NIPBL	37051950	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.694000	0.84235	2.285000	0.76669	0.477000	0.44152	GTT		0.378	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
ADAM2	2515	bcgsc.ca	37	8	39694680	39694680	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr8:39694680A>T	ENST00000265708.4	-	2	210	c.107T>A	c.(106-108)aTa>aAa	p.I36K	ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000521880.1_Missense_Mutation_p.I36K|ADAM2_ENST00000379853.2_Missense_Mutation_p.I36K|ADAM2_ENST00000347580.4_Missense_Mutation_p.I36K	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	36					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TTCCTTTATTATTGACCGTAT	0.303																																						.											0													75.0	75.0	75.0					8																	39694680		2203	4297	6500	SO:0001583	missense	2515			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.107T>A	8.37:g.39694680A>T	ENSP00000265708:p.Ile36Lys		P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	A	0.042	-1.282486	0.01398	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.01963	5.15;4.53;5.4;5.36	3.83	-4.84	0.03151	.	.	.	.	.	T	0.01387	0.0045	N	0.16656	0.425	0.09310	N	1	B;B;B;B	0.14012	0.004;0.009;0.004;0.004	B;B;B;B	0.18263	0.021;0.005;0.006;0.021	T	0.48305	-0.9047	8	.	.	.	.	6.1222	0.20159	0.3043:0.0:0.5209:0.1748	.	36;36;36;36	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	K	36	ENSP00000343854:I36K;ENSP00000369182:I36K;ENSP00000265708:I36K;ENSP00000429352:I36K	.	I	-	2	0	ADAM2	39813837	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.291000	0.02775	-0.975000	0.03546	0.477000	0.44152	ATA		0.303	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
UBQLN1	29979	bcgsc.ca	37	9	86322501	86322501	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr9:86322501delG	ENST00000376395.4	-	1	617	c.94delC	c.(94-96)ccgfs	p.P32fs	UBQLN1_ENST00000257468.7_Frame_Shift_Del_p.P32fs|RP11-522I20.3_ENST00000531661.1_RNA|RP11-522I20.3_ENST00000524818.1_RNA	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	32					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						TTGGGCTCCGCGGAGGCAGCG	0.672																																					Melanoma(186;1284 2073 12755 14558 18426)	.											0													14.0	14.0	14.0					9																	86322501		2194	4287	6481	SO:0001589	frameshift_variant	29979			AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.94delC	9.37:g.86322501delG	ENSP00000365576:p.Pro32fs		Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Del	DEL	ENST00000376395.4	37	CCDS6663.1																																																																																				0.672	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
UBQLN1	29979	bcgsc.ca	37	9	86322503	86322506	+	Frame_Shift_Del	DEL	GGAG	GGAG	-			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	GGAG	GGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chr9:86322503_86322506delGGAG	ENST00000376395.4	-	1	612_615	c.89_92delCTCC	c.(88-93)gctcccfs	p.AP30fs	UBQLN1_ENST00000257468.7_Frame_Shift_Del_p.AP30fs|RP11-522I20.3_ENST00000531661.1_RNA|RP11-522I20.3_ENST00000524818.1_RNA	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	30					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						GGGCTCCGCGGAGGCAGCGGCCGC	0.676																																					Melanoma(186;1284 2073 12755 14558 18426)	.											0																																										SO:0001589	frameshift_variant	29979			AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.89_92delCTCC	9.37:g.86322503_86322506delGGAG	ENSP00000365576:p.Ala30fs		Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Frame_Shift_Del	DEL	ENST00000376395.4	37	CCDS6663.1																																																																																				0.676	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
MT-CO1	4512	bcgsc.ca	37	M	5983	5983	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8325-01A-11D-2310-10	TCGA-KL-8325-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9fc0e0e8-1b0f-400c-b4cf-126193283695	4ff5a4a6-94f8-4f4c-ae7c-9b1ddb971fb7	g.chrM:5983delG	ENST00000361624.2	+	1	80	c.80delG	c.(79-81)ggafs	p.G27fs	MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	27					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CGCATGAGCTGGAGTCCTAGG	0.507																																						.											0																																										SO:0001589	frameshift_variant	5742					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.80delG	M.37:g.5983delG	ENSP00000354499:p.Gly27fs		Q34770	Frame_Shift_Del	DEL	ENST00000361624.2	37																																																																																					0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
