#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMP3	4314	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	11	102709283	102709283	+	Splice_Site	SNP	T	T	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:102709283T>G	ENST00000299855.5	-	8	1484	c.1228A>C	c.(1228-1230)Aga>Cga	p.R410R	WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	410					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	GCATCTCACCTCCAGTATTTG	0.423																																						.											0													156.0	153.0	154.0					11																	102709283		2203	4299	6502	SO:0001630	splice_region_variant	4314			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.1229+1A>C	11.37:g.102709283T>G			B2R8B8|Q3B7S0|Q6GRF8	Silent	SNP	ENST00000299855.5	37	CCDS8323.1																																																																																				0.423	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109758.2	NM_002422	Silent
KCNJ8	3764	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	21918737	21918737	+	Silent	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr12:21918737G>T	ENST00000240662.2	-	3	1540	c.1195C>A	c.(1195-1197)Cga>Aga	p.R399R	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	399					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)	p.R399*(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	TTGTTCCTTCGGATAGAATTG	0.418																																						.											1	Substitution - Nonsense(1)	large_intestine(1)											144.0	139.0	140.0					12																	21918737		2203	4300	6503	SO:0001819	synonymous_variant	3764			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.1195C>A	12.37:g.21918737G>T			O00657	Silent	SNP	ENST00000240662.2	37	CCDS8692.1																																																																																				0.418	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982	
RPH3A	22895	hgsc.bcm.edu;mdanderson.org	37	12	113303275	113303275	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr12:113303275A>G	ENST00000389385.4	+	6	784	c.287A>G	c.(286-288)aAc>aGc	p.N96S	RPH3A_ENST00000551052.1_Missense_Mutation_p.N92S|RPH3A_ENST00000447659.2_Missense_Mutation_p.N47S|RPH3A_ENST00000543106.2_Missense_Mutation_p.N96S|RPH3A_ENST00000415485.3_Missense_Mutation_p.N96S|RPH3A_ENST00000548866.1_Missense_Mutation_p.N47S|RPH3A_ENST00000420983.2_Missense_Mutation_p.N96S	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	96	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GATGGGGTGAACCGCTGCATA	0.527																																						.											0													204.0	178.0	187.0					12																	113303275		2203	4300	6503	SO:0001583	missense	22895			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.287A>G	12.37:g.113303275A>G	ENSP00000374036:p.Asn96Ser		B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	A	5.941	0.357590	0.11239	.	.	ENSG00000089169	ENST00000548197;ENST00000543106;ENST00000551593;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000447659;ENST00000550901;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	5.61	4.47	0.54385	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Rabphilin-3A effector, zinc-binding (1);Zinc finger, FYVE/PHD-type (1);	0.080012	0.50627	D	0.000101	T	0.59321	0.2185	N	0.25332	0.735	0.41201	D	0.986372	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.001;0.001;0.001	T	0.51403	-0.8710	10	0.21540	T	0.41	.	10.5859	0.45282	0.9234:0.0:0.0766:0.0	.	47;96;96;92	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	S	96;96;96;96;96;96;96;96;47;29;96;92;96;96;47;96	ENSP00000446570:N96S;ENSP00000440384:N96S;ENSP00000446780:N96S;ENSP00000450382:N96S;ENSP00000449613:N96S;ENSP00000447505:N96S;ENSP00000449650:N96S;ENSP00000374036:N96S;ENSP00000413254:N47S;ENSP00000448100:N29S;ENSP00000447083:N96S;ENSP00000448297:N92S;ENSP00000405357:N96S;ENSP00000450216:N96S;ENSP00000450347:N47S;ENSP00000408889:N96S	ENSP00000374036:N96S	N	+	2	0	RPH3A	111787658	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.592000	0.46171	0.958000	0.37956	0.533000	0.62120	AAC		0.527	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
SKI	6497	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	2235813	2235813	+	Missense_Mutation	SNP	G	G	T	rs376322470		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:2235813G>T	ENST00000378536.4	+	5	1628	c.1556G>T	c.(1555-1557)cGt>cTt	p.R519L		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	519					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		CCGGGTGCGCGTGCCCTGCCC	0.706																																					Ovarian(177;144 1678 13697 20086 27838 40755)	.											0													80.0	62.0	68.0					1																	2235813		2075	4070	6145	SO:0001583	missense	6497			X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1556G>T	1.37:g.2235813G>T	ENSP00000367797:p.Arg519Leu		Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	.	.	.	.	.	.	.	.	.	.	G	0.567	-0.842773	0.02671	.	.	ENSG00000157933	ENST00000378536	D	0.95518	-3.73	4.37	0.75	0.18387	.	0.561044	0.18536	N	0.138348	T	0.81635	0.4864	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71925	-0.4445	10	0.19147	T	0.46	-1.0583	2.8354	0.05513	0.4735:0.0:0.1886:0.3379	.	519	P12755	SKI_HUMAN	L	519	ENSP00000367797:R519L	ENSP00000367797:R519L	R	+	2	0	SKI	2225673	0.250000	0.23951	0.007000	0.13788	0.021000	0.10359	1.320000	0.33666	-0.040000	0.13580	-0.367000	0.07326	CGT		0.706	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
MYO5C	55930	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	15	52562050	52562050	+	Silent	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr15:52562050G>A	ENST00000261839.7	-	8	1001	c.840C>T	c.(838-840)gcC>gcT	p.A280A	MYO5C_ENST00000541028.1_Intron|MYO5C_ENST00000443683.2_Silent_p.A223A	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	280	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TAAATTCTTCGGCACTCCCTG	0.378																																						.											0													167.0	151.0	156.0					15																	52562050		1859	4100	5959	SO:0001819	synonymous_variant	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.840C>T	15.37:g.52562050G>A			Q6P1W8	Silent	SNP	ENST00000261839.7	37	CCDS42036.1																																																																																				0.378	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
GSC2	2928	hgsc.bcm.edu;mdanderson.org	37	22	19137290	19137290	+	Silent	SNP	G	G	A	rs201641909	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr22:19137290G>A	ENST00000086933.2	-	2	398	c.399C>T	c.(397-399)ttC>ttT	p.F133F		NM_005315.1	NP_005306.1	O15499	GSC2_HUMAN	goosecoid homeobox 2	133					anatomical structure morphogenesis (GO:0009653)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	Colorectal(54;0.0993)					GCTCTTCGCTGAAGATGGTGC	0.716													g|||	8	0.00159744	0.0053	0.0014	5008	,	,		8606	0.0		0.0	False		,,,				2504	0.0					.											0										4,4216		0,4,2106	8.0	10.0	10.0		399	3.5	1.0	22		10	0,8348		0,0,4174	no	coding-synonymous	GSC2	NM_005315.1		0,4,6280	AA,AG,GG		0.0,0.0948,0.0318		133/206	19137290	4,12564	2110	4174	6284	SO:0001819	synonymous_variant	2928				CCDS13757.1	22q11.21	2011-06-20	2007-08-28	2007-08-28	ENSG00000063515	ENSG00000063515		"""Homeoboxes / PRD class"""	4613	protein-coding gene	gene with protein product		601845	"""goosecoid-like"""	GSCL		9150167	Standard	NM_005315		Approved		uc011ags.2	O15499	OTTHUMG00000150122	ENST00000086933.2:c.399C>T	22.37:g.19137290G>A				Silent	SNP	ENST00000086933.2	37	CCDS13757.1																																																																																				0.716	GSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316440.2	NM_005315	
PPM1G	5496	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	27607890	27607890	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:27607890G>A	ENST00000344034.4	-	5	739	c.475C>T	c.(475-477)Cgc>Tgc	p.R159C	PPM1G_ENST00000350803.4_Missense_Mutation_p.R159C	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	159					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					TGCCCGTAGCGTGTCAGCAGC	0.597																																						.											0													143.0	144.0	144.0					2																	27607890		2203	4300	6503	SO:0001583	missense	5496			Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.475C>T	2.37:g.27607890G>A	ENSP00000342778:p.Arg159Cys			Missense_Mutation	SNP	ENST00000344034.4	37	CCDS1752.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.398817	0.83120	.	.	ENSG00000115241	ENST00000344034;ENST00000350803;ENST00000544412;ENST00000395543	T;T	0.54279	0.58;0.58	5.75	5.75	0.90469	Protein phosphatase 2C-like (3);	0.000000	0.85682	D	0.000000	T	0.71451	0.3341	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.985;0.99	T	0.72792	-0.4186	10	0.87932	D	0	-7.4083	18.4871	0.90833	0.0:0.0:1.0:0.0	.	29;159	Q59GB2;O15355	.;PPM1G_HUMAN	C	159;159;142;29	ENSP00000342778:R159C;ENSP00000264714:R159C	ENSP00000342778:R159C	R	-	1	0	PPM1G	27461394	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.309000	0.72825	2.728000	0.93425	0.655000	0.94253	CGC		0.597	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215032.1	NM_002707	
RBM47	54502	broad.mit.edu;hgsc.bcm.edu	37	4	40438607	40438608	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:40438607_40438608insT	ENST00000381793.2	-	4	1576_1577	c.1180_1181insA	c.(1180-1182)aggfs	p.R394fs	RBM47_ENST00000515809.1_Intron|RBM47_ENST00000319592.4_Intron|RBM47_ENST00000514014.1_Frame_Shift_Ins_p.R356fs|RBM47_ENST00000295971.7_Frame_Shift_Ins_p.R394fs|RBM47_ENST00000381795.6_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	394					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GTAGGAACCCCTAGGCCCTGGG	0.515																																						.											0																																										SO:0001589	frameshift_variant	54502			AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.1181dupA	4.37:g.40438608_40438608dupT	ENSP00000371212:p.Arg394fs		A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Frame_Shift_Ins	INS	ENST00000381793.2	37	CCDS43223.1																																																																																				0.515	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
UGT2B7	7364	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	4	69978239	69978239	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:69978239C>T	ENST00000305231.7	+	6	1421	c.1375C>T	c.(1375-1377)Cga>Tga	p.R459*	UGT2B7_ENST00000508661.1_3'UTR|UGT2B7_ENST00000509763.1_3'UTR	NM_001074.2	NP_001065.2	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	459					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GCCCCTGGATCGAGCAGTCTT	0.423																																						.											0													109.0	111.0	111.0					4																	69978239		2203	4297	6500	SO:0001587	stop_gained	7364			BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000305231.7:c.1375C>T	4.37:g.69978239C>T	ENSP00000304811:p.Arg459*		B2R810|Q6GTW0	Nonsense_Mutation	SNP	ENST00000305231.7	37	CCDS3526.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295865	0.60086	.	.	ENSG00000171234	ENST00000305231	.	.	.	2.13	0.0314	0.14171	.	0.339461	0.24645	U	0.036762	.	.	.	.	.	.	0.26224	N	0.979115	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7846	0.29085	0.6381:0.3619:0.0:0.0	.	.	.	.	X	459	.	.	R	+	1	2	UGT2B7	70012828	0.842000	0.29525	0.479000	0.27329	0.846000	0.48090	0.072000	0.14617	-0.197000	0.10350	0.306000	0.20318	CGA		0.423	UGT2B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251560.1	NM_001074	
RUFY3	22902	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	71588442	71588442	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:71588442C>A	ENST00000226328.4	+	1	715	c.152C>A	c.(151-153)aCa>aAa	p.T51K	RUFY3_ENST00000381006.3_Missense_Mutation_p.T51K|RUFY3_ENST00000417478.2_Intron|RUFY3_ENST00000536664.1_Missense_Mutation_p.T17K	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	51					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			ATCTCACTTACACCTGACCCA	0.532																																						.											0													166.0	136.0	146.0					4																	71588442		2203	4300	6503	SO:0001583	missense	22902			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.152C>A	4.37:g.71588442C>A	ENSP00000226328:p.Thr51Lys		B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755538	0.89843	.	.	ENSG00000018189	ENST00000381006;ENST00000226328;ENST00000536664	T;T;T	0.11821	3.11;2.74;2.77	5.51	5.51	0.81932	.	0.806005	0.11213	N	0.587473	T	0.26195	0.0639	N	0.14661	0.345	0.58432	D	0.999998	D;D;D	0.76494	0.982;0.999;0.981	D;D;D	0.80764	0.939;0.994;0.95	T	0.29150	-1.0021	10	0.56958	D	0.05	-2.8095	19.4131	0.94683	0.0:1.0:0.0:0.0	.	17;51;51	B4DKC2;Q7L099-3;Q7L099	.;.;RUFY3_HUMAN	K	51;51;17	ENSP00000370394:T51K;ENSP00000226328:T51K;ENSP00000443652:T17K	ENSP00000226328:T51K	T	+	2	0	RUFY3	71807306	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.487000	0.81328	2.590000	0.87494	0.555000	0.69702	ACA		0.532	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
ANK2	287	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	114275928	114275928	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:114275928C>T	ENST00000357077.4	+	38	6207	c.6154C>T	c.(6154-6156)Cga>Tga	p.R2052*	ANK2_ENST00000264366.6_Nonsense_Mutation_p.R2019*|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2052					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GACAATCAAACGAGGCCAGAG	0.468																																						.											0													70.0	81.0	78.0					4																	114275928		2203	4300	6503	SO:0001587	stop_gained	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6154C>T	4.37:g.114275928C>T	ENSP00000349588:p.Arg2052*		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Nonsense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	42	9.343468	0.99143	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	.	.	.	5.53	3.77	0.43336	.	0.299436	0.24096	N	0.041583	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.535	0.33357	0.2778:0.6531:0.0:0.0691	.	.	.	.	X	2052;2019	.	.	R	+	1	2	ANK2	114495377	0.938000	0.31826	0.705000	0.30386	0.131000	0.20780	0.989000	0.29629	0.767000	0.33267	-0.311000	0.09066	CGA		0.468	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
DST	667	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	56417258	56417258	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr6:56417258T>A	ENST00000361203.3	-	57	15706	c.15699A>T	c.(15697-15699)aaA>aaT	p.K5233N	DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.K3147N|DST_ENST00000370769.4_Missense_Mutation_p.K5235N|DST_ENST00000244364.6_Missense_Mutation_p.K2821N|DST_ENST00000370788.2_Missense_Mutation_p.K3147N|DST_ENST00000370754.5_Missense_Mutation_p.K5413N|DST_ENST00000446842.2_Missense_Mutation_p.K4909N			Q03001	DYST_HUMAN	dystonin	5233					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCTTGCAGGTTTTATTGGCAT	0.418																																						.											0													70.0	67.0	68.0					6																	56417258		1903	4119	6022	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.15699A>T	6.37:g.56417258T>A	ENSP00000354508:p.Lys5233Asn		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	13.73	2.322902	0.41096	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27	6.17	2.29	0.28610	.	0.207502	0.33290	N	0.005076	T	0.36054	0.0953	M	0.65975	2.015	0.28083	N	0.932106	D;P;D;B;B	0.89917	1.0;0.749;0.965;0.181;0.352	D;P;P;B;B	0.83275	0.996;0.515;0.854;0.036;0.138	T	0.26849	-1.0091	9	0.16896	T	0.51	.	9.5559	0.39339	0.0:0.3696:0.0:0.6304	.	3147;5235;5413;5233;2821	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	N	2821;5413;5235;3147;4909;3147;5233	ENSP00000244364:K2821N;ENSP00000359790:K5413N;ENSP00000359805:K5235N;ENSP00000400883:K3147N;ENSP00000393645:K4909N;ENSP00000359824:K3147N;ENSP00000354508:K5233N	ENSP00000244364:K2821N	K	-	3	2	DST	56525217	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	0.907000	0.28531	0.144000	0.18951	-0.290000	0.09829	AAA		0.418	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
TONSL	4796	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	8	145661996	145661996	+	Silent	SNP	C	C	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr8:145661996C>T	ENST00000409379.3	-	16	1988	c.1959G>A	c.(1957-1959)acG>acA	p.T653T	AC084125.4_ENST00000442850.1_RNA|AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	653					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCTTCTGCCGCGTCTCCAGGT	0.672																																						.											0													46.0	48.0	47.0					8																	145661996		2203	4300	6503	SO:0001819	synonymous_variant	4796				CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.1959G>A	8.37:g.145661996C>T			B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Silent	SNP	ENST00000409379.3	37	CCDS34968.2																																																																																				0.672	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
ZCCHC6	79670	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	88937294	88937294	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr9:88937294G>A	ENST00000375963.3	-	14	3146	c.2974C>T	c.(2974-2976)Cca>Tca	p.P992S	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.P992S|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.P281S|ZCCHC6_ENST00000375957.1_5'Flank|ZCCHC6_ENST00000375960.2_Intron	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	992					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						GGTGTTAATGGTGGCAGAGGT	0.373																																						.											0													121.0	122.0	121.0					9																	88937294		2203	4300	6503	SO:0001583	missense	79670			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2974C>T	9.37:g.88937294G>A	ENSP00000365130:p.Pro992Ser		Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305275	0.60305	.	.	ENSG00000083223	ENST00000277141;ENST00000375961;ENST00000375963	T;T;T	0.58210	0.35;0.75;0.81	5.48	5.48	0.80851	.	0.109012	0.64402	D	0.000007	T	0.51958	0.1705	L	0.52126	1.63	0.52099	D	0.999946	P	0.45672	0.864	B	0.41332	0.354	T	0.53078	-0.8489	10	0.44086	T	0.13	-48.2633	19.5559	0.95347	0.0:0.0:1.0:0.0	.	992	Q5VYS8	TUT7_HUMAN	S	281;992;992	ENSP00000277141:P281S;ENSP00000365128:P992S;ENSP00000365130:P992S	ENSP00000277141:P281S	P	-	1	0	ZCCHC6	88127114	1.000000	0.71417	0.995000	0.50966	0.827000	0.46813	4.036000	0.57304	2.861000	0.98227	0.650000	0.86243	CCA		0.373	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
THOC2	57187	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	122759902	122759902	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chrX:122759902G>A	ENST00000245838.8	-	25	2949	c.2918C>T	c.(2917-2919)aCc>aTc	p.T973I	THOC2_ENST00000491737.1_Missense_Mutation_p.T858I|THOC2_ENST00000355725.4_Missense_Mutation_p.T973I	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	973					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TTTTGTGATGGTCTCATTTTT	0.343																																						.											0													68.0	59.0	62.0					X																	122759902		1805	4069	5874	SO:0001583	missense	57187			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.2918C>T	X.37:g.122759902G>A	ENSP00000245838:p.Thr973Ile		A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220729	0.79464	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737	T;T;T	0.22539	1.95;1.95;1.95	5.83	5.83	0.93111	THO complex, subunitTHOC2, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.41949	0.1181	L	0.61036	1.89	0.80722	D	1	D	0.59767	0.986	P	0.60609	0.877	T	0.04900	-1.0919	10	0.27785	T	0.31	-5.9519	19.0992	0.93266	0.0:0.0:1.0:0.0	.	973	Q8NI27	THOC2_HUMAN	I	973;973;858	ENSP00000245838:T973I;ENSP00000347959:T973I;ENSP00000419795:T858I	ENSP00000245838:T973I	T	-	2	0	THOC2	122587583	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.810000	0.99221	2.460000	0.83146	0.600000	0.82982	ACC		0.343	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
RBMX	27316	hgsc.bcm.edu	37	X	135956574	135956574	+	Silent	SNP	C	C	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chrX:135956574C>G	ENST00000320676.7	-	9	1057	c.903G>C	c.(901-903)ccG>ccC	p.P301P	RBMX_ENST00000570135.1_Silent_p.P166P|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000562646.1_3'UTR|RBMX_ENST00000565438.1_Silent_p.P173P|RBMX_ENST00000496459.2_5'Flank	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	301					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CATAAGATGGCGGGGGCCCTC	0.463																																						.											0													92.0	86.0	88.0					X																	135956574		2203	4300	6503	SO:0001819	synonymous_variant	27316				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.903G>C	X.37:g.135956574C>G			B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Silent	SNP	ENST00000320676.7	37	CCDS14661.1																																																																																				0.463	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
MTM1	4534	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	149764981	149764981	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chrX:149764981A>G	ENST00000370396.2	+	3	137	c.83A>G	c.(82-84)aAt>aGt	p.N28S	MTM1_ENST00000542741.1_5'UTR|MTM1_ENST00000543350.1_5'UTR|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000413012.2_Missense_Mutation_p.N28S	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	28					endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					GATGGAGTCAATCGAGATCTC	0.418																																						.											0													143.0	113.0	123.0					X																	149764981		2203	4300	6503	SO:0001583	missense	4534			U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.83A>G	X.37:g.149764981A>G	ENSP00000359423:p.Asn28Ser		A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	37	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	A	9.073	0.997307	0.19043	.	.	ENSG00000171100	ENST00000370396;ENST00000424519;ENST00000413012	D;D;D	0.95821	-3.82;-3.5;-3.82	5.68	-4.87	0.03123	.	0.547300	0.21719	N	0.070141	D	0.85186	0.5639	N	0.13235	0.315	0.19575	N	0.999969	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.74569	-0.3622	10	0.27785	T	0.31	.	5.7616	0.18203	0.4035:0.4309:0.0684:0.0973	.	28;28	B7Z491;Q13496	.;MTM1_HUMAN	S	28	ENSP00000359423:N28S;ENSP00000400699:N28S;ENSP00000389157:N28S	ENSP00000359423:N28S	N	+	2	0	MTM1	149515639	0.414000	0.25408	0.000000	0.03702	0.693000	0.40251	1.427000	0.34881	-0.704000	0.05042	-0.508000	0.04489	AAT		0.418	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252	
GLB1L2	89944	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	134214285	134214285	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:134214285G>T	ENST00000535456.2	+	3	477	c.289G>T	c.(289-291)Gtt>Ttt	p.V97F	GLB1L2_ENST00000339772.7_Missense_Mutation_p.V97F|GLB1L2_ENST00000389881.3_Missense_Mutation_p.V97F	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	97					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		TTGCAGCTATGTTCCGTGGAA	0.453																																						.											0													203.0	195.0	198.0					11																	134214285		2201	4297	6498	SO:0001583	missense	89944				CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.289G>T	11.37:g.134214285G>T	ENSP00000444628:p.Val97Phe		A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	ENST00000535456.2	37	CCDS31724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.26|18.26	3.585501|3.585501	0.66105|0.66105	.|.	.|.	ENSG00000149328|ENSG00000149328	ENST00000525089|ENST00000339772;ENST00000535456;ENST00000389881	.|D;D;D	.|0.98996	.|-5.31;-5.31;-5.31	5.05|5.05	1.97|1.97	0.26223|0.26223	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.|0.138414	.|0.48286	.|D	.|0.000194	D|D	0.99111|0.99111	0.9694|0.9694	M|M	0.85630|0.85630	2.765|2.765	0.50171|0.50171	D|D	0.999851|0.999851	.|D	.|0.76494	.|0.999	.|D	.|0.79784	.|0.993	D|D	0.99486|0.99486	1.0949|1.0949	5|10	.|0.87932	.|D	.|0	-11.9247|-11.9247	10.8771|10.8771	0.46917|0.46917	0.2379:0.0:0.7621:0.0|0.2379:0.0:0.7621:0.0	.|.	.|97	.|Q8IW92	.|GLBL2_HUMAN	F|F	35|97	.|ENSP00000344659:V97F;ENSP00000444628:V97F;ENSP00000374531:V97F	.|ENSP00000344659:V97F	C|V	+|+	2|1	0|0	GLB1L2|GLB1L2	133719495|133719495	1.000000|1.000000	0.71417|0.71417	0.878000|0.878000	0.34440|0.34440	0.879000|0.879000	0.50718|0.50718	5.692000|5.692000	0.68256|0.68256	0.716000|0.716000	0.32124|0.32124	0.563000|0.563000	0.77884|0.77884	TGT|GTT		0.453	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342	
EPS8L1	54869	hgsc.bcm.edu;bcgsc.ca	37	19	55598783	55598783	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:55598783G>T	ENST00000201647.6	+	19	2121	c.2065G>T	c.(2065-2067)Gtg>Ttg	p.V689L	EPS8L1_ENST00000586329.1_Intron|EPS8L1_ENST00000245618.5_Missense_Mutation_p.V562L|EPS8L1_ENST00000588359.1_Missense_Mutation_p.V375L|EPS8L1_ENST00000540810.1_Missense_Mutation_p.V625L	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	689					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CCAGGTCACCGTGCAGCGCTC	0.677																																					Ovarian(149;255 1863 3636 27051 29647)	.											0													59.0	61.0	60.0					19																	55598783		2203	4299	6502	SO:0001583	missense	54869			AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.2065G>T	19.37:g.55598783G>T	ENSP00000201647:p.Val689Leu		Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	ENST00000201647.6	37	CCDS12914.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754167	0.89843	.	.	ENSG00000131037	ENST00000201647;ENST00000540810;ENST00000245618;ENST00000539118	T;T;T	0.27720	1.65;1.65;1.65	3.79	3.79	0.43588	.	0.073437	0.52532	D	0.000063	T	0.47173	0.1431	L	0.51914	1.62	0.58432	D	0.999999	D;D;P	0.67145	0.996;0.992;0.941	D;P;P	0.79108	0.992;0.875;0.72	T	0.37526	-0.9702	10	0.37606	T	0.19	-25.4363	13.9264	0.63966	0.0:0.0:1.0:0.0	.	468;562;689	Q8TE68-4;Q8TE68-2;Q8TE68	.;.;ES8L1_HUMAN	L	689;625;562;375	ENSP00000201647:V689L;ENSP00000437541:V625L;ENSP00000245618:V562L	ENSP00000201647:V689L	V	+	1	0	EPS8L1	60290595	1.000000	0.71417	0.910000	0.35882	0.600000	0.36913	5.846000	0.69444	2.060000	0.61445	0.313000	0.20887	GTG		0.677	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
PLK3	1263	broad.mit.edu	37	1	45270133	45270133	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:45270133T>C	ENST00000372201.4	+	12	1704	c.1465T>C	c.(1465-1467)Ttc>Ctc	p.F489L	PLK3_ENST00000465443.1_3'UTR	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	489	POLO box 1. {ECO:0000255|PROSITE- ProRule:PRU00154}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					GGCTGTGCTCTTCAACGATGG	0.567																																						.											0													67.0	72.0	70.0					1																	45270133		2203	4300	6503	SO:0001583	missense	1263			AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1465T>C	1.37:g.45270133T>C	ENSP00000361275:p.Phe489Leu		Q15767|Q5JR99|Q96CV1	Missense_Mutation	SNP	ENST00000372201.4	37	CCDS515.1	.	.	.	.	.	.	.	.	.	.	t	21.3	4.124835	0.77436	.	.	ENSG00000173846	ENST00000372201;ENST00000543983	T	0.58358	0.34	5.22	5.22	0.72569	POLO box duplicated domain (2);	.	.	.	.	T	0.63177	0.2489	M	0.83692	2.655	0.80722	D	1	P	0.44659	0.84	P	0.46685	0.524	T	0.67503	-0.5654	9	0.42905	T	0.14	-18.8092	14.6063	0.68481	0.0:0.0:0.0:1.0	.	489	Q9H4B4	PLK3_HUMAN	L	489;464	ENSP00000361275:F489L	ENSP00000361275:F489L	F	+	1	0	PLK3	45042720	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.284000	0.72652	2.105000	0.64084	0.529000	0.55759	TTC		0.567	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023429.1	NM_004073	
C1orf52	148423	broad.mit.edu	37	1	85718363	85718363	+	Silent	SNP	A	A	G	rs111657378		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:85718363A>G	ENST00000471115.1	-	3	506	c.498T>C	c.(496-498)acT>acC	p.T166T	C1orf52_ENST00000294661.4_5'UTR	NM_198077.3	NP_932343.1	Q8N6N3	CA052_HUMAN	chromosome 1 open reading frame 52	166							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)	10				all cancers(265;0.0105)|Epithelial(280;0.0293)		GCTTTTTAGAAGTATGCTCAT	0.318																																						.											0													131.0	118.0	122.0					1																	85718363		2202	4297	6499	SO:0001819	synonymous_variant	148423			BC029538	CCDS703.1	1p22.3	2008-02-05			ENSG00000162642	ENSG00000162642			24871	protein-coding gene	gene with protein product						11891061	Standard	NM_198077		Approved	gm117, FLJ44982	uc001dkv.3	Q8N6N3	OTTHUMG00000009966	ENST00000471115.1:c.498T>C	1.37:g.85718363A>G			B3KX89|Q8TDK5|Q8TDK6	Silent	SNP	ENST00000471115.1	37	CCDS703.1																																																																																				0.318	C1orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027616.2	NM_198077	
NOTCH2	4853	broad.mit.edu	37	1	120462211	120462211	+	Silent	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:120462211A>G	ENST00000256646.2	-	31	5724	c.5505T>C	c.(5503-5505)gcT>gcC	p.A1835A	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1835					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCGGAGAGAAGCCAACATCA	0.463			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													39.0	34.0	36.0					1																	120462211		2203	4300	6503	SO:0001819	synonymous_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5505T>C	1.37:g.120462211A>G			Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1																																																																																				0.463	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
CDHR5	53841	broad.mit.edu	37	11	618824	618824	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:618824delA	ENST00000358353.3	-	14	2057	c.1735delT	c.(1735-1737)tctfs	p.S579fs	CDHR5_ENST00000349570.7_Intron|IRF7_ENST00000397562.3_5'Flank|CDHR5_ENST00000397542.2_Frame_Shift_Del_p.S579fs|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397570.1_5'Flank|IRF7_ENST00000397574.2_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	579	4 X 31 AA approximate tandem repeats.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						ATCGGCTGAGAGGTTCCTGGC	0.667																																						.											0													110.0	116.0	114.0					11																	618824		2203	4300	6503	SO:0001589	frameshift_variant	53841			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1735delT	11.37:g.618824delA	ENSP00000351118:p.Ser579fs		C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Frame_Shift_Del	DEL	ENST00000358353.3	37	CCDS7707.1																																																																																				0.667	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
CDHR5	53841	broad.mit.edu	37	11	618827	618827	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:618827delT	ENST00000358353.3	-	14	2054	c.1732delA	c.(1732-1734)accfs	p.T578fs	CDHR5_ENST00000349570.7_Intron|IRF7_ENST00000397562.3_5'Flank|CDHR5_ENST00000397542.2_Frame_Shift_Del_p.T578fs|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397570.1_5'Flank|IRF7_ENST00000397574.2_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	578	4 X 31 AA approximate tandem repeats.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						GGCTGAGAGGTTCCTGGCTCT	0.667																																						.											0													110.0	117.0	115.0					11																	618827		2203	4300	6503	SO:0001589	frameshift_variant	53841			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1732delA	11.37:g.618827delT	ENSP00000351118:p.Thr578fs		C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Frame_Shift_Del	DEL	ENST00000358353.3	37	CCDS7707.1																																																																																				0.667	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
GPALPP1	55425	broad.mit.edu;bcgsc.ca	37	13	45582989	45582989	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr13:45582989A>G	ENST00000379151.4	+	4	486	c.383A>G	c.(382-384)aAg>aGg	p.K128R	GPALPP1_ENST00000361121.2_Missense_Mutation_p.K128R|RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000357537.3_5'UTR	NM_018559.2	NP_061029.2	Q8IXQ4	GPAM1_HUMAN	GPALPP motifs containing 1	128																	AAAAGTGACAAGGGCAGAGAT	0.368																																						.											0													84.0	75.0	78.0					13																	45582989		2203	4300	6503	SO:0001583	missense	55425			AB051491	CCDS9394.1	13q14.12	2013-08-13	2013-08-12	2013-08-12	ENSG00000133114	ENSG00000133114			20298	protein-coding gene	gene with protein product			"""KIAA1704"""	KIAA1704		11214970	Standard	NM_018559		Approved	bA245H20.2, AD029, LSR7	uc001uzq.3	Q8IXQ4	OTTHUMG00000016841	ENST00000379151.4:c.383A>G	13.37:g.45582989A>G	ENSP00000368447:p.Lys128Arg		A8K8X8|Q05BX8|Q05D87|Q5T3Z3|Q5T3Z5|Q9C0F9|Q9H2R0|Q9P0W6	Missense_Mutation	SNP	ENST00000379151.4	37	CCDS9394.1	.	.	.	.	.	.	.	.	.	.	A	12.10	1.836425	0.32421	.	.	ENSG00000133114	ENST00000379151;ENST00000361121	T;T	0.55234	0.53;0.53	5.31	1.59	0.23543	.	0.778085	0.12671	N	0.448776	T	0.32912	0.0845	N	0.22421	0.69	0.23043	N	0.99838	B	0.02656	0.0	B	0.04013	0.001	T	0.21552	-1.0242	10	0.16896	T	0.51	-13.9596	7.2745	0.26275	0.6279:0.0:0.3721:0.0	.	128	Q8IXQ4	K1704_HUMAN	R	128	ENSP00000368447:K128R;ENSP00000355211:K128R	ENSP00000355211:K128R	K	+	2	0	KIAA1704	44480989	0.234000	0.23783	0.997000	0.53966	0.938000	0.57974	-0.169000	0.09911	0.133000	0.18654	0.528000	0.53228	AAG		0.368	GPALPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044749.2	NM_018559	
PPIP5K1	9677	broad.mit.edu	37	15	43827440	43827440	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr15:43827440delA	ENST00000396923.3	-	30	3855	c.3734delT	c.(3733-3735)atgfs	p.M1245fs	PPIP5K1_ENST00000360301.4_Frame_Shift_Del_p.M1220fs|PPIP5K1_ENST00000348806.6_Frame_Shift_Del_p.M1218fs|PPIP5K1_ENST00000381879.4_Frame_Shift_Del_p.M1221fs|PPIP5K1_ENST00000360135.4_Frame_Shift_Del_p.M1218fs|PPIP5K1_ENST00000420765.1_Frame_Shift_Del_p.M1245fs|PPIP5K1_ENST00000381885.1_Frame_Shift_Del_p.M1241fs|PPIP5K1_ENST00000334933.4_Frame_Shift_Del_p.M1220fs			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1245					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						GCTGGTTTCCATAGGTGGCAC	0.587																																						.											0													86.0	87.0	87.0					15																	43827440		2201	4298	6499	SO:0001589	frameshift_variant	9677			AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3734delT	15.37:g.43827440delA	ENSP00000380129:p.Met1245fs		O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Frame_Shift_Del	DEL	ENST00000396923.3	37	CCDS45252.1																																																																																				0.587	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	NM_014659	
NECAB2	54550	broad.mit.edu;mdanderson.org	37	16	84024120	84024120	+	Missense_Mutation	SNP	G	G	A	rs531002237		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr16:84024120G>A	ENST00000305202.4	+	6	498	c.481G>A	c.(481-483)Gtg>Atg	p.V161M	NECAB2_ENST00000565691.1_Missense_Mutation_p.V78M	NM_019065.2	NP_061938.2	Q7Z6G3	NECA2_HUMAN	N-terminal EF-hand calcium binding protein 2	161						cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19						TGGGAGCAACGTGGACCAGTT	0.582																																						.											0													88.0	80.0	83.0					16																	84024120		2200	4300	6500	SO:0001583	missense	54550			AY299331	CCDS10940.1	16q23.3-q24.1	2013-01-10	2007-12-06	2007-12-06	ENSG00000103154	ENSG00000103154		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	23746	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 2"""	EFCBP2		12044471	Standard	NM_019065		Approved		uc002fhd.3	Q7Z6G3	OTTHUMG00000137636	ENST00000305202.4:c.481G>A	16.37:g.84024120G>A	ENSP00000307449:p.Val161Met		A2RRG3|O75547|Q6ZSK0	Missense_Mutation	SNP	ENST00000305202.4	37	CCDS10940.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690055	0.29962	.	.	ENSG00000103154	ENST00000305202	T	0.21191	2.02	5.14	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.27169	0.0666	M	0.70842	2.15	0.49687	D	0.999815	D	0.57257	0.979	P	0.44518	0.452	T	0.07139	-1.0788	10	0.41790	T	0.15	-13.0244	13.1299	0.59375	0.0796:0.0:0.9204:0.0	.	161	Q7Z6G3	NECA2_HUMAN	M	161	ENSP00000307449:V161M	ENSP00000307449:V161M	V	+	1	0	NECAB2	82581621	1.000000	0.71417	0.989000	0.46669	0.271000	0.26615	3.193000	0.50997	2.388000	0.81334	0.549000	0.68633	GTG		0.582	NECAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269077.2	NM_019065	
MIB1	57534	broad.mit.edu	37	18	19379923	19379923	+	Silent	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr18:19379923A>G	ENST00000261537.6	+	9	1623	c.1359A>G	c.(1357-1359)agA>agG	p.R453R	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	453					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			TGCTTAAAAGACCAGATGTGG	0.333																																						.											0													93.0	93.0	93.0					18																	19379923		2203	4300	6503	SO:0001819	synonymous_variant	57534			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.1359A>G	18.37:g.19379923A>G			B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Silent	SNP	ENST00000261537.6	37	CCDS11871.1																																																																																				0.333	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	
ZNF415	55786	broad.mit.edu	37	19	53619570	53619570	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:53619570G>T	ENST00000455735.2	-	4	390	c.70C>A	c.(70-72)Cct>Act	p.P24T	ZNF415_ENST00000595193.1_Silent_p.S44S|ZNF415_ENST00000448501.1_Missense_Mutation_p.P24T|ZNF415_ENST00000596683.1_5'UTR|ZNF415_ENST00000599261.1_Silent_p.S44S|ZNF415_ENST00000421033.1_Missense_Mutation_p.P24T|ZNF415_ENST00000601215.1_Intron|ZNF415_ENST00000597503.1_Silent_p.S44S|ZNF415_ENST00000500065.4_Silent_p.S44S|ZNF415_ENST00000594011.1_Silent_p.S44S|ZNF415_ENST00000595813.1_Silent_p.S44S|ZNF415_ENST00000440291.1_5'UTR|ZNF415_ENST00000597748.1_Silent_p.S44S|ZNF415_ENST00000243643.4_Silent_p.S44S|ZNF415_ENST00000600574.1_Silent_p.S44S|ZNF415_ENST00000601493.1_Intron			Q09FC8	ZN415_HUMAN	zinc finger protein 415	24					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		CCTCACCCAGGGAGACCAGGT	0.468																																						.											0													112.0	113.0	113.0					19																	53619570		2203	4300	6503	SO:0001583	missense	55786			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000455735.2:c.70C>A	19.37:g.53619570G>T	ENSP00000388787:p.Pro24Thr		F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Silent	SNP	ENST00000455735.2	37		.	.	.	.	.	.	.	.	.	.	G	15.11	2.736104	0.49045	.	.	ENSG00000170954	ENST00000448501;ENST00000421033;ENST00000455735	T;T;T	0.21191	2.51;2.02;2.51	2.95	-0.803	0.10886	.	.	.	.	.	T	0.12689	0.0308	.	.	.	0.28510	N	0.913607	P;P;P	0.46512	0.808;0.808;0.879	B;B;B	0.36885	0.118;0.118;0.235	T	0.19321	-1.0309	8	0.87932	D	0	.	5.3206	0.15879	0.4892:0.0:0.5108:0.0	.	24;24;24	B3KTG1;Q09FC8;Q09FC8-2	.;ZN415_HUMAN;.	T	24	ENSP00000396492:P24T;ENSP00000395055:P24T;ENSP00000388787:P24T	ENSP00000395055:P24T	P	-	1	0	ZNF415	58311382	0.000000	0.05858	0.866000	0.34008	0.950000	0.60333	-2.807000	0.00757	0.056000	0.16144	0.462000	0.41574	CCT		0.468	ZNF415-204	KNOWN	basic	protein_coding	protein_coding		NM_018355	
LILRP2	79166	broad.mit.edu	37	19	55221850	55221850	+	RNA	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:55221850G>A	ENST00000413439.1	+	0	1415									leukocyte immunoglobulin-like receptor pseudogene 2																		AGCTCAGAACGAGGTGGGGCA	0.637																																					Ovarian(107;788 1543 20399 31552 46707)	.											0																																												79166			AF072100		19q13.4	2010-02-17			ENSG00000240258	ENSG00000170858		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"""	15497	pseudogene	pseudogene						10941842	Standard	NR_003061		Approved	ILT10, CD85m	uc002qgs.1		OTTHUMG00000065886		19.37:g.55221850G>A				RNA	SNP	ENST00000413439.1	37																																																																																					0.637	LILRP2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000141240.2	NM_024317	
ATP6V1B1	525	broad.mit.edu;mdanderson.org;bcgsc.ca	37	2	71192114	71192114	+	Missense_Mutation	SNP	G	G	A	rs140980255		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:71192114G>A	ENST00000234396.4	+	14	1478	c.1405G>A	c.(1405-1407)Gag>Aag	p.E469K	AC007040.11_ENST00000606025.1_Intron|ATP6V1B1_ENST00000412314.1_Missense_Mutation_p.E452K|RN7SL160P_ENST00000468558.2_RNA	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	469					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						CTCGGTGTTCGAGTCGCTGGA	0.617											OREG0014686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0								G	LYS/GLU	0,4406		0,0,2203	47.0	48.0	48.0		1405	3.8	1.0	2	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATP6V1B1	NM_001692.3	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	469/514	71192114	1,13005	2203	4300	6503	SO:0001583	missense	525			AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.1405G>A	2.37:g.71192114G>A	ENSP00000234396:p.Glu469Lys	1128	Q53FY0|Q6P4H6	Missense_Mutation	SNP	ENST00000234396.4	37	CCDS1912.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448704	0.84101	0.0	1.16E-4	ENSG00000116039	ENST00000234396;ENST00000483246;ENST00000412314;ENST00000433895	T;T;T	0.77098	-1.07;-1.07;-1.07	3.81	3.81	0.43845	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (1);	0.000000	0.52532	D	0.000064	T	0.76737	0.4029	M	0.81942	2.565	0.58432	D	0.999999	P;B;B	0.45212	0.853;0.067;0.141	B;B;B	0.38428	0.273;0.074;0.14	T	0.81990	-0.0679	10	0.62326	D	0.03	-34.01	13.2521	0.60057	0.0:0.0:1.0:0.0	.	444;452;469	B4DWH7;C9JL73;P15313	.;.;VATB1_HUMAN	K	469;444;452;74	ENSP00000234396:E469K;ENSP00000388353:E452K;ENSP00000407840:E74K	ENSP00000234396:E469K	E	+	1	0	ATP6V1B1	71045622	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	1.958000	0.56883	0.455000	0.32223	GAG		0.617	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251920.2	NM_001692	
UNC80	285175	broad.mit.edu;mdanderson.org;bcgsc.ca	37	2	210683986	210683986	+	Splice_Site	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:210683986G>T	ENST00000439458.1	+	12	2042		c.e12+1		UNC80_ENST00000272845.6_Splice_Site	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TGATCTTTCTGTAAGAAGCAA	0.343																																						.											0													53.0	44.0	47.0					2																	210683986		692	1591	2283	SO:0001630	splice_region_variant	285175			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1962+1G>T	2.37:g.210683986G>T			B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Splice_Site	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568933	0.86439	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9731	0.97292	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC80	210392231	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.209000	0.95087	2.715000	0.92844	0.563000	0.77884	.		0.343	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	Intron
SCG2	7857	broad.mit.edu;ucsc.edu;mdanderson.org	37	2	224462648	224462648	+	Silent	SNP	C	C	T	rs143843249	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:224462648C>T	ENST00000305409.2	-	2	1585	c.1353G>A	c.(1351-1353)tcG>tcA	p.S451S		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGGGAAAATACGACGTTTTCT	0.488													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19932	0.0		0.0	False		,,,				2504	0.0					.											0								C		4,4402	8.1+/-20.4	0,4,2199	106.0	107.0	107.0		1353	-2.9	0.5	2	dbSNP_134	107	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SCG2	NM_003469.4		0,5,6498	TT,TC,CC		0.0116,0.0908,0.0384		451/618	224462648	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	7857			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1353G>A	2.37:g.224462648C>T			A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	ENST00000305409.2	37	CCDS2457.1																																																																																				0.488	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
SLCO4A1	28231	broad.mit.edu	37	20	61292501	61292501	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr20:61292501T>G	ENST00000370507.1	+	4	1191	c.1095T>G	c.(1093-1095)ttT>ttG	p.F365L	RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.F365L|RP11-93B14.5_ENST00000411824.1_RNA|RP11-93B14.5_ENST00000451648.1_RNA			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	365					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ACCCGGACTTTGGGAAAACCA	0.597																																					Pancreas(168;741 2006 10379 40139 45334)	.											0													79.0	71.0	74.0					20																	61292501		2203	4300	6503	SO:0001583	missense	28231			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1095T>G	20.37:g.61292501T>G	ENSP00000359538:p.Phe365Leu		Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	37	CCDS13501.1	.	.	.	.	.	.	.	.	.	.	t	10.30	1.313437	0.23908	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507	T;T	0.38077	1.16;1.16	4.25	0.186	0.15105	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.22513	0.0543	L	0.28694	0.88	0.44092	D	0.996859	B	0.09022	0.002	B	0.20384	0.029	T	0.10660	-1.0620	10	0.16896	T	0.51	.	10.1154	0.42587	0.0:0.169:0.0:0.831	.	365	Q96BD0	SO4A1_HUMAN	L	365	ENSP00000217159:F365L;ENSP00000359538:F365L	ENSP00000217159:F365L	F	+	3	2	SLCO4A1	60762946	0.985000	0.35326	0.380000	0.26093	0.056000	0.15407	0.095000	0.15127	-0.276000	0.09206	-0.404000	0.06349	TTT		0.597	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354	
ZNF445	353274	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	44488434	44488434	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:44488434G>C	ENST00000396077.2	-	8	3076	c.2729C>G	c.(2728-2730)aCc>aGc	p.T910S	ZNF445_ENST00000425708.2_Missense_Mutation_p.T910S	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	910					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		ACTGGAAAGGGTATGTCTCCC	0.483																																						.											0													102.0	100.0	100.0					3																	44488434		2203	4300	6503	SO:0001583	missense	353274			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.2729C>G	3.37:g.44488434G>C	ENSP00000379387:p.Thr910Ser		Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	37	CCDS2713.1	.	.	.	.	.	.	.	.	.	.	G	4.922	0.171299	0.09391	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.49432	0.78;0.78	4.06	4.06	0.47325	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.539313	0.17082	N	0.187728	T	0.22513	0.0543	N	0.05230	-0.09	0.09310	N	1	P;P	0.45176	0.852;0.852	B;B	0.39217	0.294;0.294	T	0.04333	-1.0959	10	0.15499	T	0.54	.	9.5794	0.39479	0.0:0.0:0.6833:0.3167	.	898;910	B7ZKX2;P59923	.;ZN445_HUMAN	S	910	ENSP00000413073:T910S;ENSP00000379387:T910S	ENSP00000379387:T910S	T	-	2	0	ZNF445	44463438	0.000000	0.05858	0.017000	0.16124	0.031000	0.12232	-2.107000	0.01337	2.559000	0.86315	0.563000	0.77884	ACC		0.483	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489	
AGPAT9	84803	broad.mit.edu	37	4	84518658	84518658	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:84518658T>C	ENST00000395226.2	+	10	1204	c.986T>C	c.(985-987)gTt>gCt	p.V329A	AGPAT9_ENST00000264409.4_Missense_Mutation_p.V329A	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	329					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				ATACATCCAGTTGCAATTAAG	0.333																																						.											0													54.0	56.0	55.0					4																	84518658		2203	4300	6503	SO:0001583	missense	84803			AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.986T>C	4.37:g.84518658T>C	ENSP00000378651:p.Val329Ala		Q68CJ4|Q6GPI6|Q96NA3	Missense_Mutation	SNP	ENST00000395226.2	37	CCDS3606.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.103293	0.76983	.	.	ENSG00000138678	ENST00000395226;ENST00000264409	D;D	0.96011	-3.88;-3.88	5.32	5.32	0.75619	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.97554	0.9199	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.98221	1.0478	10	0.66056	D	0.02	-20.1272	15.2947	0.73894	0.0:0.0:0.0:1.0	.	329	Q53EU6	GPAT3_HUMAN	A	329	ENSP00000378651:V329A;ENSP00000264409:V329A	ENSP00000264409:V329A	V	+	2	0	AGPAT9	84737682	1.000000	0.71417	0.993000	0.49108	0.830000	0.47004	7.958000	0.87877	2.005000	0.58758	0.460000	0.39030	GTT		0.333	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252821.3	NM_032717	
LARP7	51574	broad.mit.edu	37	4	113568911	113568911	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:113568911A>G	ENST00000344442.5	+	8	1341	c.1063A>G	c.(1063-1065)Aca>Gca	p.T355A	MIR302A_ENST00000385192.1_RNA|MIR302B_ENST00000362188.1_RNA|MIR302D_ENST00000362275.1_RNA|MIR302B_ENST00000509938.1_RNA|LARP7_ENST00000324052.6_Missense_Mutation_p.T355A|MIR367_ENST00000362299.1_RNA|MIR302C_ENST00000362232.1_RNA|LARP7_ENST00000509061.1_Missense_Mutation_p.T362A|MIR302B_ENST00000505215.1_RNA|MIR302B_ENST00000510655.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	355	Lys-rich.				RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TCTCTTGAAAACAAAAAGGAA	0.308																																						.											0													32.0	34.0	33.0					4																	113568911		2201	4294	6495	SO:0001583	missense	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1063A>G	4.37:g.113568911A>G	ENSP00000344950:p.Thr355Ala		B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	ENST00000344442.5	37	CCDS3701.2	.	.	.	.	.	.	.	.	.	.	A	5.077	0.199948	0.09652	.	.	ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000513553;ENST00000324052	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.89	-4.82	0.03171	.	0.593004	0.18744	N	0.132376	T	0.08935	0.0221	N	0.00972	-1.085	0.20764	N	0.999853	B	0.02656	0.0	B	0.01281	0.0	T	0.35549	-0.9784	10	0.02654	T	1	-9.5667	6.2703	0.20951	0.2366:0.0:0.3856:0.3779	.	355	Q4G0J3	LARP7_HUMAN	A	355;362;23;355	ENSP00000344950:T355A;ENSP00000422626:T362A;ENSP00000422013:T23A;ENSP00000314311:T355A	ENSP00000314311:T355A	T	+	1	0	LARP7	113788360	0.729000	0.28090	0.041000	0.18516	0.910000	0.53928	0.480000	0.22244	-0.602000	0.05775	0.533000	0.62120	ACA		0.308	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	
PCDHGC3	5098	broad.mit.edu;ucsc.edu;mdanderson.org	37	5	140857474	140857474	+	Silent	SNP	C	C	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr5:140857474C>T	ENST00000308177.3	+	1	1895	c.1791C>T	c.(1789-1791)gaC>gaT	p.D597D	PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000518882.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	597	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGGCTGGGACGCGGATGCAG	0.602											OREG0016865	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													50.0	55.0	53.0					5																	140857474		2203	4300	6503	SO:0001819	synonymous_variant	5098			AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.1791C>T	5.37:g.140857474C>T		1659	O60622|Q08192|Q9Y5C4	Silent	SNP	ENST00000308177.3	37	CCDS4261.1																																																																																				0.602	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
DOCK4	9732	broad.mit.edu;ucsc.edu	37	7	111368593	111368593	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr7:111368593C>G	ENST00000437633.1	-	52	5894	c.5638G>C	c.(5638-5640)Gtg>Ctg	p.V1880L	DOCK4_ENST00000428084.1_Missense_Mutation_p.V1889L|DOCK4_ENST00000494651.2_Missense_Mutation_p.V763L	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1880	Pro-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GGCACCGGCACTGGCACCGGC	0.647																																						.											0													34.0	42.0	39.0					7																	111368593		2073	4198	6271	SO:0001583	missense	9732				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5638G>C	7.37:g.111368593C>G	ENSP00000404179:p.Val1880Leu		O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.032|0.032	-1.328806|-1.328806	0.01298|0.01298	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000423057;ENST00000445943|ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	.|T;T;T	.|0.05513	.|4.16;3.43;4.16	4.59|4.59	1.55|1.55	0.23275|0.23275	.|.	.|0.478701	.|0.18768	.|U	.|0.131682	T|T	0.01523|0.01523	0.0049|0.0049	N|N	0.00538|0.00538	-1.39|-1.39	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B;B	.|0.01281	.|0.0;0.0;0.0;0.0;0.0;0.0	T|T	0.47649|0.47649	-0.9101|-0.9101	5|10	.|0.10902	.|T	.|0.67	.|.	6.9688|6.9688	0.24637|0.24637	0.0:0.4797:0.4192:0.101|0.0:0.4797:0.4192:0.101	.|.	.|749;763;1925;1880;1851;193	.|B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4	.|.;.;.;DOCK4_HUMAN;.;.	H|L	1302;1912|1868;1889;763;1880;1839	.|ENSP00000410746:V1889L;ENSP00000440944:V763L;ENSP00000404179:V1880L	.|ENSP00000345432:V1839L	Q|V	-|-	3|1	2|0	DOCK4|DOCK4	111155829|111155829	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.421000|0.421000	0.21280|0.21280	0.054000|0.054000	0.16065|0.16065	0.561000|0.561000	0.74099|0.74099	CAG|GTG		0.647	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
DOCK8	81704	broad.mit.edu	37	9	405015	405015	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr9:405015delT	ENST00000453981.1	+	27	3444	c.3332delT	c.(3331-3333)cttfs	p.L1111fs	DOCK8_ENST00000469391.1_Frame_Shift_Del_p.L1011fs|DOCK8_ENST00000382329.1_Frame_Shift_Del_p.L578fs|DOCK8_ENST00000432829.2_Frame_Shift_Del_p.L1043fs|DOCK8_ENST00000382331.1_Frame_Shift_Del_p.L413fs			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1111					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AATCTGAACCTTTTTTTTATG	0.393																																						.											0													132.0	114.0	121.0					9																	405015		2203	4300	6503	SO:0001589	frameshift_variant	81704			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.3332delT	9.37:g.405015delT	ENSP00000408464:p.Leu1111fs		A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Frame_Shift_Del	DEL	ENST00000453981.1	37	CCDS6440.2																																																																																				0.393	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
DMD	1756	broad.mit.edu;bcgsc.ca	37	X	32408279	32408279	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chrX:32408279G>T	ENST00000357033.4	-	31	4459	c.4253C>A	c.(4252-4254)aCa>aAa	p.T1418K	DMD_ENST00000378677.2_Missense_Mutation_p.T1414K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1418	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.T1414R(1)|p.T77R(1)|p.T1418R(1)|p.T1413R(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTCATGACTTGTCAAATCAGA	0.388																																						.											4	Substitution - Missense(4)	lung(4)											133.0	106.0	115.0					X																	32408279		2202	4300	6502	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4253C>A	X.37:g.32408279G>T	ENSP00000354923:p.Thr1418Lys		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887785	0.52014	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.20738	2.05;2.05	5.77	5.77	0.91146	.	0.000000	0.38058	U	0.001840	T	0.19446	0.0467	L	0.44542	1.39	0.80722	D	1	P;B;P;P;P	0.45827	0.867;0.014;0.791;0.596;0.596	B;B;B;B;B	0.42282	0.382;0.008;0.212;0.154;0.154	T	0.02484	-1.1152	10	0.19147	T	0.46	.	12.5325	0.56124	0.0781:0.0:0.9219:0.0	.	1410;1418;1414;77;74	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	K	1410;77;74;1414;1418;1418;1295	ENSP00000367948:T1414K;ENSP00000354923:T1418K	ENSP00000354923:T1418K	T	-	2	0	DMD	32318200	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.241000	0.51376	2.557000	0.86248	0.594000	0.82650	ACA		0.388	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
CHMP4C	92421	broad.mit.edu	37	8	82644910	82644911	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr8:82644910_82644911insG	ENST00000297265.4	+	1	242_243	c.49_50insG	c.(49-51)cgafs	p.R17fs		NM_152284.3	NP_689497.1	Q96CF2	CHM4C_HUMAN	charged multivesicular body protein 4C	17	Intramolecular interaction with C- terminus. {ECO:0000250}.				abscission (GO:0009838)|cytokinesis checkpoint (GO:0031565)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of cytokinesis (GO:0032466)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|membrane (GO:0016020)|midbody (GO:0030496)	protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	10						TTCTAAGAGCCGAGCCGCTCCC	0.599																																						.											0																																										SO:0001589	frameshift_variant	92421			AK000049	CCDS6233.1	8q21.13	2011-09-21	2011-09-21		ENSG00000164695	ENSG00000164695		"""Charged multivesicular body proteins"""	30599	protein-coding gene	gene with protein product	"""Snf7 homologue associated with Alix 3"""	610899	"""chromatin modifying protein 4C"""			12860994 , 14678797	Standard	NM_152284		Approved	MGC22825, Shax3, VPS32C	uc003ycl.3	Q96CF2	OTTHUMG00000164726	ENST00000297265.4:c.50dupG	8.37:g.82644911_82644911dupG	ENSP00000297265:p.Arg17fs		B2RBZ1	Frame_Shift_Ins	INS	ENST00000297265.4	37	CCDS6233.1																																																																																				0.599	CHMP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379927.1	NM_152284	
ABCA7	10347	ucsc.edu	37	19	1047002	1047002	+	Silent	SNP	A	A	G	rs3752234	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:1047002A>G	ENST00000263094.6	+	14	2055	c.1824A>G	c.(1822-1824)gcA>gcG	p.A608A	ABCA7_ENST00000435683.2_Silent_p.A470A|ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000433129.1_Silent_p.A608A	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	608					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAGCGCCGCACTGCTGGTTC	0.726													G|||	2899	0.578874	0.4637	0.7104	5008	,	,		13766	0.75		0.5199	False		,,,				2504	0.5256					.											0										2219,2141		606,1007,567	14.0	13.0	13.0		1824	-2.7	0.3	19	dbSNP_107	13	4663,3873		1348,1967,953	no	coding-synonymous	ABCA7	NM_019112.3		1954,2974,1520	GG,GA,AA		45.3725,49.1055,46.6346		608/2147	1047002	6882,6014	2180	4268	6448	SO:0001819	synonymous_variant	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1824A>G	19.37:g.1047002A>G			Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																				0.726	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
B4GALT5	9334	ucsc.edu	37	20	48330133	48330133	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr20:48330133A>G	ENST00000371711.4	-	1	282	c.95T>C	c.(94-96)gTc>gCc	p.V32A		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	32					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CGCCACATAGACGAAGTACAG	0.706																																						.											0													9.0	12.0	11.0					20																	48330133		2165	4274	6439	SO:0001583	missense	9334			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.95T>C	20.37:g.48330133A>G	ENSP00000360776:p.Val32Ala		E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	ENST00000371711.4	37	CCDS13420.1	.	.	.	.	.	.	.	.	.	.	A	12.88	2.071871	0.36566	.	.	ENSG00000158470	ENST00000371711	T	0.43688	0.94	2.7	2.7	0.31948	.	0.229171	0.36854	U	0.002371	T	0.30479	0.0766	L	0.36672	1.1	0.35194	D	0.773674	B	0.09022	0.002	B	0.08055	0.003	T	0.32666	-0.9898	10	0.39692	T	0.17	-1.105	9.6737	0.40028	1.0:0.0:0.0:0.0	.	32	O43286	B4GT5_HUMAN	A	32	ENSP00000360776:V32A	ENSP00000360776:V32A	V	-	2	0	B4GALT5	47763540	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	1.967000	0.40491	1.098000	0.41479	0.164000	0.16699	GTC		0.706	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776	
CACNB1	782	ucsc.edu	37	17	37331681	37331681	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr17:37331681T>C	ENST00000394303.3	-	14	1769	c.1562A>G	c.(1561-1563)gAc>gGc	p.D521G	RP5-906A24.2_ENST00000579256.1_RNA	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	521					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AGTCTCCATGTCCACACATGA	0.657											OREG0024371	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(5;100 366 38393 41452 45827)	.											0													97.0	109.0	105.0					17																	37331681		1956	4143	6099	SO:0001583	missense	782				CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.1562A>G	17.37:g.37331681T>C	ENSP00000377840:p.Asp521Gly	869	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	ENST00000394303.3	37	CCDS42311.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.538855	0.85917	.	.	ENSG00000067191	ENST00000539338;ENST00000394303	T	0.79554	-1.28	5.67	4.6	0.57074	.	0.053621	0.64402	D	0.000001	T	0.74496	0.3724	L	0.51422	1.61	0.80722	D	1	B	0.15141	0.012	B	0.10450	0.005	T	0.73310	-0.4023	10	0.66056	D	0.02	-27.8644	10.2001	0.43077	0.0:0.0791:0.0:0.9209	.	521	Q02641	CACB1_HUMAN	G	471;521	ENSP00000377840:D521G	ENSP00000377840:D521G	D	-	2	0	CACNB1	34585207	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.651000	0.61447	2.169000	0.68431	0.459000	0.35465	GAC		0.657	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3		
DUSP11	8446	ucsc.edu;bcgsc.ca	37	2	73996401	73996401	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:73996401A>G	ENST00000272444.3	-	5	667	c.626T>C	c.(625-627)cTc>cCc	p.L209P	DUSP11_ENST00000443070.1_Missense_Mutation_p.L209P|DUSP11_ENST00000377706.4_Missense_Mutation_p.L162P|DUSP11_ENST00000480948.1_5'UTR	NM_003584.2	NP_003575.2	O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	162					peptidyl-tyrosine dephosphorylation (GO:0035335)|polynucleotide 5' dephosphorylation (GO:0098507)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphatase activity (GO:0016791)|poly(A) RNA binding (GO:0044822)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12						CCTGCAAATGAGGTAGCCAGT	0.358																																						.											0													98.0	99.0	99.0					2																	73996401		2203	4300	6503	SO:0001583	missense	8446			AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092				9685386	Standard	NM_003584		Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.626T>C	2.37:g.73996401A>G	ENSP00000272444:p.Leu209Pro		B2RCT8|Q6AI47|Q9BWE3	Missense_Mutation	SNP	ENST00000272444.3	37	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	A	16.31	3.086515	0.55861	.	.	ENSG00000144048	ENST00000272444;ENST00000443070;ENST00000377706	D;D;D	0.90563	-2.69;-2.69;-2.69	4.8	3.63	0.41609	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.95671	0.8592	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.95180	0.8298	10	0.87932	D	0	-4.4581	9.4108	0.38491	0.8408:0.0:0.0:0.1592	.	209;162	C9JYA6;O75319	.;DUS11_HUMAN	P	209;209;162	ENSP00000272444:L209P;ENSP00000413444:L209P;ENSP00000366935:L162P	ENSP00000272444:L209P	L	-	2	0	DUSP11	73849909	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	6.789000	0.75110	0.953000	0.37825	0.528000	0.53228	CTC		0.358	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3		
MUC6	4588	ucsc.edu;mdanderson.org;bcgsc.ca	37	11	1024889	1024889	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:1024889C>G	ENST00000421673.2	-	24	3230	c.3180G>C	c.(3178-3180)aaG>aaC	p.K1060N		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1060	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGACGCTGCACTTGCGCTCGG	0.657																																						.											0													30.0	36.0	34.0					11																	1024889		2089	4220	6309	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.3180G>C	11.37:g.1024889C>G	ENSP00000406861:p.Lys1060Asn		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617761	0.46736	.	.	ENSG00000184956	ENST00000421673	T	0.76578	-1.03	4.03	1.02	0.19986	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.920448	0.08636	U	0.916343	T	0.78773	0.4336	L	0.39397	1.21	0.29948	N	0.820519	D	0.57257	0.979	P	0.60236	0.871	T	0.68682	-0.5344	10	0.66056	D	0.02	.	5.5361	0.17011	0.0:0.5723:0.1467:0.281	.	1060	Q6W4X9	MUC6_HUMAN	N	1060	ENSP00000406861:K1060N	ENSP00000406861:K1060N	K	-	3	2	MUC6	1014889	0.931000	0.31567	0.991000	0.47740	0.966000	0.64601	0.648000	0.24828	0.112000	0.17975	0.561000	0.74099	AAG		0.657	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
FUT4	2526	ucsc.edu;mdanderson.org	37	11	94278062	94278062	+	Missense_Mutation	SNP	A	A	G	rs2230273	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:94278062A>G	ENST00000358752.2	+	1	1046	c.763A>G	c.(763-765)Atc>Gtc	p.I255V	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_002033.3	NP_002024.1	P22083	FUT4_HUMAN	fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)	255			I -> V (in dbSNP:rs2230273).		carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	cell periphery (GO:0071944)|cell surface (GO:0009986)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(2)|endometrium(2)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCCCTGGGGCATCCAGGCGCA	0.726													G|||	517	0.103235	0.32	0.0317	5008	,	,		9733	0.0139		0.0139	False		,,,				2504	0.045					.											0								G	VAL/ILE	801,3091		86,629,1231	7.0	8.0	8.0		763	2.0	0.0	11	dbSNP_98	8	62,7852		1,60,3896	yes	missense	FUT4	NM_002033.3	29	87,689,5127	GG,GA,AA		0.7834,20.5807,7.3098	benign	255/531	94278062	863,10943	1946	3957	5903	SO:0001583	missense	2526				CCDS8301.1	11q21	2013-02-26			ENSG00000196371	ENSG00000196371		"""CD molecules"", ""Fucosyltransferases"""	4015	protein-coding gene	gene with protein product	"""ELAM ligand fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	104230		CD15, FCT3A, ELFT		1702034	Standard	NM_002033		Approved	FUC-TIV	uc001pez.3	P22083	OTTHUMG00000167795	ENST00000358752.2:c.763A>G	11.37:g.94278062A>G	ENSP00000351602:p.Ile255Val		B2RMS0	Missense_Mutation	SNP	ENST00000358752.2	37	CCDS8301.1	173	0.07921245421245421	148	0.3008130081300813	12	0.03314917127071823	5	0.008741258741258742	8	0.010554089709762533	g	0.006	-2.069712	0.00382	0.205807	0.007834	ENSG00000196371	ENST00000358752	T	0.30182	1.54	4.0	2.01	0.26516	.	.	.	.	.	T	0.00012	0.0000	N	0.00436	-1.5	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43475	-0.9389	8	0.02654	T	1	.	6.5473	0.22412	0.3539:0.0:0.6461:0.0	rs2230273;rs2230273	255	P22083	FUT4_HUMAN	V	255	ENSP00000351602:I255V	ENSP00000351602:I255V	I	+	1	0	FUT4	93917710	0.343000	0.24818	0.012000	0.15200	0.047000	0.14425	1.265000	0.33027	0.061000	0.16311	-0.374000	0.07098	ATC		0.726	FUT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396327.2	NM_002033	
RNF213	57674	ucsc.edu	37	17	78326830	78326830	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr17:78326830A>G	ENST00000582970.1	+	33	10537	c.10394A>G	c.(10393-10395)cAg>cGg	p.Q3465R	CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.Q1538R|RNF213_ENST00000508628.2_Missense_Mutation_p.Q3514R|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3465					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACCATCAGCCAGCTGTTCGCG	0.627																																						.											0													74.0	68.0	70.0					17																	78326830		2203	4300	6503	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10394A>G	17.37:g.78326830A>G	ENSP00000464087:p.Gln3465Arg		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.898988	0.52227	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.24151	1.87	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.51058	0.1652	M	0.81239	2.535	0.38732	D	0.953683	D	0.71674	0.998	D	0.63283	0.913	T	0.60969	-0.7157	10	0.87932	D	0	.	14.5041	0.67741	1.0:0.0:0.0:0.0	.	1538	Q63HN8	RN213_HUMAN	R	3465;3514;1538	ENSP00000338218:Q1538R	ENSP00000338218:Q1538R	Q	+	2	0	RNF213	75941425	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	8.238000	0.89809	2.157000	0.67596	0.533000	0.62120	CAG		0.627	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
SPEF2	79925	ucsc.edu	37	5	35774017	35774017	+	Silent	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr5:35774017A>G	ENST00000356031.3	+	28	4126	c.3972A>G	c.(3970-3972)gaA>gaG	p.E1324E	SPEF2_ENST00000440995.2_Silent_p.E1319E|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1324					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTATGGCAGAAGCAACTCCTG	0.393																																						.											0													81.0	73.0	75.0					5																	35774017		1853	4092	5945	SO:0001819	synonymous_variant	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3972A>G	5.37:g.35774017A>G			Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	ENST00000356031.3	37	CCDS43309.1																																																																																				0.393	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
SRFBP1	153443	ucsc.edu	37	5	121309892	121309892	+	Splice_Site	SNP	T	T	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr5:121309892T>C	ENST00000339397.4	+	2	110	c.38T>C	c.(37-39)gTt>gCt	p.V13A		NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		TCTTCAAAGGTTGTGAAGATG	0.333																																						.											0													67.0	63.0	64.0					5																	121309892		1820	4072	5892	SO:0001630	splice_region_variant	153443			AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.37-1T>C	5.37:g.121309892T>C				Missense_Mutation	SNP	ENST00000339397.4	37	CCDS43354.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.095015	0.76870	.	.	ENSG00000151304	ENST00000339397	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.77025	0.4070	M	0.77103	2.36	0.53688	D	0.999974	D	0.67145	0.996	P	0.59948	0.866	T	0.80405	-0.1396	9	0.87932	D	0	-16.2291	14.9786	0.71296	0.0:0.0:0.0:1.0	.	13	Q8NEF9	SRFB1_HUMAN	A	13	.	ENSP00000341324:V13A	V	+	2	0	SRFBP1	121337791	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	5.385000	0.66231	2.275000	0.75901	0.528000	0.53228	GTT		0.333	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371200.1	NM_152546	Missense_Mutation
ZNF837	116412	ucsc.edu	37	19	58880373	58880373	+	Silent	SNP	T	T	C	rs61746117	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:58880373T>C	ENST00000427624.2	-	3	649	c.327A>G	c.(325-327)caA>caG	p.Q109Q	ZNF837_ENST00000597582.1_Silent_p.Q109Q|CTD-2619J13.3_ENST00000599889.1_RNA			Q96EG3	ZN837_HUMAN	zinc finger protein 837	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						CCTCCCGGGCTTGCAGCCCCT	0.741													T|||	20	0.00399361	0.0136	0.0029	5008	,	,		12042	0.0		0.0	False		,,,				2504	0.0					.											0													4.0	5.0	5.0					19																	58880373		655	1527	2182	SO:0001819	synonymous_variant	116412			BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.327A>G	19.37:g.58880373T>C				Silent	SNP	ENST00000427624.2	37	CCDS46216.1																																																																																				0.741	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
AHNAK2	113146	mdanderson.org	37	14	105413649	105413649	+	Silent	SNP	A	A	G	rs201545349	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr14:105413649A>G	ENST00000333244.5	-	7	8258	c.8139T>C	c.(8137-8139)gaT>gaC	p.D2713D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2713						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGAGTTTCACATCCACCTGGC	0.612													.|||	29	0.00579073	0.0174	0.0	5008	,	,		17337	0.0		0.0	False		,,,				2504	0.0061					.											0													130.0	144.0	139.0					14																	105413649		1936	4121	6057	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8139T>C	14.37:g.105413649A>G			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105413682	105413682	+	Silent	SNP	A	A	G	rs200358766	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr14:105413682A>G	ENST00000333244.5	-	7	8225	c.8106T>C	c.(8104-8106)tcT>tcC	p.S2702S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2702						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCAGTTGGGCAGAGGGGGGCT	0.617																																						.											0													140.0	156.0	151.0					14																	105413682		1966	4150	6116	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8106T>C	14.37:g.105413682A>G			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105413702	105413702	+	Missense_Mutation	SNP	T	T	G	rs373727930	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr14:105413702T>G	ENST00000333244.5	-	7	8205	c.8086A>C	c.(8086-8088)Atc>Ctc	p.I2696L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2696						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGAATGCTGATGTCAGTGGTC	0.622													.|||	5	0.000998403	0.0038	0.0	5008	,	,		18132	0.0		0.0	False		,,,				2504	0.0					.											0								G	LEU/ILE	6,4002		0,6,1998	155.0	169.0	164.0		8086	-6.6	0.0	14		164	0,8354		0,0,4177	no	missense	AHNAK2	NM_138420.2	5	0,6,6175	GG,GT,TT		0.0,0.1497,0.0485	benign	2696/5796	105413702	6,12356	2004	4177	6181	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8086A>C	14.37:g.105413702T>G	ENSP00000353114:p.Ile2696Leu		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	1.766	-0.485464	0.04352	0.001497	0.0	ENSG00000185567	ENST00000333244	T	0.01215	5.16	3.28	-6.57	0.01842	.	.	.	.	.	T	0.00356	0.0011	N	0.00278	-1.715	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48422	-0.9037	9	0.27082	T	0.32	.	4.7288	0.12954	0.0859:0.4868:0.2062:0.2212	.	2696	Q8IVF2	AHNK2_HUMAN	L	2696	ENSP00000353114:I2696L	ENSP00000353114:I2696L	I	-	1	0	AHNAK2	104484747	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.340000	0.00506	-5.115000	0.00021	-4.489000	0.00005	ATC		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415661	105415661	+	Missense_Mutation	SNP	C	C	T	rs200010377	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr14:105415661C>T	ENST00000333244.5	-	7	6246	c.6127G>A	c.(6127-6129)Gcc>Acc	p.A2043T	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2043						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTCAGGTCGGCAGAAGGGGGC	0.647													.|||	82	0.0163738	0.0129	0.0086	5008	,	,		12118	0.0079		0.008	False		,,,				2504	0.044					.											0													100.0	60.0	73.0					14																	105415661		1902	3958	5860	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6127G>A	14.37:g.105415661C>T	ENSP00000353114:p.Ala2043Thr		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	14.22	2.469010	0.43839	.	.	ENSG00000185567	ENST00000333244	T	0.00912	5.55	3.87	0.935	0.19483	.	.	.	.	.	T	0.02571	0.0078	M	0.64080	1.96	0.09310	N	1	D	0.76494	0.999	D	0.68483	0.958	T	0.44757	-0.9307	9	0.14252	T	0.57	.	5.0829	0.14666	0.1662:0.6467:0.0:0.1871	.	2043	Q8IVF2	AHNK2_HUMAN	T	2043	ENSP00000353114:A2043T	ENSP00000353114:A2043T	A	-	1	0	AHNAK2	104486706	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.432000	0.21461	0.149000	0.19098	0.485000	0.47835	GCC		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ANKRD30BL	554226	mdanderson.org	37	2	132919099	132919099	+	Silent	SNP	C	C	T	rs199974298		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:132919099C>T	ENST00000409867.1	-	1	429	c.180G>A	c.(178-180)aaG>aaA	p.K60K	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	60										endometrium(1)|kidney(3)	4						CCATTGTCGTCTTCTTCATCA	0.582																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.180G>A	2.37:g.132919099C>T			B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
AQP10	89872	mdanderson.org	37	1	154294464	154294464	+	Missense_Mutation	SNP	A	A	G	rs201824170	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:154294464A>G	ENST00000324978.3	+	2	201	c.161A>G	c.(160-162)aAc>aGc	p.N54S	AQP10_ENST00000355197.4_Intron|AQP10_ENST00000484864.1_Missense_Mutation_p.N54S	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	54					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			ACCAAAGGCAACTTCTTCACC	0.572																																						.											0													71.0	60.0	64.0					1																	154294464		2202	4279	6481	SO:0001583	missense	89872			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.161A>G	1.37:g.154294464A>G	ENSP00000318355:p.Asn54Ser		Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	ENST00000324978.3	37	CCDS1065.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.164492	0.38217	.	.	ENSG00000143595	ENST00000324978;ENST00000484864	T;T	0.10860	2.83;2.83	5.1	5.1	0.69264	Aquaporin-like (2);	0.222920	0.46145	D	0.000305	T	0.04952	0.0133	L	0.28556	0.865	0.33946	D	0.643832	B;P	0.48162	0.04;0.906	B;P	0.49085	0.032;0.6	T	0.22347	-1.0219	10	0.08837	T	0.75	.	13.834	0.63398	1.0:0.0:0.0:0.0	.	54;54	Q96PS8-2;Q96PS8	.;AQP10_HUMAN	S	54	ENSP00000318355:N54S;ENSP00000420341:N54S	ENSP00000318355:N54S	N	+	2	0	AQP10	152561088	0.994000	0.37717	1.000000	0.80357	0.994000	0.84299	5.326000	0.65875	2.142000	0.66516	0.418000	0.28097	AAC		0.572	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429	
AQP10	89872	mdanderson.org	37	1	154294471	154294471	+	Silent	SNP	C	C	T	rs200279756	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:154294471C>T	ENST00000324978.3	+	2	208	c.168C>T	c.(166-168)ttC>ttT	p.F56F	AQP10_ENST00000355197.4_Intron|AQP10_ENST00000484864.1_Silent_p.F56F	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	56					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCAACTTCTTCACCATGTTTC	0.577																																						.											0													70.0	59.0	63.0					1																	154294471		2202	4278	6480	SO:0001819	synonymous_variant	89872			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.168C>T	1.37:g.154294471C>T			Q5VYD3|Q5VYD4|Q8NG70	Silent	SNP	ENST00000324978.3	37	CCDS1065.1																																																																																				0.577	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429	
BHLHE22	27319	mdanderson.org	37	8	65493429	65493429	+	Missense_Mutation	SNP	T	T	G	rs7016250	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr8:65493429T>G	ENST00000321870.1	+	1	616	c.82T>G	c.(82-84)Tcc>Gcc	p.S28A	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	28			S -> A (in dbSNP:rs7016250).		anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						CGCCTCCACCTCCAAGCGCTT	0.741													G|||	2648	0.528754	0.77	0.4452	5008	,	,		7262	0.5546		0.326	False		,,,				2504	0.4438				Colon(113;104 1586 2865 9855 18065)	.											0								G	ALA/SER	2630,1430		896,838,296	8.0	8.0	8.0		82	2.5	1.0	8	dbSNP_116	8	2053,6051		317,1419,2316	yes	missense	BHLHE22	NM_152414.4	99	1213,2257,2612	GG,GT,TT		25.3332,35.2217,38.4988	benign	28/382	65493429	4683,7481	2030	4052	6082	SO:0001583	missense	27319			U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.82T>G	8.37:g.65493429T>G	ENSP00000318799:p.Ser28Ala			Missense_Mutation	SNP	ENST00000321870.1	37	CCDS6179.1	1097	0.5022893772893773	369	0.75	153	0.42265193370165743	335	0.5856643356643356	240	0.316622691292876	t	0.020	-1.436684	0.01108	0.647783	0.253332	ENSG00000180828	ENST00000321870	D	0.94537	-3.45	3.39	2.5	0.30297	.	0.179067	0.36374	N	0.002635	T	0.00012	0.0000	N	0.04880	-0.145	0.49051	P	2.590000000000092E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.42649	-0.9439	9	0.02654	T	1	-14.5881	7.3158	0.26499	0.0929:0.0:0.7396:0.1674	rs7016250	28	Q8NFJ8	BHE22_HUMAN	A	28	ENSP00000318799:S28A	ENSP00000318799:S28A	S	+	1	0	BHLHE22	65655983	1.000000	0.71417	0.993000	0.49108	0.580000	0.36256	3.146000	0.50631	0.272000	0.22027	-0.399000	0.06403	TCC		0.741	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378549.1	NM_152414	
CD163	9332	mdanderson.org;bcgsc.ca	37	12	7649507	7649507	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr12:7649507G>T	ENST00000359156.4	-	5	1203	c.1001C>A	c.(1000-1002)tCt>tAt	p.S334Y	CD163_ENST00000432237.2_Missense_Mutation_p.S334Y|CD163_ENST00000541972.1_Missense_Mutation_p.S322Y|CD163_ENST00000396620.3_Missense_Mutation_p.S334Y	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	334	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.	Cleavage; in calcium-free condition.			acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TCCCTGGCAAGAAACGCTGTC	0.493																																						.											0													145.0	100.0	115.0					12																	7649507		2203	4300	6503	SO:0001583	missense	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1001C>A	12.37:g.7649507G>T	ENSP00000352071:p.Ser334Tyr		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	G	7.150	0.583528	0.13749	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.03	3.05	0.35203	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.810546	0.11502	N	0.557572	T	0.51261	0.1664	L	0.56124	1.755	0.09310	N	0.99999	D;P;D	0.71674	0.998;0.919;0.998	D;B;D	0.71184	0.972;0.42;0.972	T	0.28299	-1.0048	10	0.66056	D	0.02	.	8.374	0.32432	0.0:0.1458:0.5555:0.2987	.	334;334;334	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	Y	334;322;334;334	ENSP00000352071:S334Y;ENSP00000444071:S322Y;ENSP00000379863:S334Y;ENSP00000403885:S334Y	ENSP00000352071:S334Y	S	-	2	0	CD163	7540774	0.000000	0.05858	0.454000	0.27019	0.714000	0.41099	-0.478000	0.06575	1.229000	0.43630	0.561000	0.74099	TCT		0.493	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
CSMD3	114788	mdanderson.org	37	8	113237129	113237129	+	Silent	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr8:113237129A>G	ENST00000297405.5	-	71	11239	c.10995T>C	c.(10993-10995)tgT>tgC	p.C3665C	CSMD3_ENST00000343508.3_Silent_p.C3625C|CSMD3_ENST00000455883.2_Silent_p.C3496C|CSMD3_ENST00000352409.3_Silent_p.C3595C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3665						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CATGAACTGAACATCCTGTAT	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												.											0													335.0	304.0	314.0					8																	113237129		2203	4300	6503	SO:0001819	synonymous_variant	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10995T>C	8.37:g.113237129A>G			Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				0.413	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ELSPBP1	64100	mdanderson.org;bcgsc.ca	37	19	48525507	48525507	+	Missense_Mutation	SNP	G	G	A	rs2303690	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:48525507G>A	ENST00000339841.2	+	6	773	c.595G>A	c.(595-597)Gaa>Aaa	p.E199K	ELSPBP1_ENST00000597519.1_Missense_Mutation_p.E51K	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	199	Fibronectin type-II 4. {ECO:0000255|PROSITE-ProRule:PRU00479}.		E -> K (in dbSNP:rs2303690). {ECO:0000269|PubMed:11144225, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.2}.		single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CTGCACTAACGAAGGATCAAA	0.458													a|||	3432	0.685304	0.6672	0.719	5008	,	,		21670	0.8671		0.5696	False		,,,				2504	0.6176					.											0								A	LYS/GLU	2699,1707	514.5+/-368.7	854,991,358	172.0	160.0	164.0		595	1.5	0.0	19	dbSNP_100	164	4879,3721	530.3+/-381.8	1393,2093,814	yes	missense	ELSPBP1	NM_022142.4	56	2247,3084,1172	AA,AG,GG		43.2674,38.7426,41.7346	benign	199/224	48525507	7578,5428	2203	4300	6503	SO:0001583	missense	64100			AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.595G>A	19.37:g.48525507G>A	ENSP00000340660:p.Glu199Lys		Q96RT0|Q9H4C8	Missense_Mutation	SNP	ENST00000339841.2	37	CCDS12708.1	1512	0.6923076923076923	325	0.6605691056910569	242	0.6685082872928176	497	0.8688811188811189	448	0.5910290237467019	A	1.554	-0.538579	0.04053	0.612574	0.567326	ENSG00000169393	ENST00000339841	T	0.52295	0.67	3.66	1.54	0.23209	Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);	0.248846	0.28031	N	0.016863	T	0.00012	0.0000	N	0.20401	0.57	0.80722	P	0.0	B	0.14805	0.011	B	0.15870	0.014	T	0.44651	-0.9314	9	0.02654	T	1	.	3.8049	0.08773	0.4456:0.2051:0.3493:0.0	rs2303690;rs17845467;rs17858345;rs59769918;rs2303690	199	Q96BH3	ESPB1_HUMAN	K	199	ENSP00000340660:E199K	ENSP00000340660:E199K	E	+	1	0	ELSPBP1	53217319	0.439000	0.25610	0.044000	0.18714	0.012000	0.07955	0.521000	0.22893	0.108000	0.17862	-0.308000	0.09152	GAA		0.458	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465207.1		
FAM157B	100132403	mdanderson.org	37	9	141107536	141107536	+	lincRNA	SNP	G	G	A	rs367832601|rs554298933		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr9:141107536G>A	ENST00000446912.2	+	0	19							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CGgcagcggcggcagcagcag	0.547																																						.											0													7.0	13.0	11.0					9																	141107536		685	1584	2269			100132403					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107536G>A				Missense_Mutation	SNP	ENST00000446912.2	37																																																																																					0.547	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000055378.2	NM_001145249	
FAM186A	121006	mdanderson.org	37	12	50746140	50746140	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr12:50746140C>T	ENST00000327337.5	-	4	4474	c.4475G>A	c.(4474-4476)gGg>gAg	p.G1492E	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.G1492E	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1492																	GAGAGGGATCCCCAATTCCTG	0.657																																					NSCLC(138;1796 1887 12511 19463 37884)	.											0													11.0	12.0	12.0					12																	50746140		692	1588	2280	SO:0001583	missense	121006				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4475G>A	12.37:g.50746140C>T	ENSP00000329995:p.Gly1492Glu			Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	-	12.93	2.086248	0.36855	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.03982	3.74;3.74	4.53	-2.85	0.05734	.	.	.	.	.	T	0.06462	0.0166	L	0.29908	0.895	0.09310	N	1	D;B	0.89917	1.0;0.297	D;B	0.80764	0.994;0.112	T	0.15378	-1.0439	9	0.02654	T	1	.	4.5237	0.11971	0.2364:0.448:0.0:0.3156	.	1492;1492	F5GYN0;A6NE01	.;F186A_HUMAN	E	1492	ENSP00000441337:G1492E;ENSP00000329995:G1492E	ENSP00000329995:G1492E	G	-	2	0	FAM186A	49032407	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.828000	0.27435	-0.426000	0.07360	-0.409000	0.06214	GGG		0.657	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
FAM21C	253725	mdanderson.org	37	10	46254776	46254776	+	Missense_Mutation	SNP	A	A	C	rs199848673		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr10:46254776A>C	ENST00000336378.4	+	17	1680	c.1562A>C	c.(1561-1563)tAc>tCc	p.Y521S	FAM21C_ENST00000359860.4_Missense_Mutation_p.Y465S|FAM21C_ENST00000374362.2_Missense_Mutation_p.Y521S|FAM21C_ENST00000537517.1_Missense_Mutation_p.Y497S|FAM21C_ENST00000540872.1_Missense_Mutation_p.Y521S	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	521				Y -> S (in Ref. 1; BAA25518 and 2; BAG64168). {ECO:0000305}.	retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)		p.Y520S(3)|p.Y521S(2)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						ACCTTATCTTACAGCAAAAAT	0.413																																						.											5	Substitution - Missense(5)	prostate(4)|skin(1)						C	SER/TYR,SER/TYR,SER/TYR	254,3222		29,196,1513	61.0	73.0	69.0		1562,1490,1562	3.3	0.7	10	dbSNP_134	69	410,7550		58,294,3628	yes	missense,missense,missense	FAM21C	NM_001169106.1,NM_001169107.1,NM_015262.2	144,144,144	87,490,5141	CC,CA,AA		5.1508,7.3072,5.8062	benign,benign,benign	521/1280,497/1246,521/1321	46254776	664,10772	1738	3980	5718	SO:0001583	missense	253725				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1562A>C	10.37:g.46254776A>C	ENSP00000337541:p.Tyr521Ser		B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	ENST00000336378.4	37		.	.	.	.	.	.	.	.	.	.	C	0.006	-2.057382	0.00390	0.073072	0.051508	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.26	3.26	0.37387	.	0.662706	0.15995	N	0.234623	T	0.00496	0.0016	N	0.00099	-2.14	0.54753	P	1.4999999999987246E-5	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.25950	-1.0117	8	0.02654	T	1	0.2567	9.8043	0.40783	0.2076:0.7924:0.0:0.0	.	497;521;521;466	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	S	521;521;497;521;521;465;433	.	ENSP00000337541:Y521S	Y	+	2	0	FAM21C	45574782	0.554000	0.26522	0.660000	0.29694	0.197000	0.23852	2.157000	0.42320	0.721000	0.32231	-0.488000	0.04728	TAC		0.413	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
FAM8A1	51439	mdanderson.org	37	6	17608519	17608519	+	Silent	SNP	T	T	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr6:17608519T>C	ENST00000259963.3	+	5	1246	c.1191T>C	c.(1189-1191)gcT>gcC	p.A397A		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	397	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			ATCGAACAGCTTATGACATTG	0.383																																						.											0													100.0	95.0	97.0					6																	17608519		2203	4300	6503	SO:0001819	synonymous_variant	51439			AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.1191T>C	6.37:g.17608519T>C			B2R725	Silent	SNP	ENST00000259963.3	37	CCDS4540.1																																																																																				0.383	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
FMN2	56776	mdanderson.org	37	1	240371328	240371328	+	Silent	SNP	G	G	A	rs71646895	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:240371328G>A	ENST00000319653.9	+	5	3446	c.3216G>A	c.(3214-3216)gcG>gcA	p.A1072A		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1072	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TACCCGGAGCGGGCATACCCC	0.736																																						.											0													2.0	3.0	3.0					1																	240371328		1326	2694	4020	SO:0001819	synonymous_variant	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3216G>A	1.37:g.240371328G>A			B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																				0.736	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
FRG1B	284802	mdanderson.org	37	20	29625877	29625877	+	Missense_Mutation	SNP	G	G	A	rs7266938	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr20:29625877G>A	ENST00000278882.3	+	5	501	c.121G>A	c.(121-123)Gcc>Acc	p.A41T	FRG1B_ENST00000439954.2_Missense_Mutation_p.A46T|FRG1B_ENST00000358464.4_Missense_Mutation_p.A41T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	41								p.A41T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GTACAGAATCGCCCTGAAATC	0.358																																						.											2	Substitution - Missense(2)	urinary_tract(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.121G>A	20.37:g.29625877G>A	ENSP00000278882:p.Ala41Thr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	8.740	0.918766	0.17982	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62498	0.02	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	.	.	.	0.52099	D	0.999942	B	0.24186	0.099	B	0.27715	0.082	T	0.43956	-0.9359	9	0.33940	T	0.23	.	9.3557	0.38164	0.0:0.0:1.0:0.0	rs7266938;rs7266938	46	F5H5R5	.	T	41;46;41	ENSP00000408863:A46T	ENSP00000278882:A41T	A	+	1	0	FRG1B	28239538	1.000000	0.71417	0.993000	0.49108	0.033000	0.12548	5.232000	0.65332	1.250000	0.43966	0.184000	0.17185	GCC		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29625891	29625891	+	Silent	SNP	C	C	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr20:29625891C>G	ENST00000278882.3	+	5	515	c.135C>G	c.(133-135)ggC>ggG	p.G45G	FRG1B_ENST00000439954.2_Silent_p.G50G|FRG1B_ENST00000358464.4_Silent_p.G45G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	45										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGAAATCTGGCTATGGAAAAT	0.343																																						.											0																																										SO:0001819	synonymous_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.135C>G	20.37:g.29625891C>G			C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																					0.343	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628270	29628270	+	Missense_Mutation	SNP	G	G	A	rs545391756	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr20:29628270G>A	ENST00000278882.3	+	6	652	c.272G>A	c.(271-273)tGc>tAc	p.C91Y	FRG1B_ENST00000439954.2_Missense_Mutation_p.C96Y|FRG1B_ENST00000358464.4_Missense_Mutation_p.C91Y			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	91										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTTATTAGATGCAATGAAGCA	0.363													.|||	3	0.000599042	0.0	0.0029	5008	,	,		60821	0.001		0.0	False		,,,				2504	0.0					.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.272G>A	20.37:g.29628270G>A	ENSP00000278882:p.Cys91Tyr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	4.726	0.135070	0.09032	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.43294	0.95	2.08	2.08	0.27032	Actin cross-linking (1);	0.051706	0.85682	D	0.000000	T	0.39545	0.1082	.	.	.	0.29852	N	0.828316	B;P	0.40970	0.008;0.734	B;P	0.46850	0.036;0.529	T	0.31668	-0.9935	9	0.34782	T	0.22	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	96;91	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	Y	91;96;91	ENSP00000408863:C96Y	ENSP00000278882:C91Y	C	+	2	0	FRG1B	28241931	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.129000	0.64739	1.475000	0.48197	0.423000	0.28283	TGC		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628273	29628273	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr20:29628273A>G	ENST00000278882.3	+	6	655	c.275A>G	c.(274-276)aAt>aGt	p.N92S	FRG1B_ENST00000439954.2_Missense_Mutation_p.N97S|FRG1B_ENST00000358464.4_Missense_Mutation_p.N92S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	92										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATTAGATGCAATGAAGCAGGG	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.275A>G	20.37:g.29628273A>G	ENSP00000278882:p.Asn92Ser		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	5.285	0.237973	0.10023	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.41400	1.0	2.08	2.08	0.27032	Actin cross-linking (1);	0.091289	0.85682	D	0.000000	T	0.23649	0.0572	.	.	.	0.35235	D	0.777251	B;B	0.12630	0.001;0.006	B;B	0.14578	0.005;0.011	T	0.17319	-1.0373	9	0.16420	T	0.52	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	97;92	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	S	92;97;92	ENSP00000408863:N97S	ENSP00000278882:N92S	N	+	2	0	FRG1B	28241934	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.067000	0.71193	1.208000	0.43306	0.347000	0.21830	AAT		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628282	29628282	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr20:29628282G>A	ENST00000278882.3	+	6	664	c.284G>A	c.(283-285)gGg>gAg	p.G95E	FRG1B_ENST00000439954.2_Missense_Mutation_p.G100E|FRG1B_ENST00000358464.4_Missense_Mutation_p.G95E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATGAAGCAGGGGACATAGAA	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.284G>A	20.37:g.29628282G>A	ENSP00000278882:p.Gly95Glu		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.02	3.529440	0.64860	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56103	0.48	2.08	2.08	0.27032	Actin cross-linking (1);	0.051750	0.85682	D	0.000000	T	0.52092	0.1713	.	.	.	0.58432	D	0.999996	B;P	0.39940	0.309;0.696	P;P	0.46543	0.492;0.52	T	0.54221	-0.8326	9	0.45353	T	0.12	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	100;95	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	E	95;100;95	ENSP00000408863:G100E	ENSP00000278882:G95E	G	+	2	0	FRG1B	28241943	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GGG		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HLA-C	3107	mdanderson.org	37	6	31238970	31238970	+	Missense_Mutation	SNP	T	T	A	rs281860499|rs142570222	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr6:31238970T>A	ENST00000376228.5	-	3	513	c.499A>T	c.(499-501)Acc>Tcc	p.T167S	HLA-C_ENST00000383329.3_Missense_Mutation_p.T167S	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	167	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TTGCGCTGGGTGATCTGAGCC	0.672													t|||	168	0.0335463	0.0809	0.0202	5008	,	,		10400	0.0188		0.0199	False		,,,				2504	0.0082					.											0													29.0	20.0	23.0					6																	31238970		2137	4174	6311	SO:0001583	missense	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.499A>T	6.37:g.31238970T>A	ENSP00000365402:p.Thr167Ser		O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	170|170	0.07783882783882784|0.07783882783882784	55|55	0.11178861788617886|0.11178861788617886	13|13	0.03591160220994475|0.03591160220994475	58|58	0.10139860139860139|0.10139860139860139	44|44	0.05804749340369393|0.05804749340369393	.|.	11.47|11.47	1.647923|1.647923	0.29336|0.29336	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00940	.|5.52;5.52	2.81|2.81	2.81|2.81	0.32909|0.32909	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|0.377560	.|0.18473	.|U	.|0.140159	T|T	0.00552|0.00552	0.0018|0.0018	L|L	0.55834|0.55834	1.745|1.745	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.18166	.|0.005;0.005;0.003;0.026	.|B;B;B;B	.|0.22753	.|0.03;0.021;0.021;0.041	T|T	0.45220|0.45220	-0.9276|-0.9276	5|10	.|0.87932	.|D	.|0	.|.	9.364|9.364	0.38212|0.38212	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	rs1050367;rs1050668;rs2308587;rs3177938|rs1050367;rs1050668;rs2308587;rs3177938	.|167;167;167;167	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	L|S	166|167;167;167;204	.|ENSP00000365402:T167S;ENSP00000372819:T167S	.|ENSP00000365402:T167S	H|T	-|-	2|1	0|0	HLA-C|HLA-C	31346949|31346949	0.745000|0.745000	0.28261|0.28261	0.005000|0.005000	0.12908|0.12908	0.011000|0.011000	0.07611|0.07611	1.002000|1.002000	0.29796|0.29796	1.536000|1.536000	0.49237|0.49237	0.254000|0.254000	0.18369|0.18369	CAC|ACC		0.672	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
KRT85	3891	mdanderson.org	37	12	52760938	52760938	+	Silent	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr12:52760938G>A	ENST00000257901.3	-	1	327	c.252C>T	c.(250-252)tcC>tcT	p.S84S	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	84	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		ACACGCCCCCGGAGCGGTAGC	0.687																																						.											0													39.0	48.0	45.0					12																	52760938		2203	4300	6503	SO:0001819	synonymous_variant	3891			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.252C>T	12.37:g.52760938G>A			Q9NSB1	Silent	SNP	ENST00000257901.3	37	CCDS8824.1																																																																																				0.687	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
LILRA6	79168	mdanderson.org	37	19	54744722	54744722	+	Missense_Mutation	SNP	T	T	C	rs56257556	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:54744722T>C	ENST00000396365.2	-	5	979	c.940A>G	c.(940-942)Aac>Gac	p.N314D	LILRA6_ENST00000440558.2_Missense_Mutation_p.N314D|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000419410.2_Missense_Mutation_p.N314D|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000245621.5_Missense_Mutation_p.N314D	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	314	Ig-like C2-type 1.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ATCAGGATGTTCAGGGGGTCG	0.682																																						.											0													22.0	32.0	29.0					19																	54744722		2100	4147	6247	SO:0001583	missense	79168			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.940A>G	19.37:g.54744722T>C	ENSP00000379651:p.Asn314Asp			Missense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	207	0.09478021978021978	73	0.1483739837398374	41	0.1132596685082873	19	0.033216783216783216	74	0.09762532981530343	T	0	-2.690915	0.00100	.	.	ENSG00000244482	ENST00000440558;ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	2.16	1.1	0.20463	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.389073	0.18849	N	0.129445	T	0.00012	0.0000	N	0.00022	-2.725	0.80722	D	1	B;B;B;B	0.17852	0.002;0.024;0.0;0.0	B;B;B;B	0.28385	0.002;0.089;0.0;0.001	T	0.46020	-0.9221	10	0.02654	T	1	.	5.0417	0.14462	0.0:0.8181:0.0:0.1819	rs56257556	314;314;314;314	C9JFH3;Q6PI73;F8WCY4;D3YTC4	.;LIRA6_HUMAN;.;.	D	314	ENSP00000390120:N314D;ENSP00000411227:N314D;ENSP00000379651:N314D;ENSP00000245621:N314D	ENSP00000245621:N314D	N	-	1	0	LILRA6	59436534	0.686000	0.27661	0.905000	0.35620	0.042000	0.13812	1.191000	0.32138	0.467000	0.27218	-1.232000	0.01568	AAC		0.682	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
LTB4R2	56413	mdanderson.org	37	14	24780364	24780364	+	Missense_Mutation	SNP	A	A	G	rs1950504	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr14:24780364A>G	ENST00000528054.1	+	1	2204	c.587A>G	c.(586-588)gAc>gGc	p.D196G	LTB4R_ENST00000396789.4_5'Flank|LTB4R2_ENST00000543919.1_Missense_Mutation_p.D165G|CIDEB_ENST00000258807.5_5'UTR|LTB4R_ENST00000345363.3_5'Flank|CIDEB_ENST00000555817.1_Intron|CIDEB_ENST00000554411.1_5'Flank|LTB4R2_ENST00000533293.1_Missense_Mutation_p.D165G|CIDEB_ENST00000336557.5_5'UTR			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	196					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)			endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		CTGTGGAGGGACCGCGTATGC	0.731													a|||	190	0.0379393	0.1399	0.0072	5008	,	,		13130	0.0		0.0	False		,,,				2504	0.0					.											0								G	GLY/ASP,,GLY/ASP	450,3898		24,402,1748	17.0	16.0	16.0		494,,494	-1.7	0.0	14	dbSNP_92	16	2,8500		0,2,4249	no	missense,utr-5,missense	CIDEB,LTB4R2	NM_001164692.2,NM_014430.2,NM_019839.4	94,,94	24,404,5997	GG,GA,AA		0.0235,10.3496,3.5175	benign,,benign	165/359,,165/359	24780364	452,12398	2174	4251	6425	SO:0001583	missense	56413			AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.587A>G	14.37:g.24780364A>G	ENSP00000432146:p.Asp196Gly		Q5KU28|Q9NPE5	Missense_Mutation	SNP	ENST00000528054.1	37		85	0.03891941391941392	80	0.16260162601626016	5	0.013812154696132596	0	0.0	0	0.0	A	8.771	0.925972	0.18056	0.103496	2.35E-4	ENSG00000213906	ENST00000528054;ENST00000533293;ENST00000543919;ENST00000530080	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	4.88	-1.74	0.08056	GPCR, rhodopsin-like superfamily (1);	1.111770	0.06947	N	0.813820	T	0.00210	0.0006	N	0.05574	-0.02	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.02539	-1.1144	9	0.21014	T	0.42	.	6.262	0.20905	0.4321:0.1466:0.4212:0.0	rs1950504	196	Q9NPC1	LT4R2_HUMAN	G	196;165;165;165	ENSP00000432146:D196G;ENSP00000433290:D165G;ENSP00000445772:D165G;ENSP00000434760:D165G	ENSP00000337731:D196G	D	+	2	0	LTB4R2	23850204	0.000000	0.05858	0.014000	0.15608	0.878000	0.50629	-0.091000	0.11146	-0.069000	0.12931	-0.441000	0.05720	GAC		0.731	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000073194.4		
MUC16	94025	mdanderson.org	37	19	9054242	9054242	+	Silent	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:9054242A>G	ENST00000397910.4	-	4	31583	c.31380T>C	c.(31378-31380)agT>agC	p.S10460S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10462	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TACCTTTAGGACTGGCAGGCG	0.443																																						.											0													135.0	147.0	143.0					19																	9054242		1950	4152	6102	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31380T>C	19.37:g.9054242A>G			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.443	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC4	4585	mdanderson.org	37	3	195505833	195505833	+	Silent	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:195505833G>A	ENST00000463781.3	-	2	13077	c.12618C>T	c.(12616-12618)gcC>gcT	p.A4206A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.A4206A|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A4206A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAAGAGGGGTGGCGTGACCTG	0.602																																						.											2	Substitution - coding silent(2)	kidney(1)|endometrium(1)											15.0	14.0	14.0					3																	195505833		685	1569	2254	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12618C>T	3.37:g.195505833G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509209	195509209	+	Missense_Mutation	SNP	G	G	A	rs79077485		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:195509209G>A	ENST00000463781.3	-	2	9701	c.9242C>T	c.(9241-9243)gCa>gTa	p.A3081V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3081V|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.597																																						.											0													13.0	10.0	11.0					3																	195509209		660	1540	2200	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9242C>T	3.37:g.195509209G>A	ENSP00000417498:p.Ala3081Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	2.006	-0.428327	0.04701	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.53;1.55	.	.	.	.	.	.	.	.	T	0.13670	0.0331	N	0.19112	0.55	0.09310	N	1	B	0.22909	0.077	B	0.14023	0.01	T	0.24870	-1.0148	7	.	.	.	.	2.1444	0.03783	0.0:0.3296:0.3433:0.3271	.	2953	E7ESK3	.	V	3081	ENSP00000417498:A3081V;ENSP00000420243:A3081V	.	A	-	2	0	MUC4	196993988	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	-3.297000	0.00522	-0.889000	0.03950	0.000000	0.15137	GCA		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511474	195511474	+	Missense_Mutation	SNP	A	A	G	rs77680876	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:195511474A>G	ENST00000463781.3	-	2	7436	c.6977T>C	c.(6976-6978)cTt>cCt	p.L2326P	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2326P|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAAGGCTGGTGAC	0.602													.|||	128	0.0255591	0.0499	0.013	5008	,	,		15093	0.0		0.0427	False		,,,				2504	0.0102					.											0													6.0	6.0	6.0					3																	195511474		604	1454	2058	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6977T>C	3.37:g.195511474A>G	ENSP00000417498:p.Leu2326Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	5.148	0.212934	0.09757	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34472	1.37;1.36	.	.	.	.	0.442567	0.10986	N	0.612157	T	0.13586	0.0329	N	0.08118	0	0.25482	N	0.987725	B	0.13594	0.008	B	0.08055	0.003	T	0.22103	-1.0226	8	.	.	.	.	5.4043	0.16312	0.2687:0.0:0.7313:0.0	.	2326	E7ESK3	.	P	2326	ENSP00000417498:L2326P;ENSP00000420243:L2326P	.	L	-	2	0	MUC4	196995869	0.001000	0.12720	0.006000	0.13384	0.036000	0.12997	-1.528000	0.02225	-1.769000	0.01297	-2.094000	0.00368	CTT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511479	195511479	+	Silent	SNP	G	G	A	rs200148982	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:195511479G>A	ENST00000463781.3	-	2	7431	c.6972C>T	c.(6970-6972)acC>acT	p.T2324T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2324T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAAGGCTGGTGACAGGAA	0.597													.|||	15	0.00299521	0.0113	0.0	5008	,	,		14767	0.0		0.0	False		,,,				2504	0.0					.											0													6.0	6.0	6.0					3																	195511479		595	1447	2042	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6972C>T	3.37:g.195511479G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511889	195511889	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:195511889C>T	ENST00000463781.3	-	2	7021	c.6562G>A	c.(6562-6564)Ggt>Agt	p.G2188S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.G2188S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGCGTGACCTGTGGATGCT	0.597																																						.											0													10.0	14.0	13.0					3																	195511889		621	1531	2152	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6562G>A	3.37:g.195511889C>T	ENSP00000417498:p.Gly2188Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	5.644	0.303428	0.10678	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28255	1.62;1.62	.	.	.	.	.	.	.	.	T	0.24774	0.0601	N	0.19112	0.55	0.09310	N	1	P	0.51449	0.945	P	0.53062	0.717	T	0.08911	-1.0699	7	.	.	.	.	3.4513	0.07499	0.4478:0.552:1.0E-4:1.0E-4	.	2188	E7ESK3	.	S	2188	ENSP00000417498:G2188S;ENSP00000420243:G2188S	.	G	-	1	0	MUC4	196996284	0.005000	0.15991	0.002000	0.10522	0.111000	0.19643	1.352000	0.34033	0.488000	0.27723	0.064000	0.15345	GGT		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195515422	195515422	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:195515422G>T	ENST00000463781.3	-	2	3488	c.3029C>A	c.(3028-3030)cCt>cAt	p.P1010H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1010H|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	445	Repeat.|Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACAGGAAGAGGGGT	0.577																																						.											0													63.0	35.0	44.0					3																	195515422		692	1591	2283	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3029C>A	3.37:g.195515422G>T	ENSP00000417498:p.Pro1010His		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	5.962	0.361410	0.11296	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.55588	0.51;0.53	1.24	-2.49	0.06403	.	.	.	.	.	T	0.29749	0.0743	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.12889	-1.0530	8	.	.	.	.	5.6108	0.17404	0.0:0.3425:0.467:0.1905	.	1010	E7ESK3	.	H	1010	ENSP00000417498:P1010H;ENSP00000420243:P1010H	.	P	-	2	0	MUC4	196999817	.	.	0.000000	0.03702	0.077000	0.17291	.	.	-1.667000	0.01473	0.064000	0.15345	CCT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC5B	727897	mdanderson.org	37	11	1270382	1270382	+	Missense_Mutation	SNP	C	C	G	rs199736618	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:1270382C>G	ENST00000529681.1	+	31	12330	c.12272C>G	c.(12271-12273)aCg>aGg	p.T4091R	MUC5B_ENST00000447027.1_Missense_Mutation_p.T4094R|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4091	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCCACACCACGGCCACCTCC	0.701																																						.											0													96.0	131.0	120.0					11																	1270382		2100	4206	6306	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12272C>G	11.37:g.1270382C>G	ENSP00000436812:p.Thr4091Arg		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	c	6.921	0.539550	0.13250	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.22945	1.93;2.11	2.44	0.0226	0.14133	.	.	.	.	.	T	0.29061	0.0722	M	0.67953	2.075	0.19575	N	0.999965	P;P	0.47302	0.825;0.893	B;P	0.45681	0.257;0.49	T	0.18085	-1.0348	9	0.87932	D	0	.	6.5051	0.22190	0.0:0.6987:0.1834:0.118	.	4564;4094	A7Y9J9;E9PBJ0	.;.	R	4091;4094;4035;3941	ENSP00000436812:T4091R;ENSP00000415793:T4094R	ENSP00000343037:T4035R	T	+	2	0	MUC5B	1226958	0.000000	0.05858	0.001000	0.08648	0.141000	0.21300	-0.528000	0.06193	0.333000	0.23563	0.393000	0.25936	ACG		0.701	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
PRUNE2	158471	mdanderson.org	37	9	79318381	79318381	+	Silent	SNP	A	A	T	rs376038487|rs113471142|rs11267615	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr9:79318381A>T	ENST00000376718.3	-	9	8271	c.8148T>A	c.(8146-8148)gcT>gcA	p.A2716A	PRUNE2_ENST00000428286.1_Silent_p.A2357A	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2716					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CATGGGTGACAGCCTGCAACG	0.517																																						.											0													77.0	59.0	65.0					9																	79318381		1171	2533	3704	SO:0001819	synonymous_variant	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8148T>A	9.37:g.79318381A>T			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	CCDS47982.1	517	0.2367216117216117	87	0.17682926829268292	64	0.17679558011049723	229	0.40034965034965037	137	0.18073878627968337	A	10.34	1.323317	0.24080	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.89	-3.37	0.04898	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47394	-0.9121	4	.	.	.	0.0386	8.1474	0.31119	0.3085:0.5438:0.0655:0.0822	.	.	.	.	S	2038	.	.	C	-	1	0	PRUNE2	78508201	0.025000	0.19082	0.206000	0.23566	0.391000	0.30476	-0.020000	0.12525	-0.420000	0.07427	0.477000	0.44152	TGT		0.517	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
OR13C2	392376	mdanderson.org	37	9	107367674	107367674	+	Missense_Mutation	SNP	G	G	A	rs41312234	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr9:107367674G>A	ENST00000542196.1	-	1	277	c.235C>T	c.(235-237)Ccc>Tcc	p.P79S		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AGCGTGGAGGGAATAGAGGTG	0.502																																						.											0													23.0	25.0	25.0					9																	107367674		2197	4290	6487	SO:0001583	missense	392376				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.235C>T	9.37:g.107367674G>A	ENSP00000438815:p.Pro79Ser		B9EGV8|Q6IF54	Missense_Mutation	SNP	ENST00000542196.1	37	CCDS35092.1	.	.	.	.	.	.	.	.	.	.	G	8.276	0.814512	0.16607	.	.	ENSG00000257019	ENST00000542196	T	0.01854	4.6	3.39	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36740	U	0.002425	T	0.08088	0.0202	H	0.96365	3.81	0.26847	N	0.968253	B	0.33739	0.422	B	0.36134	0.218	T	0.05273	-1.0895	10	0.72032	D	0.01	.	8.5547	0.33474	0.1183:0.0:0.8817:0.0	rs41312234	79	Q8NGS9	O13C2_HUMAN	S	79	ENSP00000438815:P79S	ENSP00000438815:P79S	P	-	1	0	OR13C2	106407495	1.000000	0.71417	0.002000	0.10522	0.171000	0.22731	3.742000	0.55097	0.635000	0.30488	-0.369000	0.07265	CCC		0.502	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	NM_001004481	
PSG2	5670	mdanderson.org	37	19	43585274	43585274	+	Silent	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:43585274A>G	ENST00000406487.1	-	2	287	c.189T>C	c.(187-189)acT>acC	p.T63T	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	63	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				AGATGTAGCCAGTAAGATTCT	0.453																																						.											0													112.0	115.0	114.0					19																	43585274		2203	4296	6499	SO:0001819	synonymous_variant	5670				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.189T>C	19.37:g.43585274A>G			Q8TCD9|Q9UEA4|Q9UQ78	Silent	SNP	ENST00000406487.1	37	CCDS12616.1																																																																																				0.453	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
RGPD4	285190	mdanderson.org	37	2	108487877	108487877	+	Silent	SNP	T	T	C	rs199986270	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:108487877T>C	ENST00000408999.3	+	20	3494	c.3417T>C	c.(3415-3417)gaT>gaC	p.D1139D	RGPD4_ENST00000354986.4_Silent_p.D1139D	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1139	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)			p.D1139D(1)		breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						ATTTCTCTGATGGTGATGCCA	0.438													N|||	655	0.130791	0.1929	0.1527	5008	,	,		9395	0.0308		0.0716	False		,,,				2504	0.1953					.											1	Substitution - coding silent(1)	kidney(1)											6.0	6.0	6.0					2																	108487877		126	650	776	SO:0001819	synonymous_variant	285190			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3417T>C	2.37:g.108487877T>C			B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																				0.438	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
SEH1L	81929	mdanderson.org	37	18	12955467	12955467	+	Silent	SNP	T	T	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr18:12955467T>C	ENST00000262124.11	+	3	295	c.168T>C	c.(166-168)caT>caC	p.H56H	SEH1L_ENST00000399892.2_Silent_p.H56H	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	56					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.H56H(2)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						CCCAGACACATAGTGGATCTG	0.398																																						.											2	Substitution - coding silent(2)	prostate(1)|central_nervous_system(1)											150.0	135.0	140.0					18																	12955467		2203	4300	6503	SO:0001819	synonymous_variant	81929			BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.168T>C	18.37:g.12955467T>C			A8K5B1|Q8NFU6|Q96MH3|Q9C069	Silent	SNP	ENST00000262124.11	37	CCDS45832.1																																																																																				0.398	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458254.1	NM_031216	
SLC9B1	150159	mdanderson.org	37	4	103826757	103826757	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:103826757T>C	ENST00000296422.7	-	11	1387	c.1246A>G	c.(1246-1248)Aca>Gca	p.T416A	SLC9B1_ENST00000512651.2_Intron|SLC9B1_ENST00000394789.3_Missense_Mutation_p.T416A	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	416					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										AATAGATATGTGGTTAAAATT	0.323																																						.											0													39.0	43.0	42.0					4																	103826757		2198	4292	6490	SO:0001583	missense	150159			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.1246A>G	4.37:g.103826757T>C	ENSP00000296422:p.Thr416Ala		A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Missense_Mutation	SNP	ENST00000296422.7	37	CCDS34041.1	.	.	.	.	.	.	.	.	.	.	T	5.018	0.188936	0.09547	.	.	ENSG00000164037	ENST00000394789;ENST00000296422	T;T	0.13657	2.57;2.57	3.47	2.27	0.28462	.	0.060197	0.64402	N	0.000003	T	0.04407	0.0121	N	0.01048	-1.04	0.34123	D	0.664367	B;B;B	0.28350	0.123;0.208;0.025	B;B;B	0.37304	0.076;0.246;0.108	T	0.28713	-1.0035	10	0.25106	T	0.35	-18.6579	3.8532	0.08963	0.1863:0.1077:0.0:0.7059	.	184;416;416	Q4ZJI4-2;Q4ZJI4;Q4ZJI4-3	.;SL9B1_HUMAN;.	A	416	ENSP00000378269:T416A;ENSP00000296422:T416A	ENSP00000296422:T416A	T	-	1	0	SLC9B1	104046206	1.000000	0.71417	0.206000	0.23566	0.010000	0.07245	3.032000	0.49736	0.514000	0.28300	0.397000	0.26171	ACA		0.323	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173	
SULT1A1	6817	mdanderson.org	37	16	28620121	28620121	+	Missense_Mutation	SNP	G	G	A	rs200542791	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr16:28620121G>A	ENST00000395607.1	-	2	329	c.56C>T	c.(55-57)cCg>cTg	p.P19L	SULT1A1_ENST00000350842.4_Intron|SULT1A1_ENST00000569554.1_Missense_Mutation_p.P19L|SULT1A1_ENST00000314752.7_Missense_Mutation_p.P19L|SULT1A1_ENST00000395609.1_Missense_Mutation_p.P19L	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	19					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)	p.P19L(2)		endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	CTTGATGAGCGGGACCCCCTT	0.632																																						.											2	Substitution - Missense(2)	kidney(2)											36.0	36.0	36.0					16																	28620121		2197	4293	6490	SO:0001583	missense	6817			U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.56C>T	16.37:g.28620121G>A	ENSP00000378971:p.Pro19Leu		Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	ENST00000395607.1	37	CCDS32420.1	.	.	.	.	.	.	.	.	.	.	.	10.83	1.461115	0.26248	.	.	ENSG00000196502	ENST00000314752;ENST00000395609;ENST00000395607	T;T;T	0.01560	4.77;4.77;4.77	2.5	1.49	0.22878	.	0.000000	0.64402	D	0.000001	T	0.02807	0.0084	N	0.24115	0.695	0.47037	D	0.999295	D	0.89917	1.0	D	0.76071	0.987	T	0.57225	-0.7848	10	0.06625	T	0.88	.	7.8438	0.29414	0.1395:0.0:0.8605:0.0	.	19	P50225	ST1A1_HUMAN	L	19	ENSP00000321988:P19L;ENSP00000378972:P19L;ENSP00000378971:P19L	ENSP00000321988:P19L	P	-	2	0	SULT1A1	28527622	0.990000	0.36364	0.082000	0.20525	0.073000	0.16967	2.174000	0.42482	0.605000	0.29947	0.306000	0.20318	CCG		0.632	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254694.2	NM_001055	
SYNJ2	8871	mdanderson.org	37	6	158507981	158507981	+	Silent	SNP	G	G	A	rs2296506	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr6:158507981G>A	ENST00000355585.4	+	23	3378	c.3303G>A	c.(3301-3303)cgG>cgA	p.R1101R	SYNJ2_ENST00000367122.2_Intron|SYNJ2_ENST00000367112.1_Silent_p.R186R|SYNJ2_ENST00000367121.3_Silent_p.R1101R	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	1101	Pro-rich.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TCCCCAACCGGCCTCGGCCAC	0.652													G|||	2644	0.527955	0.5719	0.3386	5008	,	,		14003	0.5913		0.5099	False		,,,				2504	0.5562					.											0								G	,	2440,1966	615.6+/-392.6	668,1104,431	40.0	43.0	42.0		2592,3303	4.8	1.0	6	dbSNP_100	42	4371,4229	576.2+/-390.3	1097,2177,1026	no	coding-synonymous,coding-synonymous	SYNJ2	NM_001178088.1,NM_003898.3	,	1765,3281,1457	AA,AG,GG		49.1744,44.621,47.6319	,	864/1260,1101/1497	158507981	6811,6195	2203	4300	6503	SO:0001819	synonymous_variant	8871			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.3303G>A	6.37:g.158507981G>A			Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	37	CCDS5254.1																																																																																				0.652	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
TMEM108	66000	mdanderson.org	37	3	133098856	133098856	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr3:133098856G>A	ENST00000321871.6	+	4	511	c.301G>A	c.(301-303)Gct>Act	p.A101T	TMEM108_ENST00000393130.3_Missense_Mutation_p.A101T|TMEM108_ENST00000515826.1_Missense_Mutation_p.A101T|TMEM108_ENST00000508711.1_Intron	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	101	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CTCCACCATCGCTGCGACAGT	0.662																																						.											0													79.0	66.0	71.0					3																	133098856		2203	4299	6502	SO:0001583	missense	66000			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.301G>A	3.37:g.133098856G>A	ENSP00000324651:p.Ala101Thr		D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	g	0.318	-0.963467	0.02249	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000514894;ENST00000512662;ENST00000512137;ENST00000515826;ENST00000510183	T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9	2.99	-3.43	0.04810	.	1.088120	0.07306	N	0.874970	T	0.13628	0.0330	N	0.02011	-0.69	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.04013	0.001;0.001	T	0.23762	-1.0179	10	0.13470	T	0.59	0.1393	5.1788	0.15148	0.6526:0.1673:0.1802:0.0	.	101;101	E9PB58;Q6UXF1	.;TM108_HUMAN	T	101;101;52;52;101;101;101	ENSP00000324651:A101T;ENSP00000376838:A101T;ENSP00000422072:A52T;ENSP00000427447:A52T;ENSP00000426301:A101T;ENSP00000423338:A101T;ENSP00000421486:A101T	ENSP00000324651:A101T	A	+	1	0	TMEM108	134581546	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.257000	0.02866	-0.768000	0.04626	-0.230000	0.12252	GCT		0.662	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
WHAMM	123720	mdanderson.org	37	15	83478545	83478545	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr15:83478545C>G	ENST00000286760.4	+	1	166	c.67C>G	c.(67-69)Ccc>Gcc	p.P23A		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	23	Mediates association with membranes. {ECO:0000269|PubMed:18614018}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)			endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						CTTCGCCGAGCCCGAGAGGCA	0.726																																						.											0													10.0	11.0	11.0					15																	83478545		1590	3625	5215	SO:0001583	missense	123720			AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.67C>G	15.37:g.83478545C>G	ENSP00000286760:p.Pro23Ala		Q8N1J9	Missense_Mutation	SNP	ENST00000286760.4	37	CCDS45333.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760084	0.49468	.	.	ENSG00000156232	ENST00000286760;ENST00000234505	T	0.07021	3.23	5.44	3.56	0.40772	.	0.583381	0.18376	N	0.143118	T	0.10637	0.0260	M	0.66939	2.045	0.37618	D	0.921205	B	0.32753	0.383	B	0.28849	0.095	T	0.06881	-1.0802	10	0.44086	T	0.13	.	10.6106	0.45419	0.0:0.8451:0.0:0.1549	.	23	Q8TF30	WHAMM_HUMAN	A	23	ENSP00000286760:P23A	ENSP00000234505:P23A	P	+	1	0	WHAMM	81275599	0.925000	0.31364	0.628000	0.29241	0.970000	0.65996	0.721000	0.25911	0.671000	0.31185	0.585000	0.79938	CCC		0.726	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418463.1		
ZNF469	84627	mdanderson.org	37	16	88497394	88497394	+	Silent	SNP	T	T	C	rs111557381	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr16:88497394T>C	ENST00000437464.1	+	2	3432	c.3432T>C	c.(3430-3432)cgT>cgC	p.R1144R	ZNF469_ENST00000565624.1_Silent_p.R1172R	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CTCAGGCCCGTGGCCCGTCTC	0.766													T|||	191	0.038139	0.0514	0.0346	5008	,	,		9815	0.003		0.0467	False		,,,				2504	0.0501					.											0													4.0	6.0	5.0					16																	88497394		635	1484	2119	SO:0001819	synonymous_variant	84627			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3432T>C	16.37:g.88497394T>C				Silent	SNP	ENST00000437464.1	37	CCDS45544.1																																																																																				0.766	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF696	79943	mdanderson.org	37	8	144378277	144378277	+	Silent	SNP	G	G	C	rs61729412	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr8:144378277G>C	ENST00000330143.3	+	3	841	c.432G>C	c.(430-432)cgG>cgC	p.R144R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CAAAGCACCGGAGCATCCACT	0.716													G|||	111	0.0221645	0.0794	0.0072	5008	,	,		13683	0.0		0.001	False		,,,				2504	0.0					.											0								G		247,4149		8,231,1959	22.0	16.0	18.0		432	1.4	0.1	8	dbSNP_129	18	4,8586		0,4,4291	no	coding-synonymous	ZNF696	NM_030895.2		8,235,6250	CC,CG,GG		0.0466,5.6187,1.9329		144/375	144378277	251,12735	2198	4295	6493	SO:0001819	synonymous_variant	79943			AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.432G>C	8.37:g.144378277G>C			A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																				0.716	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
FLG	2312	bcgsc.ca	37	1	152283467	152283467	+	Missense_Mutation	SNP	G	G	C	rs200557207		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr1:152283467G>C	ENST00000368799.1	-	3	3930	c.3895C>G	c.(3895-3897)Cgg>Ggg	p.R1299G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1299	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			gactgctcccgagaagatcca	0.552									Ichthyosis																													.											0													177.0	177.0	177.0					1																	152283467		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3895C>G	1.37:g.152283467G>C	ENSP00000357789:p.Arg1299Gly		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	4.999	0.185600	0.09495	.	.	ENSG00000143631	ENST00000368799	T	0.01705	4.68	2.98	2.05	0.26809	.	.	.	.	.	T	0.00637	0.0021	L	0.54323	1.7	0.09310	N	1	P	0.43094	0.799	B	0.36464	0.225	T	0.44050	-0.9353	9	0.14252	T	0.57	.	5.2509	0.15521	0.1614:0.0:0.8386:0.0	.	1299	P20930	FILA_HUMAN	G	1299	ENSP00000357789:R1299G	ENSP00000357789:R1299G	R	-	1	2	FLG	150550091	0.005000	0.15991	0.002000	0.10522	0.023000	0.10783	1.776000	0.38594	1.670000	0.50864	0.299000	0.19835	CGG		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
MUC6	4588	bcgsc.ca	37	11	1017280	1017280	+	Missense_Mutation	SNP	G	G	T	rs199539548		TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr11:1017280G>T	ENST00000421673.2	-	31	5571	c.5521C>A	c.(5521-5523)Cca>Aca	p.P1841T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1841	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAGAAAGATGGAACGTGAGTG	0.537																																						.											0													652.0	616.0	628.0					11																	1017280		2199	4282	6481	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5521C>A	11.37:g.1017280G>T	ENSP00000406861:p.Pro1841Thr		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	7.317	0.616153	0.14129	.	.	ENSG00000184956	ENST00000421673	T	0.57595	0.39	3.21	-3.93	0.04143	.	.	.	.	.	T	0.56963	0.2021	M	0.68317	2.08	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50092	-0.8868	9	0.16420	T	0.52	.	1.0186	0.01513	0.1779:0.254:0.3105:0.2576	.	1841	Q6W4X9	MUC6_HUMAN	T	1841	ENSP00000406861:P1841T	ENSP00000406861:P1841T	P	-	1	0	MUC6	1007280	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.710000	0.05024	-1.011000	0.03391	0.313000	0.20887	CCA		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
CEACAM6	4680	bcgsc.ca	37	19	42260742	42260742	+	Missense_Mutation	SNP	C	C	T	rs141329594	byFrequency	TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr19:42260742C>T	ENST00000199764.6	+	2	517	c.299C>T	c.(298-300)aCa>aTa	p.T100I	AC011513.4_ENST00000601409.1_RNA|CEA_ENST00000598976.1_Intron	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	100	Ig-like V-type.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		GGTCGAGAGACAATATACCCC	0.453																																						.											0								C	ILE/THR	4,4402	4.2+/-10.8	0,4,2199	314.0	297.0	303.0		299	-0.5	0.7	19	dbSNP_134	303	5,8595	2.2+/-6.3	0,5,4295	no	missense	CEACAM6	NM_002483.4	89	0,9,6494	TT,TC,CC		0.0581,0.0908,0.0692	benign	100/345	42260742	9,12997	2203	4300	6503	SO:0001583	missense	4680			M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.299C>T	19.37:g.42260742C>T	ENSP00000199764:p.Thr100Ile		Q13774|Q14920|Q53XP7	Missense_Mutation	SNP	ENST00000199764.6	37	CCDS12585.1	.	.	.	.	.	.	.	.	.	.	C	7.727	0.698352	0.15106	9.08E-4	5.81E-4	ENSG00000086548	ENST00000199764	T	0.68479	-0.33	2.55	-0.464	0.12160	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48429	0.1499	L	0.31752	0.955	0.09310	N	1	B	0.14805	0.011	B	0.16722	0.016	T	0.38001	-0.9681	9	0.46703	T	0.11	.	3.8844	0.09091	0.2271:0.612:0.0:0.1609	.	100	P40199	CEAM6_HUMAN	I	100	ENSP00000199764:T100I	ENSP00000199764:T100I	T	+	2	0	CEACAM6	46952582	0.002000	0.14202	0.736000	0.30914	0.051000	0.14879	-0.871000	0.04223	0.158000	0.19367	0.305000	0.20034	ACA		0.453	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321147.1		
TIA1	7072	bcgsc.ca	37	2	70463215	70463215	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr2:70463215A>G	ENST00000433529.2	-	2	329	c.119T>C	c.(118-120)aTg>aCg	p.M40T	TIA1_ENST00000282574.4_Missense_Mutation_p.M40T|TIA1_ENST00000415783.2_Missense_Mutation_p.M40T|TIA1_ENST00000445587.1_Missense_Mutation_p.M40T|C2orf42_ENST00000470096.1_Intron|TIA1_ENST00000416149.2_Missense_Mutation_p.M40T	NM_022173.2	NP_071505.2	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein	40	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of translation (GO:0017148)|regulation of mRNA splicing, via spliceosome (GO:0048024)	cytoplasmic stress granule (GO:0010494)|nuclear stress granule (GO:0097165)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	17						CCTTACATCCATAATCATTTT	0.338																																						.											0													72.0	73.0	72.0					2																	70463215		2203	4300	6503	SO:0001583	missense	7072				CCDS1900.1, CCDS1901.1	2p13	2013-02-12	2001-11-28		ENSG00000116001	ENSG00000116001		"""RNA binding motif (RRM) containing"""	11802	protein-coding gene	gene with protein product	"""T-cell-restricted intracellular antigen-1"", ""nucleolysin TIA-1 isoform p40"""	603518	"""TIA1 cytotoxic granule-associated RNA-binding protein"""			8176212, 12486009	Standard	NM_022173		Approved		uc002sgj.4	P31483	OTTHUMG00000129644	ENST00000433529.2:c.119T>C	2.37:g.70463215A>G	ENSP00000401371:p.Met40Thr		Q53SS9	Missense_Mutation	SNP	ENST00000433529.2	37	CCDS1901.1	.	.	.	.	.	.	.	.	.	.	A	9.479	1.097619	0.20552	.	.	ENSG00000116001	ENST00000433529;ENST00000415783;ENST00000477807;ENST00000282574;ENST00000445587;ENST00000416149	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	5.21	5.21	0.72293	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.048795	0.85682	D	0.000000	T	0.53433	0.1796	N	0.05306	-0.075	0.80722	D	1	B;B;B;B	0.10296	0.003;0.001;0.0;0.0	B;B;B;B	0.09377	0.004;0.001;0.004;0.0	T	0.50759	-0.8790	10	0.20046	T	0.44	-11.1683	14.1969	0.65677	1.0:0.0:0.0:0.0	.	40;78;40;40	B4E0E5;Q59G98;P31483-2;P31483	.;.;.;TIA1_HUMAN	T	40;40;78;40;40;40	ENSP00000401371:M40T;ENSP00000404023:M40T;ENSP00000282574:M40T;ENSP00000399567:M40T;ENSP00000413751:M40T	ENSP00000282574:M40T	M	-	2	0	TIA1	70316719	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.636000	0.46545	2.097000	0.63578	0.454000	0.30748	ATG		0.338	TIA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251842.2	NM_022037	
CAMK4	814	bcgsc.ca	37	5	110820081	110820081	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr5:110820081G>A	ENST00000282356.4	+	11	1737	c.1339G>A	c.(1339-1341)Gca>Aca	p.A447T	CAMK4_ENST00000512890.1_3'UTR|CAMK4_ENST00000512453.1_Missense_Mutation_p.A447T	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	447					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TGTGGAGGAGGCAGCAGCTCC	0.542																																						.											0													54.0	53.0	54.0					5																	110820081		2202	4300	6502	SO:0001583	missense	814			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.1339G>A	5.37:g.110820081G>A	ENSP00000282356:p.Ala447Thr		D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052040	0.36181	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	T;T	0.68025	-0.3;-0.3	4.84	-0.624	0.11552	.	0.774566	0.10590	N	0.656924	T	0.43743	0.1261	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.34354	-0.9832	10	0.66056	D	0.02	.	4.2987	0.10915	0.0911:0.4521:0.3025:0.1544	.	447	Q16566	KCC4_HUMAN	T	447	ENSP00000422634:A447T;ENSP00000282356:A447T	ENSP00000282356:A447T	A	+	1	0	CAMK4	110847980	0.021000	0.18746	0.006000	0.13384	0.041000	0.13682	0.406000	0.21032	0.204000	0.20548	0.585000	0.79938	GCA		0.542	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744	
MT-ND5	4540	bcgsc.ca	37	M	13121	13121	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chrM:13121G>T	ENST00000361567.2	+	1	785	c.785G>T	c.(784-786)cGc>cTc	p.R262L	MT-TT_ENST00000387460.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	262					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTTACTCATCCGCTTCCACCC	0.527																																						.											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.785G>T	M.37:g.13121G>T	ENSP00000354813:p.Arg262Leu		Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	37																																																																																					0.527	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
RBM47	54502	bcgsc.ca	37	4	40438608	40438609	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KL-8330-01A-11D-2310-10	TCGA-KL-8330-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	09537dce-c797-4b60-962a-d4c3cd6ab00a	1d82038a-3a67-4b82-8e8d-5ba2c855b563	g.chr4:40438608_40438609insT	ENST00000381793.2	-	4	1575_1576	c.1179_1180insA	c.(1177-1182)cctaggfs	p.R394fs	RBM47_ENST00000515809.1_Intron|RBM47_ENST00000319592.4_Intron|RBM47_ENST00000514014.1_Frame_Shift_Ins_p.R356fs|RBM47_ENST00000295971.7_Frame_Shift_Ins_p.R394fs|RBM47_ENST00000381795.6_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	394					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						TAGGAACCCCTAGGCCCTGGGG	0.515																																						.											0																																										SO:0001589	frameshift_variant	54502			AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.1179dupA	4.37:g.40438608_40438608dupT	ENSP00000371212:p.Arg394fs		A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Frame_Shift_Ins	INS	ENST00000381793.2	37	CCDS43223.1																																																																																				0.515	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
