#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRKCDBP	112464	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	6341681	6341681	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr11:6341681C>T	ENST00000303927.3	-	1	196	c.26G>A	c.(25-27)gGg>gAg	p.G9E	PRKCDBP_ENST00000530979.1_Missense_Mutation_p.G9E	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	9					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGGCACAGGCCCCCGCTCCAA	0.701																																						.											0													10.0	11.0	11.0					11																	6341681		2131	4149	6280	SO:0001583	missense	112464			AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.26G>A	11.37:g.6341681C>T	ENSP00000307292:p.Gly9Glu			Missense_Mutation	SNP	ENST00000303927.3	37	CCDS7762.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102811	0.76983	.	.	ENSG00000170955	ENST00000303927;ENST00000530979	T;T	0.55413	0.52;1.54	5.03	3.07	0.35406	.	0.516908	0.19338	N	0.116703	T	0.29491	0.0735	N	0.08118	0	0.28687	N	0.904783	B	0.16802	0.019	B	0.23419	0.046	T	0.11842	-1.0571	10	0.62326	D	0.03	-17.3016	6.1205	0.20150	0.0:0.7081:0.1916:0.1004	.	9	Q969G5	PRDBP_HUMAN	E	9	ENSP00000307292:G9E;ENSP00000432047:G9E	ENSP00000307292:G9E	G	-	2	0	PRKCDBP	6298257	0.452000	0.25713	0.994000	0.49952	0.910000	0.53928	0.800000	0.27042	2.613000	0.88420	0.655000	0.94253	GGG		0.701	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040	
MAP7D1	55700	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	36643614	36643614	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr1:36643614G>A	ENST00000373151.2	+	9	1736	c.1520G>A	c.(1519-1521)cGg>cAg	p.R507Q	MAP7D1_ENST00000373150.4_Missense_Mutation_p.R475Q|MAP7D1_ENST00000373148.4_Missense_Mutation_p.R53Q|MAP7D1_ENST00000316156.4_Missense_Mutation_p.R470Q	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	507	Pro-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CCCAAGGGGCGGGTTCGGAGG	0.692																																						.											0													40.0	43.0	42.0					1																	36643614		2203	4300	6503	SO:0001583	missense	55700			AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.1520G>A	1.37:g.36643614G>A	ENSP00000362244:p.Arg507Gln		D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	ENST00000373151.2	37	CCDS30673.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914600	0.33815	.	.	ENSG00000116871	ENST00000316156;ENST00000373150;ENST00000373151;ENST00000373148	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.04	4.13	0.48395	.	0.415672	0.17946	N	0.156694	T	0.61837	0.2379	M	0.62723	1.935	0.33900	D	0.638424	B;D;B;B;D	0.76494	0.062;0.999;0.013;0.013;0.999	B;D;B;B;D	0.72625	0.01;0.978;0.005;0.003;0.978	T	0.70371	-0.4890	10	0.49607	T	0.09	-8.286	9.1503	0.36959	0.0989:0.0:0.9011:0.0	.	53;507;470;475;507	Q3KQU3-3;D3DPS3;Q3KQU3-2;Q3KQU3-4;Q3KQU3	.;.;.;.;MA7D1_HUMAN	Q	470;475;507;53	ENSP00000320228:R470Q;ENSP00000362243:R475Q;ENSP00000362244:R507Q;ENSP00000362241:R53Q	ENSP00000320228:R470Q	R	+	2	0	MAP7D1	36416201	1.000000	0.71417	0.875000	0.34327	0.002000	0.02628	4.004000	0.57068	1.344000	0.45657	0.655000	0.94253	CGG		0.692	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1	NM_018067	
RNF43	54894	hgsc.bcm.edu;ucsc.edu	37	17	56448329	56448329	+	Silent	SNP	G	G	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr17:56448329G>T	ENST00000584437.1	-	2	2273	c.318C>A	c.(316-318)atC>atA	p.I106I	RNF43_ENST00000577625.1_5'UTR|RNF43_ENST00000583753.1_Intron|RNF43_ENST00000407977.2_Silent_p.I106I|RNF43_ENST00000581868.1_5'UTR|RNF43_ENST00000500597.2_Intron|RNF43_ENST00000577716.1_Silent_p.I106I|BZRAP1-AS1_ENST00000583841.1_RNA			Q68DV7	RNF43_HUMAN	ring finger protein 43	106					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCAGCTTGACGATGCTGATGA	0.592																																						.											0													83.0	68.0	73.0					17																	56448329		2203	4300	6503	SO:0001819	synonymous_variant	54894				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.318C>A	17.37:g.56448329G>T			A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Silent	SNP	ENST00000584437.1	37	CCDS11607.1																																																																																				0.592	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																						.											0													15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys		A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
FER1L6	654463	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	8	125074107	125074107	+	Silent	SNP	C	C	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr8:125074107C>T	ENST00000522917.1	+	25	3368	c.3162C>T	c.(3160-3162)aaC>aaT	p.N1054N	FER1L6_ENST00000399018.1_Silent_p.N1054N|FER1L6-AS2_ENST00000601180.1_RNA|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1054	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TGCCTGAGAACGAGCTTCTGC	0.572																																						.											0													71.0	73.0	72.0					8																	125074107		1999	4196	6195	SO:0001819	synonymous_variant	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3162C>T	8.37:g.125074107C>T				Silent	SNP	ENST00000522917.1	37	CCDS43767.1																																																																																				0.572	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
MYBPHL	343263	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	1	109840181	109840181	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr1:109840181C>T	ENST00000357155.1	-	3	342	c.293G>A	c.(292-294)cGt>cAt	p.R98H	MYBPHL_ENST00000477962.1_Intron	NM_001010985.2|NM_001265613.1	NP_001010985.2|NP_001252542.1	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	98	Ig-like C2-type 1.									central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(2)	14		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)		CACACTCACACGCCTGGTGTC	0.587																																						.											0													89.0	80.0	83.0					1																	109840181		2203	4300	6503	SO:0001583	missense	343263			AK129834	CCDS30793.1	1p13	2013-02-11			ENSG00000221986	ENSG00000221986		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	30434	protein-coding gene	gene with protein product							Standard	NM_001010985		Approved		uc001dxk.1	A2RUH7	OTTHUMG00000012002	ENST00000357155.1:c.293G>A	1.37:g.109840181C>T	ENSP00000349678:p.Arg98His		B7ZME5|Q5T2Z7	Missense_Mutation	SNP	ENST00000357155.1	37	CCDS30793.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.355964	0.24598	.	.	ENSG00000221986	ENST00000357155	T	0.52057	0.68	4.63	2.76	0.32466	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.41050	0.1142	L	0.48260	1.515	0.19300	N	0.999975	D;B	0.89917	1.0;0.013	D;B	0.69824	0.966;0.012	T	0.09930	-1.0652	9	0.44086	T	0.13	.	5.9414	0.19196	0.0:0.7081:0.0:0.2919	.	98;98	B7ZME5;A2RUH7	.;MBPHL_HUMAN	H	98	ENSP00000349678:R98H	ENSP00000349678:R98H	R	-	2	0	MYBPHL	109641704	0.000000	0.05858	0.940000	0.37924	0.691000	0.40173	0.219000	0.17641	1.320000	0.45209	0.655000	0.94253	CGT		0.587	MYBPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033197.1	NM_001010985	
OR2M2	391194	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	248343636	248343636	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr1:248343636G>C	ENST00000359682.2	+	1	349	c.349G>C	c.(349-351)Gtt>Ctt	p.V117L		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V117I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCTTTTGGCTGTTATGGCTTA	0.403																																						.											1	Substitution - Missense(1)	lung(1)											206.0	220.0	215.0					1																	248343636		2203	4300	6503	SO:0001583	missense	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.349G>C	1.37:g.248343636G>C	ENSP00000352710:p.Val117Leu		A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.063815	0.00386	.	.	ENSG00000198601	ENST00000359682	T	0.05139	3.49	2.03	-0.334	0.12666	GPCR, rhodopsin-like superfamily (1);	0.744519	0.10380	U	0.681646	T	0.04048	0.0113	L	0.38175	1.15	0.09310	N	1	B	0.17268	0.021	B	0.19666	0.026	T	0.47873	-0.9083	10	0.05833	T	0.94	.	3.9033	0.09171	0.2465:0.0:0.5662:0.1872	.	117	Q96R28	OR2M2_HUMAN	L	117	ENSP00000352710:V117L	ENSP00000352710:V117L	V	+	1	0	OR2M2	246410259	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	1.410000	0.34691	-0.220000	0.09988	-0.396000	0.06452	GTT		0.403	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
DYX1C1	161582	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	15	55731737	55731737	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr15:55731737C>A	ENST00000321149.3	-	7	1193	c.826G>T	c.(826-828)Gac>Tac	p.D276Y	DYX1C1_ENST00000448430.2_Missense_Mutation_p.D276Y|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000348518.3_Missense_Mutation_p.D276Y|DYX1C1_ENST00000457155.2_Missense_Mutation_p.D276Y|DYX1C1_ENST00000380679.1_Missense_Mutation_p.D276Y	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	276					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		TCAGCTATGTCAGTATTCATT	0.338																																						.											0													104.0	100.0	101.0					15																	55731737		2193	4291	6484	SO:0001583	missense	161582				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.826G>T	15.37:g.55731737C>A	ENSP00000323275:p.Asp276Tyr		Q6P5Y9|Q8N1S6	Missense_Mutation	SNP	ENST00000321149.3	37	CCDS10154.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839365	0.71488	.	.	ENSG00000256061	ENST00000420792;ENST00000448430;ENST00000380679;ENST00000457155;ENST00000321149;ENST00000348518	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	5.09	5.09	0.68999	.	0.064564	0.64402	U	0.000015	D	0.90195	0.6935	M	0.69823	2.125	0.54753	D	0.999981	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.68353	0.957;0.929;0.944	D	0.90778	0.4677	10	0.59425	D	0.04	.	17.8393	0.88710	0.0:1.0:0.0:0.0	.	276;276;276	Q8WXU2-3;Q8WXU2;Q8WXU2-2	.;DYXC1_HUMAN;.	Y	276	ENSP00000403412:D276Y;ENSP00000370054:D276Y;ENSP00000402640:D276Y;ENSP00000323275:D276Y;ENSP00000299561:D276Y	ENSP00000323275:D276Y	D	-	1	0	DYX1C1	53519029	1.000000	0.71417	1.000000	0.80357	0.590000	0.36582	3.907000	0.56348	2.521000	0.84997	0.563000	0.77884	GAC		0.338	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254976.1	NM_130810	
ABCB11	8647	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	2	169842725	169842725	+	Silent	SNP	A	A	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr2:169842725A>C	ENST00000263817.6	-	10	1102	c.978T>G	c.(976-978)acT>acG	p.T326T		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	326	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACACGAATCCAGTAAAGAATC	0.443																																						.											0													155.0	147.0	150.0					2																	169842725		1914	4128	6042	SO:0001819	synonymous_variant	8647			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.978T>G	2.37:g.169842725A>C			Q53TL2|Q9UNB2	Silent	SNP	ENST00000263817.6	37	CCDS46444.1																																																																																				0.443	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742	
PARD3B	117583	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	2	206037069	206037069	+	Silent	SNP	G	G	A			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr2:206037069G>A	ENST00000406610.2	+	12	1962	c.1755G>A	c.(1753-1755)caG>caA	p.Q585Q	PARD3B_ENST00000462231.1_Silent_p.Q585Q|PARD3B_ENST00000358768.2_Silent_p.Q523Q|PARD3B_ENST00000349953.3_Silent_p.Q585Q|PARD3B_ENST00000351153.1_Silent_p.Q585Q	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	585	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GGATGATCCAGTTGGTGATTC	0.488																																						.											0													105.0	108.0	107.0					2																	206037069		1971	4171	6142	SO:0001819	synonymous_variant	117583			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1755G>A	2.37:g.206037069G>A			E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Silent	SNP	ENST00000406610.2	37																																																																																					0.488	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	
MCF2L2	23101	hgsc.bcm.edu	37	3	183145747	183145747	+	Missense_Mutation	SNP	C	C	T	rs372591631	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr3:183145747C>T	ENST00000328913.3	-	1	316	c.19G>A	c.(19-21)Gaa>Aaa	p.E7K	MCF2L2_ENST00000414362.2_Missense_Mutation_p.E7K|MCF2L2_ENST00000473233.1_Missense_Mutation_p.E7K|MCF2L2_ENST00000447025.2_Missense_Mutation_p.E7K	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	7							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGCATCTCTTCTTTTAAGCAA	0.438																																						.											0													90.0	96.0	94.0					3																	183145747		2203	4300	6503	SO:0001583	missense	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.19G>A	3.37:g.183145747C>T	ENSP00000328118:p.Glu7Lys		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255402	0.59321	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	T;T;T;T	0.06294	4.42;4.5;3.63;3.32	5.31	4.42	0.53409	.	0.187638	0.33217	N	0.005153	T	0.07773	0.0195	N	0.24115	0.695	0.27149	N	0.961459	P;P	0.51791	0.939;0.948	P;P	0.50314	0.637;0.588	T	0.09207	-1.0685	10	0.72032	D	0.01	.	9.0986	0.36653	0.0:0.8969:0.0:0.1031	.	7;7	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	K	7	ENSP00000328118:E7K;ENSP00000420070:E7K;ENSP00000388190:E7K;ENSP00000414131:E7K	ENSP00000328118:E7K	E	-	1	0	MCF2L2	184628441	1.000000	0.71417	0.772000	0.31596	0.835000	0.47333	2.586000	0.46119	1.201000	0.43203	0.655000	0.94253	GAA		0.438	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
LETM1	3954	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	4	1821161	1821162	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr4:1821161_1821162GC>AG	ENST00000302787.2	-	11	1942_1943	c.1646_1647GC>CT	c.(1645-1647)aGC>aCT	p.S549T		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	549					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			AGCAGGCATCGCTGAGGATGTC	0.535																																						.											0																																										SO:0001583	missense	3954			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1646_1647delinsAG	4.37:g.1821161_1821162delinsAG	ENSP00000305653:p.Ser549Thr		B4DED2|Q9UF65	Missense_Mutation	DNP	ENST00000302787.2	37	CCDS3355.1																																																																																				0.535	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1		
USP21	27005	broad.mit.edu	37	1	161132827	161132827	+	Missense_Mutation	SNP	C	C	T	rs148729808	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr1:161132827C>T	ENST00000289865.8	+	6	1233	c.1012C>T	c.(1012-1014)Cgc>Tgc	p.R338C	USP21_ENST00000368001.1_Missense_Mutation_p.R338C|USP21_ENST00000368002.3_Missense_Mutation_p.R338C	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	338	USP.				histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CTCTCCACCCCGCCGAGGAGG	0.557																																						.											0								C	CYS/ARG,CYS/ARG	3,4403	6.2+/-15.9	0,3,2200	82.0	89.0	86.0		1012,1012	0.5	0.3	1	dbSNP_134	86	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	USP21	NM_001014443.2,NM_012475.4	180,180	0,9,6494	TT,TC,CC		0.0698,0.0681,0.0692	probably-damaging,probably-damaging	338/566,338/566	161132827	9,12997	2203	4300	6503	SO:0001583	missense	27005			AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.1012C>T	1.37:g.161132827C>T	ENSP00000289865:p.Arg338Cys		Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	ENST00000289865.8	37	CCDS30920.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535267	0.27475	6.81E-4	6.98E-4	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.16324	2.52;2.52;2.35	4.72	0.51	0.16983	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.04815	0.0130	L	0.46670	1.46	0.33260	D	0.559581	B	0.02656	0.0	B	0.01281	0.0	T	0.17349	-1.0372	9	0.48119	T	0.1	.	3.6427	0.08173	0.1724:0.5373:0.0:0.2904	.	338	Q9UK80	UBP21_HUMAN	C	338	ENSP00000356981:R338C;ENSP00000289865:R338C;ENSP00000356980:R338C	ENSP00000289865:R338C	R	+	1	0	USP21	159399451	0.473000	0.25878	0.291000	0.24904	0.711000	0.40976	0.033000	0.13754	0.217000	0.20800	-0.463000	0.05309	CGC		0.557	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1		
OR2M2	391194	broad.mit.edu;mdanderson.org	37	1	248343935	248343935	+	Silent	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr1:248343935T>C	ENST00000359682.2	+	1	648	c.648T>C	c.(646-648)gcT>gcC	p.A216A		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCATCATTGCTTCCTATGCTC	0.438																																						.											0													224.0	207.0	213.0					1																	248343935		2203	4300	6503	SO:0001819	synonymous_variant	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.648T>C	1.37:g.248343935T>C			A3KFT4	Silent	SNP	ENST00000359682.2	37	CCDS31106.1																																																																																				0.438	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
CAPN5	726	broad.mit.edu	37	11	76804733	76804733	+	Silent	SNP	C	C	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr11:76804733C>T	ENST00000278559.3	+	3	360	c.171C>T	c.(169-171)atC>atT	p.I57I	CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Silent_p.I57I|CAPN5_ENST00000456580.2_Silent_p.I97I	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	57	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						CGCAGGGCATCTGCGAGGACC	0.637																																						.											0													38.0	30.0	33.0					11																	76804733		2196	4289	6485	SO:0001819	synonymous_variant	726				CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.171C>T	11.37:g.76804733C>T			O00263	Silent	SNP	ENST00000278559.3	37	CCDS8248.1																																																																																				0.637	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055	
RILPL1	353116	broad.mit.edu	37	12	123957223	123957223	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr12:123957223G>T	ENST00000376874.4	-	7	1309	c.1074C>A	c.(1072-1074)agC>agA	p.S358R	RILPL1_ENST00000544468.1_Missense_Mutation_p.S31R|SNRNP35_ENST00000527158.2_3'UTR|RILPL1_ENST00000340724.6_Missense_Mutation_p.S238R	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	358					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)		p.S358R(3)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GGGAGAAGAAGCTAAACCTTT	0.498																																						.											3	Substitution - Missense(3)	kidney(2)|endometrium(1)											65.0	63.0	63.0					12																	123957223		1944	4154	6098	SO:0001583	missense	353116			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.1074C>A	12.37:g.123957223G>T	ENSP00000366070:p.Ser358Arg		Q66K36|Q8N1M0	Missense_Mutation	SNP	ENST00000376874.4	37	CCDS45006.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028945	0.75504	.	.	ENSG00000188026	ENST00000376874;ENST00000340724;ENST00000544468	T;T;T	0.27720	1.65;1.65;1.65	5.47	4.47	0.54385	.	.	.	.	.	T	0.37892	0.1020	L	0.29908	0.895	0.51767	D	0.999936	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.991	T	0.11717	-1.0576	9	0.49607	T	0.09	-0.9352	6.5327	0.22336	0.2105:0.0:0.7895:0.0	.	358;207	Q5EBL4;Q5EBL4-3	RIPL1_HUMAN;.	R	358;238;31	ENSP00000366070:S358R;ENSP00000345874:S238R;ENSP00000442991:S31R	ENSP00000345874:S238R	S	-	3	2	RILPL1	122523176	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.403000	0.44530	2.566000	0.86566	0.655000	0.94253	AGC		0.498	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400595.1	NM_178314	
ZMYM5	9205	broad.mit.edu	37	13	20426257	20426257	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr13:20426257T>C	ENST00000337963.4	-	3	328	c.64A>G	c.(64-66)Atg>Gtg	p.M22V	ZMYM5_ENST00000382907.4_Missense_Mutation_p.M22V|ZMYM5_ENST00000382905.4_Missense_Mutation_p.M22V	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	22						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GCCATGGCCATATTCCCTAAT	0.413																																						.											0													205.0	205.0	205.0					13																	20426257		2203	4300	6503	SO:0001583	missense	9205			AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.64A>G	13.37:g.20426257T>C	ENSP00000337034:p.Met22Val		B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	SNP	ENST00000337963.4	37		.	.	.	.	.	.	.	.	.	.	T	0.574	-0.839877	0.02692	.	.	ENSG00000132950	ENST00000337963;ENST00000502168;ENST00000382907;ENST00000382905	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	4.49	0.351	0.16042	.	.	.	.	.	T	0.15046	0.0363	N	0.22421	0.69	0.09310	N	1	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.04013	0.001;0.0;0.0	T	0.23762	-1.0179	9	0.52906	T	0.07	2.6265	5.3146	0.15849	0.2807:0.0774:0.0:0.6419	.	22;22;22	Q9UJ78;Q9UJ78-2;Q9UJ78-1	ZMYM5_HUMAN;.;.	V	22;12;22;22	ENSP00000337034:M22V;ENSP00000445779:M12V;ENSP00000372364:M22V;ENSP00000372361:M22V	ENSP00000337034:M22V	M	-	1	0	ZMYM5	19324257	0.013000	0.17824	0.001000	0.08648	0.008000	0.06430	0.632000	0.24583	-0.006000	0.14370	0.459000	0.35465	ATG		0.413	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
KCNK10	54207	broad.mit.edu	37	14	88652217	88652217	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr14:88652217C>T	ENST00000340700.5	-	7	1730	c.1279G>A	c.(1279-1281)Ggg>Agg	p.G427R	KCNK10_ENST00000312350.5_Missense_Mutation_p.G432R|KCNK10_ENST00000319231.5_Missense_Mutation_p.G432R	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	427					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TGCTCCGGCCCCTTCAGGCGC	0.597																																						.											0													70.0	73.0	72.0					14																	88652217		2203	4300	6503	SO:0001583	missense	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1279G>A	14.37:g.88652217C>T	ENSP00000343104:p.Gly427Arg		B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.785026	0.49997	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.92805	-3.1;-3.11;-3.08	5.71	5.71	0.89125	.	0.463750	0.25138	N	0.032841	D	0.89646	0.6775	N	0.08118	0	0.80722	D	1	P;P;P	0.52577	0.89;0.745;0.954	P;B;P	0.53450	0.521;0.277;0.726	D	0.91751	0.5412	10	0.66056	D	0.02	.	18.8558	0.92251	0.0:1.0:0.0:0.0	.	427;432;432	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	R	427;432;432	ENSP00000343104:G427R;ENSP00000310568:G432R;ENSP00000312811:G432R	ENSP00000310568:G432R	G	-	1	0	KCNK10	87721970	1.000000	0.71417	0.352000	0.25734	0.037000	0.13140	5.529000	0.67135	2.709000	0.92574	0.655000	0.94253	GGG		0.597	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
HERC2P2	400322	broad.mit.edu	37	15	23308703	23308703	+	RNA	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr15:23308703T>C	ENST00000560464.1	-	0	3837									hect domain and RLD 2 pseudogene 2																		CCAGGTCCACTTGTCCTGCGG	0.602																																						.											0																																												400322			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23308703T>C				RNA	SNP	ENST00000560464.1	37																																																																																					0.602	HERC2P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415936.1		
CPNE7	27132	broad.mit.edu;bcgsc.ca	37	16	89649860	89649860	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr16:89649860A>G	ENST00000268720.5	+	4	636	c.506A>G	c.(505-507)gAc>gGc	p.D169G	CPNE7_ENST00000319518.8_Intron	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII	169					lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		aggtatgatgacctctgcctc	0.642																																						.											0													40.0	25.0	30.0					16																	89649860		2039	4043	6082	SO:0001583	missense	27132			AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	ENST00000268720.5:c.506A>G	16.37:g.89649860A>G	ENSP00000268720:p.Asp169Gly			Missense_Mutation	SNP	ENST00000268720.5	37	CCDS10980.1	.	.	.	.	.	.	.	.	.	.	A	1.390	-0.581055	0.03854	.	.	ENSG00000178773	ENST00000268720	T	0.27557	1.66	0.748	-0.804	0.10882	.	290.740000	0.00166	U	0.000000	T	0.14917	0.0360	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09907	-1.0653	10	0.23891	T	0.37	.	2.7152	0.05185	0.5777:0.0:0.0:0.4223	.	169	Q9UBL6	CPNE7_HUMAN	G	169	ENSP00000268720:D169G	ENSP00000268720:D169G	D	+	2	0	CPNE7	88177361	0.000000	0.05858	0.003000	0.11579	0.041000	0.13682	-0.257000	0.08745	-0.316000	0.08690	-0.871000	0.02989	GAC		0.642	CPNE7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269929.2		
GBX2	2637	broad.mit.edu;bcgsc.ca	37	2	237074936	237074936	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr2:237074936T>C	ENST00000306318.4	-	2	1065	c.668A>G	c.(667-669)gAc>gGc	p.D223G	GBX2_ENST00000551105.1_3'UTR|AC079135.1_ENST00000415226.1_RNA|AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000465889.1_5'UTR	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	223				QAAHKEEDPGHALEETPPSSGA -> PGSSQGGRPGPRGGG DPAEQRR (in Ref. 6). {ECO:0000305}.	autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		GTGGCCCGGGTCTTCCTCCTT	0.677																																						.											0													50.0	50.0	50.0					2																	237074936		2203	4300	6503	SO:0001583	missense	2637			AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.668A>G	2.37:g.237074936T>C	ENSP00000302251:p.Asp223Gly		B2RPH7|O43833|Q53RX5|Q9Y5Y1	Missense_Mutation	SNP	ENST00000306318.4	37	CCDS2515.1	.	.	.	.	.	.	.	.	.	.	T	12.43	1.934558	0.34189	.	.	ENSG00000168505	ENST00000306318	D	0.92048	-2.96	4.29	4.29	0.51040	Homeodomain-like (1);	0.054903	0.64402	D	0.000001	D	0.83008	0.5161	N	0.17082	0.46	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.76610	-0.2896	10	0.25751	T	0.34	-14.1119	8.9765	0.35939	0.0:0.0888:0.0:0.9112	.	223	P52951	GBX2_HUMAN	G	223	ENSP00000302251:D223G	ENSP00000302251:D223G	D	-	2	0	GBX2	236739675	1.000000	0.71417	0.993000	0.49108	0.749000	0.42624	4.165000	0.58196	1.582000	0.49881	0.379000	0.24179	GAC		0.677	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257078.3	NM_001485	
HELZ2	85441	broad.mit.edu	37	20	62194557	62194557	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr20:62194557delA	ENST00000467148.1	-	8	5687	c.5618delT	c.(5617-5619)gtgfs	p.V1873fs	HELZ2_ENST00000427522.2_Frame_Shift_Del_p.V1304fs	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1873				V -> A (in Ref. 2; BAE46995). {ECO:0000305}.	cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCCCGGGCCACCTCCAGGAA	0.701																																						.											0													7.0	8.0	7.0					20																	62194557		2134	4206	6340	SO:0001589	frameshift_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5618delT	20.37:g.62194557delA	ENSP00000417401:p.Val1873fs		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Frame_Shift_Del	DEL	ENST00000467148.1	37	CCDS33508.1																																																																																				0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
CCDC157	550631	broad.mit.edu	37	22	30766573	30766573	+	Missense_Mutation	SNP	G	G	A	rs370198354		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr22:30766573G>A	ENST00000405659.1	+	5	1388	c.679G>A	c.(679-681)Gtc>Atc	p.V227I	CCDC157_ENST00000338306.3_Missense_Mutation_p.V227I			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	227										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						ATGCGCCAGCGTCCAGGGAAG	0.617																																						.											0													81.0	69.0	73.0					22																	30766573		2203	4300	6503	SO:0001583	missense	550631			BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.679G>A	22.37:g.30766573G>A	ENSP00000385357:p.Val227Ile		Q0VD76|Q9BYA4	Missense_Mutation	SNP	ENST00000405659.1	37	CCDS33632.2	.	.	.	.	.	.	.	.	.	.	G	19.49	3.838226	0.71373	.	.	ENSG00000187860	ENST00000405659;ENST00000338306	T;T	0.27720	1.65;1.65	5.54	4.53	0.55603	.	0.136815	0.47852	D	0.000203	T	0.37237	0.0996	L	0.56769	1.78	0.80722	D	1	D	0.61697	0.99	P	0.47075	0.536	T	0.29518	-1.0009	10	0.51188	T	0.08	-46.0966	14.4936	0.67667	0.0698:0.0:0.9302:0.0	.	227	Q569K6	CC157_HUMAN	I	227	ENSP00000385357:V227I;ENSP00000343087:V227I	ENSP00000343087:V227I	V	+	1	0	CCDC157	29096573	0.982000	0.34865	0.965000	0.40720	0.155000	0.21991	1.856000	0.39389	1.586000	0.49944	-0.136000	0.14681	GTC		0.617	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320936.1	NM_001017437	
OTOP1	133060	broad.mit.edu	37	4	4228459	4228459	+	Frame_Shift_Del	DEL	G	G	-	rs553397205		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr4:4228459delG	ENST00000296358.4	-	1	157	c.133delC	c.(133-135)cggfs	p.R46fs		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	46					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ccgccccgccggggggccggg	0.736																																						.											0													3.0	4.0	4.0					4																	4228459		1958	3835	5793	SO:0001589	frameshift_variant	133060			BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.133delC	4.37:g.4228459delG	ENSP00000296358:p.Arg46fs		A1L476	Frame_Shift_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																				0.736	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
PDE8B	8622	broad.mit.edu	37	5	76714238	76714238	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr5:76714238A>G	ENST00000264917.5	+	18	2141	c.2096A>G	c.(2095-2097)gAc>gGc	p.D699G	PDE8B_ENST00000340978.3_Missense_Mutation_p.D652G|PDE8B_ENST00000333194.4_Missense_Mutation_p.D644G|PDE8B_ENST00000346042.3_Missense_Mutation_p.D602G|PDE8B_ENST00000505283.1_Missense_Mutation_p.D164G|PDE8B_ENST00000342343.4_Missense_Mutation_p.D679G	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	699	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	ACGGTCAAGGACACCAAATGC	0.483																																						.											0													83.0	68.0	73.0					5																	76714238		2203	4300	6503	SO:0001583	missense	8622			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.2096A>G	5.37:g.76714238A>G	ENSP00000264917:p.Asp699Gly		Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	ENST00000264917.5	37	CCDS4037.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.644819	0.67358	.	.	ENSG00000113231	ENST00000340978;ENST00000346042;ENST00000264917;ENST00000342343;ENST00000333194;ENST00000505283	D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.75	5.75	0.90469	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.85691	0.5755	M	0.73430	2.235	0.80722	D	1	B;B;B;B;B	0.31274	0.086;0.057;0.317;0.206;0.071	B;B;B;B;B	0.38500	0.275;0.105;0.233;0.169;0.26	D	0.85748	0.1341	10	0.66056	D	0.02	.	16.0519	0.80769	1.0:0.0:0.0:0.0	.	602;652;644;679;699	O95263-2;O95263-6;O95263-3;O95263-4;O95263	.;.;.;.;PDE8B_HUMAN	G	652;602;699;679;644;164	ENSP00000345446:D652G;ENSP00000330428:D602G;ENSP00000264917:D699G;ENSP00000345646:D679G;ENSP00000331336:D644G;ENSP00000423461:D164G	ENSP00000264917:D699G	D	+	2	0	PDE8B	76749994	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	9.339000	0.96797	2.196000	0.70406	0.533000	0.62120	GAC		0.483	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
NHP2	55651	broad.mit.edu	37	5	177580963	177580963	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr5:177580963G>A	ENST00000274606.3	-	0	5				NHP2_ENST00000314397.4_5'Flank	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein						rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|kidney(1)|ovary(2)	4						CAGCCCAATCGTTGACGCCCA	0.602																																						.											0																																												55651			AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.-145C>T	5.37:g.177580963G>A			A6NKY8|Q9P095	Splice_Site	SNP	ENST00000274606.3	37	CCDS4432.1																																																																																				0.602	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253471.1	NM_017838	
CEP162	22832	broad.mit.edu	37	6	84884491	84884491	+	Silent	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr6:84884491T>C	ENST00000403245.3	-	15	2094	c.1980A>G	c.(1978-1980)aaA>aaG	p.K660K	KIAA1009_ENST00000257766.4_Silent_p.K584K|KIAA1009_ENST00000461137.1_5'UTR	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TGAAGAGTTCTTTTTCCTGTT	0.303																																						.											0													63.0	57.0	59.0					6																	84884491		2202	4296	6498	SO:0001819	synonymous_variant	22832																														ENST00000403245.3:c.1980A>G	6.37:g.84884491T>C				Silent	SNP	ENST00000403245.3	37	CCDS34494.2																																																																																				0.303	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
STK31	56164	broad.mit.edu	37	7	23825129	23825129	+	Silent	SNP	A	A	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr7:23825129A>G	ENST00000355870.3	+	18	2300	c.2181A>G	c.(2179-2181)gaA>gaG	p.E727E	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000428484.1_Silent_p.E704E|STK31_ENST00000433467.2_Silent_p.E727E|STK31_ENST00000354639.3_Silent_p.E704E	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	727	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TGAGCTTGGAACGAGATCTTC	0.403																																						.											0													198.0	188.0	191.0					7																	23825129		2203	4300	6503	SO:0001819	synonymous_variant	56164			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2181A>G	7.37:g.23825129A>G			B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Silent	SNP	ENST00000355870.3	37	CCDS5386.1																																																																																				0.403	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
PHYHIP	9796	broad.mit.edu	37	8	22079280	22079280	+	Silent	SNP	G	G	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr8:22079280G>T	ENST00000321613.3	-	6	1035	c.579C>A	c.(577-579)ggC>ggA	p.G193G	PHYHIP_ENST00000454243.2_Silent_p.G193G	NM_001099335.1	NP_001092805.1	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	193										endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	10				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		GCGGGGGCTGGCCCGTGTTGA	0.622																																						.											0													16.0	22.0	20.0					8																	22079280		1977	4149	6126	SO:0001819	synonymous_variant	9796			D87463	CCDS43723.1	8p21.2	2010-02-17	2006-01-09		ENSG00000168490	ENSG00000168490			16865	protein-coding gene	gene with protein product		608511	"""phytanoyl-CoA hydroxylase interacting protein"", ""DYRK1A interacting protein 3"""	DYRK1AP3		9039502, 10686344	Standard	NM_014759		Approved	KIAA0273, PAHX-AP	uc003xbj.4	Q92561	OTTHUMG00000163776	ENST00000321613.3:c.579C>A	8.37:g.22079280G>T			D3DSR1|Q8N4I9	Silent	SNP	ENST00000321613.3	37	CCDS43723.1																																																																																				0.622	PHYHIP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375388.1	NM_014759	
ABRA	137735	broad.mit.edu	37	8	107773293	107773293	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr8:107773293T>C	ENST00000311955.3	-	2	1172	c.1118A>G	c.(1117-1119)gAc>gGc	p.D373G		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			CACAACATGGTCATCTCGGCC	0.418																																						.											0													208.0	191.0	197.0					8																	107773293		2203	4300	6503	SO:0001583	missense	137735			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.1118A>G	8.37:g.107773293T>C	ENSP00000311436:p.Asp373Gly			Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.766493	0.90020	.	.	ENSG00000174429	ENST00000311955	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.86053	0.5841	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89491	0.3757	9	0.87932	D	0	-0.5928	16.0752	0.80965	0.0:0.0:0.0:1.0	.	373	Q8N0Z2	ABRA_HUMAN	G	373	.	ENSP00000311436:D373G	D	-	2	0	ABRA	107842469	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.036000	0.88901	2.180000	0.69256	0.528000	0.53228	GAC		0.418	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
RANBP6	26953	broad.mit.edu	37	9	6012658	6012658	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr9:6012658T>G	ENST00000259569.5	-	1	2960	c.2950A>C	c.(2950-2952)Ata>Cta	p.I984L	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	984					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I984L(4)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATCTTCCCTATTGCTGAGATA	0.363																																						.											4	Substitution - Missense(4)	lung(2)|endometrium(1)|kidney(1)											110.0	103.0	106.0					9																	6012658		2203	4300	6503	SO:0001583	missense	26953			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2950A>C	9.37:g.6012658T>G	ENSP00000259569:p.Ile984Leu		Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.451466	0.26074	.	.	ENSG00000137040	ENST00000259569	T	0.08807	3.05	4.79	2.63	0.31362	Armadillo-like helical (1);Armadillo-type fold (1);	0.121890	0.53938	D	0.000050	T	0.03263	0.0095	N	0.11341	0.13	0.36993	D	0.894861	B;B;B	0.17268	0.021;0.012;0.021	B;B;B	0.16722	0.016;0.011;0.016	T	0.36648	-0.9739	10	0.06891	T	0.86	-4.4735	5.2001	0.15258	0.0:0.4849:0.0:0.5151	.	151;572;984	B4E340;B4DTX6;O60518	.;.;RNBP6_HUMAN	L	984	ENSP00000259569:I984L	ENSP00000259569:I984L	I	-	1	0	RANBP6	6002658	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.090000	0.50191	0.682000	0.31407	0.533000	0.62120	ATA		0.363	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
UBA1	7317	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	47062169	47062169	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chrX:47062169A>G	ENST00000335972.6	+	11	1372	c.1189A>G	c.(1189-1191)Ata>Gta	p.I397V	INE1_ENST00000456273.1_RNA|UBA1_ENST00000377351.4_Missense_Mutation_p.I397V|UBA1_ENST00000490869.1_3'UTR	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	397	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TCTGGCACCCATAAACGCCTT	0.602																																						.											0													37.0	31.0	33.0					X																	47062169		2203	4299	6502	SO:0001583	missense	7317			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1189A>G	X.37:g.47062169A>G	ENSP00000338413:p.Ile397Val		Q5JRR8|Q96E13	Missense_Mutation	SNP	ENST00000335972.6	37	CCDS14275.1	.	.	.	.	.	.	.	.	.	.	A	8.371	0.835280	0.16820	.	.	ENSG00000130985	ENST00000377351;ENST00000335972	T;T	0.44482	0.92;0.92	4.85	3.71	0.42584	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.141737	0.64402	D	0.000008	T	0.18964	0.0455	N	0.05177	-0.1	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.06285	-1.0835	10	0.30854	T	0.27	-4.3445	6.4032	0.21650	0.825:0.0:0.175:0.0	.	397	P22314	UBA1_HUMAN	V	397	ENSP00000366568:I397V;ENSP00000338413:I397V	ENSP00000338413:I397V	I	+	1	0	UBA1	46947113	0.061000	0.20836	0.742000	0.31022	0.959000	0.62525	0.558000	0.23469	1.921000	0.55644	0.427000	0.28365	ATA		0.602	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					NSCLC(90;1817 2035 37909 38249)	.											8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)											52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685			AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A			Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																				0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
GPR112	139378	broad.mit.edu	37	X	135429078	135429078	+	Silent	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chrX:135429078T>C	ENST00000394143.1	+	6	3504	c.3213T>C	c.(3211-3213)gcT>gcC	p.A1071A	GPR112_ENST00000370652.1_Silent_p.A1071A|GPR112_ENST00000394141.1_Silent_p.A866A|GPR112_ENST00000287534.4_Silent_p.A1008A|GPR112_ENST00000412101.1_Silent_p.A866A	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1071					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ATCAGACTGCTTCCACAACCA	0.473																																						.											0													269.0	248.0	255.0					X																	135429078		2203	4300	6503	SO:0001819	synonymous_variant	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3213T>C	X.37:g.135429078T>C			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	CCDS35409.1																																																																																				0.473	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
LIMK1	3984	broad.mit.edu	37	7	73535525	73535526	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr7:73535525_73535526insC	ENST00000336180.2	+	16	1889_1890	c.1838_1839insC	c.(1837-1842)ggccacfs	p.H614fs	LIMK1_ENST00000418310.1_Frame_Shift_Ins_p.H644fs|LIMK1_ENST00000538333.3_Frame_Shift_Ins_p.H580fs	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	614					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	CACCTGGCCGGCCACCTGCCAC	0.683																																						.											0																																										SO:0001589	frameshift_variant	3984			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1840dupC	7.37:g.73535527_73535527dupC	ENSP00000336740:p.His614fs		B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Frame_Shift_Ins	INS	ENST00000336180.2	37	CCDS5563.1																																																																																				0.683	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
FASN	2194	ucsc.edu	37	17	80049269	80049269	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr17:80049269C>T	ENST00000306749.2	-	9	1539	c.1321G>A	c.(1321-1323)Ggc>Agc	p.G441S		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	441	Acyl and malonyl transferases. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGCCGGAGGCCCTGCTCCAGC	0.721																																					Colon(59;314 1043 11189 28578 32273)	.											0													16.0	20.0	19.0					17																	80049269		2183	4284	6467	SO:0001583	missense	2194			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.1321G>A	17.37:g.80049269C>T	ENSP00000304592:p.Gly441Ser		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	7.488	0.650141	0.14516	.	.	ENSG00000169710	ENST00000306749	T	0.26223	1.75	4.41	4.41	0.53225	.	0.120650	0.56097	D	0.000026	T	0.16685	0.0401	L	0.38175	1.15	0.43126	D	0.994857	B	0.20052	0.041	B	0.16289	0.015	T	0.10314	-1.0635	10	0.27785	T	0.31	-42.7918	5.2574	0.15553	0.0:0.7415:0.0:0.2585	.	441	P49327	FAS_HUMAN	S	441	ENSP00000304592:G441S	ENSP00000304592:G441S	G	-	1	0	FASN	77642558	1.000000	0.71417	0.974000	0.42286	0.050000	0.14768	2.796000	0.47869	2.298000	0.77334	0.484000	0.47621	GGC		0.721	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
GMPR	2766	ucsc.edu	37	6	16247121	16247121	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr6:16247121T>C	ENST00000259727.4	+	2	250	c.136T>C	c.(136-138)Tca>Cca	p.S46P		NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	46					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				GCAGACCTACTCAGGGATTCC	0.473																																						.											0													141.0	128.0	132.0					6																	16247121		2203	4300	6503	SO:0001583	missense	2766				CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.136T>C	6.37:g.16247121T>C	ENSP00000259727:p.Ser46Pro		Q96HQ6	Missense_Mutation	SNP	ENST00000259727.4	37	CCDS4537.1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.222554	0.58668	.	.	ENSG00000137198	ENST00000259727	T	0.78924	-1.22	5.37	2.77	0.32553	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.298946	0.34435	N	0.003976	T	0.59985	0.2234	M	0.72894	2.215	0.43750	D	0.996253	B	0.09022	0.002	B	0.08055	0.003	T	0.60100	-0.7329	10	0.32370	T	0.25	-19.9677	9.3895	0.38363	0.5115:0.0:0.0:0.4885	.	46	P36959	GMPR1_HUMAN	P	46	ENSP00000259727:S46P	ENSP00000259727:S46P	S	+	1	0	GMPR	16355100	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.275000	0.58927	0.955000	0.37878	0.459000	0.35465	TCA		0.473	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039942.2		
LRRC1	55227	ucsc.edu	37	6	53660086	53660086	+	Missense_Mutation	SNP	A	A	G	rs201594887		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr6:53660086A>G	ENST00000370888.1	+	1	309	c.32A>G	c.(31-33)aAc>aGc	p.N11S	RP13-476E20.1_ENST00000429053.1_RNA|LRRC1_ENST00000370882.1_Missense_Mutation_p.N11S	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	11						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		TGGCGGTGCAACCGTCATGTG	0.706																																						.											0													39.0	34.0	36.0					6																	53660086		2203	4300	6503	SO:0001583	missense	55227			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.32A>G	6.37:g.53660086A>G	ENSP00000359925:p.Asn11Ser		Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	A	22.4	4.280390	0.80692	.	.	ENSG00000137269	ENST00000370888;ENST00000370882	T;T	0.50813	3.66;0.73	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.55337	0.1914	M	0.72118	2.19	0.58432	D	0.999999	D	0.63880	0.993	D	0.68192	0.956	T	0.56159	-0.8025	10	0.33940	T	0.23	.	13.2157	0.59859	1.0:0.0:0.0:0.0	.	11	Q9BTT6	LRRC1_HUMAN	S	11	ENSP00000359925:N11S;ENSP00000359919:N11S	ENSP00000359919:N11S	N	+	2	0	LRRC1	53768045	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.065000	0.89485	1.780000	0.52325	0.460000	0.39030	AAC		0.706	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168	
PPFIA2	8499	ucsc.edu	37	12	81719630	81719630	+	Silent	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr12:81719630T>C	ENST00000549396.1	-	22	2728	c.2568A>G	c.(2566-2568)gaA>gaG	p.E856E	PPFIA2_ENST00000443686.3_Silent_p.E757E|PPFIA2_ENST00000550359.2_Silent_p.E703E|PPFIA2_ENST00000552948.1_Silent_p.E856E|PPFIA2_ENST00000550584.2_Silent_p.E856E|PPFIA2_ENST00000333447.7_Silent_p.E838E|PPFIA2_ENST00000549325.1_Silent_p.E838E|PPFIA2_ENST00000407050.4_Silent_p.E782E|PPFIA2_ENST00000541017.1_Silent_p.E73E|PPFIA2_ENST00000541570.2_Silent_p.E423E|PPFIA2_ENST00000548586.1_Silent_p.E856E|PPFIA2_ENST00000545296.2_Intron	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	856					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GAGCTGCAGCTTCAGTCTCCA	0.423																																						.											0													69.0	70.0	70.0					12																	81719630		1866	4107	5973	SO:0001819	synonymous_variant	8499			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2568A>G	12.37:g.81719630T>C			B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Silent	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	T	8.987	0.976775	0.18812	.	.	ENSG00000139220	ENST00000551147	.	.	.	5.83	4.69	0.59074	.	.	.	.	.	T	0.56062	0.1960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53180	-0.8475	4	.	.	.	-17.7436	6.288	0.21043	0.141:0.0759:0.0:0.7831	.	.	.	.	G	19	.	.	S	-	1	0	PPFIA2	80243761	0.997000	0.39634	1.000000	0.80357	0.931000	0.56810	0.367000	0.20382	1.030000	0.39839	0.477000	0.44152	AGC		0.423	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
RBM15B	29890	ucsc.edu;bcgsc.ca	37	3	51429336	51429336	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr3:51429336T>C	ENST00000323686.4	+	1	606	c.506T>C	c.(505-507)aTc>aCc	p.I169T		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	169	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TTCGGCGAGATCAGCCTCCGC	0.677																																						.											0													37.0	44.0	42.0					3																	51429336		2122	4155	6277	SO:0001583	missense	29890			AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.506T>C	3.37:g.51429336T>C	ENSP00000313890:p.Ile169Thr		A4QPG7|Q6QE19|Q9BV96	Missense_Mutation	SNP	ENST00000323686.4	37	CCDS33764.1	.	.	.	.	.	.	.	.	.	.	T	16.05	3.012455	0.54468	.	.	ENSG00000179837	ENST00000323686	T	0.15139	2.45	3.88	3.88	0.44766	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	.	.	.	.	T	0.12732	0.0309	L	0.29908	0.895	0.39091	D	0.961106	P	0.47409	0.895	B	0.38842	0.283	T	0.08659	-1.0711	9	0.87932	D	0	.	11.9967	0.53208	0.0:0.0:0.0:1.0	.	169	Q8NDT2	RB15B_HUMAN	T	169	ENSP00000313890:I169T	ENSP00000313890:I169T	I	+	2	0	RBM15B	51404376	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	4.271000	0.58902	1.540000	0.49301	0.379000	0.24179	ATC		0.677	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
RRAD	6236	ucsc.edu	37	16	66958810	66958810	+	Silent	SNP	A	A	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr16:66958810A>G	ENST00000299759.6	-	2	523	c.273T>C	c.(271-273)gtT>gtC	p.V91V	RRAD_ENST00000420652.1_Silent_p.V91V			P55042	RAD_HUMAN	Ras-related associated with diabetes	91					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GCACCTTGTAAACGCTCTCGT	0.721																																						.											0													10.0	12.0	11.0					16																	66958810		2196	4296	6492	SO:0001819	synonymous_variant	6236			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.273T>C	16.37:g.66958810A>G			Q96F39	Silent	SNP	ENST00000299759.6	37	CCDS10824.1																																																																																				0.721	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268830.1	NM_004165	
TFAP2A	7020	ucsc.edu	37	6	10410153	10410153	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr6:10410153T>C	ENST00000482890.1	-	3	813	c.461A>G	c.(460-462)cAc>cGc	p.H154R	TFAP2A_ENST00000319516.4_Missense_Mutation_p.H150R|TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000379613.3_Missense_Mutation_p.H156R|TFAP2A_ENST00000379604.2_Missense_Mutation_p.H154R|TFAP2A_ENST00000379608.3_Missense_Mutation_p.H148R|TFAP2A-AS1_ENST00000420777.1_RNA			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	154					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				CTCGATGGCGTGAGGTAAGGA	0.627																																						.											0													12.0	11.0	11.0					6																	10410153		2133	4187	6320	SO:0001583	missense	7020			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.461A>G	6.37:g.10410153T>C	ENSP00000418541:p.His154Arg		Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	ENST00000482890.1	37	CCDS4510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.63|16.63	3.176652|3.176652	0.57692|0.57692	.|.	.|.	ENSG00000137203|ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890;ENST00000466073|ENST00000475264	T;T;T;T;T;T|.	0.79940|.	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70343|0.70343	0.3213|0.3213	M|M	0.82716|0.82716	2.605|2.605	0.80722|0.80722	D|D	1|1	D;P;P;B;B;B;B|.	0.76494|.	0.999;0.483;0.825;0.444;0.22;0.22;0.194|.	D;B;B;B;B;B;B|.	0.78314|.	0.991;0.057;0.255;0.114;0.039;0.024;0.184|.	T|T	0.74241|0.74241	-0.3729|-0.3729	10|5	0.56958|.	D|.	0.05|.	-11.6671|-11.6671	13.6286|13.6286	0.62181|0.62181	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	156;154;154;156;150;154;148|.	Q96SH1;C1K3N0;P05549-2;Q96SH0;Q5TAV5;P05549;Q8N1C6|.	.;.;.;.;.;AP2A_HUMAN;.|.	R|A	156;154;150;148;154;154|59	ENSP00000368933:H156R;ENSP00000368924:H154R;ENSP00000316516:H150R;ENSP00000368928:H148R;ENSP00000418541:H154R;ENSP00000417495:H154R|.	ENSP00000316516:H150R|.	H|T	-|-	2|1	0|0	TFAP2A|TFAP2A	10518139|10518139	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	3.800000|3.800000	0.55537|0.55537	1.892000|1.892000	0.54788|0.54788	0.482000|0.482000	0.46254|0.46254	CAC|ACG		0.627	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
TAGAP	117289	ucsc.edu	37	6	159456931	159456931	+	Silent	SNP	A	A	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr6:159456931A>G	ENST00000367066.3	-	10	2455	c.2124T>C	c.(2122-2124)tgT>tgC	p.C708C	TAGAP_ENST00000326965.6_Silent_p.C530C|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	708					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GTCGCACGAGACAGTCCCGCT	0.577																																						.											0													71.0	65.0	67.0					6																	159456931		2203	4300	6503	SO:0001819	synonymous_variant	117289			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.2124T>C	6.37:g.159456931A>G			Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Silent	SNP	ENST00000367066.3	37	CCDS5261.1																																																																																				0.577	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114	
ABCD1	215	mdanderson.org	37	X	153008675	153008675	+	Splice_Site	SNP	G	G	A	rs201197921		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chrX:153008675G>A	ENST00000218104.3	+	9	2265	c.1866G>A	c.(1864-1866)agG>agA	p.R622R	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	622	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGACCCCCAGGCCCAAGTACG	0.672																																						.											0													14.0	14.0	14.0					X																	153008675		2201	4290	6491	SO:0001630	splice_region_variant	215			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1866-1G>A	X.37:g.153008675G>A			Q6GTZ2	Silent	SNP	ENST00000218104.3	37	CCDS14728.1																																																																																				0.672	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	Silent
AK2	204	mdanderson.org	37	1	33478931	33478931	+	Missense_Mutation	SNP	G	G	C	rs80324279		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr1:33478931G>C	ENST00000373449.2	-	6	612	c.571C>G	c.(571-573)Cac>Gac	p.H191D	AK2_ENST00000491241.1_5'Flank|AK2_ENST00000467905.1_Missense_Mutation_p.H191D|AK2_ENST00000548033.1_Missense_Mutation_p.H149D|AK2_ENST00000354858.6_Missense_Mutation_p.H191D|AK2_ENST00000480134.1_3'UTR|RP1-117O3.2_ENST00000427524.1_RNA	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				GTTTGAGTGTGGTAGGCTTGC	0.527																																						.											0													113.0	105.0	108.0					1																	33478931		2203	4300	6503	SO:0001583	missense	204			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.571C>G	1.37:g.33478931G>C	ENSP00000362548:p.His191Asp			Missense_Mutation	SNP	ENST00000373449.2	37	CCDS373.1	575	0.2632783882783883	164	0.3333333333333333	100	0.27624309392265195	109	0.19055944055944055	202	0.26649076517150394	G	18.15	3.558980	0.65538	.	.	ENSG00000004455	ENST00000373449;ENST00000548033;ENST00000467905;ENST00000354858	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	M	0.75264	2.295	0.80722	D	1	P;D;P;P	0.65815	0.625;0.995;0.856;0.625	B;P;P;B	0.60473	0.368;0.875;0.501;0.368	T	0.00021	-1.2347	10	0.87932	D	0	-12.0924	19.5674	0.95401	0.0:0.0:1.0:0.0	.	183;149;191;191	P54819-5;F8VY04;P54819;P54819-2	.;.;KAD2_HUMAN;.	D	191;149;191;191	ENSP00000362548:H191D;ENSP00000449003:H149D;ENSP00000447082:H191D;ENSP00000346921:H191D	ENSP00000346921:H191D	H	-	1	0	AK2	33251518	1.000000	0.71417	1.000000	0.80357	0.282000	0.26991	9.827000	0.99397	2.793000	0.96121	0.563000	0.77884	CAC		0.527	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1	NM_001625	
AK2	204	mdanderson.org	37	1	33478983	33478983	+	Silent	SNP	G	G	A	rs79403800		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr1:33478983G>A	ENST00000373449.2	-	6	560	c.519C>T	c.(517-519)atC>atT	p.I173I	AK2_ENST00000491241.1_5'Flank|AK2_ENST00000467905.1_Silent_p.I173I|AK2_ENST00000548033.1_Silent_p.I131I|AK2_ENST00000354858.6_Silent_p.I173I|AK2_ENST00000480134.1_3'UTR|RP1-117O3.2_ENST00000427524.1_RNA	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CTGATCGACGGATCAAGGGTT	0.483																																						.											0													58.0	55.0	56.0					1																	33478983		2203	4300	6503	SO:0001819	synonymous_variant	204			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.519C>T	1.37:g.33478983G>A				Silent	SNP	ENST00000373449.2	37	CCDS373.1																																																																																				0.483	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1	NM_001625	
ANKRD20A5P	440482	mdanderson.org	37	18	14183978	14183978	+	RNA	SNP	T	T	C	rs77403707	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr18:14183978T>C	ENST00000581935.1	+	0	667							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGGAACATGGTGCCAATCCAA	0.448																																						.											0													93.0	93.0	93.0					18																	14183978		2201	4296	6497			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183978T>C			Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.448	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
ANKRD20A5P	440482	mdanderson.org	37	18	14184100	14184100	+	RNA	SNP	A	A	G	rs200011373	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr18:14184100A>G	ENST00000581935.1	+	0	789							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						GCACTGGACAAGGTATAGATC	0.373																																						.											0													79.0	88.0	85.0					18																	14184100		2201	4299	6500			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184100A>G			Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.373	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
FBXW10	10517	mdanderson.org	37	17	18682163	18682163	+	Missense_Mutation	SNP	T	T	C	rs199779085	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr17:18682163T>C	ENST00000395665.4	+	14	2932	c.2711T>C	c.(2710-2712)gTc>gCc	p.V904A	TVP23B_ENST00000574226.1_5'Flank|FBXW10_ENST00000308799.4_Missense_Mutation_p.V913A|FBXW10_ENST00000301938.4_Missense_Mutation_p.V851A|TVP23B_ENST00000307767.8_5'Flank|FBXW10_ENST00000395667.1_Missense_Mutation_p.V903A|TVP23B_ENST00000476139.1_5'Flank			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	904										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						AGTCCTAGAGTCCAGTCCACC	0.488																																						.											0								T	ALA/VAL	1,4405		0,1,2202	97.0	105.0	102.0		2708	3.6	0.3	17	dbSNP_134	102	0,8600		0,0,4300	no	missense	FBXW10	NM_031456.3	64	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	903/1052	18682163	1,13005	2203	4300	6503	SO:0001583	missense	10517			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.2711T>C	17.37:g.18682163T>C	ENSP00000379025:p.Val904Ala		C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	ENST00000395665.4	37	CCDS11199.3	.	.	.	.	.	.	.	.	.	.	T	9.638	1.138186	0.21123	2.27E-4	0.0	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	3.62	3.62	0.41486	.	0.542452	0.13237	U	0.403195	T	0.74943	0.3783	M	0.66939	2.045	0.09310	N	1	P;P;P;P	0.44429	0.663;0.835;0.533;0.835	B;B;B;B	0.43889	0.343;0.435;0.185;0.435	T	0.67562	-0.5639	10	0.54805	T	0.06	.	5.4477	0.16546	0.0:0.13:0.0:0.87	.	851;913;904;903	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	A	903;913;851;904	ENSP00000379026:V903A;ENSP00000310382:V913A;ENSP00000306937:V851A;ENSP00000379025:V904A	ENSP00000306937:V851A	V	+	2	0	FBXW10	18622888	0.187000	0.23238	0.327000	0.25402	0.635000	0.38103	3.727000	0.54984	1.477000	0.48234	0.338000	0.21704	GTC		0.488	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	NM_031456	
FRG1B	284802	mdanderson.org	37	20	29628270	29628270	+	Missense_Mutation	SNP	G	G	A	rs545391756	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr20:29628270G>A	ENST00000278882.3	+	6	652	c.272G>A	c.(271-273)tGc>tAc	p.C91Y	FRG1B_ENST00000358464.4_Missense_Mutation_p.C91Y|FRG1B_ENST00000439954.2_Missense_Mutation_p.C96Y			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	91										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTTATTAGATGCAATGAAGCA	0.363													.|||	3	0.000599042	0.0	0.0029	5008	,	,		60821	0.001		0.0	False		,,,				2504	0.0					.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.272G>A	20.37:g.29628270G>A	ENSP00000278882:p.Cys91Tyr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	4.726	0.135070	0.09032	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.43294	0.95	2.08	2.08	0.27032	Actin cross-linking (1);	0.051706	0.85682	D	0.000000	T	0.39545	0.1082	.	.	.	0.29852	N	0.828316	B;P	0.40970	0.008;0.734	B;P	0.46850	0.036;0.529	T	0.31668	-0.9935	9	0.34782	T	0.22	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	96;91	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	Y	91;96;91	ENSP00000408863:C96Y	ENSP00000278882:C91Y	C	+	2	0	FRG1B	28241931	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.129000	0.64739	1.475000	0.48197	0.423000	0.28283	TGC		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628282	29628282	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr20:29628282G>A	ENST00000278882.3	+	6	664	c.284G>A	c.(283-285)gGg>gAg	p.G95E	FRG1B_ENST00000358464.4_Missense_Mutation_p.G95E|FRG1B_ENST00000439954.2_Missense_Mutation_p.G100E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATGAAGCAGGGGACATAGAA	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.284G>A	20.37:g.29628282G>A	ENSP00000278882:p.Gly95Glu		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.02	3.529440	0.64860	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56103	0.48	2.08	2.08	0.27032	Actin cross-linking (1);	0.051750	0.85682	D	0.000000	T	0.52092	0.1713	.	.	.	0.58432	D	0.999996	B;P	0.39940	0.309;0.696	P;P	0.46543	0.492;0.52	T	0.54221	-0.8326	9	0.45353	T	0.12	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	100;95	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	E	95;100;95	ENSP00000408863:G100E	ENSP00000278882:G95E	G	+	2	0	FRG1B	28241943	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GGG		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
KRTAP4-9	100132386	mdanderson.org	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	A	T	rs113059833		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr17:39261693A>T	ENST00000391415.1	+	1	110	c.53A>T	c.(52-54)gAc>gTc	p.D18V		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.D18V(1)		central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						TGCGGCCAAGACCTCTGTCAG	0.627																																						.											1	Substitution - Missense(1)	endometrium(1)											18.0	22.0	21.0					17																	39261693		692	1590	2282	SO:0001583	missense	100132386			AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.53A>T	17.37:g.39261693A>T	ENSP00000375234:p.Asp18Val			Missense_Mutation	SNP	ENST00000391415.1	37	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	6.082	0.383461	0.11524	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.32272	1.46	2.51	0.174	0.15040	.	.	.	.	.	T	0.25865	0.0630	M	0.64404	1.975	0.30580	P	0.762648	B	0.17852	0.024	B	0.14023	0.01	T	0.23154	-1.0196	8	0.45353	T	0.12	.	3.5681	0.07907	0.2702:0.2037:0.5261:0.0	.	18	Q9BYQ8	KRA49_HUMAN	V	18	ENSP00000375234:D18V	ENSP00000334461:D18V	D	+	2	0	KRTAP4-9	36515219	0.000000	0.05858	0.388000	0.26195	0.320000	0.28249	0.098000	0.15189	-0.245000	0.09625	0.155000	0.16302	GAC		0.627	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041	
MUC2	4583	mdanderson.org	37	11	1092884	1092884	+	Missense_Mutation	SNP	C	C	T	rs201415503		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr11:1092884C>T	ENST00000441003.2	+	30	4730	c.4703C>T	c.(4702-4704)aCg>aTg	p.T1568M	MUC2_ENST00000359061.5_Missense_Mutation_p.T1569M|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1569M(2)|p.T1568M(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACCACCACGGTGacccca	0.637																																						.											4	Substitution - Missense(4)	large_intestine(2)|skin(2)											129.0	172.0	157.0					11																	1092884		1964	3669	5633	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4703C>T	11.37:g.1092884C>T	ENSP00000415183:p.Thr1568Met		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.409	-0.335727	0.05278	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14893	2.5;2.47	1.63	0.367	0.16140	.	25.055600	0.00797	U	0.001394	T	0.21841	0.0526	.	.	.	0.09310	N	1	D	0.76494	0.999	P	0.48425	0.577	T	0.35301	-0.9794	9	0.45353	T	0.12	.	8.9064	0.35526	0.0:0.7681:0.2319:0.0	.	1568	E7EUV1	.	M	1568;1569	ENSP00000415183:T1568M;ENSP00000351956:T1569M	ENSP00000351956:T1569M	T	+	2	0	MUC2	1082884	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.878000	0.28126	0.945000	0.37605	0.121000	0.15741	ACG		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195507529	195507529	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr3:195507529A>G	ENST00000463781.3	-	2	11381	c.10922T>C	c.(10921-10923)gTa>gCa	p.V3641A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3641A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAAG	0.582																																						.											0																																										SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10922T>C	3.37:g.195507529A>G	ENSP00000417498:p.Val3641Ala		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	2.107	-0.404705	0.04832	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.47177	1.21;0.85	0.743	-0.753	0.11068	.	.	.	.	.	T	0.16981	0.0408	N	0.08118	0	0.09310	N	1	P	0.37985	0.613	B	0.22601	0.04	T	0.12372	-1.0550	8	.	.	.	.	3.955	0.09385	0.343:0.0:0.657:0.0	rs7374898	3513	E7ESK3	.	A	3641	ENSP00000417498:V3641A;ENSP00000420243:V3641A	.	V	-	2	0	MUC4	196992308	0.000000	0.05858	0.025000	0.17156	0.025000	0.11179	-3.428000	0.00474	0.077000	0.16863	0.076000	0.15429	GTA		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510910	195510910	+	Missense_Mutation	SNP	G	G	T	rs576459717		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr3:195510910G>T	ENST00000463781.3	-	2	8000	c.7541C>A	c.(7540-7542)cCt>cAt	p.P2514H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2514H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGTAGAGGGGT	0.562																																						.											0													90.0	72.0	77.0					3																	195510910		661	1591	2252	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7541C>A	3.37:g.195510910G>T	ENSP00000417498:p.Pro2514His		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.532	0.466443	0.12402	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.3;1.37	.	.	.	.	.	.	.	.	T	0.29524	0.0736	N	0.19112	0.55	0.20489	N	0.999893	D	0.54964	0.969	P	0.52710	0.707	T	0.18840	-1.0324	7	.	.	.	.	6.8646	0.24086	1.0E-4:0.0:0.9999:0.0	.	2514	E7ESK3	.	H	2514	ENSP00000417498:P2514H;ENSP00000420243:P2514H	.	P	-	2	0	MUC4	196995305	0.082000	0.21442	0.000000	0.03702	0.000000	0.00434	0.551000	0.23361	-0.000000	0.14550	0.000000	0.15137	CCT		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PRB2	653247	mdanderson.org	37	12	11546616	11546616	+	Silent	SNP	A	A	G	rs199923047		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr12:11546616A>G	ENST00000389362.4	-	3	431	c.396T>C	c.(394-396)ccT>ccC	p.P132P	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	132	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GAGGAGGTGGAGGACCTTGAG	0.607																																						.											0													292.0	264.0	273.0					12																	11546616		2201	4300	6501	SO:0001819	synonymous_variant	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.396T>C	12.37:g.11546616A>G			O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	CCDS41757.2																																																																																				0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
SH3PXD2A	9644	mdanderson.org;bcgsc.ca	37	10	105362429	105362429	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr10:105362429C>T	ENST00000369774.4	-	15	2822	c.2546G>A	c.(2545-2547)aGc>aAc	p.S849N	SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.S716N|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.S684N|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.S821N			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	849	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)	p.S821T(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CTGGTAGGCGCTGCATGTCAT	0.612																																						.											1	Substitution - Missense(1)	lung(1)											70.0	69.0	69.0					10																	105362429		2203	4300	6503	SO:0001583	missense	9644			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2546G>A	10.37:g.105362429C>T	ENSP00000358789:p.Ser849Asn		D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37		.	.	.	.	.	.	.	.	.	.	C	8.102	0.776833	0.16120	.	.	ENSG00000107957	ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	4.83	3.8	0.43715	Src homology-3 domain (2);	0.323099	0.37715	N	0.001971	T	0.22551	0.0544	L	0.38838	1.175	0.09310	N	0.999992	B;B;B;B	0.32302	0.201;0.309;0.363;0.167	B;B;B;B	0.37601	0.197;0.197;0.254;0.124	T	0.09574	-1.0668	10	0.25106	T	0.35	-19.0441	5.7598	0.18192	0.0:0.7468:0.0:0.2532	.	849;698;694;821	Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3	SPD2A_HUMAN;.;.;.	N	849;821;656;764;716;684	ENSP00000358789:S849N;ENSP00000348215:S821N;ENSP00000443663:S716N;ENSP00000441514:S684N	ENSP00000318135:S656N	S	-	2	0	SH3PXD2A	105352419	1.000000	0.71417	0.045000	0.18777	0.479000	0.33129	4.107000	0.57811	2.255000	0.74692	0.555000	0.69702	AGC		0.612	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
SIRPG	55423	mdanderson.org	37	20	1617069	1617069	+	Silent	SNP	A	A	G	rs2277761	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr20:1617069A>G	ENST00000303415.3	-	3	577	c.513T>C	c.(511-513)caT>caC	p.H171H	SIRPG_ENST00000344103.4_Intron|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381580.1_Silent_p.H138H|SIRPG_ENST00000381583.2_Silent_p.H171H|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000216927.4_Silent_p.H171H	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	171	Ig-like C1-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						GAGAGAAGCCATGGGACTCAC	0.557													a|||	1148	0.229233	0.1619	0.366	5008	,	,		19683	0.2103		0.2376	False		,,,				2504	0.2342					.											0								A	,,	726,3680		54,618,1531	149.0	133.0	138.0		513,513,	-4.2	0.0	20	dbSNP_100	138	2134,6466		266,1602,2432	no	coding-synonymous,coding-synonymous,intron	SIRPG	NM_001039508.1,NM_018556.3,NM_080816.2	,,	320,2220,3963	GG,GA,AA		24.814,16.4775,21.9899	,,	171/277,171/388,	1617069	2860,10146	2203	4300	6503	SO:0001819	synonymous_variant	55423			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.513T>C	20.37:g.1617069A>G			B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000303415.3	37	CCDS13020.2																																																																																				0.557	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
TPTE2	93492	mdanderson.org	37	13	20000609	20000609	+	Missense_Mutation	SNP	C	C	T	rs141691551	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr13:20000609C>T	ENST00000400230.2	-	18	1395	c.1351G>A	c.(1351-1353)Ggt>Agt	p.G451S	TPTE2_ENST00000382975.4_Missense_Mutation_p.G411S|TPTE2_ENST00000255310.6_Missense_Mutation_p.G374S|TPTE2_ENST00000382978.1_Missense_Mutation_p.G411S|TPTE2_ENST00000390680.2_Missense_Mutation_p.G374S|TPTE2_ENST00000400103.2_Missense_Mutation_p.G340S|TPTE2_ENST00000382977.4_Missense_Mutation_p.G451S|TPTE2_ENST00000457266.2_Missense_Mutation_p.G340S			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	451	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.G451S(1)|p.G374R(1)|p.G374S(1)|p.G451R(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGAGGTGGACCGTCATATACA	0.338													c|||	18	0.00359425	0.0129	0.0014	5008	,	,		17308	0.0		0.0	False		,,,				2504	0.0					.											4	Substitution - Missense(4)	prostate(2)|lung(2)						C	SER/GLY,SER/GLY,SER/GLY	59,4347	53.6+/-89.4	0,59,2144	115.0	115.0	115.0		1018,1120,1351	0.8	0.0	13	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	TPTE2	NM_001141968.1,NM_130785.3,NM_199254.2	56,56,56	0,60,6443	TT,TC,CC		0.0116,1.3391,0.4613	benign,benign,benign	340/412,374/446,451/523	20000609	60,12946	2203	4300	6503	SO:0001583	missense	93492			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1351G>A	13.37:g.20000609C>T	ENSP00000383089:p.Gly451Ser		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	c	2.177	-0.388580	0.04932	0.013391	1.16E-4	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	2.06	0.84	0.18912	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.174692	0.50627	D	0.000101	T	0.56673	0.2001	N	0.12746	0.255	0.09310	N	1	B;B;B	0.32829	0.124;0.101;0.386	B;B;B	0.29524	0.064;0.024;0.103	T	0.51803	-0.8659	9	.	.	.	-15.6776	4.9604	0.14063	0.6673:0.3327:0.0:0.0	.	340;374;451	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	S	411;340;451;374;374;451;411;340;451	ENSP00000372438:G411S;ENSP00000382974:G340S;ENSP00000383089:G451S;ENSP00000255310:G374S;ENSP00000375098:G374S;ENSP00000372437:G451S;ENSP00000372435:G411S;ENSP00000442218:G340S	.	G	-	1	0	TPTE2	18898609	0.779000	0.28652	0.004000	0.12327	0.004000	0.04260	1.504000	0.35726	0.231000	0.21079	0.194000	0.17425	GGT		0.338	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
TRIM43	129868	mdanderson.org	37	2	96260889	96260889	+	Missense_Mutation	SNP	G	G	T	rs199714127		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr2:96260889G>T	ENST00000272395.2	+	3	639	c.503G>T	c.(502-504)tGg>tTg	p.W168L		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	168						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						GCCTTCCTCTGGAGGGTAAGT	0.398																																						.											0													64.0	61.0	62.0					2																	96260889		2203	4299	6502	SO:0001583	missense	129868			BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.503G>T	2.37:g.96260889G>T	ENSP00000272395:p.Trp168Leu		Q53TJ7	Missense_Mutation	SNP	ENST00000272395.2	37	CCDS2015.1	.	.	.	.	.	.	.	.	.	.	.	1.918	-0.448952	0.04572	.	.	ENSG00000144015	ENST00000272395	T	0.03124	4.04	0.629	0.629	0.17687	.	.	.	.	.	T	0.03915	0.0110	L	0.43152	1.355	0.09310	N	1	B	0.33022	0.394	B	0.34180	0.177	T	0.43065	-0.9414	8	0.30854	T	0.27	-0.0398	.	.	.	.	168	Q96BQ3	TRI43_HUMAN	L	168	ENSP00000272395:W168L	ENSP00000272395:W168L	W	+	2	0	TRIM43	95624616	0.235000	0.23794	0.009000	0.14445	0.010000	0.07245	0.666000	0.25097	0.639000	0.30564	0.375000	0.23000	TGG		0.398	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252784.1	NM_138800	
ZNF98	148198	mdanderson.org	37	19	22574547	22574547	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr19:22574547T>A	ENST00000357774.5	-	4	1611	c.1490A>T	c.(1489-1491)aAa>aTa	p.K497I		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GTTAAAAGCTTTGCCACATTC	0.403																																						.											0													75.0	67.0	70.0					19																	22574547		2185	4284	6469	SO:0001583	missense	148198				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1490A>T	19.37:g.22574547T>A	ENSP00000350418:p.Lys497Ile			Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	12.78	2.041722	0.35989	.	.	ENSG00000197360	ENST00000357774	T	0.35048	1.33	1.26	0.0148	0.14101	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57784	0.2077	M	0.87097	2.86	0.26544	N	0.974034	D	0.59767	0.986	D	0.74674	0.984	T	0.48198	-0.9056	9	0.87932	D	0	.	5.2489	0.15512	0.2563:0.0:0.0:0.7437	.	497	A6NK75	ZNF98_HUMAN	I	497	ENSP00000350418:K497I	ENSP00000350418:K497I	K	-	2	0	ZNF98	22366387	0.984000	0.35163	0.017000	0.16124	0.011000	0.07611	3.858000	0.55979	-0.306000	0.08818	-1.118000	0.02043	AAA		0.403	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
ZNF416	55659	mdanderson.org	37	19	58084930	58084930	+	Silent	SNP	G	G	A	rs3746222	byFrequency	TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr19:58084930G>A	ENST00000196489.3	-	4	564	c.342C>T	c.(340-342)acC>acT	p.T114T		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		GCAAAATGTCGGTCAGGAATG	0.507													G|||	839	0.167532	0.202	0.1369	5008	,	,		20042	0.0942		0.2078	False		,,,				2504	0.1769					.											0								G		852,3554	334.4+/-303.4	76,700,1427	121.0	104.0	110.0		342	-2.1	0.0	19	dbSNP_107	110	1661,6939	307.2+/-308.3	153,1355,2792	no	coding-synonymous	ZNF416	NM_017879.1		229,2055,4219	AA,AG,GG		19.314,19.3373,19.3219		114/595	58084930	2513,10493	2203	4300	6503	SO:0001819	synonymous_variant	55659			BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.342C>T	19.37:g.58084930G>A			Q9NWW8	Silent	SNP	ENST00000196489.3	37	CCDS12954.1																																																																																				0.507	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
MRE11A	4361	bcgsc.ca	37	11	94211961	94211961	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr11:94211961T>C	ENST00000323929.3	-	6	706	c.484A>G	c.(484-486)Ata>Gta	p.I162V	MRE11A_ENST00000323977.3_Missense_Mutation_p.I162V|MRE11A_ENST00000407439.3_Missense_Mutation_p.I165V|MRE11A_ENST00000540013.1_Missense_Mutation_p.I162V|MRE11A_ENST00000393241.4_Missense_Mutation_p.I162V	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	162					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				CTAATGTCTATCTTCTCCACA	0.363								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																													.											0													97.0	88.0	91.0					11																	94211961		2201	4298	6499	SO:0001583	missense	4361	Familial Cancer Database	ATLD	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.484A>G	11.37:g.94211961T>C	ENSP00000325863:p.Ile162Val		O43475	Missense_Mutation	SNP	ENST00000323929.3	37	CCDS8299.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822393	0.32237	.	.	ENSG00000020922	ENST00000323929;ENST00000407439;ENST00000323977;ENST00000393241;ENST00000540013	D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5	5.54	2.0	0.26442	Metallophosphoesterase domain (1);	0.125962	0.64402	N	0.000001	T	0.69433	0.3110	L	0.31926	0.97	0.45979	D	0.998794	B;B;B	0.15473	0.007;0.002;0.013	B;B;B	0.26517	0.07;0.021;0.043	T	0.57394	-0.7819	10	0.34782	T	0.22	-16.6202	8.7495	0.34607	0.0:0.2208:0.0:0.7792	.	165;162;162	B3KTC7;P49959-2;P49959	.;.;MRE11_HUMAN	V	162;165;162;162;162	ENSP00000325863:I162V;ENSP00000385614:I165V;ENSP00000326094:I162V;ENSP00000376933:I162V;ENSP00000440986:I162V	ENSP00000325863:I162V	I	-	1	0	MRE11A	93851609	1.000000	0.71417	0.999000	0.59377	0.492000	0.33523	2.694000	0.47035	0.089000	0.17243	0.372000	0.22366	ATA		0.363	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3	NM_005591	
ADAMTS15	170689	bcgsc.ca	37	11	130332482	130332501	+	Frame_Shift_Del	DEL	CTGGCTTTTGGCGTGGGCTC	CTGGCTTTTGGCGTGGGCTC	-	rs535808287|rs146615969		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	CTGGCTTTTGGCGTGGGCTC	CTGGCTTTTGGCGTGGGCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr11:130332482_130332501delCTGGCTTTTGGCGTGGGCTC	ENST00000299164.2	+	4	1349_1368	c.1349_1368delCTGGCTTTTGGCGTGGGCTC	c.(1348-1368)cctggcttttggcgtgggctcfs	p.PGFWRGL450fs		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	450	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CAGTGCGAGCTGGCTTTTGGCGTGGGCTCCAAGCCCTGTC	0.645																																						.											0																																										SO:0001589	frameshift_variant	170689			AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.1349_1368delCTGGCTTTTGGCGTGGGCTC	11.37:g.130332482_130332501delCTGGCTTTTGGCGTGGGCTC	ENSP00000299164:p.Pro450fs		Q32MI6	Frame_Shift_Del	DEL	ENST00000299164.2	37	CCDS8488.1																																																																																				0.645	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055	
ACSM5	54988	bcgsc.ca	37	16	20430733	20430733	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr16:20430733G>A	ENST00000331849.4	+	4	746	c.599G>A	c.(598-600)tGg>tAg	p.W200*	ACSM5_ENST00000575584.1_Nonsense_Mutation_p.W200*	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	200					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CGGCCAGGCTGGTTGAACTTC	0.527																																						.											0													46.0	44.0	45.0					16																	20430733		2203	4299	6502	SO:0001587	stop_gained	54988				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.599G>A	16.37:g.20430733G>A	ENSP00000327916:p.Trp200*		Q96AV1|Q96CX8|Q9NWV3	Nonsense_Mutation	SNP	ENST00000331849.4	37	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	35	5.520590	0.96416	.	.	ENSG00000183549	ENST00000331849	.	.	.	4.65	4.65	0.58169	.	0.000000	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.0847	17.6834	0.88250	0.0:0.0:1.0:0.0	.	.	.	.	X	200	.	ENSP00000327916:W200X	W	+	2	0	ACSM5	20338234	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.372000	0.79612	2.561000	0.86390	0.650000	0.86243	TGG		0.527	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
EPS15L1	58513	bcgsc.ca	37	19	16513266	16513266	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr19:16513266T>C	ENST00000248070.6	-	16	1796	c.1657A>G	c.(1657-1659)Agc>Ggc	p.S553G	EPS15L1_ENST00000597937.1_Missense_Mutation_p.S553G|EPS15L1_ENST00000602009.1_Missense_Mutation_p.S399G|EPS15L1_ENST00000594975.1_Missense_Mutation_p.S553G|EPS15L1_ENST00000535753.2_Missense_Mutation_p.S553G|EPS15L1_ENST00000455140.2_Missense_Mutation_p.S553G	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	553					endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TCCTGGCGGCTTTCATGCAGC	0.542																																						.											0													56.0	56.0	56.0					19																	16513266		2203	4300	6503	SO:0001583	missense	58513			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1657A>G	19.37:g.16513266T>C	ENSP00000248070:p.Ser553Gly		A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	ENST00000248070.6	37	CCDS32944.1	.	.	.	.	.	.	.	.	.	.	T	13.00	2.106253	0.37145	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.33654	1.55;1.8;1.4	5.5	3.17	0.36434	.	0.087286	0.85682	D	0.000000	T	0.26268	0.0641	L	0.43152	1.355	0.46241	D	0.998942	B;B;P;P;B;B	0.42078	0.154;0.286;0.77;0.626;0.042;0.156	B;B;B;B;B;B	0.37387	0.08;0.082;0.248;0.156;0.055;0.167	T	0.02852	-1.1102	10	0.41790	T	0.15	.	7.4424	0.27192	0.1478:0.0:0.134:0.7181	.	553;553;552;553;553;553	A8K5P4;A5PL29;A5PKY0;A2RRF3;Q9UBC2;G3V0H2	.;.;.;.;EP15R_HUMAN;.	G	553	ENSP00000393313:S553G;ENSP00000248070:S553G;ENSP00000440103:S553G	ENSP00000248070:S553G	S	-	1	0	EPS15L1	16374266	1.000000	0.71417	0.931000	0.37212	0.912000	0.54170	4.411000	0.59781	0.893000	0.36288	0.533000	0.62120	AGC		0.542	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
FRG1B	284802	bcgsc.ca	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr20:29628236G>C	ENST00000278882.3	+	6	618	c.238G>C	c.(238-240)Gct>Cct	p.A80P	FRG1B_ENST00000358464.4_Missense_Mutation_p.A80P|FRG1B_ENST00000439954.2_Missense_Mutation_p.A85P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	80								p.A80P(8)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGGGAAAATGGCTTTGTTGGC	0.363																																						.											8	Substitution - Missense(8)	prostate(4)|kidney(4)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.238G>C	20.37:g.29628236G>C	ENSP00000278882:p.Ala80Pro		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	15.73	2.920277	0.52653	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.57595	0.39	2.08	2.08	0.27032	Actin cross-linking (1);	0.052409	0.85682	D	0.000000	T	0.68952	0.3057	.	.	.	0.80722	D	1	D;D	0.64830	0.994;0.988	D;D	0.85130	0.997;0.993	T	0.72766	-0.4194	9	0.87932	D	0	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	85;80	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	P	80;85;80	ENSP00000408863:A85P	ENSP00000278882:A80P	A	+	1	0	FRG1B	28241897	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCT		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SOGA1	140710	bcgsc.ca	37	20	35434275	35434275	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr20:35434275T>C	ENST00000357779.3	-	9	2512	c.2186A>G	c.(2185-2187)gAc>gGc	p.D729G	SOGA1_ENST00000279034.6_Missense_Mutation_p.D729G|SOGA1_ENST00000456801.2_Missense_Mutation_p.D570G|SOGA1_ENST00000237536.4_Missense_Mutation_p.D967G			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	729					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GGTCCAGCTGTCCCCCGTGCA	0.488																																						.											0													92.0	94.0	94.0					20																	35434275		1964	4144	6108	SO:0001583	missense	140710			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.2186A>G	20.37:g.35434275T>C	ENSP00000350424:p.Asp729Gly		A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	T	15.24	2.775899	0.49786	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.19394	2.15;2.2;2.2;2.2	5.27	5.27	0.74061	.	0.098624	0.64402	D	0.000002	T	0.17109	0.0411	L	0.34521	1.04	0.37209	D	0.904735	B	0.02656	0.0	B	0.06405	0.002	T	0.09975	-1.0650	10	0.23302	T	0.38	-39.071	14.3169	0.66457	0.0:0.0:0.0:1.0	.	729	O94964-4	.	G	967;729;570;729	ENSP00000237536:D967G;ENSP00000279034:D729G;ENSP00000413886:D570G;ENSP00000350424:D729G	ENSP00000237536:D967G	D	-	2	0	KIAA0889	34867689	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.552000	0.67281	2.216000	0.71823	0.460000	0.39030	GAC		0.488	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
LETM1	3954	bcgsc.ca	37	4	1821162	1821162	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr4:1821162C>G	ENST00000302787.2	-	11	1942	c.1646G>C	c.(1645-1647)aGc>aCc	p.S549T		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	549					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			GCAGGCATCGCTGAGGATGTC	0.532																																						.											0													129.0	109.0	116.0					4																	1821162		2203	4300	6503	SO:0001583	missense	3954			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1646G>C	4.37:g.1821162C>G	ENSP00000305653:p.Ser549Thr		B4DED2|Q9UF65	Missense_Mutation	SNP	ENST00000302787.2	37	CCDS3355.1	.	.	.	.	.	.	.	.	.	.	c	16.49	3.137957	0.56936	.	.	ENSG00000168924	ENST00000302787	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.57125	0.2032	M	0.70275	2.135	0.50813	D	0.99989	P	0.46395	0.877	B	0.40741	0.339	T	0.64136	-0.6478	9	0.56958	D	0.05	-30.019	12.7556	0.57333	0.0:0.9198:0.0:0.0802	.	549	O95202	LETM1_HUMAN	T	549	.	ENSP00000305653:S549T	S	-	2	0	LETM1	1790960	1.000000	0.71417	0.782000	0.31804	0.716000	0.41182	5.032000	0.64140	2.407000	0.81776	0.655000	0.94253	AGC		0.532	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1		
KMT2C	58508	bcgsc.ca	37	7	151962265	151962265	+	Missense_Mutation	SNP	C	C	T	rs201834857		TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr7:151962265C>T	ENST00000262189.6	-	8	1260	c.1042G>A	c.(1042-1044)Gac>Aac	p.D348N	KMT2C_ENST00000355193.2_Missense_Mutation_p.D348N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	348					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.D348N(2)									CCCGGGCTGTCGCACACTGCA	0.383																																						.											2	Substitution - Missense(2)	skin(2)											112.0	101.0	104.0					7																	151962265		2203	4296	6499	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1042G>A	7.37:g.151962265C>T	ENSP00000262189:p.Asp348Asn		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730606	0.48939	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98807	-5.15;-5.15	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.43919	U	0.000512	D	0.98516	0.9505	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.98479	1.0604	10	0.23302	T	0.38	.	17.9157	0.88950	0.0:1.0:0.0:0.0	.	348	Q8NEZ4	MLL3_HUMAN	N	348	ENSP00000262189:D348N;ENSP00000347325:D348N	ENSP00000262189:D348N	D	-	1	0	MLL3	151593198	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	7.772000	0.85439	2.271000	0.75665	0.557000	0.71058	GAC		0.383	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
NUP214	8021	bcgsc.ca	37	9	134074387	134074387	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chr9:134074387T>C	ENST00000359428.5	+	29	5650	c.5506T>C	c.(5506-5508)Ttt>Ctt	p.F1836L	NUP214_ENST00000451030.1_Missense_Mutation_p.F1837L|NUP214_ENST00000483497.2_Missense_Mutation_p.F662L|NUP214_ENST00000411637.2_Missense_Mutation_p.F1826L			P35658	NU214_HUMAN	nucleoporin 214kDa	1836	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TGGGTTCAGCTTTTGCCAAGC	0.468			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0													50.0	57.0	54.0					9																	134074387		2203	4300	6503	SO:0001583	missense	8021			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.5506T>C	9.37:g.134074387T>C	ENSP00000352400:p.Phe1836Leu		A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.831854	0.91036	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605;ENST00000483497	T;T;T;T	0.62788	-0.0;0.04;-0.0;0.17	6.07	6.07	0.98685	.	0.000000	0.45361	D	0.000373	T	0.62539	0.2436	N	0.08118	0	0.80722	D	1	D;D;D;D;D	0.61697	0.99;0.99;0.99;0.99;0.99	D;D;D;D;D	0.72982	0.979;0.979;0.979;0.979;0.979	T	0.68334	-0.5436	10	0.44086	T	0.13	-22.7254	15.4756	0.75478	0.0:0.0:0.0:1.0	.	662;1265;1430;1826;1836	B7ZAV2;F5H131;Q5JUP9;P35658-4;P35658	.;.;.;.;NU214_HUMAN	L	1836;1826;1837;1815;1430;1265;662	ENSP00000352400:F1836L;ENSP00000396576:F1826L;ENSP00000405014:F1837L;ENSP00000436793:F662L	ENSP00000352400:F1836L	F	+	1	0	NUP214	133064208	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	6.810000	0.75216	2.326000	0.78906	0.533000	0.62120	TTT		0.468	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
MT-CYB	4519	bcgsc.ca	37	M	14798	14798	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8333-01A-11D-2310-10	TCGA-KL-8333-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c56505cb-e150-408d-9df6-3af4e608c376	422375ba-7c98-42a5-b8cc-f88084a938f6	g.chrM:14798T>C	ENST00000361789.2	+	1	52	c.52T>C	c.(52-54)Ttc>Ctc	p.F18L	MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	18			F -> L (in dbSNP:rs28357681). {ECO:0000269|PubMed:10453733, ECO:0000269|PubMed:11130070, ECO:0000269|PubMed:11553319}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						TTAACCACTCATTCATCGACC	0.448																																						.											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.52T>C	M.37:g.14798T>C	ENSP00000354554:p.Phe18Leu		Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																					0.448	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
