#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTS	5805	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	112101359	112101359	+	Missense_Mutation	SNP	C	C	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr11:112101359C>G	ENST00000280362.3	+	4	276	c.197C>G	c.(196-198)gCt>gGt	p.A66G	PTS_ENST00000524931.1_5'UTR|PTS_ENST00000525803.1_Intron	NM_000317.2	NP_000308.1	Q03393	PTPS_HUMAN	6-pyruvoyltetrahydropterin synthase	66					cellular amino acid metabolic process (GO:0006520)|central nervous system development (GO:0007417)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	6-pyruvoyltetrahydropterin synthase activity (GO:0003874)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|large_intestine(1)	2		all_cancers(61;2.51e-14)|all_epithelial(67;1.64e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.27e-06)|BRCA - Breast invasive adenocarcinoma(274;1.43e-06)|all cancers(92;2.1e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0519)		ATTGACCCTGCTACGGGAATG	0.373																																						.											0													178.0	177.0	177.0					11																	112101359		2201	4297	6498	SO:0001583	missense	5805			U63382	CCDS8359.1	11q22.3	2014-04-01				ENSG00000150787	4.2.3.12		9689	protein-coding gene	gene with protein product		612719				8188266	Standard	NM_000317		Approved	PTPS	uc001pnj.4	Q03393		ENST00000280362.3:c.197C>G	11.37:g.112101359C>G	ENSP00000280362:p.Ala66Gly		B0YJ87|Q8WVG8	Missense_Mutation	SNP	ENST00000280362.3	37	CCDS8359.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378147	0.24944	.	.	ENSG00000150787	ENST00000280362	D	0.99388	-5.81	5.39	-0.156	0.13391	.	0.319540	0.33792	N	0.004555	D	0.96071	0.8720	L	0.39397	1.21	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	D	0.87920	0.2703	10	0.23302	T	0.38	-16.4062	1.042	0.01561	0.1483:0.1913:0.1537:0.5067	.	66	Q03393	PTPS_HUMAN	G	66	ENSP00000280362:A66G	ENSP00000280362:A66G	A	+	2	0	PTS	111606569	0.793000	0.28825	0.988000	0.46212	0.919000	0.55068	0.412000	0.21131	-0.174000	0.10743	-0.225000	0.12378	GCT		0.373	PTS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393541.1	NM_000317	
CHFR	55743	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	133435693	133435693	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr12:133435693G>A	ENST00000432561.2	-	8	981	c.908C>T	c.(907-909)aCa>aTa	p.T303I	CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000443047.2_Missense_Mutation_p.T211I|CHFR_ENST00000266880.7_Missense_Mutation_p.T303I|CHFR_ENST00000450056.2_Missense_Mutation_p.T291I|CHFR_ENST00000537522.1_5'Flank|CHFR_ENST00000315585.7_Missense_Mutation_p.T262I			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	303					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		GATGATGCATGTCAGCGTCTC	0.602																																						.											0													243.0	138.0	174.0					12																	133435693		2203	4300	6503	SO:0001583	missense	55743			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.908C>T	12.37:g.133435693G>A	ENSP00000392395:p.Thr303Ile		A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	37	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570504	0.65765	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000541228;ENST00000432561	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.49	3.64	0.41730	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.45316	0.1336	N	0.17674	0.51	0.58432	D	0.999997	D;P;P;P;P	0.76494	0.999;0.853;0.879;0.676;0.916	D;P;P;P;P	0.77004	0.989;0.805;0.877;0.733;0.503	T	0.22871	-1.0204	10	0.30078	T	0.28	-15.3446	11.2006	0.48739	0.0693:0.1281:0.8027:0.0	.	211;303;303;291;262	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	I	262;211;291;303;103;303	ENSP00000320557:T262I;ENSP00000416431:T211I;ENSP00000398735:T291I;ENSP00000266880:T303I;ENSP00000392395:T303I	ENSP00000266880:T303I	T	-	2	0	CHFR	131945766	1.000000	0.71417	0.310000	0.25168	0.974000	0.67602	9.312000	0.96287	0.660000	0.30964	0.655000	0.94253	ACA		0.602	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2		
HSPG2	3339	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	22207292	22207292	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr1:22207292G>A	ENST00000374695.3	-	15	1934	c.1855C>T	c.(1855-1857)Cgc>Tgc	p.R619C		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	619	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	AACTCGTAGCGCACGTTGTAA	0.657																																						.											0													31.0	31.0	31.0					1																	22207292		2195	4289	6484	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.1855C>T	1.37:g.22207292G>A	ENSP00000363827:p.Arg619Cys		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436733	0.62955	.	.	ENSG00000142798	ENST00000374695	T	0.37584	1.19	5.51	4.59	0.56863	Laminin B type IV (2);Laminin B, subgroup (1);	0.000000	0.40302	N	0.001137	T	0.60663	0.2286	M	0.80982	2.52	0.54753	D	0.999984	D	0.89917	1.0	D	0.87578	0.998	T	0.65697	-0.6105	10	0.87932	D	0	.	11.9832	0.53131	0.0846:0.0:0.9154:0.0	.	619	P98160	PGBM_HUMAN	C	619	ENSP00000363827:R619C	ENSP00000363827:R619C	R	-	1	0	HSPG2	22079879	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	3.767000	0.55288	1.313000	0.45069	0.561000	0.74099	CGC		0.657	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
SACS	26278	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	13	23915268	23915268	+	Missense_Mutation	SNP	T	T	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr13:23915268T>G	ENST00000382292.3	-	9	3020	c.2747A>C	c.(2746-2748)aAa>aCa	p.K916T	SACS_ENST00000402364.1_Missense_Mutation_p.K166T|SACS_ENST00000382298.3_Missense_Mutation_p.K916T			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	916					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TCTTTTCTCTTTCTCACTGCT	0.363																																						.											0													132.0	134.0	133.0					13																	23915268		2203	4300	6503	SO:0001583	missense	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.2747A>C	13.37:g.23915268T>G	ENSP00000371729:p.Lys916Thr		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	11.97	1.796919	0.31777	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87809	-2.15;-2.3;-2.15	6.05	4.87	0.63330	.	0.154450	0.56097	D	0.000028	T	0.78304	0.4262	L	0.32530	0.975	0.30980	N	0.722627	P	0.34815	0.47	B	0.28916	0.096	T	0.74475	-0.3653	10	0.23891	T	0.37	.	11.899	0.52671	0.0:0.0675:0.0:0.9325	.	916	Q9NZJ4	SACS_HUMAN	T	916;166;916	ENSP00000371729:K916T;ENSP00000385844:K166T;ENSP00000371735:K916T	ENSP00000371729:K916T	K	-	2	0	SACS	22813268	1.000000	0.71417	0.995000	0.50966	0.913000	0.54294	2.117000	0.41939	1.118000	0.41863	0.528000	0.53228	AAA		0.363	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SERPINB3	6317	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	18	61323171	61323171	+	Missense_Mutation	SNP	G	G	A	rs377088096		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr18:61323171G>A	ENST00000283752.5	-	8	1036	c.893C>T	c.(892-894)aCg>aTg	p.T298M	SERPINB11_ENST00000489748.1_RNA|SERPINB3_ENST00000332821.8_Missense_Mutation_p.T246M	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	298					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)	p.T298M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						GGTTCTCAACGTGTCCTTGAG	0.488																																						.											1	Substitution - Missense(1)	lung(1)						G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	180.0	154.0	163.0		893	-3.2	0.0	18		163	0,8600		0,0,4300	no	missense	SERPINB3	NM_006919.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	298/391	61323171	1,13005	2203	4300	6503	SO:0001583	missense	6317			U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.893C>T	18.37:g.61323171G>A	ENSP00000283752:p.Thr298Met		A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	G	8.978	0.974626	0.18736	2.27E-4	0.0	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.84800	-1.9;-1.9	3.07	-3.17	0.05202	Serpin domain (3);	1.383540	0.04944	N	0.459085	D	0.87732	0.6251	M	0.80746	2.51	0.09310	N	1	B;D	0.55385	0.334;0.971	B;P	0.47941	0.146;0.562	T	0.81123	-0.1076	10	0.66056	D	0.02	.	11.7335	0.51752	0.6699:0.0:0.3301:0.0	.	246;298	P29508-2;P29508	.;SPB3_HUMAN	M	298;246	ENSP00000283752:T298M;ENSP00000329498:T246M	ENSP00000283752:T298M	T	-	2	0	SERPINB3	59474151	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-3.514000	0.00445	-0.831000	0.04256	-0.403000	0.06358	ACG		0.488	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
SEMA6B	10501	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	4557004	4557004	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:4557004G>A	ENST00000586582.1	-	5	638	c.328C>T	c.(328-330)Ccc>Tcc	p.P110S	SEMA6B_ENST00000586965.1_Missense_Mutation_p.P110S|SEMA6B_ENST00000301293.3_Missense_Mutation_p.P110S	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	110	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTCGCTGGGGTTAGATCTC	0.627																																						.											0													66.0	47.0	54.0					19																	4557004		2203	4299	6502	SO:0001583	missense	10501			AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.328C>T	19.37:g.4557004G>A	ENSP00000467290:p.Pro110Ser		A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.178855	0.38511	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.10192	2.9	3.7	3.7	0.42460	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.291091	0.33631	N	0.004705	T	0.17152	0.0412	L	0.33710	1.025	0.32361	N	0.557213	B;P	0.46064	0.126;0.872	B;P	0.53988	0.145;0.739	T	0.05084	-1.0907	10	0.62326	D	0.03	.	14.532	0.67934	0.0:0.0:1.0:0.0	.	110;110	B4DT36;Q9H3T3	.;SEM6B_HUMAN	S	110	ENSP00000301293:P110S	ENSP00000301292:P110S	P	-	1	0	SEMA6B	4508004	0.995000	0.38212	0.995000	0.50966	0.234000	0.25298	3.531000	0.53546	2.084000	0.62774	0.313000	0.20887	CCC		0.627	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458656.2	NM_032108	
MYO1F	4542	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	8615207	8615207	+	Missense_Mutation	SNP	T	T	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:8615207T>A	ENST00000338257.8	-	10	1205	c.938A>T	c.(937-939)gAc>gTc	p.D313V	AC092316.1_ENST00000598703.1_RNA	NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	313	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						TCGCCCGCTGTCAATGCCCAG	0.627																																						.											0													19.0	22.0	21.0					19																	8615207		2022	4193	6215	SO:0001583	missense	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.938A>T	19.37:g.8615207T>A	ENSP00000344871:p.Asp313Val		Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	37	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411157	0.83340	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.90676	-2.71	5.14	5.14	0.70334	Myosin head, motor domain (2);	0.332056	0.30714	N	0.009038	D	0.94098	0.8108	M	0.91612	3.225	0.80722	D	1	P;P	0.36909	0.573;0.573	P;B	0.45119	0.47;0.367	D	0.94932	0.8083	10	0.87932	D	0	.	14.1276	0.65233	0.0:0.0:0.0:1.0	.	313;313	B0I1T1;O00160	.;MYO1F_HUMAN	V	358;313	ENSP00000344871:D313V	ENSP00000304899:D358V	D	-	2	0	MYO1F	8521207	1.000000	0.71417	0.816000	0.32577	0.926000	0.56050	6.235000	0.72332	1.941000	0.56285	0.455000	0.32223	GAC		0.627	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
RYR1	6261	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	38976258	38976258	+	Missense_Mutation	SNP	C	C	T	rs371777056		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:38976258C>T	ENST00000359596.3	+	34	4963	c.4963C>T	c.(4963-4965)Cgc>Tgc	p.R1655C	RYR1_ENST00000355481.4_Missense_Mutation_p.R1655C|RYR1_ENST00000360985.3_Missense_Mutation_p.R1655C			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1655	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCTGTCGGAGCGCCTGGACCT	0.627																																						.											0								C	CYS/ARG,CYS/ARG	1,4399		0,1,2199	44.0	42.0	42.0		4963,4963	4.0	1.0	19		42	0,8586		0,0,4293	no	missense,missense	RYR1	NM_000540.2,NM_001042723.1	180,180	0,1,6492	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1655/5039,1655/5034	38976258	1,12985	2200	4293	6493	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.4963C>T	19.37:g.38976258C>T	ENSP00000352608:p.Arg1655Cys		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362048	0.61403	2.27E-4	0.0	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96830	-4.14;-4.14;-4.14	3.98	3.98	0.46160	.	0.078316	0.48767	U	0.000169	D	0.97081	0.9046	L	0.51422	1.61	0.53005	D	0.999962	D;D	0.89917	1.0;0.999	D;D	0.75020	0.985;0.973	D	0.97725	1.0199	10	0.66056	D	0.02	.	15.8478	0.78905	0.0:1.0:0.0:0.0	.	1655;1655	P21817-2;P21817	.;RYR1_HUMAN	C	1655	ENSP00000352608:R1655C;ENSP00000347667:R1655C;ENSP00000354254:R1655C	ENSP00000347667:R1655C	R	+	1	0	RYR1	43668098	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.839000	0.69395	2.043000	0.60533	0.650000	0.86243	CGC		0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
LTN1	26046	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	21	30331996	30331996	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr21:30331996C>T	ENST00000361371.5	-	13	2456	c.2377G>A	c.(2377-2379)Gtt>Att	p.V793I	LTN1_ENST00000389194.2_Missense_Mutation_p.V839I			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	793					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						ATTCTTTCAACATATACGTCT	0.279																																						.											0													36.0	31.0	33.0					21																	30331996		2203	4300	6503	SO:0001583	missense	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.2377G>A	21.37:g.30331996C>T	ENSP00000354977:p.Val793Ile		A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	C	14.19	2.460243	0.43736	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.19532	2.14;2.15	5.65	2.78	0.32641	.	0.346007	0.30602	N	0.009270	T	0.10035	0.0246	N	0.08118	0	0.51767	D	0.999939	B	0.24721	0.11	B	0.16722	0.016	T	0.11966	-1.0566	10	0.54805	T	0.06	.	8.7649	0.34698	0.1226:0.7461:0.0:0.1313	.	793	O94822	LTN1_HUMAN	I	839;793	ENSP00000373846:V839I;ENSP00000354977:V793I	ENSP00000354977:V793I	V	-	1	0	LTN1	29253867	1.000000	0.71417	0.994000	0.49952	0.599000	0.36880	1.160000	0.31761	0.911000	0.36747	0.655000	0.94253	GTT		0.279	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
CSF2RB	1439	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	37334203	37334203	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr22:37334203G>T	ENST00000403662.3	+	14	2575	c.2353G>T	c.(2353-2355)Gtc>Ttc	p.V785F	CSF2RB_ENST00000406230.1_Missense_Mutation_p.V791F|CSF2RB_ENST00000536485.1_Missense_Mutation_p.V732F|CSF2RB_ENST00000262825.5_Missense_Mutation_p.V791F			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	785					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GAACAATCCTGTCCCCCCTGA	0.642																																						.											0													52.0	51.0	51.0					22																	37334203		2203	4300	6503	SO:0001583	missense	1439			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2353G>T	22.37:g.37334203G>T	ENSP00000384053:p.Val785Phe		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	ENST00000403662.3	37	CCDS13936.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954914	0.53293	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.92397	-2.52;-3.03;-3.03;-3.03	5.38	1.62	0.23740	.	0.614872	0.14560	N	0.312136	D	0.88994	0.6589	L	0.29908	0.895	0.09310	N	1	D;D	0.61080	0.986;0.989	P;P	0.54100	0.742;0.726	T	0.79964	-0.1581	10	0.52906	T	0.07	-8.6352	5.7541	0.18162	0.1998:0.1672:0.633:0.0	.	791;785	P32927-2;P32927	.;IL3RB_HUMAN	F	785;785;791;791;732	ENSP00000384053:V785F;ENSP00000262825:V791F;ENSP00000385271:V791F;ENSP00000440003:V732F	ENSP00000262825:V791F	V	+	1	0	CSF2RB	35664149	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.125000	0.15749	0.632000	0.30432	0.555000	0.69702	GTC		0.642	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395	
DRD3	1814	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	113890761	113890761	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:113890761G>A	ENST00000460779.1	-	3	368	c.79C>T	c.(79-81)Cgc>Tgc	p.R27C	DRD3_ENST00000383673.2_Missense_Mutation_p.R27C|DRD3_ENST00000295881.7_Missense_Mutation_p.R27C|DRD3_ENST00000467632.1_Missense_Mutation_p.R27C	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	27					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCATGTGGGCGGGCCTGGCTG	0.627																																						.											0													41.0	36.0	38.0					3																	113890761		2203	4300	6503	SO:0001583	missense	1814				CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.79C>T	3.37:g.113890761G>A	ENSP00000419402:p.Arg27Cys		A1A4V5|Q4VBM8	Missense_Mutation	SNP	ENST00000460779.1	37	CCDS2978.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276566	0.80580	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.0	5.0	0.66597	.	0.587132	0.18863	N	0.129078	T	0.30978	0.0782	N	0.19112	0.55	0.20489	N	0.999893	D;D;D;P	0.63046	0.977;0.977;0.992;0.857	P;P;B;P	0.44860	0.462;0.462;0.386;0.462	T	0.18335	-1.0340	10	0.46703	T	0.11	.	18.4938	0.90856	0.0:0.0:1.0:0.0	.	27;27;27;27	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	C	27	ENSP00000419402:R27C;ENSP00000420662:R27C;ENSP00000373169:R27C;ENSP00000295881:R27C	ENSP00000281274:R27C	R	-	1	0	DRD3	115373451	0.912000	0.30974	0.651000	0.29564	0.276000	0.26787	3.919000	0.56439	2.603000	0.88011	0.655000	0.94253	CGC		0.627	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354699.1	NM_000796.3	
CLCN2	1181	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	184075816	184075816	+	Missense_Mutation	SNP	C	C	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:184075816C>G	ENST00000265593.4	-	5	720	c.549G>C	c.(547-549)aaG>aaC	p.K183N	EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000434054.2_Missense_Mutation_p.K139N|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000457512.1_Missense_Mutation_p.K183N|CLCN2_ENST00000423355.2_5'UTR|CLCN2_ENST00000344937.7_Missense_Mutation_p.K183N	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	183					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	CTATAAAGGTCTTGAGTGTGA	0.562																																						.											0													85.0	81.0	82.0					3																	184075816		2203	4300	6503	SO:0001583	missense	1181			S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.549G>C	3.37:g.184075816C>G	ENSP00000265593:p.Lys183Asn		B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	c	17.24	3.340551	0.60963	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54	4.34	4.34	0.51931	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.96595	0.8889	M	0.81497	2.545	0.80722	D	1	P;P;D;P;P	0.76494	0.936;0.931;0.999;0.553;0.733	P;P;D;B;P	0.74674	0.827;0.635;0.984;0.35;0.538	D	0.96554	0.9410	10	0.87932	D	0	-20.6668	10.337	0.43856	0.0:0.9085:0.0:0.0915	.	183;139;183;183;183	B4DYE3;E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;.;CLCN2_HUMAN	N	183;183;139;183	ENSP00000265593:K183N;ENSP00000345056:K183N;ENSP00000400425:K139N;ENSP00000391928:K183N	ENSP00000265593:K183N	K	-	3	2	CLCN2	185558510	0.981000	0.34729	1.000000	0.80357	0.907000	0.53573	0.165000	0.16564	2.250000	0.74265	0.462000	0.41574	AAG		0.562	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
ICE1	23379	broad.mit.edu;hgsc.bcm.edu	37	5	5463283	5463284	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:5463283_5463284insTA	ENST00000296564.7	+	13	4058_4059	c.3836_3837insTA	c.(3835-3840)ggtaaafs	p.K1280fs		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1280					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GATTGCAATGGTAAAGATACTG	0.371																																						.											0																																										SO:0001589	frameshift_variant	23379																														ENST00000296564.7:c.3837_3838dupTA	5.37:g.5463284_5463285dupTA	ENSP00000296564:p.Lys1280fs		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Frame_Shift_Ins	INS	ENST00000296564.7	37	CCDS47187.1																																																																																				0.371	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
TAS2R1	50834	hgsc.bcm.edu;ucsc.edu	37	5	9629359	9629359	+	Silent	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:9629359G>A	ENST00000382492.2	-	1	1104	c.786C>T	c.(784-786)ttC>ttT	p.F262F	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	262					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						TCACAAGGATGAAGAACAGAA	0.373																																						.											0													99.0	103.0	102.0					5																	9629359		2203	4300	6503	SO:0001819	synonymous_variant	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.786C>T	5.37:g.9629359G>A			Q646G8	Silent	SNP	ENST00000382492.2	37	CCDS3876.1																																																																																				0.373	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2		
GPBP1	65056	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	56545266	56545266	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:56545266G>A	ENST00000506184.2	+	9	1940	c.835G>A	c.(835-837)Gac>Aac	p.D279N	GPBP1_ENST00000454432.2_Missense_Mutation_p.D299N|GPBP1_ENST00000538707.1_Missense_Mutation_p.D286N|GPBP1_ENST00000424459.3_Missense_Mutation_p.D299N|GPBP1_ENST00000511209.1_Intron|GPBP1_ENST00000514387.2_Missense_Mutation_p.D108N|GPBP1_ENST00000264779.6_Missense_Mutation_p.D286N			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	279					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		TTCTCCTGTTGACAAACTTAA	0.363																																						.											0													104.0	97.0	100.0					5																	56545266		2202	4298	6500	SO:0001583	missense	65056				CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.835G>A	5.37:g.56545266G>A	ENSP00000421202:p.Asp279Asn		A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Missense_Mutation	SNP	ENST00000506184.2	37	CCDS34162.1	.	.	.	.	.	.	.	.	.	.	G	33	5.240017	0.95240	.	.	ENSG00000062194	ENST00000424459;ENST00000514387;ENST00000506184;ENST00000454432;ENST00000264779;ENST00000538707	T;T;T;T;T;T	0.49139	1.79;0.79;1.8;1.79;1.83;1.82	6.16	6.16	0.99307	.	0.111909	0.64402	D	0.000006	T	0.68165	0.2971	M	0.61703	1.905	0.41698	D	0.989386	D;P;P	0.71674	0.998;0.72;0.72	D;P;B	0.81914	0.995;0.506;0.429	T	0.67086	-0.5759	10	0.62326	D	0.03	-12.6167	19.0403	0.92995	0.0:0.0:1.0:0.0	.	299;286;279	D4PHA4;Q86WP2-2;Q86WP2	.;.;GPBP1_HUMAN	N	299;108;279;299;286;286	ENSP00000401596:D299N;ENSP00000421709:D108N;ENSP00000421202:D279N;ENSP00000403522:D299N;ENSP00000264779:D286N;ENSP00000440090:D286N	ENSP00000264779:D286N	D	+	1	0	GPBP1	56581023	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.747000	0.74872	2.937000	0.99478	0.650000	0.86243	GAC		0.363	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374496.1	NM_022913	
GPBP1	65056	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	56545374	56545374	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:56545374G>A	ENST00000506184.2	+	9	2048	c.943G>A	c.(943-945)Gaa>Aaa	p.E315K	GPBP1_ENST00000454432.2_Missense_Mutation_p.E335K|GPBP1_ENST00000538707.1_Missense_Mutation_p.E322K|GPBP1_ENST00000424459.3_Missense_Mutation_p.E335K|GPBP1_ENST00000511209.1_Missense_Mutation_p.E307K|GPBP1_ENST00000514387.2_Missense_Mutation_p.E144K|GPBP1_ENST00000264779.6_Missense_Mutation_p.E322K			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	315					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		AGAGGAACATGAAGATGAAAG	0.373																																						.											0													94.0	94.0	94.0					5																	56545374		2201	4299	6500	SO:0001583	missense	65056				CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.943G>A	5.37:g.56545374G>A	ENSP00000421202:p.Glu315Lys		A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Missense_Mutation	SNP	ENST00000506184.2	37	CCDS34162.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067775	0.76301	.	.	ENSG00000062194	ENST00000424459;ENST00000514387;ENST00000506184;ENST00000454432;ENST00000511209;ENST00000264779;ENST00000538707	T;T;T;T;T;T;T	0.50548	1.77;0.74;1.78;1.77;1.79;1.75;1.76	6.16	6.16	0.99307	.	0.100833	0.64402	D	0.000002	T	0.59932	0.2230	L	0.31926	0.97	0.45464	D	0.998434	B;B;D;B	0.67145	0.027;0.004;0.996;0.004	B;B;D;B	0.76071	0.031;0.011;0.987;0.006	T	0.55566	-0.8121	10	0.45353	T	0.12	-17.1056	18.0158	0.89239	0.0:0.0:1.0:0.0	.	335;322;307;315	D4PHA4;Q86WP2-2;Q86WP2-3;Q86WP2	.;.;.;GPBP1_HUMAN	K	335;144;315;335;307;322;322	ENSP00000401596:E335K;ENSP00000421709:E144K;ENSP00000421202:E315K;ENSP00000403522:E335K;ENSP00000422337:E307K;ENSP00000264779:E322K;ENSP00000440090:E322K	ENSP00000264779:E322K	E	+	1	0	GPBP1	56581131	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.660000	0.54496	2.937000	0.99478	0.650000	0.86243	GAA		0.373	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374496.1	NM_022913	
MAP1B	4131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	71493836	71493836	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:71493836G>A	ENST00000296755.7	+	5	4952	c.4654G>A	c.(4654-4656)Gtg>Atg	p.V1552M		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1552					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGTGGCCTCAGTGTCCACAGC	0.517																																					Melanoma(17;367 822 11631 31730 47712)	.											0													112.0	94.0	100.0					5																	71493836		2203	4300	6503	SO:0001583	missense	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4654G>A	5.37:g.71493836G>A	ENSP00000296755:p.Val1552Met		A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769918	0.49680	.	.	ENSG00000131711	ENST00000296755	T	0.03580	3.88	5.19	5.19	0.71726	.	0.000000	0.56097	D	0.000032	T	0.10380	0.0254	N	0.24115	0.695	0.58432	D	0.999997	D;D	0.76494	0.999;0.999	D;D	0.68192	0.956;0.956	T	0.18587	-1.0332	10	0.72032	D	0.01	-16.387	18.7095	0.91651	0.0:0.0:1.0:0.0	.	1426;1552	A2BDK6;P46821	.;MAP1B_HUMAN	M	1552	ENSP00000296755:V1552M	ENSP00000296755:V1552M	V	+	1	0	MAP1B	71529592	1.000000	0.71417	0.907000	0.35723	0.750000	0.42670	9.869000	0.99810	2.435000	0.82474	0.313000	0.20887	GTG		0.517	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
RASA1	5921	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	86675579	86675579	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:86675579G>A	ENST00000274376.6	+	19	3079	c.2515G>A	c.(2515-2517)Gaa>Aaa	p.E839K	RASA1_ENST00000456692.2_Missense_Mutation_p.E662K|RASA1_ENST00000506290.1_Missense_Mutation_p.E673K|RASA1_ENST00000512763.1_Missense_Mutation_p.E672K|CTC-428H11.2_ENST00000607486.1_RNA	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	839	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		AGAAAAAAATGAAGATGTGAA	0.318																																						.											0													81.0	82.0	82.0					5																	86675579		2203	4296	6499	SO:0001583	missense	5921				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2515G>A	5.37:g.86675579G>A	ENSP00000274376:p.Glu839Lys		B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	37	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995383	0.74703	.	.	ENSG00000145715	ENST00000274376;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	5.06	5.06	0.68205	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.046382	0.85682	D	0.000000	T	0.27454	0.0674	M	0.69185	2.1	0.80722	D	1	B;B;B;B;B	0.25743	0.004;0.057;0.133;0.046;0.088	B;B;B;B;B	0.20577	0.004;0.03;0.03;0.017;0.011	T	0.04678	-1.0934	10	0.42905	T	0.14	.	18.8001	0.92013	0.0:0.0:1.0:0.0	.	673;672;673;662;839	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	K	839;662;672;673	ENSP00000274376:E839K;ENSP00000411221:E662K;ENSP00000422008:E672K;ENSP00000420905:E673K	ENSP00000274376:E839K	E	+	1	0	RASA1	86711335	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.745000	0.98856	2.500000	0.84329	0.655000	0.94253	GAA		0.318	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
EBF1	1879	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	5	158526463	158526463	+	Silent	SNP	G	G	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:158526463G>T	ENST00000313708.6	-	1	306	c.24C>A	c.(22-24)atC>atA	p.I8I	EBF1_ENST00000380654.4_Silent_p.I8I|EBF1_ENST00000517373.1_Silent_p.I8I|RP11-175K6.1_ENST00000499583.1_lincRNA|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	8					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACTCCGTTGGATGCTTTCCT	0.493			T	HMGA2	lipoma																																	.		Dom	yes		5	5q34	1879	early B-cell factor 1		M	0													103.0	120.0	115.0					5																	158526463		2203	4300	6503	SO:0001819	synonymous_variant	1879			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.24C>A	5.37:g.158526463G>T			Q8IW11	Silent	SNP	ENST00000313708.6	37	CCDS4343.1																																																																																				0.493	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
CACNA2D1	781	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	81641523	81641523	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr7:81641523C>T	ENST00000356253.5	-	15	1564	c.1309G>A	c.(1309-1311)Gca>Aca	p.A437T	CACNA2D1_ENST00000464354.1_5'UTR|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.A437T|MIR1255B1_ENST00000454066.1_RNA|MIR1255B1_ENST00000439234.1_RNA			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	437					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TTGTCTCCTGCTAAAACCATT	0.363																																						.											0													175.0	157.0	163.0					7																	81641523		2203	4300	6503	SO:0001583	missense	781			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1309G>A	7.37:g.81641523C>T	ENSP00000348589:p.Ala437Thr		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	C	31	5.069378	0.93950	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.08008	3.15;3.14	5.41	5.41	0.78517	.	0.046028	0.85682	D	0.000000	T	0.23926	0.0579	M	0.70595	2.14	0.80722	D	1	P	0.47191	0.891	P	0.54759	0.76	T	0.00097	-1.2072	10	0.38643	T	0.18	-21.2337	18.325	0.90251	0.0:1.0:0.0:0.0	.	437	P54289-2	.	T	437	ENSP00000349320:A437T;ENSP00000348589:A437T	ENSP00000284088:A437T	A	-	1	0	CACNA2D1	81479459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.137000	0.77295	2.694000	0.91930	0.585000	0.79938	GCA		0.363	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
TOX	9760	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	8	60031454	60031454	+	Nonsense_Mutation	SNP	A	A	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr8:60031454A>T	ENST00000361421.1	-	1	313	c.93T>A	c.(91-93)taT>taA	p.Y31*	RP11-25K19.1_ENST00000518993.1_RNA|RP11-25K19.1_ENST00000517898.1_RNA|RP11-25K19.1_ENST00000523683.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	31						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				CCTTGTTGCAATAGTAGGGGT	0.632																																					Pancreas(161;610 1969 17913 21374 22725)	.											0													80.0	78.0	78.0					8																	60031454		2203	4300	6503	SO:0001587	stop_gained	9760				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.93T>A	8.37:g.60031454A>T	ENSP00000354842:p.Tyr31*		Q96AV5	Nonsense_Mutation	SNP	ENST00000361421.1	37	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	A	37	6.025795	0.97216	.	.	ENSG00000198846	ENST00000361421	.	.	.	4.76	4.76	0.60689	.	0.328792	0.22187	N	0.063421	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.498	0.27500	0.8348:0.0:0.1652:0.0	.	.	.	.	X	31	.	.	Y	-	3	2	TOX	60194008	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	1.807000	0.38902	1.903000	0.55091	0.459000	0.35465	TAT		0.632	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
GEM	2669	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	8	95264412	95264412	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr8:95264412C>T	ENST00000297596.2	-	4	712	c.448G>A	c.(448-450)Ggg>Agg	p.G150R	GEM_ENST00000396194.2_Missense_Mutation_p.G150R	NM_005261.3	NP_005252.1	P55040	GEM_HUMAN	GTP binding protein overexpressed in skeletal muscle	150					cell surface receptor signaling pathway (GO:0007166)|chromosome organization (GO:0051276)|immune response (GO:0006955)|metaphase plate congression (GO:0051310)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic side of plasma membrane (GO:0009898)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			TATGCGTCCCCGACCTGCATG	0.517																																					GBM(125;80 1653 28655 32188 47338)|Esophageal Squamous(19;97 579 13602 49091 51766)	.											0													82.0	73.0	76.0					8																	95264412		2203	4300	6503	SO:0001583	missense	2669				CCDS6261.1	8q13-q21	2014-05-09	2001-11-28		ENSG00000164949	ENSG00000164949			4234	protein-coding gene	gene with protein product	"""kinase-inducible Ras-like protein"""	600164	"""GTP-binding protein overexpressed in skeletal muscle"""			7912851, 11956230	Standard	NM_005261		Approved	KIR	uc003ygj.3	P55040	OTTHUMG00000164392	ENST00000297596.2:c.448G>A	8.37:g.95264412C>T	ENSP00000297596:p.Gly150Arg		B2RA31	Missense_Mutation	SNP	ENST00000297596.2	37	CCDS6261.1	.	.	.	.	.	.	.	.	.	.	C	35	5.510098	0.96386	.	.	ENSG00000164949	ENST00000396194;ENST00000297596	T;T	0.79653	-1.29;-1.29	6.17	6.17	0.99709	Small GTP-binding protein domain (1);	0.101171	0.64402	D	0.000002	D	0.92335	0.7568	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92503	0.6010	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	150	P55040	GEM_HUMAN	R	150	ENSP00000379497:G150R;ENSP00000297596:G150R	ENSP00000297596:G150R	G	-	1	0	GEM	95333588	1.000000	0.71417	0.977000	0.42913	0.958000	0.62258	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGG		0.517	GEM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378566.1	NM_181702	
KRT76	51350	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	12	53169235	53169235	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr12:53169235T>C	ENST00000332411.2	-	2	805	c.752A>G	c.(751-753)gAg>gGg	p.E251G		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	251	Coil 1B.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GTTCCCCCTCTCCCCTAGAAG	0.552																																						.											0													140.0	142.0	141.0					12																	53169235		2203	4300	6503	SO:0001583	missense	51350			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.752A>G	12.37:g.53169235T>C	ENSP00000330101:p.Glu251Gly		B4DRR3|Q7Z795	Missense_Mutation	SNP	ENST00000332411.2	37	CCDS8838.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.767701	0.49574	.	.	ENSG00000185069	ENST00000332411	D	0.90620	-2.7	4.56	3.38	0.38709	Filament (1);	0.144593	0.31612	N	0.007350	D	0.95236	0.8455	M	0.90082	3.085	0.42102	D	0.991342	D	0.67145	0.996	D	0.67725	0.953	D	0.95005	0.8146	10	0.59425	D	0.04	.	11.511	0.50494	0.0:0.0:0.1563:0.8437	.	251	Q01546	K22O_HUMAN	G	251	ENSP00000330101:E251G	ENSP00000330101:E251G	E	-	2	0	KRT76	51455502	0.925000	0.31364	0.067000	0.19924	0.330000	0.28571	5.173000	0.65010	0.825000	0.34637	0.379000	0.24179	GAG		0.552	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
BCAR1	9564	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	16	75270827	75270827	+	Missense_Mutation	SNP	C	C	T	rs370653589		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr16:75270827C>T	ENST00000162330.5	-	4	991	c.865G>A	c.(865-867)Gtg>Atg	p.V289M	BCAR1_ENST00000546196.1_Missense_Mutation_p.V260M|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000420641.3_Missense_Mutation_p.V307M|BCAR1_ENST00000538440.2_Missense_Mutation_p.V289M|BCAR1_ENST00000393422.2_Missense_Mutation_p.V307M|BCAR1_ENST00000535626.2_Missense_Mutation_p.V141M|BCAR1_ENST00000393420.6_Missense_Mutation_p.V289M|BCAR1_ENST00000542031.2_Missense_Mutation_p.V287M|BCAR1_ENST00000418647.3_Missense_Mutation_p.V335M	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	289	Substrate for kinases. {ECO:0000250}.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		CTGGGGGGCACGTCATACACC	0.632																																						.											0								C	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	2,4394	4.2+/-10.8	0,2,2196	85.0	80.0	82.0		1003,919,919,865,865,859,421,235,865	3.9	1.0	16		82	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense,missense	BCAR1	NM_001170714.1,NM_001170715.1,NM_001170716.1,NM_001170717.1,NM_001170718.1,NM_001170719.1,NM_001170720.1,NM_001170721.1,NM_014567.3	21,21,21,21,21,21,21,21,21	0,2,6496	TT,TC,CC		0.0,0.0455,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	335/917,307/889,307/889,289/889,289/871,287/869,141/723,79/661,289/871	75270827	2,12994	2198	4300	6498	SO:0001583	missense	9564			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.865G>A	16.37:g.75270827C>T	ENSP00000162330:p.Val289Met		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	ENST00000162330.5	37	CCDS10915.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963648	0.53507	4.55E-4	0.0	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	3.93	3.93	0.45458	.	0.396664	0.25076	N	0.033324	T	0.60104	0.2243	L	0.47016	1.485	0.38522	D	0.948762	D;D;D;D;D;D;D;D;D	0.89917	0.968;1.0;1.0;1.0;0.967;1.0;1.0;0.966;0.999	P;D;D;D;P;D;D;B;D	0.80764	0.546;0.994;0.945;0.994;0.734;0.981;0.994;0.321;0.987	T	0.63301	-0.6668	10	0.46703	T	0.11	-22.7831	13.8451	0.63463	0.0:1.0:0.0:0.0	.	307;141;335;287;289;307;289;289;79	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945;B3KWE2	.;.;.;.;.;.;.;BCAR1_HUMAN;.	M	289;307;307;289;335;141;289;287;260	ENSP00000162330:V289M;ENSP00000377074:V307M;ENSP00000392708:V307M;ENSP00000443841:V289M;ENSP00000391669:V335M;ENSP00000440370:V141M;ENSP00000377072:V289M;ENSP00000440415:V287M;ENSP00000442161:V260M	ENSP00000162330:V289M	V	-	1	0	BCAR1	73828328	0.976000	0.34144	0.980000	0.43619	0.703000	0.40648	2.234000	0.43035	2.199000	0.70637	0.549000	0.68633	GTG		0.632	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567	
ASXL2	55252	broad.mit.edu;hgsc.bcm.edu	37	2	25966455	25966455	+	Silent	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr2:25966455C>T	ENST00000435504.4	-	13	3044	c.2751G>A	c.(2749-2751)tcG>tcA	p.S917S	ASXL2_ENST00000336112.4_Silent_p.S889S|ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000404843.1_Intron			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	917					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAAAGTGCTCGAGGGTGGAG	0.473																																						.											0													96.0	98.0	97.0					2																	25966455		1935	4140	6075	SO:0001819	synonymous_variant	55252					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2751G>A	2.37:g.25966455C>T			Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Silent	SNP	ENST00000435504.4	37																																																																																					0.473	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
MYL7	58498	broad.mit.edu;hgsc.bcm.edu	37	7	44179423	44179423	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr7:44179423C>T	ENST00000223364.3	-	5	361	c.335G>A	c.(334-336)cGc>cAc	p.R112H	MYL7_ENST00000434895.1_5'UTR|MYL7_ENST00000458240.1_Missense_Mutation_p.R85H	NM_021223.2	NP_067046.1	Q01449	MLRA_HUMAN	myosin, light chain 7, regulatory	112	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					A band (GO:0031672)|dendritic spine (GO:0043197)|myosin complex (GO:0016459)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	12						GTCAAACATGCGGAAGGCACT	0.627																																						.											0													66.0	58.0	61.0					7																	44179423		2203	4300	6503	SO:0001583	missense	58498			M94547	CCDS5478.1	7p21-p11.2	2013-01-10	2006-09-29		ENSG00000106631	ENSG00000106631		"""Myosins / Light chain"", ""EF-hand domain containing"""	21719	protein-coding gene	gene with protein product		613993	"""myosin, light polypeptide 7, regulatory"""			8207020	Standard	NM_021223		Approved	MYLC2A, MYL2A	uc003tkg.3	Q01449	OTTHUMG00000023125	ENST00000223364.3:c.335G>A	7.37:g.44179423C>T	ENSP00000223364:p.Arg112His		B2R4L3	Missense_Mutation	SNP	ENST00000223364.3	37	CCDS5478.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.639708	0.87760	.	.	ENSG00000106631	ENST00000446581;ENST00000223364;ENST00000458240;ENST00000457314;ENST00000447951	T;T;T;T;T	0.73047	2.84;-0.71;-0.71;-0.71;-0.49	5.05	5.05	0.67936	EF-hand-like domain (1);	0.063686	0.64402	D	0.000008	T	0.67011	0.2848	M	0.67700	2.07	0.41070	D	0.985441	B	0.20887	0.049	B	0.25759	0.063	T	0.68383	-0.5423	10	0.72032	D	0.01	.	7.8513	0.29457	0.0:0.8213:0.0:0.1787	.	112	Q01449	MLRA_HUMAN	H	39;112;85;134;141	ENSP00000416010:R39H;ENSP00000223364:R112H;ENSP00000403360:R85H;ENSP00000389202:R134H;ENSP00000403988:R141H	ENSP00000223364:R112H	R	-	2	0	MYL7	44145948	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.258000	0.58822	2.348000	0.79779	0.551000	0.68910	CGC		0.627	MYL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059446.4	NM_021223	
ODF2L	57489	broad.mit.edu	37	1	86826142	86826142	+	Frame_Shift_Del	DEL	T	T	-	rs372782838		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr1:86826142delT	ENST00000359242.3	-	12	1502	c.1221delA	c.(1219-1221)aaafs	p.K407fs	ODF2L_ENST00000317336.7_Frame_Shift_Del_p.K407fs|ODF2L_ENST00000370567.1_Frame_Shift_Del_p.K378fs|ODF2L_ENST00000394731.1_Frame_Shift_Del_p.K247fs|ODF2L_ENST00000370566.3_Frame_Shift_Del_p.K378fs|ODF2L_ENST00000524695.1_5'UTR|ODF2L_ENST00000294678.2_Frame_Shift_Del_p.K378fs	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	407						centrosome (GO:0005813)		p.K378fs*22(2)		endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		GGGTTTTCTGTTTTTTTTCTA	0.289																																						.											2	Deletion - Frameshift(2)	lung(2)											87.0	92.0	90.0					1																	86826142		2202	4293	6495	SO:0001589	frameshift_variant	57489				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.1221delA	1.37:g.86826142delT	ENSP00000359600:p.Lys407fs		A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Frame_Shift_Del	DEL	ENST00000359242.3	37	CCDS41354.2																																																																																				0.289	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
TUBB8	347688	broad.mit.edu	37	10	93637	93637	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr10:93637G>A	ENST00000309812.4	-	4	757	c.695C>T	c.(694-696)aCc>aTc	p.T232I	TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.T160I	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	232					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.T232I(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CCCACTCATGGTAGCAGACAC	0.557																																					Pancreas(192;2041 3010 9013 18103)	.											1	Substitution - Missense(1)	skin(1)											19.0	20.0	20.0					10																	93637		1983	3806	5789	SO:0001583	missense	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.695C>T	10.37:g.93637G>A	ENSP00000311042:p.Thr232Ile		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.363066	0.24684	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.67698	-0.28	.	.	.	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	U	0.000006	T	0.63177	0.2489	N	0.17764	0.52	0.36197	D	0.85048	D;D	0.65815	0.995;0.961	D;P	0.70487	0.969;0.891	T	0.66236	-0.5974	9	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	195;232	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	I	160;198;195;232	ENSP00000403895:T160I	ENSP00000272035:T198I	T	-	2	0	RP11-631M21.2	83637	1.000000	0.71417	0.111000	0.21465	0.113000	0.19764	6.543000	0.73874	0.119000	0.18210	0.121000	0.15741	ACC		0.557	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
SYT7	9066	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	61291299	61291299	+	Splice_Site	SNP	C	C	A	rs567302490		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr11:61291299C>A	ENST00000263846.4	-	7	1234	c.907G>T	c.(907-909)Gac>Tac	p.D303Y	SYT7_ENST00000539008.1_Splice_Site_p.D586Y|SYT7_ENST00000540677.1_Splice_Site_p.D378Y|SYT7_ENST00000540831.1_5'Flank|SYT7_ENST00000535826.1_Splice_Site_p.D422Y|SYT7_ENST00000542670.1_Splice_Site_p.D511Y|SYT7_ENST00000542836.1_Splice_Site_p.D347Y	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	303	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AGCCCCGTACCTGATGTGCCC	0.592													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17118	0.0		0.0	False		,,,				2504	0.0					.											0													264.0	253.0	257.0					11																	61291299		2202	4299	6501	SO:0001630	splice_region_variant	9066			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.907+1G>T	11.37:g.61291299C>A			F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.355550	0.82243	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826	T;T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45;-1.45	4.48	4.48	0.54585	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.93729	0.7996	H	0.97829	4.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96390	0.9288	9	.	.	.	.	17.5306	0.87813	0.0:1.0:0.0:0.0	.	378;303	F5GZU9;O43581	.;SYT7_HUMAN	Y	303;378;586;347;511;422	ENSP00000263846:D303Y;ENSP00000444201:D378Y;ENSP00000439694:D586Y;ENSP00000444568:D347Y;ENSP00000444019:D511Y;ENSP00000437720:D422Y	.	D	-	1	0	SYT7	61047875	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.760000	0.85248	2.192000	0.70111	0.462000	0.41574	GAC		0.592	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	Missense_Mutation
ITGA5	3678	broad.mit.edu	37	12	54812840	54812840	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr12:54812840G>T	ENST00000293379.4	-	1	404	c.143C>A	c.(142-144)gCc>gAc	p.A48D	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.3_ENST00000552053.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	48					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TACTGCTGGGGCCTCCGCGTC	0.706																																						.											0													13.0	19.0	17.0					12																	54812840		2110	4214	6324	SO:0001583	missense	3678				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.143C>A	12.37:g.54812840G>T	ENSP00000293379:p.Ala48Asp		Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699146	0.30142	.	.	ENSG00000161638	ENST00000293379	T	0.69685	-0.42	4.54	3.64	0.41730	.	0.339088	0.30959	N	0.008525	T	0.50411	0.1614	L	0.28400	0.85	0.38871	D	0.956695	B	0.32781	0.384	B	0.28305	0.088	T	0.53078	-0.8489	10	0.39692	T	0.17	.	10.6553	0.45671	0.0:0.1943:0.8057:0.0	.	48	P08648	ITA5_HUMAN	D	48	ENSP00000293379:A48D	ENSP00000293379:A48D	A	-	2	0	ITGA5	53099107	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	2.524000	0.45589	1.254000	0.44035	0.462000	0.41574	GCC		0.706	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
TBC1D15	64786	broad.mit.edu	37	12	72314554	72314554	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr12:72314554T>C	ENST00000550746.1	+	16	1758	c.1694T>C	c.(1693-1695)cTc>cCc	p.L565P	TBC1D15_ENST00000393309.3_Missense_Mutation_p.L319P|TBC1D15_ENST00000485960.2_Missense_Mutation_p.L548P|TBC1D15_ENST00000319106.8_Missense_Mutation_p.L556P	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	565					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CATCTTCTTCTCTGTTGTGCT	0.323																																						.											0													219.0	217.0	217.0					12																	72314554		2203	4300	6503	SO:0001583	missense	64786			AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.1694T>C	12.37:g.72314554T>C	ENSP00000448182:p.Leu565Pro		B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	ENST00000550746.1	37	CCDS31858.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.254728	0.80135	.	.	ENSG00000121749	ENST00000550746;ENST00000319106;ENST00000485960;ENST00000393309	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.49	5.49	0.81192	Rab-GAP/TBC domain (3);	0.214306	0.40385	N	0.001113	T	0.44664	0.1304	L	0.57536	1.79	0.80722	D	1	D;P;P	0.54397	0.966;0.913;0.912	P;P;P	0.59424	0.857;0.503;0.635	T	0.41016	-0.9532	10	0.87932	D	0	-0.4369	15.6355	0.76949	0.0:0.0:0.0:1.0	.	556;548;565	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	P	565;556;548;319	ENSP00000448182:L565P;ENSP00000318262:L556P;ENSP00000420678:L548P;ENSP00000376986:L319P	ENSP00000318262:L556P	L	+	2	0	TBC1D15	70600821	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.948000	0.87774	2.105000	0.64084	0.472000	0.43445	CTC		0.323	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351266.2	NM_022771	
DDX55	57696	broad.mit.edu;mdanderson.org	37	12	124092052	124092052	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr12:124092052A>G	ENST00000238146.4	+	4	370	c.320A>G	c.(319-321)aAg>aGg	p.K107R	DDX55_ENST00000538744.1_Missense_Mutation_p.K107R	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	107	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		CATTTCACGAAGCACTTCCCC	0.493																																						.											0													260.0	207.0	225.0					12																	124092052		2203	4300	6503	SO:0001583	missense	57696			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.320A>G	12.37:g.124092052A>G	ENSP00000238146:p.Lys107Arg		Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	ENST00000238146.4	37	CCDS9251.1	.	.	.	.	.	.	.	.	.	.	A	11.83	1.756016	0.31137	.	.	ENSG00000111364	ENST00000238146;ENST00000538449;ENST00000538744	T;T	0.18338	2.22;2.22	5.71	1.99	0.26369	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.152410	0.64402	N	0.000018	T	0.12603	0.0306	L	0.31845	0.965	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.09487	-1.0672	10	0.41790	T	0.15	.	9.837	0.40975	0.8026:0.0:0.1974:0.0	.	107	Q8NHQ9	DDX55_HUMAN	R	107	ENSP00000238146:K107R;ENSP00000443114:K107R	ENSP00000238146:K107R	K	+	2	0	DDX55	122658005	1.000000	0.71417	0.977000	0.42913	0.816000	0.46133	2.882000	0.48546	0.090000	0.17273	-0.400000	0.06385	AAG		0.493	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2		
HOMEZ	57594	broad.mit.edu	37	14	23745955	23745955	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr14:23745955T>C	ENST00000357460.5	-	2	646	c.482A>G	c.(481-483)gAg>gGg	p.E161G	HOMEZ_ENST00000431326.2_Missense_Mutation_p.E163G|HOMEZ_ENST00000561013.1_Missense_Mutation_p.E163G	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	161	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		ACCAACTTGCTCTGGAGCTGG	0.547																																						.											0													124.0	125.0	125.0					14																	23745955		1926	4139	6065	SO:0001583	missense	57594			AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.482A>G	14.37:g.23745955T>C	ENSP00000350049:p.Glu161Gly		A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Missense_Mutation	SNP	ENST00000357460.5	37	CCDS45085.1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.743102	0.30865	.	.	ENSG00000215271	ENST00000357460;ENST00000431326	T;T	0.27557	1.66;1.66	5.62	5.62	0.85841	.	0.212459	0.41396	D	0.000884	T	0.21921	0.0528	L	0.29908	0.895	0.09310	N	1	P;P	0.40731	0.728;0.608	B;B	0.39339	0.297;0.156	T	0.15636	-1.0430	10	0.24483	T	0.36	-24.2871	9.9553	0.41663	0.0:0.0:0.1703:0.8297	.	163;161	F8WCA3;Q8IX15	.;HOMEZ_HUMAN	G	161;163	ENSP00000350049:E161G;ENSP00000406579:E163G	ENSP00000350049:E161G	E	-	2	0	HOMEZ	22815795	0.232000	0.23762	0.990000	0.47175	0.964000	0.63967	1.454000	0.35178	2.159000	0.67721	0.533000	0.62120	GAG		0.547	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
DTWD1	56986	broad.mit.edu	37	15	49935536	49935536	+	Frame_Shift_Del	DEL	C	C	-	rs368454338		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr15:49935536delC	ENST00000251250.6	+	6	883	c.676delC	c.(676-678)caafs	p.Q226fs	DTWD1_ENST00000558653.1_Frame_Shift_Del_p.Q226fs|DTWD1_ENST00000403028.3_Frame_Shift_Del_p.Q226fs|DTWD1_ENST00000415425.1_Frame_Shift_Del_p.Q139fs	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	226										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		AGGGTTGTTACAAGTTGAGTT	0.299																																						.											0													20.0	21.0	21.0					15																	49935536		2190	4291	6481	SO:0001589	frameshift_variant	56986			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.676delC	15.37:g.49935536delC	ENSP00000251250:p.Gln226fs		Q567Q3|Q8WVG9|Q9NRU6	Frame_Shift_Del	DEL	ENST00000251250.6	37	CCDS10132.1																																																																																				0.299	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254431.2	NM_020234	
SIN3A	25942	broad.mit.edu	37	15	75682085	75682085	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr15:75682085A>G	ENST00000394947.3	-	16	3243	c.2929T>C	c.(2929-2931)Tca>Cca	p.S977P	SIN3A_ENST00000360439.4_Missense_Mutation_p.S977P|SIN3A_ENST00000394949.4_Missense_Mutation_p.S977P	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TCATACTGTGATGAGTCTATG	0.478																																						.											0													218.0	171.0	187.0					15																	75682085		2197	4294	6491	SO:0001583	missense	25942			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.2929T>C	15.37:g.75682085A>G	ENSP00000378402:p.Ser977Pro			Missense_Mutation	SNP	ENST00000394947.3	37	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.446218	0.63178	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.49139	0.79;0.79;0.79	5.78	5.78	0.91487	.	0.108661	0.64402	D	0.000004	T	0.39410	0.1077	L	0.50333	1.59	0.80722	D	1	P	0.37370	0.592	B	0.33339	0.162	T	0.31052	-0.9957	10	0.37606	T	0.19	-11.3245	10.5229	0.44929	0.8558:0.0:0.0:0.1442	.	977	Q96ST3	SIN3A_HUMAN	P	977	ENSP00000378402:S977P;ENSP00000378403:S977P;ENSP00000353622:S977P	ENSP00000353622:S977P	S	-	1	0	SIN3A	73469138	1.000000	0.71417	0.880000	0.34516	0.996000	0.88848	4.891000	0.63185	2.214000	0.71695	0.528000	0.53228	TCA		0.478	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
RFX1	5989	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	14076447	14076447	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:14076447G>A	ENST00000254325.4	-	15	2338	c.2104C>T	c.(2104-2106)Ccc>Tcc	p.P702S		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	702					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CTGGGGATGGGCCGCAGCACG	0.662																																						.											0													75.0	59.0	64.0					19																	14076447		2202	4300	6502	SO:0001583	missense	5989				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2104C>T	19.37:g.14076447G>A	ENSP00000254325:p.Pro702Ser			Missense_Mutation	SNP	ENST00000254325.4	37	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239777	0.79912	.	.	ENSG00000132005	ENST00000254325	T	0.07567	3.18	4.09	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.24890	0.0604	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.01781	-1.1275	10	0.29301	T	0.29	-27.3527	15.2377	0.73443	0.0:0.0:1.0:0.0	.	702	P22670	RFX1_HUMAN	S	702	ENSP00000254325:P702S	ENSP00000254325:P702S	P	-	1	0	RFX1	13937447	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.565000	0.98154	2.100000	0.63781	0.462000	0.41574	CCC		0.662	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
CYP4F2	8529	broad.mit.edu	37	19	16000303	16000303	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:16000303A>G	ENST00000221700.6	-	7	943	c.848T>C	c.(847-849)gTt>gCt	p.V283A	CYP4F2_ENST00000011989.7_Missense_Mutation_p.V134A	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GAAGTCATCAACACCCTGGCT	0.577																																						.											0													78.0	74.0	76.0					19																	16000303		2203	4300	6503	SO:0001583	missense	8529			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.848T>C	19.37:g.16000303A>G	ENSP00000221700:p.Val283Ala			Missense_Mutation	SNP	ENST00000221700.6	37	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	a	0.523	-0.861336	0.02610	.	.	ENSG00000186115	ENST00000221700;ENST00000392846;ENST00000011989	T;T	0.69806	-0.43;1.94	2.72	-1.14	0.09741	.	1.188650	0.06624	U	0.757982	T	0.47322	0.1439	L	0.33245	0.995	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.005	T	0.19745	-1.0296	10	0.11485	T	0.65	.	2.902	0.05708	0.5057:0.0:0.2878:0.2066	.	134;283	B4DV75;P78329	.;CP4F2_HUMAN	A	283;134;134	ENSP00000221700:V283A;ENSP00000011989:V134A	ENSP00000011989:V134A	V	-	2	0	CYP4F2	15861303	0.000000	0.05858	0.001000	0.08648	0.803000	0.45373	-0.291000	0.08343	-0.171000	0.10797	0.254000	0.18369	GTT		0.577	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
EHD2	30846	broad.mit.edu;bcgsc.ca	37	19	48220038	48220038	+	Missense_Mutation	SNP	G	G	A	rs34140460	byFrequency	TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:48220038G>A	ENST00000263277.3	+	2	420	c.169G>A	c.(169-171)Ggc>Agc	p.G57S	CTD-2571L23.8_ENST00000599924.1_lincRNA|EHD2_ENST00000538399.1_Intron	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	57	Dynamin-type G.		G -> S (in dbSNP:rs34140460).		blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		AGACTTCGACGGCAAGCCCAT	0.682													G|||	6	0.00119808	0.0045	0.0	5008	,	,		16363	0.0		0.0	False		,,,				2504	0.0					.											0								G	SER/GLY	16,4390	22.3+/-47.3	0,16,2187	38.0	31.0	33.0		169	2.7	1.0	19	dbSNP_126	33	0,8600		0,0,4300	yes	missense	EHD2	NM_014601.3	56	0,16,6487	AA,AG,GG		0.0,0.3631,0.123	benign	57/544	48220038	16,12990	2203	4300	6503	SO:0001583	missense	30846			AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.169G>A	19.37:g.48220038G>A	ENSP00000263277:p.Gly57Ser		B2RDH9|B4DNU6|Q96CB6	Missense_Mutation	SNP	ENST00000263277.3	37	CCDS12704.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	11.14	1.551905	0.27739	0.003631	0.0	ENSG00000024422	ENST00000263277;ENST00000539439;ENST00000540364	D	0.95342	-3.68	3.75	2.7	0.31948	.	0.182929	0.46758	N	0.000267	T	0.75946	0.3919	N	0.02539	-0.55	0.80722	D	1	B	0.11235	0.004	B	0.08055	0.003	T	0.68938	-0.5277	10	0.17369	T	0.5	-30.8741	6.1058	0.20073	0.2377:0.0:0.7623:0.0	rs34140460	57	Q9NZN4	EHD2_HUMAN	S	57	ENSP00000263277:G57S	ENSP00000263277:G57S	G	+	1	0	EHD2	52911850	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.462000	0.53042	0.931000	0.37242	0.407000	0.27541	GGC		0.682	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465851.1		
TTLL1	25809	broad.mit.edu	37	22	43459837	43459837	+	Silent	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr22:43459837G>A	ENST00000266254.7	-	7	969	c.729C>T	c.(727-729)gtC>gtT	p.V243V	TTLL1_ENST00000331018.7_Silent_p.V243V	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	243	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TCTGGATGGCGACGTTGGTGA	0.532																																						.											0													219.0	189.0	199.0					22																	43459837		2203	4300	6503	SO:0001819	synonymous_variant	25809			AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.729C>T	22.37:g.43459837G>A			B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Silent	SNP	ENST00000266254.7	37	CCDS14043.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241791	0.22711	.	.	ENSG00000100271	ENST00000495814	.	.	.	5.98	-12.0	0.00017	.	.	.	.	.	T	0.40815	0.1132	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52041	-0.8628	4	.	.	.	.	5.8419	0.18639	0.4626:0.2157:0.2617:0.06	.	.	.	.	L	169	.	.	S	-	2	0	TTLL1	41789781	0.019000	0.18553	0.798000	0.32154	0.939000	0.58152	-0.794000	0.04584	-1.237000	0.02539	-0.964000	0.02622	TCG		0.532	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319659.1	NM_012263	
NBEAL2	23218	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	47041771	47041771	+	Silent	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:47041771G>A	ENST00000450053.3	+	27	4361	c.4182G>A	c.(4180-4182)ggG>ggA	p.G1394G	NBEAL2_ENST00000292309.5_Silent_p.G1210G|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1394					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CACTGGATGGGCCGCGGCCCT	0.642																																						.											0													23.0	28.0	26.0					3																	47041771		2074	4213	6287	SO:0001819	synonymous_variant	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.4182G>A	3.37:g.47041771G>A			O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	G	2.245	-0.372895	0.05034	.	.	ENSG00000160796	ENST00000416683	T	0.56611	0.45	5.48	1.58	0.23477	.	0.554048	0.19794	N	0.105905	T	0.46425	0.1392	.	.	.	0.51482	D	0.999921	.	.	.	.	.	.	T	0.31194	-0.9952	7	0.38643	T	0.18	.	2.157	0.03814	0.1597:0.2694:0.4148:0.1562	.	.	.	.	D	682	ENSP00000410405:G682D	ENSP00000410405:G682D	G	+	2	0	NBEAL2	47016775	0.927000	0.31430	0.985000	0.45067	0.362000	0.29581	0.410000	0.21098	0.006000	0.14734	-0.397000	0.06425	GGC		0.642	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
BSN	8927	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	49691694	49691694	+	Missense_Mutation	SNP	A	A	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:49691694A>T	ENST00000296452.4	+	5	4819	c.4705A>T	c.(4705-4707)Acc>Tcc	p.T1569S		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1569					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CTCCAGCCAGACCAGGATGGT	0.607																																						.											0													81.0	80.0	81.0					3																	49691694		2203	4300	6503	SO:0001583	missense	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.4705A>T	3.37:g.49691694A>T	ENSP00000296452:p.Thr1569Ser		O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.014371	0.35511	.	.	ENSG00000164061	ENST00000296452	T	0.20200	2.09	5.47	4.3	0.51218	.	0.221290	0.46758	D	0.000272	T	0.19208	0.0461	L	0.50333	1.59	0.40821	D	0.983501	B	0.27229	0.172	B	0.24155	0.051	T	0.03761	-1.1006	10	0.29301	T	0.29	.	11.1166	0.48264	0.9274:0.0:0.0726:0.0	.	1569	Q9UPA5	BSN_HUMAN	S	1569	ENSP00000296452:T1569S	ENSP00000296452:T1569S	T	+	1	0	BSN	49666698	1.000000	0.71417	0.992000	0.48379	0.923000	0.55619	1.847000	0.39299	0.917000	0.36895	0.379000	0.24179	ACC		0.607	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
TIGIT	201633	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	114018494	114018494	+	Missense_Mutation	SNP	G	G	A	rs369133784		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:114018494G>A	ENST00000486257.1	+	4	699	c.442G>A	c.(442-444)Gcg>Acg	p.A148T	TIGIT_ENST00000383671.3_Missense_Mutation_p.A148T|TIGIT_ENST00000481065.1_Missense_Mutation_p.A215T			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	148					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						AGCCATGGCCGCGACGCTGGT	0.582																																						.											0								G	THR/ALA	0,4406		0,0,2203	91.0	76.0	81.0		442	-8.2	0.0	3		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	TIGIT	NM_173799.3	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	148/245	114018494	1,13005	2203	4300	6503	SO:0001583	missense	201633			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.442G>A	3.37:g.114018494G>A	ENSP00000419085:p.Ala148Thr		Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	ENST00000486257.1	37	CCDS2980.1	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.340308	0.01277	0.0	1.16E-4	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.56611	0.51;0.45;0.49;0.49;0.51	4.09	-8.19	0.01049	.	1.743640	0.02883	N	0.133134	T	0.29190	0.0726	N	0.17082	0.46	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.29882	-0.9997	10	0.07813	T	0.8	4.6473	8.6741	0.34167	0.1485:0.0:0.5321:0.3194	.	148	Q495A1	TIGIT_HUMAN	T	127;215;148;148;127	ENSP00000418917:A127T;ENSP00000420552:A215T;ENSP00000419085:A148T;ENSP00000373167:A148T;ENSP00000419706:A127T	ENSP00000373167:A148T	A	+	1	0	TIGIT	115501184	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.907000	0.00700	-2.557000	0.00476	-1.140000	0.01884	GCG		0.582	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354690.1	NM_173799	
KLF15	28999	broad.mit.edu	37	3	126071789	126071789	+	5'UTR	SNP	G	G	A	rs574970685		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:126071789G>A	ENST00000296233.3	-	0	207				KLF15_ENST00000509675.1_5'UTR	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15						cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		TGCCGGTGGCGGCTGCAGGAA	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17468	0.0		0.0	False		,,,				2504	0.0					.											0													24.0	22.0	23.0					3																	126071789		2198	4293	6491	SO:0001623	5_prime_UTR_variant	28999			AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.-24C>T	3.37:g.126071789G>A				Splice_Site	SNP	ENST00000296233.3	37	CCDS3036.1																																																																																				0.622	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
TNK2	10188	broad.mit.edu	37	3	195594314	195594314	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:195594314delG	ENST00000333602.6	-	12	3427	c.2810delC	c.(2809-2811)ccgfs	p.P937fs	TNK2_ENST00000428187.1_Frame_Shift_Del_p.P969fs|TNK2_ENST00000392400.1_Frame_Shift_Del_p.P937fs|TNK2_ENST00000381916.2_Frame_Shift_Del_p.P1015fs	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	937	Pro-rich.			Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	AGTGGCCCTCGGGGGTGGTGG	0.716																																						.											0													7.0	10.0	9.0					3																	195594314		2037	4141	6178	SO:0001589	frameshift_variant	10188			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.2810delC	3.37:g.195594314delG	ENSP00000329425:p.Pro937fs		Q6ZMQ0|Q8N6U7|Q96H59	Frame_Shift_Del	DEL	ENST00000333602.6	37	CCDS33928.1																																																																																				0.716	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
PPP1R11	6992	broad.mit.edu	37	6	30035207	30035207	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr6:30035207G>A	ENST00000376772.3	+	1	343	c.20G>A	c.(19-21)gGg>gAg	p.G7E	PPP1R11_ENST00000376765.2_5'Flank|PPP1R11_ENST00000376769.2_5'UTR|PPP1R11_ENST00000376763.1_5'Flank|PPP1R11_ENST00000376773.1_Intron|PPP1R11_ENST00000376758.1_5'Flank	NM_021959.2	NP_068778.1	O60927	PP1RB_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 11	7						cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			lung(2)|ovary(1)|prostate(1)|skin(2)	6						GCAGGGGCTGGGCTGAGCGAG	0.607																																					Pancreas(185;1767 3918 43793)	.											0													57.0	56.0	56.0					6																	30035207		2203	4300	6503	SO:0001583	missense	6992			X81003	CCDS4671.1	6p21.3	2012-04-17			ENSG00000204619	ENSG00000204619		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9285	protein-coding gene	gene with protein product		606670		TCTE5		9843442, 8781118	Standard	NM_021959		Approved	HCGV, Tctex5, HCG-V	uc003npb.3	O60927	OTTHUMG00000031260	ENST00000376772.3:c.20G>A	6.37:g.30035207G>A	ENSP00000365963:p.Gly7Glu			Missense_Mutation	SNP	ENST00000376772.3	37	CCDS4671.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097254	0.56075	.	.	ENSG00000204619	ENST00000376772	.	.	.	5.15	5.15	0.70609	.	0.189098	0.45361	D	0.000364	T	0.22742	0.0549	N	0.14661	0.345	0.80722	D	1	B	0.18863	0.031	B	0.13407	0.009	T	0.08249	-1.0731	9	0.15499	T	0.54	-0.3005	13.998	0.64414	0.0:0.0:1.0:0.0	.	7	O60927	PP1RB_HUMAN	E	7	.	ENSP00000365963:G7E	G	+	2	0	PPP1R11	30143186	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	4.711000	0.61881	2.683000	0.91414	0.643000	0.83706	GGG		0.607	PPP1R11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076557.3	NM_021959	
EYA1	2138	broad.mit.edu;mdanderson.org;bcgsc.ca	37	8	72211306	72211306	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr8:72211306G>T	ENST00000340726.3	-	9	1441	c.802C>A	c.(802-804)Caa>Aaa	p.Q268K	EYA1_ENST00000419131.1_Missense_Mutation_p.Q263K|EYA1_ENST00000303824.7_Missense_Mutation_p.Q262K|EYA1_ENST00000388742.4_Missense_Mutation_p.Q268K|EYA1_ENST00000388740.3_Missense_Mutation_p.Q235K|EYA1_ENST00000388743.2_Missense_Mutation_p.Q267K|EYA1_ENST00000388741.2_Missense_Mutation_p.Q234K	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	268					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GTAACTGCTTGGCTGGTGATG	0.433																																						.											0													225.0	194.0	204.0					8																	72211306		2203	4300	6503	SO:0001583	missense	2138			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.802C>A	8.37:g.72211306G>T	ENSP00000342626:p.Gln268Lys		A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	37	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907619	0.72868	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	D;D;D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.88926	0.6570	L	0.61218	1.895	0.80722	D	1	P;B;P;P;B	0.50369	0.934;0.321;0.516;0.934;0.0	D;B;B;D;B	0.66351	0.943;0.205;0.281;0.943;0.004	D	0.84403	0.0561	10	0.13853	T	0.58	-4.204	19.38	0.94529	0.0:0.0:1.0:0.0	.	262;195;235;268;263	A6NCB9;Q0P517;Q99502-2;Q99502;G5E9R4	.;.;.;EYA1_HUMAN;.	K	268;268;236;235;262;234;267;263	ENSP00000373394:Q268K;ENSP00000342626:Q268K;ENSP00000373392:Q235K;ENSP00000303221:Q262K;ENSP00000373393:Q234K;ENSP00000373395:Q267K;ENSP00000410176:Q263K	ENSP00000303221:Q262K	Q	-	1	0	EYA1	72373860	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.654000	0.90174	0.585000	0.79938	CAA		0.433	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
TLE1	7088	broad.mit.edu	37	9	84199172	84199172	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr9:84199172T>C	ENST00000376499.3	-	20	3318	c.2254A>G	c.(2254-2256)Aag>Gag	p.K752E		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	752					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						ACTATGTACTTATCATCCACA	0.423																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	.											0													140.0	128.0	132.0					9																	84199172		2203	4300	6503	SO:0001583	missense	7088				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.2254A>G	9.37:g.84199172T>C	ENSP00000365682:p.Lys752Glu		A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	t	29.1	4.976325	0.92982	.	.	ENSG00000196781	ENST00000376499	T	0.11712	2.75	5.14	5.14	0.70334	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.100652	0.64402	D	0.000002	T	0.29256	0.0728	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.70716	0.97;0.901	T	0.01165	-1.1431	10	0.87932	D	0	-20.0631	15.415	0.74960	0.0:0.0:0.0:1.0	.	737;752	B4DEF9;Q04724	.;TLE1_HUMAN	E	752	ENSP00000365682:K752E	ENSP00000365682:K752E	K	-	1	0	TLE1	83388992	1.000000	0.71417	0.983000	0.44433	0.999000	0.98932	7.800000	0.85949	2.281000	0.76405	0.533000	0.62120	AAG		0.423	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
OR1L1	26737	broad.mit.edu	37	9	125424320	125424320	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr9:125424320A>G	ENST00000373686.1	+	1	476	c.476A>G	c.(475-477)aAc>aGc	p.N159S	OR1L1_ENST00000309623.1_Missense_Mutation_p.N109S			Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L, member 1	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)	17						GCCTTTGGAAACACAGACAGT	0.448																																						.											0													223.0	212.0	216.0					9																	125424320		2203	4300	6503	SO:0001583	missense	26737				CCDS35127.1, CCDS35127.2	9q33.2	2013-09-20			ENSG00000173679	ENSG00000173679		"""GPCR / Class A : Olfactory receptors"""	8213	protein-coding gene	gene with protein product				OR1L2			Standard	NM_001005236		Approved	OR9-C	uc022bmz.1	Q8NH94	OTTHUMG00000020618	ENST00000373686.1:c.476A>G	9.37:g.125424320A>G	ENSP00000362790:p.Asn159Ser		Q5T7Z3|Q6IFN2	Missense_Mutation	SNP	ENST00000373686.1	37		.	.	.	.	.	.	.	.	.	.	A	16.37	3.105085	0.56291	.	.	ENSG00000173679	ENST00000373686;ENST00000309623	T;T	0.02863	4.13;4.13	3.11	0.772	0.18510	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01940	0.0061	N	0.02225	-0.63	0.09310	N	1	D	0.53462	0.96	P	0.54174	0.744	T	0.47100	-0.9143	9	0.23891	T	0.37	.	3.1547	0.06500	0.4118:0.2383:0.3498:0.0	.	159	Q8NH94	OR1L1_HUMAN	S	159;109	ENSP00000362790:N159S;ENSP00000310773:N109S	ENSP00000310773:N109S	N	+	2	0	OR1L1	124464141	0.000000	0.05858	0.001000	0.08648	0.806000	0.45545	-1.143000	0.03200	0.394000	0.25230	0.260000	0.18958	AAC		0.448	OR1L1-201	KNOWN	basic	protein_coding	protein_coding			
ABL1	25	broad.mit.edu;mdanderson.org;bcgsc.ca	37	9	133748274	133748274	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr9:133748274A>G	ENST00000318560.5	+	6	1316	c.935A>G	c.(934-936)tAt>tGt	p.Y312C		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	312	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CCCCCGTTCTATATCATCACT	0.552			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																	.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	0													82.0	82.0	82.0					9																	133748274		2203	4300	6503	SO:0001583	missense	25			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.935A>G	9.37:g.133748274A>G	ENSP00000323315:p.Tyr312Cys		A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	ENST00000318560.5	37	CCDS35166.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.841408	0.91197	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	T;T	0.65178	-0.14;-0.14	6.04	6.04	0.98038	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66519	0.2797	N	0.15975	0.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72659	-0.4226	10	0.87932	D	0	.	15.7697	0.78157	1.0:0.0:0.0:0.0	.	312;349	P00519;Q59FK4	ABL1_HUMAN;.	C	127;331;312	ENSP00000361423:Y331C;ENSP00000323315:Y312C	ENSP00000323315:Y312C	Y	+	2	0	ABL1	132738095	1.000000	0.71417	0.986000	0.45419	0.873000	0.50193	9.339000	0.96797	2.317000	0.78254	0.460000	0.39030	TAT		0.552	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
LCN10	414332	broad.mit.edu	37	9	139636409	139636409	+	Missense_Mutation	SNP	C	C	T	rs373041848		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr9:139636409C>T	ENST00000474369.1	-	2	180	c.181G>A	c.(181-183)Gac>Aac	p.D61N	LCN6_ENST00000471509.1_5'Flank|LCN6_ENST00000435202.1_3'UTR|LCN6_ENST00000480584.1_5'UTR|LCN10_ENST00000527229.1_Missense_Mutation_p.D61N|LCN10_ENST00000497771.1_Missense_Mutation_p.D61N			Q6JVE6	LCN10_HUMAN	lipocalin 10	61					transport (GO:0006810)	extracellular region (GO:0005576)				breast(2)|cervix(1)|large_intestine(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		TTCCTCTTGTCCCTGGCCGGC	0.647																																						.											0									ASN/ASP	0,4402		0,0,2201	52.0	44.0	47.0		181	1.0	0.1	9		47	1,8599	1.2+/-3.3	0,1,4299	no	missense	LCN10	NM_001001712.2	23	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	61/201	139636409	1,13001	2201	4300	6501	SO:0001583	missense	414332			AY301271	CCDS35182.2	9q34.3	2011-10-24			ENSG00000187922	ENSG00000187922		"""Lipocalins"""	20892	protein-coding gene	gene with protein product		612904				15363845	Standard	NM_001001712		Approved		uc004civ.3	Q6JVE6	OTTHUMG00000150428	ENST00000474369.1:c.181G>A	9.37:g.139636409C>T	ENSP00000420564:p.Asp61Asn		A2RUU3|B0QZ79	Missense_Mutation	SNP	ENST00000474369.1	37	CCDS35182.2	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288725	0.59976	0.0	1.16E-4	ENSG00000187922	ENST00000527229;ENST00000497771;ENST00000474369	T;T;T	0.12039	2.72;2.72;2.72	4.07	1.03	0.20045	Calycin-like (1);Calycin (1);	0.982436	0.08310	N	0.965576	T	0.12561	0.0305	.	.	.	0.09310	N	1	P;P;P	0.46784	0.884;0.884;0.884	B;B;B	0.43103	0.408;0.408;0.408	T	0.25606	-1.0127	9	0.48119	T	0.1	-5.8772	5.5735	0.17210	0.0:0.4825:0.4041:0.1134	.	61;61;61	E9PK15;Q6JVE6;Q6JVE6-2	.;LCN10_HUMAN;.	N	61	ENSP00000431726:D61N;ENSP00000418491:D61N;ENSP00000420564:D61N	ENSP00000435948:D61N	D	-	1	0	LCN10	138756230	0.094000	0.21725	0.088000	0.20740	0.757000	0.42996	0.802000	0.27069	0.413000	0.25759	0.552000	0.68991	GAC		0.647	LCN10-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318062.2	NM_001001712	
AMPD3	272	ucsc.edu	37	11	10506508	10506508	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr11:10506508A>G	ENST00000396554.3	+	5	1099	c.758A>G	c.(757-759)cAc>cGc	p.H253R	AMPD3_ENST00000444303.2_Missense_Mutation_p.H85R	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	244					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CAGGAGCCGCACAGCCTACCC	0.582																																						.											0													88.0	77.0	81.0					11																	10506508		2201	4294	6495	SO:0001583	missense	272			M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.758A>G	11.37:g.10506508A>G	ENSP00000379802:p.His253Arg		A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	ENST00000396554.3	37	CCDS7802.1	.	.	.	.	.	.	.	.	.	.	A	12.82	2.053576	0.36277	.	.	ENSG00000133805	ENST00000444303;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	5.97	4.85	0.62838	.	0.089199	0.85682	D	0.000000	T	0.74935	0.3782	N	0.04705	-0.18	0.35951	D	0.833941	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.69859	-0.5031	10	0.20519	T	0.43	-32.6972	3.4323	0.07433	0.6868:0.0:0.3132:0.0	.	251;244;253	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	R	85;253;244;244;251;244	ENSP00000396000:H85R;ENSP00000379802:H253R;ENSP00000433284:H244R;ENSP00000379801:H244R;ENSP00000436987:H251R;ENSP00000431648:H244R	ENSP00000379801:H244R	H	+	2	0	AMPD3	10463084	0.999000	0.42202	1.000000	0.80357	0.970000	0.65996	1.627000	0.37050	2.288000	0.76882	0.533000	0.62120	CAC		0.582	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480	
CCT7	10574	ucsc.edu	37	2	73467611	73467611	+	Silent	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr2:73467611T>C	ENST00000258091.5	+	3	348	c.207T>C	c.(205-207)ctT>ctC	p.L69L	CCT7_ENST00000398422.2_Intron|CCT7_ENST00000539919.1_Silent_p.L25L|CCT7_ENST00000538797.1_5'UTR|CCT7_ENST00000537131.1_Intron|CCT7_ENST00000473786.1_Intron|CCT7_ENST00000540468.1_Intron	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	69					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						TGAAACTTCTTGATGTTGTCC	0.383																																						.											0													119.0	111.0	114.0					2																	73467611		1858	4101	5959	SO:0001819	synonymous_variant	10574			AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.207T>C	2.37:g.73467611T>C			A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Silent	SNP	ENST00000258091.5	37	CCDS46336.1																																																																																				0.383	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		
CDH23	64072	ucsc.edu	37	10	73572329	73572329	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr10:73572329A>G	ENST00000224721.6	+	66	9493	c.9488A>G	c.(9487-9489)gAg>gGg	p.E3163G	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.E918G	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	3158					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AACCTGAGTGAGATCGCCGAC	0.637																																						.											0													57.0	63.0	61.0					10																	73572329		2012	4177	6189	SO:0001583	missense	64072			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.9488A>G	10.37:g.73572329A>G	ENSP00000224721:p.Glu3163Gly		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	A	20.7	4.034027	0.75504	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.80994	-1.44	5.44	5.44	0.79542	.	0.061549	0.64402	D	0.000004	D	0.85089	0.5617	L	0.36672	1.1	0.58432	D	0.999997	D;D;P;P	0.69078	0.992;0.997;0.651;0.651	P;D;B;B	0.77557	0.813;0.99;0.115;0.115	D	0.86393	0.1737	10	0.62326	D	0.03	.	15.6681	0.77247	1.0:0.0:0.0:0.0	.	55;55;3158;3158	Q5QGS5;Q5QGS6;E9PEX1;Q9H251	.;.;.;CAD23_HUMAN	G	3163;3158;3161;918	ENSP00000381768:E918G	ENSP00000224721:E3163G	E	+	2	0	CDH23	73242335	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	9.100000	0.94213	2.288000	0.76882	0.533000	0.62120	GAG		0.637	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
CLEC4G	339390	ucsc.edu	37	19	7796207	7796207	+	Splice_Site	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:7796207T>C	ENST00000328853.5	-	3	235		c.e3-2		CLEC4G_ENST00000598081.1_5'UTR	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G							integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						CCGTGGAGGCTGAGGAGAGAG	0.751																																					Esophageal Squamous(146;540 1807 3349 19438 30853)	.											0													6.0	6.0	6.0					19																	7796207		2130	4188	6318	SO:0001630	splice_region_variant	339390			AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.167-2A>G	19.37:g.7796207T>C				Splice_Site	SNP	ENST00000328853.5	37	CCDS12185.1	.	.	.	.	.	.	.	.	.	.	T	14.07	2.427072	0.43122	.	.	ENSG00000182566	ENST00000328853	.	.	.	3.47	3.47	0.39725	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6526	0.34044	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLEC4G	7702207	0.996000	0.38824	0.935000	0.37517	0.179000	0.23085	1.767000	0.38501	1.801000	0.52704	0.454000	0.30748	.		0.751	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461989.1	NM_198492	Intron
MCM3AP	8888	ucsc.edu	37	21	47697480	47697480	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr21:47697480A>G	ENST00000397708.1	-	6	2073	c.1819T>C	c.(1819-1821)Tac>Cac	p.Y607H	MCM3AP_ENST00000291688.1_Missense_Mutation_p.Y607H			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	607					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AGCAGGCGGTACTTCTCCTTG	0.592																																						.											0													163.0	132.0	143.0					21																	47697480		2203	4300	6503	SO:0001583	missense	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1819T>C	21.37:g.47697480A>G	ENSP00000380820:p.Tyr607His		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.927853	0.92389	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.04706	3.57;3.57	5.74	5.74	0.90152	.	0.057126	0.64402	D	0.000001	T	0.19886	0.0478	M	0.68952	2.095	0.58432	D	0.999999	D	0.71674	0.998	D	0.78314	0.991	T	0.00189	-1.1938	10	0.45353	T	0.12	-19.4308	16.0421	0.80691	1.0:0.0:0.0:0.0	.	607	O60318	MCM3A_HUMAN	H	607	ENSP00000380820:Y607H;ENSP00000291688:Y607H	ENSP00000291688:Y607H	Y	-	1	0	MCM3AP	46521908	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.131000	0.94446	2.192000	0.70111	0.533000	0.62120	TAC		0.592	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
ARHGAP8	23779	ucsc.edu	37	22	45243892	45243892	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr22:45243892T>C	ENST00000389774.2	+	10	944	c.803T>C	c.(802-804)gTg>gCg	p.V268A	ARHGAP8_ENST00000356099.6_Missense_Mutation_p.V237A|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.V359A|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.V447A|ARHGAP8_ENST00000336963.4_Missense_Mutation_p.V237A|PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.V368A|PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.V447A	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	268	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		TCCGCCAGCGTGCAGACCGTC	0.662																																						.											0													66.0	58.0	61.0					22																	45243892		2203	4300	6503	SO:0001583	missense	553158			AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.803T>C	22.37:g.45243892T>C	ENSP00000374424:p.Val268Ala		A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000389774.2	37	CCDS33664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.592|2.592	-0.294895|-0.294895	0.05568|0.05568	.|.	.|.	ENSG00000248405|ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484	ENST00000515632|ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773;ENST00000389774;ENST00000336963;ENST00000356099	.|T;T;T;T;T;T;T	.|0.16324	.|2.35;2.35;2.35;2.35;2.35;2.35;2.35	4.67|4.67	-0.485|-0.485	0.12067|0.12067	.|Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.|0.215683	.|0.23077	.|N	.|0.052192	T|T	0.06234|0.06234	0.0161|0.0161	N|N	0.05306|0.05306	-0.075|-0.075	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B;B	.|0.15930	.|0.001;0.001;0.012;0.001;0.001;0.001;0.015	.|B;B;B;B;B;B;B	.|0.19946	.|0.008;0.008;0.011;0.002;0.012;0.01;0.027	T|T	0.42531|0.42531	-0.9446|-0.9446	5|10	.|0.09843	.|T	.|0.71	.|.	8.0784|8.0784	0.30731|0.30731	0.0:0.5089:0.0:0.4911|0.0:0.5089:0.0:0.4911	.|.	.|273;237;273;268;278;447;368	.|B7ZMA4;A6ZJ79;A2RU51;P85298;Q6PCC7;B1AHC4;B1AHC3	.|.;.;.;RHG08_HUMAN;.;.;.	R|A	291|368;447;447;359;268;237;237	.|ENSP00000354732:V368A;ENSP00000262731:V447A;ENSP00000429240:V447A;ENSP00000374423:V359A;ENSP00000374424:V268A;ENSP00000337287:V237A;ENSP00000348407:V237A	.|ENSP00000337287:V237A	C|V	+|+	1|2	0|0	PRR5-ARHGAP8|PRR5-ARHGAP8;ARHGAP8	43622556|43622556	0.208000|0.208000	0.23494|0.23494	0.002000|0.002000	0.10522|0.10522	0.092000|0.092000	0.18411|0.18411	1.180000|1.180000	0.32005|0.32005	-0.310000|-0.310000	0.08766|0.08766	-0.253000|-0.253000	0.11424|0.11424	TGC|GTG		0.662	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
CTC-497E21.3	0	ucsc.edu	37	11	13032159	13032159	+	lincRNA	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr11:13032159C>T	ENST00000533002.1	-	0	0																											GCTGGAGCGCCTTTCAGCCGA	0.706																																						.											0													7.0	9.0	8.0					11																	13032159		1893	4089	5982			644943																															11.37:g.13032159C>T				Missense_Mutation	SNP	ENST00000533002.1	37																																																																																					0.706	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
RSPH6A	81492	ucsc.edu	37	19	46318402	46318402	+	Silent	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:46318402A>G	ENST00000221538.3	-	1	175	c.33T>C	c.(31-33)ccT>ccC	p.P11P	RSPH6A_ENST00000597055.1_Silent_p.P11P|SYMPK_ENST00000598155.1_5'Flank	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	11						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GCTGCTGGGCAGGGCGCTCAG	0.677																																						.											0													12.0	13.0	13.0					19																	46318402		2190	4279	6469	SO:0001819	synonymous_variant	81492			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.33T>C	19.37:g.46318402A>G			Q53FE2|Q6PEZ9	Silent	SNP	ENST00000221538.3	37	CCDS12675.1																																																																																				0.677	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
SNX25	83891	ucsc.edu;mdanderson.org;bcgsc.ca	37	4	186283807	186283807	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr4:186283807G>A	ENST00000504273.1	+	18	2678	c.2384G>A	c.(2383-2385)gGt>gAt	p.G795D	SNX25_ENST00000264694.8_Missense_Mutation_p.G795D|SNX25_ENST00000512853.1_3'UTR			Q9H3E2	SNX25_HUMAN	sorting nexin 25	795					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GCCCGCCACGGTATAATAAAA	0.383																																						.											0													152.0	168.0	163.0					4																	186283807		2203	4300	6503	SO:0001583	missense	83891			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.2384G>A	4.37:g.186283807G>A	ENSP00000426255:p.Gly795Asp		Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490916	0.84962	.	.	ENSG00000109762	ENST00000504273;ENST00000264694;ENST00000264693	T;T	0.36157	1.27;1.27	5.09	4.22	0.49857	Sorting nexin, C-terminal (1);	0.108154	0.64402	D	0.000005	T	0.64918	0.2642	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.991;1.0;0.993	T	0.72077	-0.4399	10	0.87932	D	0	-17.0607	15.7978	0.78424	0.0:0.1355:0.8645:0.0	.	511;328;795	Q8N6K3;Q9H5Q8;Q9H3E2	.;.;SNX25_HUMAN	D	795;795;328	ENSP00000426255:G795D;ENSP00000264694:G795D	ENSP00000264693:G328D	G	+	2	0	SNX25	186520801	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	8.748000	0.91615	2.667000	0.90743	0.561000	0.74099	GGT		0.383	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360756.1	NM_031953	
SP8	221833	ucsc.edu	37	7	20824901	20824901	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr7:20824901A>G	ENST00000361443.4	-	3	718	c.481T>C	c.(481-483)Ttc>Ctc	p.F161L	SP8_ENST00000418710.2_Missense_Mutation_p.F179L	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	161					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						TTGGAGATGAACACCGGCTGG	0.726																																						.											0													5.0	6.0	6.0					7																	20824901		1660	3287	4947	SO:0001583	missense	221833				CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.481T>C	7.37:g.20824901A>G	ENSP00000354482:p.Phe161Leu		Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.757824	0.31137	.	.	ENSG00000164651	ENST00000297210;ENST00000418710;ENST00000361443	T;T	0.08896	3.04;3.07	3.26	3.26	0.37387	.	0.000000	0.85682	U	0.000000	T	0.05593	0.0147	L	0.33093	0.98	0.48185	D	0.999604	B;B	0.31837	0.342;0.342	B;B	0.24848	0.056;0.056	T	0.30765	-0.9967	10	0.09338	T	0.73	.	11.4081	0.49911	1.0:0.0:0.0:0.0	.	161;161	Q7Z615;Q8IXZ3	.;SP8_HUMAN	L	137;179;161	ENSP00000408792:F179L;ENSP00000354482:F161L	ENSP00000297210:F137L	F	-	1	0	SP8	20791426	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	4.629000	0.61290	1.355000	0.45865	0.260000	0.18958	TTC		0.726	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
ZBTB48	3104	ucsc.edu	37	1	6646821	6646821	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr1:6646821T>C	ENST00000377674.4	+	5	1269	c.1111T>C	c.(1111-1113)Tct>Cct	p.S371P		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	371					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		GCACATGGTGTCTCACACAGG	0.632																																					Esophageal Squamous(125;1449 1657 4031 29866 49542)	.											0													94.0	69.0	78.0					1																	6646821		2203	4300	6503	SO:0001583	missense	3104			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.1111T>C	1.37:g.6646821T>C	ENSP00000366902:p.Ser371Pro		Q5SY19	Missense_Mutation	SNP	ENST00000377674.4	37	CCDS84.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.755996	0.69648	.	.	ENSG00000204859	ENST00000377674;ENST00000545645	T	0.19105	2.17	5.62	4.47	0.54385	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.148877	0.64402	D	0.000006	T	0.35008	0.0917	L	0.49256	1.55	0.44635	D	0.997611	P	0.47841	0.901	P	0.57548	0.823	T	0.05801	-1.0863	10	0.72032	D	0.01	-36.1725	12.3143	0.54946	0.0:0.0:0.1416:0.8583	.	371	P10074	ZBT48_HUMAN	P	371;9	ENSP00000366902:S371P	ENSP00000366902:S371P	S	+	1	0	ZBTB48	6569408	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.631000	0.37092	1.053000	0.40415	0.459000	0.35465	TCT		0.632	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004193.1	NM_005341	
ZNF676	163223	ucsc.edu;mdanderson.org	37	19	22363307	22363307	+	Silent	SNP	T	T	C	rs112075209		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:22363307T>C	ENST00000397121.2	-	3	1529	c.1212A>G	c.(1210-1212)tcA>tcG	p.S404S		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GCTTTGAGGATGAGTTGGAAG	0.433																																						.											0													80.0	82.0	81.0					19																	22363307		2141	4267	6408	SO:0001819	synonymous_variant	163223			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1212A>G	19.37:g.22363307T>C			A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																				0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
FRG1B	284802	mdanderson.org	37	20	29628282	29628282	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr20:29628282G>A	ENST00000278882.3	+	6	664	c.284G>A	c.(283-285)gGg>gAg	p.G95E	FRG1B_ENST00000358464.4_Missense_Mutation_p.G95E|FRG1B_ENST00000439954.2_Missense_Mutation_p.G100E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATGAAGCAGGGGACATAGAA	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.284G>A	20.37:g.29628282G>A	ENSP00000278882:p.Gly95Glu		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.02	3.529440	0.64860	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56103	0.48	2.08	2.08	0.27032	Actin cross-linking (1);	0.051750	0.85682	D	0.000000	T	0.52092	0.1713	.	.	.	0.58432	D	0.999996	B;P	0.39940	0.309;0.696	P;P	0.46543	0.492;0.52	T	0.54221	-0.8326	9	0.45353	T	0.12	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	100;95	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	E	95;100;95	ENSP00000408863:G100E	ENSP00000278882:G95E	G	+	2	0	FRG1B	28241943	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GGG		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
LILRA3	11026	mdanderson.org	37	19	54802554	54802554	+	Missense_Mutation	SNP	G	G	C	rs114004709	byFrequency	TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr19:54802554G>C	ENST00000251390.3	-	5	978	c.887C>G	c.(886-888)aCa>aGa	p.T296R	LILRA3_ENST00000391745.1_Missense_Mutation_p.T313R|LILRA3_ENST00000391744.3_Missense_Mutation_p.T232R	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	296	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACCGGAGCATGTGTACTGGCC	0.677													.|||	448	0.0894569	0.0877	0.036	5008	,	,		9825	0.1409		0.0308	False		,,,				2504	0.137					.											0													40.0	41.0	41.0					19																	54802554		2193	4161	6354	SO:0001583	missense	11026			U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.887C>G	19.37:g.54802554G>C	ENSP00000251390:p.Thr296Arg		J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	ENST00000251390.3	37	CCDS12887.1	217	0.09935897435897435	37	0.07520325203252033	12	0.03314917127071823	154	0.2692307692307692	14	0.018469656992084433	C	0.004	-2.363184	0.00212	.	.	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	T;T;T	0.14516	2.5;2.5;2.5	1.92	-0.638	0.11500	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.429611	0.15267	N	0.271460	T	0.00012	0.0000	N	0.00159	-1.955	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.37314	-0.9711	9	0.02654	T	1	.	4.4301	0.11524	0.4442:0.3373:0.2185:0.0	.	296;296	E7EU74;Q8N6C8	.;LIRA3_HUMAN	R	296;232;313	ENSP00000251390:T296R;ENSP00000375624:T232R;ENSP00000375625:T313R	ENSP00000251390:T296R	T	-	2	0	LILRA3	59494366	0.000000	0.05858	0.008000	0.14137	0.021000	0.10359	0.006000	0.13152	-0.387000	0.07809	-1.120000	0.02017	ACA		0.677	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1		
MAGEC1	9947	mdanderson.org	37	X	140994087	140994087	+	Silent	SNP	C	C	A			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chrX:140994087C>A	ENST00000285879.4	+	4	1183	c.897C>A	c.(895-897)ccC>ccA	p.P299P	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	299				P -> A (in Ref. 1 and 2). {ECO:0000305}.						breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGTTTTCCCCAGTCTCCTC	0.493										HNSCC(15;0.026)																												.											0													124.0	116.0	119.0					X																	140994087		2199	4293	6492	SO:0001819	synonymous_variant	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.897C>A	X.37:g.140994087C>A			A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																				0.493	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
ANKRD30BL	554226	mdanderson.org	37	2	133014592	133014592	+	Intron	SNP	G	G	A	rs545157048	byFrequency	TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr2:133014592G>A	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGATCCCACCGCCACAGACAG	0.721													.|||	2	0.000399361	0.0015	0.0	5008	,	,		11897	0.0		0.0	False		,,,				2504	0.0					.											0													25.0	43.0	38.0					2																	133014592		1551	3578	5129	SO:0001627	intron_variant	100313824					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+509C>T	2.37:g.133014592G>A			B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																					0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
MUC4	4585	mdanderson.org	37	3	195515460	195515460	+	Silent	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr3:195515460A>G	ENST00000463781.3	-	2	3450	c.2991T>C	c.(2989-2991)gaT>gaC	p.D997D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.D997D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	421	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGAGGAAGCATCGGTGACAT	0.582																																						.											0													52.0	43.0	46.0					3																	195515460		2197	4263	6460	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2991T>C	3.37:g.195515460A>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NUP50	10762	mdanderson.org	37	22	45574342	45574342	+	Silent	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr22:45574342A>G	ENST00000347635.4	+	5	1030	c.564A>G	c.(562-564)aaA>aaG	p.K188K	NUP50_ENST00000396096.2_Silent_p.K160K|NUP50_ENST00000425733.2_5'UTR|NUP50_ENST00000407019.2_Silent_p.K160K|CTA-268H5.12_ENST00000610217.1_RNA	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	188	5 X 2 AA repeats of F-G.|Binding to CDKN1B. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTATCTTTAAAGACTATGAGA	0.453																																						.											0													42.0	42.0	42.0					22																	45574342		2202	4296	6498	SO:0001819	synonymous_variant	10762			AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.564A>G	22.37:g.45574342A>G			B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Silent	SNP	ENST00000347635.4	37	CCDS14062.1																																																																																				0.453	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2		
OR2T2	401992	mdanderson.org	37	1	248616749	248616749	+	Silent	SNP	C	C	G	rs151176830		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr1:248616749C>G	ENST00000342927.3	+	1	673	c.651C>G	c.(649-651)gtC>gtG	p.V217V		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCATCTCTGTCTCCTACACGC	0.542																																						.											0													255.0	173.0	201.0					1																	248616749		2189	4267	6456	SO:0001819	synonymous_variant	401992			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.651C>G	1.37:g.248616749C>G			B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	CCDS31116.1																																																																																				0.542	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
PRSS3	5646	mdanderson.org	37	9	33797881	33797881	+	Silent	SNP	G	G	A	rs372122039		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr9:33797881G>A	ENST00000361005.5	+	3	426	c.426G>A	c.(424-426)gaG>gaA	p.E142E	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000429677.3_Silent_p.E78E|PRSS3_ENST00000342836.4_Silent_p.E99E|PRSS3_ENST00000379405.3_Silent_p.E85E	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	142	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			AGGGGAATGAGCAGTTCATCA	0.547																																						.											0													202.0	166.0	178.0					9																	33797881		2203	4300	6503	SO:0001819	synonymous_variant	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.426G>A	9.37:g.33797881G>A			A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	ENST00000361005.5	37	CCDS47958.1																																																																																				0.547	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
SMCHD1	23347	mdanderson.org	37	18	2707619	2707619	+	Missense_Mutation	SNP	G	G	A	rs2276092	byFrequency	TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr18:2707619G>A	ENST00000320876.6	+	16	2460	c.2122G>A	c.(2122-2124)Gtt>Att	p.V708I	SMCHD1_ENST00000261598.8_Missense_Mutation_p.V708I|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	708			V -> I (in dbSNP:rs2276092).		chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GCCTAATGAGGTTAGGCCTGC	0.363													A|||	3457	0.690296	0.7141	0.7839	5008	,	,		14767	0.6528		0.6909	False		,,,				2504	0.6299					.											0								A	ILE/VAL	2659,981		969,721,130	179.0	168.0	171.0		2122	0.4	0.4	18	dbSNP_100	171	5737,2423		2009,1719,352	yes	missense	SMCHD1	NM_015295.2	29	2978,2440,482	AA,AG,GG		29.6936,26.9505,28.8475	benign	708/2006	2707619	8396,3404	1820	4080	5900	SO:0001583	missense	23347			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2122G>A	18.37:g.2707619G>A	ENSP00000326603:p.Val708Ile		O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	1490	0.6822344322344323	354	0.7195121951219512	279	0.7707182320441989	348	0.6083916083916084	509	0.6715039577836411	A	11.19	1.566563	0.28003	0.730495	0.703064	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.22539	1.95;1.95	5.46	0.384	0.16244	.	0.723872	0.12914	N	0.428667	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.19031	-1.0318	9	0.18710	T	0.47	-1.9438	11.4814	0.50328	0.4902:0.0:0.5098:0.0	rs2276092;rs61228446;rs2276092	708	A6NHR9	SMHD1_HUMAN	I	708	ENSP00000326603:V708I;ENSP00000261598:V708I	ENSP00000261598:V708I	V	+	1	0	SMCHD1	2697619	0.000000	0.05858	0.397000	0.26308	0.982000	0.71751	0.281000	0.18810	-0.155000	0.11098	-0.360000	0.07572	GTT		0.363	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
UGT2B4	7363	mdanderson.org	37	4	70361420	70361420	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr4:70361420T>C	ENST00000305107.6	-	1	206	c.160A>G	c.(160-162)Act>Gct	p.T54A	UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000512583.1_Missense_Mutation_p.T54A|UGT2B4_ENST00000506580.1_5'UTR	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	54					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GCCAATACAGTCACCTCATGA	0.423																																						.											0													111.0	115.0	113.0					4																	70361420		2202	4300	6502	SO:0001583	missense	7363			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.160A>G	4.37:g.70361420T>C	ENSP00000305221:p.Thr54Ala		A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.158757	0.57368	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000510114	T;T;T	0.70516	-0.49;-0.49;0.28	2.41	2.41	0.29592	.	0.000000	0.64402	U	0.000014	T	0.80539	0.4642	M	0.88450	2.955	0.80722	D	1	D;P	0.63046	0.992;0.925	P;P	0.56648	0.775;0.803	T	0.82127	-0.0611	10	0.87932	D	0	.	8.376	0.32442	0.0:0.0:0.0:1.0	.	54;54	G5E9X8;P06133	.;UD2B4_HUMAN	A	54	ENSP00000421290:T54A;ENSP00000305221:T54A;ENSP00000421113:T54A	ENSP00000305221:T54A	T	-	1	0	UGT2B4	70396009	0.525000	0.26290	0.459000	0.27081	0.088000	0.18126	1.953000	0.40352	1.105000	0.41606	0.254000	0.18369	ACT		0.423	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
ANKRD30BL	554226	bcgsc.ca	37	2	132905792	132905792	+	Missense_Mutation	SNP	G	G	C	rs189049364		TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr2:132905792G>C	ENST00000409867.1	-	6	938	c.689C>G	c.(688-690)tCt>tGt	p.S230C	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	230								p.S230C(2)		endometrium(1)|kidney(3)	4						TGTTCCTTCAGATGTTCCTTC	0.443																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.689C>G	2.37:g.132905792G>C	ENSP00000386398:p.Ser230Cys		B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	8.999	0.979581	0.18812	.	.	ENSG00000163046	ENST00000409867	T	0.38560	1.13	0.109	0.109	0.14578	.	.	.	.	.	T	0.32793	0.0841	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28427	-1.0044	5	0.35671	T	0.21	.	.	.	.	.	.	.	.	C	230	ENSP00000386398:S230C	ENSP00000386398:S230C	S	-	2	0	ANKRD30BL	132622262	0.200000	0.23398	0.088000	0.20740	0.105000	0.19272	0.320000	0.19540	0.181000	0.19994	0.184000	0.17185	TCT		0.443	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
FRG1B	284802	bcgsc.ca	37	20	29623231	29623231	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr20:29623231C>T	ENST00000278882.3	+	3	423	c.43C>T	c.(43-45)Ccc>Tcc	p.P15S	FRG1B_ENST00000358464.4_Missense_Mutation_p.P15S|FRG1B_ENST00000439954.2_Missense_Mutation_p.T16I			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	15										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGTCTTTTTACCCTGGGAGCT	0.418																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.43C>T	20.37:g.29623231C>T	ENSP00000278882:p.Pro15Ser		C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	7.175|7.175	0.588401|0.588401	0.13812|0.13812	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.55052	.|0.54	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.341731|.	0.29924|.	U|.	0.010850|.	T|T	0.53658|0.53658	0.1810|0.1810	.|.	.|.	.|.	0.25299|0.25299	N|N	0.989298|0.989298	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50651|0.50651	-0.8803|-0.8803	6|6	0.72032|0.87932	D|D	0.01|0	.|.	9.8943|9.8943	0.41309|0.41309	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	S|I	15|16	.|ENSP00000408863:T16I	ENSP00000278882:P15S|ENSP00000408863:T16I	P|T	+|+	1|2	0|0	FRG1B|FRG1B	28236892|28236892	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.101000|0.101000	0.19017|0.19017	6.586000|6.586000	0.74067|0.74067	1.399000|1.399000	0.46721|0.46721	0.423000|0.423000	0.28283|0.28283	CCC|ACC		0.418	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
MX2	4600	bcgsc.ca	37	21	42770882	42770882	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr21:42770882A>G	ENST00000330714.3	+	9	1392	c.1208A>G	c.(1207-1209)gAg>gGg	p.E403G	MX2_ENST00000496774.1_3'UTR	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	403					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				GCGACCGAGGAGCTGCGGCGT	0.517																																						.											0													82.0	87.0	86.0					21																	42770882		2203	4300	6503	SO:0001583	missense	4600				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.1208A>G	21.37:g.42770882A>G	ENSP00000333657:p.Glu403Gly		B7Z5D3|D3DSI7	Missense_Mutation	SNP	ENST00000330714.3	37	CCDS13672.1	.	.	.	.	.	.	.	.	.	.	A	15.80	2.940961	0.52972	.	.	ENSG00000183486	ENST00000330714	T	0.78816	-1.21	3.94	3.94	0.45596	Dynamin central domain (1);	0.110683	0.64402	D	0.000013	D	0.88411	0.6429	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89852	0.4010	10	0.87932	D	0	-27.61	10.8405	0.46712	1.0:0.0:0.0:0.0	.	403	P20592	MX2_HUMAN	G	403	ENSP00000333657:E403G	ENSP00000333657:E403G	E	+	2	0	MX2	41692752	1.000000	0.71417	0.994000	0.49952	0.066000	0.16364	3.858000	0.55979	1.731000	0.51592	0.482000	0.46254	GAG		0.517	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463	
ICE1	23379	bcgsc.ca	37	5	5463284	5463285	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:5463284_5463285insTA	ENST00000296564.7	+	13	4059_4060	c.3837_3838insTA	c.(3838-3840)aaafs	p.K1280fs		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1280					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ATTGCAATGGTAAAGATACTGG	0.376																																						.											0																																										SO:0001589	frameshift_variant	23379																														Exception_encountered	5.37:g.5463284_5463285insTA	ENSP00000296564:p.Lys1280fs		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Frame_Shift_Ins	INS	ENST00000296564.7	37	CCDS47187.1																																																																																				0.376	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
FAM193B	54540	bcgsc.ca	37	5	176966072	176966072	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8443-01A-11D-2310-10	TCGA-KM-8443-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c00de7a0-0b09-4e07-988c-ef2a7f8e932a	982dbbf8-fdf8-4653-91ed-2e857e1a7708	g.chr5:176966072C>T	ENST00000514747.1	-	2	335	c.287G>A	c.(286-288)gGc>gAc	p.G96D	FAM193B_ENST00000329540.5_5'UTR|FAM193B_ENST00000443375.2_5'UTR|FAM193B_ENST00000508298.1_Intron	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	96						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						TTGAGAAGGGCCTTCTTCCCA	0.587																																						.											0																																										SO:0001583	missense	54540				CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.287G>A	5.37:g.176966072C>T	ENSP00000422131:p.Gly96Asp		E9PET5|Q9NW00	Missense_Mutation	SNP	ENST00000514747.1	37	CCDS54954.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.302964	0.81136	.	.	ENSG00000146067	ENST00000514747	T	0.55588	0.51	5.45	4.58	0.56647	.	.	.	.	.	T	0.52885	0.1762	L	0.40543	1.245	0.80722	D	1	.	.	.	.	.	.	T	0.55945	-0.8060	7	0.72032	D	0.01	.	9.8958	0.41318	0.0:0.788:0.1391:0.0729	.	.	.	.	D	96	ENSP00000422131:G96D	ENSP00000422131:G96D	G	-	2	0	FAM193B	176898678	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.730000	0.62015	1.435000	0.47434	0.655000	0.94253	GGC		0.587	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373121.1	NM_019057	
