#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SELPLG	6404	hgsc.bcm.edu	37	12	109017489	109017489	+	Missense_Mutation	SNP	T	T	G	rs559346809	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr12:109017489T>G	ENST00000550948.1	-	2	819	c.595A>C	c.(595-597)Atg>Ctg	p.M199L	SELPLG_ENST00000228463.6_Missense_Mutation_p.M215L|SELPLG_ENST00000388962.3_Missense_Mutation_p.M189L			Q14242	SELPL_HUMAN	selectin P ligand	199	12 X 10 AA tandem repeats.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						TGTGCCTCCATGGCTGCTGGT	0.617													T|||	11	0.00219649	0.0076	0.0	5008	,	,		18945	0.0		0.0	False		,,,				2504	0.001					.											0													163.0	141.0	148.0					12																	109017489		2203	4300	6503	SO:0001583	missense	6404				CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.595A>C	12.37:g.109017489T>G	ENSP00000447752:p.Met199Leu		A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	ENST00000550948.1	37	CCDS31895.2	.	.	.	.	.	.	.	.	.	.	T	6.805	0.517561	0.13005	.	.	ENSG00000110876	ENST00000388962;ENST00000550948;ENST00000228463	T;T;T	0.13538	2.58;2.58;2.58	3.31	2.09	0.27110	.	0.862879	0.09676	N	0.770477	T	0.11281	0.0275	L	0.38175	1.15	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.29761	-1.0001	10	0.66056	D	0.02	-6.6031	5.9197	0.19076	0.2255:0.0:0.1387:0.6358	.	215;199;159	B7Z5C7;Q14242;B4DHR9	.;SELPL_HUMAN;.	L	189;199;215	ENSP00000373614:M189L;ENSP00000447752:M199L;ENSP00000228463:M215L	ENSP00000228463:M215L	M	-	1	0	SELPLG	107541618	0.002000	0.14202	0.004000	0.12327	0.004000	0.04260	0.391000	0.20784	0.599000	0.29845	0.402000	0.26972	ATG		0.617	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403904.1		
HHIPL2	79802	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	222721242	222721242	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr1:222721242C>T	ENST00000343410.6	-	1	203	c.145G>A	c.(145-147)Ggg>Agg	p.G49R		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	49					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		AAAGGGGGCCCGTAATCCAGG	0.617																																						.											0													29.0	33.0	32.0					1																	222721242		1911	4126	6037	SO:0001583	missense	79802			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.145G>A	1.37:g.222721242C>T	ENSP00000342118:p.Gly49Arg		Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.332411	0.01298	.	.	ENSG00000143512	ENST00000343410	T	0.70282	-0.47	4.93	-0.274	0.12910	Folate receptor-like (1);	0.414878	0.26321	N	0.025047	T	0.48390	0.1497	L	0.28400	0.85	0.21220	N	0.999754	B	0.10296	0.003	B	0.18263	0.021	T	0.29150	-1.0021	10	0.08599	T	0.76	-2.0086	6.0319	0.19684	0.0:0.5884:0.1257:0.2859	.	49	Q6UWX4	HIPL2_HUMAN	R	49	ENSP00000342118:G49R	ENSP00000342118:G49R	G	-	1	0	HHIPL2	220787865	0.006000	0.16342	0.193000	0.23327	0.352000	0.29268	0.347000	0.20014	-0.366000	0.08064	-0.136000	0.14681	GGG		0.617	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
KRT84	3890	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	52777475	52777475	+	Silent	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr12:52777475G>A	ENST00000257951.3	-	2	720	c.654C>T	c.(652-654)atC>atT	p.I218I	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	218	Coil 1B.|Rod.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GCAGGTTGGTGATGTAGCTCT	0.547																																						.											0													77.0	73.0	74.0					12																	52777475		2203	4300	6503	SO:0001819	synonymous_variant	3890			Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.654C>T	12.37:g.52777475G>A			B2RA43|Q6ISB0|Q701L6	Silent	SNP	ENST00000257951.3	37	CCDS8825.1																																																																																				0.547	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
SPTB	6710	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	14	65245965	65245965	+	Splice_Site	SNP	C	C	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr14:65245965C>T	ENST00000389721.5	-	21	4506		c.e21-1		SPTB_ENST00000542895.1_Splice_Site|SPTB_ENST00000389720.3_Splice_Site|SPTB_ENST00000389722.3_Splice_Site|SPTB_ENST00000556626.1_Splice_Site	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic						actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CCACCCAAAGCTGCAGAGACC	0.572																																						.											0													56.0	61.0	59.0					14																	65245965		2203	4300	6503	SO:0001630	splice_region_variant	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4474-1G>A	14.37:g.65245965C>T			Q15510|Q15519	Splice_Site	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445979	0.84101	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9238	0.88976	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTB	64315718	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.781000	0.85668	2.579000	0.87056	0.561000	0.74099	.		0.572	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		Intron
ZCCHC2	54877	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	60242420	60242420	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr18:60242420A>T	ENST00000269499.5	+	13	3524	c.3106A>T	c.(3106-3108)Aat>Tat	p.N1036Y	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.N715Y	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1036						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CTATTATCCTAATCCAATGCC	0.493																																						.											0													74.0	83.0	80.0					18																	60242420		2074	4203	6277	SO:0001583	missense	54877			AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.3106A>T	18.37:g.60242420A>T	ENSP00000269499:p.Asn1036Tyr		B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	A	14.59	2.581891	0.46006	.	.	ENSG00000141664	ENST00000269499	T	0.25579	1.79	5.29	4.13	0.48395	.	0.292895	0.34200	N	0.004174	T	0.35711	0.0941	L	0.51422	1.61	0.31721	N	0.638306	D	0.53885	0.963	P	0.54401	0.751	T	0.46091	-0.9216	10	0.66056	D	0.02	-7.6496	11.3077	0.49345	0.9282:0.0:0.0718:0.0	.	1036	Q9C0B9	ZCHC2_HUMAN	Y	1036	ENSP00000269499:N1036Y	ENSP00000269499:N1036Y	N	+	1	0	ZCCHC2	58393400	0.015000	0.18098	0.031000	0.17742	0.926000	0.56050	2.296000	0.43584	0.944000	0.37579	0.528000	0.53228	AAT		0.493	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
OSBP2	23762	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	22	31266429	31266429	+	Silent	SNP	C	C	T	rs376288614		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr22:31266429C>T	ENST00000332585.6	+	3	971	c.867C>T	c.(865-867)gaC>gaT	p.D289D	OSBP2_ENST00000437268.2_Silent_p.D31D|OSBP2_ENST00000403222.3_Silent_p.D124D|OSBP2_ENST00000401475.1_5'UTR|OSBP2_ENST00000446658.2_Silent_p.D289D|OSBP2_ENST00000382310.3_Silent_p.D289D|OSBP2_ENST00000407373.1_Silent_p.D116D	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	289					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						ACTCTGGGGACGACGACGAGG	0.557																																						.											0								C		1,4199		0,1,2099	63.0	65.0	65.0		867	-0.7	1.0	22		65	1,8441		0,1,4220	no	coding-synonymous	OSBP2	NM_030758.3		0,2,6319	TT,TC,CC		0.0118,0.0238,0.0158		289/917	31266429	2,12640	2100	4221	6321	SO:0001819	synonymous_variant	23762				CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.867C>T	22.37:g.31266429C>T			B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Silent	SNP	ENST00000332585.6	37	CCDS43002.1																																																																																				0.557	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758	
SSTR3	6753	hgsc.bcm.edu	37	22	37603327	37603327	+	Silent	SNP	G	G	A	rs141903633	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr22:37603327G>A	ENST00000328544.3	-	2	1049	c.516C>T	c.(514-516)gcC>gcT	p.A172A	SSTR3_ENST00000402501.1_Silent_p.A172A	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	172					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	GCACCACCACGGCTGAGGCCA	0.741													G|||	15	0.00299521	0.0106	0.0	5008	,	,		13508	0.001		0.0	False		,,,				2504	0.0					.											0								G		33,4367		0,33,2167	24.0	26.0	25.0		516	-11.3	0.1	22	dbSNP_134	25	1,8571		0,1,4285	no	coding-synonymous	SSTR3	NM_001051.2		0,34,6452	AA,AG,GG		0.0117,0.75,0.2621		172/419	37603327	34,12938	2200	4286	6486	SO:0001819	synonymous_variant	6753				CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.516C>T	22.37:g.37603327G>A			A8K550|Q53ZR7	Silent	SNP	ENST00000328544.3	37	CCDS13944.1																																																																																				0.741	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1		
KIAA1211	57482	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	4	57182677	57182677	+	Silent	SNP	G	G	A	rs369933689		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr4:57182677G>A	ENST00000504228.1	+	6	3114	c.3009G>A	c.(3007-3009)ccG>ccA	p.P1003P	KIAA1211_ENST00000541073.1_Silent_p.P996P|KIAA1211_ENST00000264229.6_Silent_p.P1003P			Q6ZU35	K1211_HUMAN	KIAA1211	1003	Pro-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CAAGTGAGCCGTCCAAGGAGG	0.657																																						.											0								G		0,4048		0,0,2024	30.0	38.0	35.0		3009	-4.3	0.0	4		35	1,8335		0,1,4167	no	coding-synonymous	KIAA1211	NM_020722.1		0,1,6191	AA,AG,GG		0.012,0.0,0.0081		1003/1234	57182677	1,12383	2024	4168	6192	SO:0001819	synonymous_variant	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3009G>A	4.37:g.57182677G>A			Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																				0.657	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
GIMAP8	155038	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	150171183	150171183	+	Missense_Mutation	SNP	C	C	T	rs576578780		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr7:150171183C>T	ENST00000307271.3	+	4	1340	c.766C>T	c.(766-768)Cgc>Tgc	p.R256C		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	256	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TGTGGGGAAACGCGGTGCTGG	0.557													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17518	0.0		0.0	False		,,,				2504	0.0					.											0													89.0	89.0	89.0					7																	150171183		2203	4300	6503	SO:0001583	missense	155038			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.766C>T	7.37:g.150171183C>T	ENSP00000305107:p.Arg256Cys			Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.040312	0.35989	.	.	ENSG00000171115	ENST00000307271	T	0.61392	0.11	4.47	3.56	0.40772	AIG1 (1);	0.309039	0.23636	N	0.046066	T	0.74574	0.3734	M	0.82630	2.6	0.19300	N	0.999978	D	0.89917	1.0	D	0.91635	0.999	T	0.65162	-0.6235	10	0.72032	D	0.01	.	9.4363	0.38641	0.2119:0.7881:0.0:0.0	.	256	Q8ND71	GIMA8_HUMAN	C	256	ENSP00000305107:R256C	ENSP00000305107:R256C	R	+	1	0	GIMAP8	149802116	0.005000	0.15991	0.231000	0.23993	0.139000	0.21198	0.617000	0.24359	1.074000	0.40909	0.650000	0.86243	CGC		0.557	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
EN2	2020	hgsc.bcm.edu	37	7	155251201	155251201	+	Silent	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr7:155251201G>A	ENST00000297375.4	+	1	378	c.129G>A	c.(127-129)ggG>ggA	p.G43G	AC008060.8_ENST00000419225.1_lincRNA	NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	43					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGGACACCGGGCGCCGGCGGG	0.746																																						.											0													3.0	3.0	3.0					7																	155251201		1605	3163	4768	SO:0001819	synonymous_variant	2020				CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.129G>A	7.37:g.155251201G>A			A4D252|Q549U3|Q9UD58	Silent	SNP	ENST00000297375.4	37	CCDS5940.1																																																																																				0.746	EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322337.1	NM_001427	
CTH	1491	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	70897872	70897872	+	Silent	SNP	C	C	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr1:70897872C>A	ENST00000370938.3	+	8	975	c.831C>A	c.(829-831)gcC>gcA	p.A277A	CTH_ENST00000411986.2_Silent_p.A245A|CTH_ENST00000346806.2_Silent_p.A233A	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TGGCAGTTGCCCAGTTCCTGG	0.403																																						.											0													112.0	107.0	109.0					1																	70897872		2203	4300	6503	SO:0001819	synonymous_variant	1491			BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.831C>A	1.37:g.70897872C>A			O95791|Q9NX42	Silent	SNP	ENST00000370938.3	37	CCDS650.1																																																																																				0.403	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025918.1	NM_001902	
RPRD2	23248	broad.mit.edu	37	1	150445701	150445701	+	Missense_Mutation	SNP	C	C	T	rs377477495		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr1:150445701C>T	ENST00000369068.4	+	11	4281	c.4277C>T	c.(4276-4278)cCt>cTt	p.P1426L	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.P1400L	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	1426	Pro-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CCTAGGGAACCTTTTCTCAGC	0.567																																						.											0								C	LEU/PRO	1,3791		0,1,1895	78.0	79.0	79.0		4277	4.6	1.0	1		79	0,8218		0,0,4109	no	missense	RPRD2	NM_015203.3	98	0,1,6004	TT,TC,CC		0.0,0.0264,0.0083	benign	1426/1462	150445701	1,12009	1896	4109	6005	SO:0001583	missense	23248			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.4277C>T	1.37:g.150445701C>T	ENSP00000358064:p.Pro1426Leu		A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365145	0.41902	2.64E-4	0.0	ENSG00000163125	ENST00000401000;ENST00000369068	T;T	0.43294	0.95;0.95	4.57	4.57	0.56435	.	0.301676	0.28977	N	0.013525	T	0.16300	0.0392	N	0.24115	0.695	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.08554	-1.0716	10	0.87932	D	0	-1.5661	10.3448	0.43899	0.0:0.9097:0.0:0.0903	.	1426;1400	Q5VT52;Q5VT52-3	RPRD2_HUMAN;.	L	1400;1426	ENSP00000383785:P1400L;ENSP00000358064:P1426L	ENSP00000358064:P1426L	P	+	2	0	RPRD2	148712325	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.717000	0.54911	2.351000	0.79841	0.655000	0.94253	CCT		0.567	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
NAA40	79829	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	63719920	63719920	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr11:63719920G>A	ENST00000377793.4	+	5	394	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	NAA40_ENST00000456907.2_Missense_Mutation_p.R58Q|NAA40_ENST00000539656.1_Intron|NAA40_ENST00000536939.1_3'UTR|NAA40_ENST00000542163.1_Missense_Mutation_p.R77Q	NM_024771.2	NP_079047.2	Q86UY6	NAA40_HUMAN	N(alpha)-acetyltransferase 40, NatD catalytic subunit	98	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				lipid metabolic process (GO:0006629)		N-acetyltransferase activity (GO:0008080)			NS(1)|endometrium(1)|lung(2)|prostate(1)	5						CGAGAGAAACGGGAGGAAATG	0.577																																						.											0													178.0	164.0	169.0					11																	63719920		2201	4297	6498	SO:0001583	missense	79829			AK023910	CCDS8053.1, CCDS73311.1	11q13.1	2013-10-11	2013-08-28	2010-01-14	ENSG00000110583	ENSG00000110583		"""N(alpha)-acetyltransferase subunits"""	25845	protein-coding gene	gene with protein product			"""N-acetyltransferase 11"", ""N-acetyltransferase 11 (GCN5-related, putative)"", ""N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)"""	NAT11		19660095	Standard	XM_005274296		Approved	FLJ13848	uc009yoz.3	Q86UY6	OTTHUMG00000167784	ENST00000377793.4:c.293G>A	11.37:g.63719920G>A	ENSP00000367024:p.Arg98Gln		B4DR03|B4DU10|Q5HYL5|Q9H897	Missense_Mutation	SNP	ENST00000377793.4	37	CCDS8053.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491315	0.84962	.	.	ENSG00000110583	ENST00000377793;ENST00000456907;ENST00000542163	T;T;T	0.44482	0.92;0.92;0.92	5.72	4.8	0.61643	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.051476	0.64402	D	0.000001	T	0.40645	0.1125	N	0.26092	0.79	0.80722	D	1	B;D	0.69078	0.019;0.997	B;P	0.53062	0.003;0.717	T	0.05818	-1.0862	10	0.26408	T	0.33	-0.0172	13.9782	0.64285	0.0754:0.0:0.9245:0.0	.	58;98	B4DU10;Q86UY6	.;NAA40_HUMAN	Q	98;58;77	ENSP00000367024:R98Q;ENSP00000407578:R58Q;ENSP00000442055:R77Q	ENSP00000367024:R98Q	R	+	2	0	NAA40	63476496	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.585000	0.67497	2.692000	0.91855	0.555000	0.69702	CGG		0.577	NAA40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396266.1	NM_024771	
OASL	8638	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	121471492	121471492	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr12:121471492C>A	ENST00000257570.5	-	2	523	c.253G>T	c.(253-255)Gtg>Ttg	p.V85L	OASL_ENST00000339275.5_Missense_Mutation_p.V85L	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	85					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)			NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGAAACGCCACCAGCTCCACC	0.577																																					Colon(192;517 2041 31392 31913 39966)	.											0													108.0	108.0	108.0					12																	121471492		2203	4300	6503	SO:0001583	missense	8638			AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.253G>T	12.37:g.121471492C>A	ENSP00000257570:p.Val85Leu		B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Missense_Mutation	SNP	ENST00000257570.5	37	CCDS9211.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231115	0.79688	.	.	ENSG00000135114	ENST00000257570;ENST00000339275	T;T	0.11821	2.74;2.74	4.52	4.52	0.55395	2-5-oligoadenylate synthetase, N-terminal (1);2-5-oligoadenylate synthetase, conserved site (1);	0.000000	0.47852	D	0.000203	T	0.29458	0.0734	M	0.74647	2.275	0.26569	N	0.973596	P;B	0.48089	0.905;0.423	P;B	0.54460	0.753;0.063	T	0.05178	-1.0901	10	0.52906	T	0.07	-1.1453	12.9391	0.58333	0.0:1.0:0.0:0.0	.	85;85	Q15646-2;Q15646	.;OASL_HUMAN	L	85	ENSP00000257570:V85L;ENSP00000341125:V85L	ENSP00000257570:V85L	V	-	1	0	OASL	119955875	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.113000	0.57851	2.496000	0.84212	0.555000	0.69702	GTG		0.577	OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337875.2	NM_003733	
TEX14	56155	broad.mit.edu;bcgsc.ca	37	17	56693673	56693673	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr17:56693673C>T	ENST00000240361.8	-	7	733	c.648G>A	c.(646-648)tgG>tgA	p.W216*	TEX14_ENST00000389934.3_Intron|TEX14_ENST00000349033.5_Intron			Q8IWB6	TEX14_HUMAN	testis expressed 14	216					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AAAACTGAAACCAAGGCATAG	0.443																																						.											0													70.0	65.0	67.0					17																	56693673		2203	4300	6503	SO:0001587	stop_gained	56155			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.648G>A	17.37:g.56693673C>T	ENSP00000240361:p.Trp216*		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Nonsense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946217	0.92593	.	.	ENSG00000121101	ENST00000240361	.	.	.	5.39	4.42	0.53409	.	0.866221	0.09789	N	0.755592	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-0.2736	13.387	0.60801	0.0:0.7796:0.2204:0.0	.	.	.	.	X	216	.	ENSP00000240361:W216X	W	-	3	0	TEX14	54048672	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	2.742000	0.47434	1.276000	0.44395	0.467000	0.42956	TGG		0.443	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																						.											0																																												201283			AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G				RNA	SNP	ENST00000430983.1	37																																																																																					0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255102.1	NM_153032	
DSG1	1828	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	28926018	28926018	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr18:28926018G>A	ENST00000257192.4	+	14	2169	c.1957G>A	c.(1957-1959)Gga>Aga	p.G653R	RP11-534N16.1_ENST00000578477.1_RNA|DSG1_ENST00000462981.2_Missense_Mutation_p.G12R|RP11-534N16.1_ENST00000581856.1_RNA|RNU6-167P_ENST00000384292.1_RNA|RP11-534N16.1_ENST00000578119.1_RNA	NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	653					apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GAGAATGACAGGATTTGAACT	0.353																																						.											0													86.0	85.0	85.0					18																	28926018		2203	4300	6503	SO:0001583	missense	1828			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1957G>A	18.37:g.28926018G>A	ENSP00000257192:p.Gly653Arg		B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331856	0.24167	.	.	ENSG00000134760	ENST00000257192	T	0.76186	-1.0	5.95	4.15	0.48705	Cadherin, cytoplasmic domain (1);	0.000000	0.64402	D	0.000002	T	0.80396	0.4615	L	0.52573	1.65	0.34238	D	0.677296	D	0.76494	0.999	D	0.74348	0.983	D	0.85203	0.1016	10	0.56958	D	0.05	.	10.1071	0.42539	0.073:0.135:0.7921:0.0	.	653	Q02413	DSG1_HUMAN	R	653	ENSP00000257192:G653R	ENSP00000257192:G653R	G	+	1	0	DSG1	27180016	1.000000	0.71417	1.000000	0.80357	0.471000	0.32888	2.890000	0.48609	1.521000	0.48983	0.609000	0.83330	GGA		0.353	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942	
HMHA1	23526	broad.mit.edu;bcgsc.ca	37	19	1073206	1073206	+	Silent	SNP	C	C	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:1073206C>A	ENST00000313093.2	+	3	711	c.480C>A	c.(478-480)gtC>gtA	p.V160V	HMHA1_ENST00000543365.1_Silent_p.V43V|HMHA1_ENST00000536472.1_De_novo_Start_InFrame|HMHA1_ENST00000592335.1_Nonsense_Mutation_p.S41*|HMHA1_ENST00000586866.1_Silent_p.V164V|HMHA1_ENST00000590214.1_Silent_p.V187V|HMHA1_ENST00000539243.2_Silent_p.V176V	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	160					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTGCGTGTCATGCATCAGA	0.647																																						.											0													66.0	64.0	64.0					19																	1073206		2203	4300	6503	SO:0001819	synonymous_variant	23526			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.480C>A	19.37:g.1073206C>A			B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Silent	SNP	ENST00000313093.2	37	CCDS32863.1																																																																																				0.647	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
DSPP	1834	broad.mit.edu	37	4	88536259	88536264	+	In_Frame_Del	DEL	CAGTGA	CAGTGA	-			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	CAGTGA	CAGTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr4:88536259_88536264delCAGTGA	ENST00000282478.7	+	4	2478_2483	c.2445_2450delCAGTGA	c.(2443-2451)agcagtgat>agt	p.SD818del	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Del_p.SD818del			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	818	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgacagcagtgatagcgacagc	0.515																																						.											0																																										SO:0001651	inframe_deletion	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2445_2450delCAGTGA	4.37:g.88536259_88536264delCAGTGA	ENSP00000282478:p.Ser818_Asp819del		A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																				0.515	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
KIF4B	285643	broad.mit.edu	37	5	154394949	154394949	+	Silent	SNP	T	T	C			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr5:154394949T>C	ENST00000435029.4	+	1	1690	c.1530T>C	c.(1528-1530)gcT>gcC	p.A510A		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	510					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTTCTGACGCTTTTACCACTC	0.488																																						.											0													95.0	100.0	99.0					5																	154394949		2203	4300	6503	SO:0001819	synonymous_variant	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1530T>C	5.37:g.154394949T>C				Silent	SNP	ENST00000435029.4	37	CCDS47324.1																																																																																				0.488	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
FLT4	2324	broad.mit.edu;mdanderson.org;bcgsc.ca	37	5	180057729	180057729	+	Missense_Mutation	SNP	C	C	T	rs202015753	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr5:180057729C>T	ENST00000261937.6	-	3	304	c.226G>A	c.(226-228)Gag>Aag	p.E76K	FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.E76K|FLT4_ENST00000393347.3_Missense_Mutation_p.E76K	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	76	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCCGTGTCCTCGCTGTCCTTG	0.662													c|||	10	0.00199681	0.0	0.0014	5008	,	,		17527	0.0		0.0	False		,,,				2504	0.0092				Colon(97;1075 1466 27033 27547 35871)	.											0													129.0	111.0	117.0					5																	180057729		2202	4299	6501	SO:0001583	missense	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.226G>A	5.37:g.180057729C>T	ENSP00000261937:p.Glu76Lys		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	2.214	-0.380086	0.05000	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649	T;T;T	0.29397	1.57;1.57;1.57	4.94	1.91	0.25777	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.17789	0.0427	L	0.41573	1.285	0.09310	N	1	B;B;B;B;B	0.33940	0.433;0.311;0.112;0.004;0.002	B;B;B;B;B	0.25884	0.064;0.03;0.01;0.004;0.005	T	0.12243	-1.0555	9	0.23891	T	0.37	.	3.6906	0.08344	0.1438:0.5735:0.1397:0.143	.	76;76;76;76;76	B5A928;B5A927;P35916-3;E9PD35;P35916	.;.;.;.;VGFR3_HUMAN	K	76	ENSP00000261937:E76K;ENSP00000377016:E76K;ENSP00000426057:E76K	ENSP00000261937:E76K	E	-	1	0	FLT4	179990335	0.065000	0.20965	0.238000	0.24106	0.056000	0.15407	1.126000	0.31344	1.212000	0.43366	0.456000	0.33151	GAG		0.662	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
DDC	1644	broad.mit.edu;mdanderson.org;bcgsc.ca	37	7	50596997	50596997	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr7:50596997C>T	ENST00000444124.2	-	5	679	c.479G>A	c.(478-480)cGg>cAg	p.R160Q	DDC_ENST00000489162.1_5'UTR|DDC_ENST00000380984.4_Missense_Mutation_p.R160Q|DDC_ENST00000426377.1_Missense_Mutation_p.R82Q|DDC_ENST00000357936.5_Missense_Mutation_p.R160Q|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000431062.1_Intron	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	160	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	CACTTTGGTCCGAGCGGCCAG	0.557																																						.											0													53.0	53.0	53.0					7																	50596997		2203	4300	6503	SO:0001583	missense	1644				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.479G>A	7.37:g.50596997C>T	ENSP00000403644:p.Arg160Gln		C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	37	CCDS5511.1	.	.	.	.	.	.	.	.	.	.	C	33	5.194391	0.94960	.	.	ENSG00000132437	ENST00000357936;ENST00000426377;ENST00000444124;ENST00000380984	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.15	5.15	0.70609	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.101870	0.64402	D	0.000005	T	0.80460	0.4627	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87383	0.2358	10	0.87932	D	0	-1.2889	17.5599	0.87903	0.0:1.0:0.0:0.0	.	160	P20711	DDC_HUMAN	Q	160;82;160;160	ENSP00000350616:R160Q;ENSP00000395069:R82Q;ENSP00000403644:R160Q;ENSP00000370371:R160Q	ENSP00000350616:R160Q	R	-	2	0	DDC	50564491	1.000000	0.71417	0.997000	0.53966	0.688000	0.40055	6.680000	0.74518	2.673000	0.90976	0.655000	0.94253	CGG		0.557	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1		
TNFRSF10C	8794	broad.mit.edu	37	8	22974315	22974315	+	Missense_Mutation	SNP	A	A	C	rs61736405		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr8:22974315A>C	ENST00000356864.3	+	5	1083	c.551A>C	c.(550-552)aAc>aCc	p.N184T	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.N82T	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	184					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.N184T(1)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGAACACCAGCCCG	0.602																																						.											1	Substitution - Missense(1)	skin(1)											68.0	80.0	76.0					8																	22974315		2203	4297	6500	SO:0001583	missense	8794			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.551A>C	8.37:g.22974315A>C	ENSP00000349324:p.Asn184Thr		O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	A	1.881	-0.457883	0.04508	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.62788	0.0;1.25	.	.	.	.	0.568776	0.17737	U	0.163718	T	0.28400	0.0702	N	0.03608	-0.345	0.22213	N	0.999289	P	0.38110	0.618	B	0.33690	0.168	T	0.14924	-1.0455	9	0.37606	T	0.19	.	2.8413	0.05530	0.5024:0.497:2.0E-4:3.0E-4	rs61736405	184	O14798	TR10C_HUMAN	T	184;82;184	ENSP00000349324:N184T;ENSP00000437612:N82T	ENSP00000349324:N184T	N	+	2	0	TNFRSF10C	23030260	0.001000	0.12720	0.054000	0.19295	0.104000	0.19210	0.918000	0.28678	0.077000	0.16863	0.076000	0.15429	AAC		0.602	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
DENND3	22898	broad.mit.edu	37	8	142175380	142175380	+	Silent	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr8:142175380G>A	ENST00000262585.2	+	11	1583	c.1305G>A	c.(1303-1305)gaG>gaA	p.E435E	DENND3_ENST00000424248.1_Silent_p.E383E|DENND3_ENST00000519811.1_Silent_p.E515E	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	435					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCAGTCGGAGGAGGACAGGT	0.468																																						.											0													137.0	136.0	136.0					8																	142175380		2203	4300	6503	SO:0001819	synonymous_variant	22898			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1305G>A	8.37:g.142175380G>A			B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	G	2.980	-0.210423	0.06140	.	.	ENSG00000105339	ENST00000518668	.	.	.	5.42	-6.03	0.02185	.	.	.	.	.	T	0.54631	0.1870	.	.	.	0.44702	D	0.997698	.	.	.	.	.	.	T	0.58086	-0.7698	4	.	.	.	-28.1093	12.2339	0.54503	0.7261:0.0996:0.1743:0.0	.	.	.	.	R	440	.	.	G	+	1	0	DENND3	142244562	0.927000	0.31430	0.025000	0.17156	0.514000	0.34195	0.069000	0.14552	-1.210000	0.02627	-0.258000	0.10820	GGA		0.468	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
SLC45A4	57210	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	8	142221657	142221657	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr8:142221657G>A	ENST00000024061.3	-	8	2588	c.2281C>T	c.(2281-2283)Ctt>Ttt	p.L761F	SLC45A4_ENST00000519067.1_3'UTR|SLC45A4_ENST00000433583.2_3'UTR|SLC45A4_ENST00000517878.1_3'UTR	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AGGAAAAGAAGATACGTCATT	0.493																																						.											0													83.0	95.0	91.0					8																	142221657		2203	4300	6503	SO:0001583	missense	57210			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.2281C>T	8.37:g.142221657G>A	ENSP00000024061:p.Leu761Phe		Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	G	8.015	0.758385	0.15846	.	.	ENSG00000022567	ENST00000024061	T	0.18338	2.22	3.9	0.867	0.19085	.	.	.	.	.	T	0.10380	0.0254	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34825	-0.9813	8	0.87932	D	0	.	1.1891	0.01861	0.2061:0.2557:0.3799:0.1582	.	761	Q5BKX6-3	.	F	761	ENSP00000024061:L761F	ENSP00000024061:L761F	L	-	1	0	SLC45A4	142290839	0.007000	0.16637	0.001000	0.08648	0.070000	0.16714	0.710000	0.25748	0.435000	0.26365	0.655000	0.94253	CTT		0.493	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					NSCLC(90;1817 2035 37909 38249)	.											8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)											52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685			AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A			Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																				0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
HSF5	124535	broad.mit.edu	37	17	56565433	56565434	+	In_Frame_Ins	INS	-	-	CGGCCC	rs550036152	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr17:56565433_56565434insCGGCCC	ENST00000323777.3	-	1	311_312	c.202_203insGGGCCG	c.(202-204)gag>gGGGCCGag	p.67_68insGA		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	67					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAGCTCGGGCTcggccccggcc	0.723														23	0.00459265	0.0106	0.0058	5008	,	,		9066	0.0		0.004	False		,,,				2504	0.001					.											0										14,3682		1,12,1835						3.7	1.0			10	32,7446		5,22,3712	no	coding	HSF5	NM_001080439.1		6,34,5547	A1A1,A1R,RR		0.4279,0.3788,0.4117				46,11128				SO:0001652	inframe_insertion	124535			BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.197_202dupGGGCCG	17.37:g.56565434_56565439dupCGGCCC	ENSP00000313243:p.Gly66_Ala67dup		Q08EH7|Q8N7V2	In_Frame_Ins	INS	ENST00000323777.3	37	CCDS32690.1																																																																																				0.723	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1	XM_064190	
RBPJ	3516	broad.mit.edu	37	4	26432510	26432511	+	Frame_Shift_Ins	INS	-	-	G	rs1064403|rs202024680		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr4:26432510_26432511insG	ENST00000361572.6	+	11	1578_1579	c.1384_1385insG	c.(1384-1386)cgafs	p.R462fs	RBPJ_ENST00000342320.4_Frame_Shift_Ins_p.R448fs|RBPJ_ENST00000504907.1_3'UTR|RBPJ_ENST00000345843.3_Frame_Shift_Ins_p.R447fs|RBPJ_ENST00000507561.1_Frame_Shift_Ins_p.R427fs|RBPJ_ENST00000348160.4_Frame_Shift_Ins_p.R449fs|RBPJ_ENST00000342295.1_Frame_Shift_Ins_p.R462fs|RBPJ_ENST00000355476.3_Frame_Shift_Ins_p.R448fs			Q06330	SUH_HUMAN	recombination signal binding protein for immunoglobulin kappa J region	462				R -> P (in Ref. 1; AAA60258). {ECO:0000305}.	angiogenesis (GO:0001525)|arterial endothelial cell fate commitment (GO:0060844)|atrioventricular canal development (GO:0036302)|auditory receptor cell fate commitment (GO:0009912)|B cell differentiation (GO:0030183)|blood vessel endothelial cell fate specification (GO:0097101)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac left ventricle morphogenesis (GO:0003214)|Clara cell differentiation (GO:0060486)|defense response to bacterium (GO:0042742)|DNA recombination (GO:0006310)|dorsal aorta morphogenesis (GO:0035912)|endocardium morphogenesis (GO:0003160)|epidermal cell fate specification (GO:0009957)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|gene expression (GO:0010467)|hair follicle maturation (GO:0048820)|humoral immune response (GO:0006959)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901297)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of ephrin receptor signaling pathway (GO:1901189)|positive regulation of ERBB signaling pathway (GO:1901186)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription of Notch receptor target (GO:0007221)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|sebaceous gland development (GO:0048733)|secondary heart field specification (GO:0003139)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|recombinase activity (GO:0000150)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)	15		Breast(46;0.0503)				AGCAATCCTTCGAGCCAATTCA	0.5																																						.											0																																										SO:0001589	frameshift_variant	3516			L07872	CCDS3436.1, CCDS3437.1, CCDS33969.1, CCDS43219.1	4p15.2	2013-10-18	2007-02-26	2007-02-26	ENSG00000168214	ENSG00000168214			5724	protein-coding gene	gene with protein product	"""suppressor of hairless homolog (Drosophila)"""	147183	"""recombining binding protein suppressor of hairless (Drosophila)"""	IGKJRB1, RBPSUH		8406481, 9290259	Standard	NM_005349		Approved	SUH, IGKJRB, RBPJK, KBF2, RBP-J, CBF1	uc003gsb.2	Q06330	OTTHUMG00000097793	ENST00000361572.6:c.1385dupG	4.37:g.26432511_26432511dupG	ENSP00000354528:p.Arg462fs		B4DY22|Q5XKH9|Q6P1N3	Frame_Shift_Ins	INS	ENST00000361572.6	37	CCDS3437.1																																																																																				0.500	RBPJ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215046.2	NM_015874	
PABPC4L	132430	broad.mit.edu	37	4	135122069	135122070	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr4:135122069_135122070insA	ENST00000421491.3	-	2	361_362	c.105_106insT	c.(103-108)cctgtgfs	p.V36fs	PABPC4L_ENST00000529122.2_Frame_Shift_Ins_p.V94fs			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	36	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						ATGGACAGCACAGGCCCCACAG	0.584																																						.											0																																										SO:0001589	frameshift_variant	132430			AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.106dupT	4.37:g.135122070_135122070dupA	ENSP00000463233:p.Val36fs			Frame_Shift_Ins	INS	ENST00000421491.3	37																																																																																					0.584	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
C1orf204	284677	ucsc.edu	37	1	159810538	159810538	+	Silent	SNP	A	A	G			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr1:159810538A>G	ENST00000368102.1	-	4	670	c.561T>C	c.(559-561)gcT>gcC	p.A187A	C1orf204_ENST00000491974.1_Intron	NM_001134233.1	NP_001127705.1	Q5VU13	VSIG8_HUMAN	chromosome 1 open reading frame 204	0	Ig-like V-type 2.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			kidney(1)	1						GAGAAGGTAGAGCTCTCATCC	0.587																																						.											0													88.0	92.0	91.0					1																	159810538		692	1591	2283	SO:0001819	synonymous_variant	284677			AK096506	CCDS44253.1	1q23.1	2012-07-30			ENSG00000188004	ENSG00000188004			27647	protein-coding gene	gene with protein product							Standard	NM_001134233		Approved	FLJ39187		Q5VU13	OTTHUMG00000035430	ENST00000368102.1:c.561T>C	1.37:g.159810538A>G			Q5VU14	Silent	SNP	ENST00000368102.1	37	CCDS44253.1																																																																																				0.587	C1orf204-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085976.1	NM_001134233	
CEP170B	283638	ucsc.edu;mdanderson.org	37	14	105349472	105349472	+	Silent	SNP	C	C	T	rs12101026	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr14:105349472C>T	ENST00000414716.3	+	8	906	c.678C>T	c.(676-678)ttC>ttT	p.F226F	CEP170B_ENST00000453495.1_Silent_p.F227F|CEP170B_ENST00000556508.1_Silent_p.F156F|CEP170B_ENST00000418279.1_Silent_p.F156F	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	226						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CCAGCTACTTCGAGATCCCCA	0.716													c|||	432	0.086262	0.3116	0.0187	5008	,	,		12202	0.0		0.005	False		,,,				2504	0.002					.											0									,	835,3005		84,667,1169	11.0	16.0	14.0		678,468	-3.9	1.0	14	dbSNP_120	14	29,8183		0,29,4077	no	coding-synonymous,coding-synonymous	KIAA0284	NM_001112726.2,NM_015005.2	,	84,696,5246	TT,TC,CC		0.3531,21.7448,7.1689	,	226/1555,156/1520	105349472	864,11188	1920	4106	6026	SO:0001819	synonymous_variant	283638			AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.678C>T	14.37:g.105349472C>T			Q2KHR7|Q86TI7	Silent	SNP	ENST00000414716.3	37	CCDS45175.1																																																																																				0.716	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
MED13	9969	ucsc.edu;bcgsc.ca	37	17	60030379	60030379	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr17:60030379A>G	ENST00000397786.2	-	27	6140	c.6064T>C	c.(6064-6066)Tct>Cct	p.S2022P		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2022					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TGTACAGGAGAACCAGTTGGA	0.458																																						.											0													125.0	123.0	124.0					17																	60030379		1884	4116	6000	SO:0001583	missense	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.6064T>C	17.37:g.60030379A>G	ENSP00000380888:p.Ser2022Pro		B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.373983	0.82573	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.83673	-1.75	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.89667	0.6781	M	0.66439	2.03	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.89487	0.3754	10	0.44086	T	0.13	-15.3752	15.4442	0.75216	1.0:0.0:0.0:0.0	.	2022	Q9UHV7	MED13_HUMAN	P	2022;2021	ENSP00000380888:S2022P	ENSP00000262436:S2021P	S	-	1	0	MED13	57385161	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.957000	0.93082	2.045000	0.60652	0.460000	0.39030	TCT		0.458	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
NLRP9	338321	ucsc.edu;bcgsc.ca	37	19	56241255	56241255	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:56241255A>G	ENST00000332836.2	-	3	1963	c.1936T>C	c.(1936-1938)Tcc>Ccc	p.S646P		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	646						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		ATCGCCAGGGAGGGATCATCA	0.438																																						.											0													96.0	95.0	96.0					19																	56241255		2203	4300	6503	SO:0001583	missense	338321			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1936T>C	19.37:g.56241255A>G	ENSP00000331857:p.Ser646Pro		B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	a	13.31	2.199816	0.38905	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.54675	0.56	3.4	1.22	0.21188	.	.	.	.	.	T	0.59595	0.2205	M	0.75264	2.295	0.09310	N	1	P	0.52692	0.955	P	0.55871	0.786	T	0.48222	-0.9054	9	0.42905	T	0.14	.	3.3706	0.07219	0.6306:0.2404:0.129:0.0	.	646	Q7RTR0	NALP9_HUMAN	P	646	ENSP00000331857:S646P	ENSP00000331857:S646P	S	-	1	0	NLRP9	60933067	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.706000	0.25690	0.205000	0.20568	0.514000	0.50259	TCC		0.438	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
TMEM2	23670	ucsc.edu;bcgsc.ca	37	9	74300250	74300250	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr9:74300250T>C	ENST00000377044.4	-	24	4554	c.4015A>G	c.(4015-4017)Acc>Gcc	p.T1339A	TMEM2_ENST00000377066.5_Missense_Mutation_p.T1276A|TMEM2_ENST00000396272.3_Missense_Mutation_p.T332A	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1339					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GCAGGACTGGTAAATAGCTTA	0.398																																						.											0													83.0	77.0	79.0					9																	74300250		2203	4300	6503	SO:0001583	missense	23670				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.4015A>G	9.37:g.74300250T>C	ENSP00000366243:p.Thr1339Ala		A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	T	12.48	1.950605	0.34377	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272	T;T;T	0.74632	-0.86;-0.78;2.32	5.53	4.38	0.52667	.	0.226336	0.43919	D	0.000502	T	0.64204	0.2577	L	0.33485	1.01	0.48632	D	0.999688	B;B	0.18968	0.019;0.032	B;B	0.23275	0.02;0.045	T	0.64007	-0.6508	10	0.56958	D	0.05	.	11.5812	0.50891	0.0:0.071:0.0:0.929	.	1339;1276	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	A	1339;1276;332	ENSP00000366243:T1339A;ENSP00000366266:T1276A;ENSP00000379569:T332A	ENSP00000366243:T1339A	T	-	1	0	TMEM2	73490070	1.000000	0.71417	0.953000	0.39169	0.996000	0.88848	4.180000	0.58296	2.103000	0.63969	0.454000	0.30748	ACC		0.398	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
ZBTB34	403341	ucsc.edu	37	9	129642226	129642226	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr9:129642226A>G	ENST00000373452.2	+	1	600	c.536A>G	c.(535-537)gAc>gGc	p.D179G	ZBTB34_ENST00000319119.4_Missense_Mutation_p.D183G			Q8NCN2	ZBT34_HUMAN	zinc finger and BTB domain containing 34	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12						GCAAGCAGTGACCTCCGGATG	0.587																																						.											0													48.0	53.0	52.0					9																	129642226		1979	4155	6134	SO:0001583	missense	403341			DQ227306	CCDS48023.1	9q33.3	2013-01-08			ENSG00000177125	ENSG00000177125		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31446	protein-coding gene	gene with protein product		611692				16718364	Standard	NM_001099270		Approved	KIAA1993, MGC24652, ZNF918	uc004bqm.4	Q8NCN2	OTTHUMG00000020694	ENST00000373452.2:c.536A>G	9.37:g.129642226A>G	ENSP00000362551:p.Asp179Gly		Q38IA7|Q5VYE9	Missense_Mutation	SNP	ENST00000373452.2	37	CCDS48023.1	.	.	.	.	.	.	.	.	.	.	A	18.94	3.728981	0.69074	.	.	ENSG00000177125	ENST00000319119;ENST00000373452	T;T	0.13420	2.59;2.61	5.54	5.54	0.83059	.	0.105167	0.64402	D	0.000006	T	0.10680	0.0261	N	0.24115	0.695	0.58432	D	0.999997	B	0.20780	0.048	B	0.20384	0.029	T	0.19224	-1.0312	10	0.16896	T	0.51	.	15.9596	0.79918	1.0:0.0:0.0:0.0	.	179	Q8NCN2	ZBT34_HUMAN	G	183;179	ENSP00000317534:D183G;ENSP00000362551:D179G	ENSP00000317534:D183G	D	+	2	0	ZBTB34	128682047	1.000000	0.71417	0.258000	0.24420	0.704000	0.40688	8.601000	0.90864	2.220000	0.72140	0.533000	0.62120	GAC		0.587	ZBTB34-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001099270	
AHNAK2	113146	mdanderson.org	37	14	105410417	105410417	+	Silent	SNP	G	G	A	rs200284292	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr14:105410417G>A	ENST00000333244.5	-	7	11490	c.11371C>T	c.(11371-11373)Ctg>Ttg	p.L3791L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3791						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTGTCGGCCAGGGACAGGTCC	0.582													.|||	177	0.0353435	0.053	0.0231	5008	,	,		20409	0.0417		0.004	False		,,,				2504	0.046					.											0													216.0	217.0	217.0					14																	105410417		1998	4162	6160	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11371C>T	14.37:g.105410417G>A			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.582	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105410435	105410435	+	Silent	SNP	G	G	A	rs201237638	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr14:105410435G>A	ENST00000333244.5	-	7	11472	c.11353C>T	c.(11353-11355)Ctg>Ttg	p.L3785L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3785						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCCCCTCCAGCTGTGCACTA	0.582													.|||	181	0.0361422	0.0545	0.0245	5008	,	,		20290	0.0437		0.004	False		,,,				2504	0.045					.											0													195.0	197.0	196.0					14																	105410435		1999	4161	6160	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.11353C>T	14.37:g.105410435G>A			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.582	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105413143	105413143	+	Missense_Mutation	SNP	G	G	A	rs201434975	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr14:105413143G>A	ENST00000333244.5	-	7	8764	c.8645C>T	c.(8644-8646)cCa>cTa	p.P2882L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2882						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTGGCCCTCTGGGAGTTTCAC	0.622																																						.											0													121.0	131.0	128.0					14																	105413143		1909	4115	6024	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8645C>T	14.37:g.105413143G>A	ENSP00000353114:p.Pro2882Leu		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	a	8.332	0.826661	0.16749	.	.	ENSG00000185567	ENST00000333244	T	0.03272	3.99	3.27	1.39	0.22231	.	.	.	.	.	T	0.07728	0.0194	M	0.83384	2.64	0.09310	N	1	B	0.15473	0.013	B	0.17979	0.02	T	0.18178	-1.0345	9	0.72032	D	0.01	.	8.7413	0.34558	0.0941:0.0:0.7578:0.1481	.	2882	Q8IVF2	AHNK2_HUMAN	L	2882	ENSP00000353114:P2882L	ENSP00000353114:P2882L	P	-	2	0	AHNAK2	104484188	0.015000	0.18098	0.000000	0.03702	0.000000	0.00434	1.021000	0.30040	-0.178000	0.10672	-4.235000	0.00009	CCA		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ANKRD30BL	554226	mdanderson.org	37	2	132905792	132905792	+	Missense_Mutation	SNP	G	G	C	rs189049364		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr2:132905792G>C	ENST00000409867.1	-	6	938	c.689C>G	c.(688-690)tCt>tGt	p.S230C	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	230								p.S230C(2)		endometrium(1)|kidney(3)	4						TGTTCCTTCAGATGTTCCTTC	0.443																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.689C>G	2.37:g.132905792G>C	ENSP00000386398:p.Ser230Cys		B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	8.999	0.979581	0.18812	.	.	ENSG00000163046	ENST00000409867	T	0.38560	1.13	0.109	0.109	0.14578	.	.	.	.	.	T	0.32793	0.0841	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28427	-1.0044	5	0.35671	T	0.21	.	.	.	.	.	.	.	.	C	230	ENSP00000386398:S230C	ENSP00000386398:S230C	S	-	2	0	ANKRD30BL	132622262	0.200000	0.23398	0.088000	0.20740	0.105000	0.19272	0.320000	0.19540	0.181000	0.19994	0.184000	0.17185	TCT		0.443	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
AQP7	364	mdanderson.org	37	9	33385786	33385786	+	Missense_Mutation	SNP	C	C	G	rs76908057		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr9:33385786C>G	ENST00000537089.1	-	6	646	c.328G>C	c.(328-330)Gag>Cag	p.E110Q	AQP7_ENST00000377425.4_Missense_Mutation_p.E145Q|AQP7_ENST00000539936.1_Missense_Mutation_p.E202Q|AQP7_ENST00000541274.1_Missense_Mutation_p.R70T			O14520	AQP7_HUMAN	aquaporin 7	202					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		ACCAGCGCCTCTGTTCCTGGC	0.617																																						.											0													112.0	100.0	104.0					9																	33385786		2203	4300	6503	SO:0001583	missense	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.328G>C	9.37:g.33385786C>G	ENSP00000441619:p.Glu110Gln		Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	3.965|3.965	-0.009525|-0.009525	0.07727|0.07727	.|.	.|.	ENSG00000165269|ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503|ENST00000541274	D;D;D;D;D;D;D;D;D|T	0.85171|0.51325	-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95|0.71	5.02|5.02	3.11|3.11	0.35812|0.35812	Aquaporin-like (2);|.	0.285780|.	0.38326|.	N|.	0.001735|.	T|T	0.23688|0.23688	0.0573|0.0573	N|N	0.01817|0.01817	-0.705|-0.705	0.40946|0.40946	P|P	0.015494000000000008|0.015494000000000008	B;B;B;B|B	0.06786|0.02656	0.0;0.0;0.001;0.001|0.0	B;B;B;B|B	0.12837|0.01281	0.001;0.001;0.004;0.008|0.0	T|T	0.10109|0.10109	-1.0644|-1.0644	9|8	0.26408|0.32370	T|T	0.33|0.25	-2.4877|-2.4877	14.8905|14.8905	0.70606|0.70606	0.0:0.6125:0.3875:0.0|0.0:0.6125:0.3875:0.0	.|.	201;202;145;202|70	Q5T5M0;B7Z4U2;Q6P5T0;O14520|B7Z7F6	.;.;.;AQP7_HUMAN|.	Q|T	110;201;70;202;145;110;201;202;138|70	ENSP00000441619:E110Q;ENSP00000368821:E201Q;ENSP00000412868:E70Q;ENSP00000297988:E202Q;ENSP00000396111:E145Q;ENSP00000410138:E110Q;ENSP00000368820:E201Q;ENSP00000439534:E202Q;ENSP00000368817:E138Q|ENSP00000438860:R70T	ENSP00000297988:E202Q|ENSP00000438860:R70T	E|R	-|-	1|2	0|0	AQP7|AQP7	33375786|33375786	0.056000|0.056000	0.20664|0.20664	0.962000|0.962000	0.40283|0.40283	0.164000|0.164000	0.22412|0.22412	0.682000|0.682000	0.25335|0.25335	0.263000|0.263000	0.21812|0.21812	-0.139000|-0.139000	0.14373|0.14373	GAG|AGA		0.617	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
CHTF18	63922	mdanderson.org	37	16	840607	840607	+	Missense_Mutation	SNP	C	C	G	rs149274107	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr16:840607C>G	ENST00000262315.9	+	7	898	c.835C>G	c.(835-837)Cac>Gac	p.H279D	RPUSD1_ENST00000567114.1_5'Flank|RPUSD1_ENST00000561734.1_5'Flank|CHTF18_ENST00000455171.2_Missense_Mutation_p.H307D|CHTF18_ENST00000317063.6_Missense_Mutation_p.H474D|RPUSD1_ENST00000565809.1_5'Flank|RPUSD1_ENST00000007264.2_5'Flank|CHTF18_ENST00000491530.1_3'UTR	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	279					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CGCCTCCAGTCACTGCCTCTG	0.632													C|||	39	0.00778754	0.0295	0.0	5008	,	,		13649	0.0		0.0	False		,,,				2504	0.0					.											0								C	ASP/HIS	97,4023		1,95,1964	34.0	39.0	38.0		835	4.2	0.9	16	dbSNP_134	38	0,8378		0,0,4189	yes	missense	CHTF18	NM_022092.2	81	1,95,6153	GG,GC,CC		0.0,2.3544,0.7761	benign	279/976	840607	97,12401	2060	4189	6249	SO:0001583	missense	63922			BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.835C>G	16.37:g.840607C>G	ENSP00000262315:p.His279Asp		B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	37	CCDS45371.1	18|18	0.008241758241758242|0.008241758241758242	18|18	0.036585365853658534|0.036585365853658534	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	C|C	10.75|10.75	1.439532|1.439532	0.25900|0.25900	0.023544|0.023544	0.0|0.0	ENSG00000127586|ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315|ENST00000426047	T;T;T|.	0.09723|.	2.95;3.0;2.99|.	5.2|5.2	4.18|4.18	0.49190|0.49190	.|.	0.215873|.	0.48767|.	D|.	0.000165|.	T|.	0.22244|.	0.0536|.	L|L	0.34521|0.34521	1.04|1.04	0.49582|0.49582	D|D	0.999803|0.999803	P;P|.	0.44006|.	0.824;0.73|.	B;B|.	0.38020|.	0.263;0.135|.	T|.	0.17137|.	-1.0379|.	10|.	0.12103|0.30854	T|T	0.63|0.27	-28.5535|-28.5535	12.2151|12.2151	0.54402|0.54402	0.1711:0.8288:0.0:0.0|0.1711:0.8288:0.0:0.0	.|.	307;279|.	Q8WVB6-2;Q8WVB6|.	.;CTF18_HUMAN|.	D|X	474;307;279|174	ENSP00000313029:H474D;ENSP00000406252:H307D;ENSP00000262315:H279D|.	ENSP00000262315:H279D|ENSP00000412015:S174X	H|S	+|+	1|2	0|0	CHTF18|CHTF18	780608|780608	0.929000|0.929000	0.31497|0.31497	0.872000|0.872000	0.34217|0.34217	0.050000|0.050000	0.14768|0.14768	3.112000|3.112000	0.50368|0.50368	2.436000|2.436000	0.82500|0.82500	0.478000|0.478000	0.44815|0.44815	CAC|TCA		0.632	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
CHTF18	63922	mdanderson.org	37	16	845819	845819	+	Silent	SNP	A	A	G	rs2294446	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr16:845819A>G	ENST00000262315.9	+	17	2373	c.2310A>G	c.(2308-2310)gcA>gcG	p.A770A	CHTF18_ENST00000455171.2_Silent_p.A798A|CHTF18_ENST00000317063.6_Silent_p.A979A	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	770					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				ACATTCTTGCACCCAAGCTCC	0.687													N|||	988	0.197284	0.357	0.0865	5008	,	,		11945	0.1012		0.0169	False		,,,				2504	0.3446					.											0										1164,3060		143,878,1091	18.0	26.0	24.0		2310	-8.4	0.0	16	dbSNP_100	24	179,8245		1,177,4034	yes	coding-synonymous	CHTF18	NM_022092.2		144,1055,5125	GG,GA,AA		2.1249,27.5568,10.6183		770/976	845819	1343,11305	2112	4212	6324	SO:0001819	synonymous_variant	63922			BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2310A>G	16.37:g.845819A>G			B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Silent	SNP	ENST00000262315.9	37	CCDS45371.1																																																																																				0.687	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
DDX12P	440081	mdanderson.org	37	12	9572801	9572801	+	IGR	SNP	C	C	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr12:9572801C>T								RP13-735L24.1 (22588 upstream) : SNORA75 (24852 downstream)														p.A751A(2)									ACCTGGAATACGCCAGCAGCA	0.557																																						.											2	Substitution - coding silent(2)	lung(2)											23.0	9.0	13.0					12																	9572801		688	1575	2263	SO:0001628	intergenic_variant	440081																															12.37:g.9572801C>T				RNA	SNP		37																																																																																				0	0.557								
EP400	57634	mdanderson.org	37	12	132547090	132547090	+	Silent	SNP	A	A	G	rs7974276	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr12:132547090A>G	ENST00000333577.4	+	48	8395	c.8286A>G	c.(8284-8286)caA>caG	p.Q2762Q	EP400_ENST00000330386.6_Silent_p.Q2645Q|EP400_ENST00000389562.2_Silent_p.Q2725Q|EP400_ENST00000389561.2_Silent_p.Q2726Q|EP400_ENST00000332482.4_Silent_p.Q2689Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2762	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacaacagcagc	0.557													G|||	1450	0.289537	0.6316	0.1671	5008	,	,		15386	0.1865		0.1322	False		,,,				2504	0.182					.											0													26.0	30.0	29.0					12																	132547090		2181	4250	6431	SO:0001819	synonymous_variant	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8286A>G	12.37:g.132547090A>G			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																					0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
F12	2161	mdanderson.org	37	5	176831544	176831544	+	Silent	SNP	G	G	A	rs41309752	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr5:176831544G>A	ENST00000253496.3	-	8	804	c.756C>T	c.(754-756)gcC>gcT	p.A252A	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	252	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	GCGCTTGCTCGGCAGTCACGT	0.761									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	138	0.0275559	0.0567	0.0101	5008	,	,		13984	0.0		0.007	False		,,,				2504	0.0501					.											0								G		211,4127		1,209,1959	10.0	13.0	12.0		756	-10.1	0.0	5	dbSNP_127	12	32,8508		0,32,4238	no	coding-synonymous	F12	NM_000505.3		1,241,6197	AA,AG,GG		0.3747,4.864,1.8869		252/616	176831544	243,12635	2169	4270	6439	SO:0001819	synonymous_variant	2161	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.756C>T	5.37:g.176831544G>A		1934	P78339	Silent	SNP	ENST00000253496.3	37	CCDS34302.1																																																																																				0.761	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
FAM186A	121006	mdanderson.org	37	12	50745811	50745811	+	Missense_Mutation	SNP	G	G	A	rs34782671		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr12:50745811G>A	ENST00000327337.5	-	4	4803	c.4804C>T	c.(4804-4806)Cct>Tct	p.P1602S	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.P1602S	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1602																	GGGGTGAGAGGGATCCCCAGT	0.687																																					NSCLC(138;1796 1887 12511 19463 37884)	.											0													6.0	7.0	6.0					12																	50745811		671	1507	2178	SO:0001583	missense	121006				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4804C>T	12.37:g.50745811G>A	ENSP00000329995:p.Pro1602Ser			Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	G	0.039	-1.292696	0.01375	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.03663	3.85;3.85	4.05	-8.09	0.01090	.	.	.	.	.	T	0.01627	0.0052	N	0.08118	0	0.09310	N	1	B;B	0.22480	0.07;0.015	B;B	0.18871	0.023;0.004	T	0.35798	-0.9774	9	0.25751	T	0.34	.	6.2613	0.20901	0.1587:0.2114:0.5249:0.1051	rs34782671	1602;1602	F5GYN0;A6NE01	.;F186A_HUMAN	S	1602	ENSP00000441337:P1602S;ENSP00000329995:P1602S	ENSP00000329995:P1602S	P	-	1	0	FAM186A	49032078	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.490000	0.00975	-4.285000	0.00059	-2.005000	0.00442	CCT		0.687	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
FLVCR1	28982	mdanderson.org	37	1	213031948	213031948	+	Missense_Mutation	SNP	G	G	C	rs11120047	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr1:213031948G>C	ENST00000366971.4	+	1	352	c.154G>C	c.(154-156)Gcc>Ccc	p.A52P	FLVCR1-AS1_ENST00000356684.3_lincRNA	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	52			A -> P (in dbSNP:rs11120047). {ECO:0000269|PubMed:15489334}.		blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		GGTGAATGGGGCCCCCCGGGA	0.716													G|||	2226	0.444489	0.2269	0.3084	5008	,	,		12077	0.5476		0.5646	False		,,,				2504	0.6053				Esophageal Squamous(199;2235 2952 19233 26256)	.											0								G	PRO/ALA	992,2868		199,594,1137	3.0	6.0	5.0		154	3.2	0.0	1	dbSNP_120	5	3551,4103		951,1649,1227	yes	missense	FLVCR1	NM_014053.3	27	1150,2243,2364	CC,CG,GG		46.394,25.6995,39.4563	benign	52/556	213031948	4543,6971	1930	3827	5757	SO:0001583	missense	28982			AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.154G>C	1.37:g.213031948G>C	ENSP00000355938:p.Ala52Pro		Q1HE16|Q86XY9|Q9NVR9	Missense_Mutation	SNP	ENST00000366971.4	37	CCDS1510.1	986	0.45146520146520147	129	0.2621951219512195	129	0.356353591160221	315	0.5506993006993007	413	0.5448548812664907	G	13.29	2.193274	0.38707	0.256995	0.46394	ENSG00000162769	ENST00000366971	D	0.83250	-1.7	5.04	3.17	0.36434	.	1.238010	0.05829	N	0.617282	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.22604	0.072	B	0.23018	0.043	T	0.38845	-0.9642	9	0.30078	T	0.28	-10.6878	10.1458	0.42762	0.1646:0.0:0.8354:0.0	rs11120047;rs17846435;rs17859484;rs56728027;rs11120047	52	Q9Y5Y0	FLVC1_HUMAN	P	52	ENSP00000355938:A52P	ENSP00000355938:A52P	A	+	1	0	FLVCR1	211098571	1.000000	0.71417	0.002000	0.10522	0.010000	0.07245	5.238000	0.65366	0.534000	0.28695	-0.253000	0.11424	GCC		0.716	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089678.2	NM_014053	
FRG1B	284802	mdanderson.org	37	20	29631613	29631613	+	Missense_Mutation	SNP	T	T	C	rs199635479		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr20:29631613T>C	ENST00000278882.3	+	7	789	c.409T>C	c.(409-411)Tgt>Cgt	p.C137R	FRG1B_ENST00000358464.4_Missense_Mutation_p.C137R			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	137										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTAAAACAATGTGAAATCAA	0.318																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.409T>C	20.37:g.29631613T>C	ENSP00000278882:p.Cys137Arg		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	7.754	0.703877	0.15172	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	2.03	0.895	0.19247	.	0.000000	0.85682	D	0.000000	T	0.67468	0.2896	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.67382	0.951	T	0.64584	-0.6373	8	0.59425	D	0.04	.	5.4205	0.16398	0.0:0.1612:0.0:0.8388	.	137	Q9BZ01	FRG1B_HUMAN	R	137	.	ENSP00000278882:C137R	C	+	1	0	FRG1B	28245274	1.000000	0.71417	0.997000	0.53966	0.050000	0.14768	6.979000	0.76154	0.237000	0.21200	-0.497000	0.04613	TGT		0.318	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1	2483	mdanderson.org	37	4	190876268	190876268	+	Missense_Mutation	SNP	A	A	G	rs528665769		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr4:190876268A>G	ENST00000226798.4	+	5	616	c.394A>G	c.(394-396)Att>Gtt	p.I132V	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	132					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TTCAGATGCAATTGGACCAAG	0.358																																						.											0													91.0	91.0	91.0					4																	190876268		2203	4300	6503	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.394A>G	4.37:g.190876268A>G	ENSP00000226798:p.Ile132Val		A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.81	1.749824	0.30955	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.44083	2.0;0.93	4.04	4.04	0.47022	Actin cross-linking (1);	0.133249	0.64402	D	0.000004	T	0.31918	0.0812	L	0.42686	1.345	0.80722	D	1	B	0.18741	0.03	B	0.26693	0.072	T	0.07009	-1.0795	10	0.06891	T	0.86	2.1537	11.3071	0.49342	1.0:0.0:0.0:0.0	.	132	Q14331	FRG1_HUMAN	V	132;69	ENSP00000226798:I132V;ENSP00000435943:I69V	ENSP00000226798:I132V	I	+	1	0	FRG1	191113262	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.941000	0.75922	1.599000	0.50093	0.462000	0.41574	ATT		0.358	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
FRG2B	441581	mdanderson.org	37	10	135439077	135439077	+	Silent	SNP	T	T	C	rs201483744		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr10:135439077T>C	ENST00000425520.1	-	4	415	c.363A>G	c.(361-363)tcA>tcG	p.S121S	FRG2B_ENST00000443774.1_Silent_p.S122S	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	121						nucleus (GO:0005634)		p.S122S(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTTTATTCAATGACAAGCTGC	0.517																																						.											1	Substitution - coding silent(1)	kidney(1)											33.0	40.0	37.0					10																	135439077		2128	4248	6376	SO:0001819	synonymous_variant	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.363A>G	10.37:g.135439077T>C			Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																				0.517	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
HLA-A	3105	mdanderson.org	37	6	29911119	29911119	+	Missense_Mutation	SNP	G	G	C	rs3173419	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr6:29911119G>C	ENST00000396634.1	+	5	759	c.418G>C	c.(418-420)Gac>Cac	p.D140H	HLA-A_ENST00000376809.5_Missense_Mutation_p.D140H|HLA-A_ENST00000376806.5_Missense_Mutation_p.D140H|HLA-A_ENST00000376802.2_Missense_Mutation_p.D140H			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	140	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GTACCGGCAGGACGCCTACGA	0.662									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			N|||	273	0.0545128	0.1399	0.0461	5008	,	,		11816	0.0159		0.0308	False		,,,				2504	0.0092					.											0													36.0	27.0	30.0					6																	29911119		1496	2698	4194	SO:0001583	missense	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.418G>C	6.37:g.29911119G>C	ENSP00000379873:p.Asp140His		O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	0.014	-1.580111	0.00879	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000376802	T;T;T;T	0.00009	9.49;9.49;9.49;9.49	3.78	-7.56	0.01322	MHC class I, alpha chain, alpha1/alpha2 (6);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	79.907900	0.01339	U	0.011517	T	0.00039	0.0001	L	0.47190	1.495	0.09310	N	1	B;B;B;B;B;B	0.16603	0.018;0.001;0.001;0.003;0.003;0.001	B;B;B;B;B;B	0.26969	0.064;0.051;0.061;0.075;0.075;0.051	T	0.10706	-1.0618	10	0.23302	T	0.38	.	5.3314	0.15934	0.102:0.2286:0.5197:0.1496	rs3173419;rs3175999;rs16896879;rs28749152;rs41549418	19;140;140;140;140;140	B4DVB9;P13746;Q5SRN7;Q5SRN5;P30455;P04439	.;1A11_HUMAN;.;.;1A36_HUMAN;1A03_HUMAN	H	140	ENSP00000379873:D140H;ENSP00000366002:D140H;ENSP00000366005:D140H;ENSP00000365998:D140H	ENSP00000365998:D140H	D	+	1	0	HLA-A	30019098	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-9.138000	0.00013	-2.332000	0.00632	-4.658000	0.00004	GAC		0.662	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
KRTAP10-1	386677	mdanderson.org	37	21	45959195	45959195	+	Missense_Mutation	SNP	G	G	A	rs233316	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr21:45959195G>A	ENST00000400375.1	-	1	883	c.839C>T	c.(838-840)cCg>cTg	p.P280L	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	280			P -> L (in dbSNP:rs233316). {ECO:0000269|PubMed:15489334}.			keratin filament (GO:0045095)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						TCAGCAGGCCGGGCGGGAGCA	0.721													G|||	3114	0.621805	0.7519	0.6081	5008	,	,		14955	0.4861		0.6531	False		,,,				2504	0.5634					.											0								G	LEU/PRO,	3137,1143		1169,799,172	16.0	21.0	19.0		839,	-1.1	0.0	21	dbSNP_79	19	5643,2789		1911,1821,484	no	missense,intron	TSPEAR,KRTAP10-1	NM_198691.2,NM_144991.2	98,	3080,2620,656	AA,AG,GG		33.0764,26.7056,30.9314	probably-damaging,	280/283,	45959195	8780,3932	2140	4216	6356	SO:0001583	missense	386677			AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.839C>T	21.37:g.45959195G>A	ENSP00000383226:p.Pro280Leu		Q0VAR0|Q0VAR1	Missense_Mutation	SNP	ENST00000400375.1	37	CCDS42954.1	1309	0.5993589743589743	333	0.676829268292683	238	0.6574585635359116	276	0.4825174825174825	462	0.6094986807387863	a	0.384	-0.927214	0.02377	0.732944	0.669236	ENSG00000215455	ENST00000400375	T	0.00816	5.66	3.28	-1.15	0.09709	.	.	.	.	.	T	0.00012	0.0000	L	0.42581	1.335	0.80722	P	0.0	D	0.54047	0.964	B	0.42522	0.39	T	0.02901	-1.1096	8	0.33141	T	0.24	.	4.1151	0.10077	0.2988:0.0:0.5346:0.1666	rs233316	280	P60331	KR101_HUMAN	L	280	ENSP00000383226:P280L	ENSP00000383226:P280L	P	-	2	0	KRTAP10-1	44783623	0.001000	0.12720	0.000000	0.03702	0.056000	0.15407	-0.233000	0.09041	-0.403000	0.07622	-0.186000	0.12905	CCG		0.721	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128030.1		
DDX53	168400	mdanderson.org	37	X	23020850	23020850	+	IGR	SNP	T	T	C			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chrX:23020850T>C	ENST00000327968.5	+	0	2118				RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						GTAAATGTTATGTGTTGGTTA	0.308													T|||	294	0.0778808	0.1006	0.0331	3775	,	,		15633	0.0694		0.0328	False		,,,				2504	0.0358					.											0																																										SO:0001628	intergenic_variant	0			AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248		X.37:g.23020850T>C			Q0D2N2|Q6NVV4	RNA	SNP	ENST00000327968.5	37	CCDS35214.1																																																																																				0.308	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
MED16	10025	mdanderson.org	37	19	871135	871135	+	Silent	SNP	A	A	G	rs1683569	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:871135A>G	ENST00000589119.1	-	12	2216	c.2217T>C	c.(2215-2217)gtT>gtC	p.V739V	MED16_ENST00000325464.1_Silent_p.V739V|MED16_ENST00000312090.6_Silent_p.V758V|MED16_ENST00000395808.3_Silent_p.V739V|MED16_ENST00000606828.1_5'Flank|MED16_ENST00000269814.4_Missense_Mutation_p.L675S			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	739					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGGCGGCTAACCAGGCCGT	0.701													g|||	1326	0.264776	0.5008	0.2205	5008	,	,		12505	0.0317		0.2873	False		,,,				2504	0.1943					.											0										1482,2440		291,900,770	9.0	11.0	10.0		2217	3.1	1.0	19	dbSNP_89	10	1843,5871		223,1397,2237	no	coding-synonymous	MED16	NM_005481.2		514,2297,3007	GG,GA,AA		23.8916,37.7868,28.5751		739/878	871135	3325,8311	1961	3857	5818	SO:0001819	synonymous_variant	10025			AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.2217T>C	19.37:g.871135A>G			Q6PJT2|Q96AD4|Q96I35|Q9Y652	Silent	SNP	ENST00000589119.1	37	CCDS12047.1	567	0.25961538461538464	240	0.4878048780487805	89	0.24585635359116023	20	0.03496503496503497	218	0.287598944591029	g	18.38	3.611665	0.66558	0.377868	0.238916	ENSG00000175221	ENST00000269814	.	.	.	4.13	3.06	0.35304	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.47065	P	6.960000000000299E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.44711	-0.9310	6	0.09590	T	0.72	-40.3568	9.783	0.40660	0.177:0.0:0.823:0.0	rs1683569;rs59662712;rs1683569	675	Q9Y2X0-4	.	S	675	.	ENSP00000269814:L675S	L	-	2	0	MED16	822135	1.000000	0.71417	0.984000	0.44739	0.793000	0.44817	2.176000	0.42500	0.718000	0.32166	-0.258000	0.10820	TTA		0.701	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
MERTK	10461	mdanderson.org	37	2	112656372	112656372	+	Splice_Site	SNP	A	A	T	rs35898499	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr2:112656372A>T	ENST00000295408.4	+	1	317	c.60A>T	c.(58-60)agA>agT	p.R20S	MERTK_ENST00000409780.1_5'UTR|MERTK_ENST00000421804.2_Splice_Site_p.R20S			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	20			R -> S (in dbSNP:rs35898499). {ECO:0000269|PubMed:11062461, ECO:0000269|PubMed:17344846}.		apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TCTGGCGTAGAGGTGAGTGCG	0.741													A|||	87	0.0173722	0.0038	0.0259	5008	,	,		9832	0.0		0.0497	False		,,,				2504	0.0143					.											0								A	SER/ARG	29,4105		1,27,2039	5.0	7.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	60	2.3	0.7	2	dbSNP_126	6	408,7922		8,392,3765	no	missense-near-splice	MERTK	NM_006343.2	110	9,419,5804	TT,TA,AA		4.898,0.7015,3.5061	benign	20/1000	112656372	437,12027	2067	4165	6232	SO:0001630	splice_region_variant	10461			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.61+1A>T	2.37:g.112656372A>T			Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	CCDS2094.1	48	0.02197802197802198	1	0.0020325203252032522	12	0.03314917127071823	2	0.0034965034965034965	33	0.04353562005277045	A	4.634	0.117901	0.08881	0.007015	0.04898	ENSG00000153208	ENST00000295408;ENST00000421804	T;T	0.74421	-0.84;-0.84	3.57	2.34	0.29019	.	.	.	.	.	T	0.13927	0.0337	N	0.08118	0	0.20196	N	0.999922	B	0.14012	0.009	B	0.08055	0.003	T	0.11227	-1.0596	9	0.41790	T	0.15	.	4.9993	0.14257	0.8402:0.0:0.1598:0.0	rs35898499	20	Q12866	MERTK_HUMAN	S	20	ENSP00000295408:R20S;ENSP00000389152:R20S	ENSP00000295408:R20S	R	+	3	2	MERTK	112372843	0.688000	0.27680	0.700000	0.30305	0.009000	0.06853	0.673000	0.25203	0.694000	0.31654	0.482000	0.46254	AGA		0.741	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		Missense_Mutation
MUC16	94025	mdanderson.org	37	19	8999449	8999449	+	Missense_Mutation	SNP	G	G	T	rs76798407	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:8999449G>T	ENST00000397910.4	-	56	40929	c.40726C>A	c.(40726-40728)Cac>Aac	p.H13576N	MUC16_ENST00000380951.5_Missense_Mutation_p.H217N	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13578	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGATGCTGTGGGTCAGCTGG	0.572																																						.											0													227.0	190.0	202.0					19																	8999449		2053	4200	6253	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40726C>A	19.37:g.8999449G>T	ENSP00000381008:p.His13576Asn		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	2.590	-0.295337	0.05532	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.35605	1.3;1.3	2.95	1.87	0.25490	SEA (2);	.	.	.	.	T	0.35158	0.0922	L	0.31752	0.955	.	.	.	P;P	0.44281	0.458;0.831	B;P	0.54664	0.192;0.758	T	0.39482	-0.9612	8	0.23891	T	0.37	.	7.1711	0.25719	0.0:0.0:0.7333:0.2667	.	21221;13576	Q8WXI7;B5ME49	MUC16_HUMAN;.	N	13576;217	ENSP00000381008:H13576N;ENSP00000370338:H217N	ENSP00000370338:H217N	H	-	1	0	MUC16	8860449	0.000000	0.05858	0.319000	0.25293	0.150000	0.21749	-0.331000	0.07914	0.784000	0.33661	0.555000	0.69702	CAC		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	mdanderson.org	37	19	8999478	8999478	+	Missense_Mutation	SNP	T	T	C	rs73493659	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:8999478T>C	ENST00000397910.4	-	56	40900	c.40697A>G	c.(40696-40698)cAg>cGg	p.Q13566R	MUC16_ENST00000380951.5_Missense_Mutation_p.Q207R	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13568	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCAGTATAGCTGCTCTCTGTC	0.587																																						.											0													176.0	148.0	157.0					19																	8999478		2001	4182	6183	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40697A>G	19.37:g.8999478T>C	ENSP00000381008:p.Gln13566Arg		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.200|0.200	-1.045174|-1.045174	0.01997|0.01997	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.29397|.	1.57;1.57|.	3.48|3.48	-4.27|-4.27	0.03744|0.03744	SEA (2);|.	.|.	.|.	.|.	.|.	T|T	0.46464|0.46464	0.1394|0.1394	L|L	0.42245|0.42245	1.32|1.32	.|.	.|.	.|.	B;P|.	0.39576|.	0.001;0.679|.	B;P|.	0.51101|.	0.002;0.659|.	T|T	0.52290|0.52290	-0.8595|-0.8595	8|4	0.11485|.	T|.	0.65|.	-0.0012|-0.0012	11.6309|11.6309	0.51173|0.51173	0.0:0.6859:0.0:0.3141|0.0:0.6859:0.0:0.3141	.|.	21211;13566|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	R|G	13566;207|406	ENSP00000381008:Q13566R;ENSP00000370338:Q207R|.	ENSP00000370338:Q207R|.	Q|S	-|-	2|1	0|0	MUC16|MUC16	8860478|8860478	0.000000|0.000000	0.05858|0.05858	0.018000|0.018000	0.16275|0.16275	0.063000|0.063000	0.16089|0.16089	-2.569000|-2.569000	0.00915|0.00915	-1.289000|-1.289000	0.02375|0.02375	0.454000|0.454000	0.30748|0.30748	CAG|AGC		0.587	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	mdanderson.org	37	19	9005605	9005605	+	Silent	SNP	A	A	T	rs74835716		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:9005605A>T	ENST00000397910.4	-	46	40004	c.39801T>A	c.(39799-39801)acT>acA	p.T13267T	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13269	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCCCAGCTCAGTGATGCTGT	0.567																																						.											0													175.0	158.0	164.0					19																	9005605		2043	4185	6228	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39801T>A	19.37:g.9005605A>T			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	3.366	-0.129417	0.06753	.	.	ENSG00000181143	ENST00000542240	.	.	.	3.51	-5.81	0.02340	.	.	.	.	.	T	0.11965	0.0291	.	.	.	.	.	.	.	.	.	.	.	.	T	0.27297	-1.0078	3	.	.	.	-11.8867	0.269	0.00229	0.2614:0.1578:0.3056:0.2752	.	.	.	.	Q	107	.	.	L	-	2	0	MUC16	8866605	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.577000	0.05847	-1.052000	0.03222	-2.889000	0.00095	CTG		0.567	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC17	140453	mdanderson.org	37	7	100680117	100680117	+	Missense_Mutation	SNP	T	T	C	rs147353603	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr7:100680117T>C	ENST00000306151.4	+	3	5484	c.5420T>C	c.(5419-5421)aTg>aCg	p.M1807T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1807	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGTGAAGGAATGACTCCATTA	0.507													-|||	4	0.000798722	0.0008	0.0	5008	,	,		27011	0.003		0.0	False		,,,				2504	0.0					.											0													250.0	253.0	252.0					7																	100680117		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5420T>C	7.37:g.100680117T>C	ENSP00000302716:p.Met1807Thr		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.005	-2.166907	0.00318	.	.	ENSG00000169876	ENST00000306151	T	0.01854	4.6	0.373	-0.746	0.11095	.	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48670	-0.9015	8	0.09338	T	0.73	.	.	.	.	.	1807	Q685J3	MUC17_HUMAN	T	1807	ENSP00000302716:M1807T	ENSP00000302716:M1807T	M	+	2	0	MUC17	100466837	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.274000	0.00531	-4.523000	0.00044	-3.958000	0.00015	ATG		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	mdanderson.org	37	7	100680120	100680120	+	Missense_Mutation	SNP	C	C	A	rs147991653	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr7:100680120C>A	ENST00000306151.4	+	3	5487	c.5423C>A	c.(5422-5424)aCt>aAt	p.T1808N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1808	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T1808N(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGGAATGACTCCATTAACA	0.512													-|||	4	0.000798722	0.0008	0.0	5008	,	,		25905	0.003		0.0	False		,,,				2504	0.0					.											1	Substitution - Missense(1)	skin(1)											246.0	249.0	248.0					7																	100680120		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5423C>A	7.37:g.100680120C>A	ENSP00000302716:p.Thr1808Asn		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	76	0.0347985347985348	28	0.056910569105691054	21	0.058011049723756904	12	0.02097902097902098	15	0.01978891820580475	c	0.142	-1.100945	0.01843	.	.	ENSG00000169876	ENST00000306151	T	0.02177	4.41	0.471	-0.615	0.11587	.	.	.	.	.	T	0.00210	0.0006	N	0.19112	0.55	0.09310	N	1	D	0.58620	0.983	B	0.40677	0.337	T	0.51988	-0.8635	8	0.32370	T	0.25	.	.	.	.	.	1808	Q685J3	MUC17_HUMAN	N	1808	ENSP00000302716:T1808N	ENSP00000302716:T1808N	T	+	2	0	MUC17	100466840	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.305000	0.19254	-0.243000	0.09653	-1.404000	0.01136	ACT		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC5B	727897	mdanderson.org	37	11	1253969	1253969	+	Silent	SNP	A	A	G	rs72846370		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr11:1253969A>G	ENST00000529681.1	+	17	2092	c.2034A>G	c.(2032-2034)gtA>gtG	p.V678V	MUC5B_ENST00000447027.1_Silent_p.V681V	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	678					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAAGGGCGTACAGCTCAGCG	0.682																																						.											0													23.0	26.0	25.0					11																	1253969		2131	4242	6373	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2034A>G	11.37:g.1253969A>G			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
NAV1	89796	mdanderson.org	37	1	201618543	201618543	+	Silent	SNP	C	C	T	rs6665525	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr1:201618543C>T	ENST00000367296.4	+	1	1167	c.747C>T	c.(745-747)agC>agT	p.S249S	NAV1_ENST00000295624.6_Silent_p.S249S|NAV1_ENST00000367300.3_Silent_p.S249S|NAV1_ENST00000367297.4_Silent_p.S249S|NAV1_ENST00000367302.1_Silent_p.S262S	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	249					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TGCTCTTCAGCCAGATGCTGG	0.682													C|||	13	0.00259585	0.0098	0.0	5008	,	,		12043	0.0		0.0	False		,,,				2504	0.0					.											0								C		40,4282		1,38,2122	9.0	11.0	10.0		747	1.8	1.0	1	dbSNP_116	10	0,8510		0,0,4255	no	coding-synonymous	NAV1	NM_020443.4		1,38,6377	TT,TC,CC		0.0,0.9255,0.3117		249/1878	201618543	40,12792	2161	4255	6416	SO:0001819	synonymous_variant	89796			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.747C>T	1.37:g.201618543C>T			A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	ENST00000367296.4	37	CCDS1414.2																																																																																				0.682	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
OR4N4	283694	mdanderson.org	37	15	22383138	22383138	+	Silent	SNP	C	C	G			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr15:22383138C>G	ENST00000328795.4	+	1	757	c.666C>G	c.(664-666)ctC>ctG	p.L222L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CAGTCATCCTCTGCCATGTTC	0.498																																						.											0													163.0	135.0	145.0					15																	22383138		2192	4261	6453	SO:0001819	synonymous_variant	283694			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.666C>G	15.37:g.22383138C>G			Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	CCDS32173.1																																																																																				0.498	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1		
PI4KA	5297	mdanderson.org	37	22	21088357	21088357	+	Silent	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr22:21088357G>A	ENST00000572273.1	-	34	4082	c.3852C>T	c.(3850-3852)caC>caT	p.H1284H	PI4KA_ENST00000255882.6_Silent_p.H1342H|PI4KA_ENST00000414196.3_Silent_p.H94H			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1284					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TGGCCGCCACGTGCCGGTTCA	0.637																																					GBM(136;1332 1831 3115 23601 50806)	.											0													21.0	19.0	19.0					22																	21088357		2198	4289	6487	SO:0001819	synonymous_variant	5297			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3852C>T	22.37:g.21088357G>A			Q7Z625|Q9UPG2	Silent	SNP	ENST00000572273.1	37																																																																																					0.637	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
POM121L1P	25812	mdanderson.org	37	22	22985303	22985303	+	RNA	SNP	C	C	G	rs6003123	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr22:22985303C>G	ENST00000402027.1	-	0	1641					NR_024591.1		Q3SYA9	P12L1_HUMAN	POM121 transmembrane nucleoporin-like 1, pseudogene																		GGGAGGTCTGCGATCTCTGGT	0.617													.|||	3985	0.795727	0.7156	0.7723	5008	,	,		10335	0.9653		0.6372	False		,,,				2504	0.909					.											0																																												25812					22q11.22	2013-10-11	2012-03-13	2009-01-15	ENSG00000183169	ENSG00000183169			16439	pseudogene	pseudogene	"""POM121-like 2"""		"""POM121 membrane glycoprotein-like 1 (rat)"", ""POM121 membrane glycoprotein-like 1, pseudogene"""	POM121L1		9074928	Standard	NR_024591		Approved		uc011ait.1	Q3SYA9	OTTHUMG00000151169		22.37:g.22985303C>G				RNA	SNP	ENST00000402027.1	37																																																																																					0.617	POM121L1P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000468457.1	NR_024591	
PRAM1	84106	mdanderson.org	37	19	8564469	8564469	+	Missense_Mutation	SNP	C	C	G	rs371461475|rs4990821	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:8564469C>G	ENST00000423345.4	-	2	743	c.223G>C	c.(223-225)Gag>Cag	p.E75Q	PRAM1_ENST00000255612.3_Missense_Mutation_p.E75Q			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	123	8 X 12 AA repeats of K-P-P-[PQ]-P-[EQ]- [VAF]-T-D-L-P-K.|Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						TCAGTGACCTCAGGCGGCGGG	0.642													C|||	1814	0.36222	0.6346	0.2968	5008	,	,		12296	0.1587		0.3062	False		,,,				2504	0.3078					.											0													41.0	53.0	49.0					19																	8564469		1849	4082	5931	SO:0001583	missense	84106			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.223G>C	19.37:g.8564469C>G	ENSP00000408342:p.Glu75Gln		Q8N6W7	Missense_Mutation	SNP	ENST00000423345.4	37	CCDS45954.2	824	0.3772893772893773	382	0.7764227642276422	110	0.30386740331491713	82	0.14335664335664336	250	0.32981530343007914	c	8.200	0.797994	0.16327	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.14144	2.53;2.53	3.74	-1.55	0.08558	.	2.531360	0.02280	N	0.069320	T	0.00012	0.0000	L	0.41824	1.3	0.80722	P	0.0	B;B	0.33940	0.433;0.433	B;B	0.27887	0.084;0.084	T	0.36065	-0.9763	9	0.24483	T	0.36	.	6.2323	0.20742	0.0:0.3333:0.4737:0.193	rs4990821	75;123	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	Q	75	ENSP00000255612:E75Q;ENSP00000408342:E75Q	ENSP00000255612:E75Q	E	-	1	0	PRAM1	8470469	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.203000	0.09438	-0.252000	0.09528	-0.187000	0.12897	GAG		0.642	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	NM_032152	
RSPH10B2	728194	mdanderson.org	37	7	6836259	6836259	+	Missense_Mutation	SNP	C	C	T	rs2528353	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr7:6836259C>T	ENST00000403107.1	+	19	2681	c.2294C>T	c.(2293-2295)aCg>aTg	p.T765M	CCZ1B_ENST00000597208.1_Intron|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000359718.3_3'UTR|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.T765M|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.T765M|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.T765M			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	765				T -> M (in Ref. 1; BAG37482 and 3; AAH34495/AAI57865/AAI57872). {ECO:0000305}.						breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GTCAATAATACGTACGTCTTC	0.433													.|||	1201	0.239816	0.18	0.2233	5008	,	,		10379	0.2639		0.1332	False		,,,				2504	0.4172					.											0													195.0	196.0	196.0					7																	6836259		1823	3749	5572	SO:0001583	missense	728194				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.2294C>T	7.37:g.6836259C>T	ENSP00000384766:p.Thr765Met		A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000403107.1	37	CCDS43552.1	.	.	.	.	.	.	.	.	.	.	T	0.830	-0.745624	0.03065	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	2.94	1.75	0.24633	.	1.687920	0.03443	N	0.209514	T	0.20292	0.0488	N	0.01576	-0.805	0.80722	P	0.0	B	0.09022	0.002	B	0.04013	0.001	T	0.19353	-1.0308	9	0.13108	T	0.6	.	5.0327	0.14419	0.0:0.2814:0.0:0.7186	.	765	B2RC85	R10B2_HUMAN	M	765	ENSP00000384766:T765M;ENSP00000386102:T765M;ENSP00000297186:T765M;ENSP00000416710:T765M	ENSP00000297186:T765M	T	+	2	0	RSPH10B2	6802784	0.257000	0.24022	0.001000	0.08648	0.058000	0.15608	1.923000	0.40055	-0.033000	0.13736	-1.381000	0.01174	ACG		0.433	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324184.4	NM_001099697	
SLC35G5	83650	mdanderson.org	37	8	11189604	11189604	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr8:11189604G>T	ENST00000382435.4	+	1	1208	c.989G>T	c.(988-990)tGt>tTt	p.C330F		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	330						integral component of membrane (GO:0016021)											AACCTCAGCTGTGAGAGGACA	0.507																																						.											0													65.0	66.0	66.0					8																	11189604		2203	4300	6503	SO:0001583	missense	83650			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.989G>T	8.37:g.11189604G>T	ENSP00000371872:p.Cys330Phe		A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	g	1.779	-0.482469	0.04383	.	.	ENSG00000177710	ENST00000382435	T	0.26957	1.7	.	.	.	.	0.000000	0.48767	D	0.000176	T	0.14787	0.0357	L	0.44542	1.39	0.32802	D	0.500314	B	0.06786	0.001	B	0.04013	0.001	T	0.41963	-0.9479	8	0.02654	T	1	-4.1531	.	.	.	.	330	Q96KT7	S35G5_HUMAN	F	330	ENSP00000371872:C330F	ENSP00000371872:C330F	C	+	2	0	SLC35G5	11227014	0.285000	0.24296	0.299000	0.25016	0.299000	0.27559	1.275000	0.33144	0.064000	0.16427	0.064000	0.15345	TGT		0.507	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
SLC35G5	83650	mdanderson.org	37	8	11189616	11189616	+	Missense_Mutation	SNP	G	G	A	rs200495954		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr8:11189616G>A	ENST00000382435.4	+	1	1220	c.1001G>A	c.(1000-1002)gGg>gAg	p.G334E		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	334						integral component of membrane (GO:0016021)											GAGAGGACAGGGAAGGTGGAG	0.498																																						.											0													55.0	58.0	57.0					8																	11189616		2203	4300	6503	SO:0001583	missense	83650			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.1001G>A	8.37:g.11189616G>A	ENSP00000371872:p.Gly334Glu		A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	g	5.777	0.327688	0.10956	.	.	ENSG00000177710	ENST00000382435	T	0.38560	1.13	.	.	.	.	0.350088	0.20838	N	0.084754	T	0.26484	0.0647	L	0.50333	1.59	0.28172	N	0.928524	B	0.06786	0.001	B	0.04013	0.001	T	0.35574	-0.9783	8	0.02654	T	1	-1.4658	.	.	.	.	334	Q96KT7	S35G5_HUMAN	E	334	ENSP00000371872:G334E	ENSP00000371872:G334E	G	+	2	0	SLC35G5	11227026	0.086000	0.21541	0.277000	0.24703	0.278000	0.26855	-0.233000	0.09041	0.064000	0.16427	0.064000	0.15345	GGG		0.498	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
TAOK2	9344	mdanderson.org	37	16	29999225	29999225	+	Missense_Mutation	SNP	G	G	A	rs11864149	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr16:29999225G>A	ENST00000308893.4	+	16	4675	c.3632G>A	c.(3631-3633)cGc>cAc	p.R1211H	TAOK2_ENST00000543033.1_Missense_Mutation_p.R1098H|TAOK2_ENST00000279394.3_Intron|TAOK2_ENST00000416441.2_Missense_Mutation_p.R1038H	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	1211				R -> H (in Ref. 1; AAD45616). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						CCTGCCTCCCGCCAGCCACTG	0.721													G|||	368	0.0734824	0.1604	0.0706	5008	,	,		11363	0.003		0.0835	False		,,,				2504	0.0204					.											0								G	,HIS/ARG	479,3449		22,435,1507	6.0	7.0	6.0		,3632	0.6	0.1	16	dbSNP_120	6	507,7365		18,471,3447	no	intron,missense	TAOK2	NM_004783.2,NM_016151.2	,29	40,906,4954	AA,AG,GG		6.4405,12.1945,8.3559	,possibly-damaging	,1211/1236	29999225	986,10814	1964	3936	5900	SO:0001583	missense	9344			AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.3632G>A	16.37:g.29999225G>A	ENSP00000310094:p.Arg1211His		A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Missense_Mutation	SNP	ENST00000308893.4	37	CCDS10663.1	174	0.07967032967032966	79	0.16056910569105692	33	0.09116022099447514	1	0.0017482517482517483	61	0.08047493403693931	G	0.054	-1.241336	0.01493	0.121945	0.064405	ENSG00000149930	ENST00000308893;ENST00000543033	T;T	0.71222	-0.52;-0.55	4.04	0.591	0.17465	.	1.515130	0.04227	N	0.334654	T	0.00271	0.0008	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.02625	-1.1132	8	.	.	.	.	7.7362	0.28815	0.2033:0.1469:0.6498:0.0	rs11864149	1402;1038;1211	Q86V37;Q9UL54-3;Q9UL54	.;.;TAOK2_HUMAN	H	1211;1098	ENSP00000310094:R1211H;ENSP00000440336:R1098H	.	R	+	2	0	TAOK2	29906726	0.000000	0.05858	0.100000	0.21137	0.027000	0.11550	0.386000	0.20702	0.037000	0.15575	-1.119000	0.02030	CGC		0.721	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151	
TRIM48	79097	mdanderson.org	37	11	55032663	55032663	+	Missense_Mutation	SNP	T	T	C	rs200778682	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr11:55032663T>C	ENST00000417545.2	+	2	418	c.332T>C	c.(331-333)aTt>aCt	p.I111T		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	95						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATGTGTGGCATTCACAGGGAG	0.498																																						.											0													98.0	90.0	93.0					11																	55032663		2188	4256	6444	SO:0001583	missense	79097			AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.332T>C	11.37:g.55032663T>C	ENSP00000402414:p.Ile111Thr		Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	c	0	-2.612529	0.00120	.	.	ENSG00000150244	ENST00000417545	T	0.40476	1.03	0.596	0.596	0.17496	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, B-box (3);	.	.	.	.	T	0.13114	0.0318	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	9	0.02654	T	1	.	1.7225	0.02915	0.3221:0.4182:0.0:0.2597	.	95	Q8IWZ4	TRI48_HUMAN	T	111	ENSP00000402414:I111T	ENSP00000402414:I111T	I	+	2	0	TRIM48	54789239	0.000000	0.05858	0.154000	0.22540	0.130000	0.20726	-4.117000	0.00292	-0.174000	0.10743	-1.141000	0.01876	ATT		0.498	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
TUBB8	347688	mdanderson.org	37	10	93778	93778	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr10:93778G>A	ENST00000309812.4	-	4	616	c.554C>T	c.(553-555)gCc>gTc	p.A185V	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.A113V	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	185					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TGAGAGGGTGGCGTTGTAGGG	0.517																																					Pancreas(192;2041 3010 9013 18103)	.											0													109.0	99.0	102.0					10																	93778		2203	4296	6499	SO:0001583	missense	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.554C>T	10.37:g.93778G>A	ENSP00000311042:p.Ala185Val		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.641506	0.47153	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.77358	-1.09	.	.	.	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.56097	U	0.000022	D	0.87470	0.6185	M	0.92459	3.31	0.36968	D	0.893686	D;D	0.76494	0.997;0.999	D;D	0.75020	0.983;0.985	D	0.86042	0.1520	9	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	148;185	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	V	113;151;148;185	ENSP00000403895:A113V	ENSP00000272035:A151V	A	-	2	0	RP11-631M21.2	83778	1.000000	0.71417	0.341000	0.25589	0.344000	0.29017	6.543000	0.73874	0.119000	0.18210	0.121000	0.15741	GCC		0.517	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
TYMP	1890	mdanderson.org	37	22	50965102	50965102	+	Silent	SNP	C	C	T	rs8141558	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr22:50965102C>T	ENST00000252029.3	-	7	993	c.831G>A	c.(829-831)ctG>ctA	p.L277L	TYMP_ENST00000395678.3_Silent_p.L277L|SCO2_ENST00000252785.3_5'Flank|SCO2_ENST00000543927.1_5'Flank|TYMP_ENST00000395680.1_Silent_p.L277L|CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000535425.1_5'Flank|TYMP_ENST00000395681.1_Silent_p.L277L|SCO2_ENST00000395693.3_5'Flank	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	277					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	CGCAGCGACCCAGGGGCTTGT	0.711													C|||	177	0.0353435	0.1256	0.0159	5008	,	,		12653	0.0		0.0	False		,,,				2504	0.0					.											0								C	,,	381,3875		17,347,1764	8.0	8.0	8.0		831,831,831	4.6	0.7	22	dbSNP_116	8	10,8426		0,10,4208	no	coding-synonymous,coding-synonymous,coding-synonymous	TYMP	NM_001113755.1,NM_001113756.1,NM_001953.3	,,	17,357,5972	TT,TC,CC		0.1185,8.9521,3.0807	,,	277/483,277/483,277/483	50965102	391,12301	2128	4218	6346	SO:0001819	synonymous_variant	1890			M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.831G>A	22.37:g.50965102C>T			A8MW15|H9KVA0|Q13390|Q8WVB7	Silent	SNP	ENST00000252029.3	37	CCDS14096.1																																																																																				0.711	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317081.1	NM_001953	
WDR18	57418	mdanderson.org	37	19	984533	984533	+	Silent	SNP	T	T	C	rs2301810	byFrequency	TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr19:984533T>C	ENST00000251289.5	+	1	203	c.180T>C	c.(178-180)aaT>aaC	p.N60N	WDR18_ENST00000587001.2_Silent_p.N60N|WDR18_ENST00000591997.1_Intron	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	60					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGCAAGAATTACATCAGCG	0.711													.|||	2246	0.448482	0.4667	0.438	5008	,	,		11366	0.3899		0.5577	False		,,,				2504	0.3793					.											0								C		1857,2351		456,945,703	7.0	9.0	9.0		180	3.3	1.0	19	dbSNP_100	9	4066,4176		1101,1864,1156	no	coding-synonymous	WDR18	NM_024100.3		1557,2809,1859	CC,CT,TT		49.3327,44.1302,47.5743		60/433	984533	5923,6527	2104	4121	6225	SO:0001819	synonymous_variant	57418				CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.180T>C	19.37:g.984533T>C			O60390|Q9BWR2	Silent	SNP	ENST00000251289.5	37	CCDS12051.1																																																																																				0.711	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
ZNF831	128611	mdanderson.org	37	20	57767041	57767041	+	Missense_Mutation	SNP	G	G	A	rs564350771		TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr20:57767041G>A	ENST00000371030.2	+	1	967	c.967G>A	c.(967-969)Gcg>Acg	p.A323T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	323							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGCGACGGCAGCGGAGAAGCC	0.716													.|||	1	0.000199681	0.0008	0.0	5008	,	,		11993	0.0		0.0	False		,,,				2504	0.0					.											0													11.0	14.0	13.0					20																	57767041		1658	3888	5546	SO:0001583	missense	128611			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.967G>A	20.37:g.57767041G>A	ENSP00000360069:p.Ala323Thr		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	5.466	0.271092	0.10349	.	.	ENSG00000124203	ENST00000371030	T	0.04234	3.67	5.19	-3.85	0.04243	.	.	.	.	.	T	0.03390	0.0098	L	0.36672	1.1	0.09310	N	1	B	0.18863	0.031	B	0.09377	0.004	T	0.43718	-0.9374	9	0.30078	T	0.28	0.0026	4.3551	0.11174	0.1062:0.1416:0.505:0.2472	.	323	Q5JPB2	ZN831_HUMAN	T	323	ENSP00000360069:A323T	ENSP00000360069:A323T	A	+	1	0	ZNF831	57200436	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.006000	0.13152	-0.627000	0.05589	-0.293000	0.09583	GCG		0.716	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
IRAK3	11213	bcgsc.ca	37	12	66597673	66597673	+	Splice_Site	SNP	G	G	T			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr12:66597673G>T	ENST00000261233.4	+	2	737	c.316G>T	c.(316-318)Gga>Tga	p.G106*	IRAK3_ENST00000457197.2_Intron	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		TACAAACTATGGTAAATGCTG	0.378																																						.											0													104.0	104.0	104.0					12																	66597673		2203	4300	6503	SO:0001630	splice_region_variant	11213			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.316+1G>T	12.37:g.66597673G>T				Nonsense_Mutation	SNP	ENST00000261233.4	37	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	G	37	6.621589	0.97714	.	.	ENSG00000090376	ENST00000261233	.	.	.	5.93	5.93	0.95920	.	0.067824	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.5857	15.8335	0.78778	0.0:0.0:1.0:0.0	.	.	.	.	X	106	.	.	G	+	1	0	IRAK3	64883940	1.000000	0.71417	0.969000	0.41365	0.031000	0.12232	4.823000	0.62694	2.818000	0.97014	0.591000	0.81541	GGA		0.378	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1		Nonsense_Mutation
SLC46A2	57864	bcgsc.ca	37	9	115652859	115652859	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chr9:115652859G>A	ENST00000374228.4	-	1	334	c.103C>T	c.(103-105)Ctc>Ttc	p.L35F		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	35					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						GCATCGTAGAGGGAGGCAGCC	0.701																																						.											0													45.0	47.0	46.0					9																	115652859		2203	4300	6503	SO:0001583	missense	57864			AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.103C>T	9.37:g.115652859G>A	ENSP00000363345:p.Leu35Phe		B1ALK1|Q86VT0|Q96NE2	Missense_Mutation	SNP	ENST00000374228.4	37	CCDS6786.1	.	.	.	.	.	.	.	.	.	.	G	7.339	0.620583	0.14193	.	.	ENSG00000119457	ENST00000374228	T	0.52754	0.65	5.11	3.0	0.34707	.	0.224065	0.45606	D	0.000352	T	0.23330	0.0564	N	0.12182	0.205	0.32707	N	0.512117	B	0.14012	0.009	B	0.10450	0.005	T	0.12682	-1.0538	10	0.23302	T	0.38	-16.569	4.2995	0.10918	0.4949:0.0:0.5051:0.0	.	35	Q9BY10	TSCOT_HUMAN	F	35	ENSP00000363345:L35F	ENSP00000363345:L35F	L	-	1	0	SLC46A2	114692680	1.000000	0.71417	0.983000	0.44433	0.892000	0.51952	3.606000	0.54095	1.145000	0.42336	0.650000	0.86243	CTC		0.701	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053702.1	NM_033051	
MT-ND5	4540	bcgsc.ca	37	M	12418	12419	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8419-01A-11D-2310-10	TCGA-KN-8419-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a592e80a-3b1a-46aa-be30-bcd87d6bca6f	04adced3-96c5-4ec2-8e06-293544f0c3d7	g.chrM:12418_12419insA	ENST00000361567.2	+	1	82_83	c.82_83insA	c.(82-84)aaafs	p.K28fs	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	28					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTAACCCTAACAAAAAAAACTC	0.411																																						.											0																																										SO:0001589	frameshift_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.89dupA	M.37:g.12426_12426dupA	ENSP00000354813:p.Lys28fs		Q34773|Q8WCY3	Frame_Shift_Ins	INS	ENST00000361567.2	37																																																																																					0.411	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
