#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATG2A	23130	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	64664265	64664265	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr11:64664265C>T	ENST00000377264.3	-	38	5339	c.5227G>A	c.(5227-5229)Ggc>Agc	p.G1743S	ATG2A_ENST00000421419.2_Missense_Mutation_p.G1745S	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1743					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CCCAGCAGGCCGGGCAGCTGG	0.622											OREG0004026	type=REGULATORY REGION|Gene=BC027481|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										.											0													58.0	60.0	59.0					11																	64664265		2201	4297	6498	SO:0001583	missense	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.5227G>A	11.37:g.64664265C>T	ENSP00000366475:p.Gly1743Ser	1078	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.8|22.8	4.331934|4.331934	0.81801|0.81801	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000421419;ENST00000377262;ENST00000377264|ENST00000418259	T;T|.	0.08370|.	3.1;3.1|.	4.05|4.05	3.13|3.13	0.36017|0.36017	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.43255|0.43255	0.1239|0.1239	N|N	0.26130|0.26130	0.795|0.795	0.54753|0.54753	D|D	0.999981|0.999981	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.18935|0.18935	-1.0321|-1.0321	10|5	0.35671|.	T|.	0.21|.	.|.	9.7877|9.7877	0.40686|0.40686	0.0:0.8963:0.0:0.1037|0.0:0.8963:0.0:0.1037	.|.	1743;1745|.	Q2TAZ0;Q2TAZ0-3|.	ATG2A_HUMAN;.|.	S|Q	1745;136;1743|1546	ENSP00000410522:G1745S;ENSP00000366475:G1743S|.	ENSP00000366473:G136S|.	G|R	-|-	1|2	0|0	ATG2A|ATG2A	64420841|64420841	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.971000|0.971000	0.66376|0.66376	5.233000|5.233000	0.65337|0.65337	1.067000|1.067000	0.40740|0.40740	-0.258000|-0.258000	0.10820|0.10820	GGC|CGG		0.622	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
OR10G4	390264	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	11	123886665	123886665	+	Silent	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr11:123886665G>A	ENST00000320891.4	+	1	384	c.384G>A	c.(382-384)ccG>ccA	p.P128P		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCAGTTACCCGCTCAGGTACA	0.557																																						.											0																																										SO:0001819	synonymous_variant	390264			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.384G>A	11.37:g.123886665G>A			Q6IEW0	Silent	SNP	ENST00000320891.4	37	CCDS31702.1																																																																																				0.557	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
STX6	10228	hgsc.bcm.edu;ucsc.edu	37	1	180945772	180945772	+	Silent	SNP	T	T	C			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr1:180945772T>C	ENST00000258301.5	-	8	939	c.702A>G	c.(700-702)caA>caG	p.Q234Q	RP11-46A10.5_ENST00000358073.2_RNA|STX6_ENST00000542060.1_Silent_p.Q133Q|STX6_ENST00000469135.1_5'UTR|AL162431.1_ENST00000457152.2_Intron	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	234					endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						TGGCACACCATTGGCGCCGAT	0.532																																						.											0													149.0	119.0	129.0					1																	180945772		2203	4300	6503	SO:0001819	synonymous_variant	10228			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.702A>G	1.37:g.180945772T>C			B2R652|B4DR17|Q5VY08|Q6FH83	Silent	SNP	ENST00000258301.5	37	CCDS1341.1																																																																																				0.532	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085143.1	NM_005819	
KBTBD6	89890	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	13	41704863	41704863	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr13:41704863C>A	ENST00000379485.1	-	1	2019	c.1785G>T	c.(1783-1785)tgG>tgT	p.W595C	KBTBD6_ENST00000499385.2_Missense_Mutation_p.W529C	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	595										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CTATATTAATCCATTGGTCTC	0.438																																						.											0													180.0	178.0	178.0					13																	41704863		2203	4300	6503	SO:0001583	missense	89890			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1785G>T	13.37:g.41704863C>A	ENSP00000368799:p.Trp595Cys		Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	37	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	c	16.59	3.165208	0.57476	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.75589	-0.95;-0.95	3.8	3.8	0.43715	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.79540	0.4463	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81938	-0.0704	10	0.87932	D	0	.	13.5205	0.61566	0.0:1.0:0.0:0.0	.	529;595	F5GZN7;Q86V97	.;KBTB6_HUMAN	C	595;529	ENSP00000368799:W595C;ENSP00000444326:W529C	ENSP00000368799:W595C	W	-	3	0	KBTBD6	40602863	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	4.462000	0.60121	2.132000	0.65825	0.462000	0.41574	TGG		0.438	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
KIAA0753	9851	hgsc.bcm.edu	37	17	6510586	6510586	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr17:6510586C>T	ENST00000361413.3	-	11	2192	c.1834G>A	c.(1834-1836)Gct>Act	p.A612T	KIAA0753_ENST00000542606.1_Missense_Mutation_p.A313T|KIAA0753_ENST00000589033.1_Missense_Mutation_p.A68T|KIAA0753_ENST00000575027.1_5'Flank|KIAA0753_ENST00000572370.1_Missense_Mutation_p.A313T	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	612						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		TCAAGCCAAGCGAGCCTAGCA	0.438																																						.											0													107.0	105.0	106.0					17																	6510586		1944	4143	6087	SO:0001583	missense	9851				CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.1834G>A	17.37:g.6510586C>T	ENSP00000355250:p.Ala612Thr		A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	ENST00000361413.3	37	CCDS42247.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.458604	0.43634	.	.	ENSG00000198920	ENST00000361413;ENST00000542606;ENST00000542826	D;D	0.86562	-2.14;-2.14	5.31	3.28	0.37604	.	0.225713	0.46145	D	0.000313	T	0.79839	0.4515	L	0.59436	1.845	0.27718	N	0.945211	P	0.39964	0.697	B	0.30029	0.11	T	0.74861	-0.3520	10	0.72032	D	0.01	-8.8009	6.7333	0.23395	0.1801:0.7305:0.0:0.0894	.	612	Q2KHM9	K0753_HUMAN	T	612;313;68	ENSP00000355250:A612T;ENSP00000444634:A313T	ENSP00000355250:A612T	A	-	1	0	KIAA0753	6451310	0.990000	0.36364	1.000000	0.80357	0.999000	0.98932	0.501000	0.22578	0.890000	0.36211	0.650000	0.86243	GCT		0.438	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804	
WFDC5	149708	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	20	43739299	43739299	+	Missense_Mutation	SNP	C	C	T	rs370436377		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr20:43739299C>T	ENST00000307971.4	-	2	281	c.203G>A	c.(202-204)cGc>cAc	p.R68H	WFDC5_ENST00000372789.4_Missense_Mutation_p.R68H			Q8TCV5	WFDC5_HUMAN	WAP four-disulfide core domain 5	68	WAP 1. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				GACACACTGGCGGAAGCAAGC	0.622																																					NSCLC(199;98 2227 9943 13455 41914)	.											0								C	HIS/ARG	0,4406		0,0,2203	73.0	59.0	64.0		203	-1.9	1.0	20		64	1,8599	1.2+/-3.3	0,1,4299	no	missense	WFDC5	NM_145652.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	68/124	43739299	1,13005	2203	4300	6503	SO:0001583	missense	149708			AY038181	CCDS33475.1	20q13.11	2013-01-21			ENSG00000175121	ENSG00000175121		"""WAP four-disulfide core domain containing"""	20477	protein-coding gene	gene with protein product		605161				12206714, 10680116	Standard	NM_145652		Approved	WAP1, dJ211D12.5	uc002xne.2	Q8TCV5	OTTHUMG00000046411	ENST00000307971.4:c.203G>A	20.37:g.43739299C>T	ENSP00000312381:p.Arg68His		Q5H981|Q6UWE4	Missense_Mutation	SNP	ENST00000307971.4	37		.	.	.	.	.	.	.	.	.	.	C	21.4	4.148427	0.78001	0.0	1.16E-4	ENSG00000175121	ENST00000372789;ENST00000307971	T;T	0.74002	-0.8;-0.8	5.24	-1.92	0.07618	Whey acidic protein, 4-disulphide core (5);	0.707661	0.12732	N	0.443738	T	0.77336	0.4115	L	0.41961	1.31	0.24345	N	0.994946	D	0.89917	1.0	D	0.78314	0.991	T	0.69323	-0.5175	10	0.14252	T	0.57	-35.335	14.0095	0.64486	0.6716:0.3284:0.0:0.0	.	68	Q8TCV5	WFDC5_HUMAN	H	68	ENSP00000361875:R68H;ENSP00000312381:R68H	ENSP00000312381:R68H	R	-	2	0	WFDC5	43172713	0.994000	0.37717	0.997000	0.53966	0.920000	0.55202	-0.019000	0.12546	-0.117000	0.11872	0.585000	0.79938	CGC		0.622	WFDC5-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000107192.1		
R3HDM1	23518	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	136473266	136473266	+	Splice_Site	SNP	T	T	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:136473266T>A	ENST00000264160.4	+	23	3146		c.e23+2		R3HDM1_ENST00000410054.1_Splice_Site|R3HDM1_ENST00000329971.3_Splice_Site|R3HDM1_ENST00000409478.1_Splice_Site|R3HDM1_ENST00000409606.1_Splice_Site	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1								poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		CCGGGCAAGGTAAGTGCACAT	0.443																																						.											0													138.0	120.0	126.0					2																	136473266		2203	4300	6503	SO:0001630	splice_region_variant	23518			D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.2776+2T>A	2.37:g.136473266T>A			A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Splice_Site	SNP	ENST00000264160.4	37	CCDS2177.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.355569	0.61293	.	.	ENSG00000048991	ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606;ENST00000429703	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.352	0.74396	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	R3HDM1	136189736	1.000000	0.71417	0.998000	0.56505	0.483000	0.33249	7.603000	0.82811	2.026000	0.59711	0.379000	0.24179	.		0.443	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	Intron
B3GALT5	10317	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	21	41033159	41033159	+	Missense_Mutation	SNP	G	G	A	rs144752439		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr21:41033159G>A	ENST00000380620.4	+	5	1265	c.673G>A	c.(673-675)Gtg>Atg	p.V225M	B3GALT5_ENST00000343118.4_Missense_Mutation_p.V225M|B3GALT5_ENST00000398714.2_Missense_Mutation_p.V225M|AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000380618.1_Missense_Mutation_p.V225M			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	225					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				TTCTGGCGACGTGGCGAGTCA	0.522																																						.											0								G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	86.0	85.0	86.0		673,673,673,673,673	3.3	0.1	21	dbSNP_134	86	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	B3GALT5	NM_006057.1,NM_033170.1,NM_033171.1,NM_033172.1,NM_033173.1	21,21,21,21,21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	225/311,225/311,225/311,225/311,225/311	41033159	1,13005	2203	4300	6503	SO:0001583	missense	10317			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.673G>A	21.37:g.41033159G>A	ENSP00000369994:p.Val225Met		A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	ENST00000380620.4	37	CCDS13667.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947287	0.34377	2.27E-4	0.0	ENSG00000183778	ENST00000380620;ENST00000380618;ENST00000343118;ENST00000398714	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.49	3.35	0.38373	.	0.114937	0.36555	N	0.002538	T	0.61073	0.2318	M	0.72576	2.205	0.42482	D	0.992867	D	0.89917	1.0	D	0.76071	0.987	T	0.65639	-0.6119	10	0.59425	D	0.04	.	12.7459	0.57281	0.1557:0.0:0.8443:0.0	.	225	Q9Y2C3	B3GT5_HUMAN	M	225	ENSP00000369994:V225M;ENSP00000369992:V225M;ENSP00000343318:V225M;ENSP00000381699:V225M	ENSP00000343318:V225M	V	+	1	0	B3GALT5	39955029	0.643000	0.27269	0.114000	0.21550	0.059000	0.15707	0.976000	0.29462	1.324000	0.45282	0.655000	0.94253	GTG		0.522	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195008.2	NM_033170	
ARL6IP6	151188	hgsc.bcm.edu;ucsc.edu	37	2	153573942	153573942	+	5'Flank	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:153573942G>A	ENST00000326446.5	+	0	0				PRPF40A_ENST00000486100.1_5'UTR|PRPF40A_ENST00000410080.1_Silent_p.G4G	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						GGCGGCCACTGCCGCTACACA	0.652																																						.											0													33.0	40.0	38.0					2																	153573942		1956	4148	6104	SO:0001631	upstream_gene_variant	55660			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		2.37:g.153573942G>A	Exception_encountered		B2RDS6|Q7Z4G7	Silent	SNP	ENST00000326446.5	37	CCDS2197.1																																																																																				0.652	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522	
CFAP44	55779	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	113114596	113114596	+	Splice_Site	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:113114596C>T	ENST00000295868.2	-	15	2053		c.e15+1		WDR52_ENST00000393845.2_Splice_Site|WDR52_ENST00000475568.1_Splice_Site	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TAATGACTTACATGAGACATG	0.358																																						.											0													116.0	110.0	112.0					3																	113114596		2203	4300	6503	SO:0001630	splice_region_variant	55779																														ENST00000295868.2:c.1890+1G>A	3.37:g.113114596C>T				Splice_Site	SNP	ENST00000295868.2	37	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988779	0.53934	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5256	0.90971	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR52	114597286	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	6.419000	0.73345	2.719000	0.93026	0.650000	0.86243	.		0.358	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		Intron
ARC	23237	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	8	143694490	143694490	+	Silent	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr8:143694490G>A	ENST00000356613.2	-	1	2343	c.1143C>T	c.(1141-1143)ccC>ccT	p.P381P	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				TGTTGGGGGCGGGCGTGAGGG	0.706																																						.											0													7.0	9.0	8.0					8																	143694490		2150	4240	6390	SO:0001819	synonymous_variant	23237			AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.1143C>T	8.37:g.143694490G>A			B4DFL0|O60937	Silent	SNP	ENST00000356613.2	37	CCDS34950.1																																																																																				0.706	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259274.2		
TLR1	7096	hgsc.bcm.edu	37	4	38798159	38798159	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr4:38798159C>T	ENST00000502213.2	-	3	2523	c.2294G>A	c.(2293-2295)cGt>cAt	p.R765H	TLR1_ENST00000308979.2_Missense_Mutation_p.R765H|TLR1_ENST00000510552.1_5'Flank			Q15399	TLR1_HUMAN	toll-like receptor 1	765	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.R765H(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						AAAAAGGCCACGTTTGCTCTT	0.423																																					GBM(5;216 373 40795 46382)	.											1	Substitution - Missense(1)	lung(1)											93.0	87.0	89.0					4																	38798159		2203	4300	6503	SO:0001583	missense	7096			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.2294G>A	4.37:g.38798159C>T	ENSP00000421259:p.Arg765His		D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	ENST00000502213.2	37	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.890829	0.00527	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	D;D	0.83419	-1.72;-1.72	5.1	1.3	0.21679	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.370723	0.25369	N	0.031163	T	0.61362	0.2341	N	0.12831	0.26	0.31308	N	0.687515	B	0.02656	0.0	B	0.01281	0.0	T	0.53129	-0.8482	10	0.02654	T	1	.	9.444	0.38686	0.0:0.2814:0.0:0.7186	.	765	Q15399	TLR1_HUMAN	H	765	ENSP00000354932:R765H;ENSP00000421259:R765H	ENSP00000354932:R765H	R	-	2	0	TLR1	38474554	0.768000	0.28519	0.998000	0.56505	0.163000	0.22366	1.128000	0.31369	0.073000	0.16731	-1.166000	0.01754	CGT		0.423	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
VSTM1	284415	hgsc.bcm.edu;mdanderson.org	37	19	54561798	54561798	+	Silent	SNP	A	A	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr19:54561798A>T	ENST00000338372.2	-	3	292	c.117T>A	c.(115-117)gtT>gtA	p.V39V	VSTM1_ENST00000366170.2_Intron|VSTM1_ENST00000376626.1_Silent_p.V39V|VSTM1_ENST00000425006.2_Silent_p.V39V	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	39	Ig-like V-type.				immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		TCTCGGCTTCAACCACCGAGC	0.502																																						.											0													90.0	92.0	91.0					19																	54561798		2203	4300	6503	SO:0001819	synonymous_variant	284415			AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.117T>A	19.37:g.54561798A>T			B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Silent	SNP	ENST00000338372.2	37	CCDS12872.1																																																																																				0.502	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481	
PCLO	27445	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	82579951	82579951	+	Missense_Mutation	SNP	T	T	C	rs376865880		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr7:82579951T>C	ENST00000333891.9	-	6	10290	c.9953A>G	c.(9952-9954)tAt>tGt	p.Y3318C	PCLO_ENST00000423517.2_Missense_Mutation_p.Y3318C|PCLO_ENST00000437081.1_Missense_Mutation_p.Y38C	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTCATAGTTATACTGGTAGAT	0.483																																						.											0								T	CYS/TYR,CYS/TYR	1,3899		0,1,1949	136.0	126.0	129.0		9953,9953	5.3	1.0	7		129	0,8304		0,0,4152	no	missense,missense	PCLO	NM_014510.2,NM_033026.5	194,194	0,1,6101	CC,CT,TT		0.0,0.0256,0.0082	probably-damaging,probably-damaging	3318/4936,3318/5143	82579951	1,12203	1950	4152	6102	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9953A>G	7.37:g.82579951T>C	ENSP00000334319:p.Tyr3318Cys			Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.253482	0.39797	2.56E-4	0.0	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T;T	0.35236	2.26;2.26;1.32	5.29	5.29	0.74685	.	.	.	.	.	T	0.56499	0.1989	L	0.59436	1.845	0.40882	D	0.984007	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.73380	0.887;0.98;0.98	T	0.61397	-0.7071	9	0.87932	D	0	.	15.5102	0.75776	0.0:0.0:0.0:1.0	.	3249;3318;3318	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	C	3249;3318;3318;38	ENSP00000334319:Y3318C;ENSP00000388393:Y3318C;ENSP00000393760:Y38C	ENSP00000334319:Y3318C	Y	-	2	0	PCLO	82417887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.672000	0.74477	2.128000	0.65567	0.460000	0.39030	TAT		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
DNASE2B	58511	broad.mit.edu;mdanderson.org	37	1	84876612	84876612	+	Silent	SNP	A	A	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr1:84876612A>T	ENST00000370665.3	+	4	510	c.477A>T	c.(475-477)ccA>ccT	p.P159P	DNASE2B_ENST00000370662.3_5'UTR	NM_021233.2	NP_067056.2	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta	159					apoptotic DNA fragmentation (GO:0006309)	extracellular region (GO:0005576)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)			endometrium(1)|lung(4)|skin(1)	6				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		ATGATTATCCACCCACAGGGA	0.428																																					Pancreas(54;788 1175 11852 16034 30034)	.											0													89.0	83.0	85.0					1																	84876612		1904	4127	6031	SO:0001819	synonymous_variant	58511			AF274571	CCDS694.1, CCDS44167.1	1p22.3	2008-02-05			ENSG00000137976	ENSG00000137976			28875	protein-coding gene	gene with protein product		608057				12594037, 11376952	Standard	NM_021233		Approved	DLAD	uc001djt.1	Q8WZ79	OTTHUMG00000009860	ENST00000370665.3:c.477A>T	1.37:g.84876612A>T			Q5VXD0|Q5VXD1|Q8WZ80|Q9NQW3	Silent	SNP	ENST00000370665.3	37	CCDS44167.1																																																																																				0.428	DNASE2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027248.1	NM_021233	
GALNT6	11226	broad.mit.edu	37	12	51757967	51757967	+	Silent	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr12:51757967G>A	ENST00000543196.2	-	5	1192	c.987C>T	c.(985-987)ttC>ttT	p.F329F	GALNT6_ENST00000356317.3_Silent_p.F329F			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	329					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TTTCCCAGCCGAAGGTCAGGC	0.572																																						.											0													119.0	111.0	114.0					12																	51757967		2203	4300	6503	SO:0001819	synonymous_variant	11226			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.987C>T	12.37:g.51757967G>A			Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	ENST00000543196.2	37	CCDS8813.1																																																																																				0.572	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
OR4N2	390429	broad.mit.edu	37	14	20296067	20296067	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr14:20296067delG	ENST00000315947.1	+	1	460	c.460delG	c.(460-462)gtcfs	p.V154fs	OR4N2_ENST00000568211.1_Frame_Shift_Del_p.V154fs	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGGGGGTTTTGTCCACTCCAT	0.527																																						.											0													126.0	138.0	134.0					14																	20296067		2203	4298	6501	SO:0001589	frameshift_variant	390429				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.460delG	14.37:g.20296067delG	ENSP00000319601:p.Val154fs		Q6IEY9|Q6IFA2	Frame_Shift_Del	DEL	ENST00000315947.1	37	CCDS32022.1																																																																																				0.527	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2		
BCAS3	54828	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	59118255	59118255	+	Splice_Site	SNP	T	T	G			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr17:59118255T>G	ENST00000390652.5	+	20	2105		c.e20+2		BCAS3_ENST00000589222.1_Splice_Site|BCAS3_ENST00000588874.1_Splice_Site|RP11-264B14.1_ENST00000588604.1_RNA|BCAS3_ENST00000407086.3_Splice_Site|BCAS3_ENST00000588462.1_Splice_Site|BCAS3_ENST00000408905.3_Splice_Site|BCAS3_ENST00000585744.1_Splice_Site	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TTGCTGGCCGTAAGTAGTTCA	0.428																																						.											0													114.0	110.0	111.0					17																	59118255		1919	4140	6059	SO:0001630	splice_region_variant	54828			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2074+2T>G	17.37:g.59118255T>G				Splice_Site	SNP	ENST00000390652.5	37	CCDS45749.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.476995	0.84640	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000408905;ENST00000360207	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2267	0.73357	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	BCAS3	56473037	1.000000	0.71417	0.988000	0.46212	0.910000	0.53928	7.194000	0.77789	2.007000	0.58848	0.528000	0.53228	.		0.428	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679	Intron
PRKD3	23683	broad.mit.edu	37	2	37483813	37483813	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:37483813delG	ENST00000379066.1	-	17	3167	c.2405delC	c.(2404-2406)tctfs	p.S802fs	PRKD3_ENST00000234179.2_Frame_Shift_Del_p.S802fs			O94806	KPCD3_HUMAN	protein kinase D3	802	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				ACCTTCACCAGAAATTTCTCT	0.323																																					Melanoma(80;621 1355 8613 11814 51767)	.											0													56.0	54.0	54.0					2																	37483813		2203	4300	6503	SO:0001589	frameshift_variant	23683			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.2405delC	2.37:g.37483813delG	ENSP00000368356:p.Ser802fs		D6W587|Q53TR7|Q8NEL8	Frame_Shift_Del	DEL	ENST00000379066.1	37	CCDS1789.1																																																																																				0.323	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813	
CCDC85A	114800	broad.mit.edu;mdanderson.org	37	2	56420144	56420144	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:56420144G>A	ENST00000407595.2	+	2	1311	c.809G>A	c.(808-810)cGc>cAc	p.R270H	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	270	His-rich.									breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACCCCAGATCGCCCCAAAGCA	0.652																																						.											0													42.0	56.0	52.0					2																	56420144		1996	4190	6186	SO:0001583	missense	114800			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.809G>A	2.37:g.56420144G>A	ENSP00000384040:p.Arg270His			Missense_Mutation	SNP	ENST00000407595.2	37	CCDS46290.1	.	.	.	.	.	.	.	.	.	.	G	2.918	-0.223868	0.06061	.	.	ENSG00000055813	ENST00000407595	T	0.45668	0.89	5.35	3.0	0.34707	.	0.137823	0.64402	N	0.000003	T	0.13329	0.0323	N	0.01209	-0.955	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.09335	-1.0679	10	0.08599	T	0.76	-6.8881	9.1145	0.36748	0.8509:0.0:0.1491:0.0	.	270	Q96PX6	CC85A_HUMAN	H	270	ENSP00000384040:R270H	ENSP00000384040:R270H	R	+	2	0	CCDC85A	56273648	0.999000	0.42202	0.998000	0.56505	0.944000	0.59088	1.851000	0.39338	0.881000	0.35993	-0.312000	0.09012	CGC		0.652	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1		
EPC2	26122	broad.mit.edu	37	2	149542571	149542572	+	Splice_Site	DEL	GT	GT	-	rs377569045		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:149542571_149542572delGT	ENST00000258484.6	+	13	2385		c.e13+1			NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)						chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		GCATAGCAAGGTGTGTGTGTGT	0.465																																						.											0										53,3913		3,47,1933						5.9	1.0			42	149,7861		2,145,3858	no	splice-5	EPC2	NM_015630.3		5,192,5791	A1A1,A1R,RR		1.8602,1.3364,1.6867				202,11774				SO:0001630	splice_region_variant	26122			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.2351+1GT>-	2.37:g.149542581_149542582delGT			B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Splice_Site	DEL	ENST00000258484.6	37	CCDS46422.1																																																																																				0.465	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1	NM_015630	Intron
SCN3A	6328	broad.mit.edu;mdanderson.org	37	2	165987817	165987817	+	Silent	SNP	G	G	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:165987817G>T	ENST00000360093.3	-	16	2993	c.2502C>A	c.(2500-2502)ctC>ctA	p.L834L	SCN3A_ENST00000283254.7_Silent_p.L834L|SCN3A_ENST00000409101.3_Silent_p.L785L	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	834					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCATTAAACTGAGGCTGACAA	0.403																																						.											0													115.0	113.0	114.0					2																	165987817		2203	4300	6503	SO:0001819	synonymous_variant	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2502C>A	2.37:g.165987817G>T			Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37																																																																																					0.403	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
TTN	7273	broad.mit.edu	37	2	179401232	179401232	+	Silent	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:179401232C>T	ENST00000591111.1	-	307	95543	c.95319G>A	c.(95317-95319)aaG>aaA	p.K31773K	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Silent_p.K24541K|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN_ENST00000342992.6_Silent_p.K30846K|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000589042.1_Silent_p.K33414K|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.K24474K|TTN_ENST00000460472.2_Silent_p.K24349K|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000585487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31773	Fibronectin type-III 131. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCAGGTGGCTTCCAGGCCA	0.403																																						.											0													68.0	67.0	67.0					2																	179401232		1840	4101	5941	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95319G>A	2.37:g.179401232C>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SRSF6	6431	broad.mit.edu	37	20	42089576	42089576	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr20:42089576C>T	ENST00000244020.3	+	6	1014	c.908C>T	c.(907-909)tCg>tTg	p.S303L		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	303	Arg/Ser-rich (RS domain).				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						CGTTCCAATTCGCCGCTACCT	0.493																																						.											0													83.0	81.0	82.0					20																	42089576		2203	4300	6503	SO:0001583	missense	6431			U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.908C>T	20.37:g.42089576C>T	ENSP00000244020:p.Ser303Leu		B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	37	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589874	0.46214	.	.	ENSG00000124193	ENST00000244020	T	0.39997	1.05	5.93	5.93	0.95920	.	0.115021	0.64402	D	0.000012	T	0.50667	0.1629	M	0.79693	2.465	0.42950	D	0.994375	B	0.15473	0.013	B	0.06405	0.002	T	0.48714	-0.9011	10	0.52906	T	0.07	.	19.1112	0.93317	0.0:1.0:0.0:0.0	.	303	Q13247	SRSF6_HUMAN	L	303	ENSP00000244020:S303L	ENSP00000244020:S303L	S	+	2	0	SRSF6	41522990	.	.	0.998000	0.56505	0.906000	0.53458	.	.	2.803000	0.96430	0.585000	0.79938	TCG		0.493	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
TMPRSS15	5651	broad.mit.edu;mdanderson.org	37	21	19744529	19744529	+	Silent	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr21:19744529G>A	ENST00000284885.3	-	6	678	c.645C>T	c.(643-645)gaC>gaT	p.D215D		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	215	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TATTGTCTTCGTCAGAACCAT	0.443																																						.											0													139.0	117.0	124.0					21																	19744529		2203	4300	6503	SO:0001819	synonymous_variant	5651				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.645C>T	21.37:g.19744529G>A			Q2NKL7	Silent	SNP	ENST00000284885.3	37	CCDS13571.1																																																																																				0.443	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
NYAP1	222950	broad.mit.edu	37	7	100087171	100087171	+	Silent	SNP	C	C	A	rs141655359	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr7:100087171C>A	ENST00000300179.2	+	4	1986	c.1827C>A	c.(1825-1827)atC>atA	p.I609I	NYAP1_ENST00000423930.1_Silent_p.I609I|NYAP1_ENST00000454988.1_Silent_p.I552I	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	609					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.I609I(1)									CCCACGTCATCGCCAGCGCAG	0.642																																						.											1	Substitution - coding silent(1)	lung(1)											44.0	47.0	46.0					7																	100087171		2203	4299	6502	SO:0001819	synonymous_variant	222950			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.1827C>A	7.37:g.100087171C>A			Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	37	CCDS5696.1																																																																																				0.642	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
MYC	4609	broad.mit.edu	37	8	128752827	128752827	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr8:128752827delA	ENST00000377970.2	+	3	1498	c.988delA	c.(988-990)actfs	p.T330fs	MYC_ENST00000524013.1_Frame_Shift_Del_p.T329fs	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	315					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	GCCTCCCTCCACTCGGAAGGA	0.577		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	0													81.0	63.0	69.0					8																	128752827		2203	4300	6503	SO:0001589	frameshift_variant	4609				CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.988delA	8.37:g.128752827delA	ENSP00000367207:p.Thr330fs		A8WFE7|P01107|Q14026	Frame_Shift_Del	DEL	ENST00000377970.2	37	CCDS6359.2																																																																																				0.577	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3		
PTPRD	5789	broad.mit.edu;mdanderson.org;bcgsc.ca	37	9	8521528	8521528	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr9:8521528C>G	ENST00000381196.4	-	17	1253	c.710G>C	c.(709-711)aGa>aCa	p.R237T	PTPRD_ENST00000397617.3_Missense_Mutation_p.R227T|PTPRD_ENST00000355233.5_Missense_Mutation_p.R237T|PTPRD_ENST00000486161.1_Missense_Mutation_p.R237T|PTPRD_ENST00000537002.1_Missense_Mutation_p.R234T|PTPRD_ENST00000356435.5_Missense_Mutation_p.R237T|PTPRD_ENST00000397611.3_Missense_Mutation_p.R234T|PTPRD_ENST00000358503.5_Missense_Mutation_p.R224T|PTPRD_ENST00000540109.1_Missense_Mutation_p.R237T|PTPRD_ENST00000360074.4_Missense_Mutation_p.R224T|PTPRD_ENST00000397606.3_Missense_Mutation_p.R227T	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	237	Ig-like C2-type 3.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GATAGAGAATCTTGGTGGGAC	0.448										TSP Lung(15;0.13)																												.											0													102.0	87.0	92.0					9																	8521528		2203	4300	6503	SO:0001583	missense	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.710G>C	9.37:g.8521528C>G	ENSP00000370593:p.Arg237Thr		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463524	0.84425	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72653	0.3487	N	0.21142	0.635	0.80722	D	1	D;D;D;D;D;D;P;D;P	0.89917	1.0;1.0;0.999;1.0;0.994;1.0;0.764;1.0;0.802	D;D;D;D;P;D;B;D;P	0.81914	0.995;0.995;0.986;0.995;0.859;0.995;0.225;0.972;0.459	T	0.70037	-0.4982	9	.	.	.	.	19.7917	0.96461	0.0:1.0:0.0:0.0	.	227;231;237;237;234;234;224;237;237	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	T	237;237;224;224;237;227;234;234;237;237;237;227	ENSP00000370593:R237T;ENSP00000348812:R237T;ENSP00000353187:R224T;ENSP00000351293:R224T;ENSP00000347373:R237T;ENSP00000380741:R227T;ENSP00000380735:R234T;ENSP00000440515:R234T;ENSP00000438164:R237T;ENSP00000417093:R237T;ENSP00000380731:R227T	.	R	-	2	0	PTPRD	8511528	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.688000	0.91661	0.563000	0.77884	AGA		0.448	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
NKAP	79576	broad.mit.edu	37	X	119072773	119072773	+	Splice_Site	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chrX:119072773C>T	ENST00000371410.3	-	2	553	c.387G>A	c.(385-387)aaG>aaA	p.K129K	NKAP_ENST00000477789.1_5'Flank	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	129					granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						CACTTAATCTCCTAGCAGATA	0.348																																						.											0													70.0	71.0	70.0					X																	119072773		2203	4297	6500	SO:0001630	splice_region_variant	79576			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.387-1G>A	X.37:g.119072773C>T			Q6IPW6|Q96BQ2|Q9H638	Silent	SNP	ENST00000371410.3	37	CCDS14592.1																																																																																				0.348	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058072.1	NM_024528	Silent
ZBTB33	10009	broad.mit.edu	37	X	119389135	119389135	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chrX:119389135G>A	ENST00000326624.2	+	2	2093	c.1865G>A	c.(1864-1866)gGa>gAa	p.G622E	ZBTB33_ENST00000557385.1_Missense_Mutation_p.G622E	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	622	Interaction with CTNND1. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						GTTGACACTGGAAAAGAACCT	0.378																																						.											0													108.0	102.0	104.0					X																	119389135		2202	4300	6502	SO:0001583	missense	10009			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.1865G>A	X.37:g.119389135G>A	ENSP00000314153:p.Gly622Glu		B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	ENST00000326624.2	37	CCDS14596.1	.	.	.	.	.	.	.	.	.	.	G	7.271	0.607135	0.14002	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.09255	3.0;3.0	5.88	5.88	0.94601	.	0.436525	0.22660	N	0.057216	T	0.06371	0.0164	N	0.14661	0.345	0.36328	D	0.85869	P	0.37500	0.597	B	0.33799	0.17	T	0.35076	-0.9803	10	0.45353	T	0.12	-4.2508	8.8319	0.35089	0.0812:0.1475:0.7713:0.0	.	622	Q86T24	KAISO_HUMAN	E	622	ENSP00000314153:G622E;ENSP00000450969:G622E	ENSP00000314153:G622E	G	+	2	0	ZBTB33;AC002086.1	119273163	0.999000	0.42202	0.994000	0.49952	0.986000	0.74619	3.660000	0.54496	2.474000	0.83562	0.600000	0.82982	GGA		0.378	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058085.2	NM_006777	
E2F4	1874	ucsc.edu	37	16	67233116	67233116	+	IGR	SNP	T	T	C			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr16:67233116T>C	ENST00000379378.3	+	0	2096				ELMO3_ENST00000477898.1_5'Flank|ELMO3_ENST00000393997.2_Missense_Mutation_p.S16P|ELMO3_ENST00000360833.1_Missense_Mutation_p.S16P	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		GACACCGAGGTCAGGTCTCGG	0.692																																						.											0													21.0	30.0	27.0					16																	67233116		2087	4209	6296	SO:0001628	intergenic_variant	79767			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67233116T>C			A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	37	CCDS32464.1	.	.	.	.	.	.	.	.	.	.	T	17.29	3.352548	0.61293	.	.	ENSG00000102890	ENST00000360833;ENST00000393997	T;T	0.15952	2.39;2.38	4.18	-5.95	0.02241	.	.	.	.	.	T	0.06005	0.0156	N	0.08118	0	0.09310	N	0.999995	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36915	-0.9728	9	0.87932	D	0	5.329	0.5961	0.00736	0.2758:0.1806:0.1364:0.4072	.	16;16	F8W9E7;Q96BJ8-3	.;.	P	16	ENSP00000354077:S16P;ENSP00000377566:S16P	ENSP00000354077:S16P	S	+	1	0	ELMO3	65790617	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.328000	0.02680	-0.679000	0.05217	-0.468000	0.05107	TCA		0.692	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
GAS2L1	10634	ucsc.edu;mdanderson.org	37	22	29704662	29704662	+	Silent	SNP	C	C	G	rs56037813	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr22:29704662C>G	ENST00000406549.3	+	2	717	c.567C>G	c.(565-567)ccC>ccG	p.P189P	GAS2L1_ENST00000360113.2_Silent_p.P189P|GAS2L1_ENST00000407647.2_Silent_p.P189P|GAS2L1_ENST00000403764.1_Silent_p.P189P|GAS2L1_ENST00000471961.1_Silent_p.P189P|GAS2L1_ENST00000341313.6_Silent_p.P189P|GAS2L1_ENST00000407854.1_Silent_p.P189P	NM_001278730.1	NP_001265659.1	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1	189					cell cycle arrest (GO:0007050)|cellular response to starvation (GO:0009267)|cellular response to thyroid hormone stimulus (GO:0097067)|microtubule bundle formation (GO:0001578)|negative regulation of cell growth (GO:0030308)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of gene expression (GO:0010629)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)|thyroid hormone receptor binding (GO:0046966)			endometrium(2)|lung(2)|prostate(1)	5						AAACCGCCCCCGCACCAGGGA	0.706													C|||	99	0.0197684	0.0023	0.0274	5008	,	,		13609	0.0		0.0706	False		,,,				2504	0.0061					.											0								C	,,	51,4287		0,51,2118	8.0	12.0	11.0		567,567,567	-9.1	0.0	22	dbSNP_129	11	506,8000		17,472,3764	no	coding-synonymous,coding-synonymous,coding-synonymous	GAS2L1	NM_006478.3,NM_152236.1,NM_152237.1	,,	17,523,5882	GG,GC,CC		5.9487,1.1757,4.3367	,,	189/682,189/682,189/338	29704662	557,12287	2169	4253	6422	SO:0001819	synonymous_variant	10634			BC001782	CCDS63438.1, CCDS74840.1	22q12.2	2008-06-11			ENSG00000185340	ENSG00000185340			16955	protein-coding gene	gene with protein product		602128				8975699, 12584248, 1607387	Standard	NM_001278730		Approved	GAR22	uc003afc.1	Q99501	OTTHUMG00000151108	ENST00000406549.3:c.567C>G	22.37:g.29704662C>G			B5MCR7|Q53EN7|Q92640|Q9BUY9	Silent	SNP	ENST00000406549.3	37																																																																																					0.706	GAS2L1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000321365.1	NM_006478	
HCRTR1	3061	ucsc.edu	37	1	32085198	32085198	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr1:32085198T>C	ENST00000373706.5	+	2	418	c.265T>C	c.(265-267)Tcc>Ccc	p.S89P	HCRTR1_ENST00000373705.1_Missense_Mutation_p.S89P|HCRTR1_ENST00000403528.2_Missense_Mutation_p.S89P|HCRTR1_ENST00000468521.1_Intron			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	89					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		TGTCAACCTGTCCCTGGCTGA	0.602																																						.											0													140.0	99.0	113.0					1																	32085198		2203	4299	6502	SO:0001583	missense	3061			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.265T>C	1.37:g.32085198T>C	ENSP00000362810:p.Ser89Pro		A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	37	CCDS344.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.124151	0.77436	.	.	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.12255	2.7;2.7;2.7	4.45	4.45	0.53987	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.43033	0.1229	M	0.89840	3.065	0.45129	D	0.998146	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.98	T	0.52786	-0.8529	10	0.87932	D	0	.	12.31	0.54924	0.0:0.0:0.0:1.0	.	89;89	A6NMV7;O43613	.;OX1R_HUMAN	P	89	ENSP00000384387:S89P;ENSP00000362810:S89P;ENSP00000362809:S89P	ENSP00000362809:S89P	S	+	1	0	HCRTR1	31857785	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.645000	0.83430	1.931000	0.55961	0.533000	0.62120	TCC		0.602	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525	
NLRP7	199713	ucsc.edu;mdanderson.org;bcgsc.ca	37	19	55447692	55447692	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr19:55447692C>T	ENST00000590030.1	-	5	2277	c.2237G>A	c.(2236-2238)cGc>cAc	p.R746H	NLRP7_ENST00000446217.1_Missense_Mutation_p.R774H|NLRP7_ENST00000592784.1_Missense_Mutation_p.R746H|NLRP7_ENST00000340844.2_Missense_Mutation_p.R746H|NLRP7_ENST00000588756.1_Missense_Mutation_p.R746H|NLRP7_ENST00000448121.2_Missense_Mutation_p.R718H|NLRP7_ENST00000328092.5_Missense_Mutation_p.R718H			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	746							ATP binding (GO:0005524)	p.R746H(1)|p.R718H(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CATCATCGTGCGTTCCCACTC	0.572																																						.											2	Substitution - Missense(2)	lung(2)											127.0	95.0	106.0					19																	55447692		2203	4300	6503	SO:0001583	missense	199713			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.2237G>A	19.37:g.55447692C>T	ENSP00000465520:p.Arg746His		E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710327	0.30322	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T	0.53206	0.63;0.63;0.63	1.95	0.909	0.19332	.	.	.	.	.	T	0.43986	0.1272	L	0.33485	1.01	0.09310	N	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.997	P;P;P;P	0.57468	0.813;0.743;0.743;0.821	T	0.22487	-1.0215	9	0.34782	T	0.22	.	3.3391	0.07111	0.0:0.24:0.0:0.76	.	774;746;746;718	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	H	746;718;746;774;513	ENSP00000409137:R718H;ENSP00000339491:R746H;ENSP00000414273:R774H	ENSP00000329568:R746H	R	-	2	0	NLRP7	60139504	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.980000	0.03770	0.240000	0.21263	-0.367000	0.07326	CGC		0.572	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
RFX7	64864	ucsc.edu	37	15	56388708	56388708	+	Silent	SNP	T	T	C			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr15:56388708T>C	ENST00000559447.2	-	9	1198	c.927A>G	c.(925-927)aaA>aaG	p.K309K	RFX7_ENST00000422057.1_Silent_p.K309K|RFX7_ENST00000317318.6_Silent_p.K406K|RFX7_ENST00000423270.1_Silent_p.K406K			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	309					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TTGGTGCCTGTTTCACAGACT	0.532																																						.											0													99.0	101.0	100.0					15																	56388708		2024	4188	6212	SO:0001819	synonymous_variant	64864					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.927A>G	15.37:g.56388708T>C			Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Silent	SNP	ENST00000559447.2	37																																																																																					0.532	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
TEX26	122046	ucsc.edu	37	13	31531011	31531011	+	Splice_Site	SNP	A	A	G			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr13:31531011A>G	ENST00000380473.3	+	4	327	c.314A>G	c.(313-315)gAc>gGc	p.D105G		NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	105																	CTTTGATAGGACATTTTCCTG	0.403																																						.											0													93.0	85.0	87.0					13																	31531011		2203	4300	6503	SO:0001630	splice_region_variant	122046			BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.313-1A>G	13.37:g.31531011A>G				Missense_Mutation	SNP	ENST00000380473.3	37	CCDS9339.1	.	.	.	.	.	.	.	.	.	.	A	2.912	-0.225094	0.06022	.	.	ENSG00000175664	ENST00000380473	T	0.46451	0.87	4.81	-2.77	0.05877	.	0.976673	0.08367	N	0.956788	T	0.28234	0.0697	L	0.31294	0.92	0.23681	N	0.997123	B	0.02656	0.0	B	0.01281	0.0	T	0.25813	-1.0121	10	0.20519	T	0.43	0.4607	10.9049	0.47073	0.5433:0.0:0.4567:0.0	.	105	Q8N6G2	CM026_HUMAN	G	105	ENSP00000369840:D105G	ENSP00000369840:D105G	D	+	2	0	C13orf26	30429011	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	0.149000	0.16243	-1.433000	0.01977	-1.676000	0.00740	GAC		0.403	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325	Missense_Mutation
ZC3H12A	80149	ucsc.edu;bcgsc.ca	37	1	37947246	37947246	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr1:37947246T>C	ENST00000373087.6	+	4	744	c.628T>C	c.(628-630)Ttc>Ctc	p.F210L		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GATCCTGGTGTTCACACCATC	0.592																																						.											0													236.0	213.0	221.0					1																	37947246		2203	4300	6503	SO:0001583	missense	80149				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.628T>C	1.37:g.37947246T>C	ENSP00000362179:p.Phe210Leu			Missense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	T	35	5.467320	0.96257	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.39787	1.06	5.42	5.42	0.78866	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.59676	0.2211	M	0.61703	1.905	0.80722	D	1	P	0.49447	0.924	P	0.61397	0.888	T	0.60005	-0.7347	10	0.48119	T	0.1	-30.0237	15.4665	0.75406	0.0:0.0:0.0:1.0	.	210	Q5D1E8	ZC12A_HUMAN	L	210	ENSP00000362179:F210L	ENSP00000362174:F210L	F	+	1	0	ZC3H12A	37719833	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.991000	0.88244	2.054000	0.61138	0.459000	0.35465	TTC		0.592	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
ANKRD20A5P	440482	mdanderson.org	37	18	14183978	14183978	+	RNA	SNP	T	T	C	rs77403707	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr18:14183978T>C	ENST00000581935.1	+	0	667							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGGAACATGGTGCCAATCCAA	0.448																																						.											0													93.0	93.0	93.0					18																	14183978		2201	4296	6497			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183978T>C			Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.448	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
CCDC144NL	339184	mdanderson.org	37	17	20768744	20768744	+	Missense_Mutation	SNP	G	G	T	rs62066974	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr17:20768744G>T	ENST00000327925.5	-	4	769	c.650C>A	c.(649-651)tCt>tAt	p.S217Y	CCDC144NL_ENST00000539484.1_5'UTR	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	217										large_intestine(3)|lung(3)|skin(1)	7						TACAACATTAGACACATGATT	0.363																																						.											0													105.0	96.0	99.0					17																	20768744		2203	4300	6503	SO:0001583	missense	339184				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.650C>A	17.37:g.20768744G>T	ENSP00000328054:p.Ser217Tyr			Missense_Mutation	SNP	ENST00000327925.5	37	CCDS32591.1	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.492150	0.00159	.	.	ENSG00000205212	ENST00000327925	T	0.18502	2.21	.	.	.	.	.	.	.	.	T	0.06234	0.0161	N	0.08118	0	0.80722	P	0.0	B	0.09022	0.002	B	0.01281	0.0	T	0.32508	-0.9904	6	0.87932	D	0	.	.	.	.	rs62066974	217	Q6NUI1	C144L_HUMAN	Y	217	ENSP00000328054:S217Y	ENSP00000328054:S217Y	S	-	2	0	CCDC144NL	20709336	0.025000	0.19082	0.005000	0.12908	0.005000	0.04900	-1.875000	0.01634	-1.915000	0.01077	-1.919000	0.00516	TCT		0.363	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
DLG2	1740	mdanderson.org	37	11	84245725	84245725	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr11:84245725C>T	ENST00000532653.1	-	2	394	c.92G>A	c.(91-93)cGa>cAa	p.R31Q	DLG2_ENST00000543673.1_Missense_Mutation_p.R136Q|DLG2_ENST00000398309.2_Missense_Mutation_p.R31Q|DLG2_ENST00000376104.2_Missense_Mutation_p.R136Q|DLG2_ENST00000524982.1_Missense_Mutation_p.R31Q			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GTGGGTTAGTCGAGGTAAGGA	0.388																																						.											0													194.0	180.0	184.0					11																	84245725		1876	4115	5991	SO:0001583	missense	1740			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.92G>A	11.37:g.84245725C>T	ENSP00000435849:p.Arg31Gln		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37		.	.	.	.	.	.	.	.	.	.	C	21.2	4.113970	0.77210	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000543673;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000527088	T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06	5.88	5.88	0.94601	Membrane-associated guanylate kinase (MAGUK), PEST domain, N-terminal (1);	0.000000	0.50627	D	0.000107	T	0.31071	0.0785	N	0.03948	-0.315	0.80722	D	1	D;B;D;B	0.63046	0.982;0.051;0.992;0.083	P;B;P;B	0.48901	0.59;0.01;0.594;0.025	T	0.22277	-1.0221	9	.	.	.	.	20.2279	0.98344	0.0:1.0:0.0:0.0	.	31;31;136;31	B7Z2T4;E9PN83;Q15700-2;Q15700	.;.;.;DLG2_HUMAN	Q	31;136;136;31;31;136;52	ENSP00000381355:R31Q;ENSP00000365272:R136Q;ENSP00000441994:R136Q;ENSP00000432894:R31Q;ENSP00000435849:R31Q;ENSP00000435809:R52Q	.	R	-	2	0	DLG2	83923373	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.624000	0.67764	2.778000	0.95560	0.655000	0.94253	CGA		0.388	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364	
DSPP	1834	mdanderson.org	37	4	88537088	88537088	+	Missense_Mutation	SNP	A	A	G	rs201754564	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr4:88537088A>G	ENST00000282478.7	+	4	3307	c.3274A>G	c.(3274-3276)Aat>Gat	p.N1092D	DSPP_ENST00000399271.1_Missense_Mutation_p.N1092D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1092	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcaatagcagtga	0.542													G|||	3443	0.6875	0.8207	0.7291	5008	,	,		11661	0.6498		0.671	False		,,,				2504	0.5337					.											0													20.0	29.0	26.0					4																	88537088		783	1640	2423	SO:0001583	missense	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3274A>G	4.37:g.88537088A>G	ENSP00000282478:p.Asn1092Asp		A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	g	2.684	-0.274594	0.05679	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87887	-2.31;-2.31	1.51	-0.39	0.12450	.	.	.	.	.	T	0.62466	0.2430	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.54456	-0.8291	8	0.07644	T	0.81	.	5.2031	0.15275	0.5656:0.0:0.4344:0.0	.	1092	Q9NZW4	DSPP_HUMAN	D	1092	ENSP00000382213:N1092D;ENSP00000282478:N1092D	ENSP00000282478:N1092D	N	+	1	0	DSPP	88756112	0.033000	0.19621	0.000000	0.03702	0.001000	0.01503	-0.014000	0.12656	-0.601000	0.05783	-2.064000	0.00396	AAT		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAM120AOS	158293	mdanderson.org	37	9	96214928	96214928	+	Missense_Mutation	SNP	G	G	A	rs1055710	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr9:96214928G>A	ENST00000375412.5	-	1	946	c.64C>T	c.(64-66)Ctc>Ttc	p.L22F	FAM120A_ENST00000333936.5_Intron|FAM120AOS_ENST00000479094.1_5'Flank|FAM120AOS_ENST00000423591.1_5'Flank|FAM120A_ENST00000277165.6_Intron|FAM120A_ENST00000340893.4_Intron|FAM120A_ENST00000375389.3_Intron	NM_198841.2	NP_942138.2	Q5T036	F120S_HUMAN	family with sequence similarity 120A opposite strand	22			L -> F (in dbSNP:rs1055710). {ECO:0000269|PubMed:14702039}.							kidney(1)|large_intestine(1)|lung(3)|skin(1)	6						GGCTGGGAGAGAGCCCCGGAC	0.627													G|||	1451	0.289736	0.2247	0.33	5008	,	,		14673	0.4187		0.3509	False		,,,				2504	0.1534					.											0								G	,PHE/LEU	862,3084		96,670,1207	22.0	25.0	24.0		,64	-6.6	0.0	9	dbSNP_86	24	2380,5512		372,1636,1938	yes	intron,missense	FAM120A,FAM120AOS	NM_014612.3,NM_198841.2	,22	468,2306,3145	AA,AG,GG		30.1571,21.8449,27.3864	,benign	,22/257	96214928	3242,8596	1973	3946	5919	SO:0001583	missense	158293			AK056096	CCDS6705.1	9q22.32	2008-02-05	2006-07-04	2006-07-04	ENSG00000188938	ENSG00000188938			23389	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 10 opposite strand"""	C9orf10OS		14585507	Standard	NM_198841		Approved		uc004atu.4	Q5T036	OTTHUMG00000020251	ENST00000375412.5:c.64C>T	9.37:g.96214928G>A	ENSP00000364561:p.Leu22Phe		A6NN20	Missense_Mutation	SNP	ENST00000375412.5	37	CCDS6705.1	781	0.3576007326007326	114	0.23170731707317074	137	0.3784530386740331	258	0.45104895104895104	272	0.35883905013192613	G	13.52	2.262325	0.39995	0.218449	0.301571	ENSG00000188938	ENST00000375412	T	0.55588	0.51	3.32	-6.63	0.01807	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	2.9999999999752447E-6	B	0.20780	0.048	B	0.16289	0.015	T	0.41052	-0.9530	8	0.32370	T	0.25	.	2.1198	0.03723	0.1008:0.2486:0.2257:0.4248	rs1055710;rs3196205;rs58279967;rs1055710	22	Q5T036	F120S_HUMAN	F	22	ENSP00000364561:L22F	ENSP00000364561:L22F	L	-	1	0	FAM120AOS	95254749	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.624000	0.02038	-1.502000	0.01814	0.591000	0.81541	CTC		0.627	FAM120AOS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053154.1		
FAM182A	284800	mdanderson.org	37	20	26061967	26061967	+	RNA	SNP	G	G	T	rs200610416	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr20:26061967G>T	ENST00000376398.2	+	0	987					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GCCTCAGTCGGCATCGCAGCT	0.587																																						.											0													20.0	17.0	18.0					20																	26061967		692	1571	2263			284800			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061967G>T			A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.925	0.739464	0.15642	.	.	ENSG00000125804	ENST00000376398;ENST00000246000;ENST00000415411	.	.	.	.	.	.	.	.	.	.	.	T	0.39172	0.1068	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38779	-0.9645	3	0.87932	D	0	.	.	.	.	.	.	.	.	S	107;107;48	.	ENSP00000246000:A107S	A	+	1	0	FAM182A	26009967	0.049000	0.20398	0.112000	0.21494	0.114000	0.19823	1.160000	0.31761	0.121000	0.18284	0.123000	0.15791	GCA		0.587	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
FAM86B1	85002	mdanderson.org	37	8	12044010	12044010	+	Missense_Mutation	SNP	C	C	T	rs201876260	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr8:12044010C>T	ENST00000448228.2	-	5	540	c.491G>A	c.(490-492)cGa>cAa	p.R164Q	FAM86B1_ENST00000321602.8_Intron|FAM86B1_ENST00000534520.1_Intron|FAM86B1_ENST00000533513.1_3'UTR|FAM86B1_ENST00000533852.2_Missense_Mutation_p.R198Q	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	164										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		GACATTCCCTCGGAGCTGCTC	0.617																																						.											0													39.0	43.0	42.0					8																	12044010		1489	2646	4135	SO:0001583	missense	85002			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.491G>A	8.37:g.12044010C>T	ENSP00000407067:p.Arg164Gln			Missense_Mutation	SNP	ENST00000448228.2	37	CCDS59512.1	.	.	.	.	.	.	.	.	.	.	-	11.09	1.537041	0.27475	.	.	ENSG00000186523	ENST00000431227;ENST00000448228;ENST00000526708	T	0.20881	2.04	1.17	1.17	0.20885	.	.	.	.	.	T	0.12689	0.0308	L	0.33624	1.015	0.80722	D	1	B;B	0.32573	0.376;0.123	B;B	0.28385	0.089;0.046	T	0.13124	-1.0521	9	0.24483	T	0.36	.	8.2654	0.31810	0.0:1.0:0.0:0.0	.	164;198	Q8N7N1;E9PN63	F86B1_HUMAN;.	Q	198;164;198	ENSP00000407067:R164Q	ENSP00000444227:R198Q	R	-	2	0	FAM86B1	12081419	0.000000	0.05858	0.202000	0.23494	0.276000	0.26787	-0.432000	0.06956	0.950000	0.37743	0.173000	0.16961	CGA		0.617	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383317.1	NM_032916	
FRG1B	284802	mdanderson.org	37	20	29628282	29628282	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr20:29628282G>A	ENST00000278882.3	+	6	664	c.284G>A	c.(283-285)gGg>gAg	p.G95E	FRG1B_ENST00000439954.2_Missense_Mutation_p.G100E|FRG1B_ENST00000358464.4_Missense_Mutation_p.G95E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATGAAGCAGGGGACATAGAA	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.284G>A	20.37:g.29628282G>A	ENSP00000278882:p.Gly95Glu		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.02	3.529440	0.64860	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56103	0.48	2.08	2.08	0.27032	Actin cross-linking (1);	0.051750	0.85682	D	0.000000	T	0.52092	0.1713	.	.	.	0.58432	D	0.999996	B;P	0.39940	0.309;0.696	P;P	0.46543	0.492;0.52	T	0.54221	-0.8326	9	0.45353	T	0.12	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	100;95	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	E	95;100;95	ENSP00000408863:G100E	ENSP00000278882:G95E	G	+	2	0	FRG1B	28241943	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GGG		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
KRTAP10-2	386679	mdanderson.org	37	21	45971081	45971081	+	Silent	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr21:45971081C>T	ENST00000391621.1	-	1	307	c.261G>A	c.(259-261)ccG>ccA	p.P87P	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	87	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						TGCAGCAAGCCGGCTGGCAGC	0.687																																						.											0													57.0	61.0	60.0					21																	45971081		2202	4292	6494	SO:0001819	synonymous_variant	386679			AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.261G>A	21.37:g.45971081C>T			Q70LJ5	Silent	SNP	ENST00000391621.1	37	CCDS42955.1																																																																																				0.687	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
KRTAP4-3	85290	mdanderson.org	37	17	39324333	39324333	+	Missense_Mutation	SNP	T	T	A	rs12953139	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr17:39324333T>A	ENST00000391356.2	-	1	91	c.92A>T	c.(91-93)cAg>cTg	p.Q31L		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	31					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGGTGGTCTGGCAGCAGCT	0.637																																						.											0													29.0	32.0	31.0					17																	39324333		2195	4293	6488	SO:0001583	missense	85290			AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.92A>T	17.37:g.39324333T>A	ENSP00000375151:p.Gln31Leu			Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	8.661	0.900435	0.17686	.	.	ENSG00000196156	ENST00000391356	T	0.01629	4.72	5.15	0.112	0.14623	.	.	.	.	.	T	0.03608	0.0103	M	0.85373	2.75	0.80722	P	0.0	B	0.34181	0.44	B	0.38378	0.272	T	0.11131	-1.0600	8	0.35671	T	0.21	.	3.821	0.08836	0.1588:0.2591:0.0:0.5822	.	31	Q9BYR4	KRA43_HUMAN	L	31	ENSP00000375151:Q31L	ENSP00000375151:Q31L	Q	-	2	0	KRTAP4-3	36577859	0.006000	0.16342	0.208000	0.23602	0.204000	0.24138	0.129000	0.15830	0.020000	0.15106	0.533000	0.62120	CAG		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
KRTAP5-10	387273	mdanderson.org	37	11	71276702	71276702	+	Silent	SNP	C	C	T	rs113977776		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr11:71276702C>T	ENST00000398531.1	+	1	94	c.69C>T	c.(67-69)ggC>ggT	p.G23G	KRTAP5-10_ENST00000376536.4_Silent_p.G23G	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	23						keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GCTGTGGGGGCTGTGGCTCCG	0.662																																						.											0													29.0	40.0	37.0					11																	71276702		2178	4275	6453	SO:0001819	synonymous_variant	387273			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.69C>T	11.37:g.71276702C>T			B9EHA4	Silent	SNP	ENST00000398531.1	37	CCDS41684.1																																																																																				0.662	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
LILRB1	10859	mdanderson.org	37	19	55147988	55147988	+	Missense_Mutation	SNP	A	A	C	rs202204734	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr19:55147988A>C	ENST00000396331.1	+	15	2048	c.1691A>C	c.(1690-1692)gAg>gCg	p.E564A	LILRB1_ENST00000396317.1_Missense_Mutation_p.E548A|LILRB1_ENST00000396332.4_Missense_Mutation_p.E565A|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396315.1_Missense_Mutation_p.E566A|LILRB1_ENST00000396327.3_Missense_Mutation_p.E565A|LILRB1_ENST00000418536.2_Missense_Mutation_p.E548A|LILRB1_ENST00000396321.2_Missense_Mutation_p.E564A|LILRB1_ENST00000434867.2_Missense_Mutation_p.E564A|LILRB1_ENST00000427581.2_Missense_Mutation_p.E615A|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000324602.7_Missense_Mutation_p.E566A	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	564					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.E564>?(2)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		ACGTATGCCGAGGTGAAACAC	0.582										HNSCC(37;0.09)			a|||	69	0.013778	0.0272	0.0043	5008	,	,		15480	0.0149		0.005	False		,,,				2504	0.0102					.											2	Complex(2)	NS(1)|skin(1)											82.0	76.0	78.0					19																	55147988		2202	4297	6499	SO:0001583	missense	10859			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1691A>C	19.37:g.55147988A>C	ENSP00000379622:p.Glu564Ala		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	A	2.522	-0.310424	0.05458	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T	0.00495	7.09;7.05;7.09;7.05;7.04;7.09;7.08;6.99;7.05;7.04	1.59	-2.69	0.06022	.	.	.	.	.	T	0.00300	0.0009	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.19200	0.001;0.034;0.0;0.009;0.009	B;B;B;B;B	0.21708	0.003;0.036;0.001;0.009;0.01	T	0.32375	-0.9909	9	0.32370	T	0.25	.	3.7184	0.08446	0.6055:0.2341:0.1604:0.0	.	548;566;565;565;564	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	A	564;548;564;565;566;564;565;615;548;566	ENSP00000379614:E564A;ENSP00000391514:E548A;ENSP00000379622:E564A;ENSP00000379618:E565A;ENSP00000315997:E566A;ENSP00000405243:E564A;ENSP00000379623:E565A;ENSP00000395004:E615A;ENSP00000379610:E548A;ENSP00000379608:E566A	ENSP00000315997:E566A	E	+	2	0	LILRB1	59839800	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.127000	0.15790	-0.858000	0.04110	-3.676000	0.00025	GAG		0.582	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
MUC2	4583	mdanderson.org	37	11	1093575	1093575	+	Silent	SNP	G	G	T	rs201450769		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr11:1093575G>T	ENST00000441003.2	+	30	5421	c.5394G>T	c.(5392-5394)acG>acT	p.T1798T	MUC2_ENST00000359061.5_Silent_p.T1754T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.T86T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1798T(1)|p.T1754T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccacaactacGGTGACCGCAA	0.582																																						.											2	Substitution - coding silent(2)	lung(2)											92.0	124.0	113.0					11																	1093575		2192	4266	6458	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5394G>T	11.37:g.1093575G>T			Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.582	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195505945	195505945	+	Missense_Mutation	SNP	A	A	G	rs200786826		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:195505945A>G	ENST00000463781.3	-	2	12965	c.12506T>C	c.(12505-12507)gTg>gCg	p.V4169A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V4169A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A4166_S4181delASSVSTGHGTPLPVTS(2)|p.V4169A(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGACACTGAGGAAGC	0.582																																						.											3	Deletion - In frame(2)|Substitution - Missense(1)	stomach(2)|upper_aerodigestive_tract(1)											16.0	10.0	12.0					3																	195505945		619	1357	1976	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12506T>C	3.37:g.195505945A>G	ENSP00000417498:p.Val4169Ala		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	1.905	-0.452055	0.04540	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39787	1.06;1.06	.	.	.	.	.	.	.	.	T	0.17534	0.0421	N	0.08118	0	0.09310	N	1	P	0.37985	0.613	B	0.35899	0.213	T	0.09729	-1.0661	7	.	.	.	.	2.6724	0.05071	0.5917:0.0:0.4083:0.0	rs3107749	4041	E7ESK3	.	A	4169	ENSP00000417498:V4169A;ENSP00000420243:V4169A	.	V	-	2	0	MUC4	196990724	0.000000	0.05858	0.023000	0.16930	0.007000	0.05969	-0.473000	0.06615	0.349000	0.23975	0.063000	0.15292	GTG		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507049	195507049	+	Missense_Mutation	SNP	G	G	A	rs76834296		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:195507049G>A	ENST00000463781.3	-	2	11861	c.11402C>T	c.(11401-11403)gCa>gTa	p.A3801V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3801V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.597																																						.											0													8.0	7.0	7.0					3																	195507049		644	1517	2161	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11402C>T	3.37:g.195507049G>A	ENSP00000417498:p.Ala3801Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	6.548	0.469336	0.12461	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31510	1.5;1.49	.	.	.	.	0.000000	0.24912	U	0.034619	T	0.12475	0.0303	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.13845	-1.0494	8	.	.	.	.	4.6062	0.12378	0.3343:0.0:0.6657:0.0	.	3673	E7ESK3	.	V	3801	ENSP00000417498:A3801V;ENSP00000420243:A3801V	.	A	-	2	0	MUC4	196991828	0.000000	0.05858	0.019000	0.16419	0.019000	0.09904	-2.749000	0.00793	-2.068000	0.00884	-2.092000	0.00371	GCA		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509093	195509093	+	Missense_Mutation	SNP	G	G	A	rs77902873		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:195509093G>A	ENST00000463781.3	-	2	9817	c.9358C>T	c.(9358-9360)Cct>Tct	p.P3120S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3120S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGTGTGA	0.587																																						.											0													16.0	9.0	12.0					3																	195509093		669	1550	2219	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9358C>T	3.37:g.195509093G>A	ENSP00000417498:p.Pro3120Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	8.043	0.764400	0.15914	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.27402	1.74;1.67	.	.	.	.	.	.	.	.	T	0.15132	0.0365	N	0.19112	0.55	0.21020	N	0.999801	B	0.15141	0.012	B	0.01281	0.0	T	0.28396	-1.0045	7	.	.	.	.	3.7959	0.08738	0.0:0.0:0.5797:0.4203	.	2992	E7ESK3	.	S	3120	ENSP00000417498:P3120S;ENSP00000420243:P3120S	.	P	-	1	0	MUC4	196993872	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.582000	0.02117	-0.000000	0.14550	0.000000	0.15137	CCT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509108	195509108	+	Missense_Mutation	SNP	T	T	A	rs200863118		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:195509108T>A	ENST00000463781.3	-	2	9802	c.9343A>T	c.(9343-9345)Aca>Tca	p.T3115S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3115S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGTGACCTGTGGATGCTGAG	0.587																																						.											0													20.0	11.0	14.0					3																	195509108		675	1555	2230	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9343A>T	3.37:g.195509108T>A	ENSP00000417498:p.Thr3115Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.337	0.620210	0.14193	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.45	.	.	.	.	.	.	.	.	T	0.16981	0.0408	N	0.19112	0.55	0.09310	N	1	P	0.42584	0.784	B	0.34418	0.182	T	0.12319	-1.0552	7	.	.	.	.	5.3345	0.15949	0.0:1.0E-4:0.0:0.9999	.	2987	E7ESK3	.	S	3115	ENSP00000417498:T3115S;ENSP00000420243:T3115S	.	T	-	1	0	MUC4	196993887	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.154000	0.10130	0.000000	0.14550	0.000000	0.15137	ACA		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510108	195510108	+	Silent	SNP	G	G	A	rs371875294	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:195510108G>A	ENST00000463781.3	-	2	8802	c.8343C>T	c.(8341-8343)caC>caT	p.H2781H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.H2781H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H2781H(4)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.592													.|||	19	0.00379393	0.0129	0.0014	5008	,	,		5980	0.0		0.0	False		,,,				2504	0.001					.											4	Substitution - coding silent(4)	kidney(3)|endometrium(1)											44.0	27.0	32.0					3																	195510108		687	1544	2231	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8343C>T	3.37:g.195510108G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1017684	1017684	+	Missense_Mutation	SNP	G	G	A	rs112886536	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr11:1017684G>A	ENST00000421673.2	-	31	5167	c.5117C>T	c.(5116-5118)gCc>gTc	p.A1706V		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1706	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTTGAGGTGGCTTCAGCATG	0.552																																						.											0								A	VAL/ALA	52,4350	752.1+/-412.3	0,52,2149	681.0	675.0	677.0		5117	-2.6	0.0	11	dbSNP_132	677	13,8559	797.0+/-407.5	0,13,4273	no	missense	MUC6	NM_005961.2	64	0,65,6422	AA,AG,GG		0.1517,1.1813,0.501	benign	1706/2440	1017684	65,12909	2201	4286	6487	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5117C>T	11.37:g.1017684G>A	ENSP00000406861:p.Ala1706Val		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	4.055	0.007944	0.07866	0.011813	0.001517	ENSG00000184956	ENST00000421673	T	0.19669	2.13	1.69	-2.64	0.06114	.	.	.	.	.	T	0.05593	0.0147	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30268	-0.9984	9	0.34782	T	0.22	.	3.8045	0.08771	0.1451:0.0:0.4591:0.3957	.	1706	Q6W4X9	MUC6_HUMAN	V	1706	ENSP00000406861:A1706V	ENSP00000406861:A1706V	A	-	2	0	MUC6	1007684	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.275000	0.08525	-0.637000	0.05516	-0.850000	0.03035	GCC		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
NACAD	23148	mdanderson.org	37	7	45123859	45123859	+	Silent	SNP	G	G	A	rs72497819	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr7:45123859G>A	ENST00000490531.2	-	2	1939	c.1920C>T	c.(1918-1920)tcC>tcT	p.S640S		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	640					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						GTGTCATAACGGAGTCCTGGG	0.602													G|||	1213	0.242212	0.1505	0.3415	5008	,	,		16852	0.2391		0.2853	False		,,,				2504	0.2546					.											0													5.0	6.0	5.0					7																	45123859		630	1536	2166	SO:0001819	synonymous_variant	23148			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.1920C>T	7.37:g.45123859G>A				Silent	SNP	ENST00000490531.2	37	CCDS47582.1																																																																																				0.602	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
OR9G1	390174	mdanderson.org	37	11	56468440	56468440	+	Missense_Mutation	SNP	G	G	T	rs397849038|rs12421330		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr11:56468440G>T	ENST00000312153.1	+	1	577	c.577G>T	c.(577-579)Ggc>Tgc	p.G193C		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						CGAGAAGGGCGGCTATAAAAT	0.478																																						.											0													117.0	118.0	118.0					11																	56468440		2201	4296	6497	SO:0001583	missense	390174			AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.577G>T	11.37:g.56468440G>T	ENSP00000309012:p.Gly193Cys		Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	ENST00000312153.1	37	CCDS31536.1	.	.	.	.	.	.	.	.	.	.	G	5.488	0.275107	0.10403	.	.	ENSG00000174914	ENST00000312153	T	0.00091	8.74	4.52	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.649761	0.14366	N	0.324095	T	0.00241	0.0007	L	0.28400	0.85	0.09310	N	1	P	0.46859	0.885	P	0.62184	0.899	T	0.56208	-0.8017	10	0.72032	D	0.01	-12.3577	8.9994	0.36072	0.2548:0.0:0.7452:0.0	rs12421330	193	Q8NH87	OR9G1_HUMAN	C	193	ENSP00000309012:G193C	ENSP00000309012:G193C	G	+	1	0	OR9G1	56225016	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	-1.080000	0.03407	0.630000	0.30394	-1.202000	0.01658	GGC		0.478	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213	
PLEC	5339	mdanderson.org	37	8	144996111	144996111	+	Silent	SNP	C	C	T	rs34803322	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr8:144996111C>T	ENST00000322810.4	-	32	8458	c.8289G>A	c.(8287-8289)ctG>ctA	p.L2763L	PLEC_ENST00000357649.2_Silent_p.L2630L|PLEC_ENST00000436759.2_Silent_p.L2653L|PLEC_ENST00000356346.3_Silent_p.L2612L|PLEC_ENST00000527096.1_Silent_p.L2649L|PLEC_ENST00000354958.2_Silent_p.L2604L|PLEC_ENST00000354589.3_Silent_p.L2626L|PLEC_ENST00000345136.3_Silent_p.L2626L|PLEC_ENST00000398774.2_Silent_p.L2594L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2763	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGCCATTGGGCAGGGTCTTTG	0.687													C|||	373	0.0744808	0.0121	0.147	5008	,	,		17788	0.0456		0.0626	False		,,,				2504	0.1493					.											0								C	,,,,,,,	66,4038		1,64,1987	15.0	19.0	17.0		7959,7836,7812,8289,7782,7878,7890,7878	2.1	1.0	8	dbSNP_126	17	487,7773		10,467,3653	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	11,531,5640	TT,TC,CC		5.8959,1.6082,4.4727	,,,,,,,	2653/4575,2612/4534,2604/4526,2763/4685,2594/4516,2626/4548,2630/4552,2626/4548	144996111	553,11811	2052	4130	6182	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8289G>A	8.37:g.144996111C>T			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1	118	0.05402930402930403	3	0.006097560975609756	45	0.12430939226519337	19	0.033216783216783216	51	0.06728232189973615	C	0.062	-1.222671	0.01530	0.016082	0.058959	ENSG00000178209	ENST00000527303	.	.	.	3.95	2.09	0.27110	.	.	.	.	.	T	0.00845	0.0028	.	.	.	0.09310	P	0.9999999999999596	.	.	.	.	.	.	T	0.13469	-1.0508	3	.	.	.	.	8.6493	0.34025	0.0:0.7593:0.1535:0.0873	rs34803322;rs34803322	.	.	.	Y	196	.	.	C	-	2	0	PLEC	145068099	0.994000	0.37717	0.997000	0.53966	0.022000	0.10575	0.364000	0.20325	0.427000	0.26145	0.448000	0.29417	TGC		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
BCRP4	616	mdanderson.org	37	22	22977706	22977706	+	IGR	SNP	G	G	C	rs150479444	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr22:22977706G>C								IGLV3-32 (40205 upstream) : POM121L1P (3941 downstream)																							TTGGCACGGTGTTTGGCCCCA	0.602													.|||	2686	0.536342	0.5809	0.5634	5008	,	,		7020	0.6815		0.3141	False		,,,				2504	0.5358					.											0																																										SO:0001628	intergenic_variant	25812																															22.37:g.22977706G>C				RNA	SNP		37																																																																																				0	0.602								
POMZP3	22932	mdanderson.org	37	7	76255328	76255328	+	Silent	SNP	C	C	T	rs199608185		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr7:76255328C>T	ENST00000310842.4	-	2	738	c.54G>A	c.(52-54)tcG>tcA	p.S18S	UPK3B_ENST00000443097.2_Intron|UPK3B_ENST00000419923.2_Intron|POMZP3_ENST00000275569.4_Silent_p.S18S|AC004980.7_ENST00000418663.1_RNA	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion	18										kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				TCGCAGAACGCGAAAATCTTC	0.483																																						.											0													106.0	78.0	87.0					7																	76255328		2202	4300	6502	SO:0001819	synonymous_variant	22932			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.54G>A	7.37:g.76255328C>T			F6STJ3|Q12903|Q9BWB4	Silent	SNP	ENST00000310842.4	37	CCDS43606.1																																																																																				0.483	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341775.1	NM_012230	
POTEG	404785	mdanderson.org	37	14	19558994	19558994	+	Missense_Mutation	SNP	G	G	A	rs138773680		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr14:19558994G>A	ENST00000409832.3	+	3	692	c.640G>A	c.(640-642)Gta>Ata	p.V214I		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	214										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CTGACAGGCCGTACAATGCCG	0.383																																						.											0													161.0	182.0	175.0					14																	19558994		1924	3884	5808	SO:0001583	missense	404785				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.640G>A	14.37:g.19558994G>A	ENSP00000386971:p.Val214Ile		A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	7.950	0.744672	0.15710	.	.	ENSG00000222036	ENST00000409832	T	0.66638	-0.22	1.87	0.387	0.16259	Ankyrin repeat-containing domain (4);	0.710225	0.12028	N	0.506284	T	0.47710	0.1460	L	0.28694	0.88	0.20926	N	0.999823	B	0.18968	0.032	B	0.16289	0.015	T	0.29488	-1.0010	10	0.35671	T	0.21	.	4.2876	0.10862	0.3015:0.0:0.6985:0.0	.	214	Q6S5H5	POTEG_HUMAN	I	214	ENSP00000386971:V214I	ENSP00000386971:V214I	V	+	1	0	POTEG	18628994	0.882000	0.30256	0.041000	0.18516	0.038000	0.13279	1.019000	0.30014	0.095000	0.17434	0.184000	0.17185	GTA		0.383	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
PRB2	653247	mdanderson.org	37	12	11546006	11546006	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr12:11546006G>A	ENST00000389362.4	-	3	1041	c.1006C>T	c.(1006-1008)Cct>Tct	p.P336S	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	336	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGACCTTGAGGTTTGTTGCCT	0.612																																						.											0													64.0	77.0	72.0					12																	11546006		2154	4213	6367	SO:0001583	missense	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.1006C>T	12.37:g.11546006G>A	ENSP00000374013:p.Pro336Ser		O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	0.008	-1.910201	0.00508	.	.	ENSG00000121335	ENST00000389362	T	0.05382	3.45	1.28	1.28	0.21552	.	.	.	.	.	T	0.02267	0.0070	N	0.04090	-0.28	0.09310	N	1	B	0.23540	0.087	B	0.15870	0.014	T	0.47586	-0.9106	9	0.10111	T	0.7	.	4.2319	0.10608	0.2535:0.0:0.7465:0.0	.	336	P02812	PRB2_HUMAN	S	336	ENSP00000374013:P336S	ENSP00000374013:P336S	P	-	1	0	PRB2	11437273	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	1.293000	0.33353	0.634000	0.30469	0.492000	0.49549	CCT		0.612	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
PRSS3	5646	mdanderson.org	37	9	33798016	33798016	+	Silent	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr9:33798016C>T	ENST00000361005.5	+	3	561	c.561C>T	c.(559-561)acC>acT	p.T187T	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Silent_p.T130T|PRSS3_ENST00000429677.3_Silent_p.T123T|PRSS3_ENST00000342836.4_Silent_p.T144T	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	187	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CTCTGCCCACCACCCCTCCAG	0.562																																						.											0													177.0	135.0	149.0					9																	33798016		2203	4300	6503	SO:0001819	synonymous_variant	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.561C>T	9.37:g.33798016C>T			A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	ENST00000361005.5	37	CCDS47958.1																																																																																				0.562	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
RAB11FIP5	26056	mdanderson.org	37	2	73316240	73316240	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:73316240A>G	ENST00000258098.6	-	2	875	c.635T>C	c.(634-636)cTc>cCc	p.L212P	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	212					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						GCTGCTTGGGAGGATGGCAGA	0.557																																						.											0													176.0	166.0	170.0					2																	73316240		2203	4300	6503	SO:0001583	missense	26056			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.635T>C	2.37:g.73316240A>G	ENSP00000258098:p.Leu212Pro		O94939|Q9P0M1	Missense_Mutation	SNP	ENST00000258098.6	37	CCDS1923.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.551239	0.65311	.	.	ENSG00000135631	ENST00000258098	T	0.33865	1.39	4.77	3.62	0.41486	.	0.190105	0.37304	N	0.002149	T	0.42063	0.1186	L	0.39898	1.24	0.58432	D	0.999999	D;D	0.63880	0.989;0.993	P;P	0.59288	0.726;0.855	T	0.14952	-1.0454	10	0.38643	T	0.18	-20.2281	9.4493	0.38717	0.9148:0.0:0.0852:0.0	.	212;212	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	P	212	ENSP00000258098:L212P	ENSP00000258098:L212P	L	-	2	0	RAB11FIP5	73169748	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.139000	0.94554	0.976000	0.38417	0.459000	0.35465	CTC		0.557	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251995.1	NM_015470	
SNRPB2	6629	mdanderson.org;bcgsc.ca	37	20	16717906	16717906	+	Splice_Site	SNP	C	C	T			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr20:16717906C>T	ENST00000246071.6	+	4	454	c.238C>T	c.(238-240)Cga>Tga	p.R80*	SNRPB2_ENST00000377943.5_Splice_Site_p.R80*	NM_003092.4	NP_003083.1	P08579	RU2B_HUMAN	small nuclear ribonucleoprotein polypeptide B	80	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	nucleotide binding (GO:0000166)|snRNA binding (GO:0017069)			large_intestine(2)|lung(2)|urinary_tract(1)	5						ATTAAAACAGCGAATACAGTA	0.299																																						.											0													48.0	47.0	47.0					20																	16717906		2202	4300	6502	SO:0001630	splice_region_variant	6629				CCDS13123.1	20p12.1	2013-02-12	2010-07-07		ENSG00000125870	ENSG00000125870		"""RNA binding motif (RRM) containing"""	11155	protein-coding gene	gene with protein product		603520	"""small nuclear ribonucleoprotein polypeptide B2"", ""small nuclear ribonucleoprotein polypeptide B''"""			2951739	Standard	NM_198220		Approved	Msl1	uc002wpi.2	P08579	OTTHUMG00000031933	ENST00000246071.6:c.238-1C>T	20.37:g.16717906C>T			B2R7J3|D3DW21|Q9UJD4	Nonsense_Mutation	SNP	ENST00000246071.6	37	CCDS13123.1	.	.	.	.	.	.	.	.	.	.	C	37	6.507542	0.97624	.	.	ENSG00000125870	ENST00000377943;ENST00000246071	.	.	.	5.76	3.74	0.42951	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.9868	13.6047	0.62039	0.4197:0.5803:0.0:0.0	.	.	.	.	X	80	.	.	R	+	1	2	SNRPB2	16665906	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.811000	0.27198	0.710000	0.31997	0.655000	0.94253	CGA		0.299	SNRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078110.1	NM_003092	Nonsense_Mutation
XAB2	56949	mdanderson.org	37	19	7694393	7694393	+	Silent	SNP	G	G	A	rs4134809	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr19:7694393G>A	ENST00000358368.4	-	1	58	c.21C>T	c.(19-21)ctC>ctT	p.L7L	PET100_ENST00000594797.1_5'Flank|XAB2_ENST00000534844.1_Silent_p.L4L|PET100_ENST00000601406.1_5'Flank|CTD-3214H19.4_ENST00000595866.1_5'Flank|PET100_ENST00000456958.3_5'Flank	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	7					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						CGGGCCGCGAGAGTCGCGCCA	0.667								Direct reversal of damage;Nucleotide excision repair (NER)					G|||	1320	0.263578	0.2103	0.2219	5008	,	,		14881	0.2083		0.3777	False		,,,				2504	0.3047					.											0								G		915,3483		96,723,1380	25.0	27.0	26.0		21	-8.9	0.0	19	dbSNP_108	26	3162,5430		573,2016,1707	no	coding-synonymous	XAB2	NM_020196.2		669,2739,3087	AA,AG,GG		36.8017,20.8049,31.3857		7/856	7694393	4077,8913	2199	4296	6495	SO:0001819	synonymous_variant	56949			AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.21C>T	19.37:g.7694393G>A			Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Silent	SNP	ENST00000358368.4	37	CCDS32892.1																																																																																				0.667	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196	
ZRSR2	8233	mdanderson.org	37	X	15838366	15838366	+	Silent	SNP	C	C	T	rs2301724	byFrequency	TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chrX:15838366C>T	ENST00000307771.7	+	10	888	c.864C>T	c.(862-864)aaC>aaT	p.N288N		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	288	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					CTCTGTTTAACGGACGATGGT	0.413			"""F, S, Mis"""		"""MDS, CLL"""								C|||	2105	0.557616	0.4191	0.4035	3775	,	,		15276	0.4504		0.3976	False		,,,				2504	0.4264				NSCLC(197;1631 3042 5741 31152)	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	0								C		2087,1748		475,822,315,335,256	162.0	153.0	156.0		864	-3.4	0.7	X	dbSNP_100	156	3278,3450		555,1233,935,640,937	no	coding-synonymous	ZRSR2	NM_005089.3		1030,2055,1250,975,1193	TT,TC,T,CC,C		48.7218,45.5802,49.2095		288/483	15838366	5365,5198	2203	4300	6503	SO:0001819	synonymous_variant	8233			BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.864C>T	X.37:g.15838366C>T			Q14D69	Silent	SNP	ENST00000307771.7	37	CCDS14172.1																																																																																				0.413	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
FASTKD1	79675	bcgsc.ca	37	2	170393737	170393737	+	Splice_Site	SNP	C	C	T	rs139576803		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr2:170393737C>T	ENST00000453153.2	-	12	2534	c.2188G>A	c.(2188-2190)Gat>Aat	p.D730N	FASTKD1_ENST00000453929.2_Splice_Site_p.D687N|FASTKD1_ENST00000495505.1_Intron	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	730					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						AATAACTTACCTACTTTGTGG	0.313																																						.											0																																										SO:0001630	splice_region_variant	79675			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.2188+1G>A	2.37:g.170393737C>T			Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	CCDS33318.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349299	0.82132	.	.	ENSG00000138399	ENST00000453153;ENST00000453929	T;T	0.78126	-1.15;-1.15	5.63	3.78	0.43462	FAST kinase-like protein, subdomain 2 (1);	0.177498	0.64402	D	0.000013	D	0.87111	0.6096	M	0.82716	2.605	0.58432	D	0.99999	D;D	0.71674	0.997;0.998	D;D	0.68353	0.928;0.957	D	0.87499	0.2432	10	0.72032	D	0.01	-0.4604	11.836	0.52323	0.1385:0.7284:0.133:0.0	.	687;730	Q53R41-2;Q53R41	.;FAKD1_HUMAN	N	730;687	ENSP00000400513:D730N;ENSP00000403229:D687N	ENSP00000400513:D730N	D	-	1	0	FASTKD1	170101983	1.000000	0.71417	0.995000	0.50966	0.813000	0.45954	4.060000	0.57477	0.697000	0.31718	0.491000	0.48974	GAT		0.313	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622	Missense_Mutation
ELFN2	114794	bcgsc.ca	37	22	37770611	37770611	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr22:37770611T>C	ENST00000402918.2	-	3	1749	c.964A>G	c.(964-966)Atg>Gtg	p.M322V	RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	322	Fibronectin type-III.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					AGGATGTACATCTTGCTGTAG	0.582																																						.											0													355.0	319.0	331.0					22																	37770611		2203	4300	6503	SO:0001583	missense	114794			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.964A>G	22.37:g.37770611T>C	ENSP00000385277:p.Met322Val		Q96PY3	Missense_Mutation	SNP	ENST00000402918.2	37	CCDS33642.1	.	.	.	.	.	.	.	.	.	.	T	10.64	1.406807	0.25378	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.04194	3.68;3.68	5.24	4.12	0.48240	.	0.045384	0.85682	D	0.000000	T	0.08223	0.0205	M	0.64997	1.995	0.45594	D	0.998538	P	0.36412	0.552	B	0.37731	0.257	T	0.07347	-1.0777	10	0.62326	D	0.03	-38.7595	12.568	0.56320	0.0:0.0:0.2406:0.7594	.	322	Q5R3F8	PPR29_HUMAN	V	322	ENSP00000300147:M322V;ENSP00000385277:M322V	ENSP00000300147:M322V	M	-	1	0	ELFN2	36100557	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.084000	0.57650	1.979000	0.57680	0.496000	0.49642	ATG		0.582	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906	
MUC4	4585	bcgsc.ca	37	3	195514379	195514379	+	Missense_Mutation	SNP	T	T	C	rs79461778		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:195514379T>C	ENST00000463781.3	-	2	4531	c.4072A>G	c.(4072-4074)Acc>Gcc	p.T1358A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T1358A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTGACCTGTG	0.567																																						.											0													3.0	4.0	4.0					3																	195514379		71	544	615	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4072A>G	3.37:g.195514379T>C	ENSP00000417498:p.Thr1358Ala		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	8.421	0.846478	0.16963	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34072	1.38;1.39	0.312	0.312	0.15837	.	.	.	.	.	T	0.10594	0.0259	N	0.02539	-0.55	0.80722	P	0.0	P	0.46912	0.886	B	0.35655	0.207	T	0.13361	-1.0512	7	.	.	.	.	5.0375	0.14441	0.0:2.0E-4:0.0:0.9998	.	1358	E7ESK3	.	A	1358	ENSP00000417498:T1358A;ENSP00000420243:T1358A	.	T	-	1	0	MUC4	196998774	0.000000	0.05858	0.014000	0.15608	0.098000	0.18820	-0.601000	0.05687	0.354000	0.24105	0.076000	0.15429	ACC		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195514403	195514403	+	Missense_Mutation	SNP	C	C	T	rs79754259		TCGA-KN-8421-01A-11D-2310-10	TCGA-KN-8421-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ba686386-8113-4885-b20f-6ad09a295604	9d5ee3f8-490f-4865-bb90-fe0a1bbf3643	g.chr3:195514403C>T	ENST00000463781.3	-	2	4507	c.4048G>A	c.(4048-4050)Gct>Act	p.A1350T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1350T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.572																																						.											0													3.0	4.0	4.0					3																	195514403		71	544	615	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4048G>A	3.37:g.195514403C>T	ENSP00000417498:p.Ala1350Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	2.328	-0.354007	0.05173	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29142	1.59;1.58	0.312	-0.624	0.11552	.	.	.	.	.	T	0.09202	0.0227	N	0.02539	-0.55	0.80722	P	0.0	B	0.12013	0.005	B	0.01281	0.0	T	0.27872	-1.0061	7	.	.	.	.	2.4452	0.04504	0.0:0.2686:0.2834:0.448	.	1350	E7ESK3	.	T	1350	ENSP00000417498:A1350T;ENSP00000420243:A1350T	.	A	-	1	0	MUC4	196998798	0.000000	0.05858	0.002000	0.10522	0.052000	0.14988	-4.702000	0.00196	-1.767000	0.01300	-1.780000	0.00649	GCT		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
