#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
WEE1	7465	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	9610060	9610060	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:9610060A>T	ENST00000450114.2	+	11	2105	c.1852A>T	c.(1852-1854)Atg>Ttg	p.M618L	WEE1_ENST00000299613.6_Missense_Mutation_p.M404L	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	618					blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		CACTGACCGGATGGCCACTAG	0.428																																						.											0													138.0	133.0	135.0					11																	9610060		2201	4294	6495	SO:0001583	missense	7465			X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.1852A>T	11.37:g.9610060A>T	ENSP00000402084:p.Met618Leu		B3KVE1|D3DQV0	Missense_Mutation	SNP	ENST00000450114.2	37	CCDS7800.1	.	.	.	.	.	.	.	.	.	.	A	10.04	1.242223	0.22796	.	.	ENSG00000166483	ENST00000450114;ENST00000299613;ENST00000527848	T;T;T	0.51574	0.83;0.7;0.99	5.31	5.31	0.75309	Protein kinase-like domain (1);	0.105878	0.64402	D	0.000003	T	0.23370	0.0565	N	0.08118	0	0.33277	D	0.561807	B	0.10296	0.003	B	0.04013	0.001	T	0.26573	-1.0099	10	0.07482	T	0.82	-15.606	9.7489	0.40464	0.9229:0.0:0.0771:0.0	.	618	P30291	WEE1_HUMAN	L	618;404;70	ENSP00000402084:M618L;ENSP00000299613:M404L;ENSP00000432284:M70L	ENSP00000299613:M404L	M	+	1	0	WEE1	9566636	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.551000	0.53698	2.014000	0.59158	0.460000	0.39030	ATG		0.428	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386757.1	NM_003390	
MYO7A	4647	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	76917244	76917244	+	Missense_Mutation	SNP	C	C	G	rs375992788		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:76917244C>G	ENST00000409709.3	+	41	6011	c.5739C>G	c.(5737-5739)gaC>gaG	p.D1913E	MYO7A_ENST00000409619.2_Missense_Mutation_p.D1864E|MYO7A_ENST00000458637.2_Missense_Mutation_p.D1875E|MYO7A_ENST00000605744.1_3'UTR	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1913	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ATGACACTGACGAGGTGAGGG	0.607																																						.											0													70.0	77.0	75.0					11																	76917244		1972	4145	6117	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5739C>G	11.37:g.76917244C>G	ENSP00000386331:p.Asp1913Glu		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	c	11.46	1.646762	0.29246	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169;ENST00000544424	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	4.54	-3.63	0.04529	Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	U	0.000000	T	0.79633	0.4479	M	0.66939	2.045	0.80722	D	1	B;D	0.76494	0.174;0.999	B;D	0.69654	0.132;0.965	T	0.77259	-0.2654	10	0.38643	T	0.18	.	12.1312	0.53944	0.0:0.2909:0.0:0.7091	.	1875;1913	F8VUN5;Q13402	.;MYO7A_HUMAN	E	1913;1875;1864;1086;1912;1882;1789;1055;528	ENSP00000386331:D1913E;ENSP00000392185:D1875E;ENSP00000386635:D1864E;ENSP00000417017:D1055E	ENSP00000345075:D1789E	D	+	3	2	MYO7A	76594892	0.116000	0.22171	0.565000	0.28409	0.133000	0.20885	-0.586000	0.05787	-0.625000	0.05604	-0.299000	0.09455	GAC		0.607	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
CDKN1B	1027	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	12871758	12871758	+	Splice_Site	SNP	G	G	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:12871758G>C	ENST00000228872.4	+	2	1191		c.e2-1		CDKN1B_ENST00000396340.1_Intron|CDKN1B_ENST00000477087.1_Splice_Site	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)			breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		CCTGCGCTTAGATTCTTCTAC	0.438																																						.											0													72.0	86.0	81.0					12																	12871758		2203	4300	6503	SO:0001630	splice_region_variant	1027			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.476-1G>C	12.37:g.12871758G>C			Q16307|Q5U0H2|Q9BUS6	Splice_Site	SNP	ENST00000228872.4	37	CCDS8653.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301381	0.60195	.	.	ENSG00000111276	ENST00000228872;ENST00000535674;ENST00000442489	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7715	0.85538	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDKN1B	12763025	1.000000	0.71417	0.994000	0.49952	0.746000	0.42486	6.881000	0.75584	2.384000	0.81235	0.655000	0.94253	.		0.438	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064	Intron
SKA3	221150	hgsc.bcm.edu	37	13	21742126	21742126	+	Splice_Site	SNP	C	C	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr13:21742126C>A	ENST00000314759.5	-	4	868		c.e4+1		SKA3_ENST00000400018.3_Splice_Site	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3						chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)				breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GAGCTGCTTACCTTTTATTAT	0.284																																						.											0													63.0	58.0	60.0					13																	21742126		2203	4297	6500	SO:0001630	splice_region_variant	221150			AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.743+1G>T	13.37:g.21742126C>A			A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Splice_Site	SNP	ENST00000314759.5	37	CCDS31946.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052163	0.36181	.	.	ENSG00000165480	ENST00000314759;ENST00000400018	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6803	0.77364	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SKA3	20640126	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	4.395000	0.59678	2.777000	0.95525	0.655000	0.94253	.		0.284	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061	Intron
ZNF598	90850	hgsc.bcm.edu	37	16	2059622	2059622	+	Splice_Site	DEL	C	C	-	rs11366527		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr16:2059622delC	ENST00000431526.1	-	3	139	c.125delG	c.(124-126)ggc>gc	p.G42fs	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	42							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GTCGCAGCGGCCCCAGCGCCG	0.736													CCC|CCCC|CCC|insertion	5008	1.0	1.0	1.0	5008	,	,		6036	1.0		1.0	False		,,,				2504	1.0					.											0										2432,4		1216,0,2	1.0	1.0	1.0			2.3	1.0	16	dbSNP_120	2	5091,7		2545,1,3	no	frameshift	ZNF598	NM_178167.2		3761,1,5	A1A1,A1R,RR		0.1373,0.1642,0.146			2059622	7523,11	285	632	917	SO:0001630	splice_region_variant	90850			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.124-1G>-	16.37:g.2059622delC			Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Frame_Shift_Del	DEL	ENST00000431526.1	37																																																																																					0.736	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	Frame_Shift_Del
ZNF319	57567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	58031971	58031971	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr16:58031971G>C	ENST00000299237.2	-	2	821	c.199C>G	c.(199-201)Ccc>Gcc	p.P67A	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	67	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						GCCTGCAGGGGTGCGTGTTGT	0.692																																						.											0													36.0	38.0	37.0					16																	58031971		2198	4299	6497	SO:0001583	missense	57567			AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.199C>G	16.37:g.58031971G>C	ENSP00000299237:p.Pro67Ala		Q52LH8	Missense_Mutation	SNP	ENST00000299237.2	37	CCDS32462.1	.	.	.	.	.	.	.	.	.	.	G	5.379	0.255089	0.10185	.	.	ENSG00000166188	ENST00000299237	T	0.03035	4.07	5.34	4.38	0.52667	.	0.085303	0.47455	D	0.000239	T	0.03220	0.0094	N	0.20685	0.6	0.36971	D	0.893841	B	0.18461	0.028	B	0.12156	0.007	T	0.46289	-0.9202	10	0.17832	T	0.49	-23.7999	15.0798	0.72106	0.0:0.1425:0.8575:0.0	.	67	Q9P2F9	ZN319_HUMAN	A	67	ENSP00000299237:P67A	ENSP00000299237:P67A	P	-	1	0	ZNF319	56589472	0.999000	0.42202	0.766000	0.31476	0.008000	0.06430	3.229000	0.51278	1.237000	0.43756	-0.302000	0.09304	CCC		0.692	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
VEZF1	7716	hgsc.bcm.edu	37	17	56056604	56056604	+	Silent	SNP	T	T	C	rs57786397|rs138088904|rs369163670	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr17:56056604T>C	ENST00000581208.1	-	5	1087	c.1047A>G	c.(1045-1047)caA>caG	p.Q349Q	VEZF1_ENST00000584396.1_Silent_p.Q340Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	349	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgctgctgct	0.468													-|||	285	0.0569089	0.0938	0.036	5008	,	,		16688	0.0099		0.0656	False		,,,				2504	0.0613					.											0								-		1,4405		0,1,2202	161.0	149.0	153.0		1047		0.4	17	dbSNP_134	153	2,8598		0,2,4298	no	coding-synonymous	VEZF1	NM_007146.2		0,3,6500	CC,CT,TT		0.0233,0.0227,0.0231		349/522	56056604	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	7716			D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1047A>G	17.37:g.56056604T>C				Silent	SNP	ENST00000581208.1	37	CCDS32687.1																																																																																				0.468	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
TSHZ3	57616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	31768447	31768447	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:31768447A>G	ENST00000240587.4	-	2	2579	c.2252T>C	c.(2251-2253)tTc>tCc	p.F751S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	751					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GCTCATCTTGAAAAGCATGCT	0.602																																						.											0													60.0	62.0	61.0					19																	31768447		2203	4300	6503	SO:0001583	missense	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2252T>C	19.37:g.31768447A>G	ENSP00000240587:p.Phe751Ser		Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	A	15.59	2.877495	0.51801	.	.	ENSG00000121297	ENST00000240587	T	0.39406	1.08	5.37	5.37	0.77165	.	0.051638	0.85682	D	0.000000	T	0.49643	0.1569	N	0.22421	0.69	0.58432	D	0.999999	D	0.65815	0.995	D	0.72982	0.979	T	0.46582	-0.9181	10	0.33141	T	0.24	-30.3567	15.3715	0.74568	1.0:0.0:0.0:0.0	.	751	Q63HK5	TSH3_HUMAN	S	751	ENSP00000240587:F751S	ENSP00000240587:F751S	F	-	2	0	TSHZ3	36460287	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.930000	0.92872	2.024000	0.59613	0.533000	0.62120	TTC		0.602	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
ZFP30	22835	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	38127148	38127148	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:38127148C>A	ENST00000351218.2	-	6	851	c.294G>T	c.(292-294)atG>atT	p.M98I	ZFP30_ENST00000392144.1_Missense_Mutation_p.M98I|ZFP30_ENST00000589018.1_Intron|ZFP30_ENST00000514101.2_Missense_Mutation_p.M98I	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAGATAAGTTCATTTCATAAA	0.343																																						.											0													45.0	44.0	44.0					19																	38127148		2203	4299	6502	SO:0001583	missense	22835			AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.294G>T	19.37:g.38127148C>A	ENSP00000343581:p.Met98Ile		Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	37	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	1.877	-0.458894	0.04508	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.04758	3.56;3.56;3.56	3.82	-2.98	0.05513	.	0.679876	0.12433	N	0.469377	T	0.01320	0.0043	N	0.01493	-0.835	0.22412	N	0.999124	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45948	-0.9226	10	0.19590	T	0.45	.	2.0782	0.03629	0.2677:0.4359:0.1246:0.1718	.	98;98	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	I	98;98;98;97	ENSP00000343581:M98I;ENSP00000422930:M98I;ENSP00000375988:M98I	ENSP00000343581:M98I	M	-	3	0	ZFP30	42818988	0.145000	0.22656	0.979000	0.43373	0.964000	0.63967	-0.420000	0.07062	-0.269000	0.09298	0.561000	0.74099	ATG		0.343	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898	
FAM71E2	284418	hgsc.bcm.edu;ucsc.edu	37	19	55870550	55870550	+	Silent	SNP	G	G	T	rs537757899		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:55870550G>T	ENST00000424985.3	-	9	1879	c.1686C>A	c.(1684-1686)ggC>ggA	p.G562G	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.A112E	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	562										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						CGTCAAAATCGCCAGGGAGCT	0.627																																						.											0													10.0	11.0	11.0					19																	55870550		690	1591	2281	SO:0001819	synonymous_variant	284418			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.1686C>A	19.37:g.55870550G>T			Q8ND99	Silent	SNP	ENST00000424985.3	37																																																																																					0.627	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
COL20A1	57642	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	61926524	61926524	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr20:61926524G>T	ENST00000358894.6	+	2	165	c.65G>T	c.(64-66)gGa>gTa	p.G22V	COL20A1_ENST00000422202.1_Missense_Mutation_p.G22V|COL20A1_ENST00000326996.6_Missense_Mutation_p.G22V|COL20A1_ENST00000435874.1_Missense_Mutation_p.G22V	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	22					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GCCACCCTGGGAAGAGAGCAA	0.697																																						.											0													13.0	17.0	16.0					20																	61926524		1985	4080	6065	SO:0001583	missense	57642			BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.65G>T	20.37:g.61926524G>T	ENSP00000351767:p.Gly22Val		Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	G	6.546	0.468969	0.12461	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	D;D;D;D	0.86164	-2.08;-2.05;-1.98;-1.98	2.84	1.79	0.24919	.	0.173457	0.37261	U	0.002171	T	0.74824	0.3767	L	0.28274	0.84	0.09310	N	0.999998	B	0.30068	0.267	B	0.22386	0.039	T	0.63233	-0.6683	10	0.40728	T	0.16	.	7.8695	0.29556	0.0:0.3747:0.6253:0.0	.	22	Q9P218	COKA1_HUMAN	V	22	ENSP00000351767:G22V;ENSP00000323077:G22V;ENSP00000408690:G22V;ENSP00000414753:G22V	ENSP00000323077:G22V	G	+	2	0	COL20A1	61396969	0.281000	0.24258	0.008000	0.14137	0.006000	0.05464	0.941000	0.29005	0.404000	0.25506	0.313000	0.20887	GGA		0.697	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
GPR148	344561	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	2	131486934	131486934	+	Silent	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr2:131486934G>A	ENST00000309926.4	+	1	292	c.210G>A	c.(208-210)ctG>ctA	p.L70L		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					GCCCCCTGCTGCTGGTGACCA	0.632																																						.											0													55.0	54.0	54.0					2																	131486934		2203	4300	6503	SO:0001819	synonymous_variant	344561			AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.210G>A	2.37:g.131486934G>A			Q2M369|Q86SP7|Q86U87	Silent	SNP	ENST00000309926.4	37	CCDS2163.1																																																																																				0.632	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092	
GAD1	2571	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	2	171709233	171709233	+	Silent	SNP	A	A	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr2:171709233A>C	ENST00000358196.3	+	13	1744	c.1194A>C	c.(1192-1194)tcA>tcC	p.S398S		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	398					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						GGGCCAACTCAGTCACCTGGA	0.507																																						.											0													171.0	134.0	147.0					2																	171709233		2203	4300	6503	SO:0001819	synonymous_variant	2571				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1194A>C	2.37:g.171709233A>C			Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Silent	SNP	ENST00000358196.3	37	CCDS2239.1																																																																																				0.507	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
CLTCL1	8218	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	22	19175230	19175230	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr22:19175230G>A	ENST00000263200.10	-	29	4517	c.4445C>T	c.(4444-4446)gCa>gTa	p.A1482V	CLTCL1_ENST00000353891.5_Intron|CLTCL1_ENST00000442042.2_Intron|CLTCL1_ENST00000427926.1_Missense_Mutation_p.A1482V	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1482	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					ATCGATAGATGCCCTTAAGCC	0.522			T	?	ALCL																																	.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													55.0	56.0	56.0					22																	19175230		2041	4191	6232	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4445C>T	22.37:g.19175230G>A	ENSP00000445677:p.Ala1482Val		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.136704	0.37728	.	.	ENSG00000070371	ENST00000263200;ENST00000427926	T;T	0.22539	1.95;1.95	3.97	3.97	0.46021	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.213152	0.39146	N	0.001446	T	0.21841	0.0526	L	0.45581	1.43	0.54753	D	0.999989	B	0.14805	0.011	B	0.18871	0.023	T	0.05257	-1.0896	10	0.41790	T	0.15	-1.1575	16.2212	0.82258	0.0:0.0:1.0:0.0	.	1482	P53675	CLH2_HUMAN	V	1482	ENSP00000445677:A1482V;ENSP00000441158:A1482V	ENSP00000445677:A1482V	A	-	2	0	CLTCL1	17555230	1.000000	0.71417	0.626000	0.29213	0.216000	0.24613	4.814000	0.62627	2.043000	0.60533	0.650000	0.86243	GCA		0.522	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
KREMEN1	83999	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	22	29517360	29517360	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr22:29517360G>T	ENST00000407188.1	+	4	362	c.362G>T	c.(361-363)gGc>gTc	p.G121V	KREMEN1_ENST00000400335.4_Missense_Mutation_p.G123V|KREMEN1_ENST00000400338.2_Missense_Mutation_p.G123V|KREMEN1_ENST00000327813.5_Missense_Mutation_p.G123V			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	121	WSC. {ECO:0000255|PROSITE- ProRule:PRU00558}.				cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						GGAAACCTTGGCTGCTACAAG	0.428																																						.											0													93.0	94.0	94.0					22																	29517360		2109	4236	6345	SO:0001583	missense	83999			AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.362G>T	22.37:g.29517360G>T	ENSP00000385431:p.Gly121Val		B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	ENST00000407188.1	37	CCDS43000.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350252	0.82132	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.14	5.14	0.70334	Carbohydrate-binding WSC (2);Kringle-like fold (1);	0.000000	0.64402	D	0.000006	D	0.88247	0.6385	H	0.97516	4.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.91893	0.5525	10	0.62326	D	0.03	.	16.4852	0.84182	0.0:0.0:1.0:0.0	.	121;123;123	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	V	123;123;123;121	ENSP00000383189:G123V;ENSP00000383192:G123V;ENSP00000331242:G123V;ENSP00000385431:G121V	ENSP00000331242:G123V	G	+	2	0	KREMEN1	27847360	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.201000	0.95017	2.566000	0.86566	0.563000	0.77884	GGC		0.428	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320947.1		
ALLC	55821	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	2	3743874	3743874	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr2:3743874G>A	ENST00000252505.3	+	9	839	c.677G>A	c.(676-678)gGg>gAg	p.G226E	ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	245					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GGAGTTGGCGGGGCAAAGTCT	0.363										HNSCC(21;0.051)																												.											0													87.0	82.0	84.0					2																	3743874		1850	4109	5959	SO:0001583	missense	55821			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.677G>A	2.37:g.3743874G>A	ENSP00000252505:p.Gly226Glu		Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	37	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625012	0.28889	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.66	-9.89	0.00464	Allantoicase domain (1);Galactose-binding domain-like (1);	2.153630	0.01366	N	0.012415	T	0.07999	0.0200	N	0.00661	-1.28	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36625	-0.9740	9	0.51188	T	0.08	-16.7355	4.9664	0.14093	0.1423:0.2747:0.492:0.091	.	245	Q8N6M5	ALLC_HUMAN	E	226	.	ENSP00000252505:G226E	G	+	2	0	ALLC	3721749	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.294000	0.08309	-1.949000	0.01031	-0.345000	0.07892	GGG		0.363	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1		
FANCD2	2177	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	10107113	10107113	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:10107113G>A	ENST00000419585.1	+	24	2365	c.2204G>A	c.(2203-2205)cGg>cAg	p.R735Q	FANCD2_ENST00000383806.1_Missense_Mutation_p.R735Q|FANCD2_ENST00000287647.3_Missense_Mutation_p.R735Q|FANCD2_ENST00000383807.1_Missense_Mutation_p.R735Q			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	735					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCGTATTTCCGGTTACTGAGA	0.443			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													169.0	166.0	167.0					3																	10107113		2203	4300	6503	SO:0001583	missense	2177	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2204G>A	3.37:g.10107113G>A	ENSP00000398754:p.Arg735Gln		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	G	31	5.080597	0.94050	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	5.29	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	M	0.72576	2.205	0.42130	D	0.991465	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76953	-0.2768	10	0.72032	D	0.01	.	13.0316	0.58845	0.0:0.0:0.8374:0.1626	.	735;735	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	Q	735	ENSP00000287647:R735Q;ENSP00000373318:R735Q;ENSP00000373317:R735Q;ENSP00000398754:R735Q	ENSP00000287647:R735Q	R	+	2	0	FANCD2	10082113	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	9.152000	0.94680	1.227000	0.43598	0.585000	0.79938	CGG		0.443	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
C3orf20	84077	broad.mit.edu;hgsc.bcm.edu	37	3	14724245	14724246	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:14724245_14724246insA	ENST00000253697.3	+	3	477_478	c.25_26insA	c.(25-27)gaafs	p.E9fs	C3orf20_ENST00000435614.1_Intron|C3orf20_ENST00000412910.1_Intron	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	9						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GAGTAACCTAGAATTATATCAG	0.48																																						.											0																																										SO:0001589	frameshift_variant	84077			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.27dupA	3.37:g.14724247_14724247dupA	ENSP00000253697:p.Glu9fs		Q7L0U6|Q8NCP2|Q9H0I7	Frame_Shift_Ins	INS	ENST00000253697.3	37	CCDS33706.1																																																																																				0.480	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
DAZL	1618	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	16630168	16630168	+	Nonstop_Mutation	SNP	C	C	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:16630168C>G	ENST00000399444.2	-	11	1180	c.887G>C	c.(886-888)tGa>tCa	p.*296S	DAZL_ENST00000250863.8_Nonstop_Mutation_p.*316S	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	0					female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						CCAGGAGGATCAAACAGATTT	0.338																																						.											0													182.0	177.0	179.0					3																	16630168		1823	4083	5906	SO:0001578	stop_lost	1618			BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.887G>C	3.37:g.16630168C>G			O15396|Q5HYB4|Q92909	Missense_Mutation	SNP	ENST00000399444.2	37	CCDS43059.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915762	0.33815	.	.	ENSG00000092345	ENST00000250863;ENST00000399444	.	.	.	5.47	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6359	0.51202	0.0:0.9173:0.0:0.0827	.	.	.	.	S	316;296	.	.	X	-	2	2	DAZL	16605172	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.683000	0.37638	2.560000	0.86352	0.655000	0.94253	TGA		0.338	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	
KIAA1211	57482	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	57181970	57181970	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:57181970G>A	ENST00000504228.1	+	6	2407	c.2302G>A	c.(2302-2304)Gag>Aag	p.E768K	KIAA1211_ENST00000541073.1_Missense_Mutation_p.E761K|KIAA1211_ENST00000264229.6_Missense_Mutation_p.E768K			Q6ZU35	K1211_HUMAN	KIAA1211	768										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TGGTGTTCGCGAGCTCGGGAA	0.602																																						.											0													52.0	65.0	60.0					4																	57181970		1945	4138	6083	SO:0001583	missense	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2302G>A	4.37:g.57181970G>A	ENSP00000423366:p.Glu768Lys		Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	G	6.105	0.387601	0.11581	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.11712	2.75;2.75;2.75	3.92	3.08	0.35506	.	.	.	.	.	T	0.04998	0.0134	N	0.12182	0.205	0.09310	N	1	B;B;B	0.14012	0.009;0.009;0.009	B;B;B	0.15052	0.012;0.004;0.004	T	0.45145	-0.9281	9	0.11182	T	0.66	-12.7984	4.905	0.13793	0.405:0.0:0.595:0.0	.	761;761;768	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	K	768;768;761;678	ENSP00000264229:E768K;ENSP00000423366:E768K;ENSP00000444006:E761K	ENSP00000264229:E768K	E	+	1	0	KIAA1211	56876727	0.791000	0.28800	0.025000	0.17156	0.005000	0.04900	4.000000	0.57039	0.855000	0.35359	0.561000	0.74099	GAG		0.602	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
KIAA1109	84162	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	4	123265699	123265699	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:123265699C>T	ENST00000264501.4	+	74	13089	c.12716C>T	c.(12715-12717)aCg>aTg	p.T4239M	KIAA1109_ENST00000388738.3_Missense_Mutation_p.T4239M			Q2LD37	K1109_HUMAN	KIAA1109	4239					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						ATGGATACTACGTTAATAAAT	0.308																																						.											0													103.0	99.0	100.0					4																	123265699		1834	4083	5917	SO:0001583	missense	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12716C>T	4.37:g.123265699C>T	ENSP00000264501:p.Thr4239Met		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.557440|4.557440	0.86231|0.86231	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000438707	.|T;T;T	.|0.32753	.|2.42;2.42;1.44	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51924|0.51924	0.1703|0.1703	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.997;0.996	T|T	0.50591|0.50591	-0.8810|-0.8810	5|10	.|0.66056	.|D	.|0.02	.|.	19.4516|19.4516	0.94871|0.94871	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|4238;4239	.|Q2LD37-4;Q2LD37	.|.;K1109_HUMAN	C|M	615|4239;4239;908	.|ENSP00000264501:T4239M;ENSP00000373390:T4239M;ENSP00000410874:T908M	.|ENSP00000264501:T4239M	R|T	+|+	1|2	0|0	KIAA1109|KIAA1109	123485149|123485149	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.951000|0.951000	0.60555|0.60555	7.631000|7.631000	0.83237|0.83237	2.590000|2.590000	0.87494|0.87494	0.655000|0.655000	0.94253|0.94253	CGT|ACG		0.308	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
MYL10	93408	hgsc.bcm.edu;mdanderson.org	37	7	101267298	101267298	+	Missense_Mutation	SNP	G	G	C	rs186580198	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr7:101267298G>C	ENST00000223167.4	-	3	352	c.175C>G	c.(175-177)Ctg>Gtg	p.L59V		NM_138403.4	NP_612412.2	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	59						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	12						gacagagccagactctgtcaa	0.502													G|||	22	0.00439297	0.0015	0.0058	5008	,	,		14497	0.0		0.0129	False		,,,				2504	0.0031				Esophageal Squamous(24;575 709 17516 40384 51639)	.											0													2.0	4.0	3.0					7																	101267298		450	613	1063	SO:0001583	missense	93408			BC002778	CCDS34713.1	7q22.1	2013-01-10			ENSG00000106436	ENSG00000106436		"""Myosins / Light chain"", ""EF-hand domain containing"""	29825	protein-coding gene	gene with protein product						1628631	Standard	NM_138403		Approved	MGC3479, MYLC2PL, PLRLC	uc003uyr.3	Q9BUA6	OTTHUMG00000157137	ENST00000223167.4:c.175C>G	7.37:g.101267298G>C	ENSP00000223167:p.Leu59Val			Missense_Mutation	SNP	ENST00000223167.4	37	CCDS34713.1	9	0.004120879120879121	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	7	0.009234828496042216	G	2.238	-0.374445	0.05034	.	.	ENSG00000106436	ENST00000223167	T	0.23950	1.88	0.235	0.235	0.15431	.	.	.	.	.	T	0.18002	0.0432	M	0.72624	2.21	0.20563	N	0.999885	B	0.06786	0.001	B	0.01281	0.0	T	0.23440	-1.0188	8	0.33141	T	0.24	.	.	.	.	.	59	Q9BUA6	MYL10_HUMAN	V	59	ENSP00000223167:L59V	ENSP00000223167:L59V	L	-	1	2	MYL10	101054018	0.036000	0.19791	0.124000	0.21820	0.129000	0.20672	-0.572000	0.05881	0.308000	0.22923	0.313000	0.20887	CTG		0.502	MYL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347575.1	NM_138403	
TRRAP	8295	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	98609129	98609129	+	Missense_Mutation	SNP	G	G	A	rs145619183		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr7:98609129G>A	ENST00000359863.4	+	71	11475	c.11266G>A	c.(11266-11268)Gcc>Acc	p.A3756T	AC004893.11_ENST00000360902.1_RNA|TRRAP_ENST00000446306.3_Missense_Mutation_p.A3745T|TRRAP_ENST00000355540.3_Missense_Mutation_p.A3727T	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3756	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GATTGCGGTCGCCCGGTGCTT	0.612																																						.											0								G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	69.0	64.0	66.0		11179	3.8	0.3	7	dbSNP_134	66	0,8600		0,0,4300	no	missense	TRRAP	NM_003496.3	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	3727/3831	98609129	1,13005	2203	4300	6503	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.11266G>A	7.37:g.98609129G>A	ENSP00000352925:p.Ala3756Thr		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352462	0.82132	2.27E-4	0.0	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.81330	-1.48;-1.48	5.67	3.83	0.44106	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.055645	0.64402	D	0.000001	D	0.91212	0.7231	M	0.91196	3.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74348	0.98;0.976;0.983	D	0.92652	0.6134	10	0.87932	D	0	.	15.096	0.72235	0.0:0.0:0.7422:0.2578	.	3727;3484;3756	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	T	3756;3727;3744	ENSP00000352925:A3756T;ENSP00000347733:A3727T	ENSP00000347733:A3727T	A	+	1	0	TRRAP	98447065	1.000000	0.71417	0.273000	0.24645	0.502000	0.33828	7.626000	0.83164	0.715000	0.32103	0.655000	0.94253	GCC		0.612	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
NOM1	64434	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	7	156742689	156742689	+	Silent	SNP	G	G	A	rs375339990		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr7:156742689G>A	ENST00000275820.3	+	1	273	c.258G>A	c.(256-258)agG>agA	p.R86R		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	86	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AGGAACTGAGGAAGGAGAAGC	0.701																																						.											0								G		2,3778		0,2,1888	5.0	7.0	6.0		258	-5.0	0.1	7		6	0,7658		0,0,3829	no	coding-synonymous	NOM1	NM_138400.1		0,2,5717	AA,AG,GG		0.0,0.0529,0.0175		86/861	156742689	2,11436	1890	3829	5719	SO:0001819	synonymous_variant	64434			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.258G>A	7.37:g.156742689G>A			Q96I08	Silent	SNP	ENST00000275820.3	37	CCDS34787.1																																																																																				0.701	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
CLN8	2055	broad.mit.edu;hgsc.bcm.edu	37	8	1728652	1728652	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:1728652delG	ENST00000331222.4	+	3	1027	c.780delG	c.(778-780)ccgfs	p.P260fs	CLN8_ENST00000523237.1_3'UTR	NM_018941.3	NP_061764.2	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)	260	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				adult walking behavior (GO:0007628)|age-dependent response to oxidative stress (GO:0001306)|associative learning (GO:0008306)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|ceramide biosynthetic process (GO:0046513)|ceramide metabolic process (GO:0006672)|cholesterol metabolic process (GO:0008203)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|lipid biosynthetic process (GO:0008610)|lipid transport (GO:0006869)|lysosome organization (GO:0007040)|mitochondrial membrane organization (GO:0007006)|musculoskeletal movement (GO:0050881)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteolysis (GO:0045861)|negative regulation of transferase activity (GO:0051348)|nervous system development (GO:0007399)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|phospholipid metabolic process (GO:0006644)|photoreceptor cell maintenance (GO:0045494)|protein catabolic process (GO:0030163)|regulation of cell size (GO:0008361)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic motor neuron differentiation (GO:0021523)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		TTCTCAATCCGGTGGACTGGA	0.547																																					Pancreas(155;338 1942 6138 10888 50612)	.											0													117.0	117.0	117.0					8																	1728652		2203	4300	6503	SO:0001589	frameshift_variant	2055			AF123761	CCDS5956.1	8p23.3	2014-09-17			ENSG00000182372	ENSG00000182372			2079	protein-coding gene	gene with protein product		607837	"""chromosome 8 open reading frame 61"""	EPMR, C8orf61		10508524	Standard	NM_018941		Approved	FLJ39417	uc003wpo.4	Q9UBY8	OTTHUMG00000090343	ENST00000331222.4:c.780delG	8.37:g.1728652delG	ENSP00000328182:p.Pro260fs		Q86U71|Q96I95	Frame_Shift_Del	DEL	ENST00000331222.4	37	CCDS5956.1																																																																																				0.547	CLN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206715.2	NM_018941	
SLC26A7	115111	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	8	92378833	92378833	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:92378833T>C	ENST00000276609.3	+	14	1753	c.1514T>C	c.(1513-1515)aTc>aCc	p.I505T	SLC26A7_ENST00000520249.1_3'UTR|SLC26A7_ENST00000523719.1_Missense_Mutation_p.I505T|SLC26A7_ENST00000309536.2_Missense_Mutation_p.I505T	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			GTGAAAATTATCTCAATAAAC	0.328																																						.											0													45.0	49.0	47.0					8																	92378833		2203	4300	6503	SO:0001583	missense	115111			AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.1514T>C	8.37:g.92378833T>C	ENSP00000276609:p.Ile505Thr			Missense_Mutation	SNP	ENST00000276609.3	37	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741478	0.49151	.	.	ENSG00000147606	ENST00000523719;ENST00000276609;ENST00000309536	D;D;D	0.88818	-2.43;-2.43;-2.43	5.33	5.33	0.75918	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.224247	0.31760	N	0.007101	D	0.85457	0.5701	L	0.57536	1.79	0.32391	N	0.553211	P;B	0.35272	0.493;0.324	B;B	0.28385	0.053;0.089	D	0.89445	0.3726	10	0.87932	D	0	.	12.8205	0.57690	0.0:0.0:0.0:1.0	.	505;505	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	T	505	ENSP00000428849:I505T;ENSP00000276609:I505T;ENSP00000309504:I505T	ENSP00000276609:I505T	I	+	2	0	SLC26A7	92448009	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.465000	0.60141	2.025000	0.59659	0.533000	0.62120	ATC		0.328	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
AARD	441376	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	8	117954928	117954928	+	Silent	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:117954928G>A	ENST00000378279.3	+	2	501	c.456G>A	c.(454-456)gcG>gcA	p.A152A	AARD_ENST00000523536.1_3'UTR	NM_001025357.2	NP_001020528.1	Q4LEZ3	AARD_HUMAN	alanine and arginine rich domain containing protein	152					lung development (GO:0030324)												ATGATGCTGCGAATCCGGAAT	0.502																																						.											0													68.0	63.0	65.0					8																	117954928		2203	4300	6503	SO:0001819	synonymous_variant	441376			AB181519, BC140924	CCDS34935.1	8q24.11	2012-04-19	2012-04-19	2012-04-19	ENSG00000205002	ENSG00000205002			33842	protein-coding gene	gene with protein product	"""Alanine and arginine-rich domain-containing protein"""		"""chromosome 8 open reading frame 85"""	C8orf85			Standard	NM_001025357		Approved	LOC441376	uc003yof.3	Q4LEZ3	OTTHUMG00000164961	ENST00000378279.3:c.456G>A	8.37:g.117954928G>A			A5PKU8	Silent	SNP	ENST00000378279.3	37	CCDS34935.1																																																																																				0.502	AARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381195.1	NM_001025357	
FAT3	120114	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	92543184	92543184	+	Nonsense_Mutation	SNP	T	T	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:92543184T>A	ENST00000298047.6	+	12	9440	c.9423T>A	c.(9421-9423)taT>taA	p.Y3141*	FAT3_ENST00000409404.2_Nonsense_Mutation_p.Y3141*|FAT3_ENST00000525166.1_Nonsense_Mutation_p.Y2991*			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3141	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCTGTGTCTATGAGAACACAG	0.527										TCGA Ovarian(4;0.039)																												.											0													58.0	59.0	59.0					11																	92543184		1943	4133	6076	SO:0001587	stop_gained	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9423T>A	11.37:g.92543184T>A	ENSP00000298047:p.Tyr3141*		B5MDB0|Q96AU6	Nonsense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	51	17.442473	0.99886	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	.	.	.	5.16	2.85	0.33270	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2732	0.31857	0.0:0.229:0.0:0.771	.	.	.	.	X	3141;3141;2991	.	ENSP00000298047:Y3141X	Y	+	3	2	FAT3	92182832	0.997000	0.39634	1.000000	0.80357	0.922000	0.55478	0.366000	0.20365	0.321000	0.23259	0.460000	0.39030	TAT		0.527	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
KIF21A	55605	hgsc.bcm.edu;mdanderson.org	37	12	39735383	39735383	+	Silent	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:39735383C>T	ENST00000361418.5	-	14	1860	c.1845G>A	c.(1843-1845)gaG>gaA	p.E615E	KIF21A_ENST00000395670.3_Silent_p.E615E|KIF21A_ENST00000541463.2_Silent_p.E602E|KIF21A_ENST00000544797.2_Silent_p.E602E|KIF21A_ENST00000361961.3_Silent_p.E602E			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	615					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E602D(1)|p.E602E(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				cctcctcctcctcttcttcat	0.398																																						.											2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(1)|kidney(1)											85.0	82.0	83.0					12																	39735383		2203	4299	6502	SO:0001819	synonymous_variant	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1845G>A	12.37:g.39735383C>T			A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	37	CCDS53776.1																																																																																				0.398	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
GPR133	283383	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	131593399	131593399	+	Missense_Mutation	SNP	G	G	A	rs141128784		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:131593399G>A	ENST00000261654.5	+	18	2577	c.2018G>A	c.(2017-2019)cGt>cAt	p.R673H	GPR133_ENST00000376682.4_Missense_Mutation_p.R359H|GPR133_ENST00000535015.1_Missense_Mutation_p.R705H|GPR133_ENST00000543617.1_Missense_Mutation_p.R192H	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	673					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R673H(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		AGCAAGCACCGTTACTACTat	0.607													g|||	1	0.000199681	0.0008	0.0	5008	,	,		11651	0.0		0.0	False		,,,				2504	0.0					.											1	Substitution - Missense(1)	prostate(1)						A	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	114.0	105.0	108.0		2018	-5.2	0.3	12	dbSNP_134	108	0,8600		0,0,4300	no	missense	GPR133	NM_198827.3	29	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign	673/875	131593399	4,13002	2203	4300	6503	SO:0001583	missense	283383			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2018G>A	12.37:g.131593399G>A	ENSP00000261654:p.Arg673His		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	g	13.48	2.250340	0.39797	9.08E-4	0.0	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	T;T;T;T	0.42513	1.18;1.21;0.97;0.97	4.78	-5.21	0.02815	GPCR, family 2-like (1);	0.429012	0.26038	N	0.026706	T	0.34629	0.0904	M	0.70842	2.15	0.20074	N	0.999931	B;B;B	0.31351	0.001;0.32;0.216	B;B;B	0.33568	0.005;0.064;0.166	T	0.21415	-1.0246	10	0.33141	T	0.24	.	8.6912	0.34267	0.2113:0.0:0.4899:0.2988	.	705;192;673	B7ZLF7;Q6QNK2-3;Q6QNK2	.;.;GP133_HUMAN	H	673;705;359;192	ENSP00000261654:R673H;ENSP00000444425:R705H;ENSP00000365872:R359H;ENSP00000438021:R192H	ENSP00000261654:R673H	R	+	2	0	GPR133	130159352	0.869000	0.29996	0.336000	0.25522	0.819000	0.46315	0.830000	0.27462	-1.407000	0.02043	-1.480000	0.00990	CGT		0.607	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
RCAN3	11123	hgsc.bcm.edu;bcgsc.ca	37	1	24861635	24861635	+	Silent	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr1:24861635T>C	ENST00000374395.4	+	5	907	c.594T>C	c.(592-594)gtT>gtC	p.V198V	RCAN3_ENST00000374393.2_Missense_Mutation_p.F83S|RCAN3_ENST00000436717.2_Silent_p.V188V|RCAN3_ENST00000538532.1_Silent_p.V140V|RCAN3_ENST00000412742.2_Missense_Mutation_p.F141S	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	198					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		GCGTGGTGGTTCATGTCTGTG	0.498																																						.											0													47.0	49.0	48.0					1																	24861635		2203	4300	6503	SO:0001819	synonymous_variant	11123				CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.594T>C	1.37:g.24861635T>C			A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Missense_Mutation	SNP	ENST00000374395.4	37	CCDS254.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162723	0.57368	.	.	ENSG00000117602	ENST00000412742;ENST00000374393	.	.	.	5.45	-10.9	0.00192	.	.	.	.	.	T	0.34164	0.0888	.	.	.	0.19300	N	0.999973	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.42258	-0.9462	7	0.87932	D	0	-33.0566	15.3457	0.74334	0.0:0.2117:0.6205:0.1677	.	83;141	E7EWD8;E7ENV1	.;.	S	141;83	.	ENSP00000363514:F83S	F	+	2	0	RCAN3	24734222	0.074000	0.21230	0.212000	0.23672	0.975000	0.68041	-0.717000	0.04986	-1.894000	0.01105	-0.435000	0.05868	TTC		0.498	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009176.2		
HPR	3250	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	16	72110892	72110892	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr16:72110892A>G	ENST00000540303.2	+	5	991	c.959A>G	c.(958-960)gAt>gGt	p.D320G	HPR_ENST00000228226.8_Missense_Mutation_p.D357G|HPR_ENST00000561690.1_Nonstop_Mutation_p.*118W|HPR_ENST00000356967.5_Missense_Mutation_p.D320G	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	320	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				CTAAGCTTTGATAAGAGCTGT	0.542																																						.											0													260.0	173.0	202.0					16																	72110892		2087	4219	6306	SO:0001583	missense	3250			BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.959A>G	16.37:g.72110892A>G	ENSP00000441828:p.Asp320Gly		Q7LE20|Q92658|Q92659|Q9ULB0	Missense_Mutation	SNP	ENST00000540303.2	37	CCDS42193.1	.	.	.	.	.	.	.	.	.	.	A	9.648	1.140896	0.21205	.	.	ENSG00000257017	ENST00000356967;ENST00000540303;ENST00000228226	D;D;D	0.88975	-2.45;-2.45;-2.45	2.64	2.64	0.31445	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	T	0.78464	0.4287	N	0.01140	-0.99	0.40259	D	0.97815	D	0.89917	1.0	D	0.97110	1.0	T	0.75671	-0.3237	10	0.02654	T	1	.	7.1984	0.25866	0.7742:0.2258:0.0:0.0	.	320	P00739	HPTR_HUMAN	G	320;320;357	ENSP00000349451:D320G;ENSP00000441828:D320G;ENSP00000228226:D357G	ENSP00000228226:D357G	D	+	2	0	HP	70668393	0.995000	0.38212	1.000000	0.80357	0.524000	0.34500	2.861000	0.48380	1.198000	0.43158	0.338000	0.21704	GAT		0.542	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421696.1	NM_020995	
PPAP2C	8612	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	288028	288028	+	Missense_Mutation	SNP	C	C	T	rs148329482	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:288028C>T	ENST00000269812.3	-	2	245	c.196G>A	c.(196-198)Gtc>Atc	p.V66I	PPAP2C_ENST00000434325.2_Missense_Mutation_p.V10I|PPAP2C_ENST00000327790.3_Missense_Mutation_p.V87I	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	66					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAAGGATGACGGTGGCCGTG	0.642													.|||	6	0.00119808	0.0	0.0	5008	,	,		12700	0.0		0.006	False		,,,				2504	0.0					.											0								C	ILE/VAL,ILE/VAL,ILE/VAL	1,4405	824.9+/-416.5	0,1,2202	113.0	99.0	104.0		196,28,259	-3.8	0.0	19	dbSNP_134	104	0,8600		0,0,4300	yes	missense,missense,missense	PPAP2C	NM_003712.2,NM_177526.1,NM_177543.1	29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	66/289,10/233,87/310	288028	1,13005	2203	4300	6503	SO:0001583	missense	8612			AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.196G>A	19.37:g.288028C>T	ENSP00000269812:p.Val66Ile		A6NLV0|E9PAY8	Missense_Mutation	SNP	ENST00000269812.3	37	CCDS12023.1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	T	0.525	-0.860463	0.02610	2.27E-4	0.0	ENSG00000141934	ENST00000269812;ENST00000327790;ENST00000434325	T;T;T	0.74632	-0.86;-0.83;1.61	4.44	-3.8	0.04307	.	0.415488	0.22661	N	0.057186	T	0.38214	0.1032	N	0.17631	0.505	0.09310	N	1	B;B	0.17038	0.0;0.02	B;B	0.13407	0.001;0.009	T	0.44236	-0.9341	10	0.02654	T	1	-8.3324	7.8963	0.29708	0.0:0.6408:0.1073:0.2519	.	66;87	O43688;O43688-2	LPP2_HUMAN;.	I	66;87;10	ENSP00000269812:V66I;ENSP00000329697:V87I;ENSP00000388565:V10I	ENSP00000269812:V66I	V	-	1	0	PPAP2C	239028	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.062000	0.03468	-0.363000	0.08101	-1.796000	0.00623	GTC		0.642	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2		
DAZL	1618	hgsc.bcm.edu;mdanderson.org	37	3	16630220	16630221	+	Splice_Site	DNP	CC	CC	TT			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:16630220_16630221CC>TT	ENST00000399444.2	-	11	1128	c.835_835GG>AA	c.(835-837)GGga>AAgga	p.G279K	DAZL_ENST00000250863.8_Splice_Site_p.G299K	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	279					female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						ACTCTTTTATCCTGGAAAAGAC	0.342																																						.											0																																										SO:0001630	splice_region_variant	1618			BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.835_835delinsTT	3.37:g.16630220_16630221delinsTT			O15396|Q5HYB4|Q92909	Splice_Site	DNP	ENST00000399444.2	37	CCDS43059.1																																																																																				0.342	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	Missense_Mutation
SMARCC1	6599	hgsc.bcm.edu	37	3	47823126	47823126	+	Silent	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:47823126C>T	ENST00000254480.5	-	1	281	c.162G>A	c.(160-162)tcG>tcA	p.S54S	SMARCC1_ENST00000425518.1_Intron	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	54					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		AGACCCGCACCGAATCCAGCT	0.701																																						.											0													18.0	22.0	21.0					3																	47823126		2177	4262	6439	SO:0001819	synonymous_variant	6599			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.162G>A	3.37:g.47823126C>T			Q17RS0|Q6P172|Q8IWH2	Silent	SNP	ENST00000254480.5	37	CCDS2758.1																																																																																				0.701	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257491.1		
FKTN	2218	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	9	108358893	108358893	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr9:108358893G>T	ENST00000223528.2	+	3	244	c.120G>T	c.(118-120)ttG>ttT	p.L40F	FKTN_ENST00000540160.1_Missense_Mutation_p.L40F|FKTN_ENST00000357998.5_Missense_Mutation_p.L40F|FKTN_ENST00000448551.2_Missense_Mutation_p.L40F|FKTN_ENST00000602661.1_Missense_Mutation_p.L40F|FKTN_ENST00000490134.1_3'UTR	NM_006731.2	NP_006722.2	O75072	FKTN_HUMAN	fukutin	40					muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|nervous system development (GO:0007399)|regulation of protein glycosylation (GO:0060049)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transferase activity (GO:0016740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	25						GAGCTGGTTTGTCAAAATCCA	0.323																																						.											0													90.0	91.0	90.0					9																	108358893		2203	4300	6503	SO:0001583	missense	2218				CCDS6766.1	9q31-q33	2014-09-17	2007-11-21	2007-11-21	ENSG00000106692	ENSG00000106692			3622	protein-coding gene	gene with protein product		607440	"""Fukuyama type congenital muscular dystrophy (fukutin)"""	FCMD		8275093, 17036286, 17044012	Standard	NM_001079802		Approved	LGMD2M	uc004bcs.3	O75072	OTTHUMG00000020425	ENST00000223528.2:c.120G>T	9.37:g.108358893G>T	ENSP00000223528:p.Leu40Phe		B4DUX9|J3KP13|Q3MIJ1|Q96TE1|Q9P295	Missense_Mutation	SNP	ENST00000223528.2	37	CCDS6766.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.617468	0.28801	.	.	ENSG00000106692	ENST00000223528;ENST00000448551;ENST00000540160;ENST00000357998	D;D;D;D	0.91068	-2.45;-2.78;-1.59;-2.78	5.83	3.16	0.36331	.	0.412429	0.26345	N	0.024912	T	0.74015	0.3661	N	0.04880	-0.145	0.23341	N	0.997877	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.0	T	0.58967	-0.7542	10	0.30078	T	0.28	-4.1447	1.2504	0.01981	0.5098:0.1362:0.1005:0.2535	.	40;40;40	B4E2W4;B4DUX9;O75072	.;.;FKTN_HUMAN	F	40	ENSP00000223528:L40F;ENSP00000399140:L40F;ENSP00000439423:L40F;ENSP00000350687:L40F	ENSP00000223528:L40F	L	+	3	2	FKTN	107398714	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.290000	0.33319	0.912000	0.36772	-0.218000	0.12543	TTG		0.323	FKTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053505.1	NM_006731	
ARHGEF19	128272	broad.mit.edu	37	1	16525737	16525737	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr1:16525737A>G	ENST00000270747.3	-	15	2295	c.2159T>C	c.(2158-2160)gTt>gCt	p.V720A	ARHGEF19-AS1_ENST00000457809.1_RNA|ARHGEF19_ENST00000478117.1_5'UTR	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	720	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		AACACACTGAACCTGGGGGCA	0.607																																						.											0													103.0	87.0	92.0					1																	16525737		2203	4300	6503	SO:0001583	missense	128272			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.2159T>C	1.37:g.16525737A>G	ENSP00000270747:p.Val720Ala		A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Missense_Mutation	SNP	ENST00000270747.3	37	CCDS170.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.123998	0.77436	.	.	ENSG00000142632	ENST00000270747	T	0.30182	1.54	4.57	4.57	0.56435	Src homology-3 domain (3);	0.000000	0.56097	D	0.000025	T	0.42562	0.1208	L	0.39326	1.205	0.80722	D	1	D	0.59767	0.986	D	0.64877	0.93	T	0.27123	-1.0083	10	0.51188	T	0.08	.	11.9367	0.52878	1.0:0.0:0.0:0.0	.	720	Q8IW93	ARHGJ_HUMAN	A	720	ENSP00000270747:V720A	ENSP00000270747:V720A	V	-	2	0	ARHGEF19	16398324	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.037000	0.88933	1.939000	0.56221	0.459000	0.35465	GTT		0.607	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213	
CELSR2	1952	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	109805471	109805471	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr1:109805471G>T	ENST00000271332.3	+	7	4649	c.4588G>T	c.(4588-4590)Gac>Tac	p.D1530Y		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1530	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CGGGGTGCCTGACCTGCCCGA	0.642																																					NSCLC(158;1285 2011 34800 34852 42084)	.											0													55.0	57.0	56.0					1																	109805471		2202	4300	6502	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.4588G>T	1.37:g.109805471G>T	ENSP00000271332:p.Asp1530Tyr		Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403315	0.62288	.	.	ENSG00000143126	ENST00000271332	T	0.81415	-1.49	4.6	3.65	0.41850	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.79534	0.4462	M	0.62088	1.915	0.38754	D	0.954164	D	0.64830	0.994	D	0.64410	0.925	T	0.80618	-0.1302	9	0.59425	D	0.04	.	5.235	0.15441	0.168:0.0:0.6532:0.1788	.	1530	Q9HCU4	CELR2_HUMAN	Y	1530	ENSP00000271332:D1530Y	ENSP00000271332:D1530Y	D	+	1	0	CELSR2	109606994	0.999000	0.42202	0.933000	0.37362	0.852000	0.48524	3.366000	0.52343	1.221000	0.43506	0.561000	0.74099	GAC		0.642	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CENPF	1063	broad.mit.edu	37	1	214815136	214815136	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr1:214815136A>G	ENST00000366955.3	+	12	3623	c.3455A>G	c.(3454-3456)gAg>gGg	p.E1152G		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTATTACAAGAGAATGAACAG	0.343																																					Colon(80;575 1284 11000 14801 43496)	.											0													62.0	64.0	63.0					1																	214815136		2203	4300	6503	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3455A>G	1.37:g.214815136A>G	ENSP00000355922:p.Glu1152Gly		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	11.28	1.593293	0.28357	.	.	ENSG00000117724	ENST00000366955	T	0.05382	3.45	5.01	5.01	0.66863	.	0.000000	0.38436	N	0.001682	T	0.08670	0.0215	.	.	.	0.41890	D	0.990365	P	0.48503	0.911	P	0.45406	0.479	T	0.14559	-1.0468	9	0.40728	T	0.16	.	9.8173	0.40860	0.9189:0.0:0.0811:0.0	.	1152	P49454	CENPF_HUMAN	G	1152	ENSP00000355922:E1152G	ENSP00000355922:E1152G	E	+	2	0	CENPF	212881759	1.000000	0.71417	0.946000	0.38457	0.294000	0.27393	4.975000	0.63777	2.011000	0.59026	0.496000	0.49642	GAG		0.343	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
MUC2	4583	broad.mit.edu	37	11	1092953	1092953	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:1092953C>T	ENST00000441003.2	+	30	4799	c.4772C>T	c.(4771-4773)aCg>aTg	p.T1591M	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Splice_Site_p.T1592M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1592M(1)|p.T1591M(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccactacggtgacccca	0.627																																						.											2	Substitution - Missense(2)	endometrium(2)											54.0	86.0	74.0					11																	1092953		1812	3313	5125	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4772C>T	11.37:g.1092953C>T	ENSP00000415183:p.Thr1591Met		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.179	-0.168424	0.06461	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.16743	2.32;2.56	1.75	-0.619	0.11572	.	6.725620	0.00827	U	0.001636	T	0.08846	0.0219	.	.	.	0.09310	N	1	D	0.60575	0.988	B	0.34489	0.184	T	0.24548	-1.0157	9	0.32370	T	0.25	.	3.3423	0.07123	0.2481:0.5888:0.0:0.163	.	1591	E7EUV1	.	M	1591;1592	ENSP00000415183:T1591M;ENSP00000351956:T1592M	ENSP00000351956:T1592M	T	+	2	0	MUC2	1082953	0.064000	0.20934	0.000000	0.03702	0.189000	0.23516	1.615000	0.36922	-0.313000	0.08728	0.121000	0.15741	ACG		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CD44	960	broad.mit.edu;bcgsc.ca	37	11	35226107	35226107	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:35226107A>G	ENST00000428726.2	+	10	1325	c.1202A>G	c.(1201-1203)gAa>gGa	p.E401G	CD44_ENST00000433892.2_Intron|CD44_ENST00000360158.4_Intron|CD44_ENST00000415148.2_Missense_Mutation_p.E358G|CD44_ENST00000433354.2_Missense_Mutation_p.E402G|CD44_ENST00000278386.6_Intron|CD44_ENST00000449691.2_Intron|CD44_ENST00000352818.4_Intron|CD44_ENST00000263398.6_Intron|CD44_ENST00000434472.2_Intron|CD44_ENST00000437706.2_Missense_Mutation_p.E401G|CD44_ENST00000526669.2_Intron	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	401	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	ACCCAGAAGGAACAGTGGTTT	0.453																																						.											0													170.0	143.0	152.0					11																	35226107		2202	4298	6500	SO:0001583	missense	960			M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.1202A>G	11.37:g.35226107A>G	ENSP00000398632:p.Glu401Gly		A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Missense_Mutation	SNP	ENST00000428726.2	37	CCDS7897.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.761218	0.31137	.	.	ENSG00000026508	ENST00000415148;ENST00000433354;ENST00000437706;ENST00000428726;ENST00000531110;ENST00000528672	T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86	5.05	3.94	0.45596	.	0.251258	0.28307	N	0.015828	T	0.43166	0.1235	M	0.72118	2.19	0.22017	N	0.999417	P;D	0.71674	0.728;0.998	B;D	0.72982	0.425;0.979	T	0.18493	-1.0335	10	0.40728	T	0.16	-18.3994	6.7294	0.23375	0.8981:0.0:0.1019:0.0	.	358;401	P16070-4;P16070	.;CD44_HUMAN	G	358;402;401;401;113;53	ENSP00000389830:E358G;ENSP00000414567:E402G;ENSP00000403990:E401G;ENSP00000398632:E401G;ENSP00000436549:E113G;ENSP00000431860:E53G	ENSP00000389830:E358G	E	+	2	0	CD44	35182683	0.806000	0.28996	0.621000	0.29145	0.003000	0.03518	3.848000	0.55903	2.199000	0.70637	0.533000	0.62120	GAA		0.453	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610	
SIPA1	6494	broad.mit.edu;bcgsc.ca	37	11	65409950	65409950	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:65409950G>C	ENST00000394224.3	+	4	1120	c.824G>C	c.(823-825)gGc>gCc	p.G275A	SIPA1_ENST00000527525.1_Missense_Mutation_p.G275A|SIPA1_ENST00000394227.3_Missense_Mutation_p.G275A|SIPA1_ENST00000534313.1_Missense_Mutation_p.G275A	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	275					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						ACACTCCGTGGCACCATCTCG	0.682																																						.											0													25.0	24.0	25.0					11																	65409950		2201	4295	6496	SO:0001583	missense	6494			AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.824G>C	11.37:g.65409950G>C	ENSP00000377771:p.Gly275Ala		O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	ENST00000394224.3	37	CCDS8108.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073406	0.76415	.	.	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29	4.0	4.0	0.46444	.	0.000000	0.50627	U	0.000103	D	0.96476	0.8850	M	0.84219	2.685	0.58432	D	0.999994	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.995	D	0.96844	0.9620	10	0.72032	D	0.01	-23.9387	13.9767	0.64277	0.0:0.0:1.0:0.0	.	275;275	F6RY50;Q96FS4	.;SIPA1_HUMAN	A	275	ENSP00000436269:G275A;ENSP00000433686:G275A;ENSP00000377771:G275A;ENSP00000377774:G275A	ENSP00000377771:G275A	G	+	2	0	SIPA1	65166526	1.000000	0.71417	1.000000	0.80357	0.335000	0.28730	7.634000	0.83273	2.240000	0.73641	0.455000	0.32223	GGC		0.682	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	NM_006747	
TBK1	29110	broad.mit.edu	37	12	64873884	64873884	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:64873884T>C	ENST00000331710.5	+	7	1133	c.794T>C	c.(793-795)gTt>gCt	p.V265A		NM_013254.3	NP_037386.1	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of gene expression (GO:0010629)|negative regulation of type I interferon production (GO:0032480)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon production (GO:0032606)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)	ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)	20				GBM - Glioblastoma multiforme(28;0.0386)		GACATGCCTGTTTCTTGCAGT	0.398																																						.											0													201.0	191.0	194.0					12																	64873884		2203	4300	6503	SO:0001583	missense	29110			AF191838	CCDS8968.1	12q14.2	2006-06-10			ENSG00000183735	ENSG00000183735			11584	protein-coding gene	gene with protein product		604834				10581243, 10783893	Standard	NM_013254		Approved	NAK	uc001ssc.2	Q9UHD2	OTTHUMG00000168796	ENST00000331710.5:c.794T>C	12.37:g.64873884T>C	ENSP00000329967:p.Val265Ala		A8K4S4|Q8IYV3|Q9NUJ5	Missense_Mutation	SNP	ENST00000331710.5	37	CCDS8968.1	.	.	.	.	.	.	.	.	.	.	T	11.43	1.637133	0.29157	.	.	ENSG00000183735	ENST00000331710	T	0.64803	-0.12	4.71	3.57	0.40892	Protein kinase, catalytic domain (1);	0.553565	0.19822	N	0.105285	T	0.31327	0.0793	N	0.01874	-0.695	0.30188	N	0.79977	B	0.02656	0.0	B	0.08055	0.003	T	0.20907	-1.0261	9	.	.	.	-3.3263	9.9944	0.41891	0.0:0.0804:0.0:0.9196	.	265	Q9UHD2	TBK1_HUMAN	A	265	ENSP00000329967:V265A	.	V	+	2	0	TBK1	63160151	0.968000	0.33430	0.914000	0.36105	0.893000	0.52053	4.470000	0.60175	0.795000	0.33922	0.477000	0.44152	GTT		0.398	TBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401130.1	NM_013254	
ORAI1	84876	broad.mit.edu	37	12	122064774	122064779	+	In_Frame_Del	DEL	CCGCCA	CCGCCA	-	rs141919534|rs531278468		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	CCGCCA	CCGCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:122064774_122064779delCCGCCA	ENST00000330079.7	+	1	320_325	c.127_132delCCGCCA	c.(127-132)ccgccadel	p.PP47del		NM_032790.3	NP_116179	Q96D31	CRCM1_HUMAN	ORAI calcium release-activated calcium modulator 1	0	Pro-rich.				blood coagulation (GO:0007596)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|regulation of calcium ion transport (GO:0051924)|store-operated calcium entry (GO:0002115)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|store-operated calcium channel activity (GO:0015279)	p.P43_P44delPP(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		cccgggggccccgccaccgccaccgc	0.748														5007	0.9998	1.0	1.0	5008	,	,		5795	1.0		1.0	False		,,,				2504	0.999					.											1	Deletion - In frame(1)	breast(1)																																								SO:0001651	inframe_deletion	84876			AK027372		12q24.31	2014-09-17	2007-08-14	2007-08-14	ENSG00000182500	ENSG00000276045		"""ORAI calcium release-activated calcium modulators"""	25896	protein-coding gene	gene with protein product	"""calcium release-activated calcium modulator 1"""	610277	"""transmembrane protein 142A"""	TMEM142A		16582901	Standard	NM_032790		Approved	FLJ14466, CRACM1	uc021rff.1	Q96D31		ENST00000330079.7:c.127_132delCCGCCA	12.37:g.122064780_122064785delCCGCCA	ENSP00000328216:p.Pro47_Pro48del		Q3MHV3|Q6DHX2|Q96BP7|Q96K71	In_Frame_Del	DEL	ENST00000330079.7	37	CCDS41851.1																																																																																				0.748	ORAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402151.1	NM_032790	
CLMN	79789	broad.mit.edu	37	14	95662949	95662949	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr14:95662949delT	ENST00000298912.4	-	10	2707	c.2594delA	c.(2593-2595)aagfs	p.K865fs	CLMN_ENST00000557215.1_5'Flank|CLMN_ENST00000556441.1_5'Flank	NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	865					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.K865fs*10(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		CCTTTTTTCCTTTTTTTTACT	0.408																																						.											1	Deletion - Frameshift(1)	large_intestine(1)											152.0	132.0	139.0					14																	95662949		2203	4300	6503	SO:0001589	frameshift_variant	79789			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.2594delA	14.37:g.95662949delT	ENSP00000298912:p.Lys865fs		B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Frame_Shift_Del	DEL	ENST00000298912.4	37	CCDS9933.1																																																																																				0.408	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
OR4F4	26682	broad.mit.edu	37	15	102462595	102462595	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr15:102462595delA	ENST00000326183.3	-	1	703	c.668delT	c.(667-669)ttafs	p.L223fs		NM_001004195.2	NP_001004195.2	Q96R69	OR4F4_HUMAN	olfactory receptor, family 4, subfamily F, member 4	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CGACTTATCTAAAGGGCAATG	0.413																																						.											0													303.0	467.0	415.0					15																	102462595		1925	4157	6082	SO:0001589	frameshift_variant	26682				CCDS32343.1	15q26.3	2012-08-09			ENSG00000177693	ENSG00000177693		"""GPCR / Class A : Olfactory receptors"""	8301	protein-coding gene	gene with protein product							Standard	NM_001004195		Approved	OR4F18	uc002cdf.1	Q96R69		ENST00000326183.3:c.668delT	15.37:g.102462595delA	ENSP00000317482:p.Leu223fs		B2RNI5|Q6IFN9	Nonsense_Mutation	DEL	ENST00000326183.3	37	CCDS32343.1																																																																																				0.413	OR4F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417599.1	NM_001004195	
ITGAD	3681	broad.mit.edu	37	16	31421837	31421837	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr16:31421837C>T	ENST00000389202.2	+	11	1254	c.1205C>T	c.(1204-1206)tCt>tTt	p.S402F		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	402					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ATGAGGGACTCTTACCTGGGT	0.597																																						.											0													73.0	70.0	71.0					16																	31421837		2197	4300	6497	SO:0001583	missense	3681			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1205C>T	16.37:g.31421837C>T	ENSP00000373854:p.Ser402Phe		Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	c	13.46	2.243558	0.39697	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.23754	1.89	4.43	4.43	0.53597	.	.	.	.	.	T	0.56426	0.1984	M	0.89658	3.05	0.32435	N	0.547457	D;D	0.62365	0.991;0.991	D;D	0.65010	0.931;0.931	T	0.72453	-0.4289	9	0.87932	D	0	.	14.5149	0.67811	0.0:1.0:0.0:0.0	.	418;402	Q59H14;Q13349	.;ITAD_HUMAN	F	418;402	ENSP00000373854:S402F	ENSP00000373854:S402F	S	+	2	0	ITGAD	31329338	0.967000	0.33354	0.825000	0.32803	0.100000	0.18952	3.338000	0.52128	2.007000	0.58848	0.197000	0.17608	TCT		0.597	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
CDH16	1014	broad.mit.edu	37	16	66942345	66942345	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr16:66942345T>C	ENST00000299752.4	-	18	2633	c.2440A>G	c.(2440-2442)Aag>Gag	p.K814E	CDH16_ENST00000568632.1_Missense_Mutation_p.K717E|CDH16_ENST00000565796.1_Missense_Mutation_p.K775E|CDH16_ENST00000570262.1_Missense_Mutation_p.K734E|CDH16_ENST00000394055.3_Missense_Mutation_p.K792E	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	814					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TCCGGGTCCTTCTTCCTTGAC	0.577																																						.											0													111.0	106.0	108.0					16																	66942345		2200	4300	6500	SO:0001583	missense	1014			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.2440A>G	16.37:g.66942345T>C	ENSP00000299752:p.Lys814Glu		B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.589247	0.46110	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.59906	0.23;0.25	5.52	4.43	0.53597	.	0.165860	0.37219	N	0.002181	T	0.59004	0.2162	N	0.22421	0.69	0.39445	D	0.967316	D;D;D	0.69078	0.997;0.997;0.988	P;D;P	0.75020	0.879;0.985;0.76	T	0.60999	-0.7151	10	0.51188	T	0.08	-26.4532	7.9819	0.30188	0.0:0.0924:0.0:0.9076	.	792;814;814	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	E	792;814;778	ENSP00000377619:K792E;ENSP00000299752:K814E	ENSP00000299752:K814E	K	-	1	0	CDH16	65499846	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	3.426000	0.52778	0.936000	0.37367	0.533000	0.62120	AAG		0.577	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
WDR59	79726	broad.mit.edu	37	16	74976691	74976691	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr16:74976691delT	ENST00000262144.6	-	7	609	c.479delA	c.(478-480)aatfs	p.N160fs		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	160										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						GCAGTTAGCATTTTTTTTATT	0.502																																						.											0													84.0	76.0	79.0					16																	74976691		2198	4300	6498	SO:0001589	frameshift_variant	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.479delA	16.37:g.74976691delT	ENSP00000262144:p.Asn160fs		B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Frame_Shift_Del	DEL	ENST00000262144.6	37	CCDS32488.1																																																																																				0.502	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
HEXDC	284004	broad.mit.edu	37	17	80377733	80377733	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr17:80377733C>A	ENST00000327949.9	+	1	69	c.58C>A	c.(58-60)Cca>Aca	p.P20T	OGFOD3_ENST00000313056.5_5'Flank|HEXDC_ENST00000337014.6_Missense_Mutation_p.P20T|Y_RNA_ENST00000364369.1_RNA|OGFOD3_ENST00000329197.5_5'Flank|HEXDC_ENST00000577944.1_Missense_Mutation_p.P20T			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	20					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TAAAGGAGCTCCACCAAAGGT	0.428																																						.											0													89.0	90.0	90.0					17																	80377733		1877	4092	5969	SO:0001583	missense	284004			AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.58C>A	17.37:g.80377733C>A	ENSP00000332634:p.Pro20Thr		B7UUP6|Q8IYN4|Q8TE81	Missense_Mutation	SNP	ENST00000327949.9	37		.	.	.	.	.	.	.	.	.	.	C	18.36	3.607611	0.66558	.	.	ENSG00000169660	ENST00000337014;ENST00000327949	D;D	0.90133	-2.62;-2.62	4.97	4.97	0.65823	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.144606	0.46442	D	0.000281	D	0.94997	0.8381	M	0.83603	2.65	0.58432	D	0.999998	D;D	0.76494	0.996;0.999	D;D	0.72982	0.935;0.979	D	0.93758	0.7064	10	0.30078	T	0.28	-22.7356	15.7781	0.78240	0.0:1.0:0.0:0.0	.	20;20	Q8WVB3;Q8WVB3-2	HEXDC_HUMAN;.	T	20	ENSP00000337854:P20T;ENSP00000332634:P20T	ENSP00000332634:P20T	P	+	1	0	HEXDC	77971022	0.946000	0.32159	0.252000	0.24328	0.687000	0.40016	3.236000	0.51336	2.568000	0.86640	0.655000	0.94253	CCA		0.428	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000443513.1	NM_173620	
MUC16	94025	broad.mit.edu	37	19	9049341	9049341	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:9049341T>C	ENST00000397910.4	-	5	32493	c.32290A>G	c.(32290-32292)Acg>Gcg	p.T10764A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10766	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGGCTATCGTCTTTGGTTCA	0.478																																						.											0													139.0	128.0	131.0					19																	9049341		1936	4138	6074	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32290A>G	19.37:g.9049341T>C	ENSP00000381008:p.Thr10764Ala		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	6.017	0.371456	0.11409	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	2.66	1.62	0.23740	.	.	.	.	.	T	0.02610	0.0079	L	0.34521	1.04	.	.	.	B	0.30068	0.267	B	0.37304	0.246	T	0.29852	-0.9998	8	0.87932	D	0	.	4.5679	0.12196	0.0:0.157:0.0:0.843	.	10764	B5ME49	.	A	10764	ENSP00000381008:T10764A	ENSP00000381008:T10764A	T	-	1	0	MUC16	8910341	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.303000	0.19210	0.440000	0.26502	0.388000	0.25769	ACG		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LIPT1	51601	broad.mit.edu	37	2	99778524	99778524	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr2:99778524A>T	ENST00000393473.2	+	3	328	c.104A>T	c.(103-105)cAg>cTg	p.Q35L	LIPT1_ENST00000393477.3_Missense_Mutation_p.Q35L|LIPT1_ENST00000340066.1_Missense_Mutation_p.Q35L|LIPT1_ENST00000393471.2_Missense_Mutation_p.Q35L|LIPT1_ENST00000393474.3_Missense_Mutation_p.Q35L|MRPL30_ENST00000410042.1_Intron	NM_001204830.1|NM_015929.3	NP_001191759.1|NP_057013.1	Q9Y234	LIPT_HUMAN	lipoyltransferase 1	35					cellular protein modification process (GO:0006464)|lipid metabolic process (GO:0006629)|protein lipoylation (GO:0009249)	mitochondrion (GO:0005739)	transferase activity, transferring acyl groups (GO:0016746)			large_intestine(6)|lung(1)	7					Lipoic Acid(DB00166)	CTCATTTTACAGTCAATTTCC	0.383																																					GBM(84;665 1268 21657 25485 30647)	.											0													95.0	91.0	93.0					2																	99778524		2203	4300	6503	SO:0001583	missense	51601			AB017566	CCDS2039.1	2q11.2	2010-11-25			ENSG00000144182	ENSG00000144182	2.3.1.181		29569	protein-coding gene	gene with protein product		610284				10103005	Standard	NM_145197		Approved	MGC12290, MGC13378	uc002szq.4	Q9Y234	OTTHUMG00000130640	ENST00000393473.2:c.104A>T	2.37:g.99778524A>T	ENSP00000377115:p.Gln35Leu		Q4ZFZ1	Missense_Mutation	SNP	ENST00000393473.2	37	CCDS2039.1	.	.	.	.	.	.	.	.	.	.	A	6.644	0.487261	0.12641	.	.	ENSG00000144182	ENST00000393473;ENST00000393477;ENST00000393474;ENST00000340066;ENST00000393471;ENST00000449211;ENST00000434566;ENST00000415142;ENST00000436234	.	.	.	5.06	5.06	0.68205	.	0.259619	0.38663	N	0.001611	T	0.41213	0.1149	N	0.20986	0.625	0.80722	D	1	B	0.15930	0.015	B	0.13407	0.009	T	0.27905	-1.0060	9	0.10111	T	0.7	-21.4158	14.1412	0.65320	1.0:0.0:0.0:0.0	.	35	Q9Y234	LIPT_HUMAN	L	35	.	ENSP00000342071:Q35L	Q	+	2	0	LIPT1	99144956	1.000000	0.71417	0.998000	0.56505	0.145000	0.21501	3.555000	0.53727	2.123000	0.65237	0.533000	0.62120	CAG		0.383	LIPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253128.1	NM_015929	
LCT	3938	broad.mit.edu;mdanderson.org	37	2	136558375	136558375	+	Silent	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr2:136558375G>A	ENST00000264162.2	-	12	4678	c.4668C>T	c.(4666-4668)gtC>gtT	p.V1556V		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1556	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCCTATTGGAGACTCCTGGAA	0.507																																						.											0													54.0	50.0	51.0					2																	136558375		2203	4300	6503	SO:0001819	synonymous_variant	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4668C>T	2.37:g.136558375G>A			Q4ZG58	Silent	SNP	ENST00000264162.2	37	CCDS2178.1																																																																																				0.507	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
TTN	7273	broad.mit.edu	37	2	179426292	179426292	+	Silent	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr2:179426292A>G	ENST00000591111.1	-	276	79868	c.79644T>C	c.(79642-79644)taT>taC	p.Y26548Y	TTN_ENST00000589042.1_Silent_p.Y28189Y|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Silent_p.Y19249Y|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Silent_p.Y19124Y|TTN_ENST00000342175.6_Silent_p.Y19316Y|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Silent_p.Y25621Y			Q8WZ42	TITIN_HUMAN	titin	26548	Fibronectin type-III 93. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCAAGATGATAGCCAATTA	0.418																																						.											0													87.0	80.0	83.0					2																	179426292		1902	4113	6015	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.79644T>C	2.37:g.179426292A>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
KRTAP10-5	386680	broad.mit.edu	37	21	46000294	46000294	+	Silent	SNP	C	C	T	rs201287112		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr21:46000294C>T	ENST00000400372.1	-	1	187	c.162G>A	c.(160-162)gcG>gcA	p.A54A	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	54	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						GCTCACAGGCCGCCTGGCAGC	0.716													.|||	1	0.000199681	0.0008	0.0	5008	,	,		17574	0.0		0.0	False		,,,				2504	0.0					.											0													30.0	36.0	34.0					21																	46000294		2190	4281	6471	SO:0001819	synonymous_variant	386680			AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.162G>A	21.37:g.46000294C>T			Q0VAR7|Q0VAR8|Q70LJ3	Silent	SNP	ENST00000400372.1	37	CCDS42958.1																																																																																				0.716	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128042.1		
CACNA1D	776	broad.mit.edu	37	3	53844075	53844075	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:53844075G>T	ENST00000350061.5	+	47	6453	c.5942G>T	c.(5941-5943)tGg>tTg	p.W1981L	CACNA1D_ENST00000544977.1_3'UTR|CACNA1D_ENST00000422281.2_Missense_Mutation_p.W1957L|CACNA1D_ENST00000288139.4_Missense_Mutation_p.W2001L	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1981					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCCGGTCGTGGGCCACCCCT	0.612																																						.											0													57.0	59.0	58.0					3																	53844075		2203	4300	6503	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5942G>T	3.37:g.53844075G>T	ENSP00000288133:p.Trp1981Leu		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039880	0.75732	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.21	5.21	0.72293	.	0.090555	0.49305	D	0.000149	T	0.72236	0.3435	M	0.74647	2.275	0.80722	D	1	D;B;B;D	0.76494	0.999;0.012;0.439;0.999	D;B;B;D	0.70716	0.934;0.009;0.109;0.97	T	0.74321	-0.3703	10	0.56958	D	0.05	.	17.3269	0.87251	0.0:0.0:1.0:0.0	.	1957;1674;1981;2001	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	L	1981;2001;1957;1674	ENSP00000288133:W1981L;ENSP00000288139:W2001L;ENSP00000409174:W1957L;ENSP00000418014:W1674L	ENSP00000288139:W2001L	W	+	2	0	CACNA1D	53819115	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	9.790000	0.99075	2.608000	0.88229	0.460000	0.39030	TGG		0.612	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
STAG1	10274	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	136076575	136076575	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:136076575C>T	ENST00000383202.2	-	28	3308	c.3052G>A	c.(3052-3054)Gac>Aac	p.D1018N	STAG1_ENST00000236698.5_Missense_Mutation_p.D1018N|STAG1_ENST00000536929.1_Missense_Mutation_p.D602N|STAG1_ENST00000434713.2_Missense_Mutation_p.D758N	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1018					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						GTCTTTTTGTCCTGTCGAAGA	0.294																																						.											0													83.0	82.0	83.0					3																	136076575		2201	4298	6499	SO:0001583	missense	10274			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.3052G>A	3.37:g.136076575C>T	ENSP00000372689:p.Asp1018Asn		O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010320	0.93346	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.93916	0.8053	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94931	0.8082	10	0.87932	D	0	.	18.0967	0.89492	0.0:1.0:0.0:0.0	.	1018;1018	Q6P275;Q8WVM7	.;STAG1_HUMAN	N	1018;1018;758;602	ENSP00000372689:D1018N;ENSP00000236698:D1018N;ENSP00000404396:D758N;ENSP00000445787:D602N	ENSP00000236698:D1018N	D	-	1	0	STAG1	137559265	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.814000	0.86154	2.495000	0.84180	0.650000	0.86243	GAC		0.294	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
CCDC158	339965	broad.mit.edu	37	4	77305357	77305357	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:77305357delT	ENST00000388914.3	-	5	762	c.610delA	c.(610-612)atafs	p.I204fs	CCDC158_ENST00000434846.2_Frame_Shift_Del_p.I204fs	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	204										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TGTTCACATATTTTTTTGCCT	0.393																																						.											0													106.0	97.0	100.0					4																	77305357		1872	4116	5988	SO:0001589	frameshift_variant	339965			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.610delA	4.37:g.77305357delT	ENSP00000373566:p.Ile204fs		Q8IYQ1|Q8N7D4|Q8N7E3	Frame_Shift_Del	DEL	ENST00000388914.3	37	CCDS43242.1																																																																																				0.393	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	
HERC5	51191	broad.mit.edu;mdanderson.org	37	4	89408222	89408222	+	Silent	SNP	C	C	T	rs369956338		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:89408222C>T	ENST00000264350.3	+	15	2007	c.1854C>T	c.(1852-1854)gaC>gaT	p.D618D	HERC5_ENST00000508159.1_Silent_p.D256D	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	618					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		ATTTTTAGGACGCTTCAGAAA	0.338																																					Esophageal Squamous(39;887 1012 34045 50514)	.											0								C		1,4405	2.1+/-5.4	0,1,2202	78.0	77.0	77.0		1854	-3.7	0.0	4		77	0,8596		0,0,4298	no	coding-synonymous	HERC5	NM_016323.2		0,1,6500	TT,TC,CC		0.0,0.0227,0.0077		618/1025	89408222	1,13001	2203	4298	6501	SO:0001819	synonymous_variant	51191			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1854C>T	4.37:g.89408222C>T			B2RTQ1|Q69G20	Silent	SNP	ENST00000264350.3	37	CCDS3630.1																																																																																				0.338	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	
COL25A1	84570	broad.mit.edu;mdanderson.org;bcgsc.ca	37	4	110221771	110221771	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:110221771C>G	ENST00000399132.1	-	3	865	c.335G>C	c.(334-336)aGa>aCa	p.R112T	AC004051.2_ENST00000500526.1_lincRNA|COL25A1_ENST00000399127.1_Missense_Mutation_p.R112T|COL25A1_ENST00000399126.1_Missense_Mutation_p.R112T	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		AGGTGCTTCTCTTGCGATTCT	0.383																																						.											0													195.0	173.0	180.0					4																	110221771		1849	4102	5951	SO:0001583	missense	84570			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.335G>C	4.37:g.110221771C>G	ENSP00000382083:p.Arg112Thr			Missense_Mutation	SNP	ENST00000399132.1	37	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.107390	0.37145	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;T;D	0.92048	-2.75;0.71;-2.96	5.38	5.38	0.77491	.	0.000000	0.51477	D	0.000084	D	0.93497	0.7925	L	0.36672	1.1	0.80722	D	1	D;D;D	0.71674	0.998;0.989;0.967	D;D;P	0.78314	0.991;0.985;0.879	D	0.92353	0.5891	9	.	.	.	-13.2884	16.4169	0.83745	0.0:1.0:0.0:0.0	.	112;112;112	A8MWQ5;Q9BXS0-2;Q9BXS0	.;.;COPA1_HUMAN	T	112	ENSP00000382083:R112T;ENSP00000382078:R112T;ENSP00000382077:R112T	.	R	-	2	0	COL25A1	110441220	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.104000	0.64584	2.686000	0.91538	0.650000	0.86243	AGA		0.383	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
ZFR	51663	broad.mit.edu	37	5	32444365	32444372	+	Frame_Shift_Del	DEL	GCCCCGCT	GCCCCGCT	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	GCCCCGCT	GCCCCGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr5:32444365_32444372delGCCCCGCT	ENST00000265069.8	-	2	202_209	c.100_107delAGCGGGGC	c.(100-108)agcggggcgfs	p.SGA34fs		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	34					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		cgccgccgccgccCCGCTGTGGGTGAAT	0.668																																						.											0																																										SO:0001589	frameshift_variant	51663			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.100_107delAGCGGGGC	5.37:g.32444365_32444372delGCCCCGCT	ENSP00000265069:p.Ser34fs		B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Frame_Shift_Del	DEL	ENST00000265069.8	37	CCDS34139.1																																																																																				0.668	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
CMYA5	202333	broad.mit.edu	37	5	79025641	79025641	+	Silent	SNP	A	A	G	rs369390314		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr5:79025641A>G	ENST00000446378.2	+	2	1084	c.1053A>G	c.(1051-1053)gcA>gcG	p.A351A		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	351					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GTGGCAGAGCAGAACAAGGAA	0.453																																						.											0								A		0,4162		0,0,2081	70.0	69.0	69.0		1053	1.4	0.1	5		69	1,8441		0,1,4220	no	coding-synonymous	CMYA5	NM_153610.3		0,1,6301	GG,GA,AA		0.0118,0.0,0.0079		351/4070	79025641	1,12603	2081	4221	6302	SO:0001819	synonymous_variant	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.1053A>G	5.37:g.79025641A>G			A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	37	CCDS47238.1																																																																																				0.453	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
DMXL1	1657	broad.mit.edu	37	5	118505983	118505983	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr5:118505983A>G	ENST00000311085.8	+	24	5577	c.5497A>G	c.(5497-5499)Aca>Gca	p.T1833A	DMXL1_ENST00000539542.1_Missense_Mutation_p.T1833A	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1833										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATCATCTGATACATTTTCCAC	0.348																																						.											0													70.0	70.0	70.0					5																	118505983		2202	4300	6502	SO:0001583	missense	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.5497A>G	5.37:g.118505983A>G	ENSP00000309690:p.Thr1833Ala			Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	A	1.142	-0.649136	0.03506	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.09163	3.01;3.01	5.52	3.57	0.40892	.	0.395739	0.27275	N	0.020120	T	0.01940	0.0061	N	0.00347	-1.61	0.22199	N	0.999298	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.40887	-0.9539	10	0.11182	T	0.66	-0.7386	2.8114	0.05443	0.3498:0.0:0.3273:0.3229	.	1833;1833	F5H269;Q9Y485	.;DMXL1_HUMAN	A	1833	ENSP00000309690:T1833A;ENSP00000439479:T1833A	ENSP00000309690:T1833A	T	+	1	0	DMXL1	118533882	0.002000	0.14202	0.949000	0.38748	0.910000	0.53928	0.366000	0.20365	0.558000	0.29135	0.455000	0.32223	ACA		0.348	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
VEGFA	7422	broad.mit.edu	37	6	43746626	43746626	+	Splice_Site	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr6:43746626A>G	ENST00000523873.1	+	5	431	c.393A>G	c.(391-393)agA>agG	p.R131R	VEGFA_ENST00000523125.1_Splice_Site_p.R131R|VEGFA_ENST00000518689.1_Splice_Site_p.R131R|VEGFA_ENST00000230480.6_Splice_Site_p.R103R|VEGFA_ENST00000413642.3_Splice_Site_p.R311R|VEGFA_ENST00000482630.2_Splice_Site_p.R311R|VEGFA_ENST00000372064.4_Splice_Site_p.R311R|VEGFA_ENST00000372067.3_Splice_Site_p.R311R|VEGFA_ENST00000324450.6_Intron|VEGFA_ENST00000523950.1_Splice_Site_p.R131R|VEGFA_ENST00000518824.1_Splice_Site_p.R131R|VEGFA_ENST00000520948.1_Splice_Site_p.R131R|VEGFA_ENST00000417285.2_Splice_Site_p.R311R|VEGFA_ENST00000372077.4_Splice_Site_p.R131R|VEGFA_ENST00000372055.4_Splice_Site_p.R311R|VEGFA_ENST00000425836.2_Splice_Site_p.R311R|VEGFA_ENST00000457104.2_Intron			P15692	VEGFA_HUMAN	vascular endothelial growth factor A	131					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|basophil chemotaxis (GO:0002575)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|camera-type eye morphogenesis (GO:0048593)|cardiac muscle fiber development (GO:0048739)|cardiac vascular smooth muscle cell development (GO:0060948)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to hypoxia (GO:0071456)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|dopaminergic neuron differentiation (GO:0071542)|endothelial cell chemotaxis (GO:0035767)|epithelial cell differentiation (GO:0030855)|eye photoreceptor cell development (GO:0042462)|growth (GO:0040007)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|induction of positive chemotaxis (GO:0050930)|kidney development (GO:0001822)|lactation (GO:0007595)|lung development (GO:0030324)|lymph vessel morphogenesis (GO:0036303)|macrophage differentiation (GO:0030225)|mammary gland alveolus development (GO:0060749)|mesoderm development (GO:0007498)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|outflow tract morphogenesis (GO:0003151)|ovarian follicle development (GO:0001541)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cellular component movement (GO:0051272)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein localization to early endosome (GO:1902966)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor internalization (GO:0002092)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular permeability (GO:0043117)|post-embryonic camera-type eye development (GO:0031077)|primitive erythrocyte differentiation (GO:0060319)|regulation of cell shape (GO:0008360)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)|surfactant homeostasis (GO:0043129)|tube formation (GO:0035148)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|VEGF-activated neuropilin signaling pathway (GO:0038190)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|neuropilin binding (GO:0038191)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor agonist activity (GO:0048018)|vascular endothelial growth factor receptor 1 binding (GO:0043183)|vascular endothelial growth factor receptor 2 binding (GO:0043184)|vascular endothelial growth factor receptor binding (GO:0005172)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Aflibercept(DB08885)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Dalteparin(DB06779)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Vandetanib(DB05294)	CCCATTGCAGACCAAAGAAAG	0.438																																						.											0													199.0	171.0	181.0					6																	43746626		2203	4300	6503	SO:0001630	splice_region_variant	7422			AB021221	CCDS34457.1, CCDS4907.2, CCDS34458.1, CCDS47432.1, CCDS47433.1, CCDS47434.1, CCDS47435.1, CCDS55007.1, CCDS55008.1, CCDS55009.1, CCDS55010.1, CCDS55011.1, CCDS55012.1, CCDS55013.1, CCDS55014.1, CCDS55015.1, CCDS69125.1	6p12	2008-02-05	2006-10-31	2006-10-31	ENSG00000112715	ENSG00000112715			12680	protein-coding gene	gene with protein product		192240	"""vascular endothelial growth factor"""	VEGF		8786112	Standard	NM_001025366		Approved	VEGF-A, VPF	uc003owh.3	P15692	OTTHUMG00000014745	ENST00000523873.1:c.393-1A>G	6.37:g.43746626A>G			B5BU86|H0Y2S8|H0Y407|H0Y414|H0Y462|H0Y8N2|H3BLW7|O60720|O75875|Q074Z4|Q16889|Q5UB46|Q6P0P5|Q96KJ0|Q96L82|Q96NW5|Q9H1W8|Q9H1W9|Q9UH58|Q9UL23	Silent	SNP	ENST00000523873.1	37	CCDS55010.1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.991235	0.54041	.	.	ENSG00000112715	ENST00000519767	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	T	0.62159	0.2405	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62927	-0.6750	4	.	.	.	.	13.9439	0.64073	1.0:0.0:0.0:0.0	.	.	.	.	A	283	.	.	T	+	1	0	VEGFA	43854604	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.043000	0.71004	2.288000	0.76882	0.533000	0.62120	ACC		0.438	VEGFA-021	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374460.1	NM_001025366	Silent
CAPN11	11131	broad.mit.edu;bcgsc.ca	37	6	44150954	44150954	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr6:44150954A>G	ENST00000398776.1	+	21	2154	c.2116A>G	c.(2116-2118)Agg>Ggg	p.R706G	CAPN11_ENST00000542245.1_Missense_Mutation_p.R706G	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	706	Domain IV.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTGTTTCCTGAGGCTAAAGAC	0.547																																						.											0													145.0	137.0	139.0					6																	44150954		1967	4158	6125	SO:0001583	missense	11131			AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.2116A>G	6.37:g.44150954A>G	ENSP00000381758:p.Arg706Gly		B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	37	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.282348	0.59867	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	T;T	0.31510	1.49;1.49	5.23	4.04	0.47022	EF-hand-like domain (1);	0.674554	0.12929	N	0.427557	T	0.49847	0.1581	M	0.92784	3.345	0.27095	N	0.962762	D	0.76494	0.999	D	0.65684	0.937	T	0.51466	-0.8702	10	0.87932	D	0	.	11.4587	0.50197	0.8492:0.1508:0.0:0.0	.	706	Q9UMQ6	CAN11_HUMAN	G	706	ENSP00000381758:R706G;ENSP00000441078:R706G	ENSP00000381758:R706G	R	+	1	2	CAPN11	44258932	0.993000	0.37304	1.000000	0.80357	0.909000	0.53808	2.567000	0.45956	0.952000	0.37798	0.523000	0.50628	AGG		0.547	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
C7orf25	79020	broad.mit.edu	37	7	42949523	42949524	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr7:42949523_42949524delCT	ENST00000350427.4	-	2	1251_1252	c.976_977delAG	c.(976-978)aggfs	p.R326fs	PSMA2_ENST00000442788.1_3'UTR|C7orf25_ENST00000438029.1_Frame_Shift_Del_p.R326fs|C7orf25_ENST00000431882.2_Frame_Shift_Del_p.R384fs|C7orf25_ENST00000447342.1_Frame_Shift_Del_p.R326fs			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	326								p.R326fs*6(1)		endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						CACAGTGGCCCTCTCTCTCTCC	0.455																																						.											1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	79020			BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.976_977delAG	7.37:g.42949531_42949532delCT	ENSP00000343364:p.Arg326fs		A4D1V2|J3KR36|Q9H779	Frame_Shift_Del	DEL	ENST00000350427.4	37	CCDS5466.1																																																																																				0.455	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250814.2	NM_024054	
POM121C	100101267	broad.mit.edu	37	7	75045328	75045328	+	IGR	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr7:75045328C>T	ENST00000257665.5	-	0	5700				NSUN5P1_ENST00000393633.2_RNA			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C						mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						CATGCCCTGGCAGGGTTCCAG	0.622																																						.											0													29.0	31.0	30.0					7																	75045328		2202	4294	6496	SO:0001628	intergenic_variant	155400				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238		7.37:g.75045328C>T			O75115|Q9Y2N3|Q9Y4S7	RNA	SNP	ENST00000257665.5	37																																																																																					0.622	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2	NM_001099415	
SSPO	23145	broad.mit.edu;mdanderson.org	37	7	149480236	149480236	+	RNA	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr7:149480236C>T	ENST00000378016.2	+	0	2118							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACCAGCAGGACGACTTCCTGA	0.592																																						.											0													97.0	102.0	100.0					7																	149480236		2179	4270	6449			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149480236C>T			Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																					0.592	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
MTMR9	66036	broad.mit.edu	37	8	11162509	11162509	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:11162509delA	ENST00000221086.3	+	4	1050	c.577delA	c.(577-579)aaafs	p.K194fs	MTMR9_ENST00000526292.1_Frame_Shift_Del_p.K109fs	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	194	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.			K -> R (in Ref. 2; BAA91170). {ECO:0000305}.		cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CTATTACCACAAAAAAAATGG	0.453																																						.											0													97.0	82.0	87.0					8																	11162509		2203	4300	6503	SO:0001589	frameshift_variant	66036			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.577delA	8.37:g.11162509delA	ENSP00000221086:p.Lys194fs		B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Frame_Shift_Del	DEL	ENST00000221086.3	37	CCDS5979.1																																																																																				0.453	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458	
RHPN1	114822	broad.mit.edu	37	8	144462920	144462920	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:144462920T>C	ENST00000289013.6	+	11	1479	c.1378T>C	c.(1378-1380)Ttc>Ctc	p.F460L		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	485	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			TGAGGATGACTTCTGTGAGGC	0.672																																						.											0													20.0	24.0	22.0					8																	144462920		2120	4235	6355	SO:0001583	missense	114822			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1378T>C	8.37:g.144462920T>C	ENSP00000289013:p.Phe460Leu		Q8TAV1|Q96PV9	Missense_Mutation	SNP	ENST00000289013.6	37	CCDS47927.1	.	.	.	.	.	.	.	.	.	.	T	10.45	1.354829	0.24512	.	.	ENSG00000158106	ENST00000289013	T	0.17691	2.26	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	L	0.51914	1.62	0.49687	D	0.999819	D	0.89917	1.0	D	0.87578	0.998	T	0.02539	-1.1144	10	0.28530	T	0.3	-13.6319	13.1807	0.59653	0.0:0.0:0.0:1.0	.	460	Q8TCX5-2	.	L	460	ENSP00000289013:F460L	ENSP00000289013:F460L	F	+	1	0	RHPN1	144534063	1.000000	0.71417	0.998000	0.56505	0.091000	0.18340	7.502000	0.81614	1.712000	0.51347	0.260000	0.18958	TTC		0.672	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381417.1		
USP9Y	8287	broad.mit.edu	37	Y	14888667	14888667	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chrY:14888667delA	ENST00000338981.3	+	19	3457	c.2512delA	c.(2512-2514)aaafs	p.K838fs	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	838					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TGATGGTGACAAAAACAGCAT	0.328																																						.											0																																										SO:0001589	frameshift_variant	8287			Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.2512delA	Y.37:g.14888667delA	ENSP00000342812:p.Lys838fs		O14601	Frame_Shift_Del	DEL	ENST00000338981.3	37	CCDS14781.1																																																																																				0.328	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
SHISA7	729956	broad.mit.edu	37	19	55953903	55953904	+	In_Frame_Ins	INS	-	-	GGG			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:55953903_55953904insGGG	ENST00000376325.4	-	1	326_327	c.327_328insCCC	c.(325-330)acctgc>accCCCtgc	p.109_110TC>TPC		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	109						integral component of membrane (GO:0016021)				skin(1)	1						CGGTAGTGGCAGGTGCCACAGC	0.678																																						.											0																																										SO:0001652	inframe_insertion	729956				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.327_328insCCC	19.37:g.55953903_55953904insGGG	ENSP00000365503:p.Thr109_Cys110insPro			In_Frame_Ins	INS	ENST00000376325.4	37	CCDS46193.1																																																																																				0.678	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334533.2	NM_001145176	
DST	667	broad.mit.edu	37	6	56422170	56422171	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr6:56422170_56422171insA	ENST00000361203.3	-	55	13960_13961	c.13953_13954insT	c.(13951-13956)cttgggfs	p.G4652fs	DST_ENST00000370769.4_Frame_Shift_Ins_p.G4654fs|DST_ENST00000244364.6_Frame_Shift_Ins_p.G2240fs|DST_ENST00000421834.2_Frame_Shift_Ins_p.G2566fs|DST_ENST00000370754.5_Frame_Shift_Ins_p.G4832fs|DST_ENST00000446842.2_Frame_Shift_Ins_p.G4328fs|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Frame_Shift_Ins_p.G2566fs			Q03001	DYST_HUMAN	dystonin	4652					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GACAAGGGCCCAAGAACACTGA	0.426																																						.											0																																										SO:0001589	frameshift_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.13954dupT	6.37:g.56422172_56422172dupA	ENSP00000354508:p.Gly4652fs		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Frame_Shift_Ins	INS	ENST00000361203.3	37																																																																																					0.426	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
SAMD5	389432	broad.mit.edu	37	6	147830410	147830411	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr6:147830410_147830411insC	ENST00000367474.1	+	1	348_349	c.346_347insC	c.(346-348)gccfs	p.A116fs		NM_001030060.2	NP_001025231.1	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	116													Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		CCACACGACCGCCCCCCGCAGC	0.743																																						.											0																																										SO:0001589	frameshift_variant	389432			AL354880	CCDS34548.1	6q24.3	2013-01-10			ENSG00000203727	ENSG00000203727		"""Sterile alpha motif (SAM) domain containing"""	21180	protein-coding gene	gene with protein product							Standard	NM_001030060		Approved	dJ875H10.1	uc003qmc.2	Q5TGI4	OTTHUMG00000015767	ENST00000367474.1:c.352dupC	6.37:g.147830416_147830416dupC	ENSP00000356444:p.Ala116fs			Frame_Shift_Ins	INS	ENST00000367474.1	37	CCDS34548.1																																																																																				0.743	SAMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042610.1	NM_001030060	
PRKDC	5591	broad.mit.edu	37	8	48748950	48748951	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:48748950_48748951insC	ENST00000314191.2	-	59	7952_7953	c.7896_7897insG	c.(7894-7899)gggcagfs	p.Q2633fs	PRKDC_ENST00000338368.3_Frame_Shift_Ins_p.Q2633fs|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2634	KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GCCCTTATCTGCCCTGCCACTG	0.609								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											0																																										SO:0001589	frameshift_variant	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.7897dupG	8.37:g.48748953_48748953dupC	ENSP00000313420:p.Gln2633fs		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Ins	INS	ENST00000314191.2	37																																																																																					0.609	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
ADAMTS8	11095	ucsc.edu;bcgsc.ca	37	11	130284611	130284611	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:130284611G>A	ENST00000257359.6	-	5	2087	c.1381C>T	c.(1381-1383)Cgc>Tgc	p.R461C		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	461	Disintegrin.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GGGCAGTGGCGGAAATCCGGC	0.677																																						.											0													49.0	56.0	54.0					11																	130284611		2051	4202	6253	SO:0001583	missense	11095			AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1381C>T	11.37:g.130284611G>A	ENSP00000257359:p.Arg461Cys		Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	37	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673513	0.67928	.	.	ENSG00000134917	ENST00000257359;ENST00000414575	T	0.60797	0.16	5.59	4.68	0.58851	.	0.602094	0.19398	N	0.115243	T	0.72187	0.3429	M	0.76938	2.355	0.40367	D	0.9793	D	0.89917	1.0	P	0.62560	0.904	T	0.75731	-0.3215	10	0.87932	D	0	.	10.5172	0.44896	0.1472:0.0:0.8528:0.0	.	461	Q9UP79	ATS8_HUMAN	C	461;490	ENSP00000257359:R461C	ENSP00000257359:R461C	R	-	1	0	ADAMTS8	129789821	0.996000	0.38824	1.000000	0.80357	0.914000	0.54420	1.602000	0.36783	1.356000	0.45884	0.655000	0.94253	CGC		0.677	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037	
AP2B1	163	ucsc.edu	37	17	34044214	34044214	+	Splice_Site	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr17:34044214A>G	ENST00000262325.7	+	20	3138	c.2585A>G	c.(2584-2586)gAc>gGc	p.D862G	AP2B1_ENST00000589344.1_Splice_Site_p.D876G|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000537622.2_Splice_Site_p.D876G|AP2B1_ENST00000312678.8_Splice_Site_p.D876G|AP2B1_ENST00000592545.1_Splice_Site_p.D838G|AP2B1_ENST00000538556.1_Splice_Site_p.D805G	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	862	Interaction with ARRB1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GTATTTCTAGACACTGTTTCC	0.398																																						.											0													107.0	100.0	103.0					17																	34044214		2203	4300	6503	SO:0001630	splice_region_variant	163			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.2585-1A>G	17.37:g.34044214A>G			A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	A	19.07	3.755295	0.69648	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.41758	1.26;1.26;0.99;1.26	5.86	5.86	0.93980	Coatomer/calthrin adaptor appendage, C-terminal subdomain (1);Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.67477	0.2897	M	0.83483	2.645	0.80722	D	1	D;P;B;B	0.59357	0.985;0.486;0.001;0.001	D;P;B;B	0.74023	0.982;0.457;0.029;0.01	T	0.70502	-0.4854	9	.	.	.	.	15.7408	0.77894	1.0:0.0:0.0:0.0	.	613;838;862;876	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	G	862;876;805;876;613	ENSP00000262325:D862G;ENSP00000314414:D876G;ENSP00000440563:D805G;ENSP00000437413:D876G	.	D	+	2	0	AP2B1	31068327	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.367000	0.80283	0.528000	0.53228	GAC		0.398	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		Missense_Mutation
ST20	400410	ucsc.edu	37	15	80215899	80215899	+	5'UTR	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr15:80215899G>A	ENST00000485386.1	-	0	145				ST20-MTHFS_ENST00000494999.1_5'UTR|C15ORF37_ENST00000542003.1_Silent_p.R127R|C15orf37_ENST00000560255.1_3'UTR|ST20-MTHFS_ENST00000479961.1_5'UTR			Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						AGAGCCGGAGGAAAGAGGCGT	0.711																																						.											0																																										SO:0001623	5_prime_UTR_variant	283687			AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5		ENST00000485386.1:c.-117C>T	15.37:g.80215899G>A				RNA	SNP	ENST00000485386.1	37	CCDS42067.1																																																																																				0.711	ST20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416729.1		
NBPF15	284565	ucsc.edu	37	1	148756448	148756448	+	Missense_Mutation	SNP	G	G	A	rs201036679	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr1:148756448G>A	ENST00000417839.1	+	16	1967	c.1777G>A	c.(1777-1779)Ggc>Agc	p.G593S		NM_001102663.1	NP_001096133	Q5SXJ2	NBPFG_HUMAN		593	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4	all_hematologic(923;0.032)					CAGGCTCAACGGCGTGCTGAT	0.443													.|||	2359	0.471046	0.441	0.4942	5008	,	,		13733	0.4782		0.493	False		,,,				2504	0.4652					.											0													19.0	14.0	16.0					1																	148756448		1538	3069	4607	SO:0001583	missense	728936																														ENST00000417839.1:c.1777G>A	1.37:g.148756448G>A	ENSP00000395369:p.Gly593Ser		A8MPT6	Missense_Mutation	SNP	ENST00000417839.1	37	CCDS41384.1	.	.	.	.	.	.	.	.	.	.	a	0.032	-1.326930	0.01309	.	.	ENSG00000203827	ENST00000417839;ENST00000254372	T	0.06218	3.33	0.109	-0.218	0.13142	DUF1220 (2);	.	.	.	.	T	0.00754	0.0025	N	0.21448	0.665	0.09310	N	1	P;B	0.40211	0.707;0.002	B;B	0.30855	0.121;0.006	T	0.45011	-0.9290	8	0.19147	T	0.46	.	.	.	.	.	593;403	Q5SXJ2;B4DRP3	NBPFG_HUMAN;.	S	593	ENSP00000395369:G593S	ENSP00000254372:G593S	G	+	1	0	NBPF16	147023072	0.998000	0.40836	0.068000	0.19968	0.069000	0.16628	0.720000	0.25896	-1.122000	0.02945	-1.109000	0.02080	GGC		0.443	NBPF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097693.1		
NR1H2	7376	ucsc.edu	37	19	50881825	50881825	+	Silent	SNP	G	G	A	rs55817866	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:50881825G>A	ENST00000253727.5	+	6	754	c.519G>A	c.(517-519)caG>caA	p.Q173Q	NR1H2_ENST00000411902.2_Silent_p.Q76Q|NR1H2_ENST00000593926.1_Silent_p.Q173Q|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_Silent_p.Q173Q|NR1H2_ENST00000598168.1_Silent_p.Q173Q	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	173					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TTCGGAAACAGCAGCAGGAGT	0.637																																						.											0													38.0	47.0	44.0					19																	50881825		2140	4249	6389	SO:0001819	synonymous_variant	7376			U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.519G>A	19.37:g.50881825G>A			A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	CCDS42593.1																																																																																				0.637	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
SIGLEC15	284266	ucsc.edu	37	18	43418922	43418922	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr18:43418922T>C	ENST00000389474.3	+	4	953	c.736T>C	c.(736-738)Tcc>Ccc	p.S246P	SIGLEC15_ENST00000587418.1_Silent_p.A15A|SIGLEC15_ENST00000602118.2_3'UTR|SIGLEC15_ENST00000546268.1_Missense_Mutation_p.S92P	NM_213602.2	NP_998767.1	Q6ZMC9	SIG15_HUMAN	sialic acid binding Ig-like lectin 15	246	Ig-like C2-type.				cellular response to lipoprotein particle stimulus (GO:0071402)|innate immune response (GO:0045087)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of bone resorption (GO:0045124)|regulation of osteoclast development (GO:2001204)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)				endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						CCTGGGCCGCTCCGAGGCCAG	0.706																																						.											0													10.0	12.0	11.0					18																	43418922		2096	4142	6238	SO:0001583	missense	284266			AK095432	CCDS32819.1	18q21.1	2014-01-28	2007-05-31	2007-05-31	ENSG00000197046	ENSG00000197046		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27596	protein-coding gene	gene with protein product			"""CD33 antigen-like 3"", ""CD33 molecule-like 3"""	CD33L3		17483134	Standard	NM_213602		Approved	HsT1361	uc002lbl.1	Q6ZMC9		ENST00000389474.3:c.736T>C	18.37:g.43418922T>C	ENSP00000374125:p.Ser246Pro		A8K2Y5|B4DVQ9	Missense_Mutation	SNP	ENST00000389474.3	37	CCDS32819.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.804493	0.50315	.	.	ENSG00000197046	ENST00000389474;ENST00000546268	T;T	0.73258	2.7;-0.73	4.63	0.601	0.17529	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.227470	0.36444	N	0.002590	T	0.61211	0.2329	L	0.57536	1.79	0.23893	N	0.996547	B	0.28400	0.21	B	0.30251	0.113	T	0.54084	-0.8346	10	0.52906	T	0.07	-9.3574	5.9974	0.19501	0.1501:0.0:0.575:0.2749	.	246	Q6ZMC9	SIG15_HUMAN	P	246;92	ENSP00000374125:S246P;ENSP00000443509:S92P	ENSP00000374125:S246P	S	+	1	0	SIGLEC15	41672920	0.650000	0.27331	0.945000	0.38365	0.961000	0.63080	2.248000	0.43160	-0.075000	0.12798	-0.648000	0.03929	TCC		0.706	SIGLEC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410768.2	NM_213602	
ADH1A	124	mdanderson.org	37	4	100203572	100203572	+	Silent	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:100203572C>T	ENST00000209668.2	-	6	872	c.759G>A	c.(757-759)gaG>gaA	p.E253E	RP11-696N14.1_ENST00000506160.1_RNA|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	253					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	CCTTTAGCACCTCCTGGATGG	0.463																																						.											0													352.0	350.0	351.0					4																	100203572		2203	4300	6503	SO:0001819	synonymous_variant	124			M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.759G>A	4.37:g.100203572C>T			A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	37	CCDS3648.1																																																																																				0.463	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	
ANKLE1	126549	mdanderson.org	37	19	17393015	17393015	+	Missense_Mutation	SNP	C	C	T	rs1864116	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:17393015C>T	ENST00000394458.3	+	2	488	c.212C>T	c.(211-213)gCt>gTt	p.A71V	ANKLE1_ENST00000594072.1_Missense_Mutation_p.A60V|ANKLE1_ENST00000433424.2_Missense_Mutation_p.A125V|ANKLE1_ENST00000598347.1_Missense_Mutation_p.A71V|ANKLE1_ENST00000404085.1_Missense_Mutation_p.A93V|CTD-2278I10.6_ENST00000596542.1_3'UTR	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	71			A -> V (in dbSNP:rs1864116). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.1}.							large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						GACCCCAACGCTCGGTAAGAT	0.741													C|||	3182	0.635383	0.798	0.5533	5008	,	,		8910	0.3125		0.834	False		,,,				2504	0.6022					.											0								C	VAL/ALA	2161,339		925,311,14	2.0	2.0	2.0		212	0.8	0.5	19	dbSNP_92	2	4508,662		1957,594,34	yes	missense	ANKLE1	NM_152363.4	64	2882,905,48	TT,TC,CC		12.8046,13.56,13.0508	probably-damaging	71/616	17393015	6669,1001	1250	2585	3835	SO:0001583	missense	126549			AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.212C>T	19.37:g.17393015C>T	ENSP00000377971:p.Ala71Val		A8VU82|Q8N8J8	Missense_Mutation	SNP	ENST00000394458.3	37	CCDS12354.2	1399	0.6405677655677655	380	0.7723577235772358	218	0.6022099447513812	164	0.2867132867132867	637	0.8403693931398417	C	16.19	3.054076	0.55218	0.8644	0.871954	ENSG00000160117	ENST00000404261;ENST00000433424;ENST00000404085;ENST00000394458;ENST00000438921	T;T;T	0.67865	-0.29;-0.29;-0.29	4.15	0.796	0.18648	Ankyrin repeat-containing domain (4);	0.432303	0.19437	N	0.114285	T	0.00012	0.0000	N	0.20807	0.61	0.80722	P	0.0	B;B;B	0.15930	0.005;0.015;0.002	B;B;B	0.17722	0.016;0.015;0.019	T	0.27606	-1.0069	9	0.18710	T	0.47	-20.551	6.1339	0.20221	0.0:0.667:0.0:0.333	rs1864116;rs17238816;rs59648740;rs1864116	71;57;71	E7ETZ9;Q8NAG6-1;Q8NAG6	.;.;ANKL1_HUMAN	V	71;125;93;60;71	ENSP00000384753:A71V;ENSP00000394460:A125V;ENSP00000384008:A93V	ENSP00000377971:A60V	A	+	2	0	ANKLE1	17254015	0.002000	0.14202	0.527000	0.27925	0.842000	0.47809	0.606000	0.24194	0.078000	0.16900	0.555000	0.69702	GCT		0.741	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
ANKRD20A5P	440482	mdanderson.org	37	18	14183978	14183978	+	RNA	SNP	T	T	C	rs77403707	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr18:14183978T>C	ENST00000581935.1	+	0	667							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGGAACATGGTGCCAATCCAA	0.448																																						.											0													93.0	93.0	93.0					18																	14183978		2201	4296	6497			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183978T>C			Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.448	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
C11orf95	65998	mdanderson.org	37	11	63531175	63531175	+	lincRNA	SNP	C	C	G	rs2959886	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:63531175C>G	ENST00000433688.1	-	0	1770							C9JLR9	CK095_HUMAN	chromosome 11 open reading frame 95																		CGCCCCGCCACCGCGGCTGGT	0.751													G|||	946	0.188898	0.4372	0.0937	5008	,	,		7651	0.003		0.1372	False		,,,				2504	0.1656					.											0													5.0	9.0	8.0					11																	63531175		637	1527	2164			65998			BC000572, AK096306		11q13	2011-11-24			ENSG00000188070	ENSG00000188070			28449	protein-coding gene	gene with protein product		615699				20607705	Standard	NM_001144936		Approved	MGC3032	uc010rmv.2	C9JLR9			11.37:g.63531175C>G			A6NLS7|Q3C1V4	Silent	SNP	ENST00000433688.1	37																																																																																					0.751	C11orf95-201	KNOWN	basic	lincRNA	lincRNA		NM_001144936	
FLRT2	23768	mdanderson.org;bcgsc.ca	37	14	86087938	86087938	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr14:86087938A>G	ENST00000330753.4	+	2	847	c.80A>G	c.(79-81)tAc>tGc	p.Y27C	FLRT2_ENST00000554746.1_Missense_Mutation_p.Y27C	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	27					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CTGGGGCTCTACTCACAGGTG	0.517																																						.											0													93.0	90.0	91.0					14																	86087938		2203	4300	6503	SO:0001583	missense	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.80A>G	14.37:g.86087938A>G	ENSP00000332879:p.Tyr27Cys		A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	37	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.473548	0.43942	.	.	ENSG00000185070	ENST00000330753;ENST00000554746	T;T	0.55588	0.51;0.51	5.73	0.269	0.15631	.	0.474802	0.24024	N	0.042253	T	0.27765	0.0683	N	0.14661	0.345	0.28151	N	0.929377	B	0.02656	0.0	B	0.01281	0.0	T	0.07908	-1.0748	10	0.39692	T	0.17	-5.2127	4.1128	0.10067	0.4357:0.3756:0.0674:0.1213	.	27	O43155	FLRT2_HUMAN	C	27	ENSP00000332879:Y27C;ENSP00000451050:Y27C	ENSP00000332879:Y27C	Y	+	2	0	FLRT2	85157691	0.034000	0.19679	0.993000	0.49108	0.996000	0.88848	0.102000	0.15272	0.084000	0.17077	0.533000	0.62120	TAC		0.517	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
DEGS2	123099	mdanderson.org	37	14	100625902	100625902	+	Missense_Mutation	SNP	C	C	T	rs7157599	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr14:100625902C>T	ENST00000553834.1	-	1	30	c.23G>A	c.(22-24)aGc>aAc	p.S8N	DEGS2_ENST00000305631.5_Missense_Mutation_p.S8N					delta(4)-desaturase, sphingolipid 2											breast(1)|lung(6)|skin(1)	8		Melanoma(154;0.212)				CTCGAAGTCGCTGCGGCTCGC	0.766													c|||	3842	0.767173	0.8661	0.768	5008	,	,		8798	0.7282		0.6948	False		,,,				2504	0.7474					.											0								T	ASN/SER	2896,464		1254,388,38	8.0	7.0	8.0	http://www.ncbi.nlm.nih.gov/pubmed?term	23	0.5	1.0	14	dbSNP_116	8	4583,1505		1740,1103,201	yes	missense	DEGS2	NM_206918.2	46	2994,1491,239	TT,TC,CC	http://www.ncbi.nlm.nih.gov/pubmed?term	24.7208,13.8095,20.8404	benign	8/324	100625902	7479,1969	1680	3044	4724	SO:0001583	missense	123099				CCDS9956.1	14q32.2	2013-09-02	2011-12-09	2004-12-14	ENSG00000168350	ENSG00000168350		"""Fatty acid desaturases"""	20113	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 2"", ""dihydroceramide desaturase 2"""	610862	"""chromosome 14 open reading frame 66"", ""degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)"""	C14orf66			Standard	NM_206918		Approved	DES2, FADS8	uc001ygx.2	Q6QHC5	OTTHUMG00000171537	ENST00000553834.1:c.23G>A	14.37:g.100625902C>T	ENSP00000450637:p.Ser8Asn			Missense_Mutation	SNP	ENST00000553834.1	37		1662	0.760989010989011	431	0.8760162601626016	274	0.7569060773480663	424	0.7412587412587412	533	0.7031662269129287	.	9.769	1.172237	0.21704	0.861905	0.752792	ENSG00000168350	ENST00000305631;ENST00000553834	T;T	0.40476	1.03;1.03	4.72	0.456	0.16655	Sphingolipid delta4-desaturase, N-terminal (1);	0.817312	0.11149	N	0.594331	T	0.00012	0.0000	N	0.13003	0.285	0.58432	P	9.000000000036756E-6	B	0.02656	0.0	B	0.04013	0.001	T	0.21827	-1.0234	9	0.17369	T	0.5	-1.5775	5.1779	0.15145	0.1384:0.5173:0.2681:0.0762	rs7157599;rs60508435;rs7157599	8	Q6QHC5	DEGS2_HUMAN	N	8	ENSP00000307126:S8N;ENSP00000450637:S8N	ENSP00000307126:S8N	S	-	2	0	DEGS2	99695655	0.085000	0.21516	0.990000	0.47175	0.532000	0.34746	-0.317000	0.08060	-0.209000	0.10156	-0.336000	0.08194	AGC		0.766	DEGS2-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000414004.1	NM_206918	
FRG1	2483	mdanderson.org	37	4	190873411	190873411	+	Silent	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:190873411T>C	ENST00000226798.4	+	3	450	c.228T>C	c.(226-228)ggT>ggC	p.G76G	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	76					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TCGACAATGGTCTTTTTACCC	0.423																																						.											0													88.0	102.0	97.0					4																	190873411		2202	4292	6494	SO:0001819	synonymous_variant	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.228T>C	4.37:g.190873411T>C			A8K775	Silent	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	4.506	0.093856	0.08632	.	.	ENSG00000109536	ENST00000524583	.	.	.	3.47	-6.93	0.01638	.	.	.	.	.	T	0.49847	0.1581	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57447	-0.7810	5	0.72032	D	0.01	-6.6814	2.1213	0.03726	0.2624:0.3899:0.0988:0.2489	.	.	.	.	A	6	.	ENSP00000435067:V6A	V	+	2	0	FRG1	191110405	0.036000	0.19791	0.635000	0.29338	0.933000	0.57130	-0.963000	0.03837	-1.953000	0.01026	-1.442000	0.01069	GTC		0.423	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
FRG2B	441581	mdanderson.org	37	10	135438998	135438998	+	Missense_Mutation	SNP	G	G	T	rs200937977		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr10:135438998G>T	ENST00000425520.1	-	4	494	c.442C>A	c.(442-444)Cgt>Agt	p.R148S	FRG2B_ENST00000443774.1_Missense_Mutation_p.R149S	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	148						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GCCCTGGAACGTCCCCTATGG	0.527																																						.											0													114.0	128.0	123.0					10																	135438998		2199	4299	6498	SO:0001583	missense	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.442C>A	10.37:g.135438998G>T	ENSP00000401310:p.Arg148Ser		Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	1.237	-0.622516	0.03636	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.43688	0.94;0.94	.	.	.	.	2.267060	0.02456	N	0.086049	T	0.27933	0.0688	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16808	-1.0390	8	0.36615	T	0.2	0.3215	.	.	.	.	148	Q96QU4	FRG2B_HUMAN	S	149;148	ENSP00000408343:R149S;ENSP00000401310:R148S	ENSP00000401310:R148S	R	-	1	0	FRG2B	135288988	0.004000	0.15560	0.164000	0.22755	0.165000	0.22458	-0.657000	0.05335	0.119000	0.18210	0.121000	0.15741	CGT		0.527	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
FRG2B	441581	mdanderson.org	37	10	135439079	135439079	+	Missense_Mutation	SNP	A	A	T	rs201410894		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr10:135439079A>T	ENST00000425520.1	-	4	413	c.361T>A	c.(361-363)Tca>Aca	p.S121T	FRG2B_ENST00000443774.1_Missense_Mutation_p.S122T	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	121						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTATTCAATGACAAGCTGCAC	0.512																																						.											0													31.0	38.0	36.0					10																	135439079		2125	4248	6373	SO:0001583	missense	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.361T>A	10.37:g.135439079A>T	ENSP00000401310:p.Ser121Thr		Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.722229	0.00005	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.42900	0.96;0.96	.	.	.	.	.	.	.	.	T	0.09774	0.0240	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15321	-1.0441	7	0.02654	T	1	-1.6731	.	.	.	.	121	Q96QU4	FRG2B_HUMAN	T	122;121	ENSP00000408343:S122T;ENSP00000401310:S121T	ENSP00000401310:S121T	S	-	1	0	FRG2B	135289069	0.000000	0.05858	0.039000	0.18376	0.039000	0.13416	-0.790000	0.04604	-1.869000	0.01141	-1.957000	0.00481	TCA		0.512	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
IFNA21	3452	mdanderson.org	37	9	21166520	21166520	+	Missense_Mutation	SNP	C	C	G	rs140583107		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr9:21166520C>G	ENST00000380225.1	-	1	139	c.92G>C	c.(91-93)aGc>aCc	p.S31T		NM_002175.2	NP_002166.2	P01568	IFN21_HUMAN	interferon, alpha 21	31					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(3)	14				GBM - Glioblastoma multiforme(5;1.93e-187)|Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		ATTACCCAGGCTGTGGGTCTG	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		20238	0.0		0.0	False		,,,				2504	0.001					.											0													58.0	62.0	61.0					9																	21166520		2202	4280	6482	SO:0001583	missense	3452				CCDS6497.1	9p22	2010-12-10			ENSG00000137080	ENSG00000137080		"""Interferons"""	5424	protein-coding gene	gene with protein product	"""leukocyte interferon protein"""	147584				1385305	Standard	NM_002175		Approved	IFN-alphaI	uc003zom.2	P01568	OTTHUMG00000019653	ENST00000380225.1:c.92G>C	9.37:g.21166520C>G	ENSP00000369574:p.Ser31Thr		Q14608|Q5VWD1|Q7M4Q4	Missense_Mutation	SNP	ENST00000380225.1	37	CCDS6497.1	.	.	.	.	.	.	.	.	.	.	N	4.824	0.153276	0.09185	.	.	ENSG00000137080	ENST00000380225	T	0.03413	3.94	3.16	-1.15	0.09709	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.796247	0.11535	N	0.554284	T	0.04182	0.0116	M	0.72118	2.19	0.09310	N	1	B	0.10296	0.003	B	0.23018	0.043	T	0.47573	-0.9107	10	0.20519	T	0.43	.	0.656	0.00834	0.1988:0.3809:0.1955:0.2248	.	31	P01568	IFN21_HUMAN	T	31	ENSP00000369574:S31T	ENSP00000369574:S31T	S	-	2	0	IFNA21	21156520	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-0.915000	0.04033	-0.239000	0.09710	0.644000	0.83932	AGC		0.522	IFNA21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051882.1	NM_002175	
INSL3	3640	mdanderson.org	37	19	17932190	17932190	+	Silent	SNP	T	T	C	rs1047233	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:17932190T>C	ENST00000317306.7	-	1	142	c.126A>G	c.(124-126)ctA>ctG	p.L42L	INSL3_ENST00000379695.5_Silent_p.L42L	NM_005543.3	NP_005534.2	P51460	INSL3_HUMAN	insulin-like 3 (Leydig cell)	42					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)	insulin receptor binding (GO:0005158)|protease binding (GO:0002020)|receptor binding (GO:0005102)			breast(1)|lung(1)	2						ACACGCGCACTAGCGCGCGTA	0.721													C|||	1288	0.257188	0.3941	0.3127	5008	,	,		12303	0.005		0.4076	False		,,,				2504	0.138					.											0								C		1224,2548		247,730,909	4.0	7.0	6.0		126	-1.9	1.0	19	dbSNP_86	6	2298,4938		486,1326,1806	no	coding-synonymous	INSL3	NM_005543.2		733,2056,2715	CC,CT,TT		31.7579,32.4496,31.9949		42/132	17932190	3522,7486	1886	3618	5504	SO:0001819	synonymous_variant	3640				CCDS12365.1, CCDS58655.1	19p13.2-p12	2013-02-26	2003-05-13			ENSG00000248099		"""Endogenous ligands"""	6086	protein-coding gene	gene with protein product	"""prepro-INSL3"""	146738	"""relaxin-like factor"""	RLNL		8020942	Standard	NM_001265587		Approved	RLF, MGC119818, MGC119819	uc010ebf.2	P51460		ENST00000317306.7:c.126A>G	19.37:g.17932190T>C			B4DZ72|G3XAG0|Q3KPI5|Q3KPI6|Q6YNB5|Q9UEA2|Q9UPH6	Silent	SNP	ENST00000317306.7	37	CCDS12365.1																																																																																				0.721	INSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466836.1	NM_005543	
KCTD8	386617	mdanderson.org	37	4	44176969	44176969	+	Silent	SNP	G	G	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:44176969G>C	ENST00000360029.3	-	2	1543	c.1260C>G	c.(1258-1260)tcC>tcG	p.S420S		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	420					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TTGTTTCCCGGGACTTGCTGA	0.413										HNSCC(17;0.042)																												.											0													212.0	222.0	219.0					4																	44176969		2203	4300	6503	SO:0001819	synonymous_variant	386617			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1260C>G	4.37:g.44176969G>C			A2RU39	Silent	SNP	ENST00000360029.3	37	CCDS3467.1																																																																																				0.413	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
MUC16	94025	mdanderson.org	37	19	9006370	9006370	+	Silent	SNP	A	A	G	rs79341062	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:9006370A>G	ENST00000397910.4	-	45	39851	c.39648T>C	c.(39646-39648)taT>taC	p.Y13216Y	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13218	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCAGCCAGAATACAGAGGGC	0.522																																						.											0													104.0	85.0	91.0					19																	9006370		2007	4178	6185	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39648T>C	19.37:g.9006370A>G			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	2.163	-0.391777	0.04932	.	.	ENSG00000181143	ENST00000542240	.	.	.	2.73	-2.09	0.07232	.	.	.	.	.	T	0.36799	0.0980	.	.	.	.	.	.	.	.	.	.	.	.	T	0.44544	-0.9321	3	.	.	.	-18.4462	7.5909	0.28021	0.6138:0.0:0.3862:0.0	.	.	.	.	T	56	.	.	I	-	2	0	MUC16	8867370	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.632000	0.00870	-0.715000	0.04968	-2.373000	0.00235	ATT		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LILRA1	11024	mdanderson.org	37	19	55106239	55106239	+	Silent	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:55106239G>A	ENST00000251372.3	+	4	362	c.180G>A	c.(178-180)ctG>ctA	p.L60L	LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Silent_p.L60L|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	60	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.L60L(3)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGTACCGTCTGTATAGAGAAA	0.572																																						.											3	Substitution - coding silent(3)	kidney(3)											124.0	119.0	121.0					19																	55106239		2203	4300	6503	SO:0001819	synonymous_variant	11024			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.180G>A	19.37:g.55106239G>A			O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	CCDS12901.1																																																																																				0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
MUC2	4583	mdanderson.org	37	11	1093047	1093047	+	Silent	SNP	T	T	C	rs12575208		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:1093047T>C	ENST00000441003.2	+	30	4893	c.4866T>C	c.(4864-4866)acT>acC	p.T1622T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caacacccactggcacacaga	0.632																																						.											0													129.0	166.0	153.0					11																	1093047		1887	3615	5502	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4866T>C	11.37:g.1093047T>C			Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195505762	195505762	+	Missense_Mutation	SNP	A	A	G	rs566782506	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195505762A>G	ENST00000463781.3	-	2	13148	c.12689T>C	c.(12688-12690)cTt>cCt	p.L4230P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L4230P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	987					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAAGGCTGGTGAC	0.577													.|||	339	0.0676917	0.034	0.0576	5008	,	,		15843	0.1062		0.0646	False		,,,				2504	0.0838					.											0													42.0	42.0	42.0					3																	195505762		2092	4200	6292	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12689T>C	3.37:g.195505762A>G	ENSP00000417498:p.Leu4230Pro		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.071	-1.202607	0.01581	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.48;1.49	.	.	.	.	.	.	.	.	T	0.08044	0.0201	N	0.04959	-0.14	0.09310	N	0.999998	P	0.35139	0.486	B	0.19946	0.027	T	0.18524	-1.0334	6	.	.	.	.	.	.	.	.	4102	E7ESK3	.	P	4230	ENSP00000417498:L4230P;ENSP00000420243:L4230P	.	L	-	2	0	MUC4	196990541	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.148000	0.16224	-1.986000	0.00983	-1.973000	0.00462	CTT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507059	195507059	+	Missense_Mutation	SNP	T	T	C	rs76367261		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195507059T>C	ENST00000463781.3	-	2	11851	c.11392A>G	c.(11392-11394)Act>Gct	p.T3798A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3798A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3798A(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGTCGGTGACA	0.602																																						.											1	Substitution - Missense(1)	kidney(1)											8.0	7.0	7.0					3																	195507059		640	1492	2132	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11392A>G	3.37:g.195507059T>C	ENSP00000417498:p.Thr3798Ala		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	5.737	0.320503	0.10845	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36878	1.23;1.27	.	.	.	.	101.427000	0.03934	U	0.285798	T	0.15349	0.0370	N	0.08118	0	0.19575	N	0.999967	B	0.13594	0.008	B	0.08055	0.003	T	0.13980	-1.0489	8	.	.	.	.	4.6071	0.12383	0.0:0.6657:0.0:0.3343	.	3670	E7ESK3	.	A	3798	ENSP00000417498:T3798A;ENSP00000420243:T3798A	.	T	-	1	0	MUC4	196991838	0.003000	0.15002	0.034000	0.17996	0.034000	0.12701	0.899000	0.28417	-2.094000	0.00854	-2.075000	0.00382	ACT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507874	195507874	+	Missense_Mutation	SNP	G	G	T	rs199875073		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195507874G>T	ENST00000463781.3	-	2	11036	c.10577C>A	c.(10576-10578)aCt>aAt	p.T3526N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3526N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.602																																						.											0													44.0	36.0	38.0					3																	195507874		680	1586	2266	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10577C>A	3.37:g.195507874G>T	ENSP00000417498:p.Thr3526Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.955	0.177484	0.09443	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30714	1.52;1.62	0.743	0.743	0.18347	.	.	.	.	.	T	0.11793	0.0287	N	0.08118	0	0.09310	N	1	B	0.22909	0.077	B	0.09377	0.004	T	0.29181	-1.0020	8	.	.	.	.	3.2552	0.06828	0.3579:0.0:0.6421:0.0	.	3398	E7ESK3	.	N	3526	ENSP00000417498:T3526N;ENSP00000420243:T3526N	.	T	-	2	0	MUC4	196992653	0.003000	0.15002	0.011000	0.14972	0.011000	0.07611	1.098000	0.31000	0.088000	0.17205	0.089000	0.15464	ACT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507926	195507926	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195507926C>T	ENST00000463781.3	-	2	10984	c.10525G>A	c.(10525-10527)Ggc>Agc	p.G3509S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.G3509S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGCGCCGGTGACAGGA	0.602																																						.											0													41.0	37.0	38.0					3																	195507926		644	1581	2225	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10525G>A	3.37:g.195507926C>T	ENSP00000417498:p.Gly3509Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	3.931	-0.016213	0.07681	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29917	1.55;1.55	0.743	-1.49	0.08718	.	.	.	.	.	T	0.10078	0.0247	N	0.03608	-0.345	0.09310	N	1	B	0.15930	0.015	B	0.09377	0.004	T	0.23261	-1.0193	8	.	.	.	.	2.5972	0.04857	0.0:0.2544:0.2715:0.4741	.	3381	E7ESK3	.	S	3509	ENSP00000417498:G3509S;ENSP00000420243:G3509S	.	G	-	1	0	MUC4	196992705	0.005000	0.15991	0.004000	0.12327	0.004000	0.04260	0.111000	0.15458	-1.791000	0.01261	-1.780000	0.00649	GGC		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195508982	195508982	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195508982C>T	ENST00000463781.3	-	2	9928	c.9469G>A	c.(9469-9471)Gac>Aac	p.D3157N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D3157N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D3157N(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																						.											2	Substitution - Missense(2)	NS(2)											5.0	4.0	4.0					3																	195508982		544	1292	1836	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9469G>A	3.37:g.195508982C>T	ENSP00000417498:p.Asp3157Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	7.037	0.561794	0.13498	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.51;1.42	.	.	.	.	.	.	.	.	T	0.12220	0.0297	N	0.19112	0.55	0.09310	N	1	D	0.52996	0.957	B	0.29077	0.098	T	0.19484	-1.0304	7	.	.	.	.	6.8901	0.24224	0.0:0.9999:0.0:1.0E-4	.	3029	E7ESK3	.	N	3157	ENSP00000417498:D3157N;ENSP00000420243:D3157N	.	D	-	1	0	MUC4	196993761	0.000000	0.05858	0.028000	0.17463	0.028000	0.11728	-0.476000	0.06591	0.073000	0.16731	0.074000	0.15403	GAC		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509142	195509142	+	Silent	SNP	C	C	G	rs12487058	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195509142C>G	ENST00000463781.3	-	2	9768	c.9309G>C	c.(9307-9309)acG>acC	p.T3103T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T3103T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGCGTGGTGTCAC	0.602																																						.											0													14.0	9.0	10.0					3																	195509142		663	1535	2198	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9309G>C	3.37:g.195509142C>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511884	195511884	+	Missense_Mutation	SNP	G	G	C	rs71617318		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195511884G>C	ENST00000463781.3	-	2	7026	c.6567C>G	c.(6565-6567)caC>caG	p.H2189Q	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H2189Q	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	978					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.602																																						.											0																																										SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6567C>G	3.37:g.195511884G>C	ENSP00000417498:p.His2189Gln		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	2.118	-0.402123	0.04865	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26373	1.74;1.79	.	.	.	.	.	.	.	.	T	0.12860	0.0312	N	0.19112	0.55	0.09310	N	1	B	0.33857	0.429	B	0.33799	0.17	T	0.26538	-1.0100	7	.	.	.	.	4.3952	0.11360	0.3325:0.0:0.6675:0.0	.	2189	E7ESK3	.	Q	2189	ENSP00000417498:H2189Q;ENSP00000420243:H2189Q	.	H	-	3	2	MUC4	196996279	0.000000	0.05858	0.002000	0.10522	0.132000	0.20833	-0.396000	0.07278	-0.417000	0.07461	0.064000	0.15345	CAC		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511911	195511911	+	Silent	SNP	G	G	A	rs200732241		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:195511911G>A	ENST00000463781.3	-	2	6999	c.6540C>T	c.(6538-6540)acC>acT	p.T2180T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2180T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2180T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.587																																						.											2	Substitution - coding silent(2)	endometrium(2)											8.0	14.0	12.0					3																	195511911		633	1518	2151	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6540C>T	3.37:g.195511911G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1018169	1018169	+	Silent	SNP	C	C	G	rs111749447|rs77647814	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:1018169C>G	ENST00000421673.2	-	31	4682	c.4632G>C	c.(4630-4632)acG>acC	p.T1544T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1544	Pro-rich.|Thr-rich.			T -> S (in Ref. 2; AAQ82434). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGGAGTAATCGTGGTAGTAG	0.552																																						.											0													238.0	243.0	241.0					11																	1018169		2145	4235	6380	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4632G>C	11.37:g.1018169C>G			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1018348	1018348	+	Missense_Mutation	SNP	G	G	A	rs202193006		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:1018348G>A	ENST00000421673.2	-	31	4503	c.4453C>T	c.(4453-4455)Cct>Tct	p.P1485S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1485	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTGGTGGAGGAATGGTACCT	0.592																																						.											0													254.0	257.0	256.0					11																	1018348		2184	4263	6447	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4453C>T	11.37:g.1018348G>A	ENSP00000406861:p.Pro1485Ser		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	4.529	0.098268	0.08681	.	.	ENSG00000184956	ENST00000421673	T	0.17054	2.3	2.28	-0.0764	0.13723	.	.	.	.	.	T	0.15089	0.0364	L	0.58101	1.795	0.09310	N	1	B	0.26809	0.16	B	0.20577	0.03	T	0.31530	-0.9940	9	0.19590	T	0.45	.	9.5843	0.39506	0.0:0.4031:0.5969:0.0	.	1485	Q6W4X9	MUC6_HUMAN	S	1485	ENSP00000406861:P1485S	ENSP00000406861:P1485S	P	-	1	0	MUC6	1008348	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	0.135000	0.15952	-0.162000	0.10964	0.313000	0.20887	CCT		0.592	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MYO9A	4649	mdanderson.org	37	15	72190902	72190902	+	Silent	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr15:72190902G>T	ENST00000356056.5	-	25	4414	c.3942C>A	c.(3940-3942)ggC>ggA	p.G1314G	MYO9A_ENST00000444904.1_Silent_p.G1295G|MYO9A_ENST00000424560.1_Silent_p.G1314G|MYO9A_ENST00000564571.1_Silent_p.G1314G|MYO9A_ENST00000566885.1_Silent_p.G934G|MYO9A_ENST00000563542.1_5'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1314	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GAGACTGAAGGCCTTCAGGCA	0.458																																						.											0													116.0	116.0	116.0					15																	72190902		2199	4297	6496	SO:0001819	synonymous_variant	4649			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.3942C>A	15.37:g.72190902G>T			B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Silent	SNP	ENST00000356056.5	37	CCDS10239.1																																																																																				0.458	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
OBP2B	29989	mdanderson.org	37	9	136083879	136083879	+	Missense_Mutation	SNP	C	C	G	rs28584111		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr9:136083879C>G	ENST00000372034.3	-	2	224	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OBP2B_ENST00000372032.2_Intron|OBP2B_ENST00000461961.1_Intron	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	61					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.K61N(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGGCTTCCAACTTCCCACCGC	0.622																																						.											1	Substitution - Missense(1)	large_intestine(1)											124.0	110.0	115.0					9																	136083879		2203	4300	6503	SO:0001583	missense	29989			AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.183G>C	9.37:g.136083879C>G	ENSP00000361104:p.Lys61Asn		Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812613	0.02798	.	.	ENSG00000171102	ENST00000372034	T	0.08458	3.09	2.31	-0.281	0.12882	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.089000	0.07156	N	0.849966	T	0.02230	0.0069	N	0.01122	-1.005	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.07813	T	0.8	-15.6209	4.9518	0.14019	0.0:0.4459:0.3286:0.2255	rs28584111	61	Q9NPH6	OBP2B_HUMAN	N	61	ENSP00000361104:K61N	ENSP00000361104:K61N	K	-	3	2	OBP2B	135073700	0.003000	0.15002	0.017000	0.16124	0.019000	0.09904	0.281000	0.18810	-0.129000	0.11620	-0.335000	0.08231	AAG		0.622	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
OR10G8	219869	mdanderson.org	37	11	123900385	123900385	+	Missense_Mutation	SNP	C	C	A	rs149524303	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:123900385C>A	ENST00000431524.1	+	1	89	c.56C>A	c.(55-57)cCa>cAa	p.P19Q		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCCCATGCCCCAGCGCTGGAC	0.567																																						.											0																																										SO:0001583	missense	219869			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.56C>A	11.37:g.123900385C>A	ENSP00000389072:p.Pro19Gln		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342383	0.24339	.	.	ENSG00000234560	ENST00000431524	T	0.00428	7.44	2.95	2.95	0.34219	.	0.136796	0.33670	N	0.004664	T	0.00384	0.0012	M	0.64170	1.965	0.25608	N	0.986521	B	0.12630	0.006	B	0.15870	0.014	T	0.37798	-0.9690	10	0.32370	T	0.25	.	8.8035	0.34923	0.2255:0.7745:0.0:0.0	.	19	Q8NGN5	O10G8_HUMAN	Q	19	ENSP00000389072:P19Q	ENSP00000389072:P19Q	P	+	2	0	OR10G8	123405595	0.001000	0.12720	0.073000	0.20177	0.007000	0.05969	1.082000	0.30803	1.634000	0.50500	0.585000	0.79938	CCA		0.567	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
OR10G8	219869	mdanderson.org	37	11	123900411	123900411	+	Missense_Mutation	SNP	G	G	A	rs202220125	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr11:123900411G>A	ENST00000431524.1	+	1	115	c.82G>A	c.(82-84)Gtc>Atc	p.V28I		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCTCTTTGGAGTCTTCCTGGT	0.572													G|||	7	0.00139776	0.0	0.0043	5008	,	,		19799	0.0		0.001	False		,,,				2504	0.0031					.											0													195.0	177.0	183.0					11																	123900411		2201	4299	6500	SO:0001583	missense	219869			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.82G>A	11.37:g.123900411G>A	ENSP00000389072:p.Val28Ile		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	G	4.296	0.054107	0.08291	.	.	ENSG00000234560	ENST00000431524	T	0.02916	4.11	2.95	-4.35	0.03656	.	0.824866	0.10366	N	0.683403	T	0.01254	0.0041	N	0.16066	0.365	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48258	-0.9051	10	0.10377	T	0.69	.	1.3401	0.02153	0.2804:0.2787:0.3033:0.1376	.	28	Q8NGN5	O10G8_HUMAN	I	28	ENSP00000389072:V28I	ENSP00000389072:V28I	V	+	1	0	OR10G8	123405621	0.000000	0.05858	0.003000	0.11579	0.022000	0.10575	-3.513000	0.00446	-1.037000	0.03283	-0.324000	0.08512	GTC		0.572	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
PBRM1	55193	mdanderson.org;bcgsc.ca	37	3	52643600	52643600	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:52643600C>A	ENST00000296302.7	-	16	2297	c.2296G>T	c.(2296-2298)Gat>Tat	p.D766Y	PBRM1_ENST00000410007.1_Missense_Mutation_p.D766Y|PBRM1_ENST00000337303.4_Missense_Mutation_p.D766Y|PBRM1_ENST00000394830.3_Missense_Mutation_p.D766Y|PBRM1_ENST00000356770.4_Missense_Mutation_p.D734Y|PBRM1_ENST00000409114.3_Missense_Mutation_p.D781Y|PBRM1_ENST00000409767.1_Missense_Mutation_p.D781Y|PBRM1_ENST00000409057.1_Missense_Mutation_p.D766Y			Q86U86	PB1_HUMAN	polybromo 1	766					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D766fs*22(2)|p.D734fs*22(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GAGTCCTCATCTCCCTCCAGG	0.433			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	.		Rec	yes		3	3p21	55193	polybromo 1		E	3	Deletion - Frameshift(3)	kidney(3)											82.0	79.0	80.0					3																	52643600		2203	4300	6503	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2296G>T	3.37:g.52643600C>A	ENSP00000296302:p.Asp766Tyr		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	21.2	4.105828	0.77096	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18	6.17	6.17	0.99709	Bromodomain (1);	0.090503	0.85682	D	0.000000	T	0.24774	0.0601	L	0.29908	0.895	0.58432	D	0.999995	D;P;D;D;P;D;D;D;D;D;D	0.62365	0.968;0.804;0.972;0.988;0.796;0.959;0.959;0.985;0.991;0.959;0.959	B;B;B;P;B;B;B;P;B;B;P	0.46237	0.409;0.075;0.291;0.492;0.146;0.312;0.406;0.494;0.407;0.312;0.508	T	0.00304	-1.1832	10	0.54805	T	0.06	-5.6171	20.8794	0.99867	0.0:1.0:0.0:0.0	.	766;141;766;766;766;766;781;781;766;734;766	Q86U86-9;Q6IRX1;Q86U86-6;E7EVG2;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;.;.;PB1_HUMAN;.;.	Y	734;766;766;766;766;766;781;781;766;725	ENSP00000349213:D734Y;ENSP00000378307:D766Y;ENSP00000296302:D766Y;ENSP00000338302:D766Y;ENSP00000386593:D766Y;ENSP00000386529:D766Y;ENSP00000386643:D781Y;ENSP00000386601:D781Y;ENSP00000387775:D766Y;ENSP00000397662:D725Y	ENSP00000296302:D766Y	D	-	1	0	PBRM1	52618640	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.994000	0.70623	2.941000	0.99782	0.655000	0.94253	GAT		0.433	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
OR5H14	403273	mdanderson.org	37	3	97868391	97868391	+	Silent	SNP	T	T	C	rs143765725		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:97868391T>C	ENST00000437310.1	+	1	222	c.162T>C	c.(160-162)caT>caC	p.H54H	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						AAGACCCTCATCTTCATATCC	0.418													t|||	1	0.000199681	0.0	0.0014	5008	,	,		21040	0.0		0.0	False		,,,				2504	0.0					.											0																																										SO:0001819	synonymous_variant	403273				CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.162T>C	3.37:g.97868391T>C			B9EH15	Silent	SNP	ENST00000437310.1	37	CCDS33798.1																																																																																				0.418	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
PKD1	5310	mdanderson.org	37	16	2154573	2154573	+	Missense_Mutation	SNP	A	A	C	rs201238819		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr16:2154573A>C	ENST00000262304.4	-	22	8295	c.8087T>G	c.(8086-8088)cTc>cGc	p.L2696R	PKD1_ENST00000561991.1_5'UTR|PKD1_ENST00000423118.1_Missense_Mutation_p.L2696R	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2696	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.		L -> R (in PKD1). {ECO:0000269|PubMed:11316854}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.L2696R(3)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGCAGGATGAGCATCATGGC	0.677																																						.											3	Substitution - Missense(3)	skin(2)|endometrium(1)	GRCh37	CM014074	PKD1	M							16.0	12.0	13.0					16																	2154573		2107	4184	6291	SO:0001583	missense	5310			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8087T>G	16.37:g.2154573A>C	ENSP00000262304:p.Leu2696Arg		Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	-	0.355	-0.942715	0.02322	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.32988	1.43;1.43	4.37	-1.71	0.08133	Egg jelly receptor, REJ-like (1);Polycystin cation channel (1);	0.646468	0.16090	N	0.230081	T	0.05181	0.0138	N	0.00347	-1.61	0.20873	N	0.99984	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35500	-0.9786	10	0.12430	T	0.62	.	2.3268	0.04224	0.102:0.2587:0.2052:0.4341	.	2696;2696	P98161-3;P98161	.;PKD1_HUMAN	R	2696;2696;2031;975	ENSP00000262304:L2696R;ENSP00000399501:L2696R	ENSP00000262304:L2696R	L	-	2	0	PKD1	2094574	0.916000	0.31088	0.097000	0.21041	0.126000	0.20510	0.857000	0.27831	-0.349000	0.08274	-0.335000	0.08231	CTC		0.677	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PRB2	653247	mdanderson.org	37	12	11546751	11546751	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:11546751G>C	ENST00000389362.4	-	3	296	c.261C>G	c.(259-261)aaC>aaG	p.N87K	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	87	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			CTTGAGGTTTGTTGCCTCCTT	0.607																																						.											0																																										SO:0001583	missense	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.261C>G	12.37:g.11546751G>C	ENSP00000374013:p.Asn87Lys		O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	1.981	-0.434036	0.04669	.	.	ENSG00000121335	ENST00000389362	T	0.03982	3.74	1.06	-2.12	0.07165	.	.	.	.	.	T	0.03220	0.0094	L	0.43152	1.355	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.50825	-0.8782	9	0.05620	T	0.96	.	3.3787	0.07247	0.2438:0.2649:0.4913:0.0	.	87	P02812	PRB2_HUMAN	K	87	ENSP00000374013:N87K	ENSP00000374013:N87K	N	-	3	2	PRB2	11438018	.	.	0.002000	0.10522	0.047000	0.14425	.	.	-1.987000	0.00982	-1.380000	0.01176	AAC		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
PRSS1	5644	mdanderson.org	37	7	142460415	142460415	+	Silent	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr7:142460415T>C	ENST00000311737.7	+	4	594	c.588T>C	c.(586-588)tgT>tgC	p.C196C	PRSS1_ENST00000486171.1_Silent_p.C210C	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	196	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	AGGATTCATGTCAGGTGATTT	0.537																																						.											0													154.0	149.0	151.0					7																	142460415		2203	4300	6503	SO:0001819	synonymous_variant	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.588T>C	7.37:g.142460415T>C			A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																				0.537	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
SDHA	6389	mdanderson.org	37	5	236649	236649	+	Missense_Mutation	SNP	C	C	T	rs76896145	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr5:236649C>T	ENST00000264932.6	+	10	1482	c.1367C>T	c.(1366-1368)tCg>tTg	p.S456L	SDHA_ENST00000510361.1_Missense_Mutation_p.S408L|SDHA_ENST00000504309.1_Missense_Mutation_p.S456L	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	456					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GGGGCAAACTCGCTCTTGGAC	0.587									Familial Paragangliomas																													.											0													91.0	82.0	85.0					5																	236649		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1367C>T	5.37:g.236649C>T	ENSP00000264932:p.Ser456Leu		A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	216|216	0.0989010989010989|0.0989010989010989	47|47	0.09552845528455285|0.09552845528455285	40|40	0.11049723756906077|0.11049723756906077	72|72	0.1258741258741259|0.1258741258741259	57|57	0.07519788918205805|0.07519788918205805	c|c	21.1|21.1	4.103578|4.103578	0.76983|0.76983	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000515815|ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	.|T;T;T	.|0.74002	.|-0.8;-0.8;-0.8	5.01|5.01	5.01|5.01	0.66863|0.66863	.|Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	.|0.146175	.|0.47455	.|U	.|0.000231	T|T	0.15869|0.15869	0.0382|0.0382	H|H	0.99815|0.99815	4.805|4.805	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.964;1.0;1.0;1.0;1.0	.|P;D;D;D;D	.|0.85130	.|0.788;0.997;0.969;0.994;0.995	T|T	0.72484|0.72484	-0.4279|-0.4279	5|10	.|0.87932	.|D	.|0	.|.	16.16|16.16	0.81698|0.81698	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|408;456;50;456;456	.|E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040	.|.;.;.;.;DHSA_HUMAN	C|L	8|456;311;456;408	.|ENSP00000264932:S456L;ENSP00000426514:S456L;ENSP00000427703:S408L	.|ENSP00000264932:S456L	R|S	+|+	1|2	0|0	SDHA|SDHA	289649|289649	1.000000|1.000000	0.71417|0.71417	0.942000|0.942000	0.38095|0.38095	0.059000|0.059000	0.15707|0.15707	7.499000|7.499000	0.81566|0.81566	2.483000|2.483000	0.83821|0.83821	0.650000|0.650000	0.86243|0.86243	CGC|TCG		0.587	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SDHA	6389	mdanderson.org	37	5	236676	236676	+	Missense_Mutation	SNP	G	G	A	rs138277996	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr5:236676G>A	ENST00000264932.6	+	10	1509	c.1394G>A	c.(1393-1395)cGg>cAg	p.R465Q	SDHA_ENST00000510361.1_Missense_Mutation_p.R417Q|SDHA_ENST00000504309.1_Missense_Mutation_p.R465Q	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	465					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTCTTTGGTCGGGCATGTGCC	0.577									Familial Paragangliomas																													.											0													87.0	79.0	82.0					5																	236676		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1394G>A	5.37:g.236676G>A	ENSP00000264932:p.Arg465Gln		A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	149|149	0.06822344322344322|0.06822344322344322	31|31	0.06300813008130081|0.06300813008130081	39|39	0.10773480662983426|0.10773480662983426	48|48	0.08391608391608392|0.08391608391608392	31|31	0.040897097625329816|0.040897097625329816	a|a	35|35	5.478541|5.478541	0.96291|0.96291	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000515815|ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	.|T;T;T	.|0.66280	.|-0.2;-0.2;-0.2	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	.|0.225299	.|0.34932	.|U	.|0.003561	T|T	0.04227|0.04227	0.0117|0.0117	H|H	0.94423|0.94423	3.535|3.535	0.80722|0.80722	D|D	1|1	.|P;D;D;D;D	.|0.61080	.|0.718;0.989;0.982;0.978;0.987	.|B;B;B;B;B	.|0.41666	.|0.122;0.342;0.236;0.217;0.363	T|T	0.57585|0.57585	-0.7786|-0.7786	5|10	.|0.87932	.|D	.|0	.|.	14.1614|14.1614	0.65450|0.65450	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|417;465;59;465;465	.|E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040	.|.;.;.;.;DHSA_HUMAN	R|Q	17|465;320;465;417	.|ENSP00000264932:R465Q;ENSP00000426514:R465Q;ENSP00000427703:R417Q	.|ENSP00000264932:R465Q	G|R	+|+	1|2	0|0	SDHA|SDHA	289676|289676	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.875000|0.875000	0.50365|0.50365	7.637000|7.637000	0.83313|0.83313	2.483000|2.483000	0.83821|0.83821	0.650000|0.650000	0.86243|0.86243	GGG|CGG		0.577	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SDHA	6389	mdanderson.org	37	5	236678	236678	+	Missense_Mutation	SNP	G	G	A	rs111387770	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr5:236678G>A	ENST00000264932.6	+	10	1511	c.1396G>A	c.(1396-1398)Gca>Aca	p.A466T	SDHA_ENST00000510361.1_Missense_Mutation_p.A418T|SDHA_ENST00000504309.1_Missense_Mutation_p.A466T	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	466					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CTTTGGTCGGGCATGTGCCCT	0.577									Familial Paragangliomas																													.											0													86.0	78.0	81.0					5																	236678		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1396G>A	5.37:g.236678G>A	ENSP00000264932:p.Ala466Thr		A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	235	0.10760073260073261	47	0.09552845528455285	43	0.11878453038674033	73	0.12762237762237763	72	0.09498680738786279	g	32	5.147215	0.94603	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.63580	-0.05;-0.05;-0.05	5.01	5.01	0.66863	.	0.138027	0.47852	U	0.000203	T	0.02012	0.0063	M	0.86097	2.795	0.80722	D	1	B;B;D;B;B	0.59357	0.085;0.268;0.985;0.433;0.411	B;B;P;B;B	0.50109	0.049;0.189;0.631;0.132;0.068	T	0.27706	-1.0066	10	0.87932	D	0	.	14.1614	0.65450	0.0:0.0:1.0:0.0	.	418;466;60;466;466	E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040	.;.;.;.;DHSA_HUMAN	T	466;321;466;418	ENSP00000264932:A466T;ENSP00000426514:A466T;ENSP00000427703:A418T	ENSP00000264932:A466T	A	+	1	0	SDHA	289678	1.000000	0.71417	0.992000	0.48379	0.881000	0.50899	9.454000	0.97621	2.483000	0.83821	0.650000	0.86243	GCA		0.577	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SLC26A1	10861	mdanderson.org	37	4	985339	985339	+	Missense_Mutation	SNP	C	C	G	rs200471470	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr4:985339C>G	ENST00000361661.2	-	3	530	c.153G>C	c.(151-153)caG>caC	p.Q51H	IDUA_ENST00000453894.1_Intron|SLC26A1_ENST00000398520.2_Missense_Mutation_p.Q51H|SLC26A1_ENST00000398516.2_Missense_Mutation_p.Q51H|SLC26A1_ENST00000513138.1_5'Flank|IDUA_ENST00000247933.4_Intron	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	51					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGAGCAGGTCCTGCACCAGCG	0.697																																						.											0								C	,HIS/GLN,HIS/GLN,HIS/GLN	0,4396		0,0,2198	26.0	24.0	25.0		,153,153,153	-1.1	0.0	4		25	3,8583		0,3,4290	no	intron,missense,missense,missense	IDUA,SLC26A1	NM_000203.3,NM_022042.2,NM_134425.1,NM_213613.2	,24,24,24	0,3,6488	GG,GC,CC		0.0349,0.0,0.0231	,possibly-damaging,possibly-damaging,possibly-damaging	,51/702,51/225,51/702	985339	3,12979	2198	4293	6491	SO:0001583	missense	10861			AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.153G>C	4.37:g.985339C>G	ENSP00000354721:p.Gln51His		A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	ENST00000361661.2	37	CCDS33934.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.437794	0.25900	0.0	3.49E-4	ENSG00000145217	ENST00000398520;ENST00000361661;ENST00000398516	D;D;D	0.93307	-3.02;-3.2;-3.2	5.12	-1.13	0.09775	.	0.352418	0.31257	N	0.007971	D	0.85818	0.5785	N	0.19112	0.55	0.09310	N	0.999997	P;P	0.43477	0.808;0.808	B;P	0.45753	0.332;0.492	T	0.79172	-0.1913	10	0.30078	T	0.28	.	6.2708	0.20953	0.0:0.4781:0.1248:0.3971	.	51;51	Q9H2B4;Q96BK0	S26A1_HUMAN;.	H	51	ENSP00000381532:Q51H;ENSP00000354721:Q51H;ENSP00000381528:Q51H	ENSP00000354721:Q51H	Q	-	3	2	SLC26A1	975339	0.023000	0.18921	0.007000	0.13788	0.125000	0.20455	1.512000	0.35812	0.014000	0.14944	-0.379000	0.06801	CAG		0.697	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
TAS2R46	259292	mdanderson.org	37	12	11214005	11214005	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:11214005C>T	ENST00000533467.1	-	1	888	c.889G>A	c.(889-891)Gtg>Atg	p.V297M	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	297				HV -> QM (in Ref. 3). {ECO:0000305}.	detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		CAGTACCTCACATGCCACAAA	0.418																																						.											0													182.0	183.0	183.0					12																	11214005		2032	4234	6266	SO:0001583	missense	259292			AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.889G>A	12.37:g.11214005C>T	ENSP00000436450:p.Val297Met		P59548|Q645X6	Missense_Mutation	SNP	ENST00000533467.1	37	CCDS53748.1	.	.	.	.	.	.	.	.	.	.	C	3.988	-0.005081	0.07773	.	.	ENSG00000226761	ENST00000533467	T	0.37584	1.19	2.54	1.59	0.23543	.	.	.	.	.	T	0.25457	0.0619	L	0.33245	0.995	0.09310	N	1	B	0.15930	0.015	B	0.26969	0.075	T	0.27468	-1.0073	9	0.36615	T	0.2	.	4.5917	0.12310	0.0:0.3575:0.432:0.2105	.	297	P59540	T2R46_HUMAN	M	297	ENSP00000436450:V297M	ENSP00000436450:V297M	V	-	1	0	TAS2R46	11105272	0.000000	0.05858	0.004000	0.12327	0.077000	0.17291	-1.385000	0.02540	0.356000	0.24157	0.194000	0.17425	GTG		0.418	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383559.1	NM_176887	
TAS2R30	259293	mdanderson.org	37	12	11286736	11286736	+	Silent	SNP	G	G	C	rs112605675		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr12:11286736G>C	ENST00000539585.1	-	1	507	c.108C>G	c.(106-108)gtC>gtG	p.V36V	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	36					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.V36V(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TTTGTCTCTTGACCCACTCAA	0.388																																						.											1	Substitution - coding silent(1)	lung(1)											67.0	66.0	66.0					12																	11286736		2014	4225	6239	SO:0001819	synonymous_variant	259293			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.108C>G	12.37:g.11286736G>C			Q645X7	Silent	SNP	ENST00000539585.1	37	CCDS53750.1																																																																																				0.388	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
ZNF219	51222	mdanderson.org	37	14	21560706	21560706	+	Silent	SNP	C	C	G	rs370417468|rs1065496	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr14:21560706C>G	ENST00000360947.3	-	3	1161	c.750G>C	c.(748-750)ccG>ccC	p.P250P	RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_Silent_p.P250P|ZNF219_ENST00000556101.1_5'Flank|ZNF219_ENST00000421093.2_Silent_p.P250P	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	250					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		gttcgggctccggctccggct	0.726											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	448	0.0894569	0.1097	0.049	5008	,	,		11470	0.0942		0.0785	False		,,,				2504	0.0971					.											0								C	,,	331,3629		14,303,1663	6.0	7.0	7.0		750,750,750	-8.1	0.1	14	dbSNP_86	7	434,7432		9,416,3508	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF219	NM_001101672.1,NM_001102454.1,NM_016423.2	,,	23,719,5171	GG,GC,CC		5.5174,8.3586,6.4688	,,	250/723,250/723,250/723	21560706	765,11061	1980	3933	5913	SO:0001819	synonymous_variant	51222			AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.750G>C	14.37:g.21560706C>G		749	D3DS16|Q53Y57|Q8IYC1|Q9BW28	Silent	SNP	ENST00000360947.3	37	CCDS9568.1																																																																																				0.726	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
PABPC3	5042	bcgsc.ca	37	13	25671027	25671027	+	Missense_Mutation	SNP	A	A	G	rs78826513	byFrequency	TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr13:25671027A>G	ENST00000281589.3	+	1	728	c.691A>G	c.(691-693)Aaa>Gaa	p.K231E		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	231	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TGGAAAATCCAAAGGATTTGG	0.418																																						.											0													81.0	76.0	78.0					13																	25671027		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.691A>G	13.37:g.25671027A>G	ENSP00000281589:p.Lys231Glu		Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631048	0.46944	.	.	ENSG00000151846	ENST00000281589	T	0.08807	3.05	0.993	0.993	0.19825	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.49916	U	0.000136	T	0.27063	0.0663	M	0.90198	3.095	0.34162	D	0.668825	D	0.65815	0.995	D	0.67725	0.953	T	0.36553	-0.9743	10	0.87932	D	0	.	6.1165	0.20130	1.0:0.0:0.0:0.0	.	231	Q9H361	PABP3_HUMAN	E	231	ENSP00000281589:K231E	ENSP00000281589:K231E	K	+	1	0	PABPC3	24569027	0.998000	0.40836	0.994000	0.49952	0.967000	0.64934	2.374000	0.44274	0.692000	0.31613	0.374000	0.22700	AAA		0.418	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
PDS5B	23047	bcgsc.ca	37	13	33253045	33253045	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr13:33253045G>T	ENST00000315596.10	+	10	1222	c.1036G>T	c.(1036-1038)Gat>Tat	p.D346Y		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	346					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GAACCATCCTGATTTAGCAAA	0.343																																						.											0													99.0	87.0	91.0					13																	33253045		1831	4086	5917	SO:0001583	missense	23047			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1036G>T	13.37:g.33253045G>T	ENSP00000313851:p.Asp346Tyr		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	37	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863929	0.91511	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	T	0.69806	-0.43	5.49	5.49	0.81192	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	L	0.59436	1.845	0.80722	D	1	P;P	0.44877	0.845;0.658	P;B	0.48524	0.58;0.211	T	0.70963	-0.4729	10	0.38643	T	0.18	-1.4873	19.3744	0.94502	0.0:0.0:1.0:0.0	.	346;346	Q9NTI5;Q9NTI5-3	PDS5B_HUMAN;.	Y	346	ENSP00000313851:D346Y	ENSP00000313851:D346Y	D	+	1	0	PDS5B	32151045	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.711000	0.98735	2.585000	0.87301	0.561000	0.74099	GAT		0.343	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
DPP9	91039	bcgsc.ca	37	19	4719881	4719881	+	5'UTR	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr19:4719881T>C	ENST00000598800.1	-	0	258				DPP9_ENST00000597849.1_Missense_Mutation_p.N13S|DPP9_ENST00000262960.9_Missense_Mutation_p.N13S			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9							cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		ACTTCCGGTGTTCTCCTTGTC	0.577																																						.											0													106.0	104.0	105.0					19																	4719881		692	1591	2283	SO:0001623	5_prime_UTR_variant	91039			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.-248A>G	19.37:g.4719881T>C			O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Missense_Mutation	SNP	ENST00000598800.1	37		.	.	.	.	.	.	.	.	.	.	T	9.005	0.980970	0.18812	.	.	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	T	0.28895	1.59	3.29	0.804	0.18697	.	0.204155	0.28712	N	0.014387	T	0.11707	0.0285	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.16630	-1.0396	10	0.26408	T	0.33	-11.1953	3.6575	0.08226	0.1805:0.0:0.3564:0.463	.	13	Q1ZZB8	.	S	92;92;13	ENSP00000262960:N13S	ENSP00000262960:N13S	N	-	2	0	DPP9	4670881	0.973000	0.33851	0.010000	0.14722	0.913000	0.54294	1.896000	0.39789	0.329000	0.23460	0.459000	0.35465	AAC		0.577	DPP9-026	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000459343.2		
FRG1B	284802	bcgsc.ca	37	20	29633902	29633902	+	Missense_Mutation	SNP	C	C	A	rs145072022		TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr20:29633902C>A	ENST00000278882.3	+	9	921	c.541C>A	c.(541-543)Cca>Aca	p.P181T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P181T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	181								p.P181T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AACAAGAGAACCAAATTGAAA	0.274																																						.											2	Substitution - Missense(2)	endometrium(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.541C>A	20.37:g.29633902C>A	ENSP00000278882:p.Pro181Thr		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	4.973	0.180670	0.09443	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.52906	T	0.07	.	9.2539	0.37571	0.0:1.0:0.0:0.0	.	.	.	.	T	181	.	ENSP00000278882:P181T	P	+	1	0	FRG1B	28247563	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.567000	0.53813	1.206000	0.43276	0.502000	0.49764	CCA		0.274	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
DSCAM	1826	bcgsc.ca	37	21	41719789	41719789	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr21:41719789T>C	ENST00000400454.1	-	6	1495	c.1018A>G	c.(1018-1020)Act>Gct	p.T340A		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	340	Ig-like C2-type 4.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGGTCCTCAGTTCCTGTCACG	0.493																																					Melanoma(134;970 1778 1785 21664 32388)	.											0													153.0	139.0	144.0					21																	41719789		1948	4154	6102	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1018A>G	21.37:g.41719789T>C	ENSP00000383303:p.Thr340Ala		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.223647	0.39300	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.66995	-0.24;-0.24	5.58	1.76	0.24704	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.364917	0.31859	N	0.006951	T	0.53562	0.1804	L	0.46157	1.445	0.21822	N	0.999522	B	0.23128	0.08	B	0.28465	0.09	T	0.37596	-0.9699	10	0.20519	T	0.43	.	6.4105	0.21688	0.26:0.0672:0.0:0.6728	.	340	O60469	DSCAM_HUMAN	A	340;92	ENSP00000383303:T340A;ENSP00000385342:T92A	ENSP00000383303:T340A	T	-	1	0	DSCAM	40641659	1.000000	0.71417	0.800000	0.32199	0.977000	0.68977	2.985000	0.49362	0.045000	0.15804	-0.438000	0.05819	ACT		0.493	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DAZL	1618	bcgsc.ca	37	3	16630220	16630221	+	Splice_Site	DNP	CC	CC	TT			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:16630220_16630221CC>TT	ENST00000399444.2	-	11	1128	c.835_835GG>AA	c.(835-837)GGga>AAgga	p.G279K	DAZL_ENST00000250863.8_Splice_Site_p.G299K	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	279					female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						ACTCTTTTATCCTGGAAAAGAC	0.342																																						.											0																																										SO:0001630	splice_region_variant	1618			BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.835_835delinsTT	3.37:g.16630220_16630221delinsTT			O15396|Q5HYB4|Q92909	Missense_Mutation|Splice_Site	SNP	ENST00000399444.2	37	CCDS43059.1																																																																																				0.342	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	Missense_Mutation
ZFR	51663	bcgsc.ca	37	5	32444366	32444373	+	Frame_Shift_Del	DEL	GCCCCGCT	GCCCCGCT	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	GCCCCGCT	GCCCCGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr5:32444366_32444373delGCCCCGCT	ENST00000265069.8	-	2	201_208	c.99_106delAGCGGGGC	c.(97-108)caagcggggccgfs	p.QAGP33fs		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	33					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		gccgccgccgccCCGCTGTGGGTGAATC	0.663																																						.											0																																										SO:0001589	frameshift_variant	51663			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.99_106delAGCGGGGC	5.37:g.32444366_32444373delGCCCCGCT	ENSP00000265069:p.Gln33fs		B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Frame_Shift_Del	DEL	ENST00000265069.8	37	CCDS34139.1																																																																																				0.663	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
NHSL1	57224	bcgsc.ca	37	6	138753237	138753237	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr6:138753237T>C	ENST00000427025.2	-	5	2885	c.2257A>G	c.(2257-2259)Act>Gct	p.T753A	NHSL1_ENST00000343505.5_Missense_Mutation_p.T749A	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	753										breast(2)|endometrium(4)|kidney(1)	7						GTGGCGGAAGTCATGCTGCTG	0.642																																						.											0													58.0	45.0	49.0					6																	138753237		692	1591	2283	SO:0001583	missense	57224			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.2257A>G	6.37:g.138753237T>C	ENSP00000394546:p.Thr753Ala		Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	ENST00000427025.2	37	CCDS55063.1	.	.	.	.	.	.	.	.	.	.	T	0.333	-0.955018	0.02285	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	T;T	0.35236	1.32;1.81	5.25	-1.75	0.08031	.	0.402474	0.24231	N	0.040346	T	0.13670	0.0331	L	0.54323	1.7	0.09310	N	1	B;B	0.13594	0.008;0.008	B;B	0.10450	0.005;0.005	T	0.37641	-0.9697	10	0.42905	T	0.14	-10.6806	11.167	0.48550	0.0:0.3574:0.0:0.6426	.	749;753	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	A	753;749	ENSP00000394546:T753A;ENSP00000344672:T749A	ENSP00000344672:T749A	T	-	1	0	NHSL1	138794930	0.995000	0.38212	0.015000	0.15790	0.040000	0.13550	0.845000	0.27668	-0.189000	0.10482	0.533000	0.62120	ACT		0.642	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	
TTLL2	83887	bcgsc.ca	37	6	167753795	167753795	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr6:167753795A>G	ENST00000239587.5	+	3	495	c.407A>G	c.(406-408)aAc>aGc	p.N136S		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	136	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		ACCGAACACAACAGTGTTAAA	0.522																																						.											0													158.0	139.0	145.0					6																	167753795		2203	4300	6503	SO:0001583	missense	83887			AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.407A>G	6.37:g.167753795A>G	ENSP00000239587:p.Asn136Ser		B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	37	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	a	0.436	-0.900972	0.02472	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02258	4.37	3.37	-4.51	0.03483	.	2.260220	0.02250	N	0.066544	T	0.00300	0.0009	N	0.05078	-0.115	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.47032	-0.9148	10	0.10111	T	0.7	.	0.763	0.01010	0.4153:0.1434:0.1229:0.3185	.	136	Q9BWV7	TTLL2_HUMAN	S	136;63	ENSP00000239587:N136S	ENSP00000239587:N136S	N	+	2	0	TTLL2	167673785	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.078000	0.14761	-0.589000	0.05874	-2.495000	0.00193	AAC		0.522	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
CLN8	2055	bcgsc.ca	37	8	1728653	1728653	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:1728653delG	ENST00000331222.4	+	3	1028	c.781delG	c.(781-783)gtgfs	p.V261fs	CLN8_ENST00000523237.1_3'UTR	NM_018941.3	NP_061764.2	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)	261	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				adult walking behavior (GO:0007628)|age-dependent response to oxidative stress (GO:0001306)|associative learning (GO:0008306)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|ceramide biosynthetic process (GO:0046513)|ceramide metabolic process (GO:0006672)|cholesterol metabolic process (GO:0008203)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|lipid biosynthetic process (GO:0008610)|lipid transport (GO:0006869)|lysosome organization (GO:0007040)|mitochondrial membrane organization (GO:0007006)|musculoskeletal movement (GO:0050881)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteolysis (GO:0045861)|negative regulation of transferase activity (GO:0051348)|nervous system development (GO:0007399)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|phospholipid metabolic process (GO:0006644)|photoreceptor cell maintenance (GO:0045494)|protein catabolic process (GO:0030163)|regulation of cell size (GO:0008361)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic motor neuron differentiation (GO:0021523)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		TCTCAATCCGGTGGACTGGAA	0.552																																					Pancreas(155;338 1942 6138 10888 50612)	.											0													116.0	116.0	116.0					8																	1728653		2203	4300	6503	SO:0001589	frameshift_variant	2055			AF123761	CCDS5956.1	8p23.3	2014-09-17			ENSG00000182372	ENSG00000182372			2079	protein-coding gene	gene with protein product		607837	"""chromosome 8 open reading frame 61"""	EPMR, C8orf61		10508524	Standard	NM_018941		Approved	FLJ39417	uc003wpo.4	Q9UBY8	OTTHUMG00000090343	ENST00000331222.4:c.781delG	8.37:g.1728653delG	ENSP00000328182:p.Val261fs		Q86U71|Q96I95	Frame_Shift_Del	DEL	ENST00000331222.4	37	CCDS5956.1																																																																																				0.552	CLN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206715.2	NM_018941	
NSMAF	8439	bcgsc.ca	37	8	59512397	59512397	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr8:59512397G>T	ENST00000038176.3	-	18	1577	c.1365C>A	c.(1363-1365)agC>agA	p.S455R	NSMAF_ENST00000519858.1_5'Flank|NSMAF_ENST00000427130.2_Missense_Mutation_p.S486R	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	455	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				TGACTAGAAAGCTCACATCAT	0.438																																						.											0													84.0	84.0	84.0					8																	59512397		2203	4300	6503	SO:0001583	missense	8439			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1365C>A	8.37:g.59512397G>T	ENSP00000038176:p.Ser455Arg		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	CCDS6173.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821634	0.50633	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	T;T	0.80480	-1.38;-1.38	6.08	6.08	0.98989	BEACH domain (4);	0.115644	0.85682	D	0.000000	T	0.79269	0.4417	M	0.72894	2.215	0.47374	D	0.999403	B;B	0.18610	0.029;0.02	B;B	0.21917	0.022;0.037	T	0.72381	-0.4311	9	.	.	.	.	13.2481	0.60033	0.1122:0.0:0.8878:0.0	.	486;455	Q92636-2;Q92636	.;FAN_HUMAN	R	455;486	ENSP00000038176:S455R;ENSP00000411012:S486R	.	S	-	3	2	NSMAF	59674951	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.236000	0.51336	2.894000	0.99253	0.591000	0.81541	AGC		0.438	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
RC3H2	54542	bcgsc.ca	37	9	125639808	125639808	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr9:125639808C>T	ENST00000373670.1	-	8	1867	c.1267G>A	c.(1267-1269)Ggg>Agg	p.G423R	RC3H2_ENST00000357244.2_Missense_Mutation_p.G423R|RC3H2_ENST00000335387.5_Missense_Mutation_p.G423R|RC3H2_ENST00000423239.2_Missense_Mutation_p.G423R|SNORD90_ENST00000391145.1_RNA|RC3H2_ENST00000373665.2_Missense_Mutation_p.G423R			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	423					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						GGACAACCCCCTTGCTGTCGC	0.418																																						.											0													276.0	270.0	272.0					9																	125639808		1898	4121	6019	SO:0001583	missense	54542			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.1267G>A	9.37:g.125639808C>T	ENSP00000362774:p.Gly423Arg		Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810872	0.90707	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239;ENST00000373665;ENST00000335387	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	5.54	5.54	0.83059	Zinc finger, CCCH-type (3);	0.109140	0.64402	N	0.000006	D	0.84660	0.5521	M	0.69463	2.115	0.54753	D	0.999985	B;D;D;D	0.76494	0.329;0.988;0.999;0.998	B;D;D;D	0.70487	0.327;0.954;0.969;0.948	T	0.82774	-0.0291	10	0.35671	T	0.21	-10.2029	18.4783	0.90800	0.0:1.0:0.0:0.0	.	423;294;423;423	A6NHN2;Q4VXB0;Q9HBD1;Q9HBD1-4	.;.;RC3H2_HUMAN;.	R	423;423;294;423;423;423	ENSP00000362774:G423R;ENSP00000349783:G423R;ENSP00000411767:G423R;ENSP00000362769:G423R;ENSP00000335150:G423R	ENSP00000335150:G423R	G	-	1	0	RC3H2	124679629	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.043000	0.71004	2.627000	0.88993	0.637000	0.83480	GGG		0.418	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	
LAMC3	10319	bcgsc.ca	37	9	133951292	133951292	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr9:133951292T>C	ENST00000361069.4	+	21	3702	c.3569T>C	c.(3568-3570)cTt>cCt	p.L1190P	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1190	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AGCTACGCGCTTCTCTGGAAT	0.627																																						.											0													51.0	45.0	47.0					9																	133951292		2203	4300	6503	SO:0001583	missense	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3569T>C	9.37:g.133951292T>C	ENSP00000354360:p.Leu1190Pro		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.859643	0.51376	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.31247	1.5	5.03	5.03	0.67393	.	0.073516	0.56097	D	0.000025	T	0.52964	0.1767	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.56323	-0.7998	10	0.62326	D	0.03	.	12.8413	0.57805	0.0:0.0:0.0:1.0	.	1190	Q9Y6N6	LAMC3_HUMAN	P	1190	ENSP00000354360:L1190P	ENSP00000347156:L1190P	L	+	2	0	LAMC3	132941113	0.937000	0.31787	0.601000	0.28877	0.099000	0.18886	2.761000	0.47589	2.027000	0.59764	0.397000	0.26171	CTT		0.627	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
MT-ND5	4540	bcgsc.ca	37	M	13208	13209	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chrM:13208_13209delTG	ENST00000361567.2	+	1	872_873	c.872_873delTG	c.(871-873)ttgfs	p.L291fs	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	291					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CGCAGCAGTCTGCGCCCTTACA	0.45																																						.											0																																										SO:0001589	frameshift_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.872_873delTG	M.37:g.13208_13209delTG	ENSP00000354813:p.Leu291fs		Q34773|Q8WCY3	Frame_Shift_Del	DEL	ENST00000361567.2	37																																																																																					0.450	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
H2BFM	286436	bcgsc.ca	37	X	103294677	103294677	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chrX:103294677G>A	ENST00000355016.3	+	1	162	c.134G>A	c.(133-135)cGc>cAc	p.R45H	H2BFM_ENST00000243297.5_Missense_Mutation_p.R148H	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	45						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						CGAGGCTCCCGCAGGCGCCAC	0.652																																						.											0													26.0	32.0	30.0					X																	103294677		692	1591	2283	SO:0001583	missense	286436			AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.134G>A	X.37:g.103294677G>A	ENSP00000347119:p.Arg45His		A6NP82	Missense_Mutation	SNP	ENST00000355016.3	37	CCDS55468.1	.	.	.	.	.	.	.	.	.	.	.	4.463	0.085754	0.08583	.	.	ENSG00000101812	ENST00000243297;ENST00000355016	T;T	0.22945	1.93;1.93	1.4	-2.81	0.05805	Histone-fold (2);	.	.	.	.	T	0.11495	0.0280	N	0.14661	0.345	0.09310	N	1	B	0.19331	0.035	B	0.11329	0.006	T	0.15925	-1.0420	9	0.33141	T	0.24	.	3.8249	0.08851	0.3098:0.379:0.3112:0.0	.	148	P0C1H6	H2BFM_HUMAN	H	148;45	ENSP00000243297:R148H;ENSP00000347119:R45H	ENSP00000243297:R148H	R	+	2	0	H2BFM	103181333	0.023000	0.18921	0.000000	0.03702	0.000000	0.00434	1.328000	0.33758	-2.345000	0.00621	-1.611000	0.00801	CGC		0.652	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057758.2	XM_210048	
C3orf20	84077	bcgsc.ca	37	3	14724246	14724247	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8430-01A-11D-2310-10	TCGA-KN-8430-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	70fd4434-02c9-4016-bb89-86bec4317489	0e26ad23-4697-4346-bb99-8cddd8d612c7	g.chr3:14724246_14724247insA	ENST00000253697.3	+	3	478_479	c.26_27insA	c.(25-30)gaattafs	p.L10fs	C3orf20_ENST00000435614.1_Intron|C3orf20_ENST00000412910.1_Intron	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	10						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						AGTAACCTAGAATTATATCAGC	0.48																																						.											0																																										SO:0001589	frameshift_variant	84077			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.27dupA	3.37:g.14724247_14724247dupA	ENSP00000253697:p.Leu10fs		Q7L0U6|Q8NCP2|Q9H0I7	Frame_Shift_Ins	INS	ENST00000253697.3	37	CCDS33706.1																																																																																				0.480	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
