#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF106	64397	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	42720229	42720229	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr15:42720229G>A	ENST00000263805.4	-	12	5242	c.4916C>T	c.(4915-4917)aCc>aTc	p.T1639I	RNU6-188P_ENST00000364207.1_RNA|ZNF106_ENST00000565380.1_Missense_Mutation_p.T867I|ZNF106_ENST00000565611.1_Missense_Mutation_p.T824I	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1639					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TATGTTGAAGGTGACCACAGT	0.512																																						.											0													171.0	138.0	150.0					15																	42720229		2203	4299	6502	SO:0001583	missense	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.4916C>T	15.37:g.42720229G>A	ENSP00000263805:p.Thr1639Ile		B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785110	0.70222	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.14266	2.52	5.26	5.26	0.73747	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101382	0.64402	D	0.000002	T	0.25419	0.0618	L	0.29908	0.895	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.993	P;P;P	0.62435	0.881;0.902;0.881	T	0.00577	-1.1662	10	0.42905	T	0.14	-9.4294	19.1213	0.93365	0.0:0.0:1.0:0.0	.	867;1639;867	E9PE29;Q9H2Y7;B4DZ40	.;ZF106_HUMAN;.	I	1639;867	ENSP00000263805:T1639I	ENSP00000263805:T1639I	T	-	2	0	ZFP106	40507521	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.960000	0.70348	2.753000	0.94483	0.650000	0.86243	ACC		0.512	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
PLEKHM1	9842	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	43523003	43523003	+	Silent	SNP	C	C	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr17:43523003C>G	ENST00000430334.3	-	9	2803	c.2670G>C	c.(2668-2670)ctG>ctC	p.L890L	PLEKHM1_ENST00000580404.1_5'UTR|PLEKHM1_ENST00000421073.2_Silent_p.L801L	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	890					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GGATCTGTGTCAGAAACTTCA	0.602																																						.											0													64.0	60.0	61.0					17																	43523003		2201	4300	6501	SO:0001819	synonymous_variant	9842			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.2670G>C	17.37:g.43523003C>G			Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Silent	SNP	ENST00000430334.3	37	CCDS32671.1																																																																																				0.602	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
ENO1	2023	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	8923329	8923329	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr1:8923329T>A	ENST00000234590.4	-	10	1260	c.1141A>T	c.(1141-1143)Atc>Ttc	p.I381F		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	381					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		AGGTCAGCGATGAAGGTATCT	0.557											OREG0013068	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(21;302 608 19946 22210 33560)	.											0													131.0	121.0	124.0					1																	8923329		2203	4300	6503	SO:0001583	missense	2023			BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.1141A>T	1.37:g.8923329T>A	ENSP00000234590:p.Ile381Phe	653	B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Missense_Mutation	SNP	ENST00000234590.4	37	CCDS97.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.297227	0.81025	.	.	ENSG00000074800	ENST00000234590	T	0.61742	0.08	5.46	5.46	0.80206	Enolase, C-terminal (1);	0.048343	0.85682	D	0.000000	D	0.83275	0.5219	H	0.96489	3.83	0.58432	D	0.999999	P;D;D;D;D;D	0.89917	0.614;0.999;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.85130	0.523;0.995;0.996;0.997;0.991;0.997	D	0.88684	0.3204	10	0.87932	D	0	-27.4565	14.716	0.69269	0.0:0.0:0.0:1.0	.	82;285;219;131;288;381	A4QMW8;E2DRY6;Q9BT62;Q96GV1;P06733-2;P06733	.;.;.;.;.;ENOA_HUMAN	F	381	ENSP00000234590:I381F	ENSP00000234590:I381F	I	-	1	0	ENO1	8845916	1.000000	0.71417	0.992000	0.48379	0.526000	0.34562	7.917000	0.87498	2.090000	0.63153	0.459000	0.35465	ATC		0.557	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004945.1	NM_001428	
PRKCSH	5589	hgsc.bcm.edu;mdanderson.org	37	19	11558367	11558367	+	Silent	SNP	G	G	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr19:11558367G>A	ENST00000589838.1	+	10	963	c.963G>A	c.(961-963)gaG>gaA	p.E321E	PRKCSH_ENST00000587327.1_Silent_p.E321E|PRKCSH_ENST00000592741.1_Silent_p.E321E|PRKCSH_ENST00000412601.1_Silent_p.E321E|PRKCSH_ENST00000252455.2_Silent_p.E321E|PRKCSH_ENST00000591462.1_Silent_p.E321E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	321	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaggaagaag	0.632																																						.											1	Deletion - In frame(1)	central_nervous_system(1)											28.0	28.0	28.0					19																	11558367		2200	4298	6498	SO:0001819	synonymous_variant	5589				CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.963G>A	19.37:g.11558367G>A			A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																				0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
ZNF793	390927	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	38028153	38028153	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr19:38028153C>G	ENST00000587143.1	+	6	828	c.593C>G	c.(592-594)aCc>aGc	p.T198S	ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000589319.1_Intron|ZNF793_ENST00000445217.1_Missense_Mutation_p.T198S|ZNF793_ENST00000542455.1_Missense_Mutation_p.T198S			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAGCTTTCACCCAGAACCCG	0.463																																					Melanoma(44;400 1431 1499 19093)	.											0													34.0	34.0	34.0					19																	38028153		1869	4106	5975	SO:0001583	missense	390927			AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.593C>G	19.37:g.38028153C>G	ENSP00000468605:p.Thr198Ser		E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	ENST00000587143.1	37	CCDS46062.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.516748	0.00151	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	T;T	0.14391	2.51;2.51	4.02	2.94	0.34122	.	0.307194	0.23762	N	0.044815	T	0.03959	0.0111	N	0.02111	-0.68	0.20975	N	0.999816	B	0.02656	0.0	B	0.01281	0.0	T	0.42749	-0.9433	10	0.02654	T	1	.	9.5982	0.39587	0.0:0.2693:0.7307:0.0	.	198	E9PGN4	.	S	198;198;198;197	ENSP00000444355:T198S;ENSP00000396402:T198S	ENSP00000318811:T197S	T	+	2	0	ZNF793	42719993	0.000000	0.05858	0.266000	0.24541	0.069000	0.16628	-1.377000	0.02558	0.981000	0.38548	-0.228000	0.12330	ACC		0.463	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
CCR2	729230	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	46399846	46399846	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr3:46399846C>A	ENST00000400888.2	+	1	867	c.828C>A	c.(826-828)aaC>aaA	p.N276K	CCR2_ENST00000465202.1_3'UTR|CCR2_ENST00000445132.2_Missense_Mutation_p.N276K|CCR2_ENST00000292301.4_Missense_Mutation_p.N276K			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	276					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		GCCTGAGTAACTGTGAAAGCA	0.473																																						.											0													160.0	146.0	150.0					3																	46399846		1568	3582	5150	SO:0001583	missense	729230				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.828C>A	3.37:g.46399846C>A	ENSP00000383681:p.Asn276Lys		A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	ENST00000400888.2	37	CCDS43078.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906713	0.33628	.	.	ENSG00000121807	ENST00000445132;ENST00000292301;ENST00000400888	T;T;T	0.69306	2.06;-0.39;-0.39	4.95	3.08	0.35506	GPCR, rhodopsin-like superfamily (1);	0.402277	0.25383	N	0.031073	T	0.71221	0.3314	M	0.77820	2.39	0.22401	N	0.999136	B;P	0.38420	0.21;0.63	P;B	0.46208	0.507;0.41	T	0.65307	-0.6200	10	0.66056	D	0.02	.	9.0876	0.36590	0.0:0.6655:0.0:0.3345	.	276;276	P41597;Q4VBL2	CCR2_HUMAN;.	K	276	ENSP00000399285:N276K;ENSP00000292301:N276K;ENSP00000383681:N276K	ENSP00000292301:N276K	N	+	3	2	CCR2	46374850	0.000000	0.05858	0.333000	0.25482	0.497000	0.33675	-0.329000	0.07935	1.197000	0.43143	0.585000	0.79938	AAC		0.473	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	NM_000647	
SPATA31E1	286234	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	90500243	90500243	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr9:90500243C>G	ENST00000325643.5	+	4	907	c.841C>G	c.(841-843)Cta>Gta	p.L281V		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	281	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAGCTCCCCTCTACACAACCA	0.652																																						.											0													42.0	45.0	44.0					9																	90500243		2203	4300	6503	SO:0001583	missense	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.841C>G	9.37:g.90500243C>G	ENSP00000322640:p.Leu281Val		B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	.	7.466	0.645757	0.14451	.	.	ENSG00000177992	ENST00000325643	T	0.03524	3.9	1.89	-0.762	0.11034	.	0.834804	0.09796	N	0.754810	T	0.02888	0.0086	L	0.39898	1.24	0.09310	N	1	P	0.43094	0.799	B	0.36378	0.223	T	0.45818	-0.9235	10	0.13108	T	0.6	.	8.1474	0.31119	0.0:0.3695:0.6305:0.0	.	281	Q6ZUB1	CI079_HUMAN	V	281	ENSP00000322640:L281V	ENSP00000322640:L281V	L	+	1	2	C9orf79	89690063	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.117000	0.15583	-0.158000	0.11040	0.455000	0.32223	CTA		0.652	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
CXorf23	256643	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	19983778	19983778	+	Nonsense_Mutation	SNP	T	T	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chrX:19983778T>A	ENST00000379682.4	-	3	691	c.658A>T	c.(658-660)Aga>Tga	p.R220*	CXorf23_ENST00000379687.3_Nonsense_Mutation_p.R220*|CXorf23_ENST00000356980.3_Nonsense_Mutation_p.R220*			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	220						mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						TCTTTAGGTCTTTTTGATGTG	0.453																																						.											0													170.0	149.0	156.0					X																	19983778		1907	4124	6031	SO:0001587	stop_gained	256643			AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.658A>T	X.37:g.19983778T>A	ENSP00000369004:p.Arg220*		A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Nonsense_Mutation	SNP	ENST00000379682.4	37		.	.	.	.	.	.	.	.	.	.	T	38	7.199527	0.98129	.	.	ENSG00000173681	ENST00000379687;ENST00000379682;ENST00000356980;ENST00000539038	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0846	0.72142	0.0:0.0:0.0:1.0	.	.	.	.	X	220;220;220;108	.	.	R	-	1	2	CXorf23	19893699	1.000000	0.71417	0.948000	0.38648	0.984000	0.73092	5.464000	0.66719	1.945000	0.56424	0.446000	0.29264	AGA		0.453	CXorf23-006	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000055991.2	NM_198279	
FBXW7	55294	hgsc.bcm.edu	37	4	153247276	153247276	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr4:153247276T>C	ENST00000281708.4	-	10	2755	c.1526A>G	c.(1525-1527)tAt>tGt	p.Y509C	FBXW7_ENST00000603841.1_Missense_Mutation_p.Y509C|FBXW7_ENST00000393956.3_Missense_Mutation_p.Y333C|FBXW7_ENST00000603548.1_Missense_Mutation_p.Y509C|FBXW7_ENST00000296555.5_Missense_Mutation_p.Y391C|FBXW7_ENST00000263981.5_Missense_Mutation_p.Y429C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	509					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.Y429F(1)|p.Y509F(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CCTGCCATCATATTGAACACA	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	.		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	3	Substitution - Missense(2)|Unknown(1)	lung(2)|haematopoietic_and_lymphoid_tissue(1)											171.0	164.0	167.0					4																	153247276		2203	4300	6503	SO:0001583	missense	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1526A>G	4.37:g.153247276T>C	ENSP00000281708:p.Tyr509Cys		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002642	0.74932	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.054216	0.85682	D	0.000000	T	0.73946	0.3652	M	0.64170	1.965	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.994;0.998;0.996;0.996	T	0.75377	-0.3339	10	0.56958	D	0.05	-21.1615	16.2962	0.82776	0.0:0.0:0.0:1.0	.	333;509;391;429	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	509;391;429;333	ENSP00000281708:Y509C;ENSP00000296555:Y391C;ENSP00000263981:Y429C;ENSP00000377528:Y333C	ENSP00000263981:Y429C	Y	-	2	0	FBXW7	153466726	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.965000	0.87945	2.304000	0.77564	0.528000	0.53228	TAT		0.468	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
ATG2A	23130	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	11	64664287	64664287	+	Silent	SNP	G	G	A	rs180755321		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr11:64664287G>A	ENST00000377264.3	-	38	5317	c.5205C>T	c.(5203-5205)gaC>gaT	p.D1735D	ATG2A_ENST00000421419.2_Silent_p.D1737D	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1735					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TCTTGCGGATGTCCTGCAGCC	0.637											OREG0004026	type=REGULATORY REGION|Gene=BC027481|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	G|||	1	0.000199681	0.0	0.0	5008	,	,		17180	0.001		0.0	False		,,,				2504	0.0					.											0													53.0	53.0	53.0					11																	64664287		2201	4297	6498	SO:0001819	synonymous_variant	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.5205C>T	11.37:g.64664287G>A		1078	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Silent	SNP	ENST00000377264.3	37	CCDS31602.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	8.328	0.825936	0.16749	.	.	ENSG00000110046	ENST00000418259	.	.	.	4.05	-0.377	0.12501	.	.	.	.	.	T	0.53916	0.1826	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44651	-0.9314	4	.	.	.	.	7.9988	0.30284	0.4059:0.0:0.5941:0.0	.	.	.	.	Y	1539	.	.	H	-	1	0	ATG2A	64420863	0.997000	0.39634	0.997000	0.53966	0.848000	0.48234	0.323000	0.19593	-0.146000	0.11274	-0.367000	0.07326	CAT		0.637	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
FOLR2	2350	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	71932013	71932013	+	Missense_Mutation	SNP	G	G	A	rs74853303	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr11:71932013G>A	ENST00000298223.6	+	3	437	c.250G>A	c.(250-252)Ggc>Agc	p.G84S	FOLR2_ENST00000449475.2_Missense_Mutation_p.G101S|FOLR2_ENST00000454954.2_Missense_Mutation_p.G43S	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	84					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	GGACCACTGCGGCAAGATGGA	0.602													G|||	26	0.00519169	0.0182	0.0029	5008	,	,		12907	0.0		0.0	False		,,,				2504	0.0					.											0								G	SER/GLY,SER/GLY,SER/GLY,SER/GLY	57,4343	57.4+/-93.9	0,57,2143	40.0	41.0	41.0		250,250,250,250	0.6	0.0	11	dbSNP_131	41	0,8586		0,0,4293	yes	missense,missense,missense,missense	FOLR2	NM_000803.4,NM_001113534.1,NM_001113535.1,NM_001113536.1	56,56,56,56	0,57,6436	AA,AG,GG		0.0,1.2955,0.4389	benign,benign,benign,benign	84/256,84/256,84/256,84/256	71932013	57,12929	2200	4293	6493	SO:0001583	missense	2350			AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.250G>A	11.37:g.71932013G>A	ENSP00000298223:p.Gly84Ser		Q05CA5|Q6GTE8	Missense_Mutation	SNP	ENST00000298223.6	37	CCDS8212.1	19	0.0086996336996337	18	0.036585365853658534	1	0.0027624309392265192	0	0.0	0	0.0	g	13.67	2.307800	0.40795	0.012955	0.0	ENSG00000165457	ENST00000449475;ENST00000298223;ENST00000413873;ENST00000454954;ENST00000541003;ENST00000539412;ENST00000536778;ENST00000535625;ENST00000321324;ENST00000538353	T;T;T;T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	4.52	0.548	0.17208	Folate receptor-like (1);	0.130041	0.51477	N	0.000089	T	0.57533	0.2060	M	0.82517	2.595	0.41806	D	0.989941	D	0.63880	0.993	P	0.55391	0.775	T	0.72194	-0.4364	10	0.54805	T	0.06	.	8.3882	0.32512	0.3371:0.0:0.6629:0.0	.	84	P14207	FOLR2_HUMAN	S	101;84;101;43;130;95;99;84;97;84	ENSP00000405638:G101S;ENSP00000298223:G84S;ENSP00000414094:G43S;ENSP00000443307:G130S;ENSP00000441547:G95S;ENSP00000438568:G99S;ENSP00000444794:G84S;ENSP00000321957:G97S;ENSP00000440337:G84S	ENSP00000298223:G84S	G	+	1	0	FOLR2	71609661	0.998000	0.40836	0.018000	0.16275	0.154000	0.21943	2.691000	0.47010	-0.058000	0.13177	0.455000	0.32223	GGC		0.602	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803	
ODF4	146852	hgsc.bcm.edu;bcgsc.ca	37	17	8249105	8249105	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr17:8249105A>G	ENST00000328248.2	+	3	897	c.709A>G	c.(709-711)Atc>Gtc	p.I237V	ODF4_ENST00000584943.1_Missense_Mutation_p.I122V	NM_153007.4	NP_694552.2	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	237					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|outer dense fiber (GO:0001520)				endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)	8						GGCACAGACGATCACAGACAC	0.522																																						.											0													95.0	93.0	94.0					17																	8249105		2203	4300	6503	SO:0001583	missense	146852			AB081120	CCDS11140.1	17p13	2010-09-27			ENSG00000184650	ENSG00000184650			19056	protein-coding gene	gene with protein product	"""cancer/testis antigen 136"""	610097					Standard	NM_153007		Approved	OPPO1, CT136	uc002gle.1	Q2M2E3	OTTHUMG00000108190	ENST00000328248.2:c.709A>G	17.37:g.8249105A>G	ENSP00000331086:p.Ile237Val		Q8J021	Missense_Mutation	SNP	ENST00000328248.2	37	CCDS11140.1	.	.	.	.	.	.	.	.	.	.	A	5.538	0.284119	0.10513	.	.	ENSG00000184650	ENST00000328248	T	0.22945	1.93	3.42	-5.82	0.02333	.	2.102490	0.02578	N	0.098545	T	0.07818	0.0196	N	0.04508	-0.205	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.20273	-1.0280	10	0.06891	T	0.86	-1.5999	0.3507	0.00348	0.3221:0.1411:0.2745:0.2624	.	237	Q2M2E3	ODFP4_HUMAN	V	237	ENSP00000331086:I237V	ENSP00000331086:I237V	I	+	1	0	ODF4	8189830	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.834000	0.04391	-1.193000	0.02688	-0.371000	0.07208	ATC		0.522	ODF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226996.1		
SSTR2	6752	hgsc.bcm.edu	37	17	71166135	71166135	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr17:71166135T>C	ENST00000357585.2	+	2	1046	c.677T>C	c.(676-678)cTt>cCt	p.L226P	RP11-143K11.5_ENST00000580671.1_RNA|SSTR2_ENST00000315332.2_Missense_Mutation_p.L226P	NM_001050.2	NP_001041.1	P30874	SSR2_HUMAN	somatostatin receptor 2	226					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|peristalsis (GO:0030432)|regulation of muscle contraction (GO:0006937)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|somatostatin receptor activity (GO:0004994)			endometrium(2)|large_intestine(5)|lung(2)|prostate(2)	11			LUSC - Lung squamous cell carcinoma(166;0.197)		Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	ATCATCTGTCTTTGCTACCTG	0.502																																						.											0													129.0	120.0	123.0					17																	71166135		2203	4300	6503	SO:0001583	missense	6752				CCDS11691.1	17q24	2012-08-08				ENSG00000180616		"""GPCR / Class A : Somatostatin receptors"""	11331	protein-coding gene	gene with protein product		182452				8449518	Standard	NM_001050		Approved		uc002jje.3	P30874		ENST00000357585.2:c.677T>C	17.37:g.71166135T>C	ENSP00000350198:p.Leu226Pro		A8K3Y0|B2R9P7|Q4VBP0|Q96GE0|Q96TF2|Q9BWH1	Missense_Mutation	SNP	ENST00000357585.2	37	CCDS11691.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.659722	0.67586	.	.	ENSG00000180616	ENST00000357585;ENST00000315332	T;T	0.39787	1.06;1.06	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.063672	0.64402	D	0.000004	T	0.66626	0.2808	M	0.80183	2.485	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.71833	-0.4473	10	0.87932	D	0	.	15.5193	0.75854	0.0:0.0:0.0:1.0	.	226	P30874	SSR2_HUMAN	P	226	ENSP00000350198:L226P;ENSP00000326616:L226P	ENSP00000326616:L226P	L	+	2	0	SSTR2	68677730	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.147000	0.66899	0.533000	0.62120	CTT		0.502	SSTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441633.1		
FAM131C	348487	broad.mit.edu;mdanderson.org	37	1	16386095	16386095	+	Silent	SNP	G	G	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr1:16386095G>A	ENST00000375662.4	-	6	639	c.456C>T	c.(454-456)gtC>gtT	p.V152V	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	152										large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		ACTGCTCGGCGACCCCTGGGG	0.672																																						.											0													15.0	15.0	15.0					1																	16386095		1788	4014	5802	SO:0001819	synonymous_variant	348487				CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.456C>T	1.37:g.16386095G>A			Q5T5Q5|Q8N3X3|Q8N9P9	Silent	SNP	ENST00000375662.4	37	CCDS41270.1																																																																																				0.672	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026319.1	NM_182623	
SRGAP2B	647135	broad.mit.edu	37	1	206516357	206516357	+	IGR	DEL	A	A	-			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr1:206516357delA								CTSE (184253 upstream) : SRGAP2-AS1 (35861 downstream)																							AAGACTCTTTAAAAAGGTACA	0.408																																						.											0													42.0	38.0	39.0					1																	206516357		1863	4095	5958	SO:0001628	intergenic_variant	23380																															1.37:g.206516357delA				Frame_Shift_Del	DEL		37																																																																																				0	0.408								
IDE	3416	broad.mit.edu	37	10	94223677	94223677	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr10:94223677A>G	ENST00000265986.6	-	21	2628	c.2572T>C	c.(2572-2574)Tac>Cac	p.Y858H	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.Y303H	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	858					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	CTTTCTAGGTAGTGAGGTGGC	0.453																																						.											0													245.0	243.0	244.0					10																	94223677		2203	4300	6503	SO:0001583	missense	3416			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2572T>C	10.37:g.94223677A>G	ENSP00000265986:p.Tyr858His		B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.304590	0.81136	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.34275	1.39;1.37	5.61	4.48	0.54585	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.48786	0.1519	L	0.58428	1.81	0.80722	D	1	P;P	0.42993	0.55;0.797	P;P	0.56612	0.567;0.802	T	0.33979	-0.9847	10	0.25751	T	0.34	-10.3367	11.7351	0.51761	0.9308:0.0:0.0692:0.0	.	858;303	P14735;B3KSB8	IDE_HUMAN;.	H	858;303	ENSP00000265986:Y858H;ENSP00000360637:Y303H	ENSP00000265986:Y858H	Y	-	1	0	IDE	94213657	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.002000	0.93572	1.065000	0.40693	-0.256000	0.11100	TAC		0.453	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
CREBBP	1387	broad.mit.edu	37	16	3817815	3817815	+	Silent	SNP	T	T	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr16:3817815T>C	ENST00000262367.5	-	16	3965	c.3156A>G	c.(3154-3156)aaA>aaG	p.K1052K	CREBBP_ENST00000382070.3_Silent_p.K1014K	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1052					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCACTTCAGGTTTCTTTTCAT	0.443			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													254.0	226.0	235.0					16																	3817815		2197	4300	6497	SO:0001819	synonymous_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3156A>G	16.37:g.3817815T>C			D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																				0.443	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
ZNF233	353355	broad.mit.edu	37	19	44778459	44778459	+	Missense_Mutation	SNP	C	C	T	rs200116301		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr19:44778459C>T	ENST00000391958.2	+	5	1773	c.1646C>T	c.(1645-1647)tCg>tTg	p.S549L	ZNF233_ENST00000334152.1_Missense_Mutation_p.S531L|ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	549					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				AGTCAGAGTTCGCATCTCCAA	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		22501	0.0		0.001	False		,,,				2504	0.0					.											0								C	LEU/SER,LEU/SER	1,4405	2.1+/-5.4	0,1,2202	103.0	93.0	96.0		1646,1646	1.6	0.0	19		96	0,8600		0,0,4300	no	missense,missense	ZNF233	NM_181756.2,NM_001207005.1	145,145	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	549/671,549/671	44778459	1,13005	2203	4300	6503	SO:0001583	missense	353355			AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1646C>T	19.37:g.44778459C>T	ENSP00000375820:p.Ser549Leu		B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	ENST00000391958.2	37	CCDS33047.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	14.72	2.619655	0.46736	2.27E-4	0.0	ENSG00000159915	ENST00000334152;ENST00000391958;ENST00000280305	T;T	0.07444	3.19;3.19	3.87	1.56	0.23342	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11067	0.0270	M	0.77313	2.365	0.09310	N	1	B	0.34181	0.44	B	0.20955	0.032	T	0.09122	-1.0689	9	0.87932	D	0	-2.1334	10.7398	0.46147	0.4941:0.5059:0.0:0.0	.	549	A6NK53	ZN233_HUMAN	L	531;549;444	ENSP00000334957:S531L;ENSP00000375820:S549L	ENSP00000280305:S444L	S	+	2	0	ZNF233	49470299	0.000000	0.05858	0.001000	0.08648	0.841000	0.47740	0.427000	0.21379	0.194000	0.20326	0.609000	0.83330	TCG		0.468	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
MBOAT2	129642	broad.mit.edu	37	2	9013240	9013240	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr2:9013240A>G	ENST00000305997.3	-	8	1079	c.881T>C	c.(880-882)cTa>cCa	p.L294P	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	294					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTACTTACCTAGCGTCCATGC	0.413																																					Ovarian(194;1699 3813 22401)	.											0													82.0	78.0	79.0					2																	9013240		2203	4300	6503	SO:0001583	missense	129642			BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.881T>C	2.37:g.9013240A>G	ENSP00000302177:p.Leu294Pro		A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	ENST00000305997.3	37	CCDS1660.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.046540	0.75846	.	.	ENSG00000143797	ENST00000305997	T	0.74421	-0.84	5.07	5.07	0.68467	.	0.139671	0.46442	D	0.000286	D	0.88239	0.6383	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.988	D	0.90823	0.4710	10	0.87932	D	0	-7.5219	14.8342	0.70169	1.0:0.0:0.0:0.0	.	294;294	B7Z3I3;Q6ZWT7	.;MBOA2_HUMAN	P	294	ENSP00000302177:L294P	ENSP00000302177:L294P	L	-	2	0	MBOAT2	8930691	1.000000	0.71417	0.964000	0.40570	0.796000	0.44982	8.954000	0.93051	1.902000	0.55061	0.377000	0.23210	CTA		0.413	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
NPAS2	4862	broad.mit.edu	37	2	101607324	101607324	+	Missense_Mutation	SNP	C	C	T	rs141762291		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr2:101607324C>T	ENST00000335681.5	+	19	2386	c.2101C>T	c.(2101-2103)Cgg>Tgg	p.R701W	AC016738.4_ENST00000452364.1_RNA|NPAS2_ENST00000542504.1_Missense_Mutation_p.R766W	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	701					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAGGACGGGACGGCAAGTCAA	0.652																																						.											0								C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	69.0	62.0	64.0		2101	3.7	1.0	2	dbSNP_134	64	1,8599		0,1,4299	no	missense	NPAS2	NM_002518.3	101	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	701/825	101607324	3,13003	2203	4300	6503	SO:0001583	missense	4862			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.2101C>T	2.37:g.101607324C>T	ENSP00000338283:p.Arg701Trp		Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	ENST00000335681.5	37	CCDS2048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.88|16.88	3.245069|3.245069	0.59103|0.59103	4.54E-4|4.54E-4	1.16E-4|1.16E-4	ENSG00000170485|ENSG00000170485	ENST00000335681;ENST00000542504|ENST00000433408	T;T|.	0.05382|.	3.47;3.45|.	4.63|4.63	3.74|3.74	0.42951|0.42951	.|.	.|.	.|.	.|.	.|.	T|T	0.56529|0.56529	0.1991|0.1991	L|L	0.51422|0.51422	1.61|1.61	0.38431|0.38431	D|D	0.946433|0.946433	D;D|.	0.69078|.	0.997;0.992|.	P;B|.	0.49953|.	0.627;0.332|.	T|T	0.57081|0.57081	-0.7872|-0.7872	9|5	0.87932|.	D|.	0|.	.|.	7.2525|7.2525	0.26158|0.26158	0.0:0.745:0.0:0.255|0.0:0.745:0.0:0.255	.|.	766;701|.	F5H027;Q99743|.	.;NPAS2_HUMAN|.	W|M	701;766|199	ENSP00000338283:R701W;ENSP00000438428:R766W|.	ENSP00000338283:R701W|.	R|T	+|+	1|2	2|0	NPAS2|NPAS2	100973756|100973756	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	1.394000|1.394000	0.34509|0.34509	2.279000|2.279000	0.76181|0.76181	0.462000|0.462000	0.41574|0.41574	CGG|ACG		0.652	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		
ADAM23	8745	broad.mit.edu;bcgsc.ca	37	2	207459582	207459582	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr2:207459582A>G	ENST00000264377.3	+	23	2528	c.2200A>G	c.(2200-2202)Agc>Ggc	p.S734G	ADAM23_ENST00000374416.1_Missense_Mutation_p.S734G|ADAM23_ENST00000374415.3_Missense_Mutation_p.S734G	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	734	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CCTAAATATGAGCAGCTGTCC	0.483																																					Melanoma(194;1127 2130 19620 24042 27855)	.											0													183.0	167.0	172.0					2																	207459582		2203	4300	6503	SO:0001583	missense	8745			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.2200A>G	2.37:g.207459582A>G	ENSP00000264377:p.Ser734Gly		A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.1|22.1	4.249450|4.249450	0.80024|0.80024	.|.	.|.	ENSG00000114948|ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415|ENST00000444281	T;T;T|.	0.02067|.	4.48;4.47;4.47|.	5.91|5.91	5.91|5.91	0.95273|0.95273	Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76335|.	0.3973|.	M|M	0.78456|0.78456	2.415|2.415	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.89917|.	1.0|.	D|.	0.66497|.	0.944|.	T|.	0.77067|.	-0.2725|.	10|.	0.52906|.	T|.	0.07|.	.|.	15.528|15.528	0.75928|0.75928	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	734|.	O75077|.	ADA23_HUMAN|.	G|W	734;734;628;734|8	ENSP00000264377:S734G;ENSP00000363537:S734G;ENSP00000363536:S734G|.	ENSP00000264377:S734G|.	S|X	+|+	1|3	0|0	ADAM23|ADAM23	207167827|207167827	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	7.327000|7.327000	0.79147|0.79147	2.263000|2.263000	0.75096|0.75096	0.528000|0.528000	0.53228|0.53228	AGC|TGA		0.483	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
EBF4	57593	broad.mit.edu	37	20	2686302	2686302	+	Silent	SNP	C	C	T			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr20:2686302C>T	ENST00000609451.1	+	2	289	c.217C>T	c.(217-219)Ctg>Ttg	p.L73L	EBF4_ENST00000380648.4_Silent_p.L69L			Q9BQW3	COE4_HUMAN	early B-cell factor 4	73					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CCACTTCGTGCTGGCCATGTA	0.592																																						.											0													82.0	84.0	84.0					20																	2686302		692	1591	2283	SO:0001819	synonymous_variant	57593			BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.217C>T	20.37:g.2686302C>T			Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Silent	SNP	ENST00000609451.1	37																																																																																					0.592	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471930.1	XM_938882	
MAP1LC3A	84557	broad.mit.edu	37	20	33147203	33147203	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr20:33147203C>T	ENST00000360668.3	+	3	910	c.149C>T	c.(148-150)aCc>aTc	p.T50I	MAP1LC3A_ENST00000374837.3_Missense_Mutation_p.T54I|MAP1LC3A_ENST00000476428.1_3'UTR|MAP1LC3A_ENST00000397709.1_Missense_Mutation_p.T50I			Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3 alpha	50					autophagic vacuole assembly (GO:0000045)|mitochondrion degradation (GO:0000422)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|late endosome (GO:0005770)|microtubule (GO:0005874)|organelle membrane (GO:0031090)	phosphatidylethanolamine binding (GO:0008429)|phospholipid binding (GO:0005543)			cervix(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(2)	5						CTGGACAAGACCAAGTTTTTG	0.652																																						.											0													44.0	45.0	44.0					20																	33147203		2201	4296	6497	SO:0001583	missense	84557				CCDS13237.1, CCDS13238.1	20q11.22	2014-02-12			ENSG00000101460	ENSG00000101460			6838	protein-coding gene	gene with protein product		601242				8833088, 17580304	Standard	NM_032514		Approved	MAP1BLC3, MAP1ALC3, LC3, LC3A, ATG8E	uc002xaq.2	Q9H492	OTTHUMG00000032306	ENST00000360668.3:c.149C>T	20.37:g.33147203C>T	ENSP00000353886:p.Thr50Ile		E1P5P4|E1P5P5|Q9BXW5	Missense_Mutation	SNP	ENST00000360668.3	37	CCDS13238.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051111	0.75960	.	.	ENSG00000101460	ENST00000374837;ENST00000360668;ENST00000397709	T;T;T	0.44083	0.93;0.93;0.93	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.70595	2.14	0.80722	D	1	B;D	0.69078	0.06;0.997	B;D	0.65987	0.116;0.94	T	0.67681	-0.5608	10	0.66056	D	0.02	-1.7041	18.0581	0.89369	0.0:1.0:0.0:0.0	.	50;54	Q9H492;Q9H492-2	MLP3A_HUMAN;.	I	54;50;50	ENSP00000363970:T54I;ENSP00000353886:T50I;ENSP00000380821:T50I	ENSP00000353886:T50I	T	+	2	0	MAP1LC3A	32610864	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.013000	0.70776	2.357000	0.79964	0.313000	0.20887	ACC		0.652	MAP1LC3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078801.2	NM_181509	
TIMD4	91937	broad.mit.edu	37	5	156378731	156378733	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	GGT	GGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr5:156378731_156378733delGGT	ENST00000274532.2	-	3	525_527	c.469_471delACC	c.(469-471)accdel	p.T157del	TIMD4_ENST00000407087.3_In_Frame_Del_p.T157del	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	157	Thr-rich.					integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCATTTGTCGGGTGGTGGTGGGG	0.527																																						.											0																																										SO:0001651	inframe_deletion	91937			BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.469_471delACC	5.37:g.156378737_156378739delGGT	ENSP00000274532:p.Thr157del		B5MCL9	In_Frame_Del	DEL	ENST00000274532.2	37	CCDS4332.1																																																																																				0.527	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	
SARDH	1757	broad.mit.edu;bcgsc.ca	37	9	136550314	136550314	+	Splice_Site	SNP	C	C	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr9:136550314C>A	ENST00000371872.4	-	17	2421		c.e17+1		SARDH_ENST00000422262.2_Splice_Site|SARDH_ENST00000439388.1_Splice_Site|SARDH_ENST00000371868.1_Splice_Site	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase						glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CTGGAACCTACCAGGTGCCCT	0.662																																						.											0													86.0	65.0	72.0					9																	136550314		2203	4300	6503	SO:0001630	splice_region_variant	1757				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.2163+1G>T	9.37:g.136550314C>A			B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Splice_Site	SNP	ENST00000371872.4	37	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671051	0.67814	.	.	ENSG00000123453	ENST00000371872;ENST00000371868;ENST00000439388;ENST00000422262	.	.	.	4.27	4.27	0.50696	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2821	0.82697	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SARDH	135540135	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	6.689000	0.74562	1.922000	0.55676	0.462000	0.41574	.		0.662	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		Intron
MAGEA12	4111	broad.mit.edu	37	X	151896626	151896626	+	IGR	DEL	A	A	-			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chrX:151896626delA	ENST00000357916.4	-	0	1664				CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12											breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GGACATCTTCACCAGACCAGT	0.562																																						.											0																																										SO:0001628	intergenic_variant	100130935				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650		X.37:g.151896626delA			Q9NSD3	RNA	DEL	ENST00000357916.4	37	CCDS14710.1																																																																																				0.562	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058764.1	NM_005367	
MUC5B	727897	broad.mit.edu	37	11	1263525	1263526	+	Frame_Shift_Ins	INS	-	-	G	rs369279116		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr11:1263525_1263526insG	ENST00000529681.1	+	31	5473_5474	c.5415_5416insG	c.(5416-5418)gggfs	p.G1806fs	MUC5B_ENST00000447027.1_Frame_Shift_Ins_p.G1809fs|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1806	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGGTTGCAGGCGGGGACATGGA	0.579																																						.											0																																										SO:0001589	frameshift_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5419dupG	11.37:g.1263529_1263529dupG	ENSP00000436812:p.Gly1806fs		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Frame_Shift_Ins	INS	ENST00000529681.1	37	CCDS44515.2																																																																																				0.579	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
ZNF205	7755	broad.mit.edu	37	16	3169758	3169759	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr16:3169758_3169759insC	ENST00000382192.3	+	7	1302_1303	c.1097_1098insC	c.(1096-1101)tgccccfs	p.CP366fs	RP11-473M20.14_ENST00000576490.1_RNA|ZNF205_ENST00000219091.4_Frame_Shift_Ins_p.CP366fs|RP11-473M20.14_ENST00000575139.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	366					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						CCCTACACCTGCCCCGCCTGCC	0.653																																						.											0																																										SO:0001589	frameshift_variant	7755			AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.1101dupC	16.37:g.3169762_3169762dupC	ENSP00000371627:p.Cys366fs		A8MZK0|D3DUB4|Q9BU95	Frame_Shift_Ins	INS	ENST00000382192.3	37	CCDS10494.2																																																																																				0.653	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309057.1	NM_003456	
C16orf96	342346	broad.mit.edu	37	16	4625753	4625754	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr16:4625753_4625754insC	ENST00000444310.4	+	5	1272_1273	c.1272_1273insC	c.(1273-1275)ccafs	p.P425fs		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CCAGGGCCCCACCACCAGCCAC	0.639																																						.											0																																										SO:0001589	frameshift_variant	342346				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.1274dupC	16.37:g.4625755_4625755dupC	ENSP00000415027:p.Pro425fs			Frame_Shift_Ins	INS	ENST00000444310.4	37	CCDS53986.1																																																																																				0.639	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
CNTD2	79935	broad.mit.edu	37	19	40730638	40730639	+	Frame_Shift_Ins	INS	-	-	C	rs199816045		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr19:40730638_40730639insC	ENST00000430325.2	-	2	395_396	c.347_348insG	c.(346-348)gtcfs	p.V116fs	CNTD2_ENST00000513948.1_Frame_Shift_Ins_p.V10fs|CNTD2_ENST00000433940.1_Intron	NM_024877.3	NP_079153.2	Q9H8S5	CNTD2_HUMAN	cyclin N-terminal domain containing 2	116	Cyclin N-terminal.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					lung(1)|prostate(1)	2						CGTGCACCTGGACCAGCCAGTC	0.698																																						.											0																																										SO:0001589	frameshift_variant	79935			AK023327	CCDS12551.1, CCDS12551.2	19q13.2	2014-07-03				ENSG00000105219			25805	protein-coding gene	gene with protein product	"""cyclin P"""					11237006	Standard	NM_024877		Approved	FLJ13265, CCNP	uc010xvi.2	Q9H8S5		ENST00000430325.2:c.347_348insG	19.37:g.40730638_40730639insC	ENSP00000396755:p.Val116fs		B4DX65	Frame_Shift_Ins	INS	ENST00000430325.2	37	CCDS12551.2																																																																																				0.698	CNTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360785.1	NM_024877	
CBWD2	150472	broad.mit.edu	37	2	114201378	114201379	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr2:114201378_114201379insG	ENST00000259199.4	+	3	454_455	c.276_277insG	c.(277-279)ggtfs	p.G93fs	CBWD2_ENST00000416503.2_Frame_Shift_Ins_p.G93fs|CBWD2_ENST00000433343.2_Frame_Shift_Ins_p.G57fs	NM_172003.3	NP_742000.1	Q8IUF1	CBWD2_HUMAN	COBW domain containing 2	93							ATP binding (GO:0005524)			endometrium(1)|lung(1)	2						CTGTCAGCCAAGGTGGAGAGCT	0.421																																						.											0																																										SO:0001589	frameshift_variant	150472			AF452722	CCDS2116.1	2q14.1	2005-08-22			ENSG00000136682	ENSG00000136682			17907	protein-coding gene	gene with protein product		611079				12421752, 15233989	Standard	NM_172003		Approved		uc002tju.3	Q8IUF1	OTTHUMG00000131360	ENST00000259199.4:c.278dupG	2.37:g.114201380_114201380dupG	ENSP00000259199:p.Gly93fs		Q0VAN3	Frame_Shift_Ins	INS	ENST00000259199.4	37	CCDS2116.1																																																																																				0.421	CBWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254149.3	NM_172003	
FAM184B	27146	broad.mit.edu	37	4	17654576	17654577	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr4:17654576_17654577insG	ENST00000265018.3	-	11	2279_2280	c.2067_2068insC	c.(2065-2070)tccagcfs	p.S690fs		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	690										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						AGGCTGTGGCTGGATTCCTTCT	0.564																																						.											0																																										SO:0001589	frameshift_variant	27146				CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2068dupC	4.37:g.17654578_17654578dupG	ENSP00000265018:p.Ser690fs			Frame_Shift_Ins	INS	ENST00000265018.3	37	CCDS47033.1																																																																																				0.564	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
MAN1B1	11253	broad.mit.edu	37	9	139990718	139990719	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr9:139990718_139990719insC	ENST00000371589.4	+	4	568_569	c.495_496insC	c.(496-498)cctfs	p.P166fs	SNORD62_ENST00000362541.1_RNA|MAN1B1_ENST00000474902.1_5'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	166					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		AGCGGGGACCACCTCACCTGCA	0.574																																						.											0																																										SO:0001589	frameshift_variant	11253			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.497dupC	9.37:g.139990720_139990720dupC	ENSP00000360645:p.Pro166fs		Q5VSG3|Q9BRS9|Q9Y5K7	Frame_Shift_Ins	INS	ENST00000371589.4	37	CCDS7029.1																																																																																				0.574	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219	
C7orf50	84310	ucsc.edu;bcgsc.ca	37	7	1049662	1049662	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr7:1049662G>A	ENST00000397098.3	-	3	1173	c.247C>T	c.(247-249)Cgg>Tgg	p.R83W	C7orf50_ENST00000357429.6_Missense_Mutation_p.R83W|C7orf50_ENST00000488073.1_5'UTR|C7orf50_ENST00000397100.2_Missense_Mutation_p.R83W			Q9BRJ6	CG050_HUMAN	chromosome 7 open reading frame 50	83							poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		CCTGCCTCCCGCAGACGCTGC	0.682																																						.											0													56.0	49.0	51.0					7																	1049662		2198	4298	6496	SO:0001583	missense	84310			BC006224	CCDS5320.1	7p22.3	2011-11-25			ENSG00000146540	ENSG00000146540			22421	protein-coding gene	gene with protein product							Standard	NM_032350		Approved	MGC11257, YCR016W	uc011jvu.1	Q9BRJ6	OTTHUMG00000151477	ENST00000397098.3:c.247C>T	7.37:g.1049662G>A	ENSP00000380286:p.Arg83Trp			Missense_Mutation	SNP	ENST00000397098.3	37	CCDS5320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	10.32|10.32	1.316882|1.316882	0.23908|0.23908	.|.	.|.	ENSG00000146540|ENSG00000146540	ENST00000412051|ENST00000397100;ENST00000397098;ENST00000357429;ENST00000444428;ENST00000491163	.|.	.|.	.|.	3.65|3.65	0.353|0.353	0.16058|0.16058	.|.	.|0.075435	.|0.50627	.|D	.|0.000114	T|T	0.47619|0.47619	0.1455|0.1455	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	.|D	.|0.76494	.|0.999	.|P	.|0.60473	.|0.875	T|T	0.31779|0.31779	-0.9931|-0.9931	5|9	.|0.66056	.|D	.|0.02	-10.5968|-10.5968	7.3918|7.3918	0.26913|0.26913	0.0:0.1567:0.524:0.3193|0.0:0.1567:0.524:0.3193	.|.	.|83	.|Q9BRJ6	.|CG050_HUMAN	V|W	67|83;83;83;51;83	.|.	.|ENSP00000350011:R83W	A|R	-|-	2|1	0|2	C7orf50|C7orf50	1016188|1016188	0.000000|0.000000	0.05858|0.05858	0.076000|0.076000	0.20297|0.20297	0.104000|0.104000	0.19210|0.19210	-0.583000|-0.583000	0.05807|0.05807	0.297000|0.297000	0.22615|0.22615	0.457000|0.457000	0.33378|0.33378	GCG|CGG		0.682	C7orf50-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322817.3	NM_032350	
NRSN1	140767	ucsc.edu	37	6	24146152	24146152	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr6:24146152T>C	ENST00000378491.4	+	4	867	c.566T>C	c.(565-567)gTc>gCc	p.V189A		NM_080723.4	NP_542454.3			neurensin 1											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						GTTCAAAATGTCCAGCCTCTA	0.488																																						.											0													59.0	66.0	64.0					6																	24146152		2203	4300	6503	SO:0001583	missense	140767			AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.566T>C	6.37:g.24146152T>C	ENSP00000367752:p.Val189Ala			Missense_Mutation	SNP	ENST00000378491.4	37	CCDS4549.1	.	.	.	.	.	.	.	.	.	.	T	18.53	3.644350	0.67244	.	.	ENSG00000152954	ENST00000378491	T	0.22743	1.94	5.35	5.35	0.76521	.	0.116292	0.64402	D	0.000016	T	0.14657	0.0354	M	0.66939	2.045	0.80722	D	1	P	0.40534	0.72	B	0.35278	0.199	T	0.03555	-1.1025	10	0.87932	D	0	-15.1381	15.351	0.74384	0.0:0.0:0.0:1.0	.	189	Q8IZ57	NRSN1_HUMAN	A	189	ENSP00000367752:V189A	ENSP00000367752:V189A	V	+	2	0	NRSN1	24254131	1.000000	0.71417	0.998000	0.56505	0.921000	0.55340	7.451000	0.80668	2.027000	0.59764	0.528000	0.53228	GTC		0.488	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043866.1	NM_080723	
OTOP1	133060	ucsc.edu	37	4	4228424	4228425	+	Missense_Mutation	DNP	TT	TT	CC	rs78657691		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr4:4228424_4228425TT>CC	ENST00000296358.4	-	1	191_192	c.167_168AA>GG	c.(166-168)aAA>aGG	p.K56R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	56					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCTCGGCCAGTTTCTGTGGGAC	0.738																																						.											0																																										SO:0001583	missense	133060			BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.167_168delinsCC	4.37:g.4228424_4228425delinsCC	ENSP00000296358:p.Lys56Arg		A1L476	Missense_Mutation	DNP	ENST00000296358.4	37	CCDS3372.1																																																																																				0.738	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
PTCD2	79810	ucsc.edu	37	5	71638808	71638808	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr5:71638808T>C	ENST00000380639.5	+	8	789	c.773T>C	c.(772-774)gTg>gCg	p.V258A	PTCD2_ENST00000543322.1_3'UTR|PTCD2_ENST00000536805.1_Missense_Mutation_p.V86A|PTCD2_ENST00000503868.1_Missense_Mutation_p.V149A|PTCD2_ENST00000460837.2_3'UTR	NM_024754.3	NP_079030.3	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	258					kidney development (GO:0001822)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|muscle fiber development (GO:0048747)|regulation of mRNA processing (GO:0050684)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(1)|skin(1)	11		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		GCAAAAGCTGTGTCCATTTTT	0.318																																						.											0													81.0	77.0	78.0					5																	71638808		2203	4297	6500	SO:0001583	missense	79810			BC018720	CCDS4014.2, CCDS68891.1, CCDS68892.1, CCDS75258.1	5q13.2	2008-02-05			ENSG00000049883	ENSG00000049883			25734	protein-coding gene	gene with protein product		615484				12477932	Standard	XM_005248601		Approved	FLJ12598	uc003kcb.3	Q8WV60	OTTHUMG00000100953	ENST00000380639.5:c.773T>C	5.37:g.71638808T>C	ENSP00000370013:p.Val258Ala		B7Z5D0|B7Z8L7|E9PFV7|Q6IA65|Q9H9R0	Missense_Mutation	SNP	ENST00000380639.5	37	CCDS4014.2	.	.	.	.	.	.	.	.	.	.	T	0.453	-0.893057	0.02491	.	.	ENSG00000049883	ENST00000380639;ENST00000503868;ENST00000510676;ENST00000536805	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.47	-5.28	0.02755	.	1.923100	0.02223	N	0.064192	T	0.32010	0.0815	L	0.44542	1.39	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.15983	-1.0418	10	0.17832	T	0.49	.	8.9156	0.35579	0.0:0.5064:0.1812:0.3123	.	149;86;258	E9PFV7;B7Z8L7;Q8WV60	.;.;PTCD2_HUMAN	A	258;149;87;86	ENSP00000370013:V258A;ENSP00000427349:V149A;ENSP00000426295:V87A;ENSP00000444772:V86A	ENSP00000308948:V258A	V	+	2	0	PTCD2	71674564	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.552000	0.06020	-0.792000	0.04480	-0.334000	0.08254	GTG		0.318	PTCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218562.6	NM_024754	
TMEM201	199953	ucsc.edu	37	1	9673104	9673104	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr1:9673104T>C	ENST00000340381.6	+	11	1973	c.1964T>C	c.(1963-1965)cTg>cCg	p.L655P	TMEM201_ENST00000377376.4_Missense_Mutation_p.L631P	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	655					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GCCAACGCCCTGTTCACCTCG	0.652																																						.											0													86.0	95.0	92.0					1																	9673104		692	1591	2283	SO:0001583	missense	199953				CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.1964T>C	1.37:g.9673104T>C	ENSP00000344503:p.Leu655Pro		B9EH90|Q5SNT3	Missense_Mutation	SNP	ENST00000340381.6	37	CCDS44055.2	.	.	.	.	.	.	.	.	.	.	T	16.28	3.078081	0.55753	.	.	ENSG00000188807	ENST00000377376;ENST00000340381	.	.	.	5.27	5.27	0.74061	.	0.190024	0.34268	N	0.004108	T	0.46639	0.1403	L	0.32530	0.975	0.53005	D	0.99996	P	0.52842	0.956	P	0.44732	0.459	T	0.52756	-0.8533	9	0.87932	D	0	-26.1062	13.7563	0.62940	0.0:0.0:0.0:1.0	.	631	E9PBR6	.	P	631;655	.	ENSP00000344503:L655P	L	+	2	0	TMEM201	9595691	0.982000	0.34865	0.964000	0.40570	0.276000	0.26787	3.196000	0.51020	2.000000	0.58554	0.374000	0.22700	CTG		0.652	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127672.1	NM_001010866	
VPS37D	155382	ucsc.edu	37	7	73085354	73085354	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr7:73085354A>G	ENST00000324941.4	+	4	538	c.404A>G	c.(403-405)gAg>gGg	p.E135G	VPS37D_ENST00000451519.1_Missense_Mutation_p.E50G	NM_001077621.1	NP_001071089.1			vacuolar protein sorting 37 homolog D (S. cerevisiae)											central_nervous_system(1)|ovary(1)	2		Lung NSC(55;0.0908)|all_lung(88;0.198)				GAGCAGATGGAGCAGCTGCTG	0.687																																						.											0													27.0	30.0	29.0					7																	73085354		2041	4162	6203	SO:0001583	missense	155382			AY081952	CCDS43596.1	7q11.23	2007-07-27	2006-04-04	2005-08-18	ENSG00000176428	ENSG00000176428			18287	protein-coding gene	gene with protein product		610039	"""Williams Beuren syndrome chromosome region 24"", ""vacuolar protein sorting 37D (yeast)"""	WBSCR24		15218037	Standard	NM_001077621		Approved	MGC35352	uc003tyr.3	Q86XT2	OTTHUMG00000157227	ENST00000324941.4:c.404A>G	7.37:g.73085354A>G	ENSP00000320416:p.Glu135Gly			Missense_Mutation	SNP	ENST00000324941.4	37	CCDS43596.1	.	.	.	.	.	.	.	.	.	.	A	15.80	2.940897	0.52972	.	.	ENSG00000176428	ENST00000324941;ENST00000451519	T;T	0.80738	-1.41;-1.41	4.18	4.18	0.49190	Modifier of rudimentary, Modr (2);	0.084599	0.44285	D	0.000467	D	0.86661	0.5986	M	0.67397	2.05	0.45227	D	0.998237	D	0.76494	0.999	D	0.79108	0.992	D	0.87301	0.2305	10	0.87932	D	0	.	9.5294	0.39185	1.0:0.0:0.0:0.0	.	135	Q86XT2	VP37D_HUMAN	G	135;50	ENSP00000320416:E135G;ENSP00000413337:E50G	ENSP00000320416:E135G	E	+	2	0	VPS37D	72723290	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.238000	0.43070	1.743000	0.51761	0.459000	0.35465	GAG		0.687	VPS37D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348064.1	NM_152560	
CCDC74A	90557	mdanderson.org	37	2	132289349	132289349	+	Silent	SNP	A	A	G	rs147297526	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr2:132289349A>G	ENST00000295171.6	+	4	795	c.657A>G	c.(655-657)aaA>aaG	p.K219K	CCDC74A_ENST00000467992.2_Silent_p.K321K|CCDC74A_ENST00000409856.3_Silent_p.K153K	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	219										endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						AGCTGGACAAAGTTCCTGGGG	0.587													N|||	815	0.16274	0.0393	0.1326	5008	,	,		12824	0.505		0.0815	False		,,,				2504	0.0818					.											0													101.0	110.0	107.0					2																	132289349		2071	4188	6259	SO:0001819	synonymous_variant	90557				CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.657A>G	2.37:g.132289349A>G			Q6P4I5	Silent	SNP	ENST00000295171.6	37	CCDS2167.1																																																																																				0.587	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2	NM_138770	
YBX3	8531	mdanderson.org	37	12	10875488	10875488	+	Missense_Mutation	SNP	T	T	C	rs1126501	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr12:10875488T>C	ENST00000228251.4	-	1	423	c.223A>G	c.(223-225)Acc>Gcc	p.T75A	YBX3_ENST00000279550.7_Missense_Mutation_p.T75A	NM_003651.4	NP_003642.3	P16989	YBOX3_HUMAN	Y box binding protein 3	75			T -> A (in dbSNP:rs1126501). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2977358, ECO:0000269|PubMed:7628487}.		3'-UTR-mediated mRNA stabilization (GO:0070935)|cellular hyperosmotic response (GO:0071474)|cellular response to tumor necrosis factor (GO:0071356)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of necroptotic process (GO:0060546)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoplasmic translation (GO:2000767)|positive regulation of organ growth (GO:0046622)|response to cold (GO:0009409)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|tight junction (GO:0005923)	double-stranded DNA binding (GO:0003690)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|Rho GTPase binding (GO:0017048)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)										Ccggcggcggtggctaaagag	0.776													T|||	1419	0.283347	0.1445	0.2824	5008	,	,		8539	0.5069		0.1779	False		,,,				2504	0.3497					.											0								T	ALA/THR,ALA/THR	475,3499		27,421,1539	5.0	5.0	5.0		223,223	-2.8	0.2	12	dbSNP_86	5	980,6780		49,882,2949	yes	missense,missense	CSDA	NM_003651.4,NM_001145426.1	58,58	76,1303,4488	CC,CT,TT		12.6289,11.9527,12.3999	benign,benign	75/373,75/304	10875488	1455,10279	1987	3880	5867	SO:0001583	missense	8531			L29064	CCDS8630.1, CCDS44831.1	12p13.1	2013-03-13	2013-03-13	2013-03-13	ENSG00000060138	ENSG00000060138			2428	protein-coding gene	gene with protein product	"""cold-shock domain containing A1"""	603437	"""cold shock domain protein A"""	CSDA		2977358, 8710501	Standard	NM_003651		Approved	dbpA, ZONAB, CSDA1	uc001qyt.3	P16989	OTTHUMG00000168409	ENST00000228251.4:c.223A>G	12.37:g.10875488T>C	ENSP00000228251:p.Thr75Ala		B2RBW6|Q14121|Q969N6|Q96B76	Missense_Mutation	SNP	ENST00000228251.4	37	CCDS8630.1	603	0.2760989010989011	81	0.16463414634146342	114	0.3149171270718232	280	0.48951048951048953	128	0.16886543535620052	T	3.109	-0.183165	0.06340	0.119527	0.126289	ENSG00000060138	ENST00000279550;ENST00000228251	T;T	0.20881	2.04;2.09	1.88	-2.83	0.05769	.	0.173369	0.26439	N	0.024375	T	0.00012	0.0000	N	0.01705	-0.755	0.51767	P	6.700000000003925E-5	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32877	-0.9890	9	0.08179	T	0.78	.	3.6567	0.08223	0.0:0.1732:0.4872:0.3397	rs1126501;rs3181559;rs11538063;rs17850397;rs17851939;rs17856315	75;75	P16989-2;P16989	.;DBPA_HUMAN	A	75	ENSP00000279550:T75A;ENSP00000228251:T75A	ENSP00000228251:T75A	T	-	1	0	CSDA	10766755	0.976000	0.34144	0.193000	0.23327	0.876000	0.50452	-0.117000	0.10708	-0.712000	0.04988	0.260000	0.18958	ACC		0.776	YBX3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399628.1	NM_003651	
EPN3	55040	mdanderson.org	37	17	48619290	48619290	+	Silent	SNP	G	G	A	rs112657244	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr17:48619290G>A	ENST00000268933.3	+	10	2250	c.1671G>A	c.(1669-1671)ccG>ccA	p.P557P	EPN3_ENST00000537145.1_Silent_p.P585P|EPN3_ENST00000541226.1_3'UTR	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	557	3 X 3 AA repeats of N-P-F.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CCGGCTCGCCGGCGCTGGGCC	0.726													G|||	195	0.0389377	0.0038	0.0418	5008	,	,		9711	0.0188		0.0984	False		,,,				2504	0.044					.											0								G		91,4245		4,83,2081	9.0	12.0	11.0		1671	-9.4	0.0	17	dbSNP_132	11	770,7712		27,716,3498	no	coding-synonymous	EPN3	NM_017957.2		31,799,5579	AA,AG,GG		9.078,2.0987,6.7171		557/633	48619290	861,11957	2168	4241	6409	SO:0001819	synonymous_variant	55040			AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.1671G>A	17.37:g.48619290G>A			A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	ENST00000268933.3	37	CCDS11570.1																																																																																				0.726	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
GRID2IP	392862	mdanderson.org	37	7	6566322	6566322	+	Silent	SNP	T	T	G	rs2881723	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr7:6566322T>G	ENST00000457091.2	-	3	662	c.663A>C	c.(661-663)gcA>gcC	p.A221A	GRID2IP_ENST00000435185.1_Silent_p.A38A|GRID2IP_ENST00000452113.1_Silent_p.A31A	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	221					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GGGCCCGGCGTGCGCGGCACA	0.766													G|||	3612	0.721246	0.8321	0.8228	5008	,	,		7615	0.4206		0.8887	False		,,,				2504	0.637					.											0													1.0	2.0	2.0					7																	6566322		355	954	1309	SO:0001819	synonymous_variant	392862				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.663A>C	7.37:g.6566322T>G				Silent	SNP	ENST00000457091.2	37	CCDS47537.1																																																																																				0.766	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340534.1	XM_294249	
HLA-A	3105	mdanderson.org	37	6	29910801	29910801	+	Missense_Mutation	SNP	C	C	A	rs1136692	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr6:29910801C>A	ENST00000396634.1	+	4	682	c.341C>A	c.(340-342)gCc>gAc	p.A114D	HLA-A_ENST00000376806.5_Missense_Mutation_p.A114D|HLA-A_ENST00000376809.5_Missense_Mutation_p.A114D|HLA-A_ENST00000376802.2_Missense_Mutation_p.A114D			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	114	Alpha-1.		A -> D (in allele A*31:03).		antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CAGAGCGAGGCCGGTGAGTGA	0.682									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			a|||	1484	0.296326	0.2413	0.1744	5008	,	,		10398	0.3929		0.2475	False		,,,				2504	0.408					.											0								A	ASP/ALA	802,3598		84,634,1482	40.0	43.0	42.0		341	-6.5	0.0	6	dbSNP_131	42	2513,6069		461,1591,2239	no	missense	HLA-A	NM_002116.7	126	545,2225,3721	AA,AC,CC		29.2822,18.2273,25.5354	benign	114/366	29910801	3315,9667	2200	4291	6491	SO:0001583	missense	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.341C>A	6.37:g.29910801C>A	ENSP00000379873:p.Ala114Asp		O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	514	0.23534798534798534	95	0.19308943089430894	51	0.1408839779005525	175	0.30594405594405594	193	0.2546174142480211	.	7.188	0.590993	0.13812	0.182273	0.292822	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00009	9.49;9.49;9.49;9.49	3.57	-6.48	0.01896	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	.	.	.	.	T	0.00039	0.0001	M	0.73319	2.225	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.0;0.0;0.0	T	0.14783	-1.0460	8	0.37606	T	0.19	.	7.6397	0.28286	0.3552:0.3375:0.3073:0.0	rs1136692;rs2231013;rs2308561;rs3177886;rs3179185;rs12721825;rs17433758;rs41557214	114;114;114;114	Q5SRN7;P16188;Q5SRN5;P04439	.;1A30_HUMAN;.;1A03_HUMAN	D	114	ENSP00000379873:A114D;ENSP00000366002:A114D;ENSP00000366005:A114D;ENSP00000365998:A114D	ENSP00000348012:A114D	A	+	2	0	HLA-A	30018780	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	-1.881000	0.01626	-1.395000	0.02074	-4.609000	0.00004	GCC		0.682	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
HLA-B	3106	mdanderson.org	37	6	31324595	31324595	+	Silent	SNP	C	C	G	rs1050543|rs281864598	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr6:31324595C>G	ENST00000412585.2	-	2	241	c.213G>C	c.(211-213)ccG>ccC	p.P71P		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	71	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						ACGGCGCCCGCGGCTCCTCTC	0.672									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				.|||	2476	0.494409	0.4902	0.4539	5008	,	,		8006	0.5417		0.3718	False		,,,				2504	0.6063					.											0								C		1038,3194		276,486,1354	35.0	35.0	35.0		213	0.2	0.6	6	dbSNP_134	35	1583,6613		422,739,2937	no	coding-synonymous	HLA-B	NM_005514.6		698,1225,4291	GG,GC,CC		19.3143,24.5274,21.0895		71/363	31324595	2621,9807	2116	4098	6214	SO:0001819	synonymous_variant	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.213G>C	6.37:g.31324595C>G			Q29764	Silent	SNP	ENST00000412585.2	37	CCDS34394.1																																																																																				0.672	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HOXC9	3225	mdanderson.org	37	12	54394497	54394497	+	Silent	SNP	C	C	T	rs2241820	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr12:54394497C>T	ENST00000303450.4	+	1	595	c.525C>T	c.(523-525)gcC>gcT	p.A175A	HOXC-AS1_ENST00000512427.1_RNA|HOXC9_ENST00000504557.1_Intron|HOXC-AS1_ENST00000505700.1_RNA|HOXC9_ENST00000508190.1_Silent_p.A175A|RP11-834C11.12_ENST00000513209.1_Intron	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	175					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						AGGAGAAGGCCGACCTGGACC	0.692													C|||	2895	0.578075	0.4667	0.5346	5008	,	,		12030	0.7609		0.6014	False		,,,				2504	0.547					.											0								C		1809,1381		539,731,325	6.0	7.0	7.0		525	1.1	1.0	12	dbSNP_98	7	4221,2551		1360,1501,525	no	coding-synonymous	HOXC9	NM_006897.1		1899,2232,850	TT,TC,CC		37.6698,43.2915,39.47		175/261	54394497	6030,3932	1595	3386	4981	SO:0001819	synonymous_variant	3225				CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.525C>T	12.37:g.54394497C>T			B2RCN7|Q9H1I0	Silent	SNP	ENST00000303450.4	37	CCDS8869.1																																																																																				0.692	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1		
HS6ST1	9394	mdanderson.org	37	2	129025928	129025928	+	Silent	SNP	G	G	A	rs200330310	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr2:129025928G>A	ENST00000259241.6	-	2	1057	c.1044C>T	c.(1042-1044)taC>taT	p.Y348Y		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	348					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		TGGCGTAGTCGTACAGCTGCA	0.642																																						.											0													76.0	81.0	79.0					2																	129025928		2180	4286	6466	SO:0001819	synonymous_variant	9394			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.1044C>T	2.37:g.129025928G>A			B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Silent	SNP	ENST00000259241.6	37	CCDS42748.1																																																																																				0.642	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331572.1	NM_004807	
HSP90AB1	3326	mdanderson.org	37	6	44221262	44221262	+	Missense_Mutation	SNP	A	A	G	rs201760495	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr6:44221262A>G	ENST00000371554.1	+	12	2316	c.2102A>G	c.(2101-2103)aAt>aGt	p.N701S	HSP90AB1_ENST00000371646.5_Missense_Mutation_p.N701S|HSP90AB1_ENST00000353801.3_Missense_Mutation_p.N701S|SLC35B2_ENST00000495706.1_5'Flank|MIR4647_ENST00000583964.1_RNA			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	701					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GAGGAACCCAATGCTGCAGTT	0.453											OREG0017471	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													75.0	76.0	76.0					6																	44221262		2203	4300	6503	SO:0001583	missense	3326			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.2102A>G	6.37:g.44221262A>G	ENSP00000360609:p.Asn701Ser	922	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	ENST00000371554.1	37	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	G	3.876	-0.026861	0.07589	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.08807	3.05;3.05;3.05	3.91	3.91	0.45181	.	0.272984	0.27901	N	0.017393	T	0.00580	0.0019	N	0.01109	-1.01	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.47749	-0.9093	10	0.02654	T	1	-8.621	7.7636	0.28968	0.0881:0.2939:0.618:0.0	.	663;691;701	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	S	701	ENSP00000360709:N701S;ENSP00000325875:N701S;ENSP00000360609:N701S	ENSP00000325875:N701S	N	+	2	0	HSP90AB1	44329240	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	2.913000	0.48790	1.010000	0.39314	-0.166000	0.13349	AAT		0.453	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
LILRB3	11025	mdanderson.org	37	19	54724407	54724407	+	Missense_Mutation	SNP	C	C	T	rs1132608	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr19:54724407C>T	ENST00000391750.1	-	7	1385	c.1249G>A	c.(1249-1251)Gtg>Atg	p.V417M	LILRA6_ENST00000270464.5_Missense_Mutation_p.V417M|LILRB3_ENST00000469273.1_5'UTR|LILRB3_ENST00000346401.6_Missense_Mutation_p.V417M|LILRB3_ENST00000424807.1_Missense_Mutation_p.V417M|LILRB3_ENST00000245620.9_Missense_Mutation_p.V417M|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000440558.2_Missense_Mutation_p.V417M|LILRB3_ENST00000407860.2_Missense_Mutation_p.V417M			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	417	Ig-like C2-type 4.			V -> M (in Ref. 1; AAB68668). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTGAGACCACGAGCTCCAGG	0.662													.|||	1775	0.354433	0.1573	0.3213	5008	,	,		7150	0.3919		0.4056	False		,,,				2504	0.5532					.											0													22.0	12.0	16.0					19																	54724407		2016	2580	4596	SO:0001583	missense	11025			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1249G>A	19.37:g.54724407C>T	ENSP00000375630:p.Val417Met		C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	ENST00000391750.1	37	CCDS33105.1	1066	0.4880952380952381	88	0.17886178861788618	202	0.5580110497237569	349	0.6101398601398601	427	0.5633245382585752	T	5.640	0.302776	0.10678	.	.	ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000244482;ENSG00000244482	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000440558;ENST00000270464	T;T;T;T;T;T;T	0.00848	5.62;5.62;5.62;5.62;5.62;5.62;5.62	2.88	-5.77	0.02369	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	4.499180	0.01074	N	0.004874	T	0.00012	0.0000	L	0.53671	1.685	0.80722	P	0.0	B;B;B;P;P;B	0.51147	0.134;0.21;0.362;0.942;0.496;0.426	B;B;B;B;B;B	0.43680	0.063;0.058;0.177;0.427;0.081;0.086	T	0.41088	-0.9528	9	0.33940	T	0.23	.	6.447	0.21882	0.0:0.2001:0.3624:0.4374	rs1132608;rs2261471;rs58860234	417;417;417;417;417;417	B5MCX0;F8WCY4;F8W6G6;O75022-2;O75022;O75022-3	.;.;.;.;LIRB3_HUMAN;.	M	417	ENSP00000375630:V417M;ENSP00000412771:V417M;ENSP00000345184:V417M;ENSP00000245620:V417M;ENSP00000384274:V417M;ENSP00000390120:V417M;ENSP00000270464:V417M	ENSP00000270464:V417M	V	-	1	0	LILRB3;LILRA6	59416219	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.372000	0.00244	-2.411000	0.00571	-2.477000	0.00200	GTG		0.662	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
LILRB3	11025	mdanderson.org	37	19	54724411	54724411	+	Silent	SNP	C	C	T	rs1132607	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr19:54724411C>T	ENST00000391750.1	-	7	1381	c.1245G>A	c.(1243-1245)gaG>gaA	p.E415E	LILRA6_ENST00000270464.5_Silent_p.E415E|LILRB3_ENST00000469273.1_5'UTR|LILRB3_ENST00000346401.6_Silent_p.E415E|LILRB3_ENST00000424807.1_Silent_p.E415E|LILRB3_ENST00000245620.9_Silent_p.E415E|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000440558.2_Silent_p.E415E|LILRB3_ENST00000407860.2_Silent_p.E415E			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	415	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGACCACGAGCTCCAGGGGCT	0.657													.|||	1334	0.266374	0.1536	0.2536	5008	,	,		6892	0.378		0.3091	False		,,,				2504	0.2689					.											0													21.0	13.0	17.0					19																	54724411		1977	2343	4320	SO:0001819	synonymous_variant	11025			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1245G>A	19.37:g.54724411C>T			C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																				0.657	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
MAGEC1	9947	mdanderson.org	37	X	140994010	140994010	+	Missense_Mutation	SNP	C	C	T	rs146798989		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chrX:140994010C>T	ENST00000285879.4	+	4	1106	c.820C>T	c.(820-822)Ccc>Tcc	p.P274S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	274				P -> R (in Ref. 1 and 2). {ECO:0000305}.						breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTGTGAGCCCCTCCTTCTC	0.483										HNSCC(15;0.026)			-|||	3	0.000794702	0.0015	0.0	3775	,	,		12386	0.0		0.0	False		,,,				2504	0.001					.											0													88.0	74.0	79.0					X																	140994010		2131	3945	6076	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.820C>T	X.37:g.140994010C>T	ENSP00000285879:p.Pro274Ser		A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	80	0.04822182037371911	22	0.045081967213114756	24	0.06741573033707865	15	0.026501766784452298	26	0.03430079155672823	t	0.006	-2.096041	0.00364	.	.	ENSG00000155495	ENST00000285879;ENST00000370511;ENST00000370510	T;T	0.10573	4.35;2.86	.	.	.	.	.	.	.	.	T	0.00241	0.0007	N	0.08118	0	0.09310	N	1	P	0.36222	0.544	B	0.23150	0.044	T	0.34850	-0.9812	7	0.06757	T	0.87	.	.	.	.	rs57859161	274	O60732	MAGC1_HUMAN	S	274;76;75	ENSP00000285879:P274S;ENSP00000359542:P76S	ENSP00000285879:P274S	P	+	1	0	MAGEC1	140821676	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-4.502000	0.00224	-1.665000	0.01477	-1.695000	0.00724	CCC		0.483	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MUC4	4585	mdanderson.org	37	3	195509641	195509641	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr3:195509641A>G	ENST00000463781.3	-	2	9269	c.8810T>C	c.(8809-8811)gTa>gCa	p.V2937A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V2937A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAAG	0.577																																						.											0													9.0	7.0	8.0					3																	195509641		662	1515	2177	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8810T>C	3.37:g.195509641A>G	ENSP00000417498:p.Val2937Ala		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	0.183	-1.060413	0.01950	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.44;1.43	.	.	.	.	.	.	.	.	T	0.12817	0.0311	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.21546	0.035	T	0.34229	-0.9837	7	.	.	.	.	4.1164	0.10083	0.657:0.3429:0.0:0.0	rs28414759	2809	E7ESK3	.	A	2937	ENSP00000417498:V2937A;ENSP00000420243:V2937A	.	V	-	2	0	MUC4	196994420	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.919000	0.00694	-0.000000	0.14550	0.000000	0.15137	GTA		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NPHS2	7827	mdanderson.org	37	1	179544941	179544941	+	Missense_Mutation	SNP	G	G	A	rs74315344	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr1:179544941G>A	ENST00000367615.4	-	1	127	c.59C>T	c.(58-60)cCg>cTg	p.P20L	RNU5F-2P_ENST00000516066.1_RNA|NPHS2_ENST00000367616.4_Missense_Mutation_p.P20L	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	20			P -> L (in dbSNP:rs74315344). {ECO:0000269|PubMed:10742096}.		actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						CTCCTTGTGCGGAGTCCTGCC	0.761													G|||	16	0.00319489	0.0061	0.0014	5008	,	,		9986	0.001		0.0	False		,,,				2504	0.0061					.											0			GRCh37	CM000579	NPHS2	M	rs74315344	G	LEU/PRO	16,3402		0,16,1693	3.0	4.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	59	2.8	0.0	1	dbSNP_131	3	14,7402		0,14,3694	yes	missense	NPHS2	NM_014625.2	98	0,30,5387	AA,AG,GG		0.1888,0.4681,0.2769	benign	20/384	179544941	30,10804	1709	3708	5417	SO:0001583	missense	7827			AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.59C>T	1.37:g.179544941G>A	ENSP00000356587:p.Pro20Leu		B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	ENST00000367615.4	37	CCDS1331.1	3	0.0013736263736263737	1	0.0020325203252032522	1	0.0027624309392265192	1	0.0017482517482517483	0	0.0	G	13.54	2.268734	0.40095	0.004681	0.001888	ENSG00000116218	ENST00000367615;ENST00000367616	D;D	0.99656	-6.31;-6.31	3.85	2.83	0.33086	.	1.497510	0.04248	U	0.338137	D	0.97854	0.9295	N	0.24115	0.695	0.09310	A	2.44025e-07	B;B	0.30193	0.272;0.098	B;B	0.19666	0.026;0.012	D	0.99312	1.0904	9	0.56958	D	0.05	-0.5397	8.0545	0.30598	0.0:0.0:0.7583:0.2417	.	20;20	Q9NP85-2;Q9NP85	.;PODO_HUMAN	L	20	ENSP00000356587:P20L;ENSP00000356588:P20L	ENSP00000356587:P20L	P	-	2	0	NPHS2	177811564	0.011000	0.17503	0.002000	0.10522	0.051000	0.14879	1.779000	0.38624	1.857000	0.53885	0.313000	0.20887	CCG		0.761	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085283.1		
OR1S2	219958	mdanderson.org	37	11	57970980	57970980	+	Missense_Mutation	SNP	A	A	G	rs34249289|rs11229277	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr11:57970980A>G	ENST00000302592.6	-	1	673	c.674T>C	c.(673-675)gTa>gCa	p.V225A		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	225			V -> A (in dbSNP:rs11229277).|V -> I (in dbSNP:rs11229278).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				GAAGATGAGTACAAAGGGGAA	0.458													a|||	423	0.0844649	0.0257	0.1138	5008	,	,		23120	0.0536		0.1083	False		,,,				2504	0.1503					.											0													164.0	137.0	146.0					11																	57970980		2201	4296	6497	SO:0001583	missense	219958			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.674T>C	11.37:g.57970980A>G	ENSP00000305469:p.Val225Ala		Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	109	0.04990842490842491	13	0.026422764227642278	27	0.07458563535911603	19	0.033216783216783216	50	0.06596306068601583	a	5.168	0.216627	0.09810	.	.	ENSG00000197887	ENST00000302592	T	0.38240	1.15	4.75	-0.698	0.11280	GPCR, rhodopsin-like superfamily (1);	0.471664	0.17897	N	0.158338	T	0.01029	0.0034	N	0.17674	0.51	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30238	-0.9985	9	0.02654	T	1	.	5.3927	0.16253	0.337:0.3756:0.2875:0.0	rs11229277;rs52800241;rs11229277	225	Q8NGQ3	OR1S2_HUMAN	A	225	ENSP00000305469:V225A	ENSP00000305469:V225A	V	-	2	0	OR1S2	57727556	0.000000	0.05858	0.260000	0.24451	0.836000	0.47400	0.422000	0.21296	0.053000	0.16036	-0.866000	0.03004	GTA		0.458	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
OR2T33	391195	mdanderson.org	37	1	248436807	248436807	+	Missense_Mutation	SNP	T	T	A	rs377005013		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr1:248436807T>A	ENST00000318021.2	-	1	331	c.310A>T	c.(310-312)Aca>Tca	p.T104S		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCACCCAGTGTGGGGAGGAAG	0.587																																						.											0								T	SER/THR	0,4404		0,0,2202	41.0	42.0	42.0		310	1.4	0.0	1		42	3,8573		0,3,4285	no	missense	OR2T33	NM_001004695.1	58	0,3,6487	AA,AT,TT		0.035,0.0,0.0231	benign	104/321	248436807	3,12977	2202	4288	6490	SO:0001583	missense	391195				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.310A>T	1.37:g.248436807T>A	ENSP00000324687:p.Thr104Ser		B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	0.015	-1.560487	0.00910	0.0	3.5E-4	ENSG00000177212	ENST00000318021	T	0.00453	7.33	2.7	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36303	U	0.002677	T	0.00144	0.0004	N	0.10972	0.075	0.09310	N	1	P	0.35307	0.494	B	0.31191	0.125	T	0.34825	-0.9813	10	0.23891	T	0.37	.	3.7146	0.08433	0.5145:0.1202:0.0:0.3652	.	104	Q8NG76	O2T33_HUMAN	S	104	ENSP00000324687:T104S	ENSP00000324687:T104S	T	-	1	0	OR2T33	246503430	0.000000	0.05858	0.009000	0.14445	0.003000	0.03518	-1.540000	0.02200	0.124000	0.18369	0.404000	0.27445	ACA		0.587	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
OR4A5	81318	mdanderson.org	37	11	51412022	51412022	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr11:51412022C>G	ENST00000319760.6	-	1	426	c.374G>C	c.(373-375)tGt>tCt	p.C125S		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CAGTGGCTTACAGATGGCCAC	0.473																																						.											0													73.0	69.0	70.0					11																	51412022		2201	4294	6495	SO:0001583	missense	81318			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.374G>C	11.37:g.51412022C>G	ENSP00000367664:p.Cys125Ser		Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	10.99	1.507356	0.27036	.	.	ENSG00000221840	ENST00000319760	T	0.33438	1.41	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000083	T	0.40067	0.1102	M	0.89030	3	0.37900	D	0.931019	B	0.26195	0.144	B	0.30572	0.117	T	0.54970	-0.8213	10	0.72032	D	0.01	.	9.9079	0.41388	0.0:1.0:0.0:0.0	.	125	Q8NH83	OR4A5_HUMAN	S	125	ENSP00000367664:C125S	ENSP00000367664:C125S	C	-	2	0	OR4A5	51268598	1.000000	0.71417	1.000000	0.80357	0.443000	0.32047	4.721000	0.61951	1.394000	0.46624	0.162000	0.16502	TGT		0.473	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
OR4A16	81327	mdanderson.org	37	11	55111086	55111086	+	Missense_Mutation	SNP	T	T	A	rs78354885	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr11:55111086T>A	ENST00000314721.2	+	1	460	c.410T>A	c.(409-411)cTg>cAg	p.L137Q		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						ATGAATCGACTGGTTTGCATC	0.468																																						.											0													179.0	162.0	168.0					11																	55111086		2201	4296	6497	SO:0001583	missense	81327			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.410T>A	11.37:g.55111086T>A	ENSP00000325128:p.Leu137Gln		Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	a	0.003	-2.541719	0.00142	.	.	ENSG00000181961	ENST00000314721	T	0.37058	1.22	2.69	-1.28	0.09318	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.12732	0.0309	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.29701	-1.0003	9	0.07325	T	0.83	.	2.94	0.05826	0.5713:0.0:0.2415:0.1872	.	137	Q8NH70	O4A16_HUMAN	Q	137	ENSP00000325128:L137Q	ENSP00000325128:L137Q	L	+	2	0	OR4A16	54867662	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.859000	0.00727	-0.456000	0.07043	-2.168000	0.00324	CTG		0.468	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
PRSS3	5646	mdanderson.org	37	9	33796734	33796734	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr9:33796734C>A	ENST00000361005.5	+	2	305	c.305C>A	c.(304-306)tCc>tAc	p.S102Y	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000429677.3_Missense_Mutation_p.S38Y|PRSS3_ENST00000379405.3_Missense_Mutation_p.S45Y|PRSS3_ENST00000342836.4_Missense_Mutation_p.S59Y	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	102	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			AATTCTGGCTCCCACTTCTGC	0.557																																						.											0													137.0	141.0	140.0					9																	33796734		2203	4300	6503	SO:0001583	missense	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.305C>A	9.37:g.33796734C>A	ENSP00000354280:p.Ser102Tyr		A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.285213	0.00251	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59	3.21	2.03	0.26663	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.242652	0.43416	N	0.000563	T	0.79364	0.4433	L	0.42008	1.315	0.21579	N	0.999634	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.58612	-0.7606	10	0.02654	T	1	.	7.8678	0.29547	0.7856:0.2143:0.0:0.0	.	45;102;59	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	Y	102;57;59;38;45	ENSP00000354280:S102Y;ENSP00000401249:S57Y;ENSP00000340889:S59Y;ENSP00000401828:S38Y;ENSP00000368715:S45Y	ENSP00000340889:S59Y	S	+	2	0	PRSS3	33786734	1.000000	0.71417	0.925000	0.36789	0.028000	0.11728	4.228000	0.58619	0.284000	0.22305	-0.886000	0.02939	TCC		0.557	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
RLIM	51132	mdanderson.org	37	X	73811737	73811737	+	Silent	SNP	T	T	A	rs113198776		TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chrX:73811737T>A	ENST00000332687.6	-	4	1631	c.1413A>T	c.(1411-1413)tcA>tcT	p.S471S	RLIM_ENST00000349225.2_Silent_p.S471S	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	471	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						aactggaacttgaactggaac	0.478																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											0													38.0	38.0	38.0					X																	73811737		2203	4300	6503	SO:0001819	synonymous_variant	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1413A>T	X.37:g.73811737T>A			B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																				0.478	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RNF39	80352	mdanderson.org	37	6	30043171	30043171	+	Silent	SNP	G	G	C	rs9261304	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr6:30043171G>C	ENST00000244360.6	-	1	493	c.396C>G	c.(394-396)ccC>ccG	p.P132P	RNF39_ENST00000376751.3_Silent_p.P132P	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	132						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										GGCCGCAGCAGGGACAGGCGG	0.721													g|||	207	0.0413339	0.0499	0.0403	5008	,	,		11706	0.0357		0.0507	False		,,,				2504	0.0266				NSCLC(8;188 360 1520 20207 31481)	.											0								G	,	120,3262		0,120,1571	4.0	5.0	4.0		396,396	0.7	0.9	6	dbSNP_118	4	303,6971		5,293,3339	no	coding-synonymous,coding-synonymous	RNF39	NM_025236.3,NM_170769.2	,	5,413,4910	CC,CG,GG		4.1655,3.5482,3.9696	,	132/421,132/355	30043171	423,10233	1691	3637	5328	SO:0001819	synonymous_variant	80352			AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.396C>G	6.37:g.30043171G>C			A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Silent	SNP	ENST00000244360.6	37	CCDS4673.1																																																																																				0.721	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
WDR90	197335	mdanderson.org	37	16	705360	705360	+	Missense_Mutation	SNP	T	T	C	rs3803697	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr16:705360T>C	ENST00000293879.4	+	15	1610	c.1610T>C	c.(1609-1611)gTg>gCg	p.V537A	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Missense_Mutation_p.V537A			Q96KV7	WDR90_HUMAN	WD repeat domain 90	537			V -> A (in dbSNP:rs3803697). {ECO:0000269|PubMed:15489334}.							endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CGTGGCGGGGTGCTGCGTTCC	0.706													C|||	3489	0.696685	0.8744	0.5965	5008	,	,		15360	0.9841		0.3757	False		,,,				2504	0.5613					.											0								C	ALA/VAL	3355,989		1322,711,139	17.0	29.0	25.0		1610	-9.3	0.0	16	dbSNP_107	25	3028,5518		558,1912,1803	yes	missense	WDR90	NM_145294.4	64	1880,2623,1942	CC,CT,TT		35.4318,22.767,49.519	benign	537/1749	705360	6383,6507	2172	4273	6445	SO:0001583	missense	197335			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1610T>C	16.37:g.705360T>C	ENSP00000293879:p.Val537Ala		Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	1465	0.6707875457875457	417	0.8475609756097561	197	0.5441988950276243	562	0.9825174825174825	289	0.3812664907651715	C	0.015	-1.540982	0.00934	0.77233	0.354318	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.26067	1.8;1.76	4.67	-9.34	0.00636	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	1.118960	0.07045	N	0.830877	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.23261	-1.0193	9	0.07813	T	0.8	.	1.8074	0.03084	0.3135:0.1797:0.0853:0.4215	rs3803697	537;537;538;537	F8VUX9;Q96KV7;C9JMK1;Q96KV7-3	.;WDR90_HUMAN;.;.	A	537	ENSP00000448122:V537A;ENSP00000293879:V537A	ENSP00000293879:V537A	V	+	2	0	WDR90	645361	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.586000	0.05787	-3.437000	0.00163	-2.865000	0.00100	GTG		0.706	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
CHIT1	1118	bcgsc.ca	37	1	203186950	203186950	+	Nonsense_Mutation	SNP	C	C	T	rs201320385|rs3831317|rs150192398	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr1:203186950C>T	ENST00000367229.1	-	10	1107	c.1073G>A	c.(1072-1074)tGg>tAg	p.W358*	CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000255427.3_Nonsense_Mutation_p.W339*|CHIT1_ENST00000535569.1_Nonsense_Mutation_p.W349*	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	358					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GTCCAGTGCCCAGACCATGGC	0.632																																						.											0													60.0	52.0	54.0					1																	203186950		2203	4300	6503	SO:0001587	stop_gained	1118			U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1073G>A	1.37:g.203186950C>T	ENSP00000356198:p.Trp358*		B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Nonsense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918897	0.73098	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	.	.	.	4.57	4.57	0.56435	.	0.000000	0.42053	D	0.000776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7042	15.2284	0.73369	0.0:1.0:0.0:0.0	.	.	.	.	X	358;339;349	.	ENSP00000255427:W339X	W	-	2	0	CHIT1	201453573	1.000000	0.71417	0.432000	0.26747	0.080000	0.17528	6.938000	0.75904	2.238000	0.73509	0.563000	0.77884	TGG		0.632	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
GALNT4	8693	bcgsc.ca	37	12	89918149	89918149	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr12:89918149A>G	ENST00000529983.2	-	1	434	c.178T>C	c.(178-180)Tct>Cct	p.S60P	GALNT4_ENST00000413530.1_Intron|POC1B_ENST00000541909.1_Intron|POC1B_ENST00000393179.4_Intron|POC1B-GALNT4_ENST00000547474.1_Intron|RP11-734K2.4_ENST00000605233.1_RNA|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000313546.3_Intron|POC1B-GALNT4_ENST00000548729.1_Missense_Mutation_p.S57P|POC1B_ENST00000549035.1_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	60					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						AGCGGTCGAGACAAATCCTCC	0.562											OREG0022018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													65.0	69.0	68.0					12																	89918149		1846	4092	5938	SO:0001583	missense	100528030			Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.178T>C	12.37:g.89918149A>G	ENSP00000436604:p.Ser60Pro	1271	B2R775|B4DMX6|O00208	Missense_Mutation	SNP	ENST00000529983.2	37	CCDS53817.1	.	.	.	.	.	.	.	.	.	.	A	9.270	1.045405	0.19748	.	.	ENSG00000259075;ENSG00000257594	ENST00000548729;ENST00000529983	T;T	0.53857	0.6;0.6	5.77	4.57	0.56435	.	.	.	.	.	T	0.42200	0.1192	L	0.29908	0.895	0.29763	N	0.835364	P;P	0.41265	0.744;0.682	B;B	0.40825	0.341;0.116	T	0.33240	-0.9876	9	0.30854	T	0.27	.	11.7429	0.51803	0.7536:0.2464:0.0:0.0	.	57;60	F8VUJ3;Q8N4A0	.;GALT4_HUMAN	P	57;60	ENSP00000447852:S57P;ENSP00000436604:S60P	ENSP00000436604:S60P	S	-	1	0	GALNT4;RP11-1109F11.4	88442280	1.000000	0.71417	0.984000	0.44739	0.055000	0.15305	1.247000	0.32815	2.198000	0.70561	0.533000	0.62120	TCT		0.562	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774	
NOB1	28987	bcgsc.ca	37	16	69783533	69783533	+	Splice_Site	SNP	C	C	T			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr16:69783533C>T	ENST00000268802.5	-	4	357	c.328G>A	c.(328-330)Gtt>Att	p.V110I		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	110					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTCACCTTAACCTTTAAAAAA	0.413																																						.											0													62.0	59.0	60.0					16																	69783533		2198	4300	6498	SO:0001630	splice_region_variant	28987			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.328-1G>A	16.37:g.69783533C>T			Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Missense_Mutation	SNP	ENST00000268802.5	37	CCDS10884.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.549058	0.27652	.	.	ENSG00000141101	ENST00000268802	T	0.31247	1.5	4.61	4.61	0.57282	.	0.241768	0.41500	D	0.000871	T	0.22859	0.0552	N	0.25201	0.72	0.58432	D	0.999999	B	0.13594	0.008	B	0.17098	0.017	T	0.04495	-1.0947	9	.	.	.	.	17.5775	0.87955	0.0:1.0:0.0:0.0	.	110	Q9ULX3	NOB1_HUMAN	I	110	ENSP00000268802:V110I	.	V	-	1	0	NOB1	68341034	1.000000	0.71417	0.997000	0.53966	0.262000	0.26303	2.682000	0.46934	2.555000	0.86185	0.555000	0.69702	GTT		0.413	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268958.2	NM_014062	Missense_Mutation
MUC4	4585	bcgsc.ca	37	3	195511358	195511358	+	Missense_Mutation	SNP	C	C	G	rs77614482	byFrequency	TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr3:195511358C>G	ENST00000463781.3	-	2	7552	c.7093G>C	c.(7093-7095)Gac>Cac	p.D2365H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2365H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTCACCTGTGGAT	0.587																																						.											0													26.0	24.0	24.0					3																	195511358		689	1585	2274	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7093G>C	3.37:g.195511358C>G	ENSP00000417498:p.Asp2365His		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	2.131	-0.399179	0.04865	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.45668	0.89;0.99	.	.	.	.	.	.	.	.	T	0.18425	0.0442	N	0.19112	0.55	0.09310	N	1	B	0.31077	0.307	B	0.15870	0.014	T	0.13098	-1.0522	7	.	.	.	.	2.1447	0.03784	0.0:0.3304:0.3444:0.3251	.	2365	E7ESK3	.	H	2365	ENSP00000417498:D2365H;ENSP00000420243:D2365H	.	D	-	1	0	MUC4	196995753	0.000000	0.05858	0.002000	0.10522	0.113000	0.19764	-2.917000	0.00695	-0.417000	0.07461	0.064000	0.15345	GAC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ROS1	6098	bcgsc.ca	37	6	117718246	117718246	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chr6:117718246T>C	ENST00000368508.3	-	7	809	c.611A>G	c.(610-612)gAg>gGg	p.E204G	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.E213G	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	204	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ACTTGAGCTCTCAATATTCCT	0.403			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													90.0	90.0	90.0					6																	117718246		2203	4300	6503	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.611A>G	6.37:g.117718246T>C	ENSP00000357494:p.Glu204Gly		Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	14.63	2.592321	0.46214	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.58506	0.33;0.33	5.54	4.37	0.52481	.	0.341658	0.26808	N	0.022397	T	0.29850	0.0746	L	0.47716	1.5	0.24776	N	0.992846	P	0.34934	0.476	B	0.34873	0.191	T	0.06844	-1.0804	10	0.35671	T	0.21	.	7.8253	0.29311	0.0:0.1551:0.0:0.8449	.	204	P08922	ROS1_HUMAN	G	204;213	ENSP00000357494:E204G;ENSP00000357493:E213G	ENSP00000357493:E213G	E	-	2	0	ROS1	117824939	0.652000	0.27349	0.837000	0.33122	0.996000	0.88848	2.332000	0.43903	2.229000	0.72834	0.528000	0.53228	GAG		0.403	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
MT-ND1	4535	bcgsc.ca	37	M	4042	4042	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8405-01A-11D-2310-10	TCGA-KO-8405-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	6400c324-2c94-477d-acb9-669d4ea46f1e	43634c4d-e2ed-4b39-bac2-474388af50e5	g.chrM:4042A>G	ENST00000361390.2	+	1	736	c.736A>G	c.(736-738)Aca>Gca	p.T246A	MT-TW_ENST00000387382.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR2_ENST00000387347.2_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	246					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCCTAGGAACAACATATGACG	0.443																																						.											0																																										SO:0001583	missense	10625					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.736A>G	M.37:g.4042A>G	ENSP00000354687:p.Thr246Ala		C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	37																																																																																					0.443	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
