#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KLC2	64837	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	66033395	66033395	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:66033395G>A	ENST00000417856.1	+	13	1757	c.1514G>A	c.(1513-1515)cGc>cAc	p.R505H	KLC2_ENST00000421552.1_Missense_Mutation_p.R428H|KLC2_ENST00000394066.2_Missense_Mutation_p.R428H|KLC2_ENST00000394067.2_Missense_Mutation_p.R505H|RP11-867G23.2_ENST00000533287.1_RNA|KLC2_ENST00000394078.1_Intron|RAB1B_ENST00000311481.6_5'Flank|KLC2_ENST00000394065.2_Missense_Mutation_p.R366H|KLC2_ENST00000316924.5_Missense_Mutation_p.R505H|RP11-867G23.1_ENST00000530805.1_RNA|RAB1B_ENST00000527397.1_5'Flank	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	505					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						CGGGGAGACCGCCGCAGCAGC	0.662																																						.											0													23.0	29.0	27.0					11																	66033395		2182	4278	6460	SO:0001583	missense	64837			AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.1514G>A	11.37:g.66033395G>A	ENSP00000399403:p.Arg505His		A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Missense_Mutation	SNP	ENST00000417856.1	37	CCDS8130.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918644	0.33908	.	.	ENSG00000174996	ENST00000417856;ENST00000394067;ENST00000316924;ENST00000421552;ENST00000394066;ENST00000394065	T;T;T;T;T;D	0.84730	-1.23;-1.23;-1.23;-1.23;-1.23;-1.89	3.71	2.8	0.32819	.	0.000000	0.64402	D	0.000004	T	0.78666	0.4319	M	0.62723	1.935	0.37978	D	0.9335	B;B;B	0.25105	0.0;0.013;0.118	B;B;B	0.20955	0.001;0.001;0.032	T	0.69946	-0.5007	10	0.16420	T	0.52	-7.9387	7.7476	0.28877	0.2114:0.0:0.7886:0.0	.	366;428;505	A8MZ87;A8MXL7;Q9H0B6	.;.;KLC2_HUMAN	H	505;505;505;428;428;366	ENSP00000399403:R505H;ENSP00000377631:R505H;ENSP00000314837:R505H;ENSP00000408484:R428H;ENSP00000377630:R428H;ENSP00000377629:R366H	ENSP00000314837:R505H	R	+	2	0	KLC2	65789971	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	2.303000	0.43646	0.765000	0.33221	-0.424000	0.05967	CGC		0.662	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1	NM_022822	
NUDC	10726	hgsc.bcm.edu	37	1	27268032	27268033	+	In_Frame_Ins	INS	-	-	GGG	rs374895246		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr1:27268032_27268033insGGG	ENST00000321265.5	+	3	367_368	c.244_245insGGG	c.(244-246)cgg>cGGGgg	p.82_83insG		NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	82					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)				cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		GGCCGAGCGGCGGGAGAAGGCG	0.614																																						.											0																																										SO:0001652	inframe_insertion	10726				CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.245_247dupGGG	1.37:g.27268033_27268035dupGGG	ENSP00000319664:p.Arg82_Glu83insGly		Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	In_Frame_Ins	INS	ENST00000321265.5	37	CCDS292.1																																																																																				0.614	NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2		
PZP	5858	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	9315213	9315213	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:9315213C>A	ENST00000261336.2	-	22	2796	c.2768G>T	c.(2767-2769)aGt>aTt	p.S923I	PZP_ENST00000539983.1_5'UTR|PZP_ENST00000381997.2_Missense_Mutation_p.S709I	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	923					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GGTCATAGAACTGAAAGTCTT	0.393																																					Melanoma(125;1402 1695 4685 34487 38571)	.											0													151.0	134.0	140.0					12																	9315213		2203	4300	6503	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2768G>T	12.37:g.9315213C>A	ENSP00000261336:p.Ser923Ile		A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653628	0.47362	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.38240	2.2;1.15	2.83	1.66	0.24008	.	0.337611	0.23351	U	0.049128	T	0.33556	0.0867	M	0.76838	2.35	0.09310	N	0.999999	B;P	0.37158	0.001;0.585	B;B	0.34652	0.0;0.187	T	0.33650	-0.9860	10	0.87932	D	0	.	4.962	0.14070	0.0:0.467:0.0:0.533	.	709;923	P20742-2;P20742	.;PZP_HUMAN	I	923;709	ENSP00000261336:S923I;ENSP00000371427:S709I	ENSP00000261336:S923I	S	-	2	0	PZP	9206480	0.505000	0.26131	0.129000	0.21949	0.530000	0.34684	-0.084000	0.11268	0.501000	0.28013	-0.483000	0.04790	AGT		0.393	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
C16orf54	283897	hgsc.bcm.edu	37	16	29755786	29755787	+	Frame_Shift_Ins	INS	-	-	G	rs551608693		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr16:29755786_29755787insG	ENST00000329410.3	-	2	581_582	c.486_487insC	c.(484-489)cccgccfs	p.A163fs	AC009133.17_ENST00000565600.1_RNA	NM_175900.3	NP_787096.2	Q6UWD8	CP054_HUMAN	chromosome 16 open reading frame 54	163						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|lung(2)|prostate(1)|urinary_tract(1)	6						AGGCCTGTGGCGGGGGGCCTCC	0.718																																						.											0																																										SO:0001589	frameshift_variant	283897			AK093000	CCDS10652.1	16p11.2	2012-10-10		2005-08-09	ENSG00000185905	ENSG00000185905			26649	protein-coding gene	gene with protein product						12975309	Standard	NM_175900		Approved	FLJ35681	uc002dtp.2	Q6UWD8	OTTHUMG00000132116	ENST00000329410.3:c.487dupC	16.37:g.29755792_29755792dupG	ENSP00000327506:p.Ala163fs		A6NJR6|Q8NAB0	Frame_Shift_Ins	INS	ENST00000329410.3	37	CCDS10652.1																																																																																				0.718	C16orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255158.1	NM_175900	
PDCD2L	84306	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	34895578	34895578	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:34895578C>T	ENST00000246535.3	+	2	180	c.133C>T	c.(133-135)Ccc>Tcc	p.P45S	RP11-618P17.4_ENST00000606020.1_Missense_Mutation_p.P40S|PDCD2L_ENST00000587065.2_5'Flank	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	45					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CGTGGCTGCGCCCAGGCCCGT	0.692																																						.											0													22.0	23.0	23.0					19																	34895578		2199	4292	6491	SO:0001583	missense	84306			BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.133C>T	19.37:g.34895578C>T	ENSP00000246535:p.Pro45Ser			Missense_Mutation	SNP	ENST00000246535.3	37	CCDS12438.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996698	0.54147	.	.	ENSG00000126249	ENST00000246535	.	.	.	4.41	3.34	0.38264	.	0.264241	0.37393	N	0.002104	T	0.33381	0.0861	L	0.58969	1.84	0.09310	N	1	P	0.35272	0.493	B	0.29785	0.107	T	0.25222	-1.0138	9	0.46703	T	0.11	-16.4667	7.2931	0.26376	0.1937:0.6187:0.1876:0.0	.	45	Q9BRP1	PDD2L_HUMAN	S	45	.	ENSP00000246535:P45S	P	+	1	0	PDCD2L	39587418	0.000000	0.05858	0.032000	0.17829	0.849000	0.48306	0.577000	0.23758	1.007000	0.39238	0.313000	0.20887	CCC		0.692	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346	
NUMBL	9253	hgsc.bcm.edu	37	19	41173904	41173904	+	Silent	SNP	T	T	C	rs79658769		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:41173904T>C	ENST00000252891.4	-	10	1466	c.1299A>G	c.(1297-1299)caA>caG	p.Q433Q	NUMBL_ENST00000540131.1_Silent_p.Q392Q|NUMBL_ENST00000598779.1_Silent_p.Q392Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	433	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgttgctgttgctgctgct	0.662																																						.											0													8.0	8.0	8.0					19																	41173904		2119	4125	6244	SO:0001819	synonymous_variant	9253			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1299A>G	19.37:g.41173904T>C			Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																				0.662	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
PPP1R2	5504	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	195256683	195256683	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:195256683C>T	ENST00000328432.3	-	2	502	c.142G>A	c.(142-144)Gat>Aat	p.D48N		NM_006241.4	NP_006232.1	P41236	IPP2_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 2	48	Required for binding PPP1CC. {ECO:0000250}.				generation of precursor metabolites and energy (GO:0006091)|glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of signal transduction (GO:0009966)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)			endometrium(2)|kidney(1)|large_intestine(1)|urinary_tract(2)	6	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)		Epithelial(36;2.64e-22)|all cancers(36;2.69e-20)|OV - Ovarian serous cystadenocarcinoma(49;3.52e-19)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;9.55e-05)		TTCATTTCATCCCACTTCTGG	0.333																																						.											0													99.0	88.0	92.0					3																	195256683		2203	4300	6503	SO:0001583	missense	5504			U68111	CCDS3309.1	3q29	2012-04-17			ENSG00000184203	ENSG00000184203	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9288	protein-coding gene	gene with protein product		601792				9126490, 8119416	Standard	XM_006713682		Approved	IPP2	uc003fup.3	P41236	OTTHUMG00000155887	ENST00000328432.3:c.142G>A	3.37:g.195256683C>T	ENSP00000328178:p.Asp48Asn			Missense_Mutation	SNP	ENST00000328432.3	37	CCDS3309.1	.	.	.	.	.	.	.	.	.	.	C	33	5.269708	0.95429	.	.	ENSG00000184203	ENST00000328432;ENST00000438848	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.83644	0.5299	M	0.86097	2.795	0.80722	D	1	D;D	0.76494	0.988;0.999	P;D	0.69654	0.836;0.965	D	0.84595	0.0669	9	0.59425	D	0.04	.	18.1336	0.89610	0.0:1.0:0.0:0.0	.	48;48	E7EMN6;P41236	.;IPP2_HUMAN	N	48	.	ENSP00000328178:D48N	D	-	1	0	PPP1R2	196737972	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.183000	0.77697	2.880000	0.98712	0.650000	0.86243	GAT		0.333	PPP1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342133.1	NM_006241	
REV3L	5980	hgsc.bcm.edu	37	6	111665249	111665249	+	Intron	DEL	A	A	-			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr6:111665249delA	ENST00000358835.3	-	22	7874				REV3L_ENST00000368805.1_Intron|REV3L_ENST00000368802.3_Intron|REV3L_ENST00000435970.1_Intron			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit						DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AGAGCCACCTAAAAAAAAAGG	0.333								DNA polymerases (catalytic subunits)																														.											0										10,35,4217		0,0,10,0,35,2086	47.0	43.0	44.0			5.7	1.0	6		46	47,78,8129		0,0,47,0,78,4002	no	intron	REV3L	NM_002912.3		0,0,57,0,113,6088	A1A1,A1A2,A1R,A2A2,A2R,RR		1.5144,1.0558,1.3583			111665249	57,113,12346	2202	4300	6502	SO:0001627	intron_variant	5980			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7420-3T>-	6.37:g.111665249delA			O43214|Q5TC33	Splice_Site	DEL	ENST00000358835.3	37	CCDS5091.2																																																																																				0.333	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
KCNT1	57582	hgsc.bcm.edu	37	9	138678160	138678160	+	Missense_Mutation	SNP	C	C	T	rs200642629	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr9:138678160C>T	ENST00000263604.3	+	28	3217	c.3217C>T	c.(3217-3219)Ccc>Tcc	p.P1073S	KCNT1_ENST00000298480.5_Missense_Mutation_p.P1099S|KCNT1_ENST00000371757.2_Missense_Mutation_p.P1099S|KCNT1_ENST00000488444.2_Missense_Mutation_p.P1078S|KCNT1_ENST00000486577.2_Missense_Mutation_p.P1056S|KCNT1_ENST00000490355.2_Missense_Mutation_p.P1077S|KCNT1_ENST00000487664.1_Missense_Mutation_p.P1054S|KCNT1_ENST00000491806.2_Missense_Mutation_p.P1064S			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	1073					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CGGCGGTGACCCCGCAGAGCA	0.751													c|||	12	0.00239617	0.0008	0.0043	5008	,	,		9758	0.0		0.005	False		,,,				2504	0.0031					.											0									SER/PRO	5,3799		0,5,1897	5.0	8.0	7.0		3295	2.8	0.0	9		7	43,7487		0,43,3722	no	missense	KCNT1	NM_020822.2	74	0,48,5619	TT,TC,CC		0.571,0.1314,0.4235	benign	1099/1236	138678160	48,11286	1902	3765	5667	SO:0001583	missense	57582			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.3217C>T	9.37:g.138678160C>T	ENSP00000263604:p.Pro1073Ser		B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	C	2.688	-0.273722	0.05679	0.001314	0.00571	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.20200	2.12;2.12;2.11;2.09	4.75	2.83	0.33086	.	0.398942	0.25397	U	0.030971	T	0.07052	0.0179	N	0.14661	0.345	0.34754	D	0.732071	B;B;B	0.11235	0.001;0.0;0.004	B;B;B	0.16289	0.004;0.001;0.015	T	0.27226	-1.0080	10	0.08837	T	0.75	-1.9472	9.2418	0.37500	0.1443:0.7787:0.0:0.077	.	1066;1099;1054	C9JYL2;B9EGP2;G5E9V0	.;.;.	S	1054;1099;1099;1058;1066;1080;1078;1073	ENSP00000417851:P1054S;ENSP00000298480:P1099S;ENSP00000360822:P1099S;ENSP00000263604:P1073S	ENSP00000263604:P1073S	P	+	1	0	KCNT1	137817981	1.000000	0.71417	0.024000	0.17045	0.003000	0.03518	4.140000	0.58031	0.393000	0.25203	0.586000	0.80456	CCC		0.751	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
CARD9	64170	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	9	139262146	139262146	+	Silent	SNP	C	C	T	rs574560841	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr9:139262146C>T	ENST00000371732.5	-	8	1377	c.1212G>A	c.(1210-1212)gcG>gcA	p.A404A	CARD9_ENST00000460290.1_5'Flank|CARD9_ENST00000371734.3_Silent_p.A404A	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	404					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		CCAGTAGCTGCGCCTCACACT	0.726													C|||	2	0.000399361	0.0	0.0014	5008	,	,		16164	0.0		0.001	False		,,,				2504	0.0					.											0													33.0	29.0	30.0					9																	139262146		2185	4291	6476	SO:0001819	synonymous_variant	64170			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.1212G>A	9.37:g.139262146C>T			Q5SXM5|Q5SXM6|Q9H854	Silent	SNP	ENST00000371732.5	37	CCDS6997.1																																																																																				0.726	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055053.1	NM_052813	
SLC22A11	55867	hgsc.bcm.edu;mdanderson.org	37	11	64326666	64326666	+	Silent	SNP	C	C	T	rs145210367		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:64326666C>T	ENST00000301891.4	+	2	827	c.453C>T	c.(451-453)tcC>tcT	p.S151S	SLC22A11_ENST00000377585.3_Silent_p.S151S|SLC22A11_ENST00000377581.3_Silent_p.S151S|SLC22A11_ENST00000490834.1_Intron	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	151					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	TCTTCATGTCCGGGATCCTGG	0.607																																						.											0								C		0,4402		0,0,2201	136.0	121.0	126.0		453	-4.5	0.0	11	dbSNP_134	126	1,8593		0,1,4296	no	coding-synonymous	SLC22A11	NM_018484.2		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		151/551	64326666	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	55867			AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.453C>T	11.37:g.64326666C>T			A8K426|Q53GR2|Q6ZP72|Q8NBU4	Silent	SNP	ENST00000301891.4	37	CCDS8074.1																																																																																				0.607	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104886.4	NM_018484	
KRT40	125115	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	39140079	39140079	+	Splice_Site	SNP	C	C	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr17:39140079C>A	ENST00000398486.2	-	3	607	c.447G>T	c.(445-447)aaG>aaT	p.K149N	KRT40_ENST00000377755.4_Splice_Site_p.K149N	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	149	Coil 1B.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				GGACACAGACCTTTTGTTGGA	0.453																																						.											0													156.0	146.0	149.0					17																	39140079		2083	4229	6312	SO:0001630	splice_region_variant	125115			AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.447+1G>T	17.37:g.39140079C>A			Q6IFU5	Missense_Mutation	SNP	ENST00000398486.2	37	CCDS42320.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960620	0.53400	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	D;D	0.89270	-2.49;-2.49	4.77	4.77	0.60923	Filament (1);	0.000000	0.35349	N	0.003279	D	0.95357	0.8493	M	0.91090	3.175	0.44508	D	0.997452	D	0.89917	1.0	D	0.80764	0.994	D	0.95890	0.8906	9	.	.	.	.	15.4557	0.75311	0.0:1.0:0.0:0.0	.	149	Q6A162	K1C40_HUMAN	N	149	ENSP00000366984:K149N;ENSP00000381500:K149N	.	K	-	3	2	KRT40	36393605	1.000000	0.71417	1.000000	0.80357	0.280000	0.26924	5.511000	0.67024	2.634000	0.89283	0.591000	0.81541	AAG		0.453	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497	Missense_Mutation
MTHFD2	10797	hgsc.bcm.edu;bcgsc.ca	37	2	74438938	74438938	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr2:74438938A>T	ENST00000394053.2	+	7	914	c.834A>T	c.(832-834)agA>agT	p.R278S	MTHFD2_ENST00000409804.1_Missense_Mutation_p.R150S|MTHFD2_ENST00000264090.4_Missense_Mutation_p.R176S|MTHFD2_ENST00000409601.1_Intron|MTHFD2_ENST00000394050.3_Missense_Mutation_p.R114S|RP11-287D1.3_ENST00000451608.2_3'UTR	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	278					folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	GAATAAATAGAGTTCACGATC	0.353																																						.											0													81.0	76.0	78.0					2																	74438938		1889	4102	5991	SO:0001583	missense	10797			X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.834A>T	2.37:g.74438938A>T	ENSP00000377617:p.Arg278Ser		Q53G90|Q53GV5|Q53S36|Q7Z650	Missense_Mutation	SNP	ENST00000394053.2	37	CCDS1935.2	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531909	0.64972	.	.	ENSG00000065911	ENST00000394053;ENST00000409804;ENST00000264090;ENST00000394050	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	5.54	4.41	0.53225	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.69557	0.3124	M	0.78285	2.405	0.58432	D	0.999996	D	0.76494	0.999	D	0.70716	0.97	T	0.72663	-0.4225	10	0.72032	D	0.01	.	3.472	0.07570	0.6287:0.2366:0.1347:0.0	.	278	P13995	MTDC_HUMAN	S	278;150;176;114	ENSP00000377617:R278S;ENSP00000386536:R150S;ENSP00000264090:R176S;ENSP00000377614:R114S	ENSP00000264090:R176S	R	+	3	2	MTHFD2	74292446	0.990000	0.36364	0.988000	0.46212	0.819000	0.46315	0.550000	0.23345	2.096000	0.63516	0.529000	0.55759	AGA		0.353	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252045.2		
TOE1	114034	broad.mit.edu	37	1	45808598	45808598	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr1:45808598A>G	ENST00000372090.5	+	7	1419	c.836A>G	c.(835-837)gAc>gGc	p.D279G	MUTYH_ENST00000372100.5_5'Flank|MUTYH_ENST00000372098.3_5'Flank|MUTYH_ENST00000488731.2_5'Flank|MUTYH_ENST00000372115.3_5'Flank|MUTYH_ENST00000528013.2_5'Flank|TOE1_ENST00000495703.1_3'UTR|MUTYH_ENST00000372110.3_5'Flank|MUTYH_ENST00000531105.1_5'Flank|MUTYH_ENST00000456914.2_5'Flank|MUTYH_ENST00000448481.1_5'Flank|MUTYH_ENST00000355498.2_5'Flank|MUTYH_ENST00000528332.2_5'Flank|MUTYH_ENST00000354383.6_5'Flank|MUTYH_ENST00000450313.1_5'Flank|MUTYH_ENST00000372104.1_5'Flank|TOE1_ENST00000539779.1_Missense_Mutation_p.D199G|MUTYH_ENST00000529984.1_5'Flank|TESK2_ENST00000486676.1_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	279						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					AGCATGAGGGACCATATTGAT	0.572																																						.											0													71.0	76.0	74.0					1																	45808598		2203	4300	6503	SO:0001583	missense	114034				CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.836A>G	1.37:g.45808598A>G	ENSP00000361162:p.Asp279Gly		B4DEM6|Q6IA35|Q8IWN5|Q9H846	Missense_Mutation	SNP	ENST00000372090.5	37	CCDS521.1	.	.	.	.	.	.	.	.	.	.	A	7.504	0.653290	0.14580	.	.	ENSG00000132773	ENST00000372090;ENST00000539779	T;T	0.30714	1.52;1.53	5.61	2.55	0.30701	Ribonuclease H-like (1);	1.049460	0.07309	N	0.875532	T	0.17408	0.0418	N	0.04959	-0.14	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.29792	-1.0000	10	0.21014	T	0.42	0.2034	12.4584	0.55718	0.1157:0.508:0.3763:0.0	.	199;279	B4DEM6;Q96GM8	.;TOE1_HUMAN	G	279;199	ENSP00000361162:D279G;ENSP00000438900:D199G	ENSP00000361162:D279G	D	+	2	0	TOE1	45581185	0.000000	0.05858	0.739000	0.30968	0.953000	0.61014	-0.037000	0.12164	0.341000	0.23771	-0.168000	0.13345	GAC		0.572	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020517.1	NM_025077	
XCL1	6375	broad.mit.edu	37	1	168550330	168550330	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr1:168550330C>A	ENST00000367818.3	+	3	382	c.217C>A	c.(217-219)Caa>Aaa	p.Q73K		NM_002995.2	NP_002986.1	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	73					cell-cell signaling (GO:0007267)|cellular response to interleukin-4 (GO:0071353)|cellular response to transforming growth factor beta stimulus (GO:0071560)|immune response (GO:0006955)|mature natural killer cell chemotaxis (GO:0035782)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T-helper 1 cell activation (GO:2000518)|negative regulation of T-helper 1 type immune response (GO:0002826)|negative regulation of transcription, DNA-templated (GO:0045892)|neutrophil chemotaxis (GO:0030593)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000566)|positive regulation of granzyme A production (GO:2000513)|positive regulation of granzyme B production (GO:0071663)|positive regulation of immunoglobulin production in mucosal tissue (GO:2000558)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 cell cytokine production (GO:2000556)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of thymocyte migration (GO:2000412)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of inflammatory response (GO:0050727)|release of sequestered calcium ion into cytosol (GO:0051209)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|protein homodimerization activity (GO:0042803)			kidney(2)|lung(7)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.208)					TGCTGATCCACAAGCCACATG	0.483																																						.											0													196.0	180.0	185.0					1																	168550330		2203	4300	6503	SO:0001583	missense	6375			D43768	CCDS1274.1	1q24.2	2014-01-30	2002-08-22	2002-08-23	ENSG00000143184	ENSG00000143184		"""Endogenous ligands"""	10645	protein-coding gene	gene with protein product		600250	"""small inducible cytokine subfamily C, member 1 (lymphotactin)"""	LTN, SCYC1		7602097, 7875320	Standard	NM_002995		Approved	LPTN, ATAC, SCM-1a, SCM-1, lymphotactin	uc001gfo.2	P47992	OTTHUMG00000034548	ENST00000367818.3:c.217C>A	1.37:g.168550330C>A	ENSP00000356792:p.Gln73Lys		Q52MA8	Missense_Mutation	SNP	ENST00000367818.3	37	CCDS1274.1	.	.	.	.	.	.	.	.	.	.	C	7.368	0.626277	0.14257	.	.	ENSG00000143184	ENST00000367818	T	0.03951	3.75	4.83	-9.64	0.00541	Chemokine interleukin-8-like domain (3);	1.098330	0.06925	N	0.810057	T	0.00784	0.0026	N	0.12853	0.265	0.25698	N	0.985611	B	0.17268	0.021	B	0.15052	0.012	T	0.47341	-0.9125	9	0.06099	T	0.92	0.2196	19.3302	0.94283	0.0965:0.1385:0.765:0.0	.	73	P47992	XCL1_HUMAN	K	73	ENSP00000356792:Q73K	ENSP00000356792:Q73K	Q	+	1	0	XCL1	166816954	0.000000	0.05858	0.000000	0.03702	0.723000	0.41478	-1.260000	0.02858	-1.502000	0.01814	0.655000	0.94253	CAA		0.483	XCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083612.1	NM_002995	
MYRF	745	broad.mit.edu	37	11	61537797	61537797	+	Silent	SNP	A	A	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:61537797A>C	ENST00000278836.5	+	5	636	c.540A>C	c.(538-540)ccA>ccC	p.P180P	TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000265460.5_Silent_p.P171P	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	180	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ATCCGCCCCCACCTCCAGCCC	0.692																																						.											0													10.0	9.0	9.0					11																	61537797		2174	4280	6454	SO:0001819	synonymous_variant	745				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.540A>C	11.37:g.61537797A>C			O43582|Q9P1Q6	Silent	SNP	ENST00000278836.5	37	CCDS44622.1																																																																																				0.692	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398519.2	NM_013279	
CDK2AP2	10263	broad.mit.edu	37	11	67274865	67274865	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:67274865C>T	ENST00000301488.3	-	3	832	c.284G>A	c.(283-285)aGc>aAc	p.S95N	PITPNM1_ENST00000356404.3_5'Flank|PITPNM1_ENST00000436757.2_5'Flank|CDK2AP2_ENST00000531506.1_Missense_Mutation_p.S95N	NM_005851.3	NP_005842.1	O75956	CDKA2_HUMAN	cyclin-dependent kinase 2 associated protein 2	95										lung(1)	1						GGCGCTCTTGCTGCCAGCATA	0.597																																						.											0													63.0	64.0	64.0					11																	67274865		2200	4295	6495	SO:0001583	missense	10263			AF089814	CCDS8169.1	11q13	2010-05-17	2008-11-04		ENSG00000167797	ENSG00000167797			30833	protein-coding gene	gene with protein product	"""tumor suppressor deleted in oral cancer related 1"""		"""CDK2-associated protein 2"""			10082655	Standard	NM_005851		Approved	DOC-1R, p14	uc001oma.4	O75956		ENST00000301488.3:c.284G>A	11.37:g.67274865C>T	ENSP00000301488:p.Ser95Asn			Missense_Mutation	SNP	ENST00000301488.3	37	CCDS8169.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.950460	0.92660	.	.	ENSG00000167797	ENST00000301488;ENST00000531506	.	.	.	4.92	4.92	0.64577	.	0.293454	0.46145	D	0.000320	T	0.68933	0.3055	L	0.43923	1.385	0.80722	D	1	D;D	0.76494	0.999;0.991	D;D	0.83275	0.996;0.982	T	0.69091	-0.5237	9	0.49607	T	0.09	-22.2115	15.6517	0.77099	0.0:1.0:0.0:0.0	.	95;95	Q6IAV4;O75956	.;CDKA2_HUMAN	N	95	.	ENSP00000301488:S95N	S	-	2	0	CDK2AP2	67031441	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.239000	0.78182	2.553000	0.86117	0.561000	0.74099	AGC		0.597	CDK2AP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395535.1	NM_005851	
GNS	2799	broad.mit.edu	37	12	65152902	65152902	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:65152902A>G	ENST00000258145.3	-	1	325	c.155T>C	c.(154-156)cTc>cCc	p.L52P	RP11-629N8.3_ENST00000434563.3_RNA|snoU13_ENST00000458789.1_RNA|GNS_ENST00000542058.1_Missense_Mutation_p.L52P|GNS_ENST00000543646.1_Missense_Mutation_p.L52P	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	52					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		GTCCGTGAGGAGCAGCACCAC	0.657																																						.											0													29.0	29.0	29.0					12																	65152902		2191	4282	6473	SO:0001583	missense	2799				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.155T>C	12.37:g.65152902A>G	ENSP00000258145:p.Leu52Pro		B4DYH8|Q53F05	Missense_Mutation	SNP	ENST00000258145.3	37	CCDS8970.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.980417	0.74474	.	.	ENSG00000135677	ENST00000258145;ENST00000543646;ENST00000542058	D;D;D	0.97041	-4.22;-4.22;-4.22	4.48	4.48	0.54585	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.131881	0.48286	D	0.000184	D	0.97216	0.9090	M	0.64997	1.995	0.54753	D	0.999982	D;D;P	0.55385	0.971;0.971;0.941	P;P;P	0.59761	0.646;0.807;0.863	D	0.96596	0.9441	9	.	.	.	-7.1383	11.5388	0.50655	1.0:0.0:0.0:0.0	.	52;52;52	B4DYH8;F6S8M0;P15586	.;.;GNS_HUMAN	P	52	ENSP00000258145:L52P;ENSP00000438497:L52P;ENSP00000444819:L52P	.	L	-	2	0	GNS	63439169	0.606000	0.26949	0.907000	0.35723	0.877000	0.50540	2.943000	0.49026	2.022000	0.59522	0.397000	0.26171	CTC		0.657	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401195.2		
DCN	1634	broad.mit.edu	37	12	91550949	91550949	+	Silent	SNP	C	C	T	rs147765043		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:91550949C>T	ENST00000052754.5	-	5	1056	c.555G>A	c.(553-555)ccG>ccA	p.P185P	DCN_ENST00000420120.2_Silent_p.P76P|DCN_ENST00000441303.2_Intron|DCN_ENST00000552962.1_Silent_p.P185P|DCN_ENST00000393155.1_Silent_p.P185P|DCN_ENST00000228329.5_Silent_p.P76P|DCN_ENST00000547568.2_Intron|DCN_ENST00000456569.2_Intron|DCN_ENST00000425043.1_Intron|DCN_ENST00000303320.3_Intron	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	185					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						AGCTCTTCAGCGGATTGGTGC	0.428																																						.											0													119.0	115.0	116.0					12																	91550949		2203	4300	6503	SO:0001819	synonymous_variant	1634			AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.555G>A	12.37:g.91550949C>T			Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Silent	SNP	ENST00000052754.5	37	CCDS9039.1																																																																																				0.428	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507	
TRAFD1	10906	broad.mit.edu	37	12	112578793	112578794	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:112578793_112578794delGA	ENST00000257604.5	+	5	1025_1026	c.408_409delGA	c.(406-411)gggagafs	p.R137fs	TRAFD1_ENST00000412615.2_Frame_Shift_Del_p.R137fs	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	137					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						AAGTTTGTGGGAGAGAGGGGGA	0.48																																						.											0																																										SO:0001589	frameshift_variant	10906			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.408_409delGA	12.37:g.112578797_112578798delGA	ENSP00000257604:p.Arg137fs		A8K5L6|B4DI89	Frame_Shift_Del	DEL	ENST00000257604.5	37	CCDS9160.1																																																																																				0.480	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405214.1	NM_006700	
EPB42	2038	broad.mit.edu	37	15	43501531	43501531	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr15:43501531C>A	ENST00000441366.2	-	6	998	c.773G>T	c.(772-774)gGc>gTc	p.G258V	EPB42_ENST00000300215.3_Missense_Mutation_p.G288V|EPB42_ENST00000540029.1_Missense_Mutation_p.G180V|EPB42_ENST00000563128.1_5'Flank	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	258					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		TCGGCCTCGGCCGGTGAGCCA	0.677																																						.											0													46.0	44.0	45.0					15																	43501531		2203	4299	6502	SO:0001583	missense	2038			M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.773G>T	15.37:g.43501531C>A	ENSP00000396616:p.Gly258Val		Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	37	CCDS45249.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528930	0.27387	.	.	ENSG00000166947	ENST00000300215;ENST00000540029;ENST00000441366;ENST00000397027	T;T;T	0.52295	0.67;0.67;0.67	4.69	4.69	0.59074	Transglutaminase-like (1);	0.481828	0.23587	N	0.046600	T	0.62925	0.2468	M	0.78049	2.395	0.22511	N	0.999034	D;D;D;D	0.89917	1.0;0.998;0.997;0.998	D;D;P;D	0.77004	0.989;0.926;0.878;0.926	T	0.54840	-0.8233	10	0.17369	T	0.5	-22.3396	8.9578	0.35829	0.0:0.9008:0.0:0.0992	.	180;258;288;258	F5H563;B7Z4C3;P16452-2;P16452	.;.;.;EPB42_HUMAN	V	288;180;258;258	ENSP00000300215:G288V;ENSP00000444699:G180V;ENSP00000396616:G258V	ENSP00000300215:G288V	G	-	2	0	EPB42	41288823	0.000000	0.05858	0.896000	0.35187	0.071000	0.16799	0.094000	0.15107	2.568000	0.86640	0.655000	0.94253	GGC		0.677	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	NM_000119	
CNGB1	1258	broad.mit.edu	37	16	57984389	57984389	+	Silent	SNP	T	T	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr16:57984389T>C	ENST00000251102.8	-	13	990	c.930A>G	c.(928-930)gaA>gaG	p.E310E	CNGB1_ENST00000564448.1_Silent_p.E304E	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	310					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						CCCAGGGCGGTTCAACCTCCT	0.552																																					Colon(156;1293 1853 16336 28962 38659)	.											0													92.0	94.0	94.0					16																	57984389		2015	4176	6191	SO:0001819	synonymous_variant	1258			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.930A>G	16.37:g.57984389T>C			H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	ENST00000251102.8	37	CCDS42169.1																																																																																				0.552	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297	
AP2B1	163	broad.mit.edu	37	17	34009754	34009754	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr17:34009754C>T	ENST00000262325.7	+	17	2876	c.2323C>T	c.(2323-2325)Cca>Tca	p.P775S	AP2B1_ENST00000312678.8_Missense_Mutation_p.P789S|AP2B1_ENST00000592545.1_Missense_Mutation_p.P751S|AP2B1_ENST00000538556.1_Missense_Mutation_p.P718S|AP2B1_ENST00000589344.1_Missense_Mutation_p.P789S|CTC-507E2.1_ENST00000588135.1_RNA|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000537622.2_Missense_Mutation_p.P789S	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	775					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CATCCATACACCACTGATGCC	0.483																																						.											0													113.0	92.0	99.0					17																	34009754		2203	4300	6503	SO:0001583	missense	163			M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.2323C>T	17.37:g.34009754C>T	ENSP00000262325:p.Pro775Ser		A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039723	0.75732	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.45	5.45	0.79879	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (1);	0.000000	0.85682	D	0.000000	T	0.69305	0.3096	M	0.85859	2.78	0.80722	D	1	D;P;B;P	0.76494	0.999;0.819;0.363;0.67	D;P;B;B	0.75484	0.986;0.593;0.275;0.179	T	0.72663	-0.4225	10	0.52906	T	0.07	-7.6667	18.2747	0.90078	0.0:1.0:0.0:0.0	.	526;751;775;789	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	S	775;789;718;789;526	ENSP00000262325:P775S;ENSP00000314414:P789S;ENSP00000440563:P718S;ENSP00000437413:P789S	ENSP00000262325:P775S	P	+	1	0	AP2B1	31033867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.662000	0.83803	2.571000	0.86741	0.650000	0.86243	CCA		0.483	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		
MAPT	4137	broad.mit.edu	37	17	44096020	44096020	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr17:44096020A>G	ENST00000571987.1	+	12	1985	c.1985A>G	c.(1984-1986)gAc>gGc	p.D662G	MAPT_ENST00000431008.3_Missense_Mutation_p.D314G|MAPT_ENST00000344290.5_Missense_Mutation_p.D680G|MAPT_ENST00000351559.5_Missense_Mutation_p.D345G|MAPT_ENST00000570299.1_3'UTR|MAPT_ENST00000446361.3_Missense_Mutation_p.D287G|MAPT_ENST00000576518.1_Missense_Mutation_p.D245G|MAPT_ENST00000574436.1_Missense_Mutation_p.D345G|MAPT_ENST00000420682.2_Missense_Mutation_p.D316G|MAPT_ENST00000340799.5_Missense_Mutation_p.D316G|MAPT_ENST00000415613.2_Missense_Mutation_p.D680G|MAPT_ENST00000334239.8_Missense_Mutation_p.D256G|MAPT_ENST00000262410.5_Missense_Mutation_p.D662G|MAPT_ENST00000535772.1_Missense_Mutation_p.D314G|MAPT_ENST00000347967.5_Missense_Mutation_p.D220G			P10636	TAU_HUMAN	microtubule-associated protein tau	662					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	GAGAAGCTTGACTTCAAGGAC	0.488																																						.											0													205.0	195.0	198.0					17																	44096020		2203	4300	6503	SO:0001583	missense	4137			J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.1985A>G	17.37:g.44096020A>G	ENSP00000458742:p.Asp662Gly		P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	ENST00000571987.1	37	CCDS11501.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.380372	0.82682	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000351559;ENST00000340799;ENST00000535772;ENST00000347967;ENST00000354326;ENST00000446361;ENST00000334239;ENST00000420682;ENST00000415613;ENST00000431008	D;D;D;D;D;D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99;-4.99;-4.99;-4.99;-4.99;-4.99	5.02	5.02	0.67125	.	0.000000	0.44902	D	0.000415	D	0.98760	0.9583	M	0.82630	2.6	0.80722	D	1	B;P;P;P;B;D;D	0.63880	0.243;0.856;0.591;0.591;0.321;0.993;0.976	B;B;B;B;B;P;D	0.65874	0.366;0.341;0.312;0.406;0.281;0.879;0.939	D	0.99686	1.1000	10	0.87932	D	0	-24.0164	13.8617	0.63564	1.0:0.0:0.0:0.0	.	680;316;263;256;287;345;662	P10636-9;P10636-7;F8WAB2;P10636-2;P10636-6;P10636-8;P10636	.;.;.;.;.;.;TAU_HUMAN	G	680;662;345;316;314;220;263;256;287;316;680;168	ENSP00000340820:D680G;ENSP00000262410:D662G;ENSP00000303214:D345G;ENSP00000340438:D316G;ENSP00000443028:D314G;ENSP00000302706:D220G;ENSP00000408975:D256G;ENSP00000413056:D316G;ENSP00000410838:D680G	ENSP00000262410:D662G	D	+	2	0	MAPT	41451867	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.013000	0.59113	0.459000	0.35465	GAC		0.488	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835	
TXNDC2	84203	broad.mit.edu;mdanderson.org	37	18	9887448	9887448	+	Silent	SNP	C	C	T	rs34819368		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr18:9887448C>T	ENST00000306084.6	+	2	1171	c.972C>T	c.(970-972)ccC>ccT	p.P324P	TXNDC2_ENST00000536353.2_3'UTR|TXNDC2_ENST00000357775.5_Silent_p.P257P	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	324	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CCATCCAGCCCAAGGAGGGTG	0.597																																						.											0													121.0	117.0	118.0					18																	9887448		2203	4300	6503	SO:0001819	synonymous_variant	84203			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.972C>T	18.37:g.9887448C>T			A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	ENST00000306084.6	37	CCDS42414.1																																																																																				0.597	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
C3P1	388503	broad.mit.edu;mdanderson.org	37	19	10166291	10166291	+	RNA	SNP	G	G	A	rs563514269		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:10166291G>A	ENST00000495140.1	+	0	1649							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)	p.V202I(1)		endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						TGTGTTCCGCGTCTTTGCCCT	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		21662	0.0		0.0	False		,,,				2504	0.001					.											1	Substitution - Missense(1)	large_intestine(1)											188.0	167.0	174.0					19																	10166291		2070	4215	6285			388503			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10166291G>A				RNA	SNP	ENST00000495140.1	37																																																																																					0.562	C3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351284.1	NR_027300	
SPIB	6689	broad.mit.edu	37	19	50931537	50931537	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:50931537C>A	ENST00000595883.1	+	6	758	c.733C>A	c.(733-735)Cgc>Agc	p.R245S	CTD-2545M3.6_ENST00000599632.1_Missense_Mutation_p.A379E|SPIB_ENST00000596074.1_3'UTR|SPIB_ENST00000270632.7_3'UTR|SPIB_ENST00000439922.2_Missense_Mutation_p.R154S	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	245					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CAAGGTCAAGCGCAAGCTCAC	0.682																																						.											0													24.0	18.0	20.0					19																	50931537		2120	4121	6241	SO:0001583	missense	6689				CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.733C>A	19.37:g.50931537C>A	ENSP00000471921:p.Arg245Ser		A8K9C9|B4DUG6|Q15359	Missense_Mutation	SNP	ENST00000595883.1	37	CCDS33080.1	.	.	.	.	.	.	.	.	.	.	.	25.3	4.625445	0.87560	.	.	ENSG00000142539	ENST00000270632;ENST00000439922	T	0.23552	1.9	4.61	3.49	0.39957	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.176247	0.26560	N	0.023682	T	0.35068	0.0919	L	0.39633	1.23	0.41749	D	0.989658	D;D	0.61697	0.99;0.99	P;P	0.61800	0.859;0.894	T	0.11372	-1.0590	10	0.87932	D	0	-0.074	10.1039	0.42521	0.3729:0.6271:0.0:0.0	.	154;245	B4DUG6;Q01892	.;SPIB_HUMAN	S	245;154	ENSP00000391877:R154S	ENSP00000270632:R245S	R	+	1	0	SPIB	55623349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.306000	0.65756	2.267000	0.75376	0.561000	0.74099	CGC		0.682	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464744.1	NM_003121	
HELZ2	85441	broad.mit.edu	37	20	62200278	62200278	+	Missense_Mutation	SNP	G	G	A	rs199977542	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr20:62200278G>A	ENST00000467148.1	-	5	1232	c.1163C>T	c.(1162-1164)cCg>cTg	p.P388L	HELZ2_ENST00000479540.1_5'Flank|HELZ2_ENST00000427522.2_5'Flank	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	388					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CAGTGCTCCCGGAGGCGCGAA	0.677													G|||	2	0.000399361	0.0	0.0	5008	,	,		17049	0.001		0.0	False		,,,				2504	0.001					.											0													47.0	47.0	47.0					20																	62200278		2180	4275	6455	SO:0001583	missense	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.1163C>T	20.37:g.62200278G>A	ENSP00000417401:p.Pro388Leu		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	8.935	0.964382	0.18583	.	.	ENSG00000130589	ENST00000467148	T	0.79352	-1.26	4.8	2.77	0.32553	.	0.952674	0.08784	N	0.894294	T	0.74884	0.3775	L	0.50333	1.59	0.09310	N	1	D	0.56035	0.974	B	0.42798	0.398	T	0.62229	-0.6898	10	0.59425	D	0.04	-10.8048	12.8997	0.58119	0.0:0.0:0.4381:0.5619	.	388	Q9BYK8	PR285_HUMAN	L	388	ENSP00000417401:P388L	ENSP00000417401:P388L	P	-	2	0	RP4-697K14.7	61670722	0.003000	0.15002	0.006000	0.13384	0.062000	0.15995	1.126000	0.31344	0.424000	0.26061	0.462000	0.41574	CCG		0.677	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
ZNF512B	57473	broad.mit.edu	37	20	62648170	62648170	+	Intron	SNP	A	A	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr20:62648170A>G	ENST00000450537.1	-	1	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.K540R			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GAAGATCGGAAGCATACCTGG	0.547																																						.											0													186.0	153.0	165.0					20																	62648170		2203	4300	6503	SO:0001627	intron_variant	24148			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+31887T>C	20.37:g.62648170A>G			Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.627152	0.66901	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.34472	1.36;1.36	6.16	5.03	0.67393	Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.40015	0.1100	L	0.55213	1.73	0.80722	D	1	P;B	0.40534	0.72;0.074	B;B	0.44224	0.444;0.063	T	0.19418	-1.0306	10	0.39692	T	0.17	.	13.7549	0.62930	0.8724:0.1276:0.0:0.0	.	540;540	O94906-2;O94906	.;PRP6_HUMAN	R	540	ENSP00000266079:K540R;ENSP00000446216:K540R	ENSP00000266079:K540R	K	+	2	0	PRPF6	62118614	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.123000	0.77176	2.367000	0.80283	0.528000	0.53228	AAG		0.547	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
SGSM1	129049	broad.mit.edu	37	22	25294500	25294500	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr22:25294500G>T	ENST00000400359.4	+	20	2756	c.2749G>T	c.(2749-2751)Gtg>Ttg	p.V917L	SNORD56_ENST00000362913.1_RNA|SGSM1_ENST00000400358.4_Missense_Mutation_p.V862L	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	917	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GGTGTCCCCTGTGTCTTCCAG	0.562																																						.											0													68.0	73.0	71.0					22																	25294500		2042	4189	6231	SO:0001583	missense	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2749G>T	22.37:g.25294500G>T	ENSP00000383212:p.Val917Leu		A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	37	CCDS46674.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393481	0.42410	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.06849	3.26;3.25	5.09	5.09	0.68999	Rab-GAP/TBC domain (3);	0.531595	0.17307	U	0.179010	T	0.08403	0.0209	L	0.27053	0.805	0.33206	D	0.552802	B;B;B;B	0.33637	0.42;0.21;0.095;0.304	B;B;B;B	0.37239	0.244;0.212;0.077;0.111	T	0.23547	-1.0185	10	0.23891	T	0.37	-29.1052	15.091	0.72195	0.0:0.142:0.858:0.0	.	862;917;934;917	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	L	917;862;917	ENSP00000383211:V862L;ENSP00000383212:V917L	ENSP00000383211:V862L	V	+	1	0	SGSM1	23624500	1.000000	0.71417	0.994000	0.49952	0.645000	0.38454	4.280000	0.58959	2.541000	0.85698	0.591000	0.81541	GTG		0.562	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318	
KIAA2018	205717	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	113375013	113375013	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:113375013A>T	ENST00000478658.1	-	5	5533	c.5516T>A	c.(5515-5517)cTc>cAc	p.L1839H	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.L1839H			Q68DE3	K2018_HUMAN	KIAA2018	1839						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						ATGTTCTGAGAGTGACCTCTG	0.443																																						.											0													97.0	95.0	96.0					3																	113375013		1979	4175	6154	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5516T>A	3.37:g.113375013A>T	ENSP00000420721:p.Leu1839His		Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.318679	0.60524	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.19532	2.14;2.14	5.91	5.91	0.95273	.	0.222346	0.31922	N	0.006858	T	0.27900	0.0687	N	0.14661	0.345	0.38952	D	0.958378	D	0.71674	0.998	P	0.60173	0.87	T	0.20974	-1.0259	10	0.87932	D	0	-8.4007	16.3453	0.83126	1.0:0.0:0.0:0.0	.	1839	Q68DE3	K2018_HUMAN	H	1839	ENSP00000320794:L1839H;ENSP00000420721:L1839H	ENSP00000320794:L1839H	L	-	2	0	KIAA2018	114857703	.	.	1.000000	0.80357	0.996000	0.88848	.	.	2.261000	0.74972	0.533000	0.62120	CTC		0.443	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
MUC4	4585	broad.mit.edu	37	3	195508903	195508903	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:195508903G>A	ENST00000463781.3	-	2	10007	c.9548C>T	c.(9547-9549)aCg>aTg	p.T3183M	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3183M	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3183I(1)|p.T3183M(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGCGTGGTGTCACC	0.592																																						.											2	Substitution - Missense(2)	NS(2)											3.0	2.0	2.0					3																	195508903		442	957	1399	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9548C>T	3.37:g.195508903G>A	ENSP00000417498:p.Thr3183Met		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	1.721	-0.496684	0.04291	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38887	1.11;1.23	.	.	.	.	.	.	.	.	T	0.34395	0.0896	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.55615	0.78	T	0.16247	-1.0409	7	.	.	.	.	4.5608	0.12160	0.0:0.4156:0.5844:0.0	.	3055	E7ESK3	.	M	3183	ENSP00000417498:T3183M;ENSP00000420243:T3183M	.	T	-	2	0	MUC4	196993682	0.001000	0.12720	0.010000	0.14722	0.010000	0.07245	0.267000	0.18552	0.073000	0.16731	0.074000	0.15403	ACG		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
HNRNPDL	9987	broad.mit.edu	37	4	83350764	83350764	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:83350764delA	ENST00000295470.5	-	1	255	c.80delT	c.(79-81)ctcfs	p.L27fs	HNRNPDL_ENST00000602300.1_5'Flank|HNRNPDL_ENST00000514511.1_5'Flank|HNRNPDL_ENST00000349655.4_5'Flank|HNRNPDL_ENST00000502762.1_Frame_Shift_Del_p.L27fs|ENOPH1_ENST00000509635.1_5'Flank|ENOPH1_ENST00000273920.3_5'Flank	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	27					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										ccAATGGGAGAGGCTGCGGGA	0.756																																						.											0													4.0	7.0	6.0					4																	83350764		1544	3554	5098	SO:0001589	frameshift_variant	9987			D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.80delT	4.37:g.83350764delA	ENSP00000295470:p.Leu27fs		Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Frame_Shift_Del	DEL	ENST00000295470.5	37	CCDS3593.1																																																																																				0.756	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252644.1	NM_005463	
LECT2	3950	broad.mit.edu	37	5	135283165	135283165	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr5:135283165T>C	ENST00000274507.1	-	4	511	c.311A>G	c.(310-312)tAc>tGc	p.Y104C	LECT2_ENST00000522943.1_Intron|FBXL21_ENST00000467490.1_RNA|LECT2_ENST00000512872.1_Missense_Mutation_p.Y32C|LECT2_ENST00000471827.1_Intron	NM_002302.2	NP_002293.2	O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2	104					chemotaxis (GO:0006935)|negative regulation of Wnt signaling pathway (GO:0030178)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	identical protein binding (GO:0042802)			large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGCTTAATGTAGAACATTTT	0.308																																						.											0													86.0	79.0	81.0					5																	135283165		2203	4300	6503	SO:0001583	missense	3950			AB007546	CCDS4190.1	5q31.1	2008-05-15			ENSG00000145826	ENSG00000145826			6550	protein-coding gene	gene with protein product		602882				9545637	Standard	NM_002302		Approved	chm-II, chm2	uc003lbe.1	O14960	OTTHUMG00000129146	ENST00000274507.1:c.311A>G	5.37:g.135283165T>C	ENSP00000274507:p.Tyr104Cys		B2RA90|O14565|Q52M49	Missense_Mutation	SNP	ENST00000274507.1	37	CCDS4190.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.784221	0.31593	.	.	ENSG00000145826	ENST00000274507;ENST00000512872	T;T	0.42513	0.97;2.95	5.52	5.52	0.82312	Peptidase M23 (1);	0.207483	0.43919	D	0.000501	T	0.30510	0.0767	L	0.33245	0.995	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	T	0.13045	-1.0524	10	0.48119	T	0.1	-4.7712	7.7505	0.28894	0.0:0.0965:0.0:0.9035	.	104	O14960	LECT2_HUMAN	C	104;32	ENSP00000274507:Y104C;ENSP00000427012:Y32C	ENSP00000274507:Y104C	Y	-	2	0	LECT2	135311064	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.555000	0.53727	2.099000	0.63709	0.533000	0.62120	TAC		0.308	LECT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251209.1	NM_002302	
MDN1	23195	broad.mit.edu;mdanderson.org;bcgsc.ca	37	6	90353740	90353740	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr6:90353740G>T	ENST00000369393.3	-	102	16890	c.16775C>A	c.(16774-16776)gCc>gAc	p.A5592D	MDN1_ENST00000428876.1_Missense_Mutation_p.A5592D			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5592					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GTGGTCAGAGGCTGTCACCAA	0.473																																						.											0													116.0	102.0	106.0					6																	90353740		2203	4300	6503	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.16775C>A	6.37:g.90353740G>T	ENSP00000358400:p.Ala5592Asp		O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415218	0.62511	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03413	3.94;3.94	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.08714	0.0216	L	0.42245	1.32	0.58432	D	0.999999	D	0.71674	0.998	D	0.64687	0.928	T	0.10590	-1.0623	10	0.72032	D	0.01	.	20.119	0.97953	0.0:0.0:1.0:0.0	.	5592	Q9NU22	MDN1_HUMAN	D	5592	ENSP00000358400:A5592D;ENSP00000413970:A5592D	ENSP00000358400:A5592D	A	-	2	0	MDN1	90410461	1.000000	0.71417	0.998000	0.56505	0.891000	0.51852	7.355000	0.79434	2.763000	0.94921	0.555000	0.69702	GCC		0.473	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
ECT2L	345930	broad.mit.edu	37	6	139164271	139164271	+	Silent	SNP	G	G	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr6:139164271G>A	ENST00000423192.1	+	5	659	c.498G>A	c.(496-498)acG>acA	p.T166T	ECT2L_ENST00000541398.1_Silent_p.T97T|ECT2L_ENST00000367682.2_Silent_p.T166T			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	166							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						CTTATGGGACGCTGAATGAAC	0.453			"""N, Splice, Mis"""		ETP ALL																																	.		Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	0													124.0	124.0	124.0					6																	139164271		1945	4154	6099	SO:0001819	synonymous_variant	345930				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.498G>A	6.37:g.139164271G>A			B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	ENST00000423192.1	37	CCDS43508.1																																																																																				0.453	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
TRRAP	8295	broad.mit.edu	37	7	98522828	98522828	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr7:98522828G>T	ENST00000359863.4	+	22	3126	c.2917G>T	c.(2917-2919)Gcc>Tcc	p.A973S	TRRAP_ENST00000446306.3_Missense_Mutation_p.A972S|TRRAP_ENST00000355540.3_Missense_Mutation_p.A973S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	973					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.A973S(2)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTCCTGGTGGCCATGATGAG	0.562																																						.											2	Substitution - Missense(2)	endometrium(2)											173.0	138.0	149.0					7																	98522828		2203	4300	6503	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.2917G>T	7.37:g.98522828G>T	ENSP00000352925:p.Ala973Ser		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.250101|4.250101	0.80024|0.80024	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.02812|.	4.15;4.15|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53578|0.53578	0.1805|0.1805	N|N	0.16066|0.16066	0.365|0.365	0.80722|0.80722	D|D	1|1	P;B;P|.	0.46784|.	0.884;0.297;0.461|.	B;B;B|.	0.43155|.	0.41;0.077;0.134|.	T|T	0.44143|0.44143	-0.9347|-0.9347	10|5	0.10377|.	T|.	0.69|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	973;687;973|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	S|C	973;973;971|687	ENSP00000352925:A973S;ENSP00000347733:A973S|.	ENSP00000347733:A973S|.	A|W	+|+	1|3	0|0	TRRAP|TRRAP	98360764|98360764	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.728000|9.728000	0.98792|0.98792	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|TGG		0.562	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
EGR3	1960	broad.mit.edu	37	8	22548132	22548132	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr8:22548132G>T	ENST00000317216.2	-	2	1375	c.1018C>A	c.(1018-1020)Cgc>Agc	p.R340S	EGR3_ENST00000524088.1_5'UTR|EGR3_ENST00000519492.1_3'UTR|RP11-459E5.1_ENST00000523627.1_RNA|EGR3_ENST00000522910.1_Missense_Mutation_p.R302S	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	340					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		GCAAACTTGCGCCCGCAGAAC	0.632																																						.											0													62.0	56.0	58.0					8																	22548132		2203	4300	6503	SO:0001583	missense	1960			X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.1018C>A	8.37:g.22548132G>T	ENSP00000318057:p.Arg340Ser		A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Missense_Mutation	SNP	ENST00000317216.2	37	CCDS6033.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.317109	0.81469	.	.	ENSG00000179388	ENST00000317216;ENST00000522910;ENST00000435199	T;T	0.18960	2.18;2.18	5.62	5.62	0.85841	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.055456	0.64402	D	0.000001	T	0.40886	0.1135	L	0.42581	1.335	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.994;0.999	T	0.13308	-1.0514	10	0.87932	D	0	-25.3596	17.1549	0.86788	0.0:0.0:1.0:0.0	.	302;340	E7EW38;Q06889	.;EGR3_HUMAN	S	340;302;181	ENSP00000318057:R340S;ENSP00000430310:R302S	ENSP00000318057:R340S	R	-	1	0	EGR3	22604077	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.832000	0.48152	2.643000	0.89663	0.655000	0.94253	CGC		0.632	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215098.1	NM_004430	
FOXD4	2298	broad.mit.edu	37	9	117398	117400	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	GGC	GGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr9:117398_117400delGGC	ENST00000382500.2	-	1	1017_1019	c.720_722delGCC	c.(718-723)cagcca>caa	p.P241del		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	241	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CCCCGGGACTGGCTGCGGCGGGG	0.734																																						.											0																																										SO:0001651	inframe_deletion	2298			U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.720_722delGCC	9.37:g.117398_117400delGGC	ENSP00000371940:p.Pro241del		B2RN05|B9EGL7|Q5VVK1|Q8WXT6	In_Frame_Del	DEL	ENST00000382500.2	37	CCDS34975.1																																																																																				0.734	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	NM_207305	
SMARCA1	6594	broad.mit.edu	37	X	128614736	128614736	+	Missense_Mutation	SNP	C	C	T	rs375431295		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chrX:128614736C>T	ENST00000371122.4	-	19	2513	c.2384G>A	c.(2383-2385)cGc>cAc	p.R795H	SMARCA1_ENST00000371123.1_Missense_Mutation_p.R783H|SMARCA1_ENST00000371121.3_Missense_Mutation_p.R783H	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	795					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CTCAAATAAGCGTGGTGGGAA	0.323																																						.											0								C	HIS/ARG,HIS/ARG	0,3835		0,0,1632,571	60.0	61.0	61.0		2384,2348	5.1	1.0	X		61	1,6727		0,1,2427,1872	no	missense,missense	SMARCA1	NM_003069.3,NM_139035.2	29,29	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging,probably-damaging	795/1055,783/1043	128614736	1,10562	2203	4300	6503	SO:0001583	missense	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2384G>A	X.37:g.128614736C>T	ENSP00000360163:p.Arg795His		Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234113	0.95207	0.0	1.49E-4	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.92199	-2.99;-2.99;-2.98;-2.97	5.1	5.1	0.69264	ATPase, nucleosome remodelling ISWI, HAND domain (2);	0.000000	0.64402	D	0.000018	D	0.96750	0.8939	M	0.93375	3.41	0.80722	D	1	D;D;D;D	0.69078	0.997;0.997;0.996;0.997	P;P;P;P	0.60886	0.88;0.88;0.809;0.88	D	0.97940	1.0325	10	0.87932	D	0	-5.865	17.6491	0.88158	0.0:1.0:0.0:0.0	.	774;795;783;795	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	H	783;783;795;774	ENSP00000360162:R783H;ENSP00000360164:R783H;ENSP00000360163:R795H;ENSP00000404275:R774H	ENSP00000360162:R783H	R	-	2	0	SMARCA1	128442417	1.000000	0.71417	0.977000	0.42913	0.978000	0.69477	6.045000	0.71020	2.096000	0.63516	0.529000	0.55759	CGC		0.323	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
HNF1A	6927	broad.mit.edu	37	12	121437368	121437369	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:121437368_121437369insC	ENST00000257555.6	+	9	1932_1933	c.1706_1707insC	c.(1705-1710)agccagfs	p.Q570fs	HNF1A_ENST00000541395.1_Frame_Shift_Ins_p.Q601fs|RP11-216P16.2_ENST00000606238.1_RNA|HNF1A_ENST00000544413.1_Frame_Shift_Ins_p.Q577fs			P20823	HNF1A_HUMAN	HNF1 homeobox A	570					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACGTCCCCAGCCAGGACCCTG	0.688									Hepatic Adenoma, Familial Clustering of																													.											0																																										SO:0001589	frameshift_variant	6927	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1708dupC	12.37:g.121437370_121437370dupC	ENSP00000257555:p.Gln570fs		A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Ins	INS	ENST00000257555.6	37	CCDS9209.1																																																																																				0.688	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
SSC5D	284297	broad.mit.edu	37	19	56029595	56029596	+	Frame_Shift_Ins	INS	-	-	C	rs201516796		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:56029595_56029596insC	ENST00000389623.6	+	14	3975_3976	c.3952_3953insC	c.(3952-3954)gatfs	p.D1318fs		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1318	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						cactactcctgatcccaccacg	0.609																																						.											0																																										SO:0001589	frameshift_variant	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		Exception_encountered	19.37:g.56029595_56029596insC	ENSP00000374274:p.Asp1318fs		B5MDQ5|C7S7T9|C7S7U0|K7EP70	Frame_Shift_Ins	INS	ENST00000389623.6	37	CCDS46196.1																																																																																				0.609	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
CCDC37	348807	broad.mit.edu	37	3	126142182	126142183	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:126142182_126142183insC	ENST00000352312.1	+	12	1196_1197	c.1097_1098insC	c.(1096-1101)atccccfs	p.IP366fs	CCDC37_ENST00000505024.1_Frame_Shift_Ins_p.IP367fs|CCDC37_ENST00000393425.1_Frame_Shift_Ins_p.IP367fs	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	366								p.T369fs*36(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		AACTCTCCCATCCCCCCCACGC	0.653																																						.											1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	348807			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1104dupC	3.37:g.126142189_126142189dupC	ENSP00000344749:p.Ile366fs		D3DNA8|Q494V1|Q494V4|Q8N838	Frame_Shift_Ins	INS	ENST00000352312.1	37	CCDS3037.1																																																																																				0.653	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4	NM_182628	
GFM1	85476	broad.mit.edu	37	3	158362472	158362473	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:158362472_158362473insC	ENST00000486715.1	+	1	406_407	c.49_50insC	c.(49-51)gccfs	p.A17fs	GFM1_ENST00000264263.5_Frame_Shift_Ins_p.A17fs|GFM1_ENST00000478576.1_Frame_Shift_Ins_p.A17fs	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GCGCGGAAGGGCCCCCGCCTCC	0.649											OREG0015898	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0																																										SO:0001589	frameshift_variant	85476			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.54dupC	3.37:g.158362477_158362477dupC	ENSP00000419038:p.Ala17fs	1793		Frame_Shift_Ins	INS	ENST00000486715.1	37	CCDS33885.1																																																																																				0.649	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
HNRNPDL	9987	broad.mit.edu	37	4	83350758	83350759	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:83350758_83350759insC	ENST00000295470.5	-	1	260_261	c.85_86insG	c.(85-87)catfs	p.H29fs	HNRNPDL_ENST00000602300.1_5'Flank|HNRNPDL_ENST00000514511.1_5'Flank|HNRNPDL_ENST00000349655.4_5'Flank|HNRNPDL_ENST00000502762.1_Frame_Shift_Ins_p.H29fs|ENOPH1_ENST00000509635.1_5'Flank|ENOPH1_ENST00000273920.3_5'Flank	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	29					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										cggccgccAATGGGAGAGGCTG	0.757																																						.											0																																										SO:0001589	frameshift_variant	9987			D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.85_86insG	4.37:g.83350758_83350759insC	ENSP00000295470:p.His29fs		Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Frame_Shift_Ins	INS	ENST00000295470.5	37	CCDS3593.1																																																																																				0.757	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252644.1	NM_005463	
HAPLN1	1404	broad.mit.edu	37	5	82940353	82940354	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr5:82940353_82940354insC	ENST00000274341.4	-	4	1453_1454	c.603_604insG	c.(601-606)gggctgfs	p.L202fs		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	202	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	CACCAGTCCAGCCCGCCCCGCC	0.619																																						.											0																																										SO:0001589	frameshift_variant	1404				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.604dupG	5.37:g.82940356_82940356dupC	ENSP00000274341:p.Leu202fs		B2R9A9	Frame_Shift_Ins	INS	ENST00000274341.4	37	CCDS4061.1																																																																																				0.619	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
LCN1	3933	broad.mit.edu	37	9	138415126	138415127	+	Frame_Shift_Ins	INS	-	-	G	rs146192526		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr9:138415126_138415127insG	ENST00000263598.2	+	3	330_331	c.270_271insG	c.(271-273)gagfs	p.E91fs	LCN1_ENST00000371781.3_Frame_Shift_Ins_p.E91fs	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	91					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		AGAAAACTGACGAGCCGGGAAA	0.644																																						.											0																																										SO:0001589	frameshift_variant	3933				CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.271dupG	9.37:g.138415127_138415127dupG	ENSP00000263598:p.Glu91fs		Q5T8A1	Frame_Shift_Ins	INS	ENST00000263598.2	37	CCDS6991.1																																																																																				0.644	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054992.1	NM_002297	
ATF2	1386	ucsc.edu	37	2	175986170	175986170	+	Splice_Site	SNP	A	A	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr2:175986170A>C	ENST00000264110.2	-	5	498		c.e5+1		ATF2_ENST00000392544.1_Splice_Site|ATF2_ENST00000345739.5_Intron|ATF2_ENST00000426833.3_Splice_Site|ATF2_ENST00000538946.1_Splice_Site|ATF2_ENST00000409635.1_Intron|ATF2_ENST00000392543.2_Intron|ATF2_ENST00000409499.1_Intron|ATF2_ENST00000409833.1_Splice_Site|ATF2_ENST00000409437.1_Splice_Site|ATF2_ENST00000487334.2_Splice_Site	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2						adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	GCATATACTAACCAGCCACAA	0.353																																					Pancreas(17;87 705 4534 15538 30988)	.											0													84.0	81.0	82.0					2																	175986170		2203	4299	6502	SO:0001630	splice_region_variant	1386			X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.199+1T>G	2.37:g.175986170A>C			A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Splice_Site	SNP	ENST00000264110.2	37	CCDS2262.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.262883	0.80358	.	.	ENSG00000115966	ENST00000264110;ENST00000409437;ENST00000435004;ENST00000392544;ENST00000426833;ENST00000538946;ENST00000487334;ENST00000409833	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5615	0.76253	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATF2	175694416	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.320000	0.96346	2.073000	0.62155	0.482000	0.46254	.		0.353	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255562.1	NM_001880	Intron
SORL1	6653	ucsc.edu	37	11	121323057	121323057	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:121323057G>T	ENST00000260197.7	+	1	146	c.17G>T	c.(16-18)aGc>aTc	p.S6I	RP11-730K11.1_ENST00000529160.1_RNA|RP11-730K11.1_ENST00000501964.1_RNA	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	6					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		ACACGGAGCAGCAGGAGGGAG	0.697																																						.											0													12.0	11.0	11.0					11																	121323057		2182	4277	6459	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.17G>T	11.37:g.121323057G>T	ENSP00000260197:p.Ser6Ile		B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086607	0.76642	.	.	ENSG00000137642	ENST00000260197	D	0.91686	-2.89	3.8	3.8	0.43715	.	0.313533	0.25148	N	0.032777	D	0.82903	0.5138	N	0.08118	0	0.80722	D	1	P	0.38565	0.637	B	0.38655	0.278	D	0.84642	0.0696	10	0.56958	D	0.05	.	11.0822	0.48066	0.0:0.0:1.0:0.0	.	6	Q92673	SORL_HUMAN	I	6	ENSP00000260197:S6I	ENSP00000260197:S6I	S	+	2	0	SORL1	120828267	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.867000	0.56047	1.985000	0.57927	0.442000	0.29010	AGC		0.697	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
TUBGCP6	85378	ucsc.edu	37	22	50666367	50666367	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr22:50666367A>G	ENST00000248846.5	-	5	1485	c.1381T>C	c.(1381-1383)Ttt>Ctt	p.F461L	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.F461L|TUBGCP6_ENST00000491449.1_5'Flank			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	461					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TTGAAGAGAAAACCAATGGTG	0.622																																						.											0													50.0	42.0	45.0					22																	50666367		2199	4298	6497	SO:0001583	missense	85378			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.1381T>C	22.37:g.50666367A>G	ENSP00000248846:p.Phe461Leu		Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.861449	0.91433	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.06849	3.25;3.25	5.44	5.44	0.79542	.	0.658896	0.16003	N	0.234200	T	0.19685	0.0473	L	0.47716	1.5	0.47308	D	0.999382	D;D	0.67145	0.991;0.996	D;D	0.63033	0.91;0.91	T	0.02966	-1.1088	10	0.20046	T	0.44	.	15.1606	0.72782	1.0:0.0:0.0:0.0	.	461;461	B2RWN4;Q96RT7	.;GCP6_HUMAN	L	461	ENSP00000248846:F461L;ENSP00000397387:F461L	ENSP00000248846:F461L	F	-	1	0	TUBGCP6	49008494	1.000000	0.71417	0.874000	0.34290	0.955000	0.61496	7.402000	0.79972	2.065000	0.61736	0.260000	0.18958	TTT		0.622	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
APOPT1	84334	mdanderson.org	37	14	104029449	104029449	+	Silent	SNP	G	G	A	rs2274267	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr14:104029449G>A	ENST00000409074.2	+	1	151	c.150G>A	c.(148-150)acG>acA	p.T50T	BAG5_ENST00000445922.2_5'Flank|APOPT1_ENST00000556253.2_Silent_p.T37T|BAG5_ENST00000299204.4_5'Flank|RP11-894P9.2_ENST00000556332.1_RNA|RP11-73M18.2_ENST00000472726.2_Silent_p.T50T|BAG5_ENST00000337322.4_5'Flank|APOPT1_ENST00000247618.4_Silent_p.T37T	NM_032374.3	NP_115750.2	Q96IL0	APOP1_HUMAN	apoptogenic 1, mitochondrial	50					intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)	mitochondrion (GO:0005739)											GCAGGGATACGGCGCCCAGCG	0.716													G|||	1108	0.221246	0.1074	0.3343	5008	,	,		12360	0.3512		0.2624	False		,,,				2504	0.1186					.											0								G		557,3355		49,459,1448	4.0	6.0	5.0		150	-0.9	0.2	14	dbSNP_100	5	2012,5966		304,1404,2281	no	coding-synonymous	APOPT1	NM_032374.3		353,1863,3729	AA,AG,GG		25.2194,14.2382,21.6064		50/207	104029449	2569,9321	1956	3989	5945	SO:0001819	synonymous_variant	84334			BC007412	CCDS9983.2	14q32.33	2012-06-28	2012-06-28	2011-09-07	ENSG00000256053	ENSG00000256053			20492	protein-coding gene	gene with protein product	"""apoptogenic protein 1"""		"""chromosome 14 open reading frame 153"", ""apoptogenic 1"""	C14orf153		16782708, 18977203	Standard	NM_032374		Approved	MGC2562, APOP-1		Q96IL0	OTTHUMG00000153929	ENST00000409074.2:c.150G>A	14.37:g.104029449G>A			Q53G28	Silent	SNP	ENST00000409074.2	37	CCDS9983.2	553	0.2532051282051282	49	0.09959349593495935	118	0.3259668508287293	189	0.3304195804195804	197	0.2598944591029024	G	6.245	0.413378	0.11812	0.142382	0.252194	ENSG00000256053	ENST00000440963	.	.	.	3.37	-0.865	0.10662	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.53005	P	3.2999999999949736E-5	.	.	.	.	.	.	T	0.40213	-0.9575	4	0.09843	T	0.71	.	0.9102	0.01293	0.2249:0.1788:0.4131:0.1831	rs2274267;rs17095256;rs28362582	.	.	.	S	50	.	ENSP00000388067:G50S	G	+	1	0	C14orf153	103099202	0.296000	0.24398	0.214000	0.23707	0.083000	0.17756	-0.397000	0.07269	-0.499000	0.06623	-0.140000	0.14226	GGC		0.716	APOPT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333060.2	NM_032374	
AQP7	364	mdanderson.org	37	9	33395103	33395103	+	Silent	SNP	G	G	A	rs148012859		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr9:33395103G>A	ENST00000539936.1	-	3	355	c.117C>T	c.(115-117)gcC>gcT	p.A39A	AQP7_ENST00000537089.1_5'UTR|AQP7_ENST00000377425.4_Intron|AQP7_ENST00000541274.1_5'UTR			O14520	AQP7_HUMAN	aquaporin 7	39					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)	p.A39A(1)		NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TCATGAACTCGGCCAGGAACT	0.582																																						.											1	Substitution - coding silent(1)	prostate(1)											126.0	85.0	99.0					9																	33395103		2203	4300	6503	SO:0001819	synonymous_variant	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000539936.1:c.117C>T	9.37:g.33395103G>A			Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000539936.1	37																																																																																					0.582	AQP7-203	KNOWN	basic	protein_coding	protein_coding		NM_001170	
ATP6V0E2	155066	mdanderson.org	37	7	149571095	149571095	+	5'UTR	SNP	G	G	A	rs79377053	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr7:149571095G>A	ENST00000464662.1	+	0	14				ATP6V0E2-AS1_ENST00000488315.1_RNA|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2_ENST00000606024.1_5'UTR|ATP6V0E2-AS1_ENST00000464939.1_RNA|ATP6V0E2_ENST00000421974.2_Missense_Mutation_p.A30T|ATP6V0E2_ENST00000456496.2_Missense_Mutation_p.A30T|ATP6V0E2_ENST00000479613.1_5'UTR|ATP6V0E2_ENST00000425642.2_5'Flank			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2						ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			CTGGGGACCCGCGCACCTGCA	0.716													G|||	682	0.136182	0.3994	0.049	5008	,	,		12396	0.0526		0.0368	False		,,,				2504	0.0307					.											0								G	THR/ALA,THR/ALA	991,2511		116,759,876	4.0	6.0	5.0		88,88	1.7	0.0	7	dbSNP_132	5	266,6746		7,252,3247	no	missense,missense	ATP6V0E2	NM_001100592.1,NM_145230.2	58,58	123,1011,4123	AA,AG,GG		3.7935,28.2981,11.9555	probably-damaging,probably-damaging	30/214,30/131	149571095	1257,9257	1751	3506	5257	SO:0001623	5_prime_UTR_variant	155066			AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000464662.1:c.-60G>A	7.37:g.149571095G>A			A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Missense_Mutation	SNP	ENST00000464662.1	37		283	0.1295787545787546	188	0.3821138211382114	21	0.058011049723756904	42	0.07342657342657342	32	0.04221635883905013	G	14.56	2.570645	0.45798	0.282981	0.037935	ENSG00000171130	ENST00000421974;ENST00000456496	.	.	.	2.57	1.67	0.24075	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.43550	P	0.004141999999999979	P	0.40638	0.725	B	0.27608	0.081	T	0.43988	-0.9357	7	0.87932	D	0	.	7.3999	0.26958	0.0:0.2709:0.7291:0.0	.	30	E9PAS2	.	T	30	.	ENSP00000411672:A30T	A	+	1	0	ATP6V0E2	149202028	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.103000	0.15292	0.651000	0.30788	0.563000	0.77884	GCG		0.716	ATP6V0E2-007	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350177.2	NM_145230	
C1orf106	55765	mdanderson.org	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753					.											0								T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765			AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys		B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
COL6A3	1293	mdanderson.org;bcgsc.ca	37	2	238269781	238269781	+	Missense_Mutation	SNP	C	C	T	rs397515332		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr2:238269781C>T	ENST00000295550.4	-	16	6645	c.6193G>A	c.(6193-6195)Ggt>Agt	p.G2065S	COL6A3_ENST00000472056.1_Missense_Mutation_p.G1458S|COL6A3_ENST00000347401.3_Missense_Mutation_p.G1864S|COL6A3_ENST00000409809.1_Missense_Mutation_p.G1859S|COL6A3_ENST00000346358.4_Missense_Mutation_p.G1865S|COL6A3_ENST00000353578.4_Missense_Mutation_p.G1859S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2065	Collagen-like 1.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCCTCATCACCAGGATAGCCT	0.448																																						.											0													88.0	87.0	87.0					2																	238269781		2203	4300	6503	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6193G>A	2.37:g.238269781C>T	ENSP00000295550:p.Gly2065Ser		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457244	0.43634	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.99527	-5.12;-6.09;-6.09;-6.09;-6.09;-6.09	5.22	5.22	0.72569	.	0.000000	0.52532	D	0.000069	D	0.99718	0.9891	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97373	0.9977	10	0.66056	D	0.02	.	18.8129	0.92065	0.0:1.0:0.0:0.0	.	1458;1859;2065	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	S	2065;1864;1859;1458;1859;1865	ENSP00000295550:G2065S;ENSP00000315609:G1864S;ENSP00000315873:G1859S;ENSP00000418285:G1458S;ENSP00000386844:G1859S;ENSP00000295546:G1865S	ENSP00000295550:G2065S	G	-	1	0	COL6A3	237934520	1.000000	0.71417	0.389000	0.26208	0.491000	0.33493	7.291000	0.78721	2.437000	0.82529	0.655000	0.94253	GGT		0.448	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
DSTN	11034	mdanderson.org	37	20	17581509	17581509	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr20:17581509A>G	ENST00000246069.7	+	2	476	c.130A>G	c.(130-132)Aaa>Gaa	p.K44E	DSTN_ENST00000474024.1_Missense_Mutation_p.K27E	NM_006870.3	NP_006861.1	P60981	DEST_HUMAN	destrin (actin depolymerizing factor)	44	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|actin filament severing (GO:0051014)|actin polymerization or depolymerization (GO:0008154)|cellular component movement (GO:0006928)|positive regulation of actin filament depolymerization (GO:0030836)	actin cytoskeleton (GO:0015629)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(5)|lung(8)|skin(1)	15						CAGTGCAGACAAAAAGTGCAT	0.383																																						.											0													118.0	111.0	113.0					20																	17581509		2203	4300	6503	SO:0001583	missense	11034			S65738	CCDS13127.1, CCDS46580.1	20p12.1	2010-08-20			ENSG00000125868	ENSG00000125868			15750	protein-coding gene	gene with protein product		609114				8399167, 2156828	Standard	NM_006870		Approved	ADF, ACTDP	uc002wpr.3	P60981	OTTHUMG00000031947	ENST00000246069.7:c.130A>G	20.37:g.17581509A>G	ENSP00000246069:p.Lys44Glu		B2R6N2|B4DYA6|P18282|Q5W166|Q6IAW2	Missense_Mutation	SNP	ENST00000246069.7	37	CCDS13127.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.543878	0.45280	.	.	ENSG00000125868	ENST00000246069;ENST00000543261	T;T	0.38077	1.16;1.16	5.65	5.65	0.86999	Actin-binding, cofilin/tropomyosin type (3);	0.178567	0.52532	D	0.000069	T	0.31295	0.0792	L	0.31294	0.92	0.53005	D	0.999965	B	0.17852	0.024	B	0.25506	0.061	T	0.06625	-1.0816	10	0.49607	T	0.09	-19.5102	15.0613	0.71955	1.0:0.0:0.0:0.0	.	44	P60981	DEST_HUMAN	E	44;27	ENSP00000246069:K44E;ENSP00000444808:K27E	ENSP00000246069:K44E	K	+	1	0	DSTN	17529509	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.053000	0.57427	2.166000	0.68216	0.460000	0.39030	AAA		0.383	DSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078131.6	NM_001011546	
FAM186A	121006	mdanderson.org	37	12	50746022	50746022	+	Silent	SNP	C	C	G	rs7304692	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:50746022C>G	ENST00000327337.5	-	4	4592	c.4593G>C	c.(4591-4593)ctG>ctC	p.L1531L	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Silent_p.L1531L	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1531								p.L1531L(1)									GCGGAGGGATCAGAGGGATCC	0.652													-|||	112	0.0223642	0.0484	0.0086	5008	,	,		17334	0.0327		0.004	False		,,,				2504	0.0051				NSCLC(138;1796 1887 12511 19463 37884)	.											1	Substitution - coding silent(1)	lung(1)											9.0	9.0	9.0					12																	50746022		690	1591	2281	SO:0001819	synonymous_variant	121006				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4593G>C	12.37:g.50746022C>G				Silent	SNP	ENST00000327337.5	37	CCDS44878.1																																																																																				0.652	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
FRG1B	284802	mdanderson.org	37	20	29632686	29632686	+	Silent	SNP	G	G	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr20:29632686G>A	ENST00000278882.3	+	8	881	c.501G>A	c.(499-501)caG>caA	p.Q167Q	FRG1B_ENST00000358464.4_Silent_p.Q167Q			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	167										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AAAAGGCTCAGAAAGATGGAT	0.318																																						.											0																																										SO:0001819	synonymous_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.501G>A	20.37:g.29632686G>A			C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																					0.318	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1	2483	mdanderson.org	37	4	190878569	190878569	+	Missense_Mutation	SNP	T	T	C	rs575384276		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:190878569T>C	ENST00000226798.4	+	6	671	c.449T>C	c.(448-450)tTg>tCg	p.L150S	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	150					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L150S(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATGGCTTTGTTGGCCTCAAAT	0.358																																						.											1	Substitution - Missense(1)	prostate(1)											13.0	18.0	16.0					4																	190878569		2139	4261	6400	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.449T>C	4.37:g.190878569T>C	ENSP00000226798:p.Leu150Ser		A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	15.24	2.773472	0.49786	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.50813	1.86;0.73	4.19	4.19	0.49359	Actin cross-linking (1);	0.139630	0.48286	D	0.000199	T	0.55417	0.1919	M	0.78456	2.415	0.80722	D	1	B	0.31680	0.335	B	0.41299	0.353	T	0.60393	-0.7272	10	0.54805	T	0.06	-2.69	11.5749	0.50856	0.0:0.0:0.0:1.0	.	150	Q14331	FRG1_HUMAN	S	150;22;87	ENSP00000226798:L150S;ENSP00000435943:L87S	ENSP00000226798:L150S	L	+	2	0	FRG1	191115563	1.000000	0.71417	0.991000	0.47740	0.482000	0.33219	7.788000	0.85771	1.677000	0.50941	0.373000	0.22412	TTG		0.358	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
FRG2	448831	mdanderson.org	37	4	190947558	190947558	+	Silent	SNP	G	G	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:190947558G>A	ENST00000378763.1	-	3	364	c.312C>T	c.(310-312)gaC>gaT	p.D104D	FRG2_ENST00000504750.1_Silent_p.D105D	NM_001005217.1|NM_001199232.1	NP_001005217.1|NP_001186161.1	Q64ET8	FRG2_HUMAN	FSHD region gene 2	104						nucleus (GO:0005634)				large_intestine(1)|lung(3)|ovary(2)|skin(1)	7		all_cancers(14;1.01e-50)|all_epithelial(14;6.7e-35)|all_lung(41;2.17e-14)|Lung NSC(41;4.95e-14)|Breast(6;3.4e-05)|Melanoma(20;0.000539)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|all_hematologic(60;0.0489)|Prostate(90;0.0513)		all cancers(3;3.83e-31)|Epithelial(3;1.36e-30)|OV - Ovarian serous cystadenocarcinoma(60;1.99e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00831)|READ - Rectum adenocarcinoma(43;0.155)		CTTGGCAGCTGTCCTTGGAAC	0.428																																						.											0													76.0	95.0	89.0					4																	190947558		2187	4296	6483	SO:0001819	synonymous_variant	448831				CCDS34123.1, CCDS68834.1	4q35.2	2014-09-04			ENSG00000205097	ENSG00000205097			19136	protein-coding gene	gene with protein product		609032				12176321, 15520407	Standard	NM_001005217		Approved	FRG2A		Q64ET8	OTTHUMG00000160339	ENST00000378763.1:c.312C>T	4.37:g.190947558G>A			B7ZMJ1|E7EN36	Silent	SNP	ENST00000378763.1	37	CCDS34123.1																																																																																				0.428	FRG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360294.1	NM_001005217	
FRG2	448831	mdanderson.org	37	4	190947570	190947570	+	Missense_Mutation	SNP	C	C	G	rs201749501		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:190947570C>G	ENST00000378763.1	-	3	352	c.300G>C	c.(298-300)atG>atC	p.M100I	FRG2_ENST00000504750.1_Missense_Mutation_p.M101I	NM_001005217.1|NM_001199232.1	NP_001005217.1|NP_001186161.1	Q64ET8	FRG2_HUMAN	FSHD region gene 2	100						nucleus (GO:0005634)				large_intestine(1)|lung(3)|ovary(2)|skin(1)	7		all_cancers(14;1.01e-50)|all_epithelial(14;6.7e-35)|all_lung(41;2.17e-14)|Lung NSC(41;4.95e-14)|Breast(6;3.4e-05)|Melanoma(20;0.000539)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|all_hematologic(60;0.0489)|Prostate(90;0.0513)		all cancers(3;3.83e-31)|Epithelial(3;1.36e-30)|OV - Ovarian serous cystadenocarcinoma(60;1.99e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00831)|READ - Rectum adenocarcinoma(43;0.155)		CCTTGGAACTCATTTTTCTTT	0.433																																						.											0													42.0	59.0	53.0					4																	190947570		1990	3891	5881	SO:0001583	missense	448831				CCDS34123.1, CCDS68834.1	4q35.2	2014-09-04			ENSG00000205097	ENSG00000205097			19136	protein-coding gene	gene with protein product		609032				12176321, 15520407	Standard	NM_001005217		Approved	FRG2A		Q64ET8	OTTHUMG00000160339	ENST00000378763.1:c.300G>C	4.37:g.190947570C>G	ENSP00000368039:p.Met100Ile		B7ZMJ1|E7EN36	Missense_Mutation	SNP	ENST00000378763.1	37	CCDS34123.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.136899	0.00030	.	.	ENSG00000205097	ENST00000504750;ENST00000378763	T;T	0.38077	1.16;1.16	0.352	-0.703	0.11261	.	1.639680	0.04326	N	0.351504	T	0.10809	0.0264	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12682	-1.0538	9	0.02654	T	1	.	.	.	.	.	101;100	E7EN36;Q64ET8	.;FRG2_HUMAN	I	101;100	ENSP00000424015:M101I;ENSP00000368039:M100I	ENSP00000368039:M100I	M	-	3	0	FRG2	191184564	0.481000	0.25941	0.001000	0.08648	0.001000	0.01503	-2.003000	0.01463	-1.489000	0.01844	-1.468000	0.01013	ATG		0.433	FRG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360294.1	NM_001005217	
FTCD	10841	mdanderson.org	37	21	47558473	47558473	+	Silent	SNP	G	G	C	rs1047179	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr21:47558473G>C	ENST00000291670.5	-	12	1435	c.1392C>G	c.(1390-1392)gcC>gcG	p.A464A	FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397743.1_Missense_Mutation_p.P450A|FTCD_ENST00000397746.3_Silent_p.A464A|FTCD_ENST00000359679.2_Silent_p.A464A|FTCD_ENST00000355384.2_Missense_Mutation_p.P450A|FTCD_ENST00000397748.1_Silent_p.A464A	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	464	Cyclodeaminase/cyclohydrolase. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	GTTCCTGCAGGGCCGGCCACA	0.711													C|||	2409	0.48103	0.5287	0.6599	5008	,	,		12121	0.4296		0.4771	False		,,,				2504	0.3466					.											0								C	,	2117,2151		576,965,593	6.0	9.0	8.0		1392,1392	-6.6	0.0	21	dbSNP_86	8	3866,4560		989,1888,1336	no	coding-synonymous,coding-synonymous	FTCD	NM_006657.2,NM_206965.1	,	1565,2853,1929	CC,CG,GG		45.8818,49.6017,47.1325	,	464/542,464/542	47558473	5983,6711	2134	4213	6347	SO:0001819	synonymous_variant	10841			U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.1392C>G	21.37:g.47558473G>C			B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Silent	SNP	ENST00000291670.5	37	CCDS13731.1	1071|1071	0.49038461538461536|0.49038461538461536	259|259	0.5264227642276422|0.5264227642276422	228|228	0.6298342541436464|0.6298342541436464	226|226	0.3951048951048951|0.3951048951048951	358|358	0.47229551451187335|0.47229551451187335	C|C	0|0	-2.731311|-2.731311	0.00089|0.00089	0.496017|0.496017	0.458818|0.458818	ENSG00000160282|ENSG00000160282	ENST00000355384;ENST00000397743|ENST00000446405	D;D|.	0.83673|.	-1.75;-1.75|.	4.23|4.23	-6.55|-6.55	0.01854|0.01854	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.41963|0.41963	-0.9479|-0.9479	6|3	.|.	.|.	.|.	.|.	3.3951|3.3951	0.07303|0.07303	0.1569:0.1253:0.1552:0.5626|0.1569:0.1253:0.1552:0.5626	rs1047179;rs3187204;rs17411992;rs57145963|rs1047179;rs3187204;rs17411992;rs57145963	450|.	B7WPK3|.	.|.	A|R	450|5	ENSP00000347545:P450A;ENSP00000380851:P450A|.	.|.	P|P	-|-	1|2	0|0	FTCD|FTCD	46382901|46382901	0.000000|0.000000	0.05858|0.05858	0.020000|0.020000	0.16555|0.16555	0.003000|0.003000	0.03518|0.03518	-2.827000|-2.827000	0.00746|0.00746	-1.536000|-1.536000	0.01738|0.01738	-2.002000|-2.002000	0.00443|0.00443	CCT|CCC		0.711	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1	NM_006657	
FZD4	8322	mdanderson.org	37	11	86662232	86662232	+	Silent	SNP	T	T	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:86662232T>C	ENST00000531380.1	-	2	1871	c.1566A>G	c.(1564-1566)agA>agG	p.R522R	PRSS23_ENST00000533902.2_Intron|PRSS23_ENST00000531521.1_Intron	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	522					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AACCATTTCCTCTCTTCTCTC	0.468																																						.											0													138.0	146.0	144.0					11																	86662232		2201	4299	6500	SO:0001819	synonymous_variant	8322			AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.1566A>G	11.37:g.86662232T>C			A8K9Q3|Q14C97|Q6S9E4	Silent	SNP	ENST00000531380.1	37	CCDS8279.1																																																																																				0.468	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2	NM_012193	
GGTLC2	91227	mdanderson.org	37	22	22988911	22988911	+	Silent	SNP	G	G	A	rs9612135	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr22:22988911G>A	ENST00000480559.1	+	1	96	c.96G>A	c.(94-96)ccG>ccA	p.P32P	POM121L1P_ENST00000402027.1_RNA|GGTLC2_ENST00000448514.1_Silent_p.P32P	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2	32					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)	p.P32P(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		TCTACACGCCGGTTGATGGGG	0.617													.|||	1847	0.36881	0.1505	0.6124	5008	,	,		7239	0.5109		0.4056	False		,,,				2504	0.3067					.											1	Substitution - coding silent(1)	prostate(1)											32.0	17.0	22.0					22																	22988911		2173	3963	6136	SO:0001819	synonymous_variant	91227			X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.96G>A	22.37:g.22988911G>A			A1A516|A2VCM9|Q5NV76|Q6ISH0	Silent	SNP	ENST00000480559.1	37	CCDS13802.2																																																																																				0.617	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321662.1	NM_199127	
GP6	51206	mdanderson.org	37	19	55525596	55525596	+	3'UTR	SNP	T	T	C	rs1654412	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:55525596T>C	ENST00000417454.1	-	0	1740				GP6_ENST00000333884.2_3'UTR|CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000310373.3_Missense_Mutation_p.R573G|CTC-550B14.7_ENST00000586845.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		ctcagccccctgagttgctgg	0.522													T|||	3589	0.716653	0.5	0.8228	5008	,	,		16885	0.8075		0.8459	False		,,,				2504	0.7076					.											0								T	GLY/ARG,	2026,1786		560,906,440	10.0	9.0	9.0		1717,	-0.5	0.0	19	dbSNP_89	9	6725,1383		2826,1073,155	no	missense,utr-3	GP6	NM_001083899.1,NM_016363.4	125,	3386,1979,595	CC,CT,TT		17.0572,46.852,26.5856	possibly-damaging,	573/621,	55525596	8751,3169	1906	4054	5960	SO:0001624	3_prime_UTR_variant	51206			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*693A>G	19.37:g.55525596T>C			Q9HCN7|Q9UIF2	Missense_Mutation	SNP	ENST00000417454.1	37	CCDS46184.1	1670	0.7646520146520146	264	0.5365853658536586	305	0.8425414364640884	467	0.8164335664335665	634	0.8364116094986808	T	6.398	0.441597	0.12164	0.53148	0.829428	ENSG00000088053	ENST00000310373	T	0.37915	1.17	0.235	-0.47	0.12131	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	P	0.37500	0.597	B	0.39119	0.291	T	0.44817	-0.9303	6	0.02654	T	1	.	.	.	.	rs1654412	573	Q9HCN6-3	.	G	573	ENSP00000308782:R573G	ENSP00000308782:R573G	R	-	1	2	GP6	60217408	0.009000	0.17119	0.009000	0.14445	0.009000	0.06853	-0.829000	0.04415	-0.912000	0.03837	-0.940000	0.02684	AGG		0.522	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1		
HSPD1	3329	mdanderson.org	37	2	198363501	198363501	+	Silent	SNP	C	C	T	rs201599915	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr2:198363501C>T	ENST00000388968.3	-	2	339	c.72G>A	c.(70-72)cgG>cgA	p.R24R	HSPE1-MOB4_ENST00000604458.1_5'Flank|HSPE1_ENST00000233893.5_5'Flank|HSPD1_ENST00000544407.1_Silent_p.R24R|HSPD1_ENST00000345042.2_Silent_p.R24R|HSPE1_ENST00000409468.1_5'Flank|HSPE1_ENST00000409729.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	24					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)	p.R24R(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			TGGCATAAGCCCGAGTGAGAT	0.502																																						.											1	Substitution - coding silent(1)	breast(1)											59.0	60.0	59.0					2																	198363501		2203	4300	6503	SO:0001819	synonymous_variant	3329			M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.72G>A	2.37:g.198363501C>T			B2R5M6|B7Z712|Q38L19|Q9UCR6	Silent	SNP	ENST00000388968.3	37	CCDS33357.1																																																																																				0.502	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
IPO5	3843	mdanderson.org	37	13	98670796	98670796	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr13:98670796A>T	ENST00000490680.1	+	23	2739	c.2674A>T	c.(2674-2676)Ata>Tta	p.I892L	IPO5_ENST00000261574.5_Missense_Mutation_p.I910L|IPO5_ENST00000539640.1_Missense_Mutation_p.I767L			O00410	IPO5_HUMAN	importin 5	892					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						TGATGATGTCATAGAACACTG	0.403																																						.											0													156.0	145.0	149.0					13																	98670796		2203	4300	6503	SO:0001583	missense	3843			U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2674A>T	13.37:g.98670796A>T	ENSP00000418393:p.Ile892Leu		B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	A	16.62	3.172782	0.57584	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.71	4.49	0.54785	.	0.138033	0.64402	D	0.000005	T	0.53206	0.1782	N	0.24115	0.695	0.44562	D	0.997528	B	0.17852	0.024	B	0.28916	0.096	T	0.45175	-0.9279	10	0.33940	T	0.23	-3.1146	10.5895	0.45302	0.8648:0.0:0.1352:0.0	.	910	O00410-3	.	L	910;892;892;767	ENSP00000261574:I910L;ENSP00000350219:I892L;ENSP00000418393:I892L;ENSP00000445126:I767L	ENSP00000261574:I910L	I	+	1	0	IPO5	97468797	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	1.739000	0.38217	0.954000	0.37851	0.528000	0.53228	ATA		0.403	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
IRF2BPL	64207	mdanderson.org	37	14	77493794	77493794	+	Silent	SNP	T	T	C	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr14:77493794T>C	ENST00000238647.3	-	1	1240	c.342A>G	c.(340-342)caA>caG	p.Q114Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgttgctgctgct	0.697													T|||	1146	0.228834	0.1649	0.1758	5008	,	,		5976	0.2659		0.2614	False		,,,				2504	0.2812					.											0								-		160,2330		6,148,1091	2.0	2.0	2.0		342	0.6	0.0	14	dbSNP_125	2	324,4012		7,310,1851	no	coding-synonymous	IRF2BPL	NM_024496.2		13,458,2942	CC,CT,TT		7.4723,6.4257,7.0905		114/797	77493794	484,6342	1245	2168	3413	SO:0001819	synonymous_variant	64207			AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342A>G	14.37:g.77493794T>C			Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																				0.697	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
MED27	9442	mdanderson.org	37	9	134735980	134735980	+	Missense_Mutation	SNP	G	G	A	rs557626461	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr9:134735980G>A	ENST00000292035.5	-	8	944	c.881C>T	c.(880-882)cCg>cTg	p.P294L	MED27_ENST00000357028.2_Missense_Mutation_p.P258L	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	294					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.P294L(4)|p.P294fs*>18(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		CCTCCATGTCGGGGGAAGGCC	0.597													G|||	40	0.00798722	0.003	0.0072	5008	,	,		18345	0.0		0.0169	False		,,,				2504	0.0143				Colon(41;784 923 6932 42329 52483)	.											5	Substitution - Missense(4)|Deletion - Frameshift(1)	endometrium(2)|kidney(2)|large_intestine(1)											30.0	29.0	29.0					9																	134735980		2203	4300	6503	SO:0001583	missense	9442			AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.881C>T	9.37:g.134735980G>A	ENSP00000292035:p.Pro294Leu		O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	ENST00000292035.5	37	CCDS6945.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095595	0.94197	.	.	ENSG00000160563	ENST00000292035;ENST00000357028;ENST00000372184	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.84014	0.5379	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	D	0.86894	0.2050	9	0.87932	D	0	-0.1478	16.105	0.81213	0.0:0.0:1.0:0.0	.	258;294	Q6P2C8-2;Q6P2C8	.;MED27_HUMAN	L	294;220;258	.	ENSP00000292035:P294L	P	-	2	0	MED27	133725801	1.000000	0.71417	0.949000	0.38748	0.987000	0.75469	7.762000	0.85270	2.472000	0.83506	0.655000	0.94253	CCG		0.597	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
KMT2C	58508	mdanderson.org	37	7	151945291	151945291	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr7:151945291G>A	ENST00000262189.6	-	14	2446	c.2228C>T	c.(2227-2229)cCt>cTt	p.P743L	KMT2C_ENST00000355193.2_Missense_Mutation_p.P743L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	743					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTCAATTGTAGGAGTCATTTC	0.378																																						.											0													79.0	77.0	77.0					7																	151945291		2203	4298	6501	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2228C>T	7.37:g.151945291G>A	ENSP00000262189:p.Pro743Leu		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	9.088	1.001012	0.19121	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.82984	-1.66;-1.67	5.53	3.69	0.42338	.	0.700771	0.12290	N	0.482124	T	0.67850	0.2937	N	0.12746	0.255	0.27555	N	0.950388	B	0.09022	0.002	B	0.06405	0.002	T	0.55673	-0.8104	10	0.25106	T	0.35	.	9.9948	0.41893	0.1645:0.0:0.8355:0.0	.	743	Q8NEZ4	MLL3_HUMAN	L	743	ENSP00000262189:P743L;ENSP00000347325:P743L	ENSP00000262189:P743L	P	-	2	0	MLL3	151576224	0.956000	0.32656	0.898000	0.35279	0.657000	0.38888	3.175000	0.50855	1.304000	0.44892	0.650000	0.86243	CCT		0.378	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MUC2	4583	mdanderson.org	37	11	1092860	1092860	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:1092860C>T	ENST00000441003.2	+	30	4706	c.4679C>T	c.(4678-4680)aCg>aTg	p.T1560M	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1561M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCCCAACAACGACACCCATC	0.627																																						.											0													126.0	161.0	149.0					11																	1092860		1924	3596	5520	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4679C>T	11.37:g.1092860C>T	ENSP00000415183:p.Thr1560Met		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	c	3.171	-0.170008	0.06461	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15718	2.4;2.8	1.61	0.458	0.16670	.	7739.210000	0.00465	U	0.000107	T	0.11623	0.0283	.	.	.	0.09310	N	1	D	0.60160	0.987	B	0.34489	0.184	T	0.37731	-0.9693	9	0.46703	T	0.11	.	7.5682	0.27892	0.2572:0.7428:0.0:0.0	.	1560	E7EUV1	.	M	1560;1561	ENSP00000415183:T1560M;ENSP00000351956:T1561M	ENSP00000351956:T1561M	T	+	2	0	MUC2	1082860	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.339000	0.19875	-0.001000	0.14495	0.109000	0.15622	ACG		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1092926	1092926	+	Missense_Mutation	SNP	C	C	G	rs377100070		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:1092926C>G	ENST00000441003.2	+	30	4772	c.4745C>G	c.(4744-4746)aCa>aGa	p.T1582R	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1583R	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1582R(1)|p.T1583R(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cagaccccaacatcgacaccc	0.632																																						.											2	Substitution - Missense(2)	prostate(2)						C	ARG/THR	24,3818		0,24,1897	77.0	115.0	102.0		4742	0.5	0.0	11		102	140,6992		0,140,3426	no	missense	MUC2	NM_002457.2	71	0,164,5323	GG,GC,CC		1.963,0.6247,1.4944	benign	1581/2813	1092926	164,10810	1921	3566	5487	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4745C>G	11.37:g.1092926C>G	ENSP00000415183:p.Thr1582Arg		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.792	-0.251014	0.05867	0.006247	0.01963	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14144	2.53;2.91	1.75	0.53	0.17102	.	18.926900	0.00496	U	0.000153	T	0.05227	0.0139	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.28364	-1.0046	9	0.45353	T	0.12	.	7.5493	0.27786	0.0:0.7315:0.2684:0.0	.	1582	E7EUV1	.	R	1582;1583	ENSP00000415183:T1582R;ENSP00000351956:T1583R	ENSP00000351956:T1583R	T	+	2	0	MUC2	1082926	0.001000	0.12720	0.001000	0.08648	0.035000	0.12851	0.551000	0.23361	1.016000	0.39470	0.121000	0.15741	ACA		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1092928	1092928	+	Missense_Mutation	SNP	T	T	A	rs12791677		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:1092928T>A	ENST00000441003.2	+	30	4774	c.4747T>A	c.(4747-4749)Tcg>Acg	p.S1583T	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.S1584T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gaccccaacatcgacacccat	0.632																																						.											0																																										SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4747T>A	11.37:g.1092928T>A	ENSP00000415183:p.Ser1583Thr		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	T	0.629	-0.817927	0.02776	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.12255	2.7;3.41	1.75	-3.51	0.04696	.	3.022220	0.02729	N	0.114829	T	0.06005	0.0156	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.29119	-1.0022	9	0.12766	T	0.61	.	0.5592	0.00676	0.2873:0.3401:0.1565:0.2162	.	1583	E7EUV1	.	T	1583;1584	ENSP00000415183:S1583T;ENSP00000351956:S1584T	ENSP00000351956:S1584T	S	+	1	0	MUC2	1082928	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-3.679000	0.00395	-2.640000	0.00429	-1.550000	0.00899	TCG		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1092951	1092951	+	Silent	SNP	T	T	C	rs62649761		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:1092951T>C	ENST00000441003.2	+	30	4797	c.4770T>C	c.(4768-4770)acT>acC	p.T1590T	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.T1591T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccactacggtgaccc	0.632																																						.											0													55.0	88.0	76.0					11																	1092951		1822	3339	5161	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4770T>C	11.37:g.1092951T>C			Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1093354	1093354	+	Missense_Mutation	SNP	T	T	A	rs56290335	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:1093354T>A	ENST00000441003.2	+	30	5200	c.5173T>A	c.(5173-5175)Tcc>Acc	p.S1725T	MUC2_ENST00000333592.6_Missense_Mutation_p.S13T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.S1692T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.S1725T(1)|p.S1692T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gacacccatctccaccaccac	0.647																																						.											2	Substitution - Missense(2)	stomach(2)											207.0	244.0	231.0					11																	1093354		1965	3771	5736	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5173T>A	11.37:g.1093354T>A	ENSP00000415183:p.Ser1725Thr		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	A	0.005	-2.130853	0.00338	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.05580	3.56;3.42;3.71	1.49	-2.99	0.05497	.	0.209755	0.18974	U	0.126050	T	0.02156	0.0067	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40232	-0.9574	9	0.07813	T	0.8	.	3.3544	0.07164	0.3578:0.2012:0.0:0.441	rs56290335;rs61051760	1725	E7EUV1	.	T	1725;1692;13	ENSP00000415183:S1725T;ENSP00000351956:S1692T;ENSP00000331373:S13T	ENSP00000331373:S13T	S	+	1	0	MUC2	1083354	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.518000	0.06267	-2.490000	0.00517	-1.234000	0.01563	TCC		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195509125	195509125	+	Missense_Mutation	SNP	C	C	A	rs71637183		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:195509125C>A	ENST00000463781.3	-	2	9785	c.9326G>T	c.(9325-9327)aGc>aTc	p.S3109I	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3109I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGGGCTAGTGACAGG	0.587																																						.											0													19.0	11.0	13.0					3																	195509125		668	1555	2223	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9326G>T	3.37:g.195509125C>A	ENSP00000417498:p.Ser3109Ile		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	4.067	0.010254	0.07912	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32023	1.48;1.47	.	.	.	.	.	.	.	.	T	0.14227	0.0344	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.27297	-1.0078	7	.	.	.	.	2.9998	0.06010	0.2466:0.2833:0.4701:0.0	.	2981	E7ESK3	.	I	3109	ENSP00000417498:S3109I;ENSP00000420243:S3109I	.	S	-	2	0	MUC4	196993904	0.000000	0.05858	0.033000	0.17914	0.000000	0.00434	-3.959000	0.00325	-0.889000	0.03950	0.000000	0.15137	AGC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509171	195509171	+	Missense_Mutation	SNP	G	G	A	rs71634716		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:195509171G>A	ENST00000463781.3	-	2	9739	c.9280C>T	c.(9280-9282)Ctt>Ttt	p.L3094F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3094F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L3094F(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.602																																						.											1	Substitution - Missense(1)	kidney(1)											13.0	10.0	11.0					3																	195509171		666	1549	2215	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9280C>T	3.37:g.195509171G>A	ENSP00000417498:p.Leu3094Phe		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	13.68	2.309979	0.40895	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36520	1.4;1.25	.	.	.	.	.	.	.	.	T	0.17280	0.0415	N	0.14661	0.345	0.09310	N	0.999996	P	0.47604	0.898	B	0.40165	0.321	T	0.07462	-1.0771	7	.	.	.	.	3.4791	0.07595	1.0E-4:1.0E-4:0.5545:0.4454	.	2966	E7ESK3	.	F	3094	ENSP00000417498:L3094F;ENSP00000420243:L3094F	.	L	-	1	0	MUC4	196993950	.	.	0.015000	0.15790	0.000000	0.00434	.	.	0.497000	0.27926	0.000000	0.15137	CTT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509586	195509586	+	Silent	SNP	T	T	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:195509586T>G	ENST00000463781.3	-	2	9324	c.8865A>C	c.(8863-8865)acA>acC	p.T2955T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2955T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGCGTGACCTGTGGATGCTG	0.592																																						.											0													9.0	8.0	8.0					3																	195509586		623	1469	2092	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8865A>C	3.37:g.195509586T>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510149	195510149	+	Missense_Mutation	SNP	G	G	A	rs542186658	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:195510149G>A	ENST00000463781.3	-	2	8761	c.8302C>T	c.(8302-8304)Cct>Tct	p.P2768S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2768S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P2768S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGCGTGA	0.577													.|||	2	0.000399361	0.0015	0.0	5008	,	,		5215	0.0		0.0	False		,,,				2504	0.0					.											1	Substitution - Missense(1)	endometrium(1)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8302C>T	3.37:g.195510149G>A	ENSP00000417498:p.Pro2768Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.381	0.255488	0.10185	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.27256	1.68;1.68	1.02	-2.03	0.07365	.	.	.	.	.	T	0.09158	0.0226	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33523	-0.9865	8	.	.	.	.	2.0272	0.03521	0.2702:0.0:0.2738:0.456	.	2640	E7ESK3	.	S	2768	ENSP00000417498:P2768S;ENSP00000420243:P2768S	.	P	-	1	0	MUC4	196994928	0.000000	0.05858	0.010000	0.14722	0.113000	0.19764	-2.060000	0.01392	-0.413000	0.07507	0.074000	0.15403	CCT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195513806	195513806	+	Missense_Mutation	SNP	C	C	G	rs199976859	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr3:195513806C>G	ENST00000463781.3	-	2	5104	c.4645G>C	c.(4645-4647)Gac>Cac	p.D1549H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D1549H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.M1535_T1550delMPLPVTSPSSASTGDT(4)|p.D1549H(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTCACCTGTGGAT	0.582																																						.											5	Deletion - In frame(4)|Substitution - Missense(1)	stomach(4)|kidney(1)											6.0	5.0	5.0					3																	195513806		644	1466	2110	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4645G>C	3.37:g.195513806C>G	ENSP00000417498:p.Asp1549His		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.687	0.127710	0.08981	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33654	1.41;1.4	0.844	0.844	0.18943	.	.	.	.	.	T	0.23649	0.0572	N	0.19112	0.55	0.09310	N	1	D	0.54964	0.969	P	0.47162	0.54	T	0.09100	-1.0690	8	.	.	.	.	3.7845	0.08694	0.0:0.6622:0.0:0.3378	.	1549	E7ESK3	.	H	1549	ENSP00000417498:D1549H;ENSP00000420243:D1549H	.	D	-	1	0	MUC4	196998201	0.000000	0.05858	0.071000	0.20095	0.071000	0.16799	-2.804000	0.00759	0.088000	0.17205	0.089000	0.15464	GAC		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MYH14	79784	mdanderson.org	37	19	50713655	50713655	+	Silent	SNP	G	G	C	rs8106196	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:50713655G>C	ENST00000596571.1	+	1	33	c.33G>C	c.(31-33)cgG>cgC	p.R11R	MYH14_ENST00000440075.2_Silent_p.R11R|MYH14_ENST00000598205.1_Silent_p.R11R|MYH14_ENST00000376970.2_Silent_p.R11R|MYH14_ENST00000601313.1_Silent_p.R11R|MYH14_ENST00000425460.1_Silent_p.R11R|MYH14_ENST00000262269.8_Silent_p.R11R			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	11					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGCCCGGGCGGAAGGCGCCCC	0.751													G|||	155	0.0309505	0.0651	0.0303	5008	,	,		8792	0.0		0.0338	False		,,,				2504	0.0143					.											0								G	,,	124,2870		1,122,1374	4.0	5.0	4.0		33,33,33	2.0	1.0	19	dbSNP_116	4	171,6701		2,167,3267	no	coding-synonymous,coding-synonymous,coding-synonymous	MYH14	NM_001077186.1,NM_001145809.1,NM_024729.3	,,	3,289,4641	CC,CG,GG		2.4884,4.1416,2.9901	,,	11/2004,11/2037,11/1996	50713655	295,9571	1497	3436	4933	SO:0001819	synonymous_variant	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.33G>C	19.37:g.50713655G>C			B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	ENST00000596571.1	37	CCDS59411.1																																																																																				0.751	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
NAA15	80155	mdanderson.org	37	4	140272727	140272727	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:140272727T>C	ENST00000296543.5	+	9	1299	c.976T>C	c.(976-978)Ttc>Ctc	p.F326L	NAA15_ENST00000398947.1_Missense_Mutation_p.F326L|NAA15_ENST00000480277.2_3'UTR	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	326					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						CCCACCAGTCTTCAATACTTT	0.328																																						.											0													103.0	102.0	102.0					4																	140272727		1811	4082	5893	SO:0001583	missense	80155			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.976T>C	4.37:g.140272727T>C	ENSP00000296543:p.Phe326Leu		D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	SNP	ENST00000296543.5	37	CCDS43270.1	.	.	.	.	.	.	.	.	.	.	T	35	5.482153	0.96307	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	T;T	0.58358	0.34;0.34	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.80132	0.4567	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85343	0.1097	10	0.72032	D	0.01	-9.7091	16.3786	0.83431	0.0:0.0:0.0:1.0	.	326	Q9BXJ9	NAA15_HUMAN	L	326;200;326	ENSP00000296543:F326L;ENSP00000381920:F326L	ENSP00000296543:F326L	F	+	1	0	NAA15	140492177	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.606000	0.82863	2.269000	0.75478	0.454000	0.30748	TTC		0.328	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	
NT5C3A	51251	mdanderson.org;bcgsc.ca	37	7	33054388	33054388	+	Missense_Mutation	SNP	T	T	C	rs79747830	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr7:33054388T>C	ENST00000242210.7	-	9	1041	c.965A>G	c.(964-966)gAt>gGt	p.D322G	NT5C3A_ENST00000381626.2_Missense_Mutation_p.D271G|NT5C3A_ENST00000610140.1_Missense_Mutation_p.D317G|NT5C3A_ENST00000405342.1_Missense_Mutation_p.D283G|NT5C3A_ENST00000409467.1_Missense_Mutation_p.D271G|NT5C3A_ENST00000396152.2_Missense_Mutation_p.D283G|AVL9_ENST00000404479.1_Intron	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	322					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.D322G(1)									TAATGATTCATCTTGTACTAA	0.353																																						.											1	Substitution - Missense(1)	skin(1)											103.0	105.0	104.0					7																	33054388		2203	4298	6501	SO:0001583	missense	0			AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.965A>G	7.37:g.33054388T>C	ENSP00000242210:p.Asp322Gly		A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Missense_Mutation	SNP	ENST00000242210.7	37	CCDS34616.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.714928	0.89112	.	.	ENSG00000122643	ENST00000381626;ENST00000396152;ENST00000242210;ENST00000405342;ENST00000409467	D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5	5.94	5.94	0.96194	HAD-like domain (1);	0.323125	0.35646	N	0.003065	D	0.95564	0.8558	M	0.93197	3.39	0.80722	D	1	P;P	0.50369	0.934;0.553	P;P	0.60949	0.881;0.531	D	0.96469	0.9347	10	0.87932	D	0	.	16.4075	0.83691	0.0:0.0:0.0:1.0	.	322;283	Q9H0P0;Q9H0P0-1	5NT3_HUMAN;.	G	271;283;322;283;271	ENSP00000371039:D271G;ENSP00000379456:D283G;ENSP00000242210:D322G;ENSP00000385261:D283G;ENSP00000387166:D271G	ENSP00000242210:D322G	D	-	2	0	NT5C3	33020913	1.000000	0.71417	0.960000	0.40013	0.989000	0.77384	8.040000	0.89188	2.275000	0.75901	0.528000	0.53228	GAT		0.353	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1	NM_016489	
NCF1	653361	mdanderson.org	37	7	74193718	74193718	+	Silent	SNP	C	C	T	rs17356100	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr7:74193718C>T	ENST00000289473.4	+	4	415	c.345C>T	c.(343-345)ctC>ctT	p.L115L	NCF1_ENST00000443956.3_3'UTR	NM_000265.4	NP_000256.4	P14598	NCF1_HUMAN	neutrophil cytosolic factor 1	115	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular defense response (GO:0006968)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|leukotriene metabolic process (GO:0006691)|negative regulation of smooth muscle contraction (GO:0045986)|neutrophil mediated killing of fungus (GO:0070947)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|protein targeting to membrane (GO:0006612)|respiratory burst (GO:0045730)|respiratory burst involved in defense response (GO:0002679)|response to yeast (GO:0001878)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagolysosome (GO:0032010)|rough endoplasmic reticulum (GO:0005791)	electron carrier activity (GO:0009055)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.L115L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(3)	10					Dextromethorphan(DB00514)	CCCACCTCCTCGACTTCTTCA	0.637																																						.											1	Substitution - coding silent(1)	endometrium(1)																																								SO:0001819	synonymous_variant	653361			M25665	CCDS34657.1	7q11.23	2014-09-17	2008-07-31		ENSG00000158517	ENSG00000158517			7660	protein-coding gene	gene with protein product	"""NADPH oxidase organizer 2"", ""chronic granulomatous disease, autosomal 1"""	608512	"""neutrophil cytosolic factor 1 (47kD, chronic granulomatous disease, autosomal 1)"""				Standard	NM_000265		Approved	p47phox, NOXO2, NCF1A, SH3PXD1A	uc022aft.1	P14598	OTTHUMG00000149965	ENST00000289473.4:c.345C>T	7.37:g.74193718C>T			A6NEH2|A8K7S9|O43842|Q2PP07|Q53FR5|Q9BU90|Q9BXI7|Q9BXI8|Q9UDV9|Q9UMU2	Silent	SNP	ENST00000289473.4	37	CCDS34657.1																																																																																				0.637	NCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314560.1	NM_000265	
OR8H3	390152	mdanderson.org	37	11	55889950	55889950	+	Silent	SNP	C	C	G	rs145348383	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:55889950C>G	ENST00000313472.3	+	1	102	c.102C>G	c.(100-102)ctC>ctG	p.L34L		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TATTTCTCCTCATATACCTAA	0.453													G|||	9	0.00179712	0.0023	0.0014	5008	,	,		19598	0.002		0.0	False		,,,				2504	0.0031					.											0													232.0	227.0	229.0					11																	55889950		2201	4296	6497	SO:0001819	synonymous_variant	390152			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.102C>G	11.37:g.55889950C>G			Q6IFB7	Silent	SNP	ENST00000313472.3	37	CCDS31519.1																																																																																				0.453	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201	
OR5M9	390162	mdanderson.org	37	11	56230790	56230790	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:56230790G>T	ENST00000279791.1	-	1	87	c.88C>A	c.(88-90)Cta>Ata	p.L30I		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					TAAACCGCTAGGAACACCACA	0.433																																						.											0													52.0	51.0	51.0					11																	56230790		2201	4296	6497	SO:0001583	missense	390162			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.88C>A	11.37:g.56230790G>T	ENSP00000279791:p.Leu30Ile		Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.837227	0.32513	.	.	ENSG00000150269	ENST00000279791	T	0.01854	4.6	4.82	0.603	0.17541	.	0.000000	0.35615	N	0.003085	T	0.10895	0.0266	M	0.88906	2.99	0.27153	N	0.961363	D	0.76494	0.999	D	0.87578	0.998	T	0.03166	-1.1065	10	0.72032	D	0.01	-4.7656	5.3013	0.15780	0.2686:0.0:0.5859:0.1455	.	30	Q8NGP3	OR5M9_HUMAN	I	30	ENSP00000279791:L30I	ENSP00000279791:L30I	L	-	1	2	OR5M9	55987366	0.000000	0.05858	0.485000	0.27403	0.065000	0.16274	-0.600000	0.05693	0.147000	0.19030	-0.272000	0.10252	CTA		0.433	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
PLEC	5339	mdanderson.org	37	8	144997656	144997656	+	Silent	SNP	C	C	T	rs7016416	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr8:144997656C>T	ENST00000322810.4	-	31	7021	c.6852G>A	c.(6850-6852)gcG>gcA	p.A2284A	PLEC_ENST00000357649.2_Silent_p.A2151A|PLEC_ENST00000356346.3_Silent_p.A2133A|PLEC_ENST00000354589.3_Silent_p.A2147A|PLEC_ENST00000398774.2_Silent_p.A2115A|PLEC_ENST00000436759.2_Silent_p.A2174A|PLEC_ENST00000527096.1_Silent_p.A2170A|PLEC_ENST00000354958.2_Silent_p.A2125A|PLEC_ENST00000345136.3_Silent_p.A2147A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2284	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTGCCCGCCGCGCCGCCTCTT	0.692													C|||	1153	0.230232	0.028	0.2954	5008	,	,		12031	0.1429		0.4245	False		,,,				2504	0.3476					.											0								C	,,,,,,,	329,3527		26,277,1625	8.0	11.0	10.0		6522,6399,6375,6852,6345,6441,6453,6441	-7.4	0.0	8	dbSNP_116	10	3097,4915		616,1865,1525	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	642,2142,3150	TT,TC,CC		38.6545,8.5322,28.8675	,,,,,,,	2174/4575,2133/4534,2125/4526,2284/4685,2115/4516,2147/4548,2151/4552,2147/4548	144997656	3426,8442	1928	4006	5934	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6852G>A	8.37:g.144997656C>T			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																				0.692	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PSPC1	55269	mdanderson.org	37	13	20279800	20279800	+	Splice_Site	SNP	A	A	G	rs199978034		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr13:20279800A>G	ENST00000338910.4	-	8	1546		c.e8+1			NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1						negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		ATGATACATTACCACTGCTCC	0.403																																						.											0													18.0	20.0	19.0					13																	20279800		1778	4021	5799	SO:0001630	splice_region_variant	55269			AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.1386+1T>C	13.37:g.20279800A>G			Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Splice_Site	SNP	ENST00000338910.4	37	CCDS41870.1	.	.	.	.	.	.	.	.	.	.	A	19.67	3.870370	0.72065	.	.	ENSG00000121390	ENST00000338910;ENST00000422828	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1232	0.72460	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PSPC1	19177800	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.069000	0.89491	2.044000	0.60594	0.402000	0.26972	.		0.403	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2		Intron
RNFT2	84900	mdanderson.org	37	12	117187907	117187907	+	Silent	SNP	T	T	C	rs111256849	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:117187907T>C	ENST00000257575.4	+	4	578	c.345T>C	c.(343-345)caT>caC	p.H115H	RNFT2_ENST00000407967.3_Silent_p.H115H|RNFT2_ENST00000319176.7_Silent_p.H115H|RNFT2_ENST00000392549.2_Silent_p.H115H			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	115	His-rich.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		CCCACCACCATTTCCACCATG	0.746													C|||	1284	0.25639	0.4826	0.1326	5008	,	,		12011	0.1786		0.166	False		,,,				2504	0.2117					.											0								C	,	1295,2539		234,827,856	3.0	4.0	4.0		345,345	3.2	1.0	12	dbSNP_132	4	888,6786		67,754,3016	no	coding-synonymous,coding-synonymous	RNFT2	NM_001109903.1,NM_032814.3	,	301,1581,3872	CC,CT,TT		11.5715,33.7767,18.9694	,	115/445,115/421	117187907	2183,9325	1917	3837	5754	SO:0001819	synonymous_variant	84900			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.345T>C	12.37:g.117187907T>C			E9PAM7|Q96SU5	Silent	SNP	ENST00000257575.4	37	CCDS44987.1																																																																																				0.746	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
SIRPB1	10326	mdanderson.org	37	20	1559300	1559300	+	Missense_Mutation	SNP	T	T	G	rs202017659	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr20:1559300T>G	ENST00000381605.4	-	2	181	c.117A>C	c.(115-117)gaA>gaC	p.E39D	RP4-576H24.4_ENST00000564763.1_Missense_Mutation_p.E39D|SIRPB1_ENST00000262929.5_Missense_Mutation_p.E38D|SIRPB1_ENST00000381603.3_Missense_Mutation_p.E39D	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	39	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						ATACGGACTTTTCAGGCTGAA	0.532													t|||	53	0.0105831	0.0061	0.0101	5008	,	,		16142	0.0089		0.0119	False		,,,				2504	0.0174					.											0													87.0	81.0	83.0					20																	1559300		2198	4243	6441	SO:0001583	missense	10326			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.117A>C	20.37:g.1559300T>G	ENSP00000371018:p.Glu39Asp		A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	37	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	4.035	0.003997	0.07866	.	.	ENSG00000101307	ENST00000381605;ENST00000381603;ENST00000262929	T;T;T	0.65732	-0.17;-0.17;-0.17	2.36	-4.72	0.03269	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.862007	0.10312	N	0.689832	T	0.43277	0.1240	L	0.27053	0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.12837	0.008;0.005	T	0.17167	-1.0378	10	0.23302	T	0.38	.	9.5019	0.39022	0.0:0.3277:0.5576:0.1147	.	39;39	O00241;O00241-2	SIRB1_HUMAN;.	D	39;39;38	ENSP00000371018:E39D;ENSP00000371016:E39D;ENSP00000262929:E38D	ENSP00000262929:E38D	E	-	3	2	SIRPB1	1507300	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.343000	0.02642	-4.273000	0.00060	-4.604000	0.00004	GAA		0.532	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
TAS2R31	259290	mdanderson.org	37	12	11183793	11183793	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:11183793G>C	ENST00000390675.2	-	1	213	c.142C>G	c.(142-144)Ctc>Gtc	p.L48V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	48					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						AGAGCAGTGAGAATCTGGTCA	0.378																																						.											0													73.0	77.0	76.0					12																	11183793		1984	4234	6218	SO:0001583	missense	259290			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.142C>G	12.37:g.11183793G>C	ENSP00000375093:p.Leu48Val		P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	37	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.416943	0.25552	.	.	ENSG00000256436	ENST00000390675	T	0.01484	4.84	2.45	1.45	0.22620	.	.	.	.	.	T	0.07818	0.0196	M	0.94142	3.5	0.09310	N	1	P	0.41450	0.75	P	0.47827	0.558	T	0.05716	-1.0868	9	0.56958	D	0.05	.	6.1115	0.20104	0.0:0.0:0.6975:0.3025	.	48	P59538	T2R31_HUMAN	V	48	ENSP00000375093:L48V	ENSP00000375093:L48V	L	-	1	0	TAS2R31	11075060	0.077000	0.21312	0.006000	0.13384	0.092000	0.18411	0.787000	0.26858	0.299000	0.22661	0.194000	0.17425	CTC		0.378	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
TAS2R31	259290	mdanderson.org	37	12	11183809	11183809	+	Silent	SNP	A	A	G			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr12:11183809A>G	ENST00000390675.2	-	1	197	c.126T>C	c.(124-126)tcT>tcC	p.S42S	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	42					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						GGTCAGCAAAAGAGATCTTTT	0.388																																						.											0													68.0	71.0	70.0					12																	11183809		1988	4220	6208	SO:0001819	synonymous_variant	259290			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.126T>C	12.37:g.11183809A>G			P59547|Q17R84|Q645X5	Silent	SNP	ENST00000390675.2	37	CCDS53747.1																																																																																				0.388	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
TBC1D29	26083	mdanderson.org	37	17	28887148	28887148	+	Missense_Mutation	SNP	T	T	A	rs200596738		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr17:28887148T>A	ENST00000580161.1	+	3	2523	c.26T>A	c.(25-27)cTa>cAa	p.L9Q	RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_Missense_Mutation_p.L9Q|TBC1D29_ENST00000584297.1_Missense_Mutation_p.L9Q			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	9	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.L9Q(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				AAGGAAGGTCTATGCACACAG	0.607																																						.											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											51.0	46.0	48.0					17																	28887148		2203	4300	6503	SO:0001583	missense	26083			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.26T>A	17.37:g.28887148T>A	ENSP00000462799:p.Leu9Gln			Missense_Mutation	SNP	ENST00000580161.1	37	CCDS32606.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	.	10.28	1.307657	0.23821	.	.	ENSG00000197689	ENST00000329040;ENST00000378698	.	.	.	0.15	0.15	0.14883	Rab-GAP/TBC domain (2);	.	.	.	.	T	0.54498	0.1862	M	0.62723	1.935	0.09310	N	1	D	0.62365	0.991	D	0.68039	0.955	T	0.41752	-0.9491	7	0.87932	D	0	.	.	.	.	.	9	Q9UFV1	TBC29_HUMAN	Q	9	.	ENSP00000330052:L9Q	L	+	2	0	TBC1D29	25911274	0.000000	0.05858	0.025000	0.17156	0.025000	0.11179	-0.060000	0.11712	0.168000	0.19655	0.166000	0.16787	CTA		0.607	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
TEX33	339669	mdanderson.org	37	22	37387257	37387257	+	Missense_Mutation	SNP	T	T	C	rs9610624	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr22:37387257T>C	ENST00000405091.2	-	7	1057	c.806A>G	c.(805-807)tAt>tGt	p.Y269C	TEX33_ENST00000381821.1_Missense_Mutation_p.Y269C|TEX33_ENST00000402860.3_Missense_Mutation_p.Y184C			O43247	TEX33_HUMAN	testis expressed 33	269																	GTTTTCTCCATATTTCTCTTC	0.438													T|||	585	0.116813	0.1369	0.1801	5008	,	,		21699	0.0813		0.0885	False		,,,				2504	0.1104					.											0								T	CYS/TYR,CYS/TYR	661,3745	281.6+/-276.1	52,557,1594	181.0	174.0	176.0		806,551	0.9	0.1	22	dbSNP_119	176	671,7929	168.4+/-220.0	28,615,3657	yes	missense,missense	C22orf33	NM_001163857.1,NM_178552.3	194,194	80,1172,5251	CC,CT,TT		7.8023,15.0023,10.2414	probably-damaging,probably-damaging	269/281,184/196	37387257	1332,11674	2203	4300	6503	SO:0001583	missense	339669			BC042635	CCDS13937.1, CCDS54524.1	22q12.3	2013-10-11	2012-02-16	2012-02-16	ENSG00000185264	ENSG00000185264			28568	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 33"""	C22orf33		22332119	Standard	NM_178552		Approved	MGC35206, EAN57	uc003aqf.3	O43247	OTTHUMG00000150531	ENST00000405091.2:c.806A>G	22.37:g.37387257T>C	ENSP00000386118:p.Tyr269Cys		B1AH46|Q6ICF2|Q8IVQ2|Q9Y4V8	Missense_Mutation	SNP	ENST00000405091.2	37	CCDS54524.1	229|229	0.10485347985347986|0.10485347985347986	68|68	0.13821138211382114|0.13821138211382114	56|56	0.15469613259668508|0.15469613259668508	39|39	0.06818181818181818|0.06818181818181818	66|66	0.0870712401055409|0.0870712401055409	T|T	10.31|10.31	1.315712|1.315712	0.23908|0.23908	0.150023|0.150023	0.078023|0.078023	ENSG00000185264|ENSG00000185264	ENST00000442538|ENST00000402860;ENST00000405091;ENST00000381821	.|.	.|.	.|.	4.43|4.43	0.878|0.878	0.19150|0.19150	.|.	.|1.510860	.|0.04364	.|N	.|0.357914	T|T	0.00210|0.00210	0.0006|0.0006	L|L	0.27053|0.27053	0.805|0.805	0.49798|0.49798	P|P	1.7800000000001148E-4|1.7800000000001148E-4	.|D	.|0.61697	.|0.99	.|P	.|0.50192	.|0.634	T|T	0.08371|0.08371	-1.0725|-1.0725	4|8	.|0.59425	.|D	.|0.04	2.9586|2.9586	8.6414|8.6414	0.33978|0.33978	0.7144:0.0:0.0:0.2856|0.7144:0.0:0.0:0.2856	rs9610624;rs52812150;rs58780254;rs9610624|rs9610624;rs52812150;rs58780254;rs9610624	.|269	.|O43247	.|EAN57_HUMAN	M|C	127|184;269;269	.|.	.|ENSP00000371243:Y269C	I|Y	-|-	3|2	3|0	C22orf33|C22orf33	35717203|35717203	0.022000|0.022000	0.18835|0.18835	0.062000|0.062000	0.19696|0.19696	0.175000|0.175000	0.22909|0.22909	0.127000|0.127000	0.15790|0.15790	-0.141000|-0.141000	0.11374|0.11374	0.460000|0.460000	0.39030|0.39030	ATA|TAT		0.438	TEX33-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318778.2	NM_178552	
VCX3B	425054	mdanderson.org	37	X	8434368	8434368	+	Missense_Mutation	SNP	G	G	C	rs199956874		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chrX:8434368G>C	ENST00000381032.1	+	3	992	c.685G>C	c.(685-687)Gag>Cag	p.E229Q	VCX3B_ENST00000453306.1_Intron|VCX3B_ENST00000440654.2_Intron|VCX3B_ENST00000381029.4_Missense_Mutation_p.E197Q|VCX3B_ENST00000444481.1_Missense_Mutation_p.E199Q	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	229	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						TCAGGAGAGCGAGATGGAAGA	0.552																																						.											0													107.0	224.0	188.0					X																	8434368		1821	4116	5937	SO:0001583	missense	425054				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.685G>C	X.37:g.8434368G>C	ENSP00000370420:p.Glu229Gln		C9JS46|Q4KN12	Missense_Mutation	SNP	ENST00000381032.1	37	CCDS48077.2	.	.	.	.	.	.	.	.	.	.	N	0.117	-1.130626	0.01756	.	.	ENSG00000205642	ENST00000381032;ENST00000444481;ENST00000381029	T;T;T	0.17213	2.29;2.29;2.29	0.601	0.601	0.17529	.	.	.	.	.	T	0.06280	0.0162	N	0.04508	-0.205	0.09310	N	1	B	0.11235	0.004	B	0.01281	0.0	T	0.44360	-0.9333	9	0.11794	T	0.64	.	6.2349	0.20758	0.0:0.3789:0.621:0.0	.	199	Q9H321	VCX3B_HUMAN	Q	229;199;197	ENSP00000370420:E229Q;ENSP00000414780:E199Q;ENSP00000370417:E197Q	ENSP00000370417:E197Q	E	+	1	0	VCX3B	8394368	0.004000	0.15560	0.001000	0.08648	0.006000	0.05464	-1.478000	0.02329	-0.223000	0.09943	-1.002000	0.02502	GAG		0.552	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055691.1		
VCX3B	425054	mdanderson.org	37	X	8434371	8434371	+	Missense_Mutation	SNP	A	A	G	rs113934664		TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chrX:8434371A>G	ENST00000381032.1	+	3	995	c.688A>G	c.(688-690)Atg>Gtg	p.M230V	VCX3B_ENST00000453306.1_Intron|VCX3B_ENST00000440654.2_Intron|VCX3B_ENST00000381029.4_Missense_Mutation_p.M198V|VCX3B_ENST00000444481.1_Missense_Mutation_p.M200V	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	230	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						GGAGAGCGAGATGGAAGAACC	0.562													-|||	45	0.0119205	0.0257	0.0029	3775	,	,		6024	0.005		0.002	False		,,,				2504	0.002					.											0													110.0	235.0	197.0					X																	8434371		1822	4119	5941	SO:0001583	missense	425054				CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.688A>G	X.37:g.8434371A>G	ENSP00000370420:p.Met230Val		C9JS46|Q4KN12	Missense_Mutation	SNP	ENST00000381032.1	37	CCDS48077.2	.	.	.	.	.	.	.	.	.	.	N	0	-2.811973	0.00073	.	.	ENSG00000205642	ENST00000381032;ENST00000444481;ENST00000381029	T;T;T	0.12361	2.69;2.69;2.69	0.601	-1.2	0.09554	.	.	.	.	.	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.37454	-0.9705	9	0.26408	T	0.33	.	3.1275	0.06412	0.4758:0.2846:0.2396:0.0	.	200	Q9H321	VCX3B_HUMAN	V	230;200;198	ENSP00000370420:M230V;ENSP00000414780:M200V;ENSP00000370417:M198V	ENSP00000370417:M198V	M	+	1	0	VCX3B	8394371	0.012000	0.17670	0.003000	0.11579	0.011000	0.07611	-1.907000	0.01589	-1.815000	0.01222	-1.090000	0.02178	ATG		0.562	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055691.1		
ZNF285	26974	mdanderson.org	37	19	44892153	44892153	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr19:44892153G>C	ENST00000330997.4	-	4	318	c.254C>G	c.(253-255)aCt>aGt	p.T85S	ZNF285_ENST00000591679.1_Missense_Mutation_p.T92S|ZNF285_ENST00000544719.2_Missense_Mutation_p.T85S|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	85	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T85S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						CTGACTCACAGTTAAATCCCG	0.413																																						.											1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	26974			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.254C>G	19.37:g.44892153G>C	ENSP00000333595:p.Thr85Ser		Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	8.428	0.848004	0.17034	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.06933	3.24	3.33	-0.0471	0.13844	Krueppel-associated box (1);	.	.	.	.	T	0.04318	0.0119	L	0.27053	0.805	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.06405	0.002;0.002	T	0.46679	-0.9174	9	0.09338	T	0.73	.	3.2813	0.06916	0.2593:0.2247:0.516:0.0	.	109;85	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	S	108;85	ENSP00000333595:T85S	ENSP00000333595:T85S	T	-	2	0	ZNF285	49583993	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	0.199000	0.17237	0.247000	0.21414	0.454000	0.30748	ACT		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ZNF469	84627	mdanderson.org	37	16	88495407	88495407	+	Missense_Mutation	SNP	G	G	C	rs7199961	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr16:88495407G>C	ENST00000437464.1	+	1	1529	c.1529G>C	c.(1528-1530)gGc>gCc	p.G510A	ZNF469_ENST00000565624.1_Missense_Mutation_p.G510A	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	510	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCGCGGGGGGCCCCGAGTGG	0.721													C|||	4966	0.991613	0.9811	0.9971	5008	,	,		10507	0.996		0.996	False		,,,				2504	0.9928					.											0													2.0	4.0	3.0					16																	88495407		449	1186	1635	SO:0001583	missense	84627			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.1529G>C	16.37:g.88495407G>C	ENSP00000402343:p.Gly510Ala			Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	2106	0.9642857142857143	474	0.9634146341463414	350	0.9668508287292817	544	0.951048951048951	738	0.9736147757255936	C	1.519	-0.547375	0.04024	.	.	ENSG00000225614	ENST00000437464	T	0.14022	2.54	4.88	-1.03	0.10102	.	.	.	.	.	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.18618	-1.0331	8	0.11182	T	0.66	.	8.8169	0.35000	0.0:0.3133:0.5324:0.1543	rs7199961;rs60057178	510	Q96JG9	ZN469_HUMAN	A	510	ENSP00000402343:G510A	ENSP00000402343:G510A	G	+	2	0	ZNF469	87022908	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.152000	0.16302	-0.814000	0.04352	-0.647000	0.03941	GGC		0.721	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF732	654254	mdanderson.org	37	4	289864	289864	+	Silent	SNP	C	C	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:289864C>T	ENST00000419098.1	-	2	94	c.84G>A	c.(82-84)ttG>ttA	p.L28L		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						CATCTCTATACAAATTCTGCT	0.408																																						.											0													32.0	32.0	32.0					4																	289864		692	1591	2283	SO:0001819	synonymous_variant	654254			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.84G>A	4.37:g.289864C>T				Silent	SNP	ENST00000419098.1	37	CCDS46990.1																																																																																				0.408	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
ZNF732	654254	mdanderson.org	37	4	289878	289878	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:289878C>A	ENST00000419098.1	-	2	80	c.70G>T	c.(70-72)Gcc>Tcc	p.A24S		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	24	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TTCTGCTGGGCAGGGTCCAGG	0.418																																						.											0													33.0	32.0	32.0					4																	289878		692	1590	2282	SO:0001583	missense	654254			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.70G>T	4.37:g.289878C>A	ENSP00000415774:p.Ala24Ser			Missense_Mutation	SNP	ENST00000419098.1	37	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	C	3.894	-0.023332	0.07634	.	.	ENSG00000186777	ENST00000419098	T	0.02258	4.37	1.22	-2.43	0.06522	Krueppel-associated box (4);	.	.	.	.	T	0.03263	0.0095	M	0.65677	2.01	0.09310	N	1	B	0.32350	0.366	B	0.37692	0.256	T	0.36939	-0.9727	9	0.42905	T	0.14	.	2.9027	0.05711	0.0:0.4666:0.2847:0.2487	.	24	B4DXR9	ZN732_HUMAN	S	24	ENSP00000415774:A24S	ENSP00000415774:A24S	A	-	1	0	ZNF732	279878	0.000000	0.05858	0.085000	0.20634	0.087000	0.18053	-1.157000	0.03157	-0.694000	0.05113	-0.680000	0.03767	GCC		0.418	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
ZNF732	654254	mdanderson.org	37	4	289881	289881	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:289881G>T	ENST00000419098.1	-	2	77	c.67C>A	c.(67-69)Cct>Act	p.P23T		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	23	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TGCTGGGCAGGGTCCAGGCAT	0.413																																						.											0													35.0	33.0	34.0					4																	289881		692	1590	2282	SO:0001583	missense	654254			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.67C>A	4.37:g.289881G>T	ENSP00000415774:p.Pro23Thr			Missense_Mutation	SNP	ENST00000419098.1	37	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.337467	0.00224	.	.	ENSG00000186777	ENST00000419098	T	0.02472	4.28	1.22	1.22	0.21188	Krueppel-associated box (4);	.	.	.	.	T	0.02888	0.0086	L	0.56340	1.77	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.49771	-0.8904	9	0.08599	T	0.76	.	5.3307	0.15930	0.0:0.0:1.0:0.0	.	23	B4DXR9	ZN732_HUMAN	T	23	ENSP00000415774:P23T	ENSP00000415774:P23T	P	-	1	0	ZNF732	279881	0.000000	0.05858	0.122000	0.21767	0.125000	0.20455	-0.620000	0.05565	0.300000	0.22699	0.305000	0.20034	CCT		0.413	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
ZNF732	654254	mdanderson.org	37	4	289888	289888	+	Silent	SNP	G	G	A			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:289888G>A	ENST00000419098.1	-	2	70	c.60C>T	c.(58-60)tgC>tgT	p.C20C		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						CAGGGTCCAGGCATTTCCACT	0.403																																						.											0													35.0	33.0	34.0					4																	289888		692	1590	2282	SO:0001819	synonymous_variant	654254			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.60C>T	4.37:g.289888G>A				Silent	SNP	ENST00000419098.1	37	CCDS46990.1																																																																																				0.403	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
ZNF732	654254	mdanderson.org	37	4	289928	289928	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr4:289928C>T	ENST00000419098.1	-	2	30	c.20G>A	c.(19-21)aGg>aAg	p.R7K		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	7	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						GGCCACATCCCTGAATGTTAA	0.403																																						.											0													30.0	27.0	28.0					4																	289928		692	1591	2283	SO:0001583	missense	654254			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.20G>A	4.37:g.289928C>T	ENSP00000415774:p.Arg7Lys			Missense_Mutation	SNP	ENST00000419098.1	37	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.600030	0.46318	.	.	ENSG00000186777	ENST00000419098	T	0.01369	4.97	1.22	0.0332	0.14179	Krueppel-associated box (4);	.	.	.	.	T	0.00998	0.0033	N	0.17723	0.515	0.09310	N	1	P	0.34615	0.459	B	0.35114	0.196	T	0.49021	-0.8982	9	0.19590	T	0.45	.	3.811	0.08796	0.0:0.6812:0.0:0.3188	.	7	B4DXR9	ZN732_HUMAN	K	7	ENSP00000415774:R7K	ENSP00000415774:R7K	R	-	2	0	ZNF732	279928	0.652000	0.27349	0.849000	0.33467	0.849000	0.48306	-1.168000	0.03123	0.300000	0.22699	0.305000	0.20034	AGG		0.403	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
CD55	1604	bcgsc.ca	37	1	207510059	207510059	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr1:207510059T>C	ENST00000367064.3	+	7	1133	c.875T>C	c.(874-876)gTc>gCc	p.V292A	CD55_ENST00000391920.4_Missense_Mutation_p.V292A|CD55_ENST00000367063.2_Missense_Mutation_p.V292A|CD55_ENST00000465534.1_3'UTR|CD55_ENST00000314754.8_Missense_Mutation_p.V292A|CD55_ENST00000367065.5_Missense_Mutation_p.V292A|CD55_ENST00000391921.4_Missense_Mutation_p.V228A|CD55_ENST00000367062.4_Missense_Mutation_p.V292A|CD55_ENST00000367067.4_3'UTR	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	292	Ser/Thr-rich.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	ACTTCCAAGGTCCCACCAACA	0.408																																						.											0													164.0	157.0	159.0					1																	207510059		2203	4300	6503	SO:0001583	missense	1604			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.875T>C	1.37:g.207510059T>C	ENSP00000356031:p.Val292Ala		B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	ENST00000367064.3	37	CCDS31006.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	1.626|1.626	-0.520334|-0.520334	0.04171|0.04171	.|.	.|.	ENSG00000196352|ENSG00000196352	ENST00000343420|ENST00000367064;ENST00000367063;ENST00000391921;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	.|T;T;T;T;T;T;T	.|0.36157	.|1.32;1.52;1.71;1.44;1.41;1.27;1.3	4.39|4.39	-2.22|-2.22	0.06952|0.06952	.|.	.|2.417300	.|0.01718	.|N	.|0.028155	T|T	0.21674|0.21674	0.0522|0.0522	N|N	0.02296|0.02296	-0.605|-0.605	0.09310|0.09310	N|N	0.999995|0.999995	.|B;P;B;B;B;B	.|0.40970	.|0.005;0.734;0.0;0.001;0.0;0.001	.|B;P;B;B;B;B	.|0.51550	.|0.003;0.673;0.001;0.006;0.001;0.003	T|T	0.17440|0.17440	-1.0369|-1.0369	5|10	.|0.08599	.|T	.|0.76	.|.	4.9011|4.9011	0.13775|0.13775	0.0:0.3138:0.1619:0.5243|0.0:0.3138:0.1619:0.5243	.|.	.|292;228;292;292;292;292	.|Q14UF6;B1AP15;Q14UF4;P08174-2;P08174;B1AP13	.|.;.;.;.;DAF_HUMAN;.	P|A	302|292;292;228;228;292;292;292;292	.|ENSP00000356031:V292A;ENSP00000356030:V292A;ENSP00000375788:V228A;ENSP00000316333:V292A;ENSP00000356032:V292A;ENSP00000375787:V292A;ENSP00000356029:V292A	.|ENSP00000316333:V292A	S|V	+|+	1|2	0|0	CD55|CD55	205576682|205576682	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.015000|0.015000	0.08874|0.08874	-3.047000|-3.047000	0.00630|0.00630	-0.436000|-0.436000	0.07254|0.07254	-0.381000|-0.381000	0.06696|0.06696	TCC|GTC		0.408	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574	
FOLH1	2346	bcgsc.ca	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-KO-8406-01A-11D-2310-10	TCGA-KO-8406-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	c29f6ed6-880d-4f03-977e-1087738e5e60	20a022aa-6b2c-4b4d-9a10-9dad1867a342	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H|FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H|FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																						.											1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	SO:0001583	missense	2346			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	37	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
