#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MUC2	4583	hgsc.bcm.edu	37	11	1092845	1092845	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr11:1092845C>T	ENST00000441003.2	+	30	4691	c.4664C>T	c.(4663-4665)aCa>aTa	p.T1555I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1556I|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCCACCGGCACACAGACCCCA	0.632																																						.											0													94.0	126.0	114.0					11																	1092845		1882	3484	5366	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4664C>T	11.37:g.1092845C>T	ENSP00000415183:p.Thr1555Ile		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.039	-0.197860	0.06219	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13538	2.58;2.91	1.59	1.59	0.23543	.	7739.210000	0.00610	U	0.000401	T	0.10508	0.0257	.	.	.	0.09310	N	1	P	0.34699	0.464	B	0.24269	0.052	T	0.33369	-0.9871	9	0.42905	T	0.14	.	10.2908	0.43594	0.0:1.0:0.0:0.0	.	1555	E7EUV1	.	I	1555;1556	ENSP00000415183:T1555I;ENSP00000351956:T1556I	ENSP00000351956:T1556I	T	+	2	0	MUC2	1082845	0.000000	0.05858	0.001000	0.08648	0.338000	0.28826	0.112000	0.15479	0.906000	0.36621	0.109000	0.15622	ACA		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CLEC9A	283420	hgsc.bcm.edu;mdanderson.org	37	12	10205356	10205356	+	Silent	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:10205356C>T	ENST00000355819.1	+	4	683	c.70C>T	c.(70-72)Ctg>Ttg	p.L24L	CLEC9A_ENST00000544751.1_3'UTR	NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	24					positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						CCAGAAATGTCTGTCTTCCAA	0.403																																						.											0													106.0	101.0	103.0					12																	10205356		2203	4300	6503	SO:0001819	synonymous_variant	283420				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.70C>T	12.37:g.10205356C>T			B0ZBM2	Silent	SNP	ENST00000355819.1	37	CCDS8611.1																																																																																				0.403	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000399564.1	NM_207345	
EPS8	2059	broad.mit.edu;hgsc.bcm.edu	37	12	15784389	15784392	+	Frame_Shift_Del	DEL	TTGT	TTGT	-			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	TTGT	TTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:15784389_15784392delTTGT	ENST00000281172.5	-	18	2464_2467	c.2028_2031delACAA	c.(2026-2031)aaacaafs	p.KQ676fs	EPS8_ENST00000542903.1_Frame_Shift_Del_p.KQ416fs|EPS8_ENST00000540613.1_Frame_Shift_Del_p.KQ416fs|EPS8_ENST00000543612.1_Frame_Shift_Del_p.KQ676fs|EPS8_ENST00000543523.1_Frame_Shift_Del_p.KQ676fs	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	676	Effector region. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CCACCGGAAGTTGTTTGTGTCTCT	0.441																																						.											0																																										SO:0001589	frameshift_variant	2059			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2028_2031delACAA	12.37:g.15784393_15784396delTTGT	ENSP00000281172:p.Lys676fs		A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Frame_Shift_Del	DEL	ENST00000281172.5	37	CCDS31753.1																																																																																				0.441	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
MARCH9	92979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	58152575	58152575	+	Silent	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:58152575C>T	ENST00000266643.5	+	4	1367	c.936C>T	c.(934-936)cgC>cgT	p.R312R	MARCH9_ENST00000548358.1_Silent_p.R199R	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	312					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			TGCCTCAGCGCTGCGGTTATA	0.657																																						.											0													28.0	29.0	28.0					12																	58152575		2203	4300	6503	SO:0001819	synonymous_variant	92979			BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.936C>T	12.37:g.58152575C>T			B2R9U9|Q86VN5|Q96GG2	Silent	SNP	ENST00000266643.5	37	CCDS31847.1																																																																																				0.657	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409244.1	NM_138396	
EXOC5	10640	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	14	57675499	57675499	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr14:57675499T>C	ENST00000413566.2	-	18	2314	c.1955A>G	c.(1954-1956)cAt>cGt	p.H652R	EXOC5_ENST00000340918.7_Missense_Mutation_p.H587R	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	652					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						ATCAAAAAGATGTAATACCAT	0.343																																						.											0													45.0	44.0	44.0					14																	57675499		1835	4072	5907	SO:0001583	missense	10640			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1955A>G	14.37:g.57675499T>C	ENSP00000389934:p.His652Arg		B2R6C5	Missense_Mutation	SNP	ENST00000413566.2	37	CCDS45111.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.070861	0.55539	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.40476	1.04;1.03	5.54	5.54	0.83059	.	0.050800	0.85682	D	0.000000	T	0.25717	0.0626	N	0.08118	0	0.48901	D	0.999727	B;B	0.11235	0.001;0.004	B;B	0.16722	0.003;0.016	T	0.07635	-1.0762	10	0.22706	T	0.39	-6.9907	15.6841	0.77396	0.0:0.0:0.0:1.0	.	587;652	F8W9B8;O00471	.;EXOC5_HUMAN	R	652;587	ENSP00000389934:H652R;ENSP00000342100:H587R	ENSP00000342100:H587R	H	-	2	0	EXOC5	56745252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.103000	0.63969	0.477000	0.44152	CAT		0.343	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
WLS	79971	hgsc.bcm.edu;mdanderson.org	37	1	68697908	68697908	+	Silent	SNP	T	T	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:68697908T>C	ENST00000262348.4	-	1	328	c.75A>G	c.(73-75)caA>caG	p.Q25Q	WLS_ENST00000370976.3_Silent_p.Q25Q|WLS_ENST00000370971.1_Silent_p.Q25Q|WLS_ENST00000354777.2_Silent_p.Q25Q|WLS_ENST00000540432.1_Silent_p.Q25Q	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	25					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						AGGCGATGATTTGGAACACGA	0.498																																						.											0													174.0	160.0	165.0					1																	68697908		2203	4300	6503	SO:0001819	synonymous_variant	79971			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.75A>G	1.37:g.68697908T>C			B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Silent	SNP	ENST00000262348.4	37	CCDS642.1	.	.	.	.	.	.	.	.	.	.	t	8.540	0.873082	0.17322	.	.	ENSG00000116729	ENST00000534713	.	.	.	4.72	-2.39	0.06602	.	.	.	.	.	T	0.31327	0.0793	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31724	-0.9933	4	.	.	.	-17.2091	5.2658	0.15597	0.1197:0.2776:0.0:0.6027	.	.	.	.	R	19	.	.	K	-	2	0	WLS	68470496	0.998000	0.40836	0.279000	0.24732	0.985000	0.73830	0.381000	0.20619	-0.657000	0.05373	0.249000	0.18162	AAA		0.498	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025368.1	NM_024911	
BPTF	2186	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	65960371	65960371	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr17:65960371C>T	ENST00000321892.4	+	27	8744	c.8683C>T	c.(8683-8685)Cgc>Tgc	p.R2895C	BPTF_ENST00000335221.5_Missense_Mutation_p.R2752C|BPTF_ENST00000306378.6_Missense_Mutation_p.R2769C|BPTF_ENST00000424123.3_Missense_Mutation_p.R2613C			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2895					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTACCATGGGCGCTGCGTTGG	0.463																																						.											0													149.0	141.0	144.0					17																	65960371		2203	4300	6503	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8683C>T	17.37:g.65960371C>T	ENSP00000315454:p.Arg2895Cys		Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	C	16.81	3.225135	0.58668	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000342579	D;D;D	0.84873	-1.91;-1.91;-1.91	5.91	5.91	0.95273	.	.	.	.	.	D	0.93844	0.8031	M	0.86573	2.825	0.80722	D	1	B;P;D;D	0.89917	0.44;0.714;1.0;1.0	B;B;D;D	0.87578	0.122;0.271;0.998;0.998	D	0.93970	0.7248	9	0.87932	D	0	-5.0974	20.3011	0.98612	0.0:1.0:0.0:0.0	.	100;573;2769;2752	E9PE19;B4DJV8;Q12830-2;Q12830-4	.;.;.;.	C	2769;2752;2895;100	ENSP00000307208:R2769C;ENSP00000334351:R2752C;ENSP00000315454:R2895C	ENSP00000307208:R2769C	R	+	1	0	BPTF	63390833	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.809000	0.96659	0.555000	0.69702	CGC		0.463	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
ONECUT2	9480	hgsc.bcm.edu;ucsc.edu	37	18	55143925	55143925	+	Silent	SNP	G	G	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr18:55143925G>A	ENST00000491143.2	+	2	1517	c.1485G>A	c.(1483-1485)tcG>tcA	p.S495S		NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	495					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GGGGCTCCTCGTCCACCTCCA	0.552																																						.											0													29.0	32.0	31.0					18																	55143925		2068	4222	6290	SO:0001819	synonymous_variant	9480			Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1485G>A	18.37:g.55143925G>A				Silent	SNP	ENST00000491143.2	37	CCDS42440.1	.	.	.	.	.	.	.	.	.	.	G	8.243	0.807355	0.16467	.	.	ENSG00000119547	ENST00000481727	.	.	.	5.9	-3.69	0.04450	.	.	.	.	.	T	0.37999	0.1024	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37079	-0.9721	4	.	.	.	-11.4231	1.3888	0.02246	0.3881:0.1988:0.2581:0.1549	.	.	.	.	I	124	.	.	V	+	1	0	ONECUT2	53294923	0.000000	0.05858	0.835000	0.33067	0.998000	0.95712	-2.337000	0.01104	-0.394000	0.07727	0.650000	0.86243	GTC		0.552	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3		
ADAMTS1	9510	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	21	28216883	28216883	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr21:28216883C>T	ENST00000284984.3	-	1	845	c.391G>A	c.(391-393)Ggc>Agc	p.G131S		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	131					heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CTGGGATCGCCATTCACGGTG	0.697											OREG0026151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													15.0	17.0	17.0					21																	28216883		2197	4298	6495	SO:0001583	missense	9510			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.391G>A	21.37:g.28216883C>T	ENSP00000284984:p.Gly131Ser	800	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.340968	0.41498	.	.	ENSG00000154734	ENST00000284984	T	0.09255	3.0	4.16	3.26	0.37387	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.14356	0.0347	L	0.58302	1.8	0.47698	D	0.999493	B	0.18968	0.032	B	0.30943	0.122	T	0.04333	-1.0959	9	0.24483	T	0.36	.	13.7507	0.62906	0.0:0.6866:0.3134:0.0	.	131	Q9UHI8	ATS1_HUMAN	S	131	ENSP00000284984:G131S	ENSP00000284984:G131S	G	-	1	0	ADAMTS1	27138754	0.932000	0.31603	0.559000	0.28332	0.430000	0.31655	1.404000	0.34623	0.935000	0.37341	0.555000	0.69702	GGC		0.697	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
MN1	4330	hgsc.bcm.edu;mdanderson.org	37	22	28194933	28194933	+	Silent	SNP	T	T	C	rs572936881|rs373314940|rs71194738	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr22:28194933T>C	ENST00000302326.4	-	1	2553	c.1599A>G	c.(1597-1599)caA>caG	p.Q533Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgct	0.652			T	ETV6	"""AML, meningioma"""								T|||	98	0.0195687	0.0613	0.0086	5008	,	,		12327	0.002		0.005	False		,,,				2504	0.0041					.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0								C		9,3561		0,9,1776	4.0	5.0	5.0		1599	-0.4	1.0	22		5	5,7341		0,5,3668	no	coding-synonymous	MN1	NM_002430.2		0,14,5444	CC,CT,TT		0.0681,0.2521,0.1283		533/1321	28194933	14,10902	1785	3673	5458	SO:0001819	synonymous_variant	4330			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1599A>G	22.37:g.28194933T>C			A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																				0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
FAM179A	165186	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	29274925	29274925	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr2:29274925C>T	ENST00000379558.4	+	20	3377	c.3026C>T	c.(3025-3027)aCa>aTa	p.T1009I	FAM179A_ENST00000403861.2_Missense_Mutation_p.T954I|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	1009										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GACAGCAAGACAACTGGCAGC	0.478																																						.											0													26.0	28.0	27.0					2																	29274925		1907	4123	6030	SO:0001583	missense	165186			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.3026C>T	2.37:g.29274925C>T	ENSP00000368876:p.Thr1009Ile		Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	37	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096144	0.36952	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.09255	3.14;3.0	5.68	1.84	0.25277	.	1.414210	0.04767	N	0.427403	T	0.10508	0.0257	N	0.22421	0.69	0.09310	N	1	P;P	0.49358	0.923;0.766	P;B	0.46110	0.504;0.243	T	0.21793	-1.0235	10	0.54805	T	0.06	.	4.9181	0.13856	0.1464:0.6259:0.0:0.2277	.	954;1009	F8W8E4;Q6ZUX3	.;F179A_HUMAN	I	1009;954	ENSP00000368876:T1009I;ENSP00000384699:T954I	ENSP00000368876:T1009I	T	+	2	0	FAM179A	29128429	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	0.022000	0.13511	0.064000	0.16427	0.655000	0.94253	ACA		0.478	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
PKD1L1	168507	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	7	47968829	47968829	+	Silent	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr7:47968829C>T	ENST00000289672.2	-	7	1082	c.1032G>A	c.(1030-1032)gcG>gcA	p.A344A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	344					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGGCAGTCACCGCCATTGCCT	0.527																																						.											0													131.0	123.0	126.0					7																	47968829		2203	4300	6503	SO:0001819	synonymous_variant	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1032G>A	7.37:g.47968829C>T			Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																				0.527	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PDP1	54704	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	8	94934838	94934838	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr8:94934838G>A	ENST00000297598.4	+	2	820	c.551G>A	c.(550-552)cGg>cAg	p.R184Q	PDP1_ENST00000520728.1_Missense_Mutation_p.R184Q|PDP1_ENST00000396200.3_Missense_Mutation_p.R209Q|PDP1_ENST00000517764.1_Missense_Mutation_p.R184Q	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	184					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						GAGAGCGGCCGGGCACTGCTA	0.453																																						.											0													62.0	59.0	60.0					8																	94934838		2203	4300	6503	SO:0001583	missense	54704			AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.551G>A	8.37:g.94934838G>A	ENSP00000297598:p.Arg184Gln		B3KX71|J3KPU0|Q5U5K1	Missense_Mutation	SNP	ENST00000297598.4	37	CCDS6259.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682500	0.68157	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764;ENST00000518827	T;T;T;T	0.45276	0.91;0.91;0.9;0.91	6.16	5.28	0.74379	Protein phosphatase 2C-like (3);	0.058183	0.64402	N	0.000002	T	0.40862	0.1134	L	0.53249	1.67	0.58432	D	0.999996	P;P	0.47409	0.895;0.895	B;B	0.39258	0.295;0.198	T	0.34850	-0.9812	10	0.40728	T	0.16	-8.858	17.6344	0.88118	0.0:0.1231:0.8769:0.0	.	235;184	B4DYX8;Q9P0J1	.;PDP1_HUMAN	Q	184;184;209;184;184	ENSP00000297598:R184Q;ENSP00000428317:R184Q;ENSP00000379503:R209Q;ENSP00000430380:R184Q	ENSP00000297598:R184Q	R	+	2	0	PDP1	95004014	1.000000	0.71417	0.957000	0.39632	0.969000	0.65631	7.989000	0.88205	1.604000	0.50143	-0.182000	0.12963	CGG		0.453	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444	
SPATA31E1	286234	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	9	90500482	90500482	+	Silent	SNP	C	C	T	rs199568188	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr9:90500482C>T	ENST00000325643.5	+	4	1146	c.1080C>T	c.(1078-1080)gaC>gaT	p.D360D		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	360					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCACCCTGACGTGCAGAAGC	0.577													.|||	3	0.000599042	0.0	0.0	5008	,	,		18697	0.001		0.002	False		,,,				2504	0.0					.											0													65.0	64.0	64.0					9																	90500482		2203	4300	6503	SO:0001819	synonymous_variant	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.1080C>T	9.37:g.90500482C>T			B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	ENST00000325643.5	37	CCDS6676.1																																																																																				0.577	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
COL6A5	256076	hgsc.bcm.edu	37	3	130095482	130095482	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr3:130095482T>A	ENST00000432398.2	+	3	964	c.470T>A	c.(469-471)cTg>cAg	p.L157Q	COL6A5_ENST00000265379.6_Missense_Mutation_p.L157Q	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	157	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TCGAAAGCCCTGCAGAAAGAC	0.512																																						.											0													75.0	80.0	78.0					3																	130095482		692	1591	2283	SO:0001583	missense	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.470T>A	3.37:g.130095482T>A	ENSP00000390895:p.Leu157Gln		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	T	11.74	1.730065	0.30684	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.82893	-1.66;-1.66	5.14	5.14	0.70334	.	.	.	.	.	D	0.92792	0.7708	M	0.92317	3.295	0.34680	D	0.724616	D	0.89917	1.0	D	0.87578	0.998	D	0.97112	0.9805	9	0.87932	D	0	.	14.2338	0.65911	0.0:0.0:0.0:1.0	.	157	A8TX70-2	.	Q	157	ENSP00000390895:L157Q;ENSP00000265379:L157Q	ENSP00000265379:L157Q	L	+	2	0	COL6A5	131578172	0.958000	0.32768	0.849000	0.33467	0.023000	0.10783	6.861000	0.75478	2.064000	0.61679	0.455000	0.32223	CTG		0.512	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
WNT2B	7482	broad.mit.edu;mdanderson.org;bcgsc.ca	37	1	113058941	113058941	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:113058941G>A	ENST00000369684.4	+	3	1068	c.583G>A	c.(583-585)Ggt>Agt	p.G195S	WNT2B_ENST00000256640.5_Missense_Mutation_p.G103S|WNT2B_ENST00000478360.1_3'UTR|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Missense_Mutation_p.G176S	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	195					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATCCACTACGGTGTCCGTTT	0.572																																						.											0													160.0	142.0	148.0					1																	113058941		2203	4300	6503	SO:0001583	missense	7482			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.583G>A	1.37:g.113058941G>A	ENSP00000358698:p.Gly195Ser		O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	ENST00000369684.4	37	CCDS847.1	.	.	.	.	.	.	.	.	.	.	G	36	5.805918	0.96967	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	D;D;D	0.81996	-1.56;-1.56;-1.56	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.91469	0.7307	M	0.85710	2.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.954;0.993	D	0.92181	0.5751	10	0.87932	D	0	.	19.2806	0.94051	0.0:0.0:1.0:0.0	.	195;176	Q93097;Q93097-2	WNT2B_HUMAN;.	S	103;176;195	ENSP00000256640:G103S;ENSP00000358700:G176S;ENSP00000358698:G195S	ENSP00000256640:G103S	G	+	1	0	WNT2B	112860464	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.869000	0.99810	2.637000	0.89404	0.561000	0.74099	GGT		0.572	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030692.1	NM_004185	
HMCN1	83872	broad.mit.edu;bcgsc.ca	37	1	185891568	185891568	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:185891568C>T	ENST00000271588.4	+	7	1187	c.958C>T	c.(958-960)Cga>Tga	p.R320*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.R320*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	320					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R320*(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TATTGATTTCCGAGCTGGCTT	0.423																																						.											1	Substitution - Nonsense(1)	urinary_tract(1)											75.0	70.0	71.0					1																	185891568		2203	4300	6503	SO:0001587	stop_gained	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.958C>T	1.37:g.185891568C>T	ENSP00000271588:p.Arg320*		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	40	8.096734	0.98651	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.43	4.51	0.55191	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0593	0.64790	0.2741:0.7259:0.0:0.0	.	.	.	.	X	320	.	ENSP00000271588:R320X	R	+	1	2	HMCN1	184158191	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.287000	0.33284	1.258000	0.44101	0.655000	0.94253	CGA		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
NEURL1	9148	broad.mit.edu	37	10	105331354	105331354	+	Missense_Mutation	SNP	G	G	A	rs539510212		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr10:105331354G>A	ENST00000369780.4	+	3	833	c.424G>A	c.(424-426)Gcc>Acc	p.A142T	NEURL_ENST00000369777.2_Missense_Mutation_p.A125T	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		142	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GCCCAAGTACGCCTGCCCCGA	0.632													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17124	0.0		0.0	False		,,,				2504	0.0					.											0													65.0	51.0	55.0					10																	105331354		2203	4300	6503	SO:0001583	missense	9148																														ENST00000369780.4:c.424G>A	10.37:g.105331354G>A	ENSP00000358795:p.Ala142Thr		Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	37	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151231	0.94645	.	.	ENSG00000107954	ENST00000369780;ENST00000437579;ENST00000369777;ENST00000455386	T;T	0.31247	1.5;1.5	5.69	5.69	0.88448	NEUZ (2);	0.000000	0.85682	D	0.000000	T	0.62490	0.2432	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66348	-0.5946	10	0.62326	D	0.03	-17.5358	18.8032	0.92027	0.0:0.0:1.0:0.0	.	142	O76050	NEU1A_HUMAN	T	142;125;125;67	ENSP00000358795:A142T;ENSP00000358792:A125T	ENSP00000358792:A125T	A	+	1	0	NEURL	105321344	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.928000	0.87587	2.681000	0.91329	0.561000	0.74099	GCC		0.632	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
MYBPC3	4607	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	47356593	47356593	+	Splice_Site	SNP	G	G	A	rs397515992		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr11:47356593G>A	ENST00000545968.1	-	27	2959	c.2905C>T	c.(2905-2907)Caa>Taa	p.Q969*	MYBPC3_ENST00000256993.4_Splice_Site_p.Q968*|MYBPC3_ENST00000399249.2_Splice_Site_p.Q969*	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	969					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GGGCACTCACGCAGGATCTCC	0.642																																						.											0			GRCh37	CM981328	MYBPC3	M							27.0	32.0	31.0					11																	47356593		1984	4157	6141	SO:0001630	splice_region_variant	4607			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.2905+1C>T	11.37:g.47356593G>A			A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Nonsense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	G	38	6.868535	0.97897	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	.	.	.	5.16	3.14	0.36123	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1437	0.54012	0.0743:0.1318:0.7939:0.0	.	.	.	.	X	969;969;968	.	.	Q	-	1	0	MYBPC3	47313169	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	3.648000	0.54410	1.185000	0.42971	0.455000	0.32223	CAA		0.642	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		Nonsense_Mutation
PPFIA2	8499	broad.mit.edu	37	12	81675147	81675147	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:81675147A>G	ENST00000549396.1	-	27	3261	c.3101T>C	c.(3100-3102)tTa>tCa	p.L1034S	PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000443686.3_Missense_Mutation_p.L929S|PPFIA2_ENST00000541570.2_Missense_Mutation_p.L570S|PPFIA2_ENST00000550359.2_Missense_Mutation_p.L881S|PPFIA2_ENST00000541017.1_Missense_Mutation_p.L220S|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000552948.1_Missense_Mutation_p.L1013S|PPFIA2_ENST00000550584.2_Missense_Mutation_p.L1034S|PPFIA2_ENST00000407050.4_Missense_Mutation_p.L933S|PPFIA2_ENST00000333447.7_Missense_Mutation_p.L1019S|PPFIA2_ENST00000549325.1_Missense_Mutation_p.L1019S|PPFIA2_ENST00000548586.1_Missense_Mutation_p.L1028S	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1034	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GTACTGAGGTAACCCCAAGCT	0.393																																						.											0													115.0	110.0	111.0					12																	81675147		1840	4113	5953	SO:0001583	missense	8499			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3101T>C	12.37:g.81675147A>G	ENSP00000450337:p.Leu1034Ser		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.5|23.5	4.428353|4.428353	0.83667|0.83667	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000550018	T;T;T;T;T;T;T;T;T|.	0.62788|.	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);|.	0.000000|.	0.64402|.	D|.	0.000003|.	D|D	0.85353|0.85353	0.5677|0.5677	M|M	0.92367|0.92367	3.3|3.3	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	D|D	0.88989|0.88989	0.3413|0.3413	10|5	0.87932|.	D|.	0|.	-8.0075|-8.0075	15.9105|15.9105	0.79470|0.79470	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1034|.	O75334|.	LIPA2_HUMAN|.	S|H	1034;1019;570;220;933;1045;1019;1028;929;1013|137	ENSP00000450337:L1034S;ENSP00000450298:L1019S;ENSP00000438337:L570S;ENSP00000445532:L220S;ENSP00000385093:L933S;ENSP00000327416:L1019S;ENSP00000449338:L1028S;ENSP00000388373:L929S;ENSP00000447868:L1013S|.	ENSP00000327416:L1019S|.	L|Y	-|-	2|1	0|0	PPFIA2|PPFIA2	80199278|80199278	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.221000|9.221000	0.95188|0.95188	2.220000|2.220000	0.72140|0.72140	0.454000|0.454000	0.30748|0.30748	TTA|TAC		0.393	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
RILPL1	353116	broad.mit.edu	37	12	123957223	123957223	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:123957223G>T	ENST00000376874.4	-	7	1309	c.1074C>A	c.(1072-1074)agC>agA	p.S358R	RILPL1_ENST00000544468.1_Missense_Mutation_p.S31R|SNRNP35_ENST00000527158.2_3'UTR|RILPL1_ENST00000340724.6_Missense_Mutation_p.S238R	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	358					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)		p.S358R(3)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GGGAGAAGAAGCTAAACCTTT	0.498																																						.											3	Substitution - Missense(3)	kidney(2)|endometrium(1)											65.0	63.0	63.0					12																	123957223		1944	4154	6098	SO:0001583	missense	353116			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.1074C>A	12.37:g.123957223G>T	ENSP00000366070:p.Ser358Arg		Q66K36|Q8N1M0	Missense_Mutation	SNP	ENST00000376874.4	37	CCDS45006.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028945	0.75504	.	.	ENSG00000188026	ENST00000376874;ENST00000340724;ENST00000544468	T;T;T	0.27720	1.65;1.65;1.65	5.47	4.47	0.54385	.	.	.	.	.	T	0.37892	0.1020	L	0.29908	0.895	0.51767	D	0.999936	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.991	T	0.11717	-1.0576	9	0.49607	T	0.09	-0.9352	6.5327	0.22336	0.2105:0.0:0.7895:0.0	.	358;207	Q5EBL4;Q5EBL4-3	RIPL1_HUMAN;.	R	358;238;31	ENSP00000366070:S358R;ENSP00000345874:S238R;ENSP00000442991:S31R	ENSP00000345874:S238R	S	-	3	2	RILPL1	122523176	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.403000	0.44530	2.566000	0.86566	0.655000	0.94253	AGC		0.498	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400595.1	NM_178314	
XPO4	64328	broad.mit.edu	37	13	21373326	21373326	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr13:21373326G>A	ENST00000255305.6	-	16	2371	c.2300C>T	c.(2299-2301)aCc>aTc	p.T767I	XPO4_ENST00000400602.2_Missense_Mutation_p.T767I			Q9C0E2	XPO4_HUMAN	exportin 4	767					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		CTGCTGTTTGGTTTCTGTGTC	0.443																																						.											0													252.0	246.0	248.0					13																	21373326		1919	4139	6058	SO:0001583	missense	64328			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.2300C>T	13.37:g.21373326G>A	ENSP00000255305:p.Thr767Ile		Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	ENST00000255305.6	37	CCDS41872.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336919	0.41398	.	.	ENSG00000132953	ENST00000400602;ENST00000456108;ENST00000255305	T;T	0.54479	0.57;0.57	5.98	5.98	0.97165	Armadillo-type fold (1);	0.145132	0.64402	D	0.000008	T	0.42899	0.1223	L	0.29908	0.895	0.51767	D	0.999936	B	0.13145	0.007	B	0.08055	0.003	T	0.16928	-1.0386	10	0.38643	T	0.18	-14.1782	15.5733	0.76356	0.0673:0.0:0.9327:0.0	.	767	Q9C0E2	XPO4_HUMAN	I	767;637;767	ENSP00000383444:T767I;ENSP00000255305:T767I	ENSP00000255305:T767I	T	-	2	0	XPO4	20271326	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.526000	0.81920	2.835000	0.97688	0.650000	0.86243	ACC		0.443	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459	
CDH24	64403	broad.mit.edu	37	14	23522739	23522739	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr14:23522739C>T	ENST00000267383.5	-	6	1284	c.1192G>A	c.(1192-1194)Gcg>Acg	p.A398T	CDH24_ENST00000554034.1_Missense_Mutation_p.A398T|CDH24_ENST00000487137.2_Missense_Mutation_p.A398T|CDH24_ENST00000397359.3_Missense_Mutation_p.A398T			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	398	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		AGGTCAGCCGCGGAGATCTGG	0.632																																						.											0													34.0	32.0	33.0					14																	23522739		2203	4300	6503	SO:0001583	missense	64403			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.1192G>A	14.37:g.23522739C>T	ENSP00000267383:p.Ala398Thr		D3DS44|Q86UP1|Q9NT84	Missense_Mutation	SNP	ENST00000267383.5	37	CCDS9585.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.431928	0.83776	.	.	ENSG00000139880	ENST00000397359;ENST00000487137;ENST00000554034;ENST00000267383	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	5.39	5.39	0.77823	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.84611	0.5510	H	0.96662	3.86	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.89350	0.3660	10	0.87932	D	0	.	18.0965	0.89492	0.0:1.0:0.0:0.0	.	398;398;398	Q86UP0-2;Q96LQ7;Q86UP0	.;.;CAD24_HUMAN	T	398	ENSP00000380517:A398T;ENSP00000434821:A398T;ENSP00000452493:A398T;ENSP00000267383:A398T	ENSP00000267383:A398T	A	-	1	0	CDH24	22592579	1.000000	0.71417	0.218000	0.23776	0.425000	0.31504	7.383000	0.79741	2.804000	0.96469	0.655000	0.94253	GCG		0.632	CDH24-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257241.2	NM_022478	
PCNXL4	64430	broad.mit.edu	37	14	60581861	60581861	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr14:60581861C>T	ENST00000406854.1	+	4	1593	c.1039C>T	c.(1039-1041)Ccg>Tcg	p.P347S	PCNXL4_ENST00000404681.2_Missense_Mutation_p.P347S|PCNXL4_ENST00000317623.4_Missense_Mutation_p.P113S|PCNXL4_ENST00000406949.1_Missense_Mutation_p.P113S			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	347						integral component of membrane (GO:0016021)											ACCCAGTGGTCCGGAAAAACA	0.383																																						.											0													142.0	124.0	130.0					14																	60581861		1841	4086	5927	SO:0001583	missense	64430			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.1039C>T	14.37:g.60581861C>T	ENSP00000384801:p.Pro347Ser		A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	ENST00000406854.1	37		.	.	.	.	.	.	.	.	.	.	C	0.715	-0.785530	0.02907	.	.	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681	T;T;T;T	0.21932	1.99;1.99;1.98;1.99	5.4	1.81	0.25067	.	.	.	.	.	T	0.05686	0.0149	N	0.00801	-1.175	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40776	-0.9545	9	0.09338	T	0.73	.	8.6417	0.33981	0.0:0.3241:0.0:0.6759	.	347;113	Q63HM2;B5MC47	CN135_HUMAN;.	S	113;347;113;347	ENSP00000317396:P113S;ENSP00000384801:P347S;ENSP00000385201:P113S;ENSP00000385713:P347S	ENSP00000317396:P113S	P	+	1	0	C14orf135	59651614	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.548000	0.23314	0.445000	0.26639	-0.379000	0.06801	CCG		0.383	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495	
CFDP1	10428	broad.mit.edu	37	16	75448501	75448501	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr16:75448501delT	ENST00000283882.3	-	2	289	c.157delA	c.(157-159)agafs	p.R53fs	RP11-77K12.1_ENST00000567194.1_Frame_Shift_Del_p.R110fs|RP11-77K12.1_ENST00000561887.1_Intron|CFDP1_ENST00000564286.1_5'UTR	NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1	53	Glu-rich.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						TGGGCCTTTCTTTTTTTCCCT	0.443																																						.											0													210.0	192.0	198.0					16																	75448501		2198	4300	6498	SO:0001589	frameshift_variant	10428			AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.157delA	16.37:g.75448501delT	ENSP00000283882:p.Arg53fs		O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	Frame_Shift_Del	DEL	ENST00000283882.3	37	CCDS10916.1																																																																																				0.443	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269031.2	NM_006324	
ZNF836	162962	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	52660555	52660555	+	Silent	SNP	A	A	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr19:52660555A>G	ENST00000322146.8	-	5	902	c.381T>C	c.(379-381)caT>caC	p.H127H	ZNF836_ENST00000597252.1_Silent_p.H127H|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CCTCTTGACTATGTTGACCTC	0.333																																						.											0													115.0	108.0	111.0					19																	52660555		1986	4198	6184	SO:0001819	synonymous_variant	162962			BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.381T>C	19.37:g.52660555A>G				Silent	SNP	ENST00000322146.8	37	CCDS46162.1																																																																																				0.333	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
CST1	1469	broad.mit.edu	37	20	23728528	23728528	+	Silent	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr20:23728528C>T	ENST00000304749.2	-	3	421	c.351G>A	c.(349-351)ttG>ttA	p.L117L	CST1_ENST00000398402.1_Silent_p.L117L	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L117L(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGAAAGAGCACAACTGTTTCT	0.527																																						.											1	Substitution - coding silent(1)	lung(1)											93.0	81.0	85.0					20																	23728528		2203	4300	6503	SO:0001819	synonymous_variant	1469			M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.351G>A	20.37:g.23728528C>T			Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	CCDS13160.1																																																																																				0.527	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898	
NKTR	4820	broad.mit.edu	37	3	42660605	42660605	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr3:42660605G>A	ENST00000232978.8	+	4	415	c.227G>A	c.(226-228)gGg>gAg	p.G76E	NKTR_ENST00000442970.1_Missense_Mutation_p.G76E|RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000445452.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	76	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		ATTCAGGGTGGGGACTTCAGT	0.353																																						.											0													135.0	146.0	142.0					3																	42660605		2203	4300	6503	SO:0001583	missense	4820				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.227G>A	3.37:g.42660605G>A	ENSP00000232978:p.Gly76Glu			Missense_Mutation	SNP	ENST00000232978.8	37	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710635	0.89112	.	.	ENSG00000114857	ENST00000232978;ENST00000442970;ENST00000445842	T;T;T	0.67865	-0.29;-0.29;-0.29	4.94	4.94	0.65067	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);Peptidyl-prolyl cis-trans isomerase, cyclophilin-type, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.89955	0.6865	H	0.99286	4.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94345	0.7574	10	0.87932	D	0	-16.2248	18.1303	0.89599	0.0:0.0:1.0:0.0	.	76;76	P30414;A8K7K2	NKTR_HUMAN;.	E	76	ENSP00000232978:G76E;ENSP00000390259:G76E;ENSP00000408660:G76E	ENSP00000232978:G76E	G	+	2	0	NKTR	42635609	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.766000	0.98957	2.460000	0.83146	0.555000	0.69702	GGG		0.353	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	
BSN	8927	broad.mit.edu	37	3	49689196	49689196	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr3:49689196delA	ENST00000296452.4	+	5	2321	c.2207delA	c.(2206-2208)cagfs	p.Q736fs		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	736					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCTTTGCTGCAGGCCCAGGGC	0.662																																						.											0													40.0	41.0	41.0					3																	49689196		2203	4300	6503	SO:0001589	frameshift_variant	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.2207delA	3.37:g.49689196delA	ENSP00000296452:p.Gln736fs		O43161|Q7LGH3	Frame_Shift_Del	DEL	ENST00000296452.4	37	CCDS2800.1																																																																																				0.662	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
RAD54L2	23132	broad.mit.edu	37	3	51624506	51624508	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr3:51624506_51624508delGAG	ENST00000409535.2	+	2	195_197	c.70_72delGAG	c.(70-72)gagdel	p.E30del		NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	30						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		ggatgcggaagaggaggaggagg	0.586																																						.											0																																										SO:0001651	inframe_deletion	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.70_72delGAG	3.37:g.51624515_51624517delGAG	ENSP00000386520:p.Glu30del		Q8TB57|Q9BV54	In_Frame_Del	DEL	ENST00000409535.2	37	CCDS33765.2																																																																																				0.586	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
DSPP	1834	broad.mit.edu	37	4	88535571	88535571	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr4:88535571A>G	ENST00000282478.7	+	4	1790	c.1757A>G	c.(1756-1758)gAc>gGc	p.D586G	DSPP_ENST00000399271.1_Missense_Mutation_p.D586G|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	586	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		agtgacagtgacagcagtgat	0.458																																						.											0													76.0	80.0	79.0					4																	88535571		2165	4223	6388	SO:0001583	missense	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1757A>G	4.37:g.88535571A>G	ENSP00000282478:p.Asp586Gly		A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	2.127	-0.400045	0.04865	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88975	-2.45;-2.45	3.69	3.69	0.42338	.	.	.	.	.	D	0.89022	0.6597	L	0.43923	1.385	0.24296	N	0.995148	D	0.64830	0.994	P	0.60609	0.877	T	0.78565	-0.2155	9	0.36615	T	0.2	.	5.9187	0.19070	0.874:0.0:0.126:0.0	.	586	Q9NZW4	DSPP_HUMAN	G	586	ENSP00000382213:D586G;ENSP00000282478:D586G	ENSP00000282478:D586G	D	+	2	0	DSPP	88754595	0.863000	0.29885	0.297000	0.24988	0.010000	0.07245	1.453000	0.35167	1.439000	0.47511	0.366000	0.22137	GAC		0.458	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAT1	2195	broad.mit.edu	37	4	187541479	187541479	+	Silent	SNP	G	G	A	rs532659201		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr4:187541479G>A	ENST00000441802.2	-	10	6470	c.6261C>T	c.(6259-6261)taC>taT	p.Y2087Y		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2087	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TAACAACGGCGTAGTAGGGAA	0.498										HNSCC(5;0.00058)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		19018	0.0		0.0	False		,,,				2504	0.0				Colon(197;1040 2055 4143 4984 49344)	.											0													171.0	164.0	166.0					4																	187541479		1982	4151	6133	SO:0001819	synonymous_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6261C>T	4.37:g.187541479G>A				Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																				0.498	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
HLA-A	3105	broad.mit.edu;mdanderson.org	37	6	29910607	29910607	+	Silent	SNP	G	G	C	rs72555397		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr6:29910607G>C	ENST00000396634.1	+	4	488	c.147G>C	c.(145-147)gtG>gtC	p.V49V	HLA-A_ENST00000376809.5_Silent_p.V49V|HLA-A_ENST00000376806.5_Silent_p.V49V|HLA-A_ENST00000376802.2_Silent_p.V49V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	49	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.V49V(2)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TCATCGCCGTGGGCTACGTGG	0.692									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												.											2	Substitution - coding silent(2)	lung(1)|kidney(1)																																								SO:0001819	synonymous_variant	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.147G>C	6.37:g.29910607G>C			O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	37	CCDS34373.1																																																																																				0.692	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
GGH	8836	broad.mit.edu;bcgsc.ca	37	8	63942762	63942762	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr8:63942762T>C	ENST00000260118.6	-	3	641	c.239A>G	c.(238-240)gAg>gGg	p.E80G	GGH_ENST00000518113.1_5'UTR	NM_003878.2	NP_003869.1	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)	80	Gamma-glutamyl hydrolase. {ECO:0000255|PROSITE-ProRule:PRU00607}.				glutamine metabolic process (GO:0006541)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	exopeptidase activity (GO:0008238)|gamma-glutamyl-peptidase activity (GO:0034722)|omega peptidase activity (GO:0008242)			breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(6)|stomach(1)	11	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|Methotrexate(DB00563)	ATAGTCTTTCTCTGTAAGATC	0.318																																						.											0													86.0	88.0	88.0					8																	63942762		2203	4293	6496	SO:0001583	missense	8836			U55206	CCDS6177.1	8q12.3	2008-02-05			ENSG00000137563	ENSG00000137563	3.4.19.9		4248	protein-coding gene	gene with protein product		601509				8816764, 10570974	Standard	NM_003878		Approved		uc003xuw.3	Q92820	OTTHUMG00000164365	ENST00000260118.6:c.239A>G	8.37:g.63942762T>C	ENSP00000260118:p.Glu80Gly			Missense_Mutation	SNP	ENST00000260118.6	37	CCDS6177.1	.	.	.	.	.	.	.	.	.	.	T	8.575	0.880955	0.17467	.	.	ENSG00000137563	ENST00000260118;ENST00000517622	T	0.46451	0.87	5.45	-1.69	0.08186	.	2.128780	0.01441	N	0.015086	T	0.39064	0.1064	M	0.72479	2.2	0.09310	N	1	P	0.36616	0.561	B	0.34301	0.179	T	0.13899	-1.0492	10	0.27082	T	0.32	-20.6927	4.3633	0.11213	0.1164:0.066:0.3632:0.4545	.	80	Q92820	GGH_HUMAN	G	80;41	ENSP00000260118:E80G	ENSP00000260118:E80G	E	-	2	0	GGH	64105316	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.045000	0.12003	-0.432000	0.07297	-0.316000	0.08728	GAG		0.318	GGH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378453.1		
TRPS1	7227	broad.mit.edu	37	8	116616283	116616283	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr8:116616283T>C	ENST00000220888.5	-	3	2033	c.1874A>G	c.(1873-1875)gAc>gGc	p.D625G	TRPS1_ENST00000519674.1_Missense_Mutation_p.D625G|TRPS1_ENST00000395715.3_Missense_Mutation_p.D638G|TRPS1_ENST00000519076.1_Intron|TRPS1_ENST00000520276.1_Missense_Mutation_p.D629G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	625					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TACATCTACGTCAGGGGTGGT	0.517									Langer-Giedion syndrome																													.											0													79.0	78.0	78.0					8																	116616283		2051	4198	6249	SO:0001583	missense	7227	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1874A>G	8.37:g.116616283T>C	ENSP00000220888:p.Asp625Gly		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	T	16.00	2.999497	0.54147	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.77	5.77	0.91146	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	L	0.29908	0.895	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.994;0.998	T	0.31475	-0.9942	10	0.87932	D	0	.	16.3948	0.83586	0.0:0.0:0.0:1.0	.	629;625;638	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	G	638;625;629;625	ENSP00000379065:D638G;ENSP00000220888:D625G;ENSP00000428680:D629G;ENSP00000429174:D625G	ENSP00000220888:D625G	D	-	2	0	TRPS1	116685458	1.000000	0.71417	0.394000	0.26270	0.434000	0.31775	7.628000	0.83189	2.326000	0.78906	0.533000	0.62120	GAC		0.517	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
SLC4A8	9498	broad.mit.edu	37	12	51868965	51868966	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:51868965_51868966insG	ENST00000453097.2	+	16	2364_2365	c.2147_2148insG	c.(2146-2151)aagacgfs	p.T717fs	SLC4A8_ENST00000514353.3_Frame_Shift_Ins_p.T664fs|SLC4A8_ENST00000358657.3_Frame_Shift_Ins_p.T744fs|SLC4A8_ENST00000394856.1_Frame_Shift_Ins_p.T664fs	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		AAGACGTTTAAGACGAGCCGTT	0.446																																						.											0																																										SO:0001589	frameshift_variant	9498			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.2148dupG	12.37:g.51868966_51868966dupG	ENSP00000405812:p.Thr717fs			Frame_Shift_Ins	INS	ENST00000453097.2	37	CCDS44890.1																																																																																				0.446	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
POM121	9883	broad.mit.edu	37	7	72413476	72413477	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr7:72413476_72413477insC	ENST00000434423.2	+	11	2944_2945	c.2944_2945insC	c.(2944-2946)gccfs	p.A982fs	POM121_ENST00000358357.3_Frame_Shift_Ins_p.A717fs|POM121_ENST00000257622.4_Frame_Shift_Ins_p.A717fs|POM121_ENST00000395270.1_Frame_Shift_Ins_p.A717fs|POM121_ENST00000446813.1_Frame_Shift_Ins_p.A717fs			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	982	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GCCACCGGGGGCCGCCAAGCCG	0.653																																						.											0																																										SO:0001589	frameshift_variant	9883			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.2946dupC	7.37:g.72413478_72413478dupC	ENSP00000405562:p.Ala982fs		A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Frame_Shift_Ins	INS	ENST00000434423.2	37																																																																																					0.653	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
CTDSPL	10217	ucsc.edu;mdanderson.org	37	3	38009346	38009346	+	Silent	SNP	G	G	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr3:38009346G>A	ENST00000273179.5	+	5	425	c.399G>A	c.(397-399)ccG>ccA	p.P133P	CTDSPL_ENST00000443503.2_Silent_p.P122P|MIR26A1_ENST00000362205.1_RNA|CTDSPL_ENST00000310189.3_3'UTR	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	133	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		TTATTGTTCCGGTTGAAATCG	0.284											OREG0015472	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													63.0	62.0	62.0					3																	38009346		2198	4298	6496	SO:0001819	synonymous_variant	10217			D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.399G>A	3.37:g.38009346G>A		874	Q3ZTU0|Q70KI4|Q7Z5Q2	Silent	SNP	ENST00000273179.5	37	CCDS33734.1	.	.	.	.	.	.	.	.	.	.	G	9.235	1.036705	0.19669	.	.	ENSG00000144677	ENST00000416688	.	.	.	5.25	1.09	0.20402	.	.	.	.	.	T	0.51652	0.1687	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35351	-0.9792	4	.	.	.	-16.9444	5.6624	0.17676	0.0633:0.1909:0.2146:0.5311	.	.	.	.	S	42	.	.	G	+	1	0	CTDSPL	37984350	0.228000	0.23718	0.996000	0.52242	0.999000	0.98932	-0.451000	0.06795	-0.024000	0.13941	0.655000	0.94253	GGT		0.284	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342392.1	NM_005808	
SLC26A8	116369	ucsc.edu	37	6	35930387	35930387	+	Silent	SNP	A	A	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr6:35930387A>G	ENST00000490799.1	-	12	1730	c.1377T>C	c.(1375-1377)gcT>gcC	p.A459A	SLC26A8_ENST00000394602.2_Silent_p.A354A|SLC26A8_ENST00000355574.2_Silent_p.A459A	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						GAATAATACCAGCCAGCACAG	0.458																																						.											0													113.0	99.0	104.0					6																	35930387		2203	4300	6503	SO:0001819	synonymous_variant	116369			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.1377T>C	6.37:g.35930387A>G				Silent	SNP	ENST00000490799.1	37	CCDS4813.1																																																																																				0.458	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		
SLIT1	6585	ucsc.edu;mdanderson.org;bcgsc.ca	37	10	98819913	98819913	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr10:98819913C>T	ENST00000266058.4	-	10	1189	c.944G>A	c.(943-945)cGc>cAc	p.R315H	SLIT1_ENST00000371070.4_Missense_Mutation_p.R315H|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371041.3_Missense_Mutation_p.R315H	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	315					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		CAGCTCCAGGCGTCTGCGGGG	0.607																																						.											0													83.0	76.0	78.0					10																	98819913		2203	4300	6503	SO:0001583	missense	6585			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.944G>A	10.37:g.98819913C>T	ENSP00000266058:p.Arg315His		Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611644	0.87258	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371054;ENST00000371070;ENST00000314867;ENST00000456008;ENST00000371041	T;T;T;T	0.57273	1.84;1.84;0.67;0.41	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.61311	0.2337	N	0.17723	0.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67440	-0.5670	10	0.87932	D	0	.	18.7943	0.91988	0.0:1.0:0.0:0.0	.	315;315	E7EWQ8;O75093	.;SLIT1_HUMAN	H	315;315;291;315;298;291;315	ENSP00000266058:R315H;ENSP00000360109:R315H;ENSP00000315005:R298H;ENSP00000360080:R315H	ENSP00000266058:R315H	R	-	2	0	SLIT1	98809903	1.000000	0.71417	1.000000	0.80357	0.598000	0.36846	7.197000	0.77814	2.464000	0.83262	0.561000	0.74099	CGC		0.607	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
TTC39A	22996	ucsc.edu	37	1	51761772	51761772	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:51761772T>C	ENST00000447632.2	-	13	1280	c.1232A>G	c.(1231-1233)gAc>gGc	p.D411G	TTC39A_ENST00000451380.1_Missense_Mutation_p.D375G|TTC39A_ENST00000371747.3_Missense_Mutation_p.D410G|TTC39A_ENST00000534098.1_Intron|TTC39A_ENST00000530004.1_Missense_Mutation_p.D19G|TTC39A_ENST00000262675.7_Missense_Mutation_p.D348G|TTC39A_ENST00000413473.2_Missense_Mutation_p.D379G|TTC39A_ENST00000371750.5_Missense_Mutation_p.D376G			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	411								p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						CACTTCGTCGTCCCCGAACGG	0.592																																						.											2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											56.0	65.0	62.0					1																	51761772		2052	4187	6239	SO:0001583	missense	22996			AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.1232A>G	1.37:g.51761772T>C	ENSP00000393952:p.Asp411Gly		B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	ENST00000447632.2	37		.	.	.	.	.	.	.	.	.	.	T	23.6	4.437380	0.83885	.	.	ENSG00000085831	ENST00000530004;ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750;ENST00000525906;ENST00000371747	T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.09	5.09	0.68999	.	0.045757	0.85682	D	0.000000	T	0.56949	0.2020	M	0.64404	1.975	0.58432	D	0.999994	P;P;P;P;P;P	0.49862	0.523;0.578;0.929;0.929;0.888;0.913	B;B;P;P;P;P	0.51297	0.236;0.348;0.665;0.665;0.484;0.535	T	0.60495	-0.7252	10	0.52906	T	0.07	-12.7519	14.8601	0.70376	0.0:0.0:0.0:1.0	.	379;375;348;375;411;376	Q5SRH9-4;E7EQY9;D3DQ30;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;TT39A_HUMAN;.	G	19;411;379;348;375;376;19;410	ENSP00000431228:D19G;ENSP00000393952:D411G;ENSP00000406144:D379G;ENSP00000262675:D348G;ENSP00000397207:D375G;ENSP00000360815:D376G;ENSP00000436659:D19G;ENSP00000360812:D410G	ENSP00000262675:D348G	D	-	2	0	TTC39A	51534360	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	7.601000	0.82783	1.899000	0.54978	0.460000	0.39030	GAC		0.592	TTC39A-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000022434.2		
UBE2QL1	134111	ucsc.edu	37	5	6449023	6449023	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr5:6449023A>G	ENST00000399816.3	+	1	288	c.17A>G	c.(16-18)gAc>gGc	p.D6G		NM_001145161.2	NP_001138633.1	A1L167	U2QL1_HUMAN	ubiquitin-conjugating enzyme E2Q family-like 1	6					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			breast(1)|endometrium(1)	2						GAGCTGCAGGACATCGCGCGC	0.701																																						.											0													95.0	96.0	96.0					5																	6449023		692	1591	2283	SO:0001583	missense	134111			AK057805	CCDS47189.1	5p15.31	2010-02-17			ENSG00000215218	ENSG00000215218			37269	protein-coding gene	gene with protein product		615832					Standard	NM_001145161		Approved	FLJ25076	uc003jdp.4	A1L167	OTTHUMG00000161683	ENST00000399816.3:c.17A>G	5.37:g.6449023A>G	ENSP00000382713:p.Asp6Gly			Missense_Mutation	SNP	ENST00000399816.3	37	CCDS47189.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.340085	0.41398	.	.	ENSG00000215218	ENST00000399816	T	0.38077	1.16	4.09	4.09	0.47781	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.40670	0.1126	M	0.70903	2.155	0.58432	D	0.999994	P	0.34412	0.453	B	0.36959	0.237	T	0.45352	-0.9267	9	0.72032	D	0.01	.	11.9241	0.52808	1.0:0.0:0.0:0.0	.	6	A1L167	U2QL1_HUMAN	G	6	ENSP00000382713:D6G	ENSP00000382713:D6G	D	+	2	0	UBE2QL1	6502023	1.000000	0.71417	1.000000	0.80357	0.224000	0.24922	8.010000	0.88615	1.497000	0.48584	0.347000	0.21830	GAC		0.701	UBE2QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365717.1	NM_001145161	
USP24	23358	ucsc.edu	37	1	55595207	55595207	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:55595207A>G	ENST00000294383.6	-	32	3577	c.3578T>C	c.(3577-3579)aTg>aCg	p.M1193T	USP24_ENST00000407756.1_Missense_Mutation_p.M1033T	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1193					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						GCTTCTGGCCATGTCATCATC	0.408																																						.											0													97.0	96.0	96.0					1																	55595207		1909	4128	6037	SO:0001583	missense	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.3578T>C	1.37:g.55595207A>G	ENSP00000294383:p.Met1193Thr		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	A	4.152	0.026554	0.08054	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02197	4.4;4.42	5.78	4.64	0.57946	.	0.071934	0.85682	D	0.000000	T	0.01765	0.0056	N	0.14661	0.345	0.54753	D	0.999983	B	0.14438	0.01	B	0.13407	0.009	T	0.53844	-0.8381	10	0.12766	T	0.61	.	13.075	0.59081	0.8658:0.1342:0.0:0.0	.	1033	B7WPF4	.	T	1193;1033	ENSP00000294383:M1193T;ENSP00000385700:M1033T	ENSP00000294383:M1193T	M	-	2	0	USP24	55367795	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.962000	0.93254	0.988000	0.38734	0.482000	0.46254	ATG		0.408	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
AASS	10157	mdanderson.org	37	7	121773650	121773650	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr7:121773650G>C	ENST00000393376.1	-	1	226	c.131C>G	c.(130-132)cCc>cGc	p.P44R	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.P44R			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	44	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						GATGTGCTTGGGAGCTAGCGG	0.537																																						.											0													112.0	97.0	102.0					7																	121773650		2203	4300	6503	SO:0001583	missense	10157			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.131C>G	7.37:g.121773650G>C	ENSP00000377040:p.Pro44Arg		O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	.	26.0	4.699346	0.88830	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	D;D	0.91521	-2.86;-2.86	5.18	5.18	0.71444	Alanine dehydrogenase/PNT, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97188	0.9081	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98611	1.0663	10	0.87932	D	0	-13.2955	18.6875	0.91570	0.0:0.0:1.0:0.0	.	44	Q9UDR5	AASS_HUMAN	R	44	ENSP00000377040:P44R;ENSP00000403768:P44R	ENSP00000351834:P44R	P	-	2	0	AASS	121560886	1.000000	0.71417	0.932000	0.37286	0.883000	0.51084	9.771000	0.98977	2.390000	0.81377	0.557000	0.71058	CCC		0.537	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
ARHGEF17	9828	mdanderson.org	37	11	73020389	73020389	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr11:73020389A>T	ENST00000263674.3	+	1	1056	c.706A>T	c.(706-708)Atc>Ttc	p.I236F	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	236					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CTCCTCCTCCATCGCCGCCTC	0.677																																						.											0													12.0	15.0	14.0					11																	73020389		2048	3983	6031	SO:0001583	missense	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.706A>T	11.37:g.73020389A>T	ENSP00000263674:p.Ile236Phe		B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.870463	0.33069	.	.	ENSG00000110237	ENST00000263674	T	0.59638	0.25	4.61	0.695	0.18070	.	0.993735	0.08148	N	0.990484	T	0.35480	0.0933	N	0.24115	0.695	0.19775	N	0.999951	P	0.35982	0.531	B	0.24394	0.053	T	0.25117	-1.0141	10	0.54805	T	0.06	-1.1385	5.2264	0.15397	0.6445:0.1573:0.1981:0.0	.	236	Q96PE2	ARHGH_HUMAN	F	236	ENSP00000263674:I236F	ENSP00000263674:I236F	I	+	1	0	ARHGEF17	72698037	0.000000	0.05858	0.765000	0.31456	0.926000	0.56050	-0.104000	0.10923	0.647000	0.30713	0.379000	0.24179	ATC		0.677	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
ATN1	1822	mdanderson.org	37	12	7045906	7045906	+	Silent	SNP	G	G	A	rs377147612		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:7045906G>A	ENST00000356654.4	+	5	1713	c.1476G>A	c.(1474-1476)caG>caA	p.Q492Q	ATN1_ENST00000396684.2_Silent_p.Q492Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	492	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.647																																						.											0													43.0	53.0	49.0					12																	7045906		2188	4263	6451	SO:0001819	synonymous_variant	1822			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1476G>A	12.37:g.7045906G>A			Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																				0.647	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
ATXN1	6310	mdanderson.org	37	6	16327921	16327921	+	Missense_Mutation	SNP	C	C	A	rs201030692		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr6:16327921C>A	ENST00000244769.4	-	8	1557	c.621G>T	c.(619-621)caG>caT	p.Q207H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q207H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	207	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.Q207H(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgatgctgctgctgctgct	0.662																																						.											2	Substitution - Missense(2)	lung(1)|prostate(1)											5.0	8.0	7.0					6																	16327921		1605	3502	5107	SO:0001583	missense	6310			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.621G>T	6.37:g.16327921C>A	ENSP00000244769:p.Gln207His		Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	c	0.699	-0.791581	0.02884	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.56275	0.47;0.47	0.0465	-0.093	0.13652	.	.	.	.	.	T	0.07908	0.0198	N	0.08118	0	0.09310	N	1	D	0.54964	0.969	B	0.38106	0.265	T	0.21042	-1.0257	8	0.35671	T	0.21	.	.	.	.	.	207	P54253	ATX1_HUMAN	H	207	ENSP00000244769:Q207H;ENSP00000416360:Q207H	ENSP00000244769:Q207H	Q	-	3	2	ATXN1	16435900	0.128000	0.22383	0.017000	0.16124	0.068000	0.16541	-0.076000	0.11412	-1.412000	0.02030	-1.404000	0.01136	CAG		0.662	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
AXDND1	126859	mdanderson.org	37	1	179504037	179504037	+	Missense_Mutation	SNP	G	G	C	rs200097954|rs368406759|rs6425573	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:179504037G>C	ENST00000367618.3	+	25	3358	c.2971G>C	c.(2971-2973)Gaa>Caa	p.E991Q		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	991	Glu-rich.		E -> Q (in dbSNP:rs6425573).					p.E991_Q992delEQ(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						agaagaagaagaacaacaaga	0.318													G|||	14	0.00279553	0.0	0.0058	5008	,	,		17137	0.002		0.004	False		,,,				2504	0.0041					.											1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)											49.0	51.0	50.0					1																	179504037		2152	4286	6438	SO:0001583	missense	126859			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2971G>C	1.37:g.179504037G>C	ENSP00000356590:p.Glu991Gln		Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	G	9.300	1.052898	0.19907	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.19105	2.17;2.17	4.89	-6.02	0.02192	.	0.508747	0.16499	N	0.211773	T	0.08980	0.0222	N	0.24115	0.695	0.09310	N	1	B;B	0.24186	0.099;0.099	B;B	0.10450	0.003;0.005	T	0.15838	-1.0423	10	0.28530	T	0.3	-2.8152	6.1976	0.20557	0.4456:0.3814:0.173:0.0	rs6425573	875;991	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	Q	991;875;851	ENSP00000356590:E991Q;ENSP00000391716:E851Q	ENSP00000353471:E875Q	E	+	1	0	AXDND1	177770660	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.365000	0.20348	-1.164000	0.02790	-1.047000	0.02352	GAA		0.318	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
AXDND1	126859	mdanderson.org	37	1	179504040	179504040	+	Missense_Mutation	SNP	C	C	G	rs200097954|rs368406759|rs79330752	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:179504040C>G	ENST00000367618.3	+	25	3361	c.2974C>G	c.(2974-2976)Caa>Gaa	p.Q992E		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	992	Glu-rich.							p.E991_Q992delEQ(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						agaagaagaacaacaagaaga	0.318													c|||	14	0.00279553	0.0	0.0058	5008	,	,		17397	0.002		0.004	False		,,,				2504	0.0041					.											1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)											50.0	53.0	52.0					1																	179504040		2149	4285	6434	SO:0001583	missense	126859			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2974C>G	1.37:g.179504040C>G	ENSP00000356590:p.Gln992Glu		Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-2.898575	0.00058	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.15256	2.44;2.44	2.01	-1.28	0.09318	.	1.561730	0.04078	N	0.309154	T	0.06554	0.0168	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23904	-1.0175	10	0.02654	T	1	-5.6078	3.1227	0.06397	0.3057:0.2604:0.4339:0.0	.	876;992	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	E	992;876;852	ENSP00000356590:Q992E;ENSP00000391716:Q852E	ENSP00000353471:Q876E	Q	+	1	0	AXDND1	177770663	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.281000	0.08456	-0.358000	0.08162	-4.192000	0.00009	CAA		0.318	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
DDX11	1663	mdanderson.org	37	12	31237922	31237922	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:31237922G>C	ENST00000407793.2	+	5	751	c.500G>C	c.(499-501)aGa>aCa	p.R167T	DDX11_ENST00000542838.1_Missense_Mutation_p.R167T|DDX11_ENST00000228264.6_Missense_Mutation_p.R141T|DDX11_ENST00000350437.4_Missense_Mutation_p.R167T|DDX11_ENST00000545668.1_Missense_Mutation_p.R167T|DDX11_ENST00000251758.5_Missense_Mutation_p.R167T	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	167	Glu-rich.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R167T(11)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GAAGAAGAAAGAGAGAATCTC	0.612										Multiple Myeloma(12;0.14)																												.											11	Substitution - Missense(11)	lung(6)|kidney(2)|large_intestine(1)|prostate(1)|central_nervous_system(1)											18.0	20.0	19.0					12																	31237922		2203	4299	6502	SO:0001583	missense	1663			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.500G>C	12.37:g.31237922G>C	ENSP00000384703:p.Arg167Thr		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.810541	0.00600	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000251758;ENST00000228264;ENST00000438391;ENST00000415475;ENST00000545668;ENST00000350437	T;T;T;T;T;T;T;T	0.59224	4.17;4.17;4.17;4.17;0.28;4.17;4.17;4.17	3.87	0.233	0.15386	Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.241085	0.41938	N	0.000785	T	0.18635	0.0447	N	0.00841	-1.15	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.25779	-1.0122	10	0.12430	T	0.62	.	5.1988	0.15252	0.0:0.4995:0.1963:0.3042	.	167;167;167;167	B4DZY1;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	T	167;167;167;141;138;141;167;167	ENSP00000443426:R167T;ENSP00000384703:R167T;ENSP00000251758:R167T;ENSP00000228264:R141T;ENSP00000407646:R138T;ENSP00000406457:R141T;ENSP00000440402:R167T;ENSP00000309965:R167T	ENSP00000228264:R141T	R	+	2	0	DDX11	31129189	0.211000	0.23529	0.000000	0.03702	0.000000	0.00434	0.680000	0.25306	-0.264000	0.09365	-1.993000	0.00448	AGA		0.612	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
EP400	57634	mdanderson.org	37	12	132547138	132547138	+	Silent	SNP	A	A	G	rs111782215|rs561398509	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:132547138A>G	ENST00000333577.4	+	48	8443	c.8334A>G	c.(8332-8334)caA>caG	p.Q2778Q	EP400_ENST00000332482.4_Silent_p.Q2705Q|EP400_ENST00000330386.6_Silent_p.Q2661Q|EP400_ENST00000389562.2_Silent_p.Q2741Q|EP400_ENST00000389561.2_Silent_p.Q2742Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2778	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2741Q(3)|p.Q2742Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacagcagcagc	0.602													G|||	74	0.0147764	0.028	0.0086	5008	,	,		14914	0.0079		0.0119	False		,,,				2504	0.0112					.											4	Substitution - coding silent(4)	prostate(2)|endometrium(1)|kidney(1)											48.0	40.0	43.0					12																	132547138		2203	4300	6503	SO:0001819	synonymous_variant	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8334A>G	12.37:g.132547138A>G			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																					0.602	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FAM174B	400451	mdanderson.org	37	15	93198687	93198688	+	Missense_Mutation	DNP	GA	GA	CC	rs200080757		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr15:93198687_93198688GA>CC	ENST00000327355.5	-	1	500_501	c.202_203TC>GG	c.(202-204)TCc>GGc	p.S68G	FAM174B_ENST00000555696.1_5'Flank|FAM174B_ENST00000555748.1_5'Flank	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B	68				Missing (in Ref. 1; BAC11703 and 3; AAH60873). {ECO:0000305}.		integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						GTTGGAGCTGGAGCTGCCGCTG	0.723																																						.											0																																										SO:0001583	missense	400451				CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.202_203delinsCC	15.37:g.93198687_93198688delinsCC	ENSP00000329040:p.Ser68Gly		Q3ZCR9|Q8NBH7	Missense_Mutation	DNP	ENST00000327355.5	37	CCDS45355.1																																																																																				0.723	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414931.1	NM_207446	
FAM21C	253725	mdanderson.org	37	10	46248649	46248649	+	Missense_Mutation	SNP	T	T	C	rs2610452	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr10:46248649T>C	ENST00000336378.4	+	13	1262	c.1144T>C	c.(1144-1146)Tcc>Ccc	p.S382P	FAM21C_ENST00000374362.2_Missense_Mutation_p.S382P|FAM21C_ENST00000540872.1_Missense_Mutation_p.S382P|FAM21C_ENST00000537517.1_Missense_Mutation_p.S358P|FAM21C_ENST00000359860.4_Missense_Mutation_p.S326P	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	382				S -> P (in Ref. 4; AAI50612). {ECO:0000305}.	retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CACGGAAGCCTCCCAGGATCG	0.493													C|||	755	0.150759	0.1823	0.1196	5008	,	,		7906	0.1706		0.0944	False		,,,				2504	0.1677					.											0													50.0	54.0	53.0					10																	46248649		1176	3339	4515	SO:0001583	missense	253725				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1144T>C	10.37:g.46248649T>C	ENSP00000337541:p.Ser382Pro		B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	ENST00000336378.4	37		66	0.03021978021978022	19	0.03861788617886179	7	0.019337016574585635	27	0.0472027972027972	13	0.017150395778364115	C	0.089	-1.169554	0.01660	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.23	3.23	0.37069	.	0.311519	0.35096	N	0.003450	T	0.00906	0.0030	N	0.00436	-1.5	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.36480	-0.9746	9	0.02654	T	1	-3.2928	6.6596	0.23007	0.0:0.8641:0.0:0.1359	.	358;382;382;327	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	P	382;382;358;382;382;326;294	.	ENSP00000337541:S382P	S	+	1	0	FAM21C	45568655	0.006000	0.16342	0.005000	0.12908	0.071000	0.16799	0.625000	0.24477	0.714000	0.32081	-0.176000	0.13171	TCC		0.493	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
FGFRL1	53834	mdanderson.org	37	4	1019078	1019078	+	Silent	SNP	T	T	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr4:1019078T>A	ENST00000398484.2	+	8	2038	c.1458T>A	c.(1456-1458)tcT>tcA	p.S486S	FGFRL1_ENST00000504138.1_Silent_p.S486S|RP11-460I19.2_ENST00000503095.1_lincRNA|FGFRL1_ENST00000510644.1_Silent_p.S486S|FGFRL1_ENST00000264748.6_Silent_p.S486S			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	486	His-rich.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			acacacactctcacacacact	0.607																																						.											0													12.0	14.0	13.0					4																	1019078		2171	4277	6448	SO:0001819	synonymous_variant	53834				CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.1458T>A	4.37:g.1019078T>A			B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Silent	SNP	ENST00000398484.2	37	CCDS3344.1																																																																																				0.607	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923	
FRG1	2483	mdanderson.org	37	4	190876307	190876307	+	Splice_Site	SNP	G	G	A	rs200854715		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr4:190876307G>A	ENST00000226798.4	+	5	654		c.e5+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		CTTTCAAAATGTAAGTGCTGT	0.328																																						.											0													74.0	74.0	74.0					4																	190876307		2202	4295	6497	SO:0001630	splice_region_variant	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.432+1G>A	4.37:g.190876307G>A			A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	18.80	3.700931	0.68501	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7779	0.63066	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191113301	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.413000	0.80104	1.879000	0.54435	0.567000	0.79289	.		0.328	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
GTF2IRD2	84163	mdanderson.org	37	7	74212075	74212075	+	Silent	SNP	G	G	T	rs2523348		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr7:74212075G>T	ENST00000405086.2	-	16	1965	c.1776C>A	c.(1774-1776)ggC>ggA	p.G592G	GTF2IRD2_ENST00000451013.2_Silent_p.G139G	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	592					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						agatctcgttgccagattttg	0.507																																					NSCLC(40;560 1096 7501 40315 49546)	.											0													68.0	64.0	65.0					7																	74212075		2203	4299	6502	SO:0001819	synonymous_variant	84163			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.1776C>A	7.37:g.74212075G>T			A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Silent	SNP	ENST00000405086.2	37	CCDS5576.1																																																																																				0.507	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252712.3	NM_173537	
HLA-A	3105	mdanderson.org	37	6	29910602	29910602	+	Missense_Mutation	SNP	G	G	T	rs41552219	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr6:29910602G>T	ENST00000396634.1	+	4	483	c.142G>T	c.(142-144)Gcc>Tcc	p.A48S	HLA-A_ENST00000376809.5_Missense_Mutation_p.A48S|HLA-A_ENST00000376806.5_Missense_Mutation_p.A48S|HLA-A_ENST00000376802.2_Missense_Mutation_p.A48S			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	48	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CCGCTTCATCGCCGTGGGCTA	0.697									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												.											0													32.0	28.0	29.0					6																	29910602		2201	4298	6499	SO:0001583	missense	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.142G>T	6.37:g.29910602G>T	ENSP00000379873:p.Ala48Ser		O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	8.545	0.874078	0.17395	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00012	9.31;9.31;9.31;9.31	3.72	-7.44	0.01379	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	3.134130	0.02442	N	0.084628	T	0.00039	0.0001	N	0.11927	0.2	0.09310	N	1	B;D;B;D;B	0.69078	0.001;0.997;0.001;0.997;0.001	B;D;B;D;B	0.91635	0.069;0.999;0.111;0.999;0.069	T	0.53989	-0.8360	10	0.44086	T	0.13	.	3.4234	0.07401	0.21:0.0831:0.5765:0.1304	rs41552219	48;48;48;48;48	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	S	48	ENSP00000379873:A48S;ENSP00000366002:A48S;ENSP00000366005:A48S;ENSP00000365998:A48S	ENSP00000348012:A48S	A	+	1	0	HLA-A	30018581	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-6.122000	0.00080	-2.883000	0.00318	-1.516000	0.00938	GCC		0.697	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
HLA-A	3105	mdanderson.org	37	6	29910622	29910622	+	Silent	SNP	C	C	T	rs199501996	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr6:29910622C>T	ENST00000396634.1	+	4	503	c.162C>T	c.(160-162)gaC>gaT	p.D54D	HLA-A_ENST00000376809.5_Silent_p.D54D|HLA-A_ENST00000376806.5_Silent_p.D54D|HLA-A_ENST00000376802.2_Silent_p.D54D			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	54	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.D54D(2)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						ACGTGGACGACACGCAGTTCG	0.687									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												.											2	Substitution - coding silent(2)	prostate(2)											47.0	40.0	42.0					6																	29910622		2202	4299	6501	SO:0001819	synonymous_variant	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.162C>T	6.37:g.29910622C>T			O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	37	CCDS34373.1																																																																																				0.687	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
KRTAP10-10	353333	mdanderson.org	37	21	46057625	46057625	+	Silent	SNP	T	T	C	rs66931310|rs56249559|rs55677560	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr21:46057625T>C	ENST00000380095.1	+	1	353	c.291T>C	c.(289-291)ccT>ccC	p.P97P	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	97	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						gctgtgtgcctgtctgctgtg	0.622																																						.											0													82.0	79.0	80.0					21																	46057625		2132	4094	6226	SO:0001819	synonymous_variant	353333			AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.291T>C	21.37:g.46057625T>C				Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																				0.622	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
KRTAP10-10	353333	mdanderson.org	37	21	46057634	46057634	+	Silent	SNP	T	T	C	rs61029972	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr21:46057634T>C	ENST00000380095.1	+	1	362	c.300T>C	c.(298-300)tgT>tgC	p.C100C	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	100	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						ctgtctgctgtgtgcccgtct	0.632													C|||	539	0.107628	0.2383	0.0591	5008	,	,		18755	0.0109		0.0557	False		,,,				2504	0.1186					.											0													126.0	121.0	123.0					21																	46057634		2203	4298	6501	SO:0001819	synonymous_variant	353333			AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.300T>C	21.37:g.46057634T>C				Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																				0.632	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
KRTAP4-11	653240	mdanderson.org	37	17	39274206	39274206	+	Missense_Mutation	SNP	C	C	T	rs79388709		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr17:39274206C>T	ENST00000391413.2	-	1	400	c.362G>A	c.(361-363)aGa>aAa	p.R121K		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.R121K(5)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcactggggtctgcagcagct	0.652																																						.											5	Substitution - Missense(5)	lung(2)|prostate(1)|kidney(1)|skin(1)											5.0	9.0	8.0					17																	39274206		644	1533	2177	SO:0001583	missense	653240			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.362G>A	17.37:g.39274206C>T	ENSP00000375232:p.Arg121Lys		A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	4.782	0.145483	0.09134	.	.	ENSG00000212721	ENST00000391413	T	0.01455	4.87	3.34	-4.84	0.03151	.	.	.	.	.	T	0.01905	0.0060	M	0.73962	2.25	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.50276	-0.8847	9	0.11794	T	0.64	.	2.2508	0.04042	0.1417:0.1925:0.1396:0.5262	.	121	Q9BYQ6	KR411_HUMAN	K	121	ENSP00000375232:R121K	ENSP00000375232:R121K	R	-	2	0	KRTAP4-11	36527732	0.000000	0.05858	0.009000	0.14445	0.065000	0.16274	-1.602000	0.02079	-0.525000	0.06391	-1.218000	0.01608	AGA		0.652	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP5-10	387273	mdanderson.org	37	11	71276725	71276725	+	Missense_Mutation	SNP	A	A	G	rs201471375	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr11:71276725A>G	ENST00000398531.1	+	1	117	c.92A>G	c.(91-93)tAt>tGt	p.Y31C	KRTAP5-10_ENST00000376536.4_Missense_Mutation_p.Y31C	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	31						keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						TGTGGGGGCTATGGCTCTGGC	0.677																																						.											0																																										SO:0001583	missense	387273			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.92A>G	11.37:g.71276725A>G	ENSP00000381542:p.Tyr31Cys		B9EHA4	Missense_Mutation	SNP	ENST00000398531.1	37	CCDS41684.1	.	.	.	.	.	.	.	.	.	.	g	4.044	0.005740	0.07866	.	.	ENSG00000204572	ENST00000398531;ENST00000376536	T;T	0.00856	5.61;5.85	1.67	1.67	0.24075	.	.	.	.	.	T	0.00271	0.0008	N	0.00031	-2.595	0.20638	N	0.999878	B	0.02656	0.0	B	0.01281	0.0	T	0.46816	-0.9164	9	0.48119	T	0.1	.	4.2372	0.10632	0.3976:0.0:0.6024:0.0	.	31	Q6L8G5	KR510_HUMAN	C	31	ENSP00000381542:Y31C;ENSP00000365719:Y31C	ENSP00000365719:Y31C	Y	+	2	0	KRTAP5-10	70954373	0.001000	0.12720	0.866000	0.34008	0.119000	0.20118	-1.171000	0.03115	0.049000	0.15920	-0.473000	0.04963	TAT		0.677	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
LCN1	3933	mdanderson.org	37	9	138413982	138413982	+	Silent	SNP	G	G	A	rs150536266	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr9:138413982G>A	ENST00000263598.2	+	2	240	c.180G>A	c.(178-180)acG>acA	p.T60T	LCN1_ENST00000371781.3_Silent_p.T60T	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	60					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		TGACCCTCACGACCCTGGAAG	0.612													G|||	14	0.00279553	0.0091	0.0	5008	,	,		17535	0.0		0.0	False		,,,				2504	0.002					.											0								G		11,4381		0,11,2185	13.0	12.0	12.0		180	-1.6	0.0	9	dbSNP_134	12	0,8564		0,0,4282	no	coding-synonymous	LCN1	NM_002297.2		0,11,6467	AA,AG,GG		0.0,0.2505,0.0849		60/177	138413982	11,12945	2196	4282	6478	SO:0001819	synonymous_variant	3933				CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.180G>A	9.37:g.138413982G>A			Q5T8A1	Silent	SNP	ENST00000263598.2	37	CCDS6991.1																																																																																				0.612	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054992.1	NM_002297	
LRRC37A2	474170	mdanderson.org	37	17	44630768	44630768	+	Missense_Mutation	SNP	A	A	G	rs200445221		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr17:44630768A>G	ENST00000576629.1	+	12	5307	c.4812A>G	c.(4810-4812)atA>atG	p.I1604M	ARL17A_ENST00000329240.4_Intron|ARL17A_ENST00000573185.1_Intron|ARL17A_ENST00000445552.2_Intron|ARL17A_ENST00000337845.7_Intron|LRRC37A2_ENST00000333412.3_Missense_Mutation_p.I1604M|ARL17A_ENST00000570550.1_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1604						integral component of membrane (GO:0016021)		p.I1604M(2)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TAAAACAGATATGTTGTCACC	0.338																																						.											2	Substitution - Missense(2)	prostate(2)											66.0	120.0	102.0					17																	44630768		2198	4293	6491	SO:0001583	missense	474170			AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.4812A>G	17.37:g.44630768A>G	ENSP00000459551:p.Ile1604Met		B7ZMC3	Missense_Mutation	SNP	ENST00000576629.1	37	CCDS42353.1	.	.	.	.	.	.	.	.	.	.	a	11.80	1.747925	0.30955	.	.	ENSG00000238083	ENST00000333412	T	0.53857	0.6	2.45	1.28	0.21552	.	.	.	.	.	T	0.60792	0.2296	L	0.53249	1.67	0.20307	N	0.999911	D;D	0.89917	1.0;0.997	D;D	0.80764	0.994;0.916	T	0.48958	-0.8988	9	0.87932	D	0	.	3.1223	0.06395	0.2434:0.0:0.2508:0.5058	.	565;1604	B3KRJ4;A6NM11	.;L37A2_HUMAN	M	1604	ENSP00000333071:I1604M	ENSP00000333071:I1604M	I	+	3	3	LRRC37A2	41986084	0.009000	0.17119	0.240000	0.24138	0.009000	0.06853	-0.890000	0.04140	-0.033000	0.13736	-1.974000	0.00461	ATA		0.338	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440299.2	NM_001006607	
ANKRD30BL	554226	mdanderson.org	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																						.											0													27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C			B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																					0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
MUC16	94025	mdanderson.org	37	19	8999421	8999421	+	Missense_Mutation	SNP	G	G	C	rs75266616		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr19:8999421G>C	ENST00000397910.4	-	56	40957	c.40754C>G	c.(40753-40755)aCc>aGc	p.T13585S	MUC16_ENST00000380951.5_Missense_Mutation_p.T226S	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13587	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCTGTCCAGGGTGTAGGGGCC	0.567																																						.											0													247.0	206.0	219.0					19																	8999421		2072	4221	6293	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40754C>G	19.37:g.8999421G>C	ENSP00000381008:p.Thr13585Ser		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.18|12.18	1.861742|1.861742	0.32884|0.32884	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.24538	.|1.85;1.85	3.48|3.48	1.25|1.25	0.21368|0.21368	.|SEA (1);	.|.	.|.	.|.	.|.	T|T	0.35740|0.35740	0.0942|0.0942	.|.	.|.	.|.	.|.	.|.	.|.	.|B;P	.|0.48911	.|0.114;0.917	.|B;D	.|0.63488	.|0.031;0.915	T|T	0.40403|0.40403	-0.9565|-0.9565	3|7	.|0.30854	.|T	.|0.27	.|.	4.5034|4.5034	0.11876|0.11876	0.1321:0.2319:0.6359:0.0|0.1321:0.2319:0.6359:0.0	.|.	.|21230;13585	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	A|S	425|13585;226	.|ENSP00000381008:T13585S;ENSP00000370338:T226S	.|ENSP00000370338:T226S	P|T	-|-	1|2	0|0	MUC16|MUC16	8860421|8860421	0.991000|0.991000	0.36638|0.36638	0.997000|0.997000	0.53966|0.53966	0.497000|0.497000	0.33675|0.33675	0.218000|0.218000	0.17622|0.17622	0.783000|0.783000	0.33636|0.33636	0.555000|0.555000	0.69702|0.69702	CCC|ACC		0.567	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC6	4588	mdanderson.org	37	11	1017679	1017679	+	Missense_Mutation	SNP	A	A	G	rs111294390	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr11:1017679A>G	ENST00000421673.2	-	31	5172	c.5122T>C	c.(5122-5124)Tca>Cca	p.S1708P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1708	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTAGAAGTTGAGGTGGCTTCA	0.542																																						.											0													671.0	663.0	666.0					11																	1017679		2200	4286	6486	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5122T>C	11.37:g.1017679A>G	ENSP00000406861:p.Ser1708Pro		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	a	1.190	-0.635554	0.03584	.	.	ENSG00000184956	ENST00000421673	T	0.24350	1.86	1.74	-3.47	0.04753	.	.	.	.	.	T	0.06645	0.0170	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13150	-1.0520	9	0.30078	T	0.28	.	0.4744	0.00537	0.3445:0.1183:0.2044:0.3327	.	1708	Q6W4X9	MUC6_HUMAN	P	1708	ENSP00000406861:S1708P	ENSP00000406861:S1708P	S	-	1	0	MUC6	1007679	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.120000	0.00595	-4.140000	0.00070	-0.883000	0.02948	TCA		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1018271	1018271	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr11:1018271G>C	ENST00000421673.2	-	31	4580	c.4530C>G	c.(4528-4530)agC>agG	p.S1510R		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1510	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTGGGCTTGGCTGGTCCCAC	0.552																																						.											0													242.0	258.0	253.0					11																	1018271		2170	4268	6438	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4530C>G	11.37:g.1018271G>C	ENSP00000406861:p.Ser1510Arg		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	2.932	-0.220929	0.06061	.	.	ENSG00000184956	ENST00000421673	T	0.19669	2.13	2.41	-4.82	0.03171	.	.	.	.	.	T	0.14098	0.0341	L	0.55481	1.735	0.09310	N	1	P	0.38978	0.652	B	0.32724	0.151	T	0.01228	-1.1412	9	0.34782	T	0.22	.	5.8101	0.18462	0.5536:0.2513:0.1951:0.0	.	1510	Q6W4X9	MUC6_HUMAN	R	1510	ENSP00000406861:S1510R	ENSP00000406861:S1510R	S	-	3	2	MUC6	1008271	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.010000	0.03656	-2.668000	0.00415	-0.657000	0.03884	AGC		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
NACAD	23148	mdanderson.org	37	7	45123697	45123697	+	Silent	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr7:45123697C>T	ENST00000490531.2	-	2	2101	c.2082G>A	c.(2080-2082)tcG>tcA	p.S694S		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	694					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TTGGGGCTGACGAGAGATCTG	0.632																																						.											0													1.0	1.0	1.0					7																	45123697		51	296	347	SO:0001819	synonymous_variant	23148			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.2082G>A	7.37:g.45123697C>T				Silent	SNP	ENST00000490531.2	37	CCDS47582.1																																																																																				0.632	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
OR5H1	26341	mdanderson.org	37	3	97851659	97851659	+	Missense_Mutation	SNP	A	A	T	rs199787047	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr3:97851659A>T	ENST00000354565.2	+	1	118	c.118A>T	c.(118-120)Atg>Ttg	p.M40L	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M40L(3)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CATCACCATCATGGGGAATCT	0.413																																						.											3	Substitution - Missense(3)	kidney(2)|endometrium(1)											45.0	49.0	48.0					3																	97851659		2174	4242	6416	SO:0001583	missense	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.118A>T	3.37:g.97851659A>T	ENSP00000346575:p.Met40Leu			Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	A	3.067	-0.192020	0.06299	.	.	ENSG00000231192	ENST00000354565	T	0.00241	8.46	3.63	-0.16	0.13375	.	0.578292	0.14348	N	0.325303	T	0.00073	0.0002	N	0.04116	-0.275	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04976	-1.0914	10	0.33940	T	0.23	.	7.0903	0.25279	0.5661:0.0:0.4339:0.0	.	40	A6NKK0	OR5H1_HUMAN	L	40	ENSP00000346575:M40L	ENSP00000346575:M40L	M	+	1	0	OR5H1	99334349	0.000000	0.05858	0.016000	0.15963	0.102000	0.19082	-3.263000	0.00535	-0.297000	0.08934	0.164000	0.16699	ATG		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
OR5H1	26341	mdanderson.org	37	3	97851661	97851661	+	Missense_Mutation	SNP	G	G	T	rs200721525	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr3:97851661G>T	ENST00000354565.2	+	1	120	c.120G>T	c.(118-120)atG>atT	p.M40I	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M40I(4)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TCACCATCATGGGGAATCTTG	0.413																																						.											4	Substitution - Missense(4)	endometrium(2)|kidney(2)											46.0	50.0	48.0					3																	97851661		2173	4250	6423	SO:0001583	missense	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.120G>T	3.37:g.97851661G>T	ENSP00000346575:p.Met40Ile			Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	G	3.467	-0.108676	0.06924	.	.	ENSG00000231192	ENST00000354565	T	0.00433	7.43	3.63	2.75	0.32379	.	0.578292	0.14348	N	0.325303	T	0.00178	0.0005	N	0.02842	-0.48	0.20764	N	0.999858	B	0.06786	0.001	B	0.04013	0.001	T	0.29882	-0.9997	10	0.33940	T	0.23	.	8.5896	0.33679	0.1182:0.0:0.8818:0.0	.	40	A6NKK0	OR5H1_HUMAN	I	40	ENSP00000346575:M40I	ENSP00000346575:M40I	M	+	3	0	OR5H1	99334351	0.002000	0.14202	0.678000	0.29963	0.118000	0.20060	-0.111000	0.10807	0.729000	0.32403	0.195000	0.17529	ATG		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
POLRMT	5442	mdanderson.org	37	19	622336	622336	+	Missense_Mutation	SNP	T	T	G	rs2238549	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr19:622336T>G	ENST00000588649.2	-	9	1748	c.1664A>C	c.(1663-1665)gAg>gCg	p.E555A	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	555			E -> A (in dbSNP:rs2238549).		gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCCCCAGCTCCTCCCAGTA	0.736													G|||	3107	0.620407	0.7421	0.3905	5008	,	,		13238	0.5804		0.505	False		,,,				2504	0.7791					.											0								G	ALA/GLU	2180,1784		674,832,476	3.0	4.0	4.0		1664	0.8	0.2	19	dbSNP_98	4	3162,4714		735,1692,1511	no	missense	POLRMT	NM_005035.3	107	1409,2524,1987	GG,GT,TT		40.1473,45.005,45.1182	benign	555/1231	622336	5342,6498	1982	3938	5920	SO:0001583	missense	5442				CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.1664A>C	19.37:g.622336T>G	ENSP00000465759:p.Glu555Ala		O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	1206	0.5521978021978022	355	0.7215447154471545	157	0.43370165745856354	311	0.5437062937062938	383	0.5052770448548812	.	0.101	-1.151710	0.01700	0.54995	0.401473	ENSG00000099821	ENST00000215591	T	0.38887	1.11	4.15	0.782	0.18567	.	1.028080	0.07721	N	0.943661	T	0.00012	0.0000	N	0.00483	-1.445	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39563	-0.9608	9	0.07175	T	0.84	-7.4541	3.713	0.08427	0.2656:0.0:0.3311:0.4033	rs2238549;rs60424827	555	O00411	RPOM_HUMAN	A	555	ENSP00000215591:E555A	ENSP00000215591:E555A	E	-	2	0	POLRMT	573336	0.000000	0.05858	0.177000	0.23020	0.499000	0.33736	0.188000	0.17018	-0.062000	0.13088	-0.217000	0.12591	GAG		0.736	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
SEMA6A	57556	mdanderson.org	37	5	115837967	115837967	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr5:115837967T>C	ENST00000343348.6	-	3	944	c.157A>G	c.(157-159)Agg>Ggg	p.R53G	SEMA6A_ENST00000257414.8_Missense_Mutation_p.R53G|SEMA6A_ENST00000510263.1_Missense_Mutation_p.R53G|SEMA6A_ENST00000503962.1_5'UTR|CTB-118N6.3_ENST00000510682.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	53	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AGCCTGTGCCTCTGTGTGGTG	0.498																																						.											0													249.0	247.0	248.0					5																	115837967		2049	4205	6254	SO:0001583	missense	57556			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.157A>G	5.37:g.115837967T>C	ENSP00000345512:p.Arg53Gly		Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	37	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.913512	0.52439	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263;ENST00000515009;ENST00000509665	T;T;T;T;T	0.29142	1.99;1.99;1.99;1.58;1.58	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.049179	0.85682	D	0.000000	T	0.43055	0.1230	M	0.67953	2.075	0.80722	D	1	P;P	0.49696	0.881;0.927	B;P	0.48677	0.382;0.586	T	0.44952	-0.9294	10	0.72032	D	0.01	.	15.2197	0.73303	0.0:0.0:0.0:1.0	.	53;53	Q9H2E6;Q9H2E6-2	SEM6A_HUMAN;.	G	53	ENSP00000345512:R53G;ENSP00000257414:R53G;ENSP00000424388:R53G;ENSP00000421935:R53G;ENSP00000425553:R53G	ENSP00000257414:R53G	R	-	1	2	SEMA6A	115865866	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.895000	0.56258	2.082000	0.62665	0.528000	0.53228	AGG		0.498	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
SLC27A3	11000	mdanderson.org	37	1	153748161	153748161	+	Missense_Mutation	SNP	G	G	C	rs34527123|rs587776392	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr1:153748161G>C	ENST00000368661.3	+	1	394	c.329G>C	c.(328-330)gGg>gCg	p.G110A	SLC27A3_ENST00000271857.2_Missense_Mutation_p.G191A|SLC27A3_ENST00000484014.1_Intron	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	110			G -> A (in dbSNP:rs34527123).		fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGTCCCGAGGGGGGCTGCAGC	0.711													G|||	51	0.0101837	0.0008	0.0173	5008	,	,		13208	0.001		0.0328	False		,,,				2504	0.0041					.											0								G	ALA/GLY	21,3907		0,21,1943	4.0	6.0	5.0		329	2.8	1.0	1	dbSNP_126	5	220,7654		2,216,3719	no	missense	SLC27A3	NM_024330.1	60	2,237,5662	CC,CG,GG		2.794,0.5346,2.042	possibly-damaging	110/731	153748161	241,11561	1964	3937	5901	SO:0001583	missense	11000			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.329G>C	1.37:g.153748161G>C	ENSP00000357650:p.Gly110Ala		Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	40	0.018315018315018316	3	0.006097560975609756	8	0.022099447513812154	1	0.0017482517482517483	28	0.036939313984168866	G	15.58	2.876242	0.51801	0.005346	0.02794	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.58210	0.35;0.4	3.71	2.78	0.32641	.	0.562171	0.15028	N	0.284627	T	0.13970	0.0338	N	0.14661	0.345	0.19300	N	0.999971	B	0.02656	0.0	B	0.04013	0.001	T	0.24512	-1.0158	10	0.25751	T	0.34	-2.2657	8.9582	0.35832	0.0:0.2277:0.7723:0.0	rs34527123	110	Q5K4L6	S27A3_HUMAN	A	191;110	ENSP00000271857:G191A;ENSP00000357650:G110A	ENSP00000271857:G191A	G	+	2	0	SLC27A3	152014785	0.535000	0.26370	0.973000	0.42090	0.938000	0.57974	0.716000	0.25836	0.753000	0.32945	0.462000	0.41574	GGG		0.711	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
SYCE1L	100130958	mdanderson.org	37	16	77246218	77246218	+	Missense_Mutation	SNP	G	G	A	rs13331769	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr16:77246218G>A	ENST00000378644.4	+	9	588	c.533G>A	c.(532-534)cGg>cAg	p.R178Q	RP11-538I12.2_ENST00000569032.1_RNA	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	178					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)				breast(1)|prostate(1)	2						GTGGAGCGGCGGCTGCACTCG	0.766													G|||	1815	0.36242	0.2065	0.3833	5008	,	,		11988	0.3065		0.5875	False		,,,				2504	0.3845					.											0													3.0	6.0	5.0					16																	77246218		527	1355	1882	SO:0001583	missense	100130958				CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.533G>A	16.37:g.77246218G>A	ENSP00000367911:p.Arg178Gln		A6NF23	Missense_Mutation	SNP	ENST00000378644.4	37	CCDS45533.1	873	0.39972527472527475	110	0.22357723577235772	150	0.4143646408839779	178	0.3111888111888112	435	0.5738786279683378	G	3.435	-0.115281	0.06881	.	.	ENSG00000205078	ENST00000378644	T	0.46063	0.88	3.01	0.923	0.19413	.	1.711630	0.04935	U	0.457533	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	D	0.57899	0.981	B	0.43103	0.408	T	0.42120	-0.9470	9	0.09843	T	0.71	.	3.8967	0.09143	0.1317:0.0:0.6355:0.2328	rs13331769	178	A8MT33	SYC1L_HUMAN	Q	178	ENSP00000367911:R178Q	ENSP00000367911:R178Q	R	+	2	0	SYCE1L	75803719	0.005000	0.15991	0.001000	0.08648	0.107000	0.19398	-0.261000	0.08694	0.272000	0.22027	0.471000	0.43371	CGG		0.766	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433889.1	NM_001129979	
TBP	6908	mdanderson.org	37	6	170871049	170871049	+	Silent	SNP	G	G	A	rs369312237|rs56241301		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr6:170871049G>A	ENST00000392092.2	+	3	504	c.225G>A	c.(223-225)caG>caA	p.Q75Q	TBP_ENST00000230354.6_Silent_p.Q75Q|TBP_ENST00000540980.1_Silent_p.Q55Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	75	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q75Q(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacagcaacagcagcagcagc	0.567																																						.											2	Substitution - coding silent(2)	lung(2)											15.0	19.0	18.0					6																	170871049		1966	3856	5822	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.225G>A	6.37:g.170871049G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																				0.567	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TUBG2	27175	mdanderson.org	37	17	40818353	40818353	+	Silent	SNP	C	C	T	rs523338	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr17:40818353C>T	ENST00000251412.7	+	10	1208	c.1009C>T	c.(1009-1011)Ctg>Ttg	p.L337L	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	337					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.L337L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		CCACAAGAGCCTGCAGAGGAT	0.672																																						.											1	Substitution - coding silent(1)	central_nervous_system(1)											46.0	48.0	47.0					17																	40818353		2203	4300	6503	SO:0001819	synonymous_variant	27175			AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.1009C>T	17.37:g.40818353C>T			A6NDI4|Q32NB2	Silent	SNP	ENST00000251412.7	37	CCDS32658.1																																																																																				0.672	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452326.1	NM_016437	
ZNF285	26974	mdanderson.org	37	19	44891089	44891089	+	Missense_Mutation	SNP	A	A	T	rs199819861	byFrequency	TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr19:44891089A>T	ENST00000330997.4	-	4	1382	c.1318T>A	c.(1318-1320)Tgt>Agt	p.C440S	ZNF285_ENST00000591679.1_Missense_Mutation_p.C447S|ZNF285_ENST00000544719.2_Missense_Mutation_p.C440S|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	440					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						AGGTGTGTACATTGGCTGAAG	0.468													T|||	4	0.000798722	0.0	0.0043	5008	,	,		22416	0.0		0.001	False		,,,				2504	0.0					.											0																																										SO:0001583	missense	26974			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1318T>A	19.37:g.44891089A>T	ENSP00000333595:p.Cys440Ser		Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.606878	0.00842	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.06849	3.25	3.36	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01124	0.0037	N	0.00044	-2.46	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42649	-0.9439	9	0.02654	T	1	.	3.9217	0.09247	0.49:0.0999:0.0:0.4101	.	464;440	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	S	463;440	ENSP00000333595:C440S	ENSP00000333595:C440S	C	-	1	0	ZNF285	49582929	0.000000	0.05858	0.246000	0.24233	0.897000	0.52465	-2.732000	0.00804	-0.408000	0.07565	-0.908000	0.02827	TGT		0.468	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ZC3H4	23211	mdanderson.org	37	19	47575243	47575243	+	Silent	SNP	T	T	A	rs392366		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr19:47575243T>A	ENST00000253048.5	-	13	1975	c.1938A>T	c.(1936-1938)gcA>gcT	p.A646A	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	646	Pro-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		cgtgcatgtctgcgtgcatgt	0.662																																						.											0								C		1,4247		0,1,2123	31.0	36.0	34.0		1938	-10.4	0.0	19	dbSNP_80	34	6,8510		0,6,4252	no	coding-synonymous	ZC3H4	NM_015168.1		0,7,6375	AA,AT,TT		0.0705,0.0235,0.0548		646/1304	47575243	7,12757	2124	4258	6382	SO:0001819	synonymous_variant	23211			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1938A>T	19.37:g.47575243T>A			Q9Y420	Silent	SNP	ENST00000253048.5	37	CCDS42582.1																																																																																				0.662	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
VN1R4	317703	mdanderson.org	37	19	53770825	53770825	+	Missense_Mutation	SNP	A	A	G	rs141780644		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr19:53770825A>G	ENST00000311170.4	-	1	147	c.94T>C	c.(94-96)Ttt>Ctt	p.F32L	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	32					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		GTGCAGTAAAAGGAGAGATAA	0.507										HNSCC(26;0.072)																												.											0													55.0	60.0	58.0					19																	53770825		2203	4300	6503	SO:0001583	missense	317703			AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.94T>C	19.37:g.53770825A>G	ENSP00000310856:p.Phe32Leu		Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Missense_Mutation	SNP	ENST00000311170.4	37	CCDS33099.1	.	.	.	.	.	.	.	.	.	.	A	3.164	-0.171426	0.06421	.	.	ENSG00000228567	ENST00000311170	T	0.34072	1.38	2.28	-3.47	0.04753	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30575	N	0.009335	T	0.09862	0.0242	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25676	-1.0125	10	0.02654	T	1	.	1.5772	0.02626	0.1176:0.3229:0.2328:0.3268	.	32	Q7Z5H5	VN1R4_HUMAN	L	32	ENSP00000310856:F32L	ENSP00000310856:F32L	F	-	1	0	VN1R4	58462637	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.898000	0.04105	-0.609000	0.05724	-3.182000	0.00056	TTT		0.507	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	NM_173857	
EPS8	2059	bcgsc.ca	37	12	15784390	15784393	+	Frame_Shift_Del	DEL	TTGT	TTGT	-			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	TTGT	TTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr12:15784390_15784393delTTGT	ENST00000281172.5	-	18	2463_2466	c.2027_2030delACAA	c.(2026-2031)aacaaafs	p.NK676fs	EPS8_ENST00000542903.1_Frame_Shift_Del_p.NK416fs|EPS8_ENST00000540613.1_Frame_Shift_Del_p.NK416fs|EPS8_ENST00000543612.1_Frame_Shift_Del_p.NK676fs|EPS8_ENST00000543523.1_Frame_Shift_Del_p.NK676fs	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	676	Effector region. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CACCGGAAGTTGTTTGTGTCTCTG	0.446																																						.											0																																										SO:0001589	frameshift_variant	2059			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2027_2030delACAA	12.37:g.15784390_15784393delTTGT	ENSP00000281172:p.Asn676fs		A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Frame_Shift_Del	DEL	ENST00000281172.5	37	CCDS31753.1																																																																																				0.446	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
ADAMTSL5	339366	bcgsc.ca	37	19	1506881	1506881	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr19:1506881A>G	ENST00000413997.2	-	10	928	c.929T>C	c.(928-930)cTc>cCc	p.L310P	ADAMTSL5_ENST00000590562.1_5'UTR|CTB-25B13.9_ENST00000590252.1_RNA|ADAMTSL5_ENST00000330475.4_Missense_Mutation_p.L300P|ADAMTSL5_ENST00000395467.2_Missense_Mutation_p.L69P			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	310						extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCCGAGGGAGCCAGAACTC	0.697																																						.											0													19.0	25.0	24.0					19																	1506881		1819	3754	5573	SO:0001583	missense	339366			BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.929T>C	19.37:g.1506881A>G	ENSP00000399364:p.Leu310Pro		B4DXK7|Q8IW95	Missense_Mutation	SNP	ENST00000413997.2	37		.	.	.	.	.	.	.	.	.	.	A	18.89	3.719079	0.68844	.	.	ENSG00000185761	ENST00000413997;ENST00000330475;ENST00000395467	T;T;T	0.56941	0.43;0.43;0.43	4.05	4.05	0.47172	ADAM-TS Spacer 1 (1);	0.000000	0.64402	D	0.000002	T	0.70692	0.3253	M	0.82193	2.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72459	-0.4287	10	0.48119	T	0.1	.	9.3042	0.37865	1.0:0.0:0.0:0.0	.	310;300	B4DXK7;Q6ZMM2	.;ATL5_HUMAN	P	310;300;69	ENSP00000399364:L310P;ENSP00000327608:L300P;ENSP00000378850:L69P	ENSP00000327608:L300P	L	-	2	0	ADAMTSL5	1457881	1.000000	0.71417	0.996000	0.52242	0.787000	0.44495	6.470000	0.73558	1.702000	0.51228	0.397000	0.26171	CTC		0.697	ADAMTSL5-202	KNOWN	basic	protein_coding	protein_coding		XM_294919	
ANKRD30BL	554226	bcgsc.ca	37	2	132905706	132905706	+	Nonstop_Mutation	SNP	A	A	G	rs142209162		TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr2:132905706A>G	ENST00000409867.1	-	6	1024	c.775T>C	c.(775-777)Tag>Cag	p.*259Q	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	0										endometrium(1)|kidney(3)	4						ACTGTATCCTATTCATCAGGT	0.438																																						.											0																																										SO:0001578	stop_lost	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.775T>C	2.37:g.132905706A>G	ENSP00000386398:p.*259Gluext*29		B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.034	-1.317389	0.01331	.	.	ENSG00000163046	ENST00000409867	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Q	259	.	.	X	-	1	0	ANKRD30BL	132622176	0.072000	0.21174	0.103000	0.21229	0.104000	0.19210	0.225000	0.17757	0.156000	0.19299	0.155000	0.16302	TAG		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
FRG1B	284802	bcgsc.ca	37	20	29625885	29625885	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr20:29625885A>T	ENST00000278882.3	+	5	509	c.129A>T	c.(127-129)aaA>aaT	p.K43N	FRG1B_ENST00000358464.4_Missense_Mutation_p.K43N|FRG1B_ENST00000439954.2_Missense_Mutation_p.K48N			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	43								p.K43N(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCGCCCTGAAATCTGGCTATG	0.353																																						.											2	Substitution - Missense(2)	prostate(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.129A>T	20.37:g.29625885A>T	ENSP00000278882:p.Lys43Asn		C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	10.23	1.292024	0.23564	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62364	0.03	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.74145	0.3678	.	.	.	0.48762	D	0.999701	D	0.71674	0.998	D	0.79784	0.993	T	0.74598	-0.3612	9	0.87932	D	0	.	7.3757	0.26827	1.0:0.0:0.0:0.0	.	48	F5H5R5	.	N	43;48;43	ENSP00000408863:K48N	ENSP00000278882:K43N	K	+	3	2	FRG1B	28239546	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	0.595000	0.24029	1.028000	0.39785	0.155000	0.16302	AAA		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
OXCT1	5019	bcgsc.ca	37	5	41794806	41794806	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr5:41794806C>T	ENST00000196371.5	-	12	1305	c.1145G>A	c.(1144-1146)aGc>aAc	p.S382N	OXCT1_ENST00000509987.1_Missense_Mutation_p.S196N|OXCT1_ENST00000512084.1_5'Flank|OXCT1_ENST00000510634.1_5'Flank|OXCT1_ENST00000513081.1_5'Flank	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	382					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	TGATTCATCGCTGGAGAAAAA	0.398																																						.											0													70.0	67.0	68.0					5																	41794806		2203	4300	6503	SO:0001583	missense	5019			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1145G>A	5.37:g.41794806C>T	ENSP00000196371:p.Ser382Asn		B2R5V2|B7Z528	Missense_Mutation	SNP	ENST00000196371.5	37	CCDS3937.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011963	0.93346	.	.	ENSG00000083720	ENST00000196371;ENST00000509987	D;D	0.87729	-2.29;-2.29	5.84	5.84	0.93424	3-oxoacid CoA-transferase, subunit B (1);	0.079191	0.85682	D	0.000000	D	0.95981	0.8691	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96810	0.9596	10	0.87932	D	0	-17.4734	18.9061	0.92462	0.0:1.0:0.0:0.0	.	382	P55809	SCOT1_HUMAN	N	382;196	ENSP00000196371:S382N;ENSP00000425348:S196N	ENSP00000196371:S382N	S	-	2	0	OXCT1	41830563	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.410000	0.80065	2.765000	0.95021	0.655000	0.94253	AGC		0.398	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436	
MT-CYB	4519	bcgsc.ca	37	M	15093	15093	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chrM:15093G>A	ENST00000361789.2	+	1	347	c.347G>A	c.(346-348)gGc>gAc	p.G116D	MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	116					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CTGAAACATCGGCATTATCCT	0.463											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										.											0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.347G>A	M.37:g.15093G>A	ENSP00000354554:p.Gly116Asp	585	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																					0.463	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
CXorf36	79742	bcgsc.ca	37	X	45010908	45010908	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chrX:45010908C>T	ENST00000398000.2	-	5	1365	c.1291G>A	c.(1291-1293)Gat>Aat	p.D431N	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	431						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						CAGAACTTATCGTTATATTTG	0.527																																						.											0													95.0	84.0	88.0					X																	45010908		1568	3582	5150	SO:0001583	missense	79742			AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.1291G>A	X.37:g.45010908C>T	ENSP00000381086:p.Asp431Asn		A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	ENST00000398000.2	37	CCDS48096.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053779	0.55218	.	.	ENSG00000147113	ENST00000398000	T	0.36520	1.25	5.24	4.38	0.52667	.	0.404164	0.23272	N	0.050001	T	0.36635	0.0974	M	0.67953	2.075	0.80722	D	1	B	0.26845	0.161	B	0.19391	0.025	T	0.22661	-1.0210	10	0.72032	D	0.01	.	11.4036	0.49885	0.0:0.914:0.0:0.086	.	431	Q9H7Y0	CX036_HUMAN	N	431	ENSP00000381086:D431N	ENSP00000381086:D431N	D	-	1	0	CXorf36	44895852	0.997000	0.39634	0.684000	0.30055	0.530000	0.34684	2.903000	0.48711	0.996000	0.38943	0.594000	0.82650	GAT		0.527	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2	NM_024689	
CTBP2	1488	bcgsc.ca	37	10	126715160	126715161	+	Intron	INS	-	-	GCCGCAGGCTGGGGCTGCAGG			TCGA-KO-8411-01A-11D-2310-10	TCGA-KO-8411-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	9dfcbabf-2bc0-43a2-bdde-d0b2aaca3f6b	7f8f088d-0cab-4301-8a5d-9e780d18439b	g.chr10:126715160_126715161insGCCGCAGGCTGGGGCTGCAGG	ENST00000337195.5	-	3	458				CTBP2_ENST00000309035.6_In_Frame_Ins_p.390_391insCSPSLRP|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000411419.2_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CTGCAGAGGAGCCGCAGCGCCC	0.698																																						.											0																																										SO:0001627	intron_variant	1488			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12404->CCTGCAGCCCCAGCCTGCGGC	10.37:g.126715160_126715161insGCCGCAGGCTGGGGCTGCAGG			A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	In_Frame_Ins	INS	ENST00000337195.5	37	CCDS7643.1																																																																																				0.698	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
