#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTEN	5728	hgsc.bcm.edu	37	10	89720712	89720712	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr10:89720712delA	ENST00000371953.3	+	8	2220	c.863delA	c.(862-864)gaafs	p.E288fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	288	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.E288fs*3(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.S287fs*8(1)|p.W274_F341del(1)|p.S287fs*1(1)|p.E288fs*9(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAAACCTCAGAAAAAGTAGAA	0.313		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	58	Whole gene deletion(37)|Deletion - Frameshift(17)|Deletion - In frame(2)|Unknown(2)	prostate(16)|central_nervous_system(12)|endometrium(7)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|large_intestine(1)|soft_tissue(1)											57.0	60.0	59.0					10																	89720712		2202	4296	6498	SO:0001589	frameshift_variant	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.863delA	10.37:g.89720712delA	ENSP00000361021:p.Glu288fs		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				0.313	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
OR4X1	390113	hgsc.bcm.edu	37	11	48285986	48285986	+	Missense_Mutation	SNP	T	T	A	rs76457745		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:48285986T>A	ENST00000320048.1	+	1	574	c.574T>A	c.(574-576)Ttc>Atc	p.F192I		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						AGACACCTTCTTCATTAGCCT	0.537																																						.											0													110.0	85.0	94.0					11																	48285986		2201	4298	6499	SO:0001583	missense	390113			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.574T>A	11.37:g.48285986T>A	ENSP00000321506:p.Phe192Ile		Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	37	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	T	4.614	0.114104	0.08831	.	.	ENSG00000176567	ENST00000320048	T	0.00030	8.9	4.4	2.51	0.30379	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.01668	-0.77	0.22745	N	0.998789	B	0.25235	0.121	B	0.24394	0.053	T	0.00485	-1.1711	9	0.17369	T	0.5	.	3.9248	0.09259	0.1875:0.6133:0.0:0.1992	.	192	Q8NH49	OR4X1_HUMAN	I	192	ENSP00000321506:F192I	ENSP00000321506:F192I	F	+	1	0	OR4X1	48242562	0.000000	0.05858	0.999000	0.59377	0.059000	0.15707	-2.231000	0.01206	1.210000	0.43336	-0.318000	0.08688	TTC		0.537	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
FAM189B	10712	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	155224214	155224214	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:155224214A>T	ENST00000361361.2	-	2	768	c.259T>A	c.(259-261)Tgg>Agg	p.W87R	SCAMP3_ENST00000472397.1_5'Flank|FAM189B_ENST00000368368.3_Intron|FAM189B_ENST00000472550.1_5'UTR|FAM189B_ENST00000350210.2_Intron	NM_006589.2	NP_006580.2	P81408	F189B_HUMAN	family with sequence similarity 189, member B	87						integral component of membrane (GO:0016021)	WW domain binding (GO:0050699)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGCCGCTTCCAGGACACAATG	0.632																																						.											0													76.0	76.0	76.0					1																	155224214		2203	4300	6503	SO:0001583	missense	10712			AF070550	CCDS1103.1, CCDS1104.1, CCDS58035.1	1q21	2009-07-09	2009-07-09	2009-07-09	ENSG00000160767	ENSG00000160767			1233	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 2"""	C1orf2		9331372	Standard	NM_006589		Approved	cote1	uc001fjm.3	P81408	OTTHUMG00000035844	ENST00000361361.2:c.259T>A	1.37:g.155224214A>T	ENSP00000354958:p.Trp87Arg		B1AVS5|Q8IXL3|Q9BR66	Missense_Mutation	SNP	ENST00000361361.2	37	CCDS1103.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.240778	0.79912	.	.	ENSG00000160767	ENST00000361361	T	0.02258	4.37	4.46	4.46	0.54185	.	0.000000	0.64402	D	0.000001	T	0.05960	0.0155	M	0.65975	2.015	0.46298	D	0.99897	D	0.76494	0.999	D	0.87578	0.998	T	0.05338	-1.0891	10	0.87932	D	0	.	11.9955	0.53201	1.0:0.0:0.0:0.0	.	87	P81408	F189B_HUMAN	R	87	ENSP00000354958:W87R	ENSP00000354958:W87R	W	-	1	0	FAM189B	153490838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.248000	0.78268	1.989000	0.58080	0.459000	0.35465	TGG		0.632	FAM189B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087224.1	NM_006589	
BRINP3	339479	hgsc.bcm.edu;ucsc.edu	37	1	190067565	190067565	+	Silent	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:190067565G>A	ENST00000367462.3	-	8	2115	c.1884C>T	c.(1882-1884)taC>taT	p.Y628Y	BRINP3_ENST00000534846.1_Silent_p.Y526Y	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	628					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GACTTCTCAGGTAGATGTGTA	0.453																																						.											0													223.0	233.0	230.0					1																	190067565		2203	4300	6503	SO:0001819	synonymous_variant	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1884C>T	1.37:g.190067565G>A			B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	CCDS1373.1																																																																																				0.453	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
GRIN2B	2904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	13828724	13828724	+	Silent	SNP	C	C	T	rs201952040		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:13828724C>T	ENST00000609686.1	-	4	1289	c.1080G>A	c.(1078-1080)ccG>ccA	p.P360P		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	360					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCACCAGTTTCGGGTGCATCT	0.373																																						.											0													127.0	124.0	125.0					12																	13828724		2203	4300	6503	SO:0001819	synonymous_variant	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1080G>A	12.37:g.13828724C>T			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	CCDS8662.1																																																																																				0.373	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
DGKA	1606	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	56335069	56335069	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:56335069G>A	ENST00000331886.5	+	14	1589	c.1135G>A	c.(1135-1137)Gtc>Atc	p.V379I	DGKA_ENST00000551156.1_Missense_Mutation_p.V379I|DGKA_ENST00000394147.1_Missense_Mutation_p.V379I|DGKA_ENST00000549079.2_3'UTR	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	379	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.			V -> L (in Ref. 2; AAC34802). {ECO:0000305}.	blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)	p.V379I(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	CCCACTTCTCGTCTTTGTCAA	0.493																																						.											1	Substitution - Missense(1)	pancreas(1)											115.0	114.0	114.0					12																	56335069		2203	4300	6503	SO:0001583	missense	1606			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1135G>A	12.37:g.56335069G>A	ENSP00000328405:p.Val379Ile		O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	37	CCDS8896.1	.	.	.	.	.	.	.	.	.	.	G	36	5.648661	0.96714	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156;ENST00000552903	T;T;T;T;T	0.50548	0.79;0.74;0.79;0.79;0.74	5.85	5.85	0.93711	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.67392	0.2888	M	0.74389	2.26	0.80722	D	1	D;D	0.76494	0.999;0.995	P;P	0.59487	0.778;0.858	T	0.68379	-0.5424	10	0.66056	D	0.02	.	19.3175	0.94220	0.0:0.0:1.0:0.0	.	298;379	G3V4E1;P23743	.;DGKA_HUMAN	I	379;298;379;379;14	ENSP00000328405:V379I;ENSP00000451743:V298I;ENSP00000377703:V379I;ENSP00000450359:V379I;ENSP00000451518:V14I	ENSP00000328405:V379I	V	+	1	0	DGKA	54621336	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	9.241000	0.95402	2.941000	0.99782	0.655000	0.94253	GTC		0.493	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
SETD1B	23067	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	122260719	122260719	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:122260719G>T	ENST00000604567.1	+	12	4302	c.4234G>T	c.(4234-4236)Gcc>Tcc	p.A1412S	SETD1B_ENST00000542440.1_Missense_Mutation_p.A1369S|SETD1B_ENST00000267197.5_Missense_Mutation_p.A1369S			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1412	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CTCCTACCCAGCCCCGTCCCC	0.701																																						.											0													18.0	21.0	20.0					12																	122260719		692	1591	2283	SO:0001583	missense	23067			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.4234G>T	12.37:g.122260719G>T	ENSP00000474253:p.Ala1412Ser		F6MFW1	Missense_Mutation	SNP	ENST00000604567.1	37		.	.	.	.	.	.	.	.	.	.	G	9.162	1.019039	0.19355	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	T;T	0.32023	1.47;1.47	4.91	-0.493	0.12038	.	0.294326	0.38058	N	0.001836	T	0.08403	0.0209	N	0.01705	-0.755	0.21878	N	0.999499	B	0.02656	0.0	B	0.01281	0.0	T	0.37314	-0.9711	10	0.06757	T	0.87	.	7.9516	0.30019	0.1276:0.0:0.4033:0.4691	.	1369	Q9UPS6	SET1B_HUMAN	S	1369	ENSP00000442924:A1369S;ENSP00000267197:A1369S	ENSP00000267197:A1369S	A	+	1	0	SETD1B	120745102	0.331000	0.24713	0.142000	0.22268	0.881000	0.50899	0.710000	0.25748	-0.254000	0.09500	0.655000	0.94253	GCC		0.701	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
ING1	3621	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	13	111367954	111367954	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr13:111367954A>T	ENST00000375774.3	+	1	626	c.164A>T	c.(163-165)aAc>aTc	p.N55I	ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000333219.7_Intron|ING1_ENST00000338450.7_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	55					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GTTGATTTGAACGTCTTCGGG	0.602																																						.											0													109.0	104.0	105.0					13																	111367954		2203	4300	6503	SO:0001583	missense	3621				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.164A>T	13.37:g.111367954A>T	ENSP00000364929:p.Asn55Ile		O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	A	14.79	2.639445	0.47153	.	.	ENSG00000153487	ENST00000375774	T	0.38077	1.16	4.32	4.32	0.51571	.	0.225560	0.42294	D	0.000738	T	0.29976	0.0750	N	0.19112	0.55	0.27004	N	0.964843	D	0.58268	0.982	P	0.49140	0.601	T	0.11743	-1.0575	10	0.87932	D	0	-12.9249	9.7925	0.40715	1.0:0.0:0.0:0.0	.	55	Q9UK53	ING1_HUMAN	I	55	ENSP00000364929:N55I	ENSP00000364929:N55I	N	+	2	0	ING1	110165955	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	4.220000	0.58567	1.809000	0.52856	0.459000	0.35465	AAC		0.602	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
EVL	51466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	14	100595075	100595075	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr14:100595075G>T	ENST00000402714.2	+	6	1305	c.701G>T	c.(700-702)aGa>aTa	p.R234I	EVL_ENST00000544450.2_Missense_Mutation_p.R240I|EVL_ENST00000392920.3_Missense_Mutation_p.R236I			Q9UI08	EVL_HUMAN	Enah/Vasp-like	234	EVH2 block A.|EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				AAGCTGAGAAGAGTCCAACGG	0.657																																						.											0													27.0	30.0	29.0					14																	100595075		2196	4293	6489	SO:0001583	missense	51466			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.701G>T	14.37:g.100595075G>T	ENSP00000384720:p.Arg234Ile		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	ENST00000402714.2	37		.	.	.	.	.	.	.	.	.	.	G	21.5	4.154557	0.78114	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000557384;ENST00000554695	T;T;T;T	0.72167	-0.62;-0.63;-0.63;0.64	5.2	4.27	0.50696	.	0.064953	0.56097	D	0.000025	T	0.78616	0.4311	M	0.76574	2.34	0.58432	D	0.999999	B;D;D	0.71674	0.006;0.998;0.996	B;P;P	0.59703	0.005;0.862;0.731	T	0.80513	-0.1349	10	0.87932	D	0	-21.3881	8.6814	0.34212	0.0758:0.0:0.7728:0.1514	.	240;236;234	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	I	234;240;236;199;130;51	ENSP00000384720:R234I;ENSP00000437904:R240I;ENSP00000376652:R236I;ENSP00000450979:R130I	ENSP00000376652:R236I	R	+	2	0	EVL	99664828	1.000000	0.71417	0.995000	0.50966	0.931000	0.56810	4.238000	0.58688	2.422000	0.82143	0.655000	0.94253	AGA		0.657	EVL-006	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000413958.1		
CPPED1	55313	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	12798816	12798816	+	Missense_Mutation	SNP	T	T	A	rs3748982		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr16:12798816T>A	ENST00000381774.4	-	3	620	c.380A>T	c.(379-381)aAc>aTc	p.N127I	CPPED1_ENST00000261660.4_Intron|CPPED1_ENST00000433677.2_Intron	NM_018340.2	NP_060810.2	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain containing 1	127	Catalytic.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|urinary_tract(1)	18						AATGTCATGGTTGCCGCTGAC	0.627																																						.											0													66.0	71.0	69.0					16																	12798816		2093	4219	6312	SO:0001583	missense	55313			AK022710	CCDS42119.1, CCDS42120.1	16p13.12	2014-02-12	2009-03-13		ENSG00000103381	ENSG00000103381			25632	protein-coding gene	gene with protein product	"""complete S transactivated protein 1"""	615603				12477932	Standard	NM_018340		Approved	CSTP1, FLJ11151	uc002dca.4	Q9BRF8	OTTHUMG00000167711	ENST00000381774.4:c.380A>T	16.37:g.12798816T>A	ENSP00000371193:p.Asn127Ile		B4DQ68|Q6MZY9|Q9H9M9|Q9NUT6	Missense_Mutation	SNP	ENST00000381774.4	37	CCDS42120.1	.	.	.	.	.	.	.	.	.	.	T	17.05	3.290732	0.59976	.	.	ENSG00000103381	ENST00000381774	D	0.99304	-5.72	5.7	5.7	0.88788	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.99518	0.9828	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98268	1.0502	10	0.87932	D	0	-38.6905	13.9242	0.63952	0.0:0.0:0.0:1.0	.	127	Q9BRF8	CPPED_HUMAN	I	127	ENSP00000371193:N127I	ENSP00000371193:N127I	N	-	2	0	CPPED1	12706317	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	7.740000	0.84986	2.169000	0.68431	0.528000	0.53228	AAC		0.627	CPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395795.2	NM_018340	
CLEC19A	728276	hgsc.bcm.edu;ucsc.edu	37	16	19310063	19310063	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr16:19310063C>T	ENST00000465414.1	+	2	230	c.157C>T	c.(157-159)Cga>Tga	p.R53*	CLEC19A_ENST00000493231.1_Nonsense_Mutation_p.R53*			Q6UXS0	CL19A_HUMAN	C-type lectin domain family 19, member A	53	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)										CCACTGCTATCGATTCTTCCC	0.582																																						.											0																																										SO:0001587	stop_gained	728276					16p12.3	2013-01-07			ENSG00000261210	ENSG00000261210		"""C-type lectin domain containing"""	34522	protein-coding gene	gene with protein product							Standard	NM_001256720		Approved		uc031qvg.1	Q6UXS0	OTTHUMG00000177218	ENST00000465414.1:c.157C>T	16.37:g.19310063C>T	ENSP00000455948:p.Arg53*		Q0VF32	Nonsense_Mutation	SNP	ENST00000465414.1	37																																																																																					0.582	CLEC19A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254277.2	NM_00125672	
KRT34	3885	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	39535652	39535652	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr17:39535652G>A	ENST00000394001.1	-	5	985	c.955C>T	c.(955-957)Cgc>Tgc	p.R319C		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	319	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				TTGACTGTGCGTCTCAGCTCG	0.582																																						.											0													136.0	110.0	119.0					17																	39535652		2203	4300	6503	SO:0001583	missense	3885			Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.955C>T	17.37:g.39535652G>A	ENSP00000377570:p.Arg319Cys		Q8IUT8|Q8N4W2	Missense_Mutation	SNP	ENST00000394001.1	37	CCDS11390.1	.	.	.	.	.	.	.	.	.	.	g	13.59	2.282843	0.40394	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	4.9	4.9	0.64082	Filament (1);	0.000000	0.64402	D	0.000004	T	0.69405	0.3107	M	0.75085	2.285	0.50813	D	0.999899	P	0.50710	0.938	P	0.46825	0.528	T	0.76258	-0.3025	9	0.87932	D	0	.	17.4103	0.87484	0.0:0.0:1.0:0.0	.	319	O76011	KRT34_HUMAN	C	277;319	.	ENSP00000251648:R319C	R	-	1	0	KRT34	36789178	1.000000	0.71417	1.000000	0.80357	0.058000	0.15608	4.309000	0.59135	2.422000	0.82143	0.555000	0.69702	CGC		0.582	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
MYADML2	255275	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	79899490	79899490	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr17:79899490C>T	ENST00000409745.2	-	3	482	c.128G>A	c.(127-129)cGg>cAg	p.R43Q	MYADML2_ENST00000330655.3_Missense_Mutation_p.R43Q|AC137723.5_ENST00000415556.1_RNA	NM_001145113.2	NP_001138585.2	A6NDP7	MADL2_HUMAN	myeloid-associated differentiation marker-like 2	43	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)	1						AAAGCCACCCCGGTGGGCCAC	0.687																																						.											0													10.0	16.0	14.0					17																	79899490		684	1575	2259	SO:0001583	missense	255275			AC137723, BC029306	CCDS45815.1	17q25.3	2008-10-15			ENSG00000185105	ENSG00000185105			34548	protein-coding gene	gene with protein product							Standard	NM_001145113		Approved	LOC255275	uc010wvf.1	A6NDP7	OTTHUMG00000154388	ENST00000409745.2:c.128G>A	17.37:g.79899490C>T	ENSP00000386702:p.Arg43Gln			Missense_Mutation	SNP	ENST00000409745.2	37	CCDS45815.1	.	.	.	.	.	.	.	.	.	.	C	11.53	1.666908	0.29604	.	.	ENSG00000185105	ENST00000409745;ENST00000330655	T;T	0.25579	1.79;1.79	4.69	4.69	0.59074	Marvel (1);MARVEL-like domain (1);	0.259105	0.40144	N	0.001175	T	0.13756	0.0333	N	0.17474	0.49	0.38879	D	0.956865	B	0.25169	0.119	B	0.15484	0.013	T	0.12167	-1.0558	10	0.12430	T	0.62	-3.0135	11.7296	0.51728	0.0:0.906:0.0:0.094	.	43	A6NDP7	MADL2_HUMAN	Q	43	ENSP00000386702:R43Q;ENSP00000327718:R43Q	ENSP00000327718:R43Q	R	-	2	0	MYADML2	77492781	0.155000	0.22806	0.931000	0.37212	0.636000	0.38137	0.749000	0.26320	2.435000	0.82474	0.491000	0.48974	CGG		0.687	MYADML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335008.2	XR_041347	
SIN3B	23309	hgsc.bcm.edu;ucsc.edu	37	19	16982119	16982119	+	Silent	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:16982119G>A	ENST00000248054.5	+	14	2523	c.2502G>A	c.(2500-2502)acG>acA	p.T834T	SIN3B_ENST00000595541.1_Silent_p.T424T|SIN3B_ENST00000379803.1_Silent_p.T866T					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						TCGACCCCACGCAGTACGAGG	0.627																																						.											0													115.0	96.0	103.0					19																	16982119		2203	4300	6503	SO:0001819	synonymous_variant	23309			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.2502G>A	19.37:g.16982119G>A				Silent	SNP	ENST00000248054.5	37																																																																																					0.627	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
KIAA1211	57482	hgsc.bcm.edu	37	4	57180576	57180577	+	In_Frame_Ins	INS	-	-	GGAGCGGAGGGAGCGGAG	rs71921617|rs138358443|rs11276076	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr4:57180576_57180577insGGAGCGGAGGGAGCGGAG	ENST00000504228.1	+	6	1013_1014	c.908_909insGGAGCGGAGGGAGCGGAG	c.(907-912)gcggag>gcGGAGCGGAGGGAGCGGAGggag	p.304_305insRRERRE	KIAA1211_ENST00000541073.1_In_Frame_Ins_p.297_298insRRERRE|KIAA1211_ENST00000264229.6_In_Frame_Ins_p.304_305insRRERRE			Q6ZU35	K1211_HUMAN	KIAA1211	304	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TGGGAGGACGCGGAGCGGAGGG	0.733														1350	0.269569	0.2716	0.2781	5008	,	,		14300	0.0694		0.4076	False		,,,				2504	0.3252					.											0										903,2311		258,387,962						-10.2	0.0		dbSNP_130	6	2065,4451		612,841,1805	no	coding	KIAA1211	NM_020722.1		870,1228,2767	A1A1,A1R,RR		31.6912,28.0958,30.5036				2968,6762				SO:0001652	inframe_insertion	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	Exception_encountered	4.37:g.57180576_57180577insGGAGCGGAGGGAGCGGAG	ENSP00000423366:p.Glu304_Arg305insArgArgGluArgArgGlu		Q9NTE2|Q9NTP8|Q9ULK9	In_Frame_Ins	INS	ENST00000504228.1	37	CCDS43230.1																																																																																				0.733	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
PCDHGA4	56111	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	5	140736273	140736273	+	Silent	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr5:140736273C>T	ENST00000571252.1	+	1	1506	c.1506C>T	c.(1504-1506)tcC>tcT	p.S502S	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	502	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCTCTGTCCTCCTATGTCT	0.512																																						.											0													128.0	135.0	133.0					5																	140736273		2096	4248	6344	SO:0001819	synonymous_variant	56111			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1506C>T	5.37:g.140736273C>T			Q9Y5D3	Silent	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																				0.512	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
GPR98	84059	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	89981756	89981756	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr5:89981756G>A	ENST00000405460.2	+	29	6530	c.6434G>A	c.(6433-6435)gGa>gAa	p.G2145E		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2145	Calx-beta 15. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGAACAGGAGGAGCATTTGCA	0.418																																						.											0													84.0	75.0	78.0					5																	89981756		1914	4129	6043	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6434G>A	5.37:g.89981756G>A	ENSP00000384582:p.Gly2145Glu		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164873	0.94727	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.37411	1.2	5.59	5.59	0.84812	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.66703	0.2816	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69702	-0.5074	10	0.54805	T	0.06	.	19.5929	0.95523	0.0:0.0:1.0:0.0	.	2145	Q8WXG9	GPR98_HUMAN	E	2145	ENSP00000384582:G2145E	ENSP00000296619:G2145E	G	+	2	0	GPR98	90017512	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.624000	0.98398	2.626000	0.88956	0.591000	0.81541	GGA		0.418	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
RANBP17	64901	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	170725856	170725856	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr5:170725856G>A	ENST00000523189.1	+	28	3425	c.3261G>A	c.(3259-3261)atG>atA	p.M1087I	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	1087					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCGACATGATGAGCTGACCCG	0.517			T	TRD@	ALL																																	.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	0													104.0	85.0	91.0					5																	170725856		2203	4300	6503	SO:0001583	missense	64901			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.3261G>A	5.37:g.170725856G>A	ENSP00000427975:p.Met1087Ile		Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669902	0.47677	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.22743	1.94	5.87	5.87	0.94306	.	0.148962	0.48286	D	0.000195	T	0.20373	0.0490	L	0.38175	1.15	0.35735	D	0.818246	B	0.30793	0.295	B	0.27608	0.081	T	0.09907	-1.0653	10	0.49607	T	0.09	-17.8979	17.9912	0.89170	0.0:0.0:1.0:0.0	.	1087	Q9H2T7	RBP17_HUMAN	I	1087;517	ENSP00000427975:M1087I	ENSP00000427975:M1087I	M	+	3	0	RANBP17	170658461	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	7.541000	0.82084	2.785000	0.95823	0.655000	0.94253	ATG		0.517	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
TG	7038	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	8	134145788	134145788	+	Missense_Mutation	SNP	G	G	A	rs531167775		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr8:134145788G>A	ENST00000220616.4	+	47	8112	c.8072G>A	c.(8071-8073)cGt>cAt	p.R2691H	TG_ENST00000542445.1_Missense_Mutation_p.R1061H|TG_ENST00000519543.1_Missense_Mutation_p.R824H|TG_ENST00000377869.1_Missense_Mutation_p.R2634H	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2691					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTTGTACCCCGTGCTGGTGGA	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		19855	0.0		0.0	False		,,,				2504	0.001					.											0													124.0	116.0	119.0					8																	134145788		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.8072G>A	8.37:g.134145788G>A	ENSP00000220616:p.Arg2691His		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.459928	0.00171	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000535932;ENST00000542445;ENST00000519543;ENST00000521107	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;1.0	4.84	-3.18	0.05186	Carboxylesterase, type B (1);	1.420510	0.04377	N	0.360115	T	0.37839	0.1018	N	0.04880	-0.145	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.001;0.0;0.002	T	0.41251	-0.9519	10	0.02654	T	1	.	7.5366	0.27714	0.5152:0.1139:0.3709:0.0	.	824;1061;2691	E7EVM0;F5GWW5;P01266	.;.;THYG_HUMAN	H	2634;1497;2691;810;1061;824;95	ENSP00000367100:R2634H;ENSP00000220616:R2691H;ENSP00000441693:R1061H;ENSP00000430430:R824H;ENSP00000430161:R95H	ENSP00000220616:R2691H	R	+	2	0	TG	134214970	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.194000	0.09559	-0.692000	0.05128	-1.134000	0.01955	CGT		0.502	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
CSMD1	64478	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	3263582	3263582	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr8:3263582C>T	ENST00000520002.1	-	16	2791	c.2236G>A	c.(2236-2238)Gtg>Atg	p.V746M	CSMD1_ENST00000537824.1_Missense_Mutation_p.V745M|CSMD1_ENST00000602723.1_Missense_Mutation_p.V746M|CSMD1_ENST00000400186.3_Missense_Mutation_p.V746M|CSMD1_ENST00000542608.1_Missense_Mutation_p.V745M|CSMD1_ENST00000539096.1_Missense_Mutation_p.V745M|CSMD1_ENST00000602557.1_Missense_Mutation_p.V746M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	746	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTCCAGACCACGTTCCCGTCT	0.552																																						.											0													58.0	60.0	59.0					8																	3263582		1985	4175	6160	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2236G>A	8.37:g.3263582C>T	ENSP00000430733:p.Val746Met		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.1|27.1	4.803832|4.803832	0.90623|0.90623	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.64803	.|-0.12;-0.12;-0.12;-0.12;-0.12	5.36|5.36	5.36|5.36	0.76844|0.76844	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.64402	.|D	.|0.000003	T|T	0.78000|0.78000	0.4215|0.4215	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.998;0.999	T|T	0.77892|0.77892	-0.2418|-0.2418	5|10	.|0.49607	.|T	.|0.09	.|.	19.0906|19.0906	0.93225|0.93225	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|746;746	.|E5RIG2;Q96PZ7	.|.;CSMD1_HUMAN	H|M	225|746;746;608;745;745;745	.|ENSP00000383047:V746M;ENSP00000430733:V746M;ENSP00000441462:V745M;ENSP00000446243:V745M;ENSP00000441675:V745M	.|ENSP00000320445:V608M	R|V	-|-	2|1	0|0	CSMD1|CSMD1	3250989|3250989	1.000000|1.000000	0.71417|0.71417	0.921000|0.921000	0.36526|0.36526	0.856000|0.856000	0.48823|0.48823	7.618000|7.618000	0.83043|0.83043	2.486000|2.486000	0.83907|0.83907	0.591000|0.591000	0.81541|0.81541	CGT|GTG		0.552	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
PTK2	5747	hgsc.bcm.edu;bcgsc.ca	37	8	141856698	141856698	+	Splice_Site	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr8:141856698C>T	ENST00000522684.1	-	6	759	c.530G>A	c.(529-531)cGg>cAg	p.R177Q	PTK2_ENST00000395218.2_Splice_Site_p.R177Q|PTK2_ENST00000340930.3_Splice_Site_p.R177Q|PTK2_ENST00000535192.1_Splice_Site_p.R177Q|PTK2_ENST00000519419.1_Splice_Site_p.R221Q|PTK2_ENST00000521059.1_Splice_Site_p.R177Q|PTK2_ENST00000517887.1_Splice_Site_p.R221Q	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	177	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			ATCATCTTACCGTATTTCTAG	0.323																																						.											0													106.0	99.0	102.0					8																	141856698		2203	4300	6503	SO:0001630	splice_region_variant	5747			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.530+1G>A	8.37:g.141856698C>T			B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	C	35	5.496021	0.96355	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000340930;ENST00000519419;ENST00000524357	T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;1.03	5.35	5.35	0.76521	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.85691	0.5755	M	0.82193	2.58	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.997;0.999;0.996;0.997;0.998	D	0.86495	0.1800	9	.	.	.	.	18.6889	0.91576	0.0:1.0:0.0:0.0	.	177;84;177;199;177;88	B4E2N6;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6	.;.;FAK1_HUMAN;.;.;.	Q	177;177;221;177;87;177;84;177;221;92	ENSP00000429911:R177Q;ENSP00000438009:R177Q;ENSP00000429082:R221Q;ENSP00000429474:R177Q;ENSP00000378644:R177Q;ENSP00000341189:R177Q;ENSP00000429129:R221Q;ENSP00000429001:R92Q	.	R	-	2	0	PTK2	141925880	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	6.631000	0.74277	2.504000	0.84457	0.484000	0.47621	CGG;CGG;CGG;CGG;CGG;CGG;CGG;CGG;CGG;CGA		0.323	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	Missense_Mutation
ARSD	414	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	2827911	2827911	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chrX:2827911C>G	ENST00000381154.1	-	8	1320	c.1245G>C	c.(1243-1245)atG>atC	p.M415I		NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	415					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGAACACGTCCATCAGGCTCG	0.612																																						.											0													49.0	43.0	45.0					X																	2827911		2203	4300	6503	SO:0001583	missense	414			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1245G>C	X.37:g.2827911C>G	ENSP00000370546:p.Met415Ile		Q9UHJ8	Missense_Mutation	SNP	ENST00000381154.1	37	CCDS35196.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031848	0.54790	.	.	ENSG00000006756	ENST00000381154;ENST00000458014	D;D	0.98493	-4.96;-3.03	2.98	2.98	0.34508	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	U	0.000000	D	0.98353	0.9453	L	0.60012	1.86	0.51767	D	0.999933	D	0.89917	1.0	D	0.97110	1.0	D	0.98773	1.0729	10	0.66056	D	0.02	.	13.7858	0.63108	0.0:1.0:0.0:0.0	.	415	P51689	ARSD_HUMAN	I	415;17	ENSP00000370546:M415I;ENSP00000409180:M17I	ENSP00000370546:M415I	M	-	3	0	ARSD	2837911	1.000000	0.71417	0.838000	0.33150	0.203000	0.24098	4.688000	0.61715	1.286000	0.44565	0.436000	0.28706	ATG		0.612	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		
Unknown	0	broad.mit.edu	37	1	16976896	16976896	+	IGR	SNP	A	A	G	rs374493848		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:16976896A>G								CROCCP2 (15842 upstream) : RNU1-3 (16383 downstream)																							aaacagtaataaagaagagaa	0.328																																						.											0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16976896A>G				RNA	SNP		37																																																																																				0	0.328								
TRIM51HP	440041	broad.mit.edu	37	11	55061186	55061186	+	RNA	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:55061186A>G	ENST00000526016.1	-	0	756					NR_038174.2				tripartite motif-containing 51H, pseudogene																		CCTGCACTGAAATCTGGATTC	0.448																																						.											0																																												440041					11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55061186A>G				RNA	SNP	ENST00000526016.1	37																																																																																					0.448	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000391438.1		
KRT5	3852	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	52913573	52913573	+	Missense_Mutation	SNP	C	C	T	rs59115483		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:52913573C>T	ENST00000252242.4	-	1	898	c.508G>A	c.(508-510)Gag>Aag	p.E170K		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	170	Coil 1A.|Rod.		E -> K (in K-EBS; dbSNP:rs59115483). {ECO:0000269|PubMed:11973334}.		cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		TTGATCTGCTCGCGCTCCTCG	0.498																																						.											0			GRCh37	CM021625	KRT5	M	rs59115483						182.0	175.0	177.0					12																	52913573		2203	4300	6503	SO:0001583	missense	3852				CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.508G>A	12.37:g.52913573C>T	ENSP00000252242:p.Glu170Lys		Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	37	CCDS8830.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522137	0.85600	.	.	ENSG00000186081	ENST00000252242;ENST00000456000;ENST00000549420;ENST00000551275	D;T;T	0.91631	-2.88;-1.12;-1.12	5.66	5.66	0.87406	Filament (1);	0.000000	0.64402	D	0.000019	D	0.96716	0.8928	M	0.89904	3.07	0.58432	A	0.999999	D	0.71674	0.998	D	0.64321	0.924	D	0.97086	0.9787	9	0.87932	D	0	.	19.7439	0.96243	0.0:1.0:0.0:0.0	rs59115483	170	P13647	K2C5_HUMAN	K	170;135;60;135	ENSP00000252242:E170K;ENSP00000447209:E60K;ENSP00000448041:E135K	ENSP00000252242:E170K	E	-	1	0	KRT5	51199840	1.000000	0.71417	0.963000	0.40424	0.292000	0.27327	7.818000	0.86416	2.669000	0.90835	0.655000	0.94253	GAG		0.498	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
KRT76	51350	broad.mit.edu	37	12	53169330	53169330	+	Silent	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:53169330C>T	ENST00000332411.2	-	2	710	c.657G>A	c.(655-657)caG>caA	p.Q219Q		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	219	Linker 1.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGGTCTGCTGCTGGAGCAGTT	0.557																																						.											0													111.0	113.0	112.0					12																	53169330		2203	4300	6503	SO:0001819	synonymous_variant	51350			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.657G>A	12.37:g.53169330C>T			B4DRR3|Q7Z795	Silent	SNP	ENST00000332411.2	37	CCDS8838.1																																																																																				0.557	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
GOLGA6L6	727832	broad.mit.edu	37	15	20740040	20740040	+	Missense_Mutation	SNP	A	A	C			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr15:20740040A>C	ENST00000427390.2	-	8	1800	c.1710T>G	c.(1708-1710)gaT>gaG	p.D570E		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	570	Gln-rich.|Glu-rich.							p.D570E(2)		NS(3)|endometrium(4)|kidney(1)|skin(3)	11						tccacatcttatcctcctgct	0.562																																						.											2	Substitution - Missense(2)	kidney(1)|skin(1)											39.0	41.0	41.0					15																	20740040		671	1549	2220	SO:0001583	missense	727832			AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1710T>G	15.37:g.20740040A>C	ENSP00000398615:p.Asp570Glu		D3YTC0	Missense_Mutation	SNP	ENST00000427390.2	37	CCDS45184.1	.	.	.	.	.	.	.	.	.	.	C	1.368	-0.586972	0.03827	.	.	ENSG00000215405	ENST00000427390	T	0.07444	3.19	.	.	.	.	.	.	.	.	T	0.01489	0.0048	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31971	-0.9924	7	0.02654	T	1	.	.	.	.	.	570	A8MZA4	GG6L6_HUMAN	E	570	ENSP00000398615:D570E	ENSP00000398615:D570E	D	-	3	2	GOLGA6L6	19000054	0.000000	0.05858	0.011000	0.14972	0.011000	0.07611	0.104000	0.15313	-1.815000	0.01222	-1.875000	0.00549	GAT		0.562	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414660.3	NM_001145004	
DRC7	84229	broad.mit.edu;mdanderson.org	37	16	57760055	57760055	+	Missense_Mutation	SNP	G	G	A	rs542227091	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr16:57760055G>A	ENST00000360716.3	+	14	2055	c.1834G>A	c.(1834-1836)Gcg>Acg	p.A612T	CCDC135_ENST00000394337.4_Missense_Mutation_p.A612T|CCDC135_ENST00000336825.8_Missense_Mutation_p.A547T			Q8IY82	CC135_HUMAN		612					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)		p.A612T(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GTTTCTGGTCGCGGAGGAGCG	0.632													g|||	4	0.000798722	0.0008	0.0	5008	,	,		16364	0.003		0.0	False		,,,				2504	0.0					.											1	Substitution - Missense(1)	lung(1)											56.0	48.0	51.0					16																	57760055		2198	4298	6496	SO:0001583	missense	84229																														ENST00000360716.3:c.1834G>A	16.37:g.57760055G>A	ENSP00000353942:p.Ala612Thr		A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	37	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	g	6.322	0.427552	0.11987	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.10192	3.07;2.9;3.07	4.87	-9.73	0.00512	.	3.226540	0.00864	N	0.001941	T	0.04679	0.0127	N	0.22421	0.69	0.09310	N	1	B;B	0.16396	0.017;0.016	B;B	0.09377	0.004;0.004	T	0.36163	-0.9759	10	0.15499	T	0.54	0.6512	0.4774	0.00542	0.2806:0.1555:0.3011:0.2629	.	547;612	Q8IY82-2;Q8IY82	.;CC135_HUMAN	T	612;547;612	ENSP00000377869:A612T;ENSP00000338938:A547T;ENSP00000353942:A612T	ENSP00000338938:A547T	A	+	1	0	CCDC135	56317556	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-5.390000	0.00126	-1.869000	0.01141	0.655000	0.94253	GCG		0.632	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
LCAT	3931	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	67974324	67974324	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr16:67974324A>T	ENST00000264005.5	-	6	835	c.806T>A	c.(805-807)aTa>aAa	p.I269K		NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	269					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		GGTGGTGGTTATGCGCTGCTC	0.582																																						.											0													139.0	120.0	126.0					16																	67974324		2198	4300	6498	SO:0001583	missense	3931				CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.806T>A	16.37:g.67974324A>T	ENSP00000264005:p.Ile269Lys		Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	37	CCDS10854.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.594408	0.46214	.	.	ENSG00000213398	ENST00000264005	D	0.95377	-3.69	5.89	3.57	0.40892	.	0.119263	0.56097	U	0.000039	D	0.93497	0.7925	M	0.81682	2.555	0.47737	D	0.999503	B	0.20164	0.042	B	0.18871	0.023	D	0.90033	0.4136	10	0.52906	T	0.07	-18.912	4.8882	0.13713	0.6798:0.1586:0.1616:0.0	.	269	P04180	LCAT_HUMAN	K	269	ENSP00000264005:I269K	ENSP00000264005:I269K	I	-	2	0	LCAT	66531825	1.000000	0.71417	0.622000	0.29159	0.962000	0.63368	6.155000	0.71833	1.064000	0.40671	0.459000	0.35465	ATA		0.582	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
DSC3	1825	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	28604440	28604440	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr18:28604440G>T	ENST00000360428.4	-	6	730	c.650C>A	c.(649-651)aCt>aAt	p.T217N	DSC3_ENST00000434452.1_Missense_Mutation_p.T217N	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	217	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TCCATCTGCAGTTGACGCATA	0.403																																						.											0													62.0	65.0	64.0					18																	28604440		2203	4300	6503	SO:0001583	missense	1825			X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.650C>A	18.37:g.28604440G>T	ENSP00000353608:p.Thr217Asn		A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	ENST00000360428.4	37	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098160	0.37048	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.45668	0.89;0.89	4.9	4.9	0.64082	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.58878	0.2153	L	0.48935	1.535	0.31889	N	0.617423	B;D	0.76494	0.443;0.999	B;D	0.74674	0.425;0.984	T	0.62690	-0.6801	9	0.56958	D	0.05	.	17.3669	0.87366	0.0:0.0:1.0:0.0	.	217;217	Q14574;Q14574-2	DSC3_HUMAN;.	N	217	ENSP00000353608:T217N;ENSP00000392068:T217N	ENSP00000353608:T217N	T	-	2	0	DSC3	26858438	0.999000	0.42202	0.387000	0.26183	0.146000	0.21551	4.619000	0.61218	2.691000	0.91804	0.655000	0.94253	ACT		0.403	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
MAST3	23031	broad.mit.edu;mdanderson.org	37	19	18245714	18245714	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:18245714G>A	ENST00000262811.6	+	16	1705	c.1705G>A	c.(1705-1707)Gtc>Atc	p.V569I		NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	569	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CATGGGCGTCGTCCTCTATGA	0.632																																						.											0													98.0	106.0	103.0					19																	18245714		2062	4217	6279	SO:0001583	missense	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.1705G>A	19.37:g.18245714G>A	ENSP00000262811:p.Val569Ile		Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	G	5.645	0.303656	0.10678	.	.	ENSG00000099308	ENST00000262811	T	0.24723	1.84	4.8	0.811	0.18739	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.270108	0.40728	N	0.001035	T	0.07188	0.0182	N	0.02334	-0.595	0.32713	N	0.511322	B	0.06786	0.001	B	0.06405	0.002	T	0.42666	-0.9438	10	0.02654	T	1	-29.6574	8.0084	0.30338	0.8171:0.0:0.1829:0.0	.	569	O60307	MAST3_HUMAN	I	569	ENSP00000262811:V569I	ENSP00000262811:V569I	V	+	1	0	MAST3	18106714	1.000000	0.71417	0.983000	0.44433	0.967000	0.64934	2.549000	0.45803	0.249000	0.21456	0.313000	0.20887	GTC		0.632	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150	
ARHGAP33	115703	broad.mit.edu	37	19	36278799	36278799	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:36278799C>T	ENST00000007510.4	+	21	3476	c.3332C>T	c.(3331-3333)cCc>cTc	p.P1111L	ARHGAP33_ENST00000378944.5_Missense_Mutation_p.P947L|ARHGAP33_ENST00000314737.5_Missense_Mutation_p.P950L|AC002398.5_ENST00000433059.1_lincRNA			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1111					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CGCTCCATGCCCCCCGACAGG	0.647																																						.											0													22.0	24.0	23.0					19																	36278799		2202	4299	6501	SO:0001583	missense	115703			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3332C>T	19.37:g.36278799C>T	ENSP00000007510:p.Pro1111Leu		O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	C	14.39	2.521279	0.44866	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.25085	2.53;1.82;2.2	4.85	4.85	0.62838	.	0.000000	0.45606	D	0.000359	T	0.17323	0.0416	N	0.14661	0.345	0.58432	D	0.999999	P;P	0.40731	0.728;0.728	B;B	0.39217	0.294;0.294	T	0.06110	-1.0845	10	0.24483	T	0.36	.	17.0835	0.86604	0.0:1.0:0.0:0.0	.	947;950	O14559-10;O14559-11	.;.	L	1111;950;947	ENSP00000007510:P1111L;ENSP00000320038:P950L;ENSP00000368227:P947L	ENSP00000007510:P1111L	P	+	2	0	ARHGAP33	40970639	0.997000	0.39634	1.000000	0.80357	0.617000	0.37484	3.755000	0.55197	2.421000	0.82119	0.462000	0.41574	CCC		0.647	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
FBL	2091	broad.mit.edu	37	19	40331124	40331124	+	Silent	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:40331124A>G	ENST00000221801.3	-	3	326	c.213T>C	c.(211-213)ggT>ggC	p.G71G	FBL_ENST00000593503.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	71	DMA/Gly-rich.				histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		CCCGACCACGACCCCGGTTGC	0.587																																						.											0													213.0	190.0	198.0					19																	40331124		2203	4300	6503	SO:0001819	synonymous_variant	2091			AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.213T>C	19.37:g.40331124A>G			B5BUE8|O75259|Q6IAT5|Q9UPI6	Silent	SNP	ENST00000221801.3	37	CCDS12545.1																																																																																				0.587	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462509.4	NM_001436	
ZNF615	284370	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	52505118	52505118	+	Silent	SNP	T	T	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:52505118T>G	ENST00000602063.1	-	5	535	c.186A>C	c.(184-186)cgA>cgC	p.R62R	ZNF615_ENST00000597747.1_Silent_p.R62R|ZNF615_ENST00000595114.1_5'Flank|ZNF615_ENST00000391795.3_Silent_p.R67R|ZNF615_ENST00000594083.1_Silent_p.R62R|ZNF615_ENST00000376716.5_Silent_p.R62R|ZNF615_ENST00000598071.1_Silent_p.R62R			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TTTCTTCTCCTCGTTCCAATT	0.463																																						.											0													183.0	141.0	155.0					19																	52505118		2203	4300	6503	SO:0001819	synonymous_variant	284370			AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.186A>C	19.37:g.52505118T>G			B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	ENST00000602063.1	37	CCDS12846.1																																																																																				0.463	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
VN1R2	317701	broad.mit.edu	37	19	53762250	53762250	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:53762250T>C	ENST00000341702.3	+	1	706	c.622T>C	c.(622-624)Tac>Cac	p.Y208H		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	208					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		AGCCCCGACATACATTGGTCT	0.473																																						.											0													54.0	54.0	54.0					19																	53762250		2203	4300	6503	SO:0001583	missense	317701			AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.622T>C	19.37:g.53762250T>C	ENSP00000351244:p.Tyr208His		A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	37	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	T	8.543	0.873682	0.17322	.	.	ENSG00000196131	ENST00000341702	T	0.05199	3.48	2.94	1.92	0.25849	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.06690	0.0171	L	0.39147	1.195	0.09310	N	1	P	0.37548	0.599	B	0.41135	0.348	T	0.34004	-0.9846	9	0.42905	T	0.14	.	4.7136	0.12884	0.0:0.2716:0.0:0.7284	.	208	Q8NFZ6	VN1R2_HUMAN	H	208	ENSP00000351244:Y208H	ENSP00000351244:Y208H	Y	+	1	0	VN1R2	58454062	0.000000	0.05858	0.004000	0.12327	0.058000	0.15608	0.011000	0.13264	0.560000	0.29169	0.486000	0.48141	TAC		0.473	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
XDH	7498	broad.mit.edu;ucsc.edu;mdanderson.org	37	2	31621476	31621476	+	Silent	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr2:31621476G>A	ENST00000379416.3	-	5	444	c.396C>T	c.(394-396)ccC>ccT	p.P132P		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	132					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	TGGTGGGCTCGGGCTGATTCC	0.567																																					Colon(66;682 1445 30109 40147)	.											0													130.0	123.0	125.0					2																	31621476		2203	4300	6503	SO:0001819	synonymous_variant	7498			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.396C>T	2.37:g.31621476G>A			Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	37	CCDS1775.1																																																																																				0.567	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
GTDC1	79712	broad.mit.edu	37	2	144765015	144765015	+	Silent	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr2:144765015A>G	ENST00000392869.2	-	6	761	c.609T>C	c.(607-609)ccT>ccC	p.P203P	GTDC1_ENST00000409298.1_Intron|GTDC1_ENST00000344850.4_Silent_p.P203P|GTDC1_ENST00000542155.1_Silent_p.P203P|GTDC1_ENST00000392867.3_Silent_p.P203P|GTDC1_ENST00000409214.1_Silent_p.P203P|GTDC1_ENST00000241391.5_Silent_p.P203P|GTDC1_ENST00000463875.2_Silent_p.P74P	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	203					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		CTGGCTGAAAAGGAAGGGCCA	0.423																																						.											0													77.0	78.0	77.0					2																	144765015		2203	4300	6503	SO:0001819	synonymous_variant	79712			AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.609T>C	2.37:g.144765015A>G			A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Silent	SNP	ENST00000392869.2	37	CCDS33300.1																																																																																				0.423	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254779.2	NM_024659	
TNS1	7145	broad.mit.edu	37	2	218713275	218713275	+	Silent	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr2:218713275C>T	ENST00000171887.4	-	17	2042	c.1590G>A	c.(1588-1590)gaG>gaA	p.E530E	TNS1_ENST00000419504.1_Silent_p.E530E|TNS1_ENST00000430930.1_Silent_p.E530E|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	530					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGTAGCCCCCCTCACTGGTGT	0.592																																						.											0													64.0	69.0	67.0					2																	218713275		2203	4300	6503	SO:0001819	synonymous_variant	7145			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1590G>A	2.37:g.218713275C>T			Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																				0.592	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
USP37	57695	broad.mit.edu	37	2	219350461	219350461	+	Silent	SNP	T	T	C			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr2:219350461T>C	ENST00000258399.3	-	16	2008	c.1596A>G	c.(1594-1596)gaA>gaG	p.E532E	USP37_ENST00000454775.1_Silent_p.E532E|USP37_ENST00000415516.1_Silent_p.E460E|USP37_ENST00000475553.1_5'UTR|USP37_ENST00000418019.1_Silent_p.E532E	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	532	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		ACTCCAGTTCTTCGGCCTATA	0.333																																						.											0													104.0	109.0	107.0					2																	219350461		2203	4300	6503	SO:0001819	synonymous_variant	57695			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.1596A>G	2.37:g.219350461T>C			A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Silent	SNP	ENST00000258399.3	37	CCDS2418.1																																																																																				0.333	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935	
JAG1	182	broad.mit.edu	37	20	10629266	10629266	+	Silent	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr20:10629266A>G	ENST00000254958.5	-	12	2015	c.1500T>C	c.(1498-1500)ggT>ggC	p.G500G	JAG1_ENST00000488480.1_RNA|JAG1_ENST00000423891.2_Silent_p.G341G	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	500	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						TCTGACAGTGACCCCCATTCA	0.498									Alagille Syndrome																													.											0													77.0	73.0	74.0					20																	10629266		2203	4300	6503	SO:0001819	synonymous_variant	182	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.1500T>C	20.37:g.10629266A>G			A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	37	CCDS13112.1																																																																																				0.498	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
OR5H1	26341	broad.mit.edu	37	3	97851659	97851659	+	Missense_Mutation	SNP	A	A	T	rs199787047	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr3:97851659A>T	ENST00000354565.2	+	1	118	c.118A>T	c.(118-120)Atg>Ttg	p.M40L	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M40L(3)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CATCACCATCATGGGGAATCT	0.413																																						.											3	Substitution - Missense(3)	kidney(2)|endometrium(1)											45.0	49.0	48.0					3																	97851659		2174	4242	6416	SO:0001583	missense	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.118A>T	3.37:g.97851659A>T	ENSP00000346575:p.Met40Leu			Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	A	3.067	-0.192020	0.06299	.	.	ENSG00000231192	ENST00000354565	T	0.00241	8.46	3.63	-0.16	0.13375	.	0.578292	0.14348	N	0.325303	T	0.00073	0.0002	N	0.04116	-0.275	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04976	-1.0914	10	0.33940	T	0.23	.	7.0903	0.25279	0.5661:0.0:0.4339:0.0	.	40	A6NKK0	OR5H1_HUMAN	L	40	ENSP00000346575:M40L	ENSP00000346575:M40L	M	+	1	0	OR5H1	99334349	0.000000	0.05858	0.016000	0.15963	0.102000	0.19082	-3.263000	0.00535	-0.297000	0.08934	0.164000	0.16699	ATG		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
MUC4	4585	broad.mit.edu	37	3	195510066	195510066	+	Silent	SNP	T	T	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr3:195510066T>G	ENST00000463781.3	-	2	8844	c.8385A>C	c.(8383-8385)acA>acC	p.T2795T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2795T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGTGTGACCTGTGGATGCTG	0.592																																						.											0													60.0	35.0	43.0					3																	195510066		687	1519	2206	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8385A>C	3.37:g.195510066T>G			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
F2R	2149	broad.mit.edu	37	5	76029194	76029194	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr5:76029194G>A	ENST00000319211.4	+	2	1409	c.1144G>A	c.(1144-1146)Gtc>Atc	p.V382I		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	382					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	CCAGAGGTACGTCTACAGTAT	0.473																																						.											0													115.0	115.0	115.0					5																	76029194		2203	4300	6503	SO:0001583	missense	2149			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.1144G>A	5.37:g.76029194G>A	ENSP00000321326:p.Val382Ile		Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	ENST00000319211.4	37	CCDS4032.1	.	.	.	.	.	.	.	.	.	.	G	5.320	0.244382	0.10077	.	.	ENSG00000181104	ENST00000319211	T	0.37752	1.18	4.79	3.91	0.45181	.	0.136796	0.49305	D	0.000147	T	0.19765	0.0475	N	0.14661	0.345	0.80722	D	1	B	0.18310	0.027	B	0.08055	0.003	T	0.04930	-1.0917	10	0.45353	T	0.12	-25.1425	7.4328	0.27137	0.0:0.707:0.1446:0.1484	.	382	P25116	PAR1_HUMAN	I	382	ENSP00000321326:V382I	ENSP00000321326:V382I	V	+	1	0	F2R	76064950	1.000000	0.71417	0.923000	0.36655	0.445000	0.32107	1.883000	0.39658	1.368000	0.46115	-0.539000	0.04255	GTC		0.473	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2		
TREML1	340205	broad.mit.edu	37	6	41121543	41121543	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr6:41121543C>T	ENST00000426005.2	-	2	372	c.329G>A	c.(328-330)aGg>aAg	p.R110K	TREML1_ENST00000437044.2_Intron|TREML1_ENST00000373127.4_Missense_Mutation_p.R110K	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	110	Ig-like V-type.				calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)		p.R110K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGGGGCCCCCTGGCCCCATC	0.602																																						.											1	Substitution - Missense(1)	ovary(1)											46.0	53.0	51.0					6																	41121543		2203	4300	6503	SO:0001583	missense	340205			AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.329G>A	6.37:g.41121543C>T	ENSP00000402855:p.Arg110Lys		Q496B3|Q8IWY1|Q8IWY2	Missense_Mutation	SNP	ENST00000426005.2	37	CCDS4851.1	.	.	.	.	.	.	.	.	.	.	C	1.289	-0.608158	0.03717	.	.	ENSG00000161911	ENST00000373127;ENST00000426005	T;T	0.21932	1.98;1.98	6.08	-2.33	0.06724	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.389720	0.01192	N	0.007343	T	0.01627	0.0052	N	0.08118	0	0.18873	N	0.999988	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14755	-1.0461	10	0.05525	T	0.97	.	0.6503	0.00825	0.2664:0.1127:0.2842:0.3367	.	110;110	Q86YW5;Q86YW5-2	TRML1_HUMAN;.	K	110	ENSP00000362219:R110K;ENSP00000402855:R110K	ENSP00000362219:R110K	R	-	2	0	TREML1	41229521	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.513000	0.06305	-0.872000	0.04037	-2.175000	0.00321	AGG		0.602	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043538.2	NM_178174	
CHCHD2	51142	broad.mit.edu	37	7	56172050	56172050	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr7:56172050C>T	ENST00000395422.3	-	2	331	c.169G>A	c.(169-171)Gcc>Acc	p.A57T		NM_016139.2	NP_057223.1	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 2	57						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCCATCTGGGCCATCAGACCT	0.647																																						.											0													20.0	21.0	21.0					7																	56172050		2198	4289	6487	SO:0001583	missense	51142			AF078845	CCDS5526.1	7p11.2	2014-07-14	2004-01-19	2004-01-21	ENSG00000106153	ENSG00000106153		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	21645	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 17"""	C7orf17		23303788	Standard	NM_016139		Approved		uc003tsa.3	Q9Y6H1	OTTHUMG00000129429	ENST00000395422.3:c.169G>A	7.37:g.56172050C>T	ENSP00000378812:p.Ala57Thr		Q498C3|Q6NZ50	Missense_Mutation	SNP	ENST00000395422.3	37	CCDS5526.1	.	.	.	.	.	.	.	.	.	.	C	34	5.298530	0.95574	.	.	ENSG00000106153	ENST00000395422	T	0.48522	0.81	5.62	4.74	0.60224	.	0.051128	0.85682	D	0.000000	T	0.74168	0.3681	M	0.92970	3.365	0.80722	D	1	D	0.71674	0.998	D	0.65987	0.94	T	0.81656	-0.0834	10	0.66056	D	0.02	.	15.123	0.72460	0.1425:0.8575:0.0:0.0	.	57	Q9Y6H1	CHCH2_HUMAN	T	57	ENSP00000378812:A57T	ENSP00000378812:A57T	A	-	1	0	CHCHD2	56139544	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.926000	0.70070	1.378000	0.46305	-0.152000	0.13540	GCC		0.647	CHCHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251589.1	NM_016139	
GPR124	25960	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	8	37688272	37688272	+	Missense_Mutation	SNP	C	C	T	rs144591273		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr8:37688272C>T	ENST00000412232.2	+	7	776	c.763C>T	c.(763-765)Cgc>Tgc	p.R255C	GPR124_ENST00000315215.7_Missense_Mutation_p.R255C	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	255	Ig-like.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CCCGTCCCTACGCCAAGTGGT	0.657																																						.											0								C	CYS/ARG	1,4399		0,1,2199	81.0	52.0	62.0		763	5.2	1.0	8	dbSNP_134	62	1,8597		0,1,4298	no	missense	GPR124	NM_032777.9	180	0,2,6497	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	255/1339	37688272	2,12996	2200	4299	6499	SO:0001583	missense	25960			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.763C>T	8.37:g.37688272C>T	ENSP00000406367:p.Arg255Cys		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451640	0.84209	2.27E-4	1.16E-4	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.60299	0.2;0.25	5.19	5.19	0.71726	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.135299	0.51477	D	0.000096	T	0.76111	0.3942	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.97	T	0.78553	-0.2160	10	0.66056	D	0.02	-37.0163	18.7204	0.91691	0.0:1.0:0.0:0.0	.	255;255	Q96PE1-2;Q96PE1	.;GP124_HUMAN	C	248;255;255	ENSP00000323508:R255C;ENSP00000406367:R255C	ENSP00000323508:R255C	R	+	1	0	GPR124	37807430	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	3.846000	0.55888	2.429000	0.82318	0.655000	0.94253	CGC		0.657	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
CDK2AP2P2	107133486	broad.mit.edu	37	9	66500864	66500864	+	IGR	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr9:66500864A>G								RP11-262H14.1 (31554 upstream) : RP11-262H14.7 (16341 downstream)																							GAGCACCTACACGGAACTGCT	0.602																																						.											0																																										SO:0001628	intergenic_variant	442421																															9.37:g.66500864A>G				RNA	SNP		37																																																																																				0	0.602								
DYNC1I1	1780	ucsc.edu;mdanderson.org;bcgsc.ca	37	7	95668630	95668630	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr7:95668630C>A	ENST00000324972.6	+	14	1650	c.1457C>A	c.(1456-1458)cCa>cAa	p.P486Q	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.P466Q|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.P449Q|DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.P469Q|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.P469Q|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.P449Q	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	486					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CACCAAGGGCCAGTGACAGGA	0.478																																						.											0													151.0	142.0	145.0					7																	95668630		2203	4300	6503	SO:0001583	missense	1780			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1457C>A	7.37:g.95668630C>A	ENSP00000320130:p.Pro486Gln		B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622230	0.87460	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08	4.94	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78291	0.4260	M	0.82132	2.575	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.998;0.993	T	0.81095	-0.1088	10	0.87932	D	0	-20.6976	18.7491	0.91806	0.0:1.0:0.0:0.0	.	469;466;469;486;449	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	Q	469;486;449;466;449;469	ENSP00000392337:P469Q;ENSP00000320130:P486Q;ENSP00000438377:P449Q;ENSP00000398118:P466Q;ENSP00000352348:P449Q;ENSP00000412444:P469Q	ENSP00000320130:P486Q	P	+	2	0	DYNC1I1	95506566	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.651000	0.83577	2.753000	0.94483	0.557000	0.71058	CCA		0.478	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
MDC1	9656	ucsc.edu	37	6	30681950	30681950	+	Silent	SNP	T	T	C			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr6:30681950T>C	ENST00000376406.3	-	3	794	c.147A>G	c.(145-147)ctA>ctG	p.L49L	MDC1_ENST00000494654.1_5'Flank|MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Silent_p.L49L	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	49	Interaction with CHEK2.|Interaction with the MRN complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TCCCGAGGTGTAGTGGGAAAT	0.463								Other conserved DNA damage response genes																														.											0													42.0	40.0	41.0					6																	30681950		1506	2696	4202	SO:0001819	synonymous_variant	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.147A>G	6.37:g.30681950T>C			A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	CCDS34384.1																																																																																				0.463	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
AK2	204	mdanderson.org	37	1	33478920	33478920	+	Silent	SNP	G	G	A	rs111261425		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:33478920G>A	ENST00000373449.2	-	6	623	c.582C>T	c.(580-582)acC>acT	p.T194T	AK2_ENST00000354858.6_Silent_p.T194T|AK2_ENST00000467905.1_Silent_p.T194T|AK2_ENST00000491241.1_5'Flank|RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000548033.1_Silent_p.T152T|AK2_ENST00000480134.1_3'UTR	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TGAGTGGGGTGGTTTGAGTGT	0.532																																						.											0													114.0	105.0	108.0					1																	33478920		2203	4300	6503	SO:0001819	synonymous_variant	204			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.582C>T	1.37:g.33478920G>A				Silent	SNP	ENST00000373449.2	37	CCDS373.1																																																																																				0.532	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1	NM_001625	
ANKRD30BL	554226	mdanderson.org	37	2	132919099	132919099	+	Silent	SNP	C	C	T	rs199974298		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr2:132919099C>T	ENST00000409867.1	-	1	429	c.180G>A	c.(178-180)aaG>aaA	p.K60K	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	60										endometrium(1)|kidney(3)	4						CCATTGTCGTCTTCTTCATCA	0.582																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.180G>A	2.37:g.132919099C>T			B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
BAGE2	85319	mdanderson.org	37	21	11058230	11058230	+	RNA	SNP	C	C	A	rs372289393		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr21:11058230C>A	ENST00000470054.1	-	0	417							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGAAAGGTGTCGGCTCCTGCA	0.418																																						.											0													92.0	72.0	78.0					21																	11058230		692	1591	2283			85319			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058230C>A			A8K925|Q08ER0	Silent	SNP	ENST00000470054.1	37																																																																																					0.418	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
C15orf43	145645	mdanderson.org	37	15	45253735	45253735	+	Missense_Mutation	SNP	A	A	T	rs77033860	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr15:45253735A>T	ENST00000340827.3	+	4	318	c.301A>T	c.(301-303)Att>Ttt	p.I101F	RNU6-1332P_ENST00000516666.1_RNA	NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	101										NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		AAGAAGAAAAATTGGTAGTTT	0.289																																						.											0													63.0	60.0	61.0					15																	45253735		2198	4293	6491	SO:0001583	missense	145645			BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.301A>T	15.37:g.45253735A>T	ENSP00000340644:p.Ile101Phe			Missense_Mutation	SNP	ENST00000340827.3	37	CCDS10115.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.274786	0.40194	.	.	ENSG00000167014	ENST00000340827	T	0.49139	0.79	4.4	3.26	0.37387	.	0.243069	0.31909	N	0.006868	T	0.35008	0.0917	L	0.29908	0.895	0.37417	D	0.913478	P	0.35383	0.498	B	0.37943	0.261	T	0.30621	-0.9972	10	0.48119	T	0.1	.	8.141	0.31082	0.7769:0.2231:0.0:0.0	.	101	Q8NHR7	CO043_HUMAN	F	101	ENSP00000340644:I101F	ENSP00000340644:I101F	I	+	1	0	C15orf43	43041027	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.732000	0.26072	0.650000	0.30769	0.448000	0.29417	ATT		0.289	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448	
CCDC144NL	339184	mdanderson.org	37	17	20768803	20768803	+	Silent	SNP	C	C	T	rs561339792|rs76135364	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr17:20768803C>T	ENST00000327925.5	-	4	710	c.591G>A	c.(589-591)gaG>gaA	p.E197E	RP11-344E13.3_ENST00000577537.1_RNA|CCDC144NL_ENST00000539484.1_5'UTR	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	197										large_intestine(3)|lung(3)|skin(1)	7						GAACCCTTTGCTCATGCAGAT	0.348																																						.											0													82.0	76.0	78.0					17																	20768803		2203	4299	6502	SO:0001819	synonymous_variant	339184				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.591G>A	17.37:g.20768803C>T				Silent	SNP	ENST00000327925.5	37	CCDS32591.1																																																																																				0.348	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
CCDC144NL	339184	mdanderson.org	37	17	20769964	20769964	+	Silent	SNP	C	C	A	rs79395366	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr17:20769964C>A	ENST00000327925.5	-	3	587	c.468G>T	c.(466-468)gtG>gtT	p.V156V	RP11-344E13.3_ENST00000577537.1_RNA|RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000577860.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA|RP11-344E13.3_ENST00000582324.1_RNA|CCDC144NL_ENST00000539484.1_5'UTR|RP11-344E13.3_ENST00000439794.2_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	156										large_intestine(3)|lung(3)|skin(1)	7						tcatctgctccaccgtaccac	0.612																																						.											0													69.0	45.0	53.0					17																	20769964		2137	4143	6280	SO:0001819	synonymous_variant	339184				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.468G>T	17.37:g.20769964C>A				Silent	SNP	ENST00000327925.5	37	CCDS32591.1																																																																																				0.612	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
CDC42BPG	55561	mdanderson.org	37	11	64601933	64601933	+	Silent	SNP	T	T	C	rs7933683	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:64601933T>C	ENST00000342711.5	-	19	2291	c.2292A>G	c.(2290-2292)acA>acG	p.T764T	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CCTGCACCTGTGTCAGCCGCT	0.706													C|||	1376	0.27476	0.0424	0.2147	5008	,	,		15170	0.4921		0.2575	False		,,,				2504	0.4254					.											0								C		284,3850		12,260,1795	6.0	7.0	6.0		2292	-6.1	0.8	11	dbSNP_116	6	1681,6531		171,1339,2596	no	coding-synonymous	CDC42BPG	NM_017525.2		183,1599,4391	CC,CT,TT		20.47,6.8699,15.9161		764/1552	64601933	1965,10381	2067	4106	6173	SO:0001819	synonymous_variant	55561			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.2292A>G	11.37:g.64601933T>C				Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																				0.706	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
CST2	1470	mdanderson.org	37	20	23805930	23805930	+	Missense_Mutation	SNP	T	T	C	rs199856966		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr20:23805930T>C	ENST00000304725.2	-	2	329	c.259A>G	c.(259-261)Ata>Gta	p.I87V		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	87					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						CCCACCTCTATGTCGAAGAAG	0.537																																					Pancreas(193;496 3017 22514 29918)	.											0													314.0	240.0	265.0					20																	23805930		2203	4300	6503	SO:0001583	missense	1470			M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.259A>G	20.37:g.23805930T>C	ENSP00000307540:p.Ile87Val		Q9UCQ7	Missense_Mutation	SNP	ENST00000304725.2	37	CCDS13161.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.972408	0.00457	.	.	ENSG00000170369	ENST00000304725	T	0.11169	2.8	2.36	1.34	0.21922	Proteinase inhibitor I25, cystatin, conserved site (1);Proteinase inhibitor I25, cystatin (2);	0.163089	0.40818	N	0.001002	T	0.01523	0.0049	N	0.00150	-1.985	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43718	-0.9374	10	0.02654	T	1	.	5.1107	0.14808	0.0:0.6785:0.0:0.3215	.	87	P09228	CYTT_HUMAN	V	87	ENSP00000307540:I87V	ENSP00000307540:I87V	I	-	1	0	CST2	23753930	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	-0.283000	0.08433	-0.065000	0.13021	-0.665000	0.03846	ATA		0.537	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078352.2		
FAM153B	202134	mdanderson.org	37	5	175528584	175528584	+	Splice_Site	SNP	C	C	T	rs200684937		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr5:175528584C>T	ENST00000253490.4	+	12	721	c.664C>T	c.(664-666)Ctt>Ttt	p.L222F	FAM153B_ENST00000510151.1_Splice_Site_p.L145F|FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000515817.1_Splice_Site_p.L145F			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	222								p.L222F(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		ACTGGCCGAACGTACGTATTC	0.463																																						.											1	Substitution - Missense(1)	prostate(1)																																								SO:0001630	splice_region_variant	202134			AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.664+1C>T	5.37:g.175528584C>T			A8MTI1	Missense_Mutation	SNP	ENST00000253490.4	37		.	.	.	.	.	.	.	.	.	.	C	6.188	0.402789	0.11696	.	.	ENSG00000182230	ENST00000515817;ENST00000253490	.	.	.	0.752	-0.292	0.12839	.	.	.	.	.	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	D	0.60575	0.988	B	0.40982	0.345	T	0.17410	-1.0370	8	0.38643	T	0.18	.	4.5589	0.12151	0.0:0.421:0.579:0.0	.	222	P0C7A2	F153B_HUMAN	F	145;222	.	ENSP00000253490:L222F	L	+	1	0	FAM153B	175461190	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	-4.439000	0.00234	-0.089000	0.12484	-1.402000	0.01139	CTT		0.463	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001079529	Missense_Mutation
FAM182B	728882	mdanderson.org	37	20	25755895	25755895	+	Missense_Mutation	SNP	C	C	T	rs77970644		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr20:25755895C>T	ENST00000376403.1	-	3	439	c.61G>A	c.(61-63)Ggg>Agg	p.G21R	FAM182B_ENST00000478164.1_5'UTR|FAM182B_ENST00000376404.2_Missense_Mutation_p.G18R			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	21										lung(1)	1						GTGCAGATCCCCACTTCGTGT	0.537																																						.											0																																										SO:0001583	missense	728882					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.61G>A	20.37:g.25755895C>T	ENSP00000365585:p.Gly21Arg		Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.157	-0.645057	0.03531	.	.	ENSG00000175170	ENST00000376404;ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.17916	0.0430	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30822	-0.9965	3	0.13108	T	0.6	.	.	.	.	.	.	.	.	R	18;21	.	ENSP00000365585:G21R	G	-	1	0	FAM182B	25703895	0.116000	0.22171	0.328000	0.25416	0.336000	0.28762	0.601000	0.24119	0.064000	0.16427	0.064000	0.15345	GGG		0.537	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
FKBP9	11328	mdanderson.org	37	7	33044951	33044951	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr7:33044951C>G	ENST00000242209.4	+	10	1870	c.1701C>G	c.(1699-1701)caC>caG	p.H567Q	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000490776.2_Missense_Mutation_p.H335Q|FKBP9_ENST00000538336.1_Missense_Mutation_p.H620Q|FKBP9_ENST00000538443.1_Missense_Mutation_p.H429Q	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	567	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			AAGCCAAACACGATGAACTCT	0.517																																						.											0													152.0	109.0	124.0					7																	33044951		2203	4300	6503	SO:0001583	missense	11328			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1701C>G	7.37:g.33044951C>G	ENSP00000242209:p.His567Gln		B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	ENST00000242209.4	37	CCDS5439.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365781	0.61513	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443;ENST00000490776	T;T;T;T	0.58060	0.36;0.38;0.4;0.36	5.07	-3.51	0.04696	.	.	.	.	.	T	0.69806	0.3152	.	.	.	0.58432	D	0.999995	D;D;P	0.89917	0.999;1.0;0.86	D;D;B	0.87578	0.993;0.998;0.401	T	0.71185	-0.4667	8	0.72032	D	0.01	-9.9572	14.0577	0.64779	0.0:0.4114:0.0:0.5886	.	335;620;567	B7Z1G9;B7Z6H3;O95302	.;.;FKBP9_HUMAN	Q	567;620;429;335	ENSP00000242209:H567Q;ENSP00000439250:H620Q;ENSP00000437504:H429Q;ENSP00000441317:H335Q	ENSP00000242209:H567Q	H	+	3	2	FKBP9	33011476	0.024000	0.19004	0.835000	0.33067	0.918000	0.54935	-0.859000	0.04277	-1.301000	0.02338	-0.266000	0.10368	CAC		0.517	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
GLIS3	169792	mdanderson.org	37	9	4118111	4118111	+	Missense_Mutation	SNP	G	G	T	rs6415788	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr9:4118111G>T	ENST00000324333.10	-	3	1095	c.902C>A	c.(901-903)cCa>cAa	p.P301Q	GLIS3_ENST00000381971.3_Missense_Mutation_p.P456Q	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	301	Pro-rich.		P -> Q (in dbSNP:rs6415788). {ECO:0000269|PubMed:15489334}.		negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		tggggggcctgggggcggcgg	0.731													T|||	3386	0.676118	0.6006	0.7622	5008	,	,		9673	0.874		0.6302	False		,,,				2504	0.5603					.											0								T	GLN/PRO,GLN/PRO	2499,1143		894,711,216	8.0	11.0	10.0		1367,902	5.4	1.0	9	dbSNP_116	10	4958,2542		1716,1526,508	yes	missense,missense	GLIS3	NM_001042413.1,NM_152629.3	76,76	2610,2237,724	TT,TG,GG		33.8933,31.3839,33.0731	benign,benign	456/931,301/776	4118111	7457,3685	1821	3750	5571	SO:0001583	missense	169792			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.902C>A	9.37:g.4118111G>T	ENSP00000325494:p.Pro301Gln		B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000324333.10	37	CCDS6451.1	1503	0.6881868131868132	289	0.5873983739837398	261	0.7209944751381215	500	0.8741258741258742	453	0.5976253298153035	T	1.187	-0.636435	0.03557	0.686161	0.661067	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.10192	2.92;2.9	5.37	5.37	0.77165	.	0.000000	0.47852	N	0.000210	T	0.00012	0.0000	N	0.01048	-1.04	0.42193	P	0.008264000000000049	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34576	-0.9823	9	0.02654	T	1	.	12.6151	0.56571	0.0:0.0:0.1388:0.8612	rs6415788;rs13294473;rs59237658;rs6415788	456;301	Q8NEA6-2;Q8NEA6	.;GLIS3_HUMAN	Q	301;456	ENSP00000325494:P301Q;ENSP00000371398:P456Q	ENSP00000325494:P301Q	P	-	2	0	GLIS3	4108111	1.000000	0.71417	0.971000	0.41717	0.160000	0.22226	4.123000	0.57917	0.872000	0.35775	-0.256000	0.11100	CCA		0.731	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629	
HAPLN4	404037	mdanderson.org	37	19	19369435	19369435	+	Silent	SNP	A	A	G	rs2074295	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:19369435A>G	ENST00000291481.7	-	4	777	c.714T>C	c.(712-714)agT>agC	p.S238S	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	238	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.S238S(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	CGCCCCCTGCACTCCCGGTCC	0.701													G|||	1768	0.353035	0.4675	0.3213	5008	,	,		12281	0.2589		0.2117	False		,,,				2504	0.4632					.											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)						G		1881,2525	599.7+/-389.3	404,1073,726	30.0	29.0	29.0		714	1.8	0.0	19	dbSNP_96	29	1941,6655	695.8+/-404.8	217,1507,2574	no	coding-synonymous	HAPLN4	NM_023002.2		621,2580,3300	GG,GA,AA		22.5803,42.6918,29.3955		238/403	19369435	3822,9180	2203	4298	6501	SO:0001819	synonymous_variant	404037			AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.714T>C	19.37:g.19369435A>G			A5PKW5|Q96PW2	Silent	SNP	ENST00000291481.7	37	CCDS12398.1																																																																																				0.701	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002	
IFITM3	10410	mdanderson.org	37	11	320606	320606	+	Missense_Mutation	SNP	G	G	T	rs199749095	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:320606G>T	ENST00000399808.4	-	1	444	c.208C>A	c.(208-210)Ccc>Acc	p.P70T	RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000602735.1_Missense_Mutation_p.P49T|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.P49T|RP11-326C3.11_ENST00000602429.1_RNA	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	70	Interaction with SPP1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.P70T(3)		central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		AGGCAGCAGGGGTTCATGAAG	0.632																																						.											3	Substitution - Missense(3)	endometrium(2)|central_nervous_system(1)											89.0	95.0	93.0					11																	320606		2101	4210	6311	SO:0001583	missense	10410			X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.208C>A	11.37:g.320606G>T	ENSP00000382707:p.Pro70Thr		Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	ENST00000399808.4	37	CCDS41585.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|G	0.076|0.076	-1.193620|-1.193620	0.01594|0.01594	.|.	.|.	ENSG00000142089|ENSG00000142089	ENST00000270031|ENST00000399808;ENST00000526811	.|T;T	.|0.78595	.|-0.94;-1.19	4.65|4.65	-9.3|-9.3	0.00649|0.00649	.|.	.|.	.|.	.|.	.|.	.|T	.|0.54447	.|0.1859	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.32375	.|-0.9909	.|9	.|0.22109	.|T	.|0.4	.|.	2.5632|2.5632	0.04777|0.04777	0.1587:0.0951:0.2785:0.4676|0.1587:0.0951:0.2785:0.4676	.|.	.|70	.|Q01628	.|IFM3_HUMAN	.|T	-1|70;49	.|ENSP00000382707:P70T;ENSP00000432108:P49T	.|ENSP00000382707:P70T	.|P	-|-	.|1	.|0	IFITM3|IFITM3	310606|310606	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.022000|0.022000	0.10575|0.10575	-1.460000|-1.460000	0.02368|0.02368	-3.272000|-3.272000	0.00199|0.00199	-2.532000|-2.532000	0.00182|0.00182	.|CCC		0.632	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
KIF26A	26153	mdanderson.org	37	14	104643721	104643721	+	Silent	SNP	C	C	A	rs2487301	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr14:104643721C>A	ENST00000423312.2	+	12	4596	c.4596C>A	c.(4594-4596)gcC>gcA	p.A1532A	KIF26A_ENST00000315264.7_Silent_p.A1393A	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1532					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GCCCTGTGGCCGGTCCCAGAG	0.731													C|||	2298	0.458866	0.7383	0.2911	5008	,	,		13223	0.372		0.3419	False		,,,				2504	0.41					.											0								C		2061,1315		665,731,292	4.0	6.0	5.0		4596	-7.6	0.0	14	dbSNP_100	5	2447,5087		528,1391,1848	no	coding-synonymous	KIF26A	NM_015656.1		1193,2122,2140	AA,AC,CC		32.4794,38.9514,41.3199		1532/1883	104643721	4508,6402	1688	3767	5455	SO:0001819	synonymous_variant	26153			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4596C>A	14.37:g.104643721C>A			Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																				0.731	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
KRTAP10-4	386672	mdanderson.org	37	21	45993851	45993851	+	Silent	SNP	C	C	T	rs201895065		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr21:45993851C>T	ENST00000400374.3	+	1	246	c.216C>T	c.(214-216)tgC>tgT	p.C72C	TSPEAR_ENST00000397916.1_5'Flank|TSPEAR_ENST00000323084.4_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	72	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CAGTGACCTGCGAGCCCAGCC	0.721																																						.											0													20.0	38.0	32.0					21																	45993851		1993	4191	6184	SO:0001819	synonymous_variant	386672			AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.216C>T	21.37:g.45993851C>T			Q08AS0	Silent	SNP	ENST00000400374.3	37	CCDS42957.1																																																																																				0.721	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687	
LAMC3	10319	mdanderson.org	37	9	133884820	133884820	+	Missense_Mutation	SNP	T	T	G	rs3739512	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr9:133884820T>G	ENST00000361069.4	+	1	352	c.219T>G	c.(217-219)caT>caG	p.H73Q	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	73	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		cgggggcTCATTGCCAGCGCT	0.731													G|||	3285	0.65595	0.8011	0.5504	5008	,	,		9081	0.8611		0.4533	False		,,,				2504	0.5317					.											0								G	GLN/HIS	2801,873		1125,551,161	6.0	5.0	6.0		219	3.0	0.6	9	dbSNP_107	6	3292,3800		842,1608,1096	no	missense	LAMC3	NM_006059.3	24	1967,2159,1257	GG,GT,TT		46.4185,23.7616,43.4052	benign	73/1576	133884820	6093,4673	1837	3546	5383	SO:0001583	missense	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.219T>G	9.37:g.133884820T>G	ENSP00000354360:p.His73Gln		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	1392	0.6373626373626373	369	0.75	198	0.5469613259668509	486	0.8496503496503497	339	0.4472295514511873	G	4.105	0.017662	0.07959	0.762384	0.464185	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.73681	-0.77	3.94	3.0	0.34707	Laminin, N-terminal (3);	0.518974	0.20363	N	0.093816	T	0.00012	0.0000	N	0.00224	-1.81	0.49798	P	1.7699999999998273E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.39761	-0.9598	9	0.18710	T	0.47	.	8.2046	0.31446	0.0:0.327:0.5045:0.1685	rs3739512	73	Q9Y6N6	LAMC3_HUMAN	Q	73	ENSP00000354360:H73Q	ENSP00000325873:H73Q	H	+	3	2	LAMC3	132874641	1.000000	0.71417	0.637000	0.29366	0.294000	0.27393	1.591000	0.36665	0.126000	0.18424	-0.648000	0.03929	CAT		0.731	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
MB21D1	115004	mdanderson.org	37	6	74161503	74161503	+	Silent	SNP	A	A	G	rs9446904	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr6:74161503A>G	ENST00000370315.3	-	1	496	c.402T>C	c.(400-402)ccT>ccC	p.P134P	MB21D1_ENST00000370318.1_Silent_p.P134P	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	134					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						GCCCGGGCGGAGGTCTTGGCT	0.751													G|||	4499	0.898363	0.8949	0.8674	5008	,	,		11256	0.9484		0.8579	False		,,,				2504	0.9151					.											0								G		3318,426		1470,378,24	4.0	5.0	4.0		402	-3.0	0.0	6	dbSNP_119	4	6360,1026		2732,896,65	no	coding-synonymous	MB21D1	NM_138441.2		4202,1274,89	GG,GA,AA		13.8911,11.3782,13.0458		134/523	74161503	9678,1452	1872	3693	5565	SO:0001819	synonymous_variant	115004			BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.402T>C	6.37:g.74161503A>G			L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Silent	SNP	ENST00000370315.3	37	CCDS4978.1																																																																																				0.751	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
MUC2	4583	mdanderson.org	37	11	1092998	1092998	+	Missense_Mutation	SNP	C	C	T	rs199740586		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1092998C>T	ENST00000441003.2	+	30	4844	c.4817C>T	c.(4816-4818)aCg>aTg	p.T1606M	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accccaaccacgacacccatc	0.627																																						.											0													58.0	103.0	87.0					11																	1092998		1812	3359	5171	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4817C>T	11.37:g.1092998C>T	ENSP00000415183:p.Thr1606Met		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.220	-0.378525	0.05000	.	.	ENSG00000198788	ENST00000441003	T	0.14144	2.53	1.75	-0.359	0.12571	.	.	.	.	.	T	0.07007	0.0178	.	.	.	0.09310	N	1	P	0.36789	0.57	B	0.21360	0.034	T	0.27365	-1.0076	8	0.62326	D	0.03	.	5.2464	0.15498	0.0:0.6213:0.0:0.3787	.	1606	E7EUV1	.	M	1606	ENSP00000415183:T1606M	ENSP00000415183:T1606M	T	+	2	0	MUC2	1082998	0.001000	0.12720	0.005000	0.12908	0.058000	0.15608	1.095000	0.30964	0.104000	0.17725	0.121000	0.15741	ACG		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1093311	1093311	+	Silent	SNP	C	C	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1093311C>A	ENST00000441003.2	+	30	5157	c.5130C>A	c.(5128-5130)acC>acA	p.T1710T	MUC2_ENST00000359061.5_Silent_p.T1677T|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tgaccccaaccccaacaccca	0.637																																						.											0													143.0	189.0	173.0					11																	1093311		1906	3557	5463	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5130C>A	11.37:g.1093311C>A			Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1093343	1093343	+	Missense_Mutation	SNP	C	C	T	rs56002648		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1093343C>T	ENST00000441003.2	+	30	5189	c.5162C>T	c.(5161-5163)cCg>cTg	p.P1721L	MUC2_ENST00000359061.5_Missense_Mutation_p.P1688L|MUC2_ENST00000333592.6_Missense_Mutation_p.P9L|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accccaaccccgacacccatc	0.642																																						.											0													235.0	272.0	259.0					11																	1093343		1969	3753	5722	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5162C>T	11.37:g.1093343C>T	ENSP00000415183:p.Pro1721Leu		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	9.738	1.164007	0.21538	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.08008	3.14;3.23;3.4	1.4	1.4	0.22301	.	2.679550	0.04278	U	0.343350	T	0.07234	0.0183	.	.	.	0.09310	N	1	B	0.31125	0.309	B	0.15052	0.012	T	0.36504	-0.9745	9	0.87932	D	0	.	8.2676	0.31824	0.0:1.0:0.0:0.0	rs56002648	1721	E7EUV1	.	L	1721;1688;9	ENSP00000415183:P1721L;ENSP00000351956:P1688L;ENSP00000331373:P9L	ENSP00000331373:P9L	P	+	2	0	MUC2	1083343	0.001000	0.12720	0.001000	0.08648	0.009000	0.06853	1.149000	0.31626	0.729000	0.32403	0.195000	0.17529	CCG		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195506482	195506482	+	Missense_Mutation	SNP	G	G	T	rs113936020	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr3:195506482G>T	ENST00000463781.3	-	2	12428	c.11969C>A	c.(11968-11970)aCt>aAt	p.T3990N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3990N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.592																																						.											0													10.0	7.0	8.0					3																	195506482		623	1357	1980	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11969C>A	3.37:g.195506482G>T	ENSP00000417498:p.Thr3990Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.405	-0.916416	0.02415	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.46	0.481	0.481	0.16809	.	0.562686	0.09843	U	0.748557	T	0.35913	0.0948	N	0.14661	0.345	0.09310	N	1	D	0.57257	0.979	D	0.68192	0.956	T	0.29852	-0.9998	9	.	.	.	.	6.8687	0.24108	1.0E-4:0.0:0.9999:0.0	.	3862	E7ESK3	.	N	3990	ENSP00000417498:T3990N;ENSP00000420243:T3990N	.	T	-	2	0	MUC4	196991261	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.001000	0.12947	0.537000	0.28751	0.064000	0.15345	ACT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509287	195509287	+	Missense_Mutation	SNP	T	T	G	rs71291872|rs201610800		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr3:195509287T>G	ENST00000463781.3	-	2	9623	c.9164A>C	c.(9163-9165)aAc>aCc	p.N3055T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.N3055T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	996					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATGAAGAGGGTTGGCGTGACC	0.627																																						.											0													29.0	15.0	19.0					3																	195509287		628	1560	2188	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9164A>C	3.37:g.195509287T>G	ENSP00000417498:p.Asn3055Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	5.093	0.202865	0.09704	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.56	.	.	.	.	.	.	.	.	T	0.12263	0.0298	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.30794	-0.9966	7	.	.	.	.	3.2933	0.06957	0.0:0.0:0.4408:0.5592	.	2927	E7ESK3	.	T	3055	ENSP00000417498:N3055T;ENSP00000420243:N3055T	.	N	-	2	0	MUC4	196994066	0.000000	0.05858	0.006000	0.13384	0.000000	0.00434	-2.273000	0.01164	0.415000	0.25817	0.000000	0.15137	AAC		0.627	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509414	195509414	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr3:195509414C>T	ENST00000463781.3	-	2	9496	c.9037G>A	c.(9037-9039)Gac>Aac	p.D3013N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D3013N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																						.											0													21.0	16.0	17.0					3																	195509414		660	1573	2233	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9037G>A	3.37:g.195509414C>T	ENSP00000417498:p.Asp3013Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	7.957	0.746186	0.15710	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.54;1.54	.	.	.	.	.	.	.	.	T	0.17534	0.0421	N	0.19112	0.55	0.09310	N	1	D	0.58970	0.984	P	0.44647	0.456	T	0.13202	-1.0518	7	.	.	.	.	4.1611	0.10284	0.0:0.4686:0.0:0.5314	.	2885	E7ESK3	.	N	3013	ENSP00000417498:D3013N;ENSP00000420243:D3013N	.	D	-	1	0	MUC4	196994193	0.031000	0.19500	0.001000	0.08648	0.000000	0.00434	-0.540000	0.06106	-0.437000	0.07243	0.000000	0.15137	GAC		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1017068	1017068	+	Silent	SNP	C	C	T	rs78992004		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1017068C>T	ENST00000421673.2	-	31	5783	c.5733G>A	c.(5731-5733)acG>acA	p.T1911T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1911	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGTTTTGGCCGTGCTAAATG	0.552																																						.											0																																										SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5733G>A	11.37:g.1017068C>T			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017074	1017074	+	Silent	SNP	A	A	G	rs79277162		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1017074A>G	ENST00000421673.2	-	31	5777	c.5727T>C	c.(5725-5727)ttT>ttC	p.F1909F		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1909	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGCCGTGCTAAATGAGCTTG	0.552																																						.											0													687.0	705.0	699.0					11																	1017074		2198	4284	6482	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5727T>C	11.37:g.1017074A>G			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017744	1017744	+	Missense_Mutation	SNP	T	T	C	rs200243990		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1017744T>C	ENST00000421673.2	-	31	5107	c.5057A>G	c.(5056-5058)aAc>aGc	p.N1686S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1686	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTTGGCTGTGTTTAATGAGCT	0.562																																						.											0													863.0	836.0	845.0					11																	1017744		2200	4296	6496	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5057A>G	11.37:g.1017744T>C	ENSP00000406861:p.Asn1686Ser		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.750323	0.00669	.	.	ENSG00000184956	ENST00000421673	T	0.14640	2.49	1.87	-2.04	0.07343	.	.	.	.	.	T	0.02012	0.0063	N	0.00152	-1.975	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38134	-0.9675	9	0.02654	T	1	.	6.3147	0.21184	0.0:0.2622:0.5902:0.1476	.	1686	Q6W4X9	MUC6_HUMAN	S	1686	ENSP00000406861:N1686S	ENSP00000406861:N1686S	N	-	2	0	MUC6	1007744	0.016000	0.18221	0.000000	0.03702	0.019000	0.09904	-0.366000	0.07563	-1.043000	0.03258	-0.886000	0.02939	AAC		0.562	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017773	1017773	+	Silent	SNP	G	G	A	rs57384288	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1017773G>A	ENST00000421673.2	-	31	5078	c.5028C>T	c.(5026-5028)agC>agT	p.S1676S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1676	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.S1676S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCTGGTCCCGCTGGTGGTCA	0.557													A|||	1486	0.296725	0.3298	0.1542	5008	,	,		31162	0.3165		0.2505	False		,,,				2504	0.3804					.											1	Substitution - coding silent(1)	ovary(1)											688.0	686.0	687.0					11																	1017773		2198	4294	6492	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5028C>T	11.37:g.1017773G>A			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.557	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC6	4588	mdanderson.org	37	11	1017945	1017945	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:1017945A>G	ENST00000421673.2	-	31	4906	c.4856T>C	c.(4855-4857)tTc>tCc	p.F1619S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1619	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGAGGTGGAGAAAGGTGGAAC	0.542																																						.											0																																										SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4856T>C	11.37:g.1017945A>G	ENSP00000406861:p.Phe1619Ser		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	0.026	-1.375208	0.01214	.	.	ENSG00000184956	ENST00000421673	T	0.19669	2.13	2.39	-1.65	0.08291	.	.	.	.	.	T	0.14227	0.0344	L	0.41710	1.295	0.09310	N	1	B	0.29341	0.242	B	0.35931	0.214	T	0.39860	-0.9593	9	0.06625	T	0.88	.	6.4604	0.21954	0.6729:0.0:0.3271:0.0	.	1619	Q6W4X9	MUC6_HUMAN	S	1619	ENSP00000406861:F1619S	ENSP00000406861:F1619S	F	-	2	0	MUC6	1007945	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.579000	0.05834	-0.502000	0.06596	-0.917000	0.02746	TTC		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
NASP	4678	mdanderson.org	37	1	46073361	46073362	+	Missense_Mutation	DNP	CA	CA	TG	rs78094239|rs75187774	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:46073361_46073362CA>TG	ENST00000350030.3	+	6	865_866	c.778_779CA>TG	c.(778-780)CAg>TGg	p.Q260W	NASP_ENST00000537798.1_Missense_Mutation_p.Q196W|NASP_ENST00000372052.4_Intron|NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_Missense_Mutation_p.Q262W	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	260	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					AAAAGGAGGTCAGGAGAAGCAG	0.48																																						.											0																																										SO:0001583	missense	4678			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	Exception_encountered	1.37:g.46073361_46073362delinsTG	ENSP00000255120:p.Gln260Trp		A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	DNP	ENST00000350030.3	37	CCDS524.1																																																																																				0.480	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
NASP	4678	mdanderson.org	37	1	46073373	46073373	+	Missense_Mutation	SNP	G	G	A	rs199792714	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:46073373G>A	ENST00000350030.3	+	6	877	c.790G>A	c.(790-792)Gga>Aga	p.G264R	NASP_ENST00000537798.1_Missense_Mutation_p.G200R|NASP_ENST00000372052.4_Intron|NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_Missense_Mutation_p.G266R	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	264	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					GGAGAAGCAGGGAGAGGTAAT	0.478																																						.											0													44.0	47.0	46.0					1																	46073373		2203	4300	6503	SO:0001583	missense	4678			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.790G>A	1.37:g.46073373G>A	ENSP00000255120:p.Gly264Arg		A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	ENST00000350030.3	37	CCDS524.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306595	0.81247	.	.	ENSG00000132780	ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030;ENST00000470768	D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48	5.37	5.37	0.77165	.	0.623202	0.16964	N	0.192395	D	0.93615	0.7961	L	0.32530	0.975	0.43412	D	0.995555	P;P;D;P;P	0.53619	0.928;0.933;0.961;0.883;0.919	P;P;P;B;B	0.50405	0.565;0.542;0.64;0.231;0.408	D	0.92054	0.5651	9	.	.	.	-3.2525	20.0097	0.97446	0.0:0.0:1.0:0.0	.	200;264;164;264;266	F5H3J2;Q53H03;B4DS57;P49321;P49321-3	.;.;.;NASP_HUMAN;.	R	200;266;164;264;227	ENSP00000438871:G200R;ENSP00000384529:G266R;ENSP00000255120:G264R;ENSP00000436924:G227R	.	G	+	1	0	NASP	45845960	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.877000	0.39598	2.902000	0.99343	0.650000	0.86243	GGA		0.478	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
NCOR1	9611	mdanderson.org	37	17	16068464	16068464	+	Silent	SNP	G	G	A	rs200311165	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr17:16068464G>A	ENST00000268712.3	-	5	704	c.447C>T	c.(445-447)ttC>ttT	p.F149F	NCOR1_ENST00000395848.1_Silent_p.F40F|NCOR1_ENST00000395851.1_Silent_p.F149F	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	149	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTTTGCCTCCGAATGCTGGAT	0.378																																						.											0													107.0	99.0	102.0					17																	16068464		2203	4300	6503	SO:0001819	synonymous_variant	9611			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.447C>T	17.37:g.16068464G>A			B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	37	CCDS11175.1																																																																																				0.378	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
OAS3	4940	mdanderson.org	37	12	113376452	113376452	+	Silent	SNP	C	C	T	rs1859329	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:113376452C>T	ENST00000228928.7	+	1	296	c.117C>T	c.(115-117)gcC>gcT	p.A39A	RP1-71H24.1_ENST00000552784.1_RNA|OAS3_ENST00000551007.1_Silent_p.A39A|OAS3_ENST00000548514.1_Silent_p.A39A|OAS3_ENST00000546638.1_3'UTR	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	39	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						TGGCCGCTGCCCTGAGGGAGC	0.701													C|||	3937	0.786142	0.9887	0.7738	5008	,	,		12918	0.748		0.6352	False		,,,				2504	0.7157					.											0								C		3337,247		1556,225,11	7.0	8.0	8.0		117	0.8	0.0	12	dbSNP_92	8	5199,2777		1738,1723,527	no	coding-synonymous	OAS3	NM_006187.2		3294,1948,538	TT,TC,CC		34.817,6.8917,26.1592		39/1088	113376452	8536,3024	1792	3988	5780	SO:0001819	synonymous_variant	4940			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.117C>T	12.37:g.113376452C>T			Q2HJ14|Q9H3P5	Silent	SNP	ENST00000228928.7	37	CCDS44981.1																																																																																				0.701	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1		
OR14C36	127066	mdanderson.org	37	1	248512749	248512749	+	Missense_Mutation	SNP	G	G	A	rs28377739	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:248512749G>A	ENST00000317861.1	+	1	673	c.673G>A	c.(673-675)Ggg>Agg	p.G225R		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	225			G -> R (in dbSNP:rs28377739).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						GACCGTGCTCGGGTTTCCAAG	0.498													a|||	2306	0.460463	0.3601	0.4885	5008	,	,		19309	0.4315		0.5239	False		,,,				2504	0.5409					.											0								A	ARG/GLY	1764,2642	643.9+/-397.9	352,1060,791	191.0	146.0	161.0		673	1.2	0.0	1	dbSNP_125	161	4894,3706	530.1+/-381.7	1390,2114,796	yes	missense	OR14C36	NM_001001918.1	125	1742,3174,1587	AA,AG,GG		43.093,40.0363,48.8082	benign	225/313	248512749	6658,6348	2203	4300	6503	SO:0001583	missense	127066			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.673G>A	1.37:g.248512749G>A	ENSP00000324534:p.Gly225Arg		Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	CCDS31112.1	1006	0.4606227106227106	169	0.3434959349593496	179	0.494475138121547	253	0.4423076923076923	405	0.5343007915567283	A	0.005	-2.203520	0.00296	0.400363	0.56907	ENSG00000177174	ENST00000317861	T	0.00019	9.06	3.91	1.2	0.21068	GPCR, rhodopsin-like superfamily (1);	0.422559	0.19555	N	0.111462	T	0.00012	0.0000	N	0.00227	-1.8	0.80722	P	0.0	B	0.09022	0.002	B	0.01281	0.0	T	0.37776	-0.9691	9	0.02654	T	1	.	6.3589	0.21417	0.6176:0.2982:0.0841:0.0	rs28377739	225	Q8NHC7	O14CZ_HUMAN	R	225	ENSP00000324534:G225R	ENSP00000324534:G225R	G	+	1	0	OR14C36	246579372	0.000000	0.05858	0.035000	0.18076	0.144000	0.21451	0.145000	0.16157	0.101000	0.17610	-1.086000	0.02197	GGG		0.498	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
OR4M1	441670	mdanderson.org	37	14	20248760	20248760	+	Silent	SNP	C	C	A			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr14:20248760C>A	ENST00000315957.4	+	1	360	c.279C>A	c.(277-279)tcC>tcA	p.S93S		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S93S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGATAATTTCCTTTGGTGGAT	0.448																																						.											1	Substitution - coding silent(1)	large_intestine(1)											252.0	273.0	266.0					14																	20248760		2203	4300	6503	SO:0001819	synonymous_variant	441670				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.279C>A	14.37:g.20248760C>A			B9EH18|Q6IFA3	Silent	SNP	ENST00000315957.4	37	CCDS32021.1																																																																																				0.448	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
PLEC	5339	mdanderson.org	37	8	144996263	144996263	+	Silent	SNP	G	G	A	rs11988293	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr8:144996263G>A	ENST00000322810.4	-	32	8306	c.8137C>T	c.(8137-8139)Ctg>Ttg	p.L2713L	PLEC_ENST00000356346.3_Silent_p.L2562L|PLEC_ENST00000345136.3_Silent_p.L2576L|PLEC_ENST00000354589.3_Silent_p.L2576L|PLEC_ENST00000354958.2_Silent_p.L2554L|PLEC_ENST00000398774.2_Silent_p.L2544L|PLEC_ENST00000357649.2_Silent_p.L2580L|PLEC_ENST00000527096.1_Silent_p.L2599L|PLEC_ENST00000436759.2_Silent_p.L2603L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2713	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						tgctgctccagctgctgcagc	0.721													G|||	268	0.0535144	0.1952	0.013	5008	,	,		15052	0.0		0.001	False		,,,				2504	0.0					.											0								G	,,,,,,,	677,3429		38,601,1414	5.0	6.0	5.0		7807,7684,7660,8137,7630,7726,7738,7726	3.2	0.7	8	dbSNP_120	5	6,7986		0,6,3990	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	38,607,5404	AA,AG,GG		0.0751,16.4881,5.6456	,,,,,,,	2603/4575,2562/4534,2554/4526,2713/4685,2544/4516,2576/4548,2580/4552,2576/4548	144996263	683,11415	2053	3996	6049	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8137C>T	8.37:g.144996263G>A			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																				0.721	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PRKX	5613	mdanderson.org	37	X	3631167	3631167	+	Missense_Mutation	SNP	A	A	G	rs3752362	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chrX:3631167A>G	ENST00000262848.5	-	1	482	c.128T>C	c.(127-129)gTg>gCg	p.V43A		NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	43			V -> A (in dbSNP:rs3752362).		angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				CAGGCTGTACACAGGCGGCTC	0.751													N|||	2672	0.707815	0.736	0.4856	3775	,	,		7851	0.6944		0.2644	False		,,,				2504	0.4049					.											0								G	ALA/VAL	3226,436		1253,279,441,50,57	6.0	5.0	6.0		128	-0.4	0.0	X	dbSNP_107	6	2368,4079		373,1000,622,979,1121	yes	missense	PRKX	NM_005044.4	64	1626,1279,1063,1029,1178	GG,GA,G,AA,A		36.7303,11.9061,44.6632	benign	43/359	3631167	5594,4515	2080	4095	6175	SO:0001583	missense	5613				CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.128T>C	X.37:g.3631167A>G	ENSP00000262848:p.Val43Ala			Missense_Mutation	SNP	ENST00000262848.5	37	CCDS14125.1	1097	0.6612417118746232	255	0.8673469387755102	120	0.47619047619047616	261	0.8474025974025974	133	0.20336391437308868	G	2.016	-0.425905	0.04701	0.880939	0.367303	ENSG00000183943	ENST00000262848	T	0.07908	3.15	1.08	-0.453	0.12201	Protein kinase-like domain (1);	0.957488	0.08497	N	0.937090	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.07908	-1.0748	9	0.38643	T	0.18	.	1.5859	0.02644	0.284:0.0:0.3851:0.3309	rs3752362;rs57248025	43	P51817	PRKX_HUMAN	A	43	ENSP00000262848:V43A	ENSP00000262848:V43A	V	-	2	0	PRKX	3641167	0.007000	0.16637	0.001000	0.08648	0.016000	0.09150	-0.380000	0.07427	-0.338000	0.08413	-0.697000	0.03683	GTG		0.751	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
RSPH10B	222967	mdanderson.org	37	7	5983092	5983092	+	Missense_Mutation	SNP	G	G	A	rs201187545		TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr7:5983092G>A	ENST00000405415.1	-	14	2007	c.1621C>T	c.(1621-1623)Cgt>Tgt	p.R541C	RSPH10B_ENST00000404406.1_Missense_Mutation_p.R541C|RSPH10B_ENST00000337579.3_Missense_Mutation_p.R541C|RSPH10B_ENST00000535104.1_5'UTR|RSPH10B_ENST00000441023.2_Missense_Mutation_p.R541C|RSPH10B_ENST00000539903.1_Missense_Mutation_p.P280L			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	541										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		TGTTGCTCACGGAATAAATTG	0.388																																						.											0													28.0	28.0	28.0					7																	5983092		2142	4274	6416	SO:0001583	missense	728194				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.1621C>T	7.37:g.5983092G>A	ENSP00000385443:p.Arg541Cys		A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	ENST00000405415.1	37	CCDS34598.1	10|10	0.004578754578754579|0.004578754578754579	4|4	0.008130081300813009|0.008130081300813009	0|0	0.0|0.0	0|0	0.0|0.0	6|6	0.0079155672823219|0.0079155672823219	G|G	10.49|10.49	1.366017|1.366017	0.24684|0.24684	.|.	.|.	ENSG00000155026|ENSG00000155026	ENST00000539903|ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	T|T;T;T;T	0.62639|0.51817	0.01|0.69;0.69;0.69;0.69	3.38|3.38	-4.94|-4.94	0.03057|0.03057	.|.	.|1.615010	.|0.03267	.|N	.|0.184174	T|T	0.10380|0.10380	0.0254|0.0254	N|N	0.00436|0.00436	-1.5|-1.5	0.31735|0.31735	N|N	0.636584|0.636584	.|B;B;B	.|0.12630	.|0.006;0.0;0.0	.|B;B;B	.|0.04013	.|0.001;0.0;0.0	T|T	0.13469|0.13469	-1.0508|-1.0508	7|10	0.87932|0.37606	D|T	0|0.19	.|.	6.042|6.042	0.19740|0.19740	0.5682:0.0:0.26:0.1718|0.5682:0.0:0.26:0.1718	.|.	.|242;541;400	.|B7Z298;P0C881;F5GXE3	.|.;R10B1_HUMAN;.	L|C	280|541;541;541;400;541	ENSP00000445203:P280L|ENSP00000385443:R541C;ENSP00000384097:R541C;ENSP00000338556:R541C;ENSP00000400988:R541C	ENSP00000440914:P323L|ENSP00000338556:R541C	P|R	-|-	2|1	0|0	RSPH10B|RSPH10B	5949618|5949618	0.026000|0.026000	0.19158|0.19158	0.142000|0.142000	0.22268|0.22268	0.069000|0.069000	0.16628|0.16628	-0.149000|-0.149000	0.10204|0.10204	-0.612000|-0.612000	0.05701|0.05701	-1.143000|-1.143000	0.01870|0.01870	CCG|CGT		0.388	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325465.2	NM_173565	
SCARF2	91179	mdanderson.org	37	22	20780296	20780296	+	Missense_Mutation	SNP	G	G	A	rs9680797	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr22:20780296G>A	ENST00000266214.5	-	11	2086	c.1982C>T	c.(1981-1983)cCa>cTa	p.P661L	SCARF2_ENST00000405555.3_Missense_Mutation_p.P656L	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	661	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GGGGTCAGGTGGCGGCGGTTT	0.756													g|||	68	0.0135783	0.0008	0.0303	5008	,	,		7971	0.0		0.0398	False		,,,				2504	0.0061					.											0									LEU/PRO,LEU/PRO	27,4371		0,27,2172	16.0	20.0	19.0		1982,1967	3.4	0.9	22	dbSNP_119	19	316,8274		10,296,3989	yes	missense,missense	SCARF2	NM_153334.4,NM_182895.2	98,98	10,323,6161	AA,AG,GG		3.6787,0.6139,2.6409	probably-damaging,probably-damaging	661/871,656/866	20780296	343,12645	2199	4295	6494	SO:0001583	missense	91179			AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.1982C>T	22.37:g.20780296G>A	ENSP00000266214:p.Pro661Leu		E5RFB8|Q58A83|Q8IXF3|Q9BW74	Missense_Mutation	SNP	ENST00000266214.5	37	CCDS13779.1	43	0.019688644688644688	4	0.008130081300813009	9	0.024861878453038673	0	0.0	30	0.0395778364116095	g	15.57	2.873045	0.51695	0.006139	0.036787	ENSG00000244486	ENST00000405555;ENST00000341328;ENST00000266214	T;T	0.22539	2.01;1.95	3.38	3.38	0.38709	.	0.084416	0.47093	U	0.000259	T	0.07458	0.0188	L	0.29908	0.895	0.49299	D	0.999771	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.01405	-1.1363	10	0.11485	T	0.65	.	12.6984	0.57018	0.0:0.0:1.0:0.0	rs9680797	656;656	E5RFB8;Q96GP6	.;SREC2_HUMAN	L	656;656;661	ENSP00000385589:P656L;ENSP00000266214:P661L	ENSP00000266214:P661L	P	-	2	0	SCARF2	19110296	1.000000	0.71417	0.865000	0.33974	0.132000	0.20833	8.286000	0.89916	1.917000	0.55516	0.441000	0.28932	CCA		0.756	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SLC2A3	6515	mdanderson.org	37	12	8074168	8074168	+	Silent	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:8074168A>G	ENST00000075120.7	-	10	1572	c.1332T>C	c.(1330-1332)gcT>gcC	p.A444A	SLC2A3_ENST00000543435.1_5'Flank	NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	444					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		AGAAGGTAAAAGCCAAGAAGG	0.448																																					Colon(96;424 1461 14416 20933 23688)	.											0													79.0	75.0	77.0					12																	8074168		2203	4300	6503	SO:0001819	synonymous_variant	6515			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.1332T>C	12.37:g.8074168A>G			B2R606|D3DUU6|Q6I9U2|Q9UG15	Silent	SNP	ENST00000075120.7	37	CCDS8586.1																																																																																				0.448	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931	
SP8	221833	mdanderson.org	37	7	20824614	20824614	+	Silent	SNP	C	C	T	rs34908430	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr7:20824614C>T	ENST00000361443.4	-	3	1005	c.768G>A	c.(766-768)tcG>tcA	p.S256S	SP8_ENST00000418710.2_Silent_p.S274S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	256					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GACTCAGGCCCGAGTAATCCG	0.706													c|||	1351	0.269768	0.0635	0.379	5008	,	,		12232	0.3958		0.2893	False		,,,				2504	0.3211					.											0								C	,	317,3303		22,273,1515	5.0	6.0	5.0		822,768	-5.1	1.0	7	dbSNP_126	5	1820,5582		247,1326,2128	no	coding-synonymous,coding-synonymous	SP8	NM_182700.4,NM_198956.2	,	269,1599,3643	TT,TC,CC		24.5879,8.7569,19.3885	,	274/509,256/491	20824614	2137,8885	1810	3701	5511	SO:0001819	synonymous_variant	221833				CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.768G>A	7.37:g.20824614C>T			Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	37	CCDS5372.1																																																																																				0.706	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
TAS2R19	259294	mdanderson.org	37	12	11174302	11174302	+	Missense_Mutation	SNP	A	A	G	rs72475480	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:11174302A>G	ENST00000390673.2	-	1	917	c.869T>C	c.(868-870)tTt>tCt	p.F290S	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	290					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						AACTGAAAGAAAGGTCTGTTT	0.433																																						.											0													101.0	95.0	97.0					12																	11174302		2203	4300	6503	SO:0001583	missense	259294			AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.869T>C	12.37:g.11174302A>G	ENSP00000375091:p.Phe290Ser		Q3MIJ4|Q645X8	Missense_Mutation	SNP	ENST00000390673.2	37	CCDS8640.1	.	.	.	.	.	.	.	.	.	.	A	10.22	1.289028	0.23478	.	.	ENSG00000212124	ENST00000390673	T	0.42131	0.98	2.95	-0.758	0.11049	.	0.445516	0.17704	U	0.164832	T	0.39963	0.1098	L	0.45698	1.435	0.09310	N	1	P	0.50272	0.933	P	0.53102	0.718	T	0.29336	-1.0015	10	0.25106	T	0.35	.	6.5702	0.22535	0.6087:0.0:0.3913:0.0	.	290	P59542	T2R19_HUMAN	S	290	ENSP00000375091:F290S	ENSP00000375091:F290S	F	-	2	0	TAS2R19	11065569	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-0.267000	0.08619	-0.011000	0.14247	0.333000	0.21579	TTT		0.433	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370080.1	NM_176888	
TAS2R19	259294	mdanderson.org	37	12	11174327	11174327	+	Missense_Mutation	SNP	C	C	T	rs72475481	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:11174327C>T	ENST00000390673.2	-	1	892	c.844G>A	c.(844-846)Gga>Aga	p.G282R	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	282					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						TTCCTACTTCCCATAATCAGG	0.428																																						.											0													120.0	113.0	115.0					12																	11174327		2203	4300	6503	SO:0001583	missense	259294			AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.844G>A	12.37:g.11174327C>T	ENSP00000375091:p.Gly282Arg		Q3MIJ4|Q645X8	Missense_Mutation	SNP	ENST00000390673.2	37	CCDS8640.1	966	0.4423076923076923	167	0.3394308943089431	168	0.46408839779005523	270	0.47202797202797203	361	0.4762532981530343	C	11.62	1.692440	0.30052	.	.	ENSG00000212124	ENST00000390673	T	0.32988	1.43	2.95	2.95	0.34219	.	0.303148	0.25189	U	0.032478	T	0.00012	0.0000	M	0.64676	1.99	0.09310	N	1	P	0.46912	0.886	P	0.46585	0.521	T	0.51521	-0.8695	10	0.52906	T	0.07	.	7.4146	0.27036	0.2594:0.7406:0.0:0.0	.	282	P59542	T2R19_HUMAN	R	282	ENSP00000375091:G282R	ENSP00000375091:G282R	G	-	1	0	TAS2R19	11065594	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	-0.166000	0.09954	1.662000	0.50781	0.405000	0.27470	GGA		0.428	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370080.1	NM_176888	
TAS2R31	259290	mdanderson.org	37	12	11183797	11183797	+	Silent	SNP	C	C	T			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:11183797C>T	ENST00000390675.2	-	1	209	c.138G>A	c.(136-138)caG>caA	p.Q46Q	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	46					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						CAGTGAGAATCTGGTCAGCAA	0.378																																						.											0																																										SO:0001819	synonymous_variant	259290			AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.138G>A	12.37:g.11183797C>T			P59547|Q17R84|Q645X5	Silent	SNP	ENST00000390675.2	37	CCDS53747.1																																																																																				0.378	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
TEKT4	150483	mdanderson.org	37	2	95539855	95539855	+	Splice_Site	SNP	T	T	G	rs201662522	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr2:95539855T>G	ENST00000295201.4	+	3	850		c.e3+2		AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4						cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCAAGAGAGGTGGGCCCCAGC	0.682																																						.											0													56.0	54.0	55.0					2																	95539855		2203	4300	6503	SO:0001630	splice_region_variant	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.713+2T>G	2.37:g.95539855T>G				Splice_Site	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	13.70	2.316724	0.40996	.	.	ENSG00000163060	ENST00000295201	.	.	.	2.24	2.24	0.28232	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0143	0.30372	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TEKT4	94903582	1.000000	0.71417	0.603000	0.28903	0.057000	0.15508	4.740000	0.62087	0.779000	0.33543	0.254000	0.18369	.		0.682	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	Intron
TMEM259	91304	mdanderson.org	37	19	1010406	1010406	+	Silent	SNP	G	G	A	rs62131162	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:1010406G>A	ENST00000356663.3	-	11	1927	c.1806C>T	c.(1804-1806)ggC>ggT	p.G602G	TMEM259_ENST00000333175.5_3'UTR	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	602						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											GGCTAGGCCCGCCTACCGCAG	0.741													N|||	505	0.100839	0.1278	0.098	5008	,	,		11980	0.001		0.1322	False		,,,				2504	0.137					.											0									,	328,3510		20,288,1611	3.0	4.0	4.0		1806,	-2.6	0.0	19	dbSNP_129	4	874,6922		40,794,3064	no	coding-synonymous,utr-3	C19orf6	NM_001033026.1,NM_033420.3	,	60,1082,4675	AA,AG,GG		11.2109,8.5461,10.3318	,	602/621,	1010406	1202,10432	1919	3898	5817	SO:0001819	synonymous_variant	91304			BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.1806C>T	19.37:g.1010406G>A			O60392|Q8NF79|Q96H30	Silent	SNP	ENST00000356663.3	37	CCDS32862.1																																																																																				0.741	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458236.1	NM_033420	
UBXN11	91544	mdanderson.org	37	1	26608828	26608828	+	Missense_Mutation	SNP	G	G	A	rs66614970|rs1134584	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr1:26608828G>A	ENST00000374222.1	-	16	1989	c.1525C>T	c.(1525-1527)Ccc>Tcc	p.P509S	UBXN11_ENST00000374217.2_Missense_Mutation_p.P476S|UBXN11_ENST00000374223.1_Missense_Mutation_p.P266S|UBXN11_ENST00000314675.7_Missense_Mutation_p.P389S|UBXN11_ENST00000374221.3_Missense_Mutation_p.P509S|UBXN11_ENST00000357089.4_Missense_Mutation_p.P476S			Q5T124	UBX11_HUMAN	UBX domain protein 11	509	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		P -> S (in dbSNP:rs17838088). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2}.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						cagggactggggccgggaccg	0.716													-|||	1970	0.393371	0.3555	0.402	5008	,	,		9393	0.3095		0.6292	False		,,,				2504	0.2822					.											1	Deletion - In frame(1)	ovary(1)						G	SER/PRO,SER/PRO,SER/PRO	1653,1827		423,807,510	15.0	18.0	17.0		1525,1426,1165		0.1	1	dbSNP_86	17	5288,2624		1813,1662,481	yes	missense,missense,missense	UBXN11	NM_183008.2,NM_145345.2,NM_001077262.1	74,74,74	2236,2469,991	AA,AG,GG		33.1648,47.5,39.0713	,,	509/521,476/488,389/401	26608828	6941,4451	1740	3956	5696	SO:0001583	missense	91544			AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1525C>T	1.37:g.26608828G>A	ENSP00000363339:p.Pro509Ser		D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	816	0.37362637362637363	167	0.3394308943089431	127	0.35082872928176795	149	0.26048951048951047	373	0.4920844327176781	-	0.571	-0.841059	0.02692	0.475	0.668352	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.22945	2.0;1.93;1.95;2.0;2.0;1.95	.	.	.	.	0.324999	0.15808	U	0.243645	T	0.00012	0.0000	N	0.24115	0.695	0.54753	P	1.4999999999987246E-5	.	.	.	.	.	.	T	0.23261	-1.0193	5	0.36615	T	0.2	.	.	.	.	rs3196815	476;389;509	Q5T124-2;Q5T124-3;Q5T124	.;.;UBX11_HUMAN	S	389;266;476;509;509;476	ENSP00000324721:P389S;ENSP00000363340:P266S;ENSP00000349601:P476S;ENSP00000363338:P509S;ENSP00000363339:P509S;ENSP00000363334:P476S	ENSP00000324721:P389S	P	-	1	0	UBXN11	26481415	0.000000	0.05858	0.140000	0.22221	0.152000	0.21847	-0.877000	0.04197	0.064000	0.16427	0.064000	0.15345	CCC		0.716	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
ZNF628	89887	mdanderson.org	37	19	55994240	55994240	+	Silent	SNP	C	C	T	rs12981044	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr19:55994240C>T	ENST00000598519.1	+	3	2233	c.1680C>T	c.(1678-1680)caC>caT	p.H560H	ZNF628_ENST00000391718.2_Silent_p.H556H|NAT14_ENST00000591590.1_5'Flank|NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000205194.4_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	560					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		GCCACGTGCACACTGGCGAGA	0.716													N|||	2845	0.568091	0.6717	0.536	5008	,	,		12336	0.4375		0.5368	False		,,,				2504	0.6176					.											0										2855,1543		931,993,275	22.0	23.0	23.0		1668	3.1	1.0	19	dbSNP_121	23	4867,3723		1367,2133,795	no	coding-synonymous	ZNF628	NM_033113.2		2298,3126,1070	TT,TC,CC		43.3411,35.0841,40.5451		556/1056	55994240	7722,5266	2199	4295	6494	SO:0001819	synonymous_variant	89887			AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.1680C>T	19.37:g.55994240C>T			Q86X34	Silent	SNP	ENST00000598519.1	37	CCDS33116.3																																																																																				0.716	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
PTEN	5728	bcgsc.ca	37	10	89720713	89720713	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr10:89720713delA	ENST00000371953.3	+	8	2221	c.864delA	c.(862-864)gaafs	p.E288fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	288	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.E288fs*8(1)|p.S287fs*8(1)|p.W274_F341del(1)|p.S287fs*1(1)|p.E288fs*3(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAACCTCAGAAAAAGTAGAAA	0.308		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	54	Whole gene deletion(37)|Deletion - Frameshift(13)|Deletion - In frame(2)|Unknown(2)	prostate(16)|central_nervous_system(12)|skin(6)|endometrium(4)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)											57.0	61.0	60.0					10																	89720713		2202	4296	6498	SO:0001589	frameshift_variant	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.864delA	10.37:g.89720713delA	ENSP00000361021:p.Glu288fs		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																				0.308	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
ZNF215	7762	bcgsc.ca	37	11	6977554	6977554	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr11:6977554A>G	ENST00000278319.5	+	7	1934	c.1346A>G	c.(1345-1347)gAc>gGc	p.D449G	ZNF215_ENST00000414517.2_Missense_Mutation_p.D449G|ZNF215_ENST00000529903.1_Intron	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	449					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		AAAAGTGAAGACAGTAATAAT	0.393																																						.											0													88.0	89.0	89.0					11																	6977554		2201	4296	6497	SO:0001583	missense	7762			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1346A>G	11.37:g.6977554A>G	ENSP00000278319:p.Asp449Gly		Q96C84	Missense_Mutation	SNP	ENST00000278319.5	37	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	A	0.179	-1.063752	0.01934	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.06142	3.34;3.34	4.75	3.6	0.41247	.	0.322331	0.22564	N	0.058429	T	0.05181	0.0138	N	0.20881	0.62	0.46241	D	0.99894	P	0.46395	0.877	B	0.40636	0.335	T	0.42699	-0.9436	10	0.87932	D	0	-4.2538	9.1926	0.37209	0.8374:0.0:0.0:0.1626	.	449	Q9UL58	ZN215_HUMAN	G	449	ENSP00000278319:D449G;ENSP00000393202:D449G	ENSP00000278319:D449G	D	+	2	0	ZNF215	6934130	0.000000	0.05858	0.041000	0.18516	0.009000	0.06853	-1.036000	0.03560	0.922000	0.37019	0.477000	0.44152	GAC		0.393	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1		
IPO8	10526	bcgsc.ca	37	12	30787155	30787155	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr12:30787155T>C	ENST00000256079.4	-	23	3099	c.2761A>G	c.(2761-2763)Aga>Gga	p.R921G	IPO8_ENST00000544829.1_Missense_Mutation_p.R716G	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	921					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCTTCACCTCTTCCATTATTT	0.408																																						.											0													251.0	199.0	217.0					12																	30787155		2203	4300	6503	SO:0001583	missense	10526			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2761A>G	12.37:g.30787155T>C	ENSP00000256079:p.Arg921Gly		B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	T	7.327	0.618242	0.14129	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.45276	1.91;0.9	5.1	-4.0	0.04057	Armadillo-type fold (1);	0.499991	0.22314	N	0.061686	T	0.13329	0.0323	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.25813	-1.0121	10	0.25106	T	0.35	-13.0789	9.4985	0.39004	0.0:0.1284:0.7165:0.1551	.	716;397;921	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	G	921;397;716	ENSP00000256079:R921G;ENSP00000444520:R716G	ENSP00000256079:R921G	R	-	1	2	IPO8	30678422	0.015000	0.18098	0.004000	0.12327	0.330000	0.28571	1.089000	0.30890	-0.435000	0.07264	0.533000	0.62120	AGA		0.408	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
ARGFX	503582	bcgsc.ca	37	3	121304933	121304933	+	Missense_Mutation	SNP	G	G	A	rs9813391	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr3:121304933G>A	ENST00000334384.3	+	4	444	c.434G>A	c.(433-435)cGa>cAa	p.R145Q		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	145			R -> Q (in dbSNP:rs9813391).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		GCAAAGCAACGAAACCAGATC	0.502													G|||	857	0.171126	0.1127	0.4438	5008	,	,		19879	0.0506		0.2545	False		,,,				2504	0.0951					.											0								G	GLN/ARG	613,3793	263.1+/-265.3	38,537,1628	123.0	113.0	116.0		434	-0.9	0.0	3	dbSNP_119	116	2371,6229	390.0+/-343.1	324,1723,2253	yes	missense	ARGFX	NM_001012659.1	43	362,2260,3881	AA,AG,GG		27.5698,13.9128,22.9433	benign	145/316	121304933	2984,10022	2203	4300	6503	SO:0001583	missense	503582				CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.434G>A	3.37:g.121304933G>A	ENSP00000335578:p.Arg145Gln			Missense_Mutation	SNP	ENST00000334384.3	37	CCDS33834.1	440	0.20146520146520147	64	0.13008130081300814	142	0.39226519337016574	30	0.05244755244755245	204	0.2691292875989446	G	0.150	-1.091973	0.01858	0.139128	0.275698	ENSG00000186103	ENST00000334384	D	0.88354	-2.37	3.32	-0.937	0.10415	.	1.246050	0.06010	N	0.649304	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.16396	0.017	B	0.04013	0.001	T	0.04165	-1.0972	9	0.10111	T	0.7	-0.0198	2.7093	0.05170	0.1684:0.3796:0.344:0.108	rs9813391;rs17741793;rs52830852;rs9813391	145	A6NJG6	ARGFX_HUMAN	Q	145	ENSP00000335578:R145Q	ENSP00000335578:R145Q	R	+	2	0	ARGFX	122787623	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.293000	0.08320	-0.190000	0.10465	-0.270000	0.10280	CGA		0.502	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659	
SLC26A8	116369	bcgsc.ca	37	6	35918965	35918965	+	Missense_Mutation	SNP	C	C	T	rs116200048|rs35886585	byFrequency	TCGA-KO-8415-01A-11D-2310-10	TCGA-KO-8415-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ebde5c33-4b0f-4c3d-bf45-52b2d54093ec	6ae02049-78de-46c7-af90-146bd04cb94e	g.chr6:35918965C>T	ENST00000490799.1	-	19	2800	c.2447G>A	c.(2446-2448)cGg>cAg	p.R816Q	SLC26A8_ENST00000394602.2_Missense_Mutation_p.R711Q|SLC26A8_ENST00000355574.2_Missense_Mutation_p.R816Q	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						GTAGGTTTCCCGTATCACTGT	0.542													C|||	10	0.00199681	0.0	0.0043	5008	,	,		16596	0.0		0.007	False		,,,				2504	0.0					.											0								C	GLN/ARG,GLN/ARG,GLN/ARG	7,4399	12.9+/-30.5	0,7,2196	140.0	119.0	126.0		2447,2447,2132	1.3	1.0	6	dbSNP_132	126	93,8507	51.9+/-112.3	1,91,4208	yes	missense,missense,missense	SLC26A8	NM_001193476.1,NM_052961.3,NM_138718.2	43,43,43	1,98,6404	TT,TC,CC		1.0814,0.1589,0.7689	benign,benign,benign	816/971,816/971,711/866	35918965	100,12906	2203	4300	6503	SO:0001583	missense	116369			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.2447G>A	6.37:g.35918965C>T	ENSP00000417638:p.Arg816Gln			Missense_Mutation	SNP	ENST00000490799.1	37	CCDS4813.1	4	0.0018315018315018315	0	0.0	2	0.0055248618784530384	0	0.0	2	0.002638522427440633	C	4.362	0.066653	0.08388	0.001589	0.010814	ENSG00000112053	ENST00000490799;ENST00000394602;ENST00000355574	D;D;D	0.94457	-3.13;-3.43;-3.13	5.42	1.33	0.21861	.	0.337736	0.25810	N	0.028143	T	0.56688	0.2002	N	0.01048	-1.04	0.26909	N	0.966934	B;B;B	0.12013	0.003;0.005;0.005	B;B;B	0.06405	0.001;0.001;0.002	T	0.62248	-0.6894	10	0.02654	T	1	.	7.521	0.27629	0.0:0.2612:0.0:0.7388	.	816;711;398	Q96RN1;Q96RN1-2;Q96RN1-3	S26A8_HUMAN;.;.	Q	816;711;816	ENSP00000417638:R816Q;ENSP00000378100:R711Q;ENSP00000347778:R816Q	ENSP00000347778:R816Q	R	-	2	0	SLC26A8	36026943	0.997000	0.39634	0.999000	0.59377	0.902000	0.53008	0.352000	0.20113	0.084000	0.17077	-0.290000	0.09829	CGG		0.542	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		
