#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CTTNBP2NL	55917	hgsc.bcm.edu	37	1	112999075	112999075	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:112999075A>G	ENST00000271277.6	+	6	1186	c.961A>G	c.(961-963)Aga>Gga	p.R321G		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	321					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCAGCAGAAAGAACCCATGG	0.483																																					p.R321G		Atlas-SNP	.											.	CTTNBP2NL	65	.	0			c.A961G						PASS	.						136.0	140.0	138.0					1																	112999075		2203	4300	6503	SO:0001583	missense	55917	exon6			GCAGAAAGAACCC	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.961A>G	chr1.hg19:g.112999075A>G	ENSP00000271277:p.Arg321Gly	145.0	0.0	.		118.0	20.0	.	NM_018704	B3KMS5|Q96B40	Missense_Mutation	SNP	ENST00000271277.6	hg19	CCDS845.1	.	.	.	.	.	.	.	.	.	.	A	2.835	-0.241767	0.05906	.	.	ENSG00000143079	ENST00000271277	T	0.22945	1.93	5.88	4.73	0.59995	.	0.247257	0.38778	N	0.001578	T	0.08714	0.0216	L	0.44542	1.39	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.22208	-1.0223	10	0.22109	T	0.4	-12.5708	12.215	0.54402	0.8572:0.1428:0.0:0.0	.	321	Q9P2B4	CT2NL_HUMAN	G	321	ENSP00000271277:R321G	ENSP00000271277:R321G	R	+	1	2	CTTNBP2NL	112800598	0.600000	0.26899	0.921000	0.36526	0.055000	0.15305	1.467000	0.35321	1.017000	0.39495	0.533000	0.62120	AGA	.	.	.	none		0.483	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704	
ANKRD35	148741	hgsc.bcm.edu	37	1	145561841	145561841	+	Missense_Mutation	SNP	G	G	A	rs201815402		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:145561841G>A	ENST00000355594.4	+	10	1616	c.1529G>A	c.(1528-1530)cGg>cAg	p.R510Q		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	510										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GATGCTGCCCGGGGGGCTTTG	0.632																																					p.R510Q	Melanoma(9;127 754 22988 51047)	Atlas-SNP	.											.	ANKRD35	96	.	0			c.G1529A						PASS	.						87.0	104.0	98.0					1																	145561841		2201	4300	6501	SO:0001583	missense	148741	exon10			CTGCCCGGGGGGC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1529G>A	chr1.hg19:g.145561841G>A	ENSP00000347802:p.Arg510Gln	115.0	0.0	.		96.0	11.0	.	NM_144698	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	hg19	CCDS919.1	.	.	.	.	.	.	.	.	.	.	g	13.79	2.341545	0.41498	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.67865	-0.29	5.23	4.31	0.51392	.	0.342769	0.20873	N	0.084127	T	0.46756	0.1409	M	0.70595	2.14	0.80722	D	1	B	0.32324	0.364	B	0.24006	0.05	T	0.51364	-0.8715	10	0.34782	T	0.22	-6.7716	11.0303	0.47769	0.0:0.0:0.8146:0.1853	.	510	Q8N283	ANR35_HUMAN	Q	419;510	ENSP00000347802:R510Q	ENSP00000347802:R510Q	R	+	2	0	ANKRD35	144273198	0.749000	0.28305	0.965000	0.40720	0.652000	0.38707	1.901000	0.39838	1.405000	0.46838	0.651000	0.88453	CGG	.	G|1.000;T|0.000	.	alt		0.632	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
DENND4B	9909	hgsc.bcm.edu	37	1	153907297	153907297	+	Silent	SNP	C	C	T	rs557071025|rs544489048	byFrequency	TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:153907297C>T	ENST00000361217.4	-	18	3130	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	904	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgtt	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		16455	0.0		0.0	False		,,,				2504	0.001				p.Q904Q		Atlas-SNP	.											DENND4B_ENST00000361217,NS,carcinoma,0,6	DENND4B	210	.	0			c.G2712A						PASS	.						28.0	36.0	33.0					1																	153907297		2179	4277	6456	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2712G>A	chr1.hg19:g.153907297C>T		39.0	0.0	.		38.0	12.0	.	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	hg19	CCDS44228.1																																																																																			.	.	.	none		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
ILDR2	387597	hgsc.bcm.edu	37	1	166890003	166890003	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:166890003C>T	ENST00000271417.3	-	9	1880	c.1825G>A	c.(1825-1827)Gac>Aac	p.D609N	ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000528703.1_Missense_Mutation_p.D550N|ILDR2_ENST00000526687.1_Missense_Mutation_p.D501N|ILDR2_ENST00000469934.2_Intron|ILDR2_ENST00000525740.1_Missense_Mutation_p.D482N|ILDR2_ENST00000529071.1_Missense_Mutation_p.D590N	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	609					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						TAGGGCAGGTCGCGGCCGCGG	0.687																																					p.D609N		Atlas-SNP	.											.	ILDR2	79	.	0			c.G1825A						PASS	.						6.0	9.0	8.0					1																	166890003		2076	4108	6184	SO:0001583	missense	387597	exon9			GCAGGTCGCGGCC	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1825G>A	chr1.hg19:g.166890003C>T	ENSP00000271417:p.Asp609Asn	36.0	0.0	.		31.0	7.0	.	NM_199351		Missense_Mutation	SNP	ENST00000271417.3	hg19	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069172	0.76301	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T	0.77750	0.5;-1.12;0.5;-1.12;-0.12	4.76	4.76	0.60689	.	3.853080	0.00892	N	0.002254	T	0.64638	0.2616	L	0.56769	1.78	0.35061	D	0.761595	P	0.49358	0.923	B	0.36030	0.216	T	0.57464	-0.7807	9	0.62326	D	0.03	.	12.8493	0.57848	0.1631:0.8369:0.0:0.0	.	609	Q71H61	ILDR2_HUMAN	N	609;482;590;501;550	ENSP00000271417:D609N;ENSP00000436120:D482N;ENSP00000436882:D590N;ENSP00000434273:D501N;ENSP00000432750:D550N	ENSP00000271417:D609N	D	-	1	0	ILDR2	165156627	1.000000	0.71417	0.997000	0.53966	0.735000	0.41995	4.789000	0.62446	2.171000	0.68590	0.561000	0.74099	GAC	.	.	.	none		0.687	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351	
TPR	7175	hgsc.bcm.edu	37	1	186316562	186316562	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:186316562A>G	ENST00000367478.4	-	22	3101	c.2805T>C	c.(2803-2805)gaT>gaC	p.D935D		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	935					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TCACAAGATCATCCACATCTT	0.368			T	NTRK1	papillary thyroid																																p.D935D		Atlas-SNP	.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	441	.	0			c.T2805C						PASS	.						213.0	200.0	204.0					1																	186316562		1964	4159	6123	SO:0001819	synonymous_variant	7175	exon22			AAGATCATCCACA	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2805T>C	chr1.hg19:g.186316562A>G		108.0	0.0	.		70.0	4.0	.	NM_003292	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	hg19	CCDS41446.1																																																																																			.	.	.	none		0.368	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
ASPM	259266	hgsc.bcm.edu	37	1	197072290	197072290	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr1:197072290A>G	ENST00000367409.4	-	18	6347	c.6091T>C	c.(6091-6093)Tat>Cat	p.Y2031H	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2031	IQ 14. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ATACCACGATAAGCTGACTGT	0.328																																					p.Y2031H		Atlas-SNP	.											.	ASPM	444	.	0			c.T6091C						PASS	.						94.0	99.0	97.0					1																	197072290		2203	4298	6501	SO:0001583	missense	259266	exon18			CACGATAAGCTGA	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6091T>C	chr1.hg19:g.197072290A>G	ENSP00000356379:p.Tyr2031His	155.0	0.0	.		100.0	17.0	.	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	hg19	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	a	19.52	3.842459	0.71488	.	.	ENSG00000066279	ENST00000367409	T	0.27557	1.66	5.6	4.46	0.54185	.	0.174809	0.40302	N	0.001123	T	0.59959	0.2232	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.63541	-0.6614	10	0.41790	T	0.15	.	11.3347	0.49496	0.8639:0.0:0.0:0.1361	.	2031	Q8IZT6	ASPM_HUMAN	H	2031	ENSP00000356379:Y2031H	ENSP00000356379:Y2031H	Y	-	1	0	ASPM	195338913	1.000000	0.71417	0.632000	0.29296	0.972000	0.66771	7.212000	0.77941	0.930000	0.37217	0.524000	0.50904	TAT	.	.	.	none		0.328	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
IFT172	26160	hgsc.bcm.edu	37	2	27702392	27702392	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:27702392T>A	ENST00000260570.3	-	10	1092	c.989A>T	c.(988-990)tAt>tTt	p.Y330F	IFT172_ENST00000359466.6_Missense_Mutation_p.Y330F|IFT172_ENST00000416524.2_Missense_Mutation_p.Y309F	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	330					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					AGGTCCCACATACGTCAACTC	0.507																																					p.Y330F		Atlas-SNP	.											.	IFT172	119	.	0			c.A989T						PASS	.						164.0	142.0	150.0					2																	27702392		2203	4300	6503	SO:0001583	missense	26160	exon10			CCCACATACGTCA	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.989A>T	chr2.hg19:g.27702392T>A	ENSP00000260570:p.Tyr330Phe	71.0	0.0	.		97.0	12.0	.	NM_015662	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	ENST00000260570.3	hg19	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.547345	0.65311	.	.	ENSG00000138002	ENST00000260570;ENST00000359466;ENST00000416524	T;T;T	0.23147	1.92;1.92;1.92	5.64	5.64	0.86602	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.30230	0.0758	M	0.64404	1.975	0.80722	D	1	B;P;B;B	0.35821	0.394;0.523;0.394;0.322	B;B;B;B	0.38378	0.228;0.272;0.144;0.2	T	0.04320	-1.0960	10	0.25106	T	0.35	-9.0488	14.6686	0.68926	0.0:0.0:0.0:1.0	.	330;330;330;330	A5PKZ0;Q9UG01-2;E7EP25;Q9UG01	.;.;.;IF172_HUMAN	F	330;330;309	ENSP00000260570:Y330F;ENSP00000352443:Y330F;ENSP00000407408:Y309F	ENSP00000260570:Y330F	Y	-	2	0	IFT172	27555896	1.000000	0.71417	0.988000	0.46212	0.937000	0.57800	7.558000	0.82253	2.138000	0.66242	0.533000	0.62120	TAT	.	.	.	none		0.507	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
TCF7L1	83439	hgsc.bcm.edu	37	2	85361150	85361150	+	Silent	SNP	C	C	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:85361150C>G	ENST00000282111.3	+	2	536	c.261C>G	c.(259-261)cgC>cgG	p.R87R		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	87					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CGGAGAGGCGCCCGCAGCCCG	0.697																																					p.R87R		Atlas-SNP	.											.	TCF7L1	44	.	0			c.C261G						PASS	.						19.0	25.0	23.0					2																	85361150		2200	4299	6499	SO:0001819	synonymous_variant	83439	exon2			GAGGCGCCCGCAG	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.261C>G	chr2.hg19:g.85361150C>G		90.0	0.0	.		117.0	19.0	.	NM_031283	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000282111.3	hg19	CCDS1971.1																																																																																			.	.	.	none		0.697	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
RNF103	7844	hgsc.bcm.edu	37	2	86832185	86832185	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:86832185A>G	ENST00000237455.4	-	4	1807	c.839T>C	c.(838-840)aTt>aCt	p.I280T	CHMP3_ENST00000439940.2_Intron|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000439077.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	280					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						ATATATGCCAATATCTGTCAT	0.353																																					p.I280T		Atlas-SNP	.											.	RNF103	58	.	0			c.T839C						PASS	.						45.0	48.0	47.0					2																	86832185		2203	4300	6503	SO:0001583	missense	7844	exon4			ATGCCAATATCTG	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.839T>C	chr2.hg19:g.86832185A>G	ENSP00000237455:p.Ile280Thr	133.0	0.0	.		133.0	8.0	.	NM_005667	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	ENST00000237455.4	hg19	CCDS33237.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.790231	0.31685	.	.	ENSG00000239305	ENST00000237455	T	0.48522	0.81	5.1	5.1	0.69264	.	0.052243	0.85682	D	0.000000	T	0.43033	0.1229	L	0.51422	1.61	0.53688	D	0.999973	B	0.20052	0.041	B	0.16289	0.015	T	0.28073	-1.0055	10	0.30078	T	0.28	-13.0155	14.881	0.70534	1.0:0.0:0.0:0.0	.	280	O00237	RN103_HUMAN	T	280	ENSP00000237455:I280T	ENSP00000237455:I280T	I	-	2	0	RNF103	86685696	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.953000	0.93041	1.937000	0.56155	0.377000	0.23210	ATT	.	.	.	none		0.353	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667	
MALL	7851	hgsc.bcm.edu	37	2	110873286	110873286	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:110873286G>A	ENST00000272462.2	-	1	857	c.84C>T	c.(82-84)ttC>ttT	p.F28F	MALL_ENST00000427178.1_Silent_p.F28F	NM_005434.4	NP_005425.1	Q13021	MALL_HUMAN	mal, T-cell differentiation protein-like	28	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cholesterol homeostasis (GO:0042632)	clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	9				Epithelial(1;0.0546)|STAD - Stomach adenocarcinoma(1;0.18)		GGAAGAAGGCGAAAGGGATGG	0.726																																					p.F28F		Atlas-SNP	.											.	MALL	14	.	0			c.C84T						PASS	.						21.0	22.0	21.0					2																	110873286		2184	4286	6470	SO:0001819	synonymous_variant	7851	exon1			GAAGGCGAAAGGG	U17077	CCDS2085.1	2q13	2008-02-05			ENSG00000144063	ENSG00000144063			6818	protein-coding gene	gene with protein product		602022				9326933	Standard	NM_005434		Approved	BENE	uc002tfk.3	Q13021	OTTHUMG00000131196	ENST00000272462.2:c.84C>T	chr2.hg19:g.110873286G>A		133.0	0.0	.		178.0	22.0	.	NM_005434	B3KWR6|Q9BTU0	Silent	SNP	ENST00000272462.2	hg19	CCDS2085.1																																																																																			.	.	.	none		0.726	MALL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253921.1	NM_005434	
SLC20A1	6574	hgsc.bcm.edu	37	2	113418053	113418053	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:113418053T>C	ENST00000272542.3	+	9	2236	c.1697T>C	c.(1696-1698)cTc>cCc	p.L566P		NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	566					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						TGGCTTCTACTCTATGGTGGT	0.458																																					p.L566P		Atlas-SNP	.											.	SLC20A1	59	.	0			c.T1697C						PASS	.						180.0	174.0	176.0					2																	113418053		2203	4300	6503	SO:0001583	missense	6574	exon9			TTCTACTCTATGG		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.1697T>C	chr2.hg19:g.113418053T>C	ENSP00000272542:p.Leu566Pro	211.0	0.0	.		176.0	29.0	.	NM_005415	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	hg19	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.570460	0.86542	.	.	ENSG00000144136	ENST00000272542	D	0.91996	-2.95	5.81	5.81	0.92471	.	0.062816	0.64402	D	0.000004	D	0.95191	0.8441	M	0.68593	2.085	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.992	D	0.95405	0.8493	10	0.66056	D	0.02	-33.1091	14.1127	0.65132	0.0:0.0:0.0:1.0	.	566;566	A7LNJ1;Q8WUM9	.;S20A1_HUMAN	P	566	ENSP00000272542:L566P	ENSP00000272542:L566P	L	+	2	0	SLC20A1	113134524	1.000000	0.71417	0.926000	0.36857	0.997000	0.91878	8.040000	0.89188	2.226000	0.72624	0.482000	0.46254	CTC	.	.	.	none		0.458	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
INHBB	3625	hgsc.bcm.edu	37	2	121106693	121106693	+	Missense_Mutation	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:121106693G>A	ENST00000295228.3	+	2	513	c.467G>A	c.(466-468)cGg>cAg	p.R156Q		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	156					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)	p.R156Q(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				GCCTCCTCCCGGGTCCGCCTA	0.557																																					p.R156Q		Atlas-SNP	.											INHBB,NS,adenocarcinoma,0,2	INHBB	29	.	1	Substitution - Missense(1)	large_intestine(1)	c.G467A						PASS	.						53.0	58.0	56.0					2																	121106693		2203	4300	6503	SO:0001583	missense	3625	exon2			CCTCCCGGGTCCG		CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.467G>A	chr2.hg19:g.121106693G>A	ENSP00000295228:p.Arg156Gln	133.0	0.0	.		96.0	5.0	.	NM_002193	Q53T31|Q8N1D3	Missense_Mutation	SNP	ENST00000295228.3	hg19	CCDS2132.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.497539	0.26861	.	.	ENSG00000163083	ENST00000295228	T	0.66995	-0.24	5.09	5.09	0.68999	Transforming growth factor-beta, N-terminal (1);	0.555848	0.17053	N	0.188863	T	0.53850	0.1822	L	0.31664	0.95	0.33909	D	0.639429	B	0.24823	0.112	B	0.26094	0.066	T	0.59316	-0.7477	10	0.30854	T	0.27	-3.725	11.2497	0.49017	0.0848:0.0:0.9151:0.0	.	156	P09529	INHBB_HUMAN	Q	156	ENSP00000295228:R156Q	ENSP00000295228:R156Q	R	+	2	0	INHBB	120823163	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.966000	0.70395	2.804000	0.96469	0.655000	0.94253	CGG	.	.	.	none		0.557	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254234.1		
EEF1B2	1933	hgsc.bcm.edu	37	2	207027278	207027278	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:207027278A>T	ENST00000392222.2	+	5	838	c.463A>T	c.(463-465)Atg>Ttg	p.M155L	NDUFS1_ENST00000233190.6_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.M155L|SNORA41_ENST00000384675.1_RNA|EEF1B2_ENST00000392221.1_Missense_Mutation_p.M155L|SNORD51_ENST00000384320.2_RNA	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	155					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						TGAGACAGATATGGCGAAATT	0.388																																					p.M155L		Atlas-SNP	.											.	EEF1B2	58	.	0			c.A463T						PASS	.						125.0	132.0	129.0					2																	207027278		2203	4300	6503	SO:0001583	missense	1933	exon6			ACAGATATGGCGA	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.463A>T	chr2.hg19:g.207027278A>T	ENSP00000376056:p.Met155Leu	206.0	0.0	.		209.0	28.0	.	NM_021121	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	hg19	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.990128	0.54041	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222	.	.	.	5.24	5.24	0.73138	Translation elongation factor EF1B/ribosomal protein S6 (1);Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange (3);	0.071117	0.85682	D	0.000000	T	0.54902	0.1887	L	0.39245	1.2	0.80722	D	1	B	0.02656	0.0	B	0.20384	0.029	T	0.50651	-0.8803	9	0.33940	T	0.23	-16.9302	15.1403	0.72607	1.0:0.0:0.0:0.0	.	155	P24534	EF1B_HUMAN	L	155	.	ENSP00000236957:M155L	M	+	1	0	EEF1B2	206735523	1.000000	0.71417	0.994000	0.49952	0.958000	0.62258	9.237000	0.95368	1.984000	0.57885	0.533000	0.62120	ATG	.	.	.	none		0.388	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
RAB17	64284	hgsc.bcm.edu	37	2	238494741	238494741	+	Silent	SNP	C	C	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:238494741C>A	ENST00000264601.3	-	2	686	c.57G>T	c.(55-57)gtG>gtT	p.V19V	RAB17_ENST00000538644.1_5'UTR|RAB17_ENST00000409576.1_Intron|RAB17_ENST00000409822.1_Intron|RAB17_ENST00000416106.1_5'UTR	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	19			V -> A (in dbSNP:rs3751112). {ECO:0000269|Ref.3}.		cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		CCAGCTTGAACACACGGGGCT	0.597																																					p.V19V	Colon(56;987 1029 6466 13943 27336)	Atlas-SNP	.											.	RAB17	17	.	0			c.G57T						PASS	.						57.0	57.0	57.0					2																	238494741		2203	4300	6503	SO:0001819	synonymous_variant	64284	exon2			CTTGAACACACGG	AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.57G>T	chr2.hg19:g.238494741C>A		116.0	0.0	.		120.0	18.0	.	NM_022449	Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	Silent	SNP	ENST00000264601.3	hg19	CCDS2520.1	.	.	.	.	.	.	.	.	.	.	C	6.279	0.419620	0.11928	.	.	ENSG00000124839	ENST00000430445	.	.	.	4.69	-3.2	0.05156	.	.	.	.	.	T	0.49029	0.1533	.	.	.	0.58432	D	0.999991	.	.	.	.	.	.	T	0.40515	-0.9559	4	.	.	.	-6.0609	5.8207	0.18526	0.0869:0.4881:0.2678:0.1572	.	.	.	.	F	1	.	.	C	-	2	0	RAB17	238159480	0.001000	0.12720	0.004000	0.12327	0.070000	0.16714	-0.140000	0.10342	-0.948000	0.03668	-1.094000	0.02160	TGT	.	.	.	none		0.597	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257084.2		
SLC6A6	6533	hgsc.bcm.edu	37	3	14508107	14508107	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr3:14508107A>G	ENST00000454876.2	+	7	1145	c.816A>G	c.(814-816)gcA>gcG	p.A272A	SLC6A6_ENST00000360861.3_Silent_p.A272A			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	272				A -> R (in Ref. 1; CAA79481). {ECO:0000305}.	amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						GCGCGGGCGCAGGCATCAAGT	0.632																																					p.A272A		Atlas-SNP	.											.	SLC6A6	58	.	0			c.A816G						PASS	.						80.0	70.0	73.0					3																	14508107		2203	4300	6503	SO:0001819	synonymous_variant	6533	exon7			GGGCGCAGGCATC		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.816A>G	chr3.hg19:g.14508107A>G		60.0	0.0	.		64.0	9.0	.	NM_003043	B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	ENST00000454876.2	hg19	CCDS33705.1																																																																																			.	.	.	none		0.632	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	
TMEM115	11070	hgsc.bcm.edu	37	3	50396218	50396218	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr3:50396218A>G	ENST00000266025.3	-	1	823	c.277T>C	c.(277-279)Tgg>Cgg	p.W93R	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	93					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AAGGCCCCCCAGAGGGGCTCC	0.622																																					p.W93R		Atlas-SNP	.											.	TMEM115	20	.	0			c.T277C						PASS	.						55.0	68.0	64.0					3																	50396218		2203	4300	6503	SO:0001583	missense	11070	exon1			CCCCCCAGAGGGG	BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.277T>C	chr3.hg19:g.50396218A>G	ENSP00000266025:p.Trp93Arg	89.0	0.0	.		86.0	12.0	.	NM_007024	A2IDB7|O14568|Q6IAY4|Q9UIX3	Missense_Mutation	SNP	ENST00000266025.3	hg19	CCDS2828.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.371161	0.82573	.	.	ENSG00000126062	ENST00000266025	T	0.11712	2.75	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.46555	-0.9183	10	0.87932	D	0	.	14.4388	0.67301	1.0:0.0:0.0:0.0	.	93	Q12893	TM115_HUMAN	R	93	ENSP00000266025:W93R	ENSP00000266025:W93R	W	-	1	0	TMEM115	50371222	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.943000	0.92975	2.110000	0.64415	0.460000	0.39030	TGG	.	.	.	none		0.622	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102784.3	NM_007024	
P2RY1	5028	hgsc.bcm.edu	37	3	152554007	152554007	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr3:152554007A>G	ENST00000305097.3	+	1	1272	c.436A>G	c.(436-438)Agt>Ggt	p.S146G		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	146					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			GACATGCATCAGTGCCCACCG	0.507																																					p.S146G		Atlas-SNP	.											.	P2RY1	49	.	0			c.A436G						PASS	.						91.0	79.0	83.0					3																	152554007		2203	4300	6503	SO:0001583	missense	5028	exon1			TGCATCAGTGCCC	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.436A>G	chr3.hg19:g.152554007A>G	ENSP00000304767:p.Ser146Gly	82.0	0.0	.		90.0	5.0	.	NM_002563		Missense_Mutation	SNP	ENST00000305097.3	hg19	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164790	0.78339	.	.	ENSG00000169860	ENST00000305097	T	0.80994	-1.44	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.90844	0.7124	M	0.92122	3.275	0.58432	D	0.999999	D	0.63046	0.992	P	0.60012	0.867	D	0.92885	0.6326	10	0.72032	D	0.01	.	15.2728	0.73717	1.0:0.0:0.0:0.0	.	146	P47900	P2RY1_HUMAN	G	146	ENSP00000304767:S146G	ENSP00000304767:S146G	S	+	1	0	P2RY1	154036697	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	9.210000	0.95106	2.186000	0.69663	0.533000	0.62120	AGT	.	.	.	none		0.507	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
FGFR3	2261	hgsc.bcm.edu	37	4	1807653	1807653	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr4:1807653T>A	ENST00000260795.2	+	12	1924	c.1822T>A	c.(1822-1824)Ttg>Atg	p.L608M	FGFR3_ENST00000481110.2_Missense_Mutation_p.L609M|FGFR3_ENST00000412135.2_Missense_Mutation_p.L496M|FGFR3_ENST00000352904.1_Missense_Mutation_p.L496M|FGFR3_ENST00000340107.4_Missense_Mutation_p.L610M|FGFR3_ENST00000440486.2_Missense_Mutation_p.L608M			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	608	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CATGGAGTACTTGGCCTCCCA	0.662		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.L610M		Atlas-SNP	.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3	3320	.	0			c.T1828A						PASS	.						39.0	47.0	44.0					4																	1807653		2203	4299	6502	SO:0001583	missense	2261	exon13	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GAGTACTTGGCCT	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1822T>A	chr4.hg19:g.1807653T>A	ENSP00000260795:p.Leu608Met	57.0	0.0	.		55.0	17.0	.	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	hg19	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	c	11.98	1.799537	0.31869	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904	D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	4.18	1.33	0.21861	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.95586	0.8565	M	0.86805	2.84	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.998;0.991	D	0.94568	0.7768	10	0.87932	D	0	.	10.2771	0.43517	0.0:0.681:0.0:0.319	.	610;496;608;609	P22607-2;P22607-3;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	M	609;610;608;496;608;496	ENSP00000420533:L609M;ENSP00000339824:L610M;ENSP00000414914:L608M;ENSP00000412903:L496M;ENSP00000260795:L608M;ENSP00000231803:L496M	ENSP00000260795:L608M	L	+	1	2	FGFR3	1777451	0.995000	0.38212	0.995000	0.50966	0.390000	0.30446	0.568000	0.23623	0.311000	0.23014	-1.193000	0.01689	TTG	.	.	.	none		0.662	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
SLC4A4	8671	hgsc.bcm.edu	37	4	72413388	72413388	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr4:72413388T>C	ENST00000264485.5	+	20	2762	c.2645T>C	c.(2644-2646)cTt>cCt	p.L882P	SLC4A4_ENST00000351898.6_Intron|SLC4A4_ENST00000340595.3_Missense_Mutation_p.L838P|SLC4A4_ENST00000425175.1_Missense_Mutation_p.L882P	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	882					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	ACTGGAACCCTTGTGTTTATT	0.373																																					p.L882P		Atlas-SNP	.											.	SLC4A4	269	.	0			c.T2645C						PASS	.						217.0	212.0	214.0					4																	72413388		2203	4300	6503	SO:0001583	missense	8671	exon20			GAACCCTTGTGTT	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2645T>C	chr4.hg19:g.72413388T>C	ENSP00000264485:p.Leu882Pro	109.0	0.0	.		82.0	7.0	.	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	hg19	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277920	0.80692	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000340595	D;D;D	0.82167	-1.58;-1.58;-1.58	5.81	5.81	0.92471	Bicarbonate transporter, C-terminal (1);	0.329506	0.33980	N	0.004364	D	0.87661	0.6233	M	0.80183	2.485	0.80722	D	1	P;P;B	0.40230	0.708;0.481;0.242	P;B;B	0.46208	0.507;0.419;0.427	D	0.89124	0.3505	10	0.87932	D	0	.	16.167	0.81768	0.0:0.0:0.0:1.0	.	882;838;882	A5JJ20;Q9Y6R1-2;Q9Y6R1	.;.;S4A4_HUMAN	P	882;882;838	ENSP00000264485:L882P;ENSP00000393557:L882P;ENSP00000344272:L838P	ENSP00000264485:L882P	L	+	2	0	SLC4A4	72632252	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.184000	0.72008	2.210000	0.71456	0.533000	0.62120	CTT	.	.	.	none		0.373	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
ISL1	3670	hgsc.bcm.edu	37	5	50680410	50680410	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:50680410A>G	ENST00000230658.7	+	2	649	c.64A>G	c.(64-66)Aat>Gat	p.N22D	ISL1_ENST00000511384.1_Missense_Mutation_p.N22D|CTD-2314G24.2_ENST00000559112.2_RNA	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	22	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				TGGTTGCGGCAATCAGATTCA	0.393																																					p.N22D		Atlas-SNP	.											.	ISL1	65	.	0			c.A64G						PASS	.						141.0	131.0	134.0					5																	50680410		1856	4100	5956	SO:0001583	missense	3670	exon2			TGCGGCAATCAGA	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.64A>G	chr5.hg19:g.50680410A>G	ENSP00000230658:p.Asn22Asp	189.0	0.0	.		173.0	47.0	.	NM_002202	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	hg19	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.682347	0.47991	.	.	ENSG00000016082	ENST00000230658;ENST00000503187;ENST00000511384	D;D	0.87029	-2.2;-2.2	6.16	6.16	0.99307	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	T	0.79040	0.4379	N	0.13098	0.295	0.58432	D	0.999993	P	0.36183	0.542	B	0.36030	0.216	T	0.78427	-0.2208	10	0.31617	T	0.26	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	22	P61371	ISL1_HUMAN	D	22	ENSP00000230658:N22D;ENSP00000422676:N22D	ENSP00000230658:N22D	N	+	1	0	ISL1	50716167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.543000	0.82106	2.367000	0.80283	0.528000	0.53228	AAT	.	.	.	none		0.393	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
SEC24A	10802	hgsc.bcm.edu	37	5	134060676	134060676	+	Missense_Mutation	SNP	G	G	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:134060676G>C	ENST00000398844.2	+	23	3462	c.3174G>C	c.(3172-3174)gaG>gaC	p.E1058D		NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	1058					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAAGGGATGAGAGTCCAATGA	0.323																																					p.E1058D		Atlas-SNP	.											.	SEC24A	77	.	0			c.G3174C						PASS	.						60.0	56.0	57.0					5																	134060676		1806	4068	5874	SO:0001583	missense	10802	exon23			GGATGAGAGTCCA	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.3174G>C	chr5.hg19:g.134060676G>C	ENSP00000381823:p.Glu1058Asp	409.0	0.0	.		404.0	43.0	.	NM_021982	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	hg19	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	G	7.791	0.711484	0.15239	.	.	ENSG00000113615	ENST00000398844	T	0.28666	1.6	5.68	5.68	0.88126	.	0.045285	0.85682	D	0.000000	T	0.11623	0.0283	N	0.04260	-0.245	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29731	-1.0002	10	0.10902	T	0.67	-12.469	5.5239	0.16947	0.1812:0.1697:0.6491:0.0	.	822;1058	B4E205;O95486	.;SC24A_HUMAN	D	1058	ENSP00000381823:E1058D	ENSP00000381823:E1058D	E	+	3	2	SEC24A	134088575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.734000	0.26101	2.691000	0.91804	0.650000	0.86243	GAG	.	.	.	none		0.323	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
HNRNPA0	10949	hgsc.bcm.edu	37	5	137088931	137088931	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:137088931G>A	ENST00000314940.4	-	1	1108	c.825C>T	c.(823-825)ggC>ggT	p.G275G		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	275	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)	p.G275G(1)		large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			Tgcctccaccgccgccgccgc	0.632																																					p.G275G		Atlas-SNP	.											HNRNPA0,colon,carcinoma,0,1	HNRNPA0	17	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C825T						PASS	.						9.0	13.0	11.0					5																	137088931		1925	3891	5816	SO:0001819	synonymous_variant	10949	exon1			TCCACCGCCGCCG	U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.825C>T	chr5.hg19:g.137088931G>A		70.0	1.0	.		85.0	7.0	.	NM_006805	Q6IB18	Silent	SNP	ENST00000314940.4	hg19	CCDS4193.1																																																																																			.	.	.	none		0.632	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251221.1	NM_006805	
CREBRF	153222	hgsc.bcm.edu	37	5	172518246	172518246	+	Missense_Mutation	SNP	A	A	T	rs374100928		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr5:172518246A>T	ENST00000296953.2	+	4	1383	c.1064A>T	c.(1063-1065)gAa>gTa	p.E355V	CREBRF_ENST00000540014.1_Missense_Mutation_p.E355V|CREBRF_ENST00000520420.1_Missense_Mutation_p.E355V|CREBRF_ENST00000522692.1_Missense_Mutation_p.E355V	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	355	Glu-rich.				negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGCAGTCCtgaagaagatgag	0.443																																					p.E355V		Atlas-SNP	.											.	.	.	.	0			c.A1064T						PASS	.						63.0	50.0	54.0					5																	172518246		2203	4300	6503	SO:0001583	missense	153222	exon4			GTCCTGAAGAAGA	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1064A>T	chr5.hg19:g.172518246A>T	ENSP00000296953:p.Glu355Val	190.0	0.0	.		169.0	32.0	.	NM_153607	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	ENST00000296953.2	hg19	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.323089	0.60634	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000538538;ENST00000393776	T;T;T;T	0.70749	-0.51;2.19;2.19;-0.51	5.52	5.52	0.82312	.	0.433677	0.23268	N	0.050045	T	0.75525	0.3861	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.991;0.996	T	0.78703	-0.2101	10	0.66056	D	0.02	.	15.3153	0.74069	1.0:0.0:0.0:0.0	.	355;355	Q8IUR6;Q8IUR6-2	CE041_HUMAN;.	V	355	ENSP00000431107:E355V;ENSP00000296953:E355V;ENSP00000440075:E355V;ENSP00000428290:E355V	ENSP00000296953:E355V	E	+	2	0	C5orf41	172450852	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.297000	0.72757	2.103000	0.63969	0.533000	0.62120	GAA	.	.	.	none		0.443	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607	
HIVEP2	3097	hgsc.bcm.edu	37	6	143090738	143090738	+	Missense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr6:143090738G>T	ENST00000367604.1	-	4	5777	c.5138C>A	c.(5137-5139)cCt>cAt	p.P1713H	HIVEP2_ENST00000012134.2_Missense_Mutation_p.P1713H|HIVEP2_ENST00000367603.2_Missense_Mutation_p.P1713H			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1713					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCCGGTTCCAGGCCTATGCAT	0.433																																					p.P1713H	Esophageal Squamous(107;843 1510 13293 16805 42198)	Atlas-SNP	.											.	HIVEP2	225	.	0			c.C5138A						PASS	.						118.0	109.0	112.0					6																	143090738		1861	4116	5977	SO:0001583	missense	3097	exon5			GTTCCAGGCCTAT	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.5138C>A	chr6.hg19:g.143090738G>T	ENSP00000356576:p.Pro1713His	133.0	0.0	.		93.0	17.0	.	NM_006734	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	hg19	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231189	0.58777	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02863	4.13;4.13;4.13	5.95	4.11	0.48088	.	0.192613	0.56097	D	0.000024	T	0.04907	0.0132	M	0.72894	2.215	0.47407	D	0.999417	D	0.67145	0.996	P	0.58013	0.831	T	0.10019	-1.0648	10	0.87932	D	0	-17.5678	8.3283	0.32171	0.135:0.1282:0.7368:0.0	.	1713	P31629	ZEP2_HUMAN	H	1713	ENSP00000356576:P1713H;ENSP00000356575:P1713H;ENSP00000012134:P1713H	ENSP00000012134:P1713H	P	-	2	0	HIVEP2	143132431	1.000000	0.71417	0.975000	0.42487	0.991000	0.79684	6.728000	0.74769	1.514000	0.48869	0.655000	0.94253	CCT	.	.	.	none		0.433	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
EIF2AK1	27102	hgsc.bcm.edu	37	7	6084205	6084205	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr7:6084205T>G	ENST00000199389.6	-	7	864	c.718A>C	c.(718-720)Att>Ctt	p.I240L	EIF2AK1_ENST00000495565.1_5'UTR|EIF2AK1_ENST00000536084.1_Missense_Mutation_p.I116L	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		CGTGGCTGAATCACATGAACA	0.468																																					p.I240L		Atlas-SNP	.											.	EIF2AK1	76	.	0			c.A718C						PASS	.						99.0	79.0	86.0					7																	6084205		2203	4300	6503	SO:0001583	missense	27102	exon7			GCTGAATCACATG	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.718A>C	chr7.hg19:g.6084205T>G	ENSP00000199389:p.Ile240Leu	31.0	0.0	.		41.0	6.0	.	NM_001134335	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	ENST00000199389.6	hg19	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	.	1.012	-0.687440	0.03328	.	.	ENSG00000086232	ENST00000199389;ENST00000536084	T;T	0.14144	2.53;2.53	5.2	2.36	0.29203	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.526065	0.21443	N	0.074457	T	0.06826	0.0174	N	0.17723	0.515	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.006;0.002;0.002	T	0.42932	-0.9422	10	0.11485	T	0.65	-0.4159	5.4401	0.16504	0.0:0.4964:0.2696:0.234	.	116;240;240	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	L	240;116	ENSP00000199389:I240L;ENSP00000445784:I116L	ENSP00000199389:I240L	I	-	1	0	EIF2AK1	6050731	0.000000	0.05858	0.062000	0.19696	0.277000	0.26821	-0.787000	0.04618	0.180000	0.19960	-0.248000	0.11899	ATT	.	.	.	none		0.468	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
CLCN1	1180	hgsc.bcm.edu	37	7	143049049	143049049	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr7:143049049G>A	ENST00000343257.2	+	23	3045	c.2958G>A	c.(2956-2958)ctG>ctA	p.L986L		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	986					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					AGGATGAACTGATCCTTTGAC	0.617																																					p.L986L		Atlas-SNP	.											.	CLCN1	141	.	0			c.G2958A						PASS	.						85.0	83.0	84.0					7																	143049049		2203	4300	6503	SO:0001819	synonymous_variant	1180	exon23			TGAACTGATCCTT	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2958G>A	chr7.hg19:g.143049049G>A		110.0	0.0	.		105.0	23.0	.	NM_000083	A4D2H5|Q2M202	Silent	SNP	ENST00000343257.2	hg19	CCDS5881.1																																																																																			.	.	.	none		0.617	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
CTSL	1514	hgsc.bcm.edu	37	9	90344596	90344596	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr9:90344596C>T	ENST00000343150.5	+	6	1620	c.730C>T	c.(730-732)Ccc>Tcc	p.P244S	CTSL_ENST00000340342.6_Missense_Mutation_p.P244S|CTSL_ENST00000495822.1_3'UTR			P07711	CATL1_HUMAN	cathepsin L	244					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										AACTGTGGGGCCCATTTCTGT	0.428																																					p.P244S		Atlas-SNP	.											.	CTSL1	43	.	0			c.C730T						PASS	.						153.0	147.0	149.0					9																	90344596		2203	4300	6503	SO:0001583	missense	1514	exon6			GTGGGGCCCATTT	X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.730C>T	chr9.hg19:g.90344596C>T	ENSP00000345344:p.Pro244Ser	108.0	0.0	.		81.0	16.0	.	NM_145918	Q6IAV1|Q96QJ0	Missense_Mutation	SNP	ENST00000343150.5	hg19	CCDS6675.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562005	0.65538	.	.	ENSG00000135047	ENST00000343150;ENST00000340342	T;T	0.58652	0.32;0.32	4.19	4.19	0.49359	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.86167	0.5868	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92638	0.6122	10	0.87932	D	0	.	16.7092	0.85380	0.0:1.0:0.0:0.0	.	244	P07711	CATL1_HUMAN	S	244	ENSP00000345344:P244S;ENSP00000365061:P244S	ENSP00000365061:P244S	P	+	1	0	CTSL1	89534416	1.000000	0.71417	0.118000	0.21660	0.300000	0.27592	6.804000	0.75186	2.134000	0.65973	0.655000	0.94253	CCC	.	.	.	none		0.428	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912	
MASTL	84930	hgsc.bcm.edu	37	10	27456144	27456144	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr10:27456144T>A	ENST00000375940.4	+	7	982	c.925T>A	c.(925-927)Ttc>Atc	p.F309I	MASTL_ENST00000375946.4_Missense_Mutation_p.F309I|MASTL_ENST00000342386.6_Missense_Mutation_p.F309I			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	309	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATCCCACACCTTCATATCCAG	0.438																																					p.F309I		Atlas-SNP	.											.	MASTL	81	.	0			c.T925A						PASS	.						98.0	94.0	95.0					10																	27456144		2203	4300	6503	SO:0001583	missense	84930	exon7			CACACCTTCATAT	BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.925T>A	chr10.hg19:g.27456144T>A	ENSP00000365107:p.Phe309Ile	96.0	0.0	.		86.0	4.0	.	NM_032844	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	hg19	CCDS53502.1	.	.	.	.	.	.	.	.	.	.	T	19.40	3.821148	0.71028	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.66280	-0.1;-0.2;-0.09	6.16	6.16	0.99307	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.182060	0.49305	D	0.000145	T	0.69415	0.3108	M	0.67953	2.075	0.09310	N	1	D;P;D	0.60575	0.96;0.932;0.988	P;B;P	0.55455	0.579;0.397;0.776	T	0.64698	-0.6346	10	0.29301	T	0.29	-21.7995	10.7305	0.46093	0.0:0.1106:0.0:0.8894	.	309;309;309	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	I	309	ENSP00000365113:F309I;ENSP00000343446:F309I;ENSP00000365107:F309I	ENSP00000343446:F309I	F	+	1	0	MASTL	27496150	0.046000	0.20272	0.950000	0.38849	0.998000	0.95712	0.873000	0.28052	2.367000	0.80283	0.528000	0.53228	TTC	.	.	.	none		0.438	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
IFIT5	24138	hgsc.bcm.edu	37	10	91177012	91177012	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr10:91177012A>G	ENST00000371795.4	+	2	269	c.56A>G	c.(55-57)cAt>cGt	p.H19R	IFIT5_ENST00000416601.1_Missense_Mutation_p.H19R|LIPA_ENST00000371837.1_5'Flank	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	19					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						TTAGAATGTCATTTTACATGG	0.318																																					p.H19R		Atlas-SNP	.											.	IFIT5	32	.	0			c.A56G						PASS	.						69.0	71.0	70.0					10																	91177012		2203	4300	6503	SO:0001583	missense	24138	exon2			AATGTCATTTTAC	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.56A>G	chr10.hg19:g.91177012A>G	ENSP00000360860:p.His19Arg	148.0	0.0	.		125.0	16.0	.	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	ENST00000371795.4	hg19	CCDS7403.1	.	.	.	.	.	.	.	.	.	.	A	19.78	3.890598	0.72524	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	T;T	0.60797	0.16;0.16	6.16	6.16	0.99307	.	0.045911	0.85682	D	0.000000	T	0.77253	0.4103	M	0.80847	2.515	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.80284	-0.1447	10	0.87932	D	0	-13.583	15.9872	0.80168	1.0:0.0:0.0:0.0	.	19;19	Q13325;B4DDV1	IFIT5_HUMAN;.	R	19	ENSP00000360860:H19R;ENSP00000414042:H19R	ENSP00000360860:H19R	H	+	2	0	IFIT5	91166992	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.666000	0.68059	2.367000	0.80283	0.528000	0.53228	CAT	.	.	.	none		0.318	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
USH1C	10083	hgsc.bcm.edu	37	11	17542471	17542471	+	Missense_Mutation	SNP	A	A	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:17542471A>C	ENST00000318024.4	-	14	1264	c.1156T>G	c.(1156-1158)Ttg>Gtg	p.L386V	USH1C_ENST00000005226.7_Missense_Mutation_p.L386V|USH1C_ENST00000527020.1_Missense_Mutation_p.L367V|USH1C_ENST00000527720.1_Missense_Mutation_p.L355V	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	386					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						GTTTTAGGCAAGAGTAGCTGT	0.488																																					p.L386V		Atlas-SNP	.											.	USH1C	157	.	0			c.T1156G						PASS	.						457.0	438.0	444.0					11																	17542471		2200	4293	6493	SO:0001583	missense	10083	exon14			TAGGCAAGAGTAG	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1156T>G	chr11.hg19:g.17542471A>C	ENSP00000317018:p.Leu386Val	134.0	0.0	.		87.0	9.0	.	NM_005709	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	hg19	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	A	9.184	1.024225	0.19433	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.63913	1.77;1.77;2.01;-0.07	5.7	-8.8	0.00817	.	0.781295	0.12318	N	0.479554	T	0.26159	0.0638	N	0.08118	0	0.09310	N	1	B;B;B	0.14438	0.01;0.006;0.0	B;B;B	0.15870	0.014;0.006;0.001	T	0.28554	-1.0040	10	0.11485	T	0.65	.	3.9214	0.09245	0.2554:0.0946:0.4467:0.2034	.	367;386;386	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	V	386;355;367;386	ENSP00000317018:L386V;ENSP00000432944:L355V;ENSP00000436934:L367V;ENSP00000005226:L386V	ENSP00000005226:L386V	L	-	1	2	USH1C	17499047	0.000000	0.05858	0.002000	0.10522	0.642000	0.38348	-1.114000	0.03293	-1.238000	0.02535	-1.039000	0.02377	TTG	.	.	.	none		0.488	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
OR5M3	219482	hgsc.bcm.edu	37	11	56237348	56237348	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:56237348A>T	ENST00000312240.2	-	1	666	c.626T>A	c.(625-627)cTg>cAg	p.L209Q		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					AATTACAGTCAGGGAATATGT	0.438																																					p.L209Q		Atlas-SNP	.											.	OR5M3	103	.	0			c.T626A						PASS	.						111.0	109.0	110.0					11																	56237348		2201	4296	6497	SO:0001583	missense	219482	exon1			ACAGTCAGGGAAT	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.626T>A	chr11.hg19:g.56237348A>T	ENSP00000312208:p.Leu209Gln	206.0	0.0	.		173.0	20.0	.	NM_001004742	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	hg19	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	A	7.810	0.715500	0.15306	.	.	ENSG00000174937	ENST00000312240	T	0.49432	0.78	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33854	N	0.004500	T	0.71753	0.3377	H	0.97240	3.965	0.09310	N	1	B	0.19445	0.036	B	0.40038	0.317	T	0.68884	-0.5291	10	0.72032	D	0.01	-8.3442	12.8019	0.57591	1.0:0.0:0.0:0.0	.	209	Q8NGP4	OR5M3_HUMAN	Q	209	ENSP00000312208:L209Q	ENSP00000312208:L209Q	L	-	2	0	OR5M3	55993924	0.207000	0.23482	0.002000	0.10522	0.005000	0.04900	4.573000	0.60893	1.897000	0.54924	0.448000	0.29417	CTG	.	.	.	none		0.438	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
OR5M3	219482	hgsc.bcm.edu	37	11	56237358	56237358	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:56237358T>A	ENST00000312240.2	-	1	656	c.616A>T	c.(616-618)Aca>Tca	p.T206S		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					AGGGAATATGTGAAGTTAATG	0.428																																					p.T206S		Atlas-SNP	.											.	OR5M3	103	.	0			c.A616T						PASS	.						120.0	118.0	119.0					11																	56237358		2201	4296	6497	SO:0001583	missense	219482	exon1			AATATGTGAAGTT	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.616A>T	chr11.hg19:g.56237358T>A	ENSP00000312208:p.Thr206Ser	205.0	0.0	.		172.0	20.0	.	NM_001004742	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	hg19	CCDS31532.1	.	.	.	.	.	.	.	.	.	.	T	3.617	-0.078287	0.07184	.	.	ENSG00000174937	ENST00000312240	T	0.37058	1.22	5.08	-0.403	0.12400	GPCR, rhodopsin-like superfamily (1);	0.993240	0.08161	N	0.988433	T	0.16981	0.0408	N	0.11255	0.115	0.09310	N	1	B	0.14012	0.009	B	0.23150	0.044	T	0.31194	-0.9952	10	0.22706	T	0.39	-3.9091	3.5764	0.07936	0.2773:0.1679:0.0:0.5548	.	206	Q8NGP4	OR5M3_HUMAN	S	206	ENSP00000312208:T206S	ENSP00000312208:T206S	T	-	1	0	OR5M3	55993934	0.000000	0.05858	0.552000	0.28243	0.327000	0.28475	-0.845000	0.04340	0.248000	0.21435	0.448000	0.29417	ACA	.	.	.	none		0.428	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
SSRP1	6749	hgsc.bcm.edu	37	11	57100282	57100282	+	Silent	SNP	C	C	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:57100282C>A	ENST00000278412.2	-	6	851	c.585G>T	c.(583-585)acG>acT	p.T195T		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	195					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						TGGCATCTCCCGTGGCCTGGA	0.562																																					p.T195T	Colon(89;1000 1340 6884 23013 41819)	Atlas-SNP	.											.	SSRP1	75	.	0			c.G585T						PASS	.						65.0	63.0	64.0					11																	57100282		2201	4296	6497	SO:0001819	synonymous_variant	6749	exon6			ATCTCCCGTGGCC	M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.585G>T	chr11.hg19:g.57100282C>A		98.0	0.0	.		72.0	15.0	.	NM_003146	Q5BJG8	Silent	SNP	ENST00000278412.2	hg19	CCDS7952.1																																																																																			.	.	.	none		0.562	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392460.1	NM_003146	
FRMD8	83786	hgsc.bcm.edu	37	11	65168213	65168213	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:65168213C>T	ENST00000317568.5	+	9	1109	c.946C>T	c.(946-948)Cgc>Tgc	p.R316C	FRMD8_ENST00000355991.5_Missense_Mutation_p.R260C|FRMD8_ENST00000416776.2_Missense_Mutation_p.R282C	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	316	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						GCTGGGCCTGCGCTTCCAGGA	0.657																																					p.R316C		Atlas-SNP	.											.	FRMD8	28	.	0			c.C946T						PASS	.						48.0	38.0	41.0					11																	65168213		2201	4296	6497	SO:0001583	missense	83786	exon9			GGCCTGCGCTTCC	AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.946C>T	chr11.hg19:g.65168213C>T	ENSP00000319726:p.Arg316Cys	76.0	0.0	.		82.0	13.0	.	NM_031904	B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	ENST00000317568.5	hg19	CCDS8102.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609302	0.46527	.	.	ENSG00000126391	ENST00000317568;ENST00000355991;ENST00000416776	D;T;D	0.84223	-1.81;-1.22;-1.82	4.49	3.56	0.40772	FERM domain (1);	0.572355	0.18795	N	0.130960	D	0.84813	0.5555	.	.	.	0.48452	D	0.999659	B;B;D	0.71674	0.041;0.175;0.998	B;B;P	0.48654	0.01;0.028;0.585	D	0.83999	0.0342	9	0.56958	D	0.05	-14.6802	9.9641	0.41715	0.3682:0.6317:0.0:0.0	.	282;260;316	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	C	316;260;282	ENSP00000319726:R316C;ENSP00000348270:R260C;ENSP00000392111:R282C	ENSP00000319726:R316C	R	+	1	0	FRMD8	64924789	0.940000	0.31905	1.000000	0.80357	0.991000	0.79684	1.023000	0.30065	0.998000	0.38996	0.549000	0.68633	CGC	.	.	.	none		0.657	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
MUS81	80198	hgsc.bcm.edu	37	11	65631192	65631192	+	Splice_Site	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:65631192G>A	ENST00000308110.4	+	9	1310	c.961G>A	c.(961-963)Gca>Aca	p.A321T	EFEMP2_ENST00000532648.1_5'Flank|MUS81_ENST00000533035.1_Splice_Site_p.A246T|CFL1_ENST00000534769.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	321	ERCC4.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		TAGAGACCCAGGTGAAGGGCC	0.637								Homologous recombination																													p.A321T		Atlas-SNP	.											.	MUS81	68	.	0			c.G961A						PASS	.						59.0	64.0	63.0					11																	65631192		2201	4296	6497	SO:0001630	splice_region_variant	80198	exon9			GACCCAGGTGAAG		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.961+1G>A	chr11.hg19:g.65631192G>A		132.0	0.0	.		110.0	21.0	.	NM_025128	Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	hg19	CCDS8115.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.03|11.03	1.519664|1.519664	0.27211|0.27211	.|.	.|.	ENSG00000172732|ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855|ENST00000529374	T;T|.	0.22945|.	1.93;1.93|.	5.14|5.14	3.2|3.2	0.36748|0.36748	DNA repair nuclease, XPF-type/Helicase (1);Restriction endonuclease, type II-like (1);ERCC4 domain (2);|.	0.343384|.	0.32430|.	N|.	0.006119|.	T|T	0.43656|0.43656	0.1257|0.1257	L|L	0.35288|0.35288	1.05|1.05	0.36284|0.36284	D|D	0.855981|0.855981	B|.	0.29805|.	0.257|.	B|.	0.31442|.	0.13|.	T|T	0.46317|0.46317	-0.9200|-0.9200	10|5	0.13470|.	T|.	0.59|.	-1.6633|-1.6633	6.6325|6.6325	0.22865|0.22865	0.0927:0.0:0.7303:0.177|0.0927:0.0:0.7303:0.177	.|.	321|.	Q96NY9|.	MUS81_HUMAN|.	T|N	246;321;321|245	ENSP00000432287:A246T;ENSP00000307853:A321T|.	ENSP00000307853:A321T|.	A|S	+|+	1|2	0|0	MUS81|MUS81	65387768|65387768	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.034000|0.034000	0.12701|0.12701	3.588000|3.588000	0.53964|0.53964	1.370000|1.370000	0.46153|0.46153	0.563000|0.563000	0.77884|0.77884	GCA|AGC	.	.	.	none		0.637	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128	Missense_Mutation
INPPL1	3636	hgsc.bcm.edu	37	11	71948603	71948603	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:71948603A>G	ENST00000298229.2	+	26	3519	c.3315A>G	c.(3313-3315)ccA>ccG	p.P1105P	INPPL1_ENST00000538751.1_Silent_p.P863P|INPPL1_ENST00000541756.1_Silent_p.P863P|PHOX2A_ENST00000544057.1_5'Flank	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1105	Pro-rich.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GCCCCTCACCAGCCAGCACTT	0.692																																					p.P1105P		Atlas-SNP	.											.	INPPL1	120	.	0			c.A3315G						PASS	.						19.0	21.0	20.0					11																	71948603		2108	4155	6263	SO:0001819	synonymous_variant	3636	exon26			CTCACCAGCCAGC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3315A>G	chr11.hg19:g.71948603A>G		93.0	0.0	.		72.0	17.0	.	NM_001567	B2RTX5|Q13577|Q13578	Silent	SNP	ENST00000298229.2	hg19	CCDS8213.1																																																																																			.	.	.	none		0.692	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
C2CD3	26005	hgsc.bcm.edu	37	11	73796809	73796809	+	Missense_Mutation	SNP	C	C	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:73796809C>G	ENST00000334126.7	-	21	3990	c.3764G>C	c.(3763-3765)tGt>tCt	p.C1255S	C2CD3_ENST00000313663.7_Missense_Mutation_p.C1255S			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1255	C2 1.				brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GCAGAAAGAACAGGCCACAGG	0.547																																					p.C1255S		Atlas-SNP	.											.	C2CD3	288	.	0			c.G3764C						PASS	.						86.0	75.0	79.0					11																	73796809		2200	4293	6493	SO:0001583	missense	26005	exon21			AAAGAACAGGCCA	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.3764G>C	chr11.hg19:g.73796809C>G	ENSP00000334379:p.Cys1255Ser	140.0	0.0	.		132.0	19.0	.	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	hg19		.	.	.	.	.	.	.	.	.	.	C	20.1	3.935426	0.73442	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.37411	1.2;1.2;1.2	5.8	4.88	0.63580	.	0.169348	0.50627	D	0.000102	T	0.27241	0.0668	L	0.29908	0.895	0.42377	D	0.992478	P	0.47910	0.902	B	0.40066	0.318	T	0.03008	-1.1083	10	0.37606	T	0.19	-9.4621	13.9561	0.64150	0.0:0.9267:0.0:0.0733	.	1255	Q4AC94-1	.	S	1255;1255;1255;63	ENSP00000334379:C1255S;ENSP00000323339:C1255S;ENSP00000388750:C63S	ENSP00000323339:C1255S	C	-	2	0	C2CD3	73474457	0.998000	0.40836	1.000000	0.80357	0.951000	0.60555	3.590000	0.53979	2.742000	0.94016	0.655000	0.94253	TGT	.	.	.	none		0.547	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
YAP1	10413	hgsc.bcm.edu	37	11	102100555	102100555	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:102100555G>T	ENST00000282441.5	+	9	1787	c.1399G>T	c.(1399-1401)Gga>Tga	p.G467*	YAP1_ENST00000528834.1_3'UTR|YAP1_ENST00000531439.1_Nonsense_Mutation_p.G451*|YAP1_ENST00000526343.1_Nonsense_Mutation_p.G413*|RP11-864G5.3_ENST00000526310.1_RNA|YAP1_ENST00000537274.1_Nonsense_Mutation_p.G455*|YAP1_ENST00000524575.1_Nonsense_Mutation_p.G289*|YAP1_ENST00000345877.2_Nonsense_Mutation_p.G417*	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	467	Transactivation domain.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		GAACATAGAAGGAGAGGAGCT	0.483																																					p.G467X	Colon(50;247 1103 7861 28956)	Atlas-SNP	.											.	YAP1	45	.	0			c.G1399T						PASS	.						131.0	123.0	126.0					11																	102100555		2203	4299	6502	SO:0001587	stop_gained	10413	exon9			ATAGAAGGAGAGG		CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.1399G>T	chr11.hg19:g.102100555G>T	ENSP00000282441:p.Gly467*	128.0	0.0	.		94.0	15.0	.	NM_001130145	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Nonsense_Mutation	SNP	ENST00000282441.5	hg19	CCDS44716.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.303129|8.303129	0.98750|0.98750	.|.	.|.	ENSG00000137693|ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575|ENST00000529029	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.77638	.|0.4160	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73658	.|-0.3913	.|4	0.87932|.	D|.	0|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|N	413;467;455;417;384;451;289|220	.|.	ENSP00000282441:G467X|.	G|K	+|+	1|3	0|2	YAP1|YAP1	101605765|101605765	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	9.441000|9.441000	0.97557|0.97557	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GGA|AAG	.	.	.	none		0.483	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394151.1	NM_006106	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128933815	128933815	+	Silent	SNP	A	A	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:128933815A>G	ENST00000310343.9	-	8	824	c.825T>C	c.(823-825)ccT>ccC	p.P275P	ARHGAP32_ENST00000524655.1_Silent_p.P201P	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	275	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TCAGTTCGTCAGGGGCCCGAG	0.433																																					p.P275P		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.T825C						PASS	.						162.0	158.0	160.0					11																	128933815		1566	3579	5145	SO:0001819	synonymous_variant	9743	exon8			TTCGTCAGGGGCC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.825T>C	chr11.hg19:g.128933815A>G		158.0	0.0	.		139.0	24.0	.	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	hg19	CCDS44769.1																																																																																			.	.	.	none		0.433	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
CLSTN3	9746	hgsc.bcm.edu	37	12	7302198	7302198	+	Silent	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr12:7302198T>C	ENST00000266546.6	+	14	2604	c.2154T>C	c.(2152-2154)gaT>gaC	p.D718D	CLSTN3_ENST00000537408.1_Silent_p.D730D	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	718					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ATGACCTGGATCCCGAGCGGG	0.572																																					p.D718D		Atlas-SNP	.											.	CLSTN3	84	.	0			c.T2154C						PASS	.						86.0	78.0	80.0					12																	7302198		2203	4300	6503	SO:0001819	synonymous_variant	9746	exon14			CCTGGATCCCGAG	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2154T>C	chr12.hg19:g.7302198T>C		110.0	0.0	.		67.0	21.0	.	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Silent	SNP	ENST00000266546.6	hg19	CCDS8575.1																																																																																			.	.	.	none		0.572	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
MON2	23041	hgsc.bcm.edu	37	12	62954577	62954577	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr12:62954577T>A	ENST00000393632.2	+	26	4107	c.3716T>A	c.(3715-3717)cTa>cAa	p.L1239Q	MON2_ENST00000280379.6_Missense_Mutation_p.L1240Q|MON2_ENST00000552738.1_Missense_Mutation_p.L1216Q|MON2_ENST00000393629.2_Missense_Mutation_p.L1239Q|MON2_ENST00000393630.3_Missense_Mutation_p.L1240Q|MON2_ENST00000546600.1_Missense_Mutation_p.L1239Q	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1239					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GATTTGAATCTATGGTGGGCT	0.393																																					p.L1239Q		Atlas-SNP	.											.	MON2	160	.	0			c.T3716A						PASS	.						92.0	90.0	91.0					12																	62954577		2203	4300	6503	SO:0001583	missense	23041	exon26			TGAATCTATGGTG		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3716T>A	chr12.hg19:g.62954577T>A	ENSP00000377252:p.Leu1239Gln	116.0	0.0	.		99.0	22.0	.	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	hg19	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.100011	0.76983	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	T	0.79857	0.4518	L	0.52759	1.655	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;0.979;1.0;1.0	D;P;P;D;D	0.83275	0.99;0.861;0.793;0.994;0.996	T	0.79308	-0.1857	9	.	.	.	-5.6366	15.0609	0.71951	0.0:0.0:0.0:1.0	.	1239;1216;1239;114;1239	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	Q	1239;1240;1240;1239;1216;1239	ENSP00000377252:L1239Q;ENSP00000377250:L1240Q;ENSP00000280379:L1240Q;ENSP00000447407:L1239Q;ENSP00000449215:L1216Q;ENSP00000377249:L1239Q	.	L	+	2	0	MON2	61240844	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.787000	0.85759	2.031000	0.59945	0.377000	0.23210	CTA	.	.	.	none		0.393	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
MRPS31	10240	hgsc.bcm.edu	37	13	41323388	41323388	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr13:41323388A>T	ENST00000323563.6	-	6	880	c.844T>A	c.(844-846)Ttt>Att	p.F282I	MRPS31_ENST00000498078.1_5'UTR	NM_005830.3	NP_005821.2	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31	282						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		TGCTTAGCAAATTCCACATCC	0.368																																					p.F282I		Atlas-SNP	.											.	MRPS31	30	.	0			c.T844A						PASS	.						103.0	90.0	94.0					13																	41323388		2203	4300	6503	SO:0001583	missense	10240	exon6			TAGCAAATTCCAC	Z68747	CCDS9372.1	13q14.11	2012-09-13			ENSG00000102738	ENSG00000102738		"""Mitochondrial ribosomal proteins / small subunits"""	16632	protein-coding gene	gene with protein product		611992				11279123, 8567980	Standard	NM_005830		Approved	IMOGN38	uc001uxm.4	Q92665	OTTHUMG00000016777	ENST00000323563.6:c.844T>A	chr13.hg19:g.41323388A>T	ENSP00000315397:p.Phe282Ile	122.0	0.0	.		88.0	8.0	.	NM_005830	B2RCS3|Q5VYC8|Q8WTV8	Missense_Mutation	SNP	ENST00000323563.6	hg19	CCDS9372.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196191	0.58126	.	.	ENSG00000102738	ENST00000323563	T	0.30182	1.54	5.17	5.17	0.71159	.	0.105571	0.64402	D	0.000003	T	0.50973	0.1647	M	0.80982	2.52	0.40731	D	0.982746	D	0.71674	0.998	D	0.65233	0.933	T	0.54255	-0.8321	10	0.37606	T	0.19	.	8.5691	0.33558	0.912:0.0:0.088:0.0	.	282	Q92665	RT31_HUMAN	I	282	ENSP00000315397:F282I	ENSP00000315397:F282I	F	-	1	0	MRPS31	40221388	1.000000	0.71417	0.995000	0.50966	0.613000	0.37349	2.868000	0.48436	1.947000	0.56498	0.524000	0.50904	TTT	.	.	.	none		0.368	MRPS31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044640.2		
COL4A2	1284	hgsc.bcm.edu	37	13	111117912	111117912	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr13:111117912T>A	ENST00000360467.5	+	25	2243	c.1937T>A	c.(1936-1938)tTc>tAc	p.F646Y	COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	646	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CCACCAGGCTTCCTGGGCCCT	0.597																																					p.F646Y		Atlas-SNP	.											.	COL4A2	178	.	0			c.T1937A						PASS	.						29.0	34.0	32.0					13																	111117912		1873	4094	5967	SO:0001583	missense	1284	exon25			CAGGCTTCCTGGG	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1937T>A	chr13.hg19:g.111117912T>A	ENSP00000353654:p.Phe646Tyr	158.0	0.0	.		124.0	14.0	.	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	hg19	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.456320	0.01071	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93247	-3.19	4.82	3.55	0.40652	.	0.654622	0.13725	N	0.367070	D	0.84942	0.5584	N	0.17674	0.51	0.09310	N	0.999999	B	0.23650	0.089	B	0.17098	0.017	T	0.72966	-0.4131	10	0.29301	T	0.29	.	5.8702	0.18799	0.1497:0.0841:0.0:0.7662	.	646	P08572	CO4A2_HUMAN	Y	646	ENSP00000353654:F646Y	ENSP00000257309:F646Y	F	+	2	0	COL4A2	109915913	0.000000	0.05858	0.103000	0.21229	0.102000	0.19082	0.319000	0.19522	1.802000	0.52723	0.379000	0.24179	TTC	.	.	.	none		0.597	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
GTF2A1	2957	hgsc.bcm.edu	37	14	81659105	81659105	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr14:81659105T>A	ENST00000553612.1	-	7	1094	c.691A>T	c.(691-693)Aat>Tat	p.N231Y	GTF2A1_ENST00000434192.2_Missense_Mutation_p.N192Y	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	231					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		TGAGTCTTATTTCCTGTAAAT	0.502																																					p.N231Y		Atlas-SNP	.											.	GTF2A1	34	.	0			c.A691T						PASS	.						174.0	172.0	173.0					14																	81659105		2203	4300	6503	SO:0001583	missense	2957	exon7			TCTTATTTCCTGT	X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.691A>T	chr14.hg19:g.81659105T>A	ENSP00000452454:p.Asn231Tyr	84.0	0.0	.		77.0	9.0	.	NM_015859	Q3KNQ9	Missense_Mutation	SNP	ENST00000553612.1	hg19	CCDS9873.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.444489	0.83993	.	.	ENSG00000165417	ENST00000553612;ENST00000344860;ENST00000434192	T;T	0.44083	0.93;0.93	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.62588	0.2440	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.64723	-0.6340	10	0.52906	T	0.07	-21.9526	15.3673	0.74531	0.0:0.0:0.0:1.0	.	231	P52655	TF2AA_HUMAN	Y	231;192;192	ENSP00000452454:N231Y;ENSP00000409492:N192Y	ENSP00000298173:N231Y	N	-	1	0	GTF2A1	80728858	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.643000	0.83403	2.084000	0.62774	0.533000	0.62120	AAT	.	.	.	none		0.502	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413309.1	NM_015859	
SETD3	84193	hgsc.bcm.edu	37	14	99929881	99929881	+	Silent	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr14:99929881C>T	ENST00000331768.5	-	3	297	c.138G>A	c.(136-138)gaG>gaA	p.E46E	SETD3_ENST00000329331.3_Silent_p.E46E|SETD3_ENST00000453938.1_5'UTR|SETD3_ENST00000436070.2_Silent_p.E46E	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	46					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				ACTCTTCCCACTCTTTTCCTG	0.413																																					p.E46E		Atlas-SNP	.											.	SETD3	56	.	0			c.G138A						PASS	.						84.0	71.0	76.0					14																	99929881		2203	4300	6503	SO:0001819	synonymous_variant	84193	exon3			TTCCCACTCTTTT	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.138G>A	chr14.hg19:g.99929881C>T		85.0	0.0	.		63.0	11.0	.	NM_032233	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Silent	SNP	ENST00000331768.5	hg19	CCDS9951.1																																																																																			.	.	.	none		0.413	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	
FAN1	22909	hgsc.bcm.edu	37	15	31197838	31197838	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:31197838T>G	ENST00000362065.4	+	2	1263	c.972T>G	c.(970-972)caT>caG	p.H324Q	FAN1_ENST00000561594.1_Missense_Mutation_p.H324Q|FAN1_ENST00000561607.1_Missense_Mutation_p.H324Q|FAN1_ENST00000565466.1_Missense_Mutation_p.H324Q	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	324					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						CAAAATCTCATAGTTCTGCAG	0.418								Direct reversal of damage																													p.H324Q		Atlas-SNP	.											.	FAN1	77	.	0			c.T972G						PASS	.						71.0	67.0	68.0					15																	31197838		2202	4300	6502	SO:0001583	missense	22909	exon2			ATCTCATAGTTCT		CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.972T>G	chr15.hg19:g.31197838T>G	ENSP00000354497:p.His324Gln	97.0	0.0	.		86.0	16.0	.	NM_001146095	A8K4M2|Q86WU8	Missense_Mutation	SNP	ENST00000362065.4	hg19	CCDS32186.1	.	.	.	.	.	.	.	.	.	.	T	3.821	-0.037772	0.07497	.	.	ENSG00000198690	ENST00000362065	T	0.40756	1.02	5.46	-9.68	0.00528	.	2.519990	0.00901	N	0.002356	T	0.18299	0.0439	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.17228	-1.0376	10	0.12766	T	0.61	0.1551	2.0377	0.03543	0.2596:0.2533:0.3519:0.1352	.	324;324	Q9Y2M0;Q9Y2M0-2	FAN1_HUMAN;.	Q	324	ENSP00000354497:H324Q	ENSP00000354497:H324Q	H	+	3	2	FAN1	28985130	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-3.615000	0.00414	-2.231000	0.00718	-0.291000	0.09656	CAT	.	.	.	none		0.418	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1	NM_014967	
SIN3A	25942	hgsc.bcm.edu	37	15	75705130	75705130	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:75705130G>A	ENST00000394947.3	-	5	1044	c.730C>T	c.(730-732)Cag>Tag	p.Q244*	SIN3A_ENST00000360439.4_Nonsense_Mutation_p.Q244*|SIN3A_ENST00000394949.4_Nonsense_Mutation_p.Q244*	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						GGTGggggctgaggagctggc	0.552																																					p.Q244X		Atlas-SNP	.											.	SIN3A	152	.	0			c.C730T						PASS	.						81.0	75.0	77.0					15																	75705130		2197	4294	6491	SO:0001587	stop_gained	25942	exon5			GGGGCTGAGGAGC	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.730C>T	chr15.hg19:g.75705130G>A	ENSP00000378402:p.Gln244*	131.0	0.0	.		89.0	12.0	.	NM_001145358		Nonsense_Mutation	SNP	ENST00000394947.3	hg19	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	G	37	6.213995	0.97380	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	.	.	.	6.04	5.12	0.69794	.	0.098566	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-11.3013	14.2887	0.66263	0.0708:0.0:0.9292:0.0	.	.	.	.	X	244	.	ENSP00000353622:Q244X	Q	-	1	0	SIN3A	73492183	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.867000	0.99620	1.557000	0.49525	0.561000	0.74099	CAG	.	.	.	none		0.552	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
RASGRF1	5923	hgsc.bcm.edu	37	15	79350728	79350728	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr15:79350728A>T	ENST00000419573.3	-	3	753	c.479T>A	c.(478-480)cTt>cAt	p.L160H	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.L160H	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	160					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CTGCTGCCGAAGCTGCTTGGC	0.602																																					p.L160H		Atlas-SNP	.											.	RASGRF1	168	.	0			c.T479A						PASS	.						124.0	101.0	109.0					15																	79350728		2196	4293	6489	SO:0001583	missense	5923	exon3			TGCCGAAGCTGCT	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.479T>A	chr15.hg19:g.79350728A>T	ENSP00000405963:p.Leu160His	46.0	0.0	.		44.0	4.0	.	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982389	0.74474	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.46819	0.86	4.59	4.59	0.56863	.	0.000000	0.64402	D	0.000005	T	0.62258	0.2413	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.85130	0.954;0.984;0.993;0.997	T	0.65492	-0.6155	10	0.87932	D	0	.	11.9588	0.52997	1.0:0.0:0.0:0.0	.	160;160;160;160	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	H	160	ENSP00000405963:L160H	ENSP00000378224:L160H	L	-	2	0	RASGRF1	77137783	1.000000	0.71417	0.997000	0.53966	0.677000	0.39632	8.730000	0.91510	1.917000	0.55516	0.443000	0.29094	CTT	.	.	.	none		0.602	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
GRIN2A	2903	hgsc.bcm.edu	37	16	9858489	9858489	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr16:9858489T>C	ENST00000396573.2	-	14	3221	c.2912A>G	c.(2911-2913)cAg>cGg	p.Q971R	GRIN2A_ENST00000562109.1_Missense_Mutation_p.Q971R|GRIN2A_ENST00000396575.2_Missense_Mutation_p.Q971R|GRIN2A_ENST00000330684.3_Missense_Mutation_p.Q971R|GRIN2A_ENST00000404927.2_Missense_Mutation_p.Q971R|GRIN2A_ENST00000535259.1_Missense_Mutation_p.Q814R	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	971					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTATCCTTCTGCCGGTTGGC	0.468																																					p.Q971R		Atlas-SNP	.											.	GRIN2A	366	.	0			c.A2912G						PASS	.						151.0	131.0	137.0					16																	9858489		2197	4300	6497	SO:0001583	missense	2903	exon14			TCCTTCTGCCGGT		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2912A>G	chr16.hg19:g.9858489T>C	ENSP00000379818:p.Gln971Arg	96.0	0.0	.		84.0	27.0	.	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	hg19	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	T	5.637	0.302152	0.10678	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.11712	2.75;2.75;2.76;2.75;2.75	5.33	5.33	0.75918	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.088776	0.85682	D	0.000000	T	0.08714	0.0216	L	0.27053	0.805	0.23293	N	0.997962	B;B;B	0.24317	0.034;0.101;0.005	B;B;B	0.29440	0.062;0.102;0.008	T	0.32428	-0.9907	9	.	.	.	.	10.6354	0.45563	0.0:0.0:0.1607:0.8393	.	814;971;971	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	R	971;971;814;971;971	ENSP00000379818:Q971R;ENSP00000385872:Q971R;ENSP00000441572:Q814R;ENSP00000332549:Q971R;ENSP00000379820:Q971R	.	Q	-	2	0	GRIN2A	9765990	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.691000	0.61738	2.016000	0.59253	0.533000	0.62120	CAG	.	.	.	none		0.468	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ITGAX	3687	hgsc.bcm.edu	37	16	31373395	31373395	+	Splice_Site	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr16:31373395G>A	ENST00000268296.4	+	11	1207		c.e11-1		ITGAX_ENST00000562522.1_Splice_Site	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TTTTCTCCCAGGATGGCCCCG	0.592																																					.		Atlas-SNP	.											.	ITGAX	198	.	0			c.1087-1G>A						PASS	.						82.0	87.0	86.0					16																	31373395		2197	4300	6497	SO:0001630	splice_region_variant	3687	exon11			CTCCCAGGATGGC	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1087-1G>A	chr16.hg19:g.31373395G>A		94.0	0.0	.		74.0	10.0	.	NM_000887	Q8IVA6	Splice_Site	SNP	ENST00000268296.4	hg19	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	g	13.52	2.262216	0.39995	.	.	ENSG00000140678	ENST00000268296	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4899	0.67645	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGAX	31280896	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	5.608000	0.67654	2.217000	0.71921	0.580000	0.79431	.	.	.	.	none		0.592	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	Intron
ITGAX	3687	hgsc.bcm.edu	37	16	31383064	31383064	+	Missense_Mutation	SNP	G	G	A	rs368436373		TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr16:31383064G>A	ENST00000268296.4	+	17	2240	c.2119G>A	c.(2119-2121)Ggg>Agg	p.G707R	ITGAX_ENST00000562522.1_Missense_Mutation_p.G707R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	707					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCGAGTCCTCGGGCTGAAGGC	0.652																																					p.G707R		Atlas-SNP	.											.	ITGAX	198	.	0			c.G2119A						PASS	.	G	ARG/GLY	0,4394		0,0,2197	60.0	54.0	56.0		2119	4.4	0.0	16		56	2,8598	2.2+/-6.3	0,2,4298	no	missense	ITGAX	NM_000887.3	125	0,2,6495	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	707/1164	31383064	2,12992	2197	4300	6497	SO:0001583	missense	3687	exon17			GTCCTCGGGCTGA	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2119G>A	chr16.hg19:g.31383064G>A	ENSP00000268296:p.Gly707Arg	59.0	0.0	.		54.0	5.0	.	NM_000887	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	hg19	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741680	0.49151	0.0	2.33E-4	ENSG00000140678	ENST00000268296	T	0.44881	0.91	5.4	4.43	0.53597	Integrin alpha-2 (1);	.	.	.	.	T	0.51398	0.1672	L	0.55834	1.745	0.09310	N	1	D	0.59767	0.986	P	0.56514	0.8	T	0.38436	-0.9661	9	0.49607	T	0.09	.	10.5956	0.45336	0.0933:0.0:0.9067:0.0	.	707	P20702	ITAX_HUMAN	R	707	ENSP00000268296:G707R	ENSP00000268296:G707R	G	+	1	0	ITGAX	31290565	0.076000	0.21285	0.028000	0.17463	0.033000	0.12548	2.282000	0.43461	2.662000	0.90505	0.655000	0.94253	GGG	.	.	.	weak		0.652	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
COL1A1	1277	hgsc.bcm.edu	37	17	48277127	48277127	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr17:48277127G>A	ENST00000225964.5	-	2	403	c.285C>T	c.(283-285)tgC>tgT	p.C95C		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	95	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	AGCCGTCGGGGCAGACGGGAC	0.726			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.C95C		Atlas-SNP	.		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1	158	.	0			c.C285T						PASS	.						47.0	49.0	48.0					17																	48277127		2202	4300	6502	SO:0001819	synonymous_variant	1277	exon2			GTCGGGGCAGACG	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.285C>T	chr17.hg19:g.48277127G>A		34.0	0.0	.		59.0	6.0	.	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Silent	SNP	ENST00000225964.5	hg19	CCDS11561.1																																																																																			.	.	.	none		0.726	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
SRSF1	6426	hgsc.bcm.edu	37	17	56083837	56083837	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr17:56083837G>T	ENST00000258962.4	-	2	454	c.246C>A	c.(244-246)taC>taA	p.Y82*	SRSF1_ENST00000585096.1_Intron|SRSF1_ENST00000582730.2_Nonsense_Mutation_p.Y82*|SRSF1_ENST00000581497.1_5'Flank|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000584773.1_Nonsense_Mutation_p.Y82*	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	82	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Y82*(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCCGCAGACGGTACCCATCGT	0.637																																					p.Y82X		Atlas-SNP	.											SRSF1,NS,lymphoid_neoplasm,0,2	SRSF1	41	.	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C246A						PASS	.						30.0	28.0	29.0					17																	56083837		2203	4298	6501	SO:0001587	stop_gained	6426	exon2			CAGACGGTACCCA		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.246C>A	chr17.hg19:g.56083837G>T	ENSP00000258962:p.Tyr82*	223.0	0.0	.		206.0	20.0	.	NM_006924	B2R6Z7|D3DTZ3|Q13809	Nonsense_Mutation	SNP	ENST00000258962.4	hg19	CCDS11600.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149607	0.78001	.	.	ENSG00000136450	ENST00000258962	.	.	.	5.96	-2.82	0.05787	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	13.3631	0.60667	0.5712:0.0:0.4287:0.0	.	.	.	.	X	82	.	ENSP00000258962:Y82X	Y	-	3	2	SRSF1	53438836	1.000000	0.71417	0.931000	0.37212	0.911000	0.54048	0.912000	0.28597	-0.291000	0.09012	-0.794000	0.03295	TAC	.	.	.	none		0.637	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924	
NETO1	81832	hgsc.bcm.edu	37	18	70450990	70450990	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr18:70450990A>T	ENST00000327305.6	-	7	1448	c.791T>A	c.(790-792)cTt>cAt	p.L264H	NETO1_ENST00000299430.2_Missense_Mutation_p.L263H|NETO1_ENST00000583169.1_Missense_Mutation_p.L264H	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	264	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GATCACCCCAAGACCCGTGCG	0.478																																					p.L264H		Atlas-SNP	.											.	NETO1	178	.	0			c.T791A						PASS	.						193.0	165.0	174.0					18																	70450990		2203	4300	6503	SO:0001583	missense	81832	exon7			ACCCCAAGACCCG	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.791T>A	chr18.hg19:g.70450990A>T	ENSP00000313088:p.Leu264His	74.0	0.0	.		88.0	7.0	.	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	hg19	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.261669	0.80358	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.18174	2.23;2.23	5.27	5.27	0.74061	CUB (5);	0.000000	0.53938	D	0.000058	T	0.36082	0.0954	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.87578	0.998;0.957	T	0.08146	-1.0736	10	0.72032	D	0.01	-10.3986	15.5016	0.75703	1.0:0.0:0.0:0.0	.	263;264	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	H	264;263	ENSP00000313088:L264H;ENSP00000299430:L263H	ENSP00000299430:L263H	L	-	2	0	NETO1	68601970	1.000000	0.71417	0.058000	0.19502	0.790000	0.44656	9.287000	0.95975	2.102000	0.63906	0.528000	0.53228	CTT	.	.	.	none		0.478	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
DOT1L	84444	hgsc.bcm.edu	37	19	2226194	2226194	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:2226194C>T	ENST00000398665.3	+	27	3710	c.3674C>T	c.(3673-3675)gCg>gTg	p.A1225V		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1225					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGGCTTGGCGGGAAGGAAG	0.677																																					p.A1225V		Atlas-SNP	.											.	DOT1L	205	.	0			c.C3674T						PASS	.						12.0	16.0	15.0					19																	2226194		1920	4101	6021	SO:0001583	missense	84444	exon27			GCTTGGCGGGAAG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.3674C>T	chr19.hg19:g.2226194C>T	ENSP00000381657:p.Ala1225Val	63.0	0.0	.		68.0	12.0	.	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	hg19	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379238	0.24944	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000457590	T;T	0.30182	1.95;1.54	4.54	-0.654	0.11443	.	1.117080	0.06764	N	0.782394	T	0.21103	0.0508	L	0.31294	0.92	0.09310	N	1	B;B	0.16396	0.002;0.017	B;B	0.09377	0.001;0.004	T	0.32719	-0.9896	10	0.87932	D	0	-8.2664	5.1085	0.14796	0.0:0.5858:0.1604:0.2538	.	1225;1225	Q8TEK3;Q8TEK3-2	DOT1L_HUMAN;.	V	1225;1225;105	ENSP00000381657:A1225V;ENSP00000407411:A105V	ENSP00000221482:A1225V	A	+	2	0	DOT1L	2177194	0.000000	0.05858	0.000000	0.03702	0.225000	0.24961	0.096000	0.15147	-0.246000	0.09611	0.491000	0.48974	GCG	.	.	.	none		0.677	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
RYR1	6261	hgsc.bcm.edu	37	19	38948847	38948847	+	Nonsense_Mutation	SNP	C	C	G			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:38948847C>G	ENST00000359596.3	+	18	2082	c.2082C>G	c.(2080-2082)taC>taG	p.Y694*	RYR1_ENST00000360985.3_Nonsense_Mutation_p.Y694*|RYR1_ENST00000355481.4_Nonsense_Mutation_p.Y694*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	694	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACACCCCCTACCCTGGGGCCG	0.637																																					p.Y694X		Atlas-SNP	.											.	RYR1	708	.	0			c.C2082G						PASS	.						52.0	51.0	51.0					19																	38948847		2203	4300	6503	SO:0001587	stop_gained	6261	exon18			CCCCTACCCTGGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2082C>G	chr19.hg19:g.38948847C>G	ENSP00000352608:p.Tyr694*	55.0	0.0	.		46.0	8.0	.	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	41	8.988435	0.99027	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	5.02	5.02	0.67125	.	0.000000	0.64402	U	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9369	0.58320	0.0:0.9196:0.0:0.0804	.	.	.	.	X	694	.	ENSP00000347667:Y694X	Y	+	3	2	RYR1	43640687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.109000	0.41863	2.623000	0.88846	0.549000	0.68633	TAC	.	.	.	none		0.637	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PSG5	5673	hgsc.bcm.edu	37	19	43679366	43679366	+	Splice_Site	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:43679366C>T	ENST00000366175.3	-	4	1095		c.e4+1		PSG5_ENST00000407568.1_Intron|PSG5_ENST00000404580.1_Missense_Mutation_p.G322D|PSG5_ENST00000407356.1_Splice_Site|PSG5_ENST00000599812.1_Splice_Site|PSG5_ENST00000342951.6_Splice_Site			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				GATCCACTTACCAGAGACTTC	0.463																																					.		Atlas-SNP	.											.	PSG5	58	.	0			c.964+1G>A						PASS	.						125.0	148.0	140.0					19																	43679366		2202	4292	6494	SO:0001630	splice_region_variant	5673	exon5			CACTTACCAGAGA		CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.964+1G>A	chr19.hg19:g.43679366C>T		153.0	0.0	.		114.0	12.0	.	NM_002781	Q15239|Q96QJ1|Q9UQ75	Splice_Site	SNP	ENST00000366175.3	hg19	CCDS12617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|c	5.814|5.814	0.334421|0.334421	0.11013|0.11013	.|.	.|.	ENSG00000204941|ENSG00000204941	ENST00000366175;ENST00000407356;ENST00000342951|ENST00000404580	.|T	.|0.01252	.|5.1	1.25|1.25	1.25|1.25	0.21368|0.21368	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00967	.|0.0032	.|.	.|.	.|.	0.23661|0.23661	N|N	0.99718|0.99718	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.49634	.|-0.8919	.|6	.|0.15499	.|T	.|0.54	.|.	5.8107|5.8107	0.18465|0.18465	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|D	-1|322	.|ENSP00000385250:G322D	.|ENSP00000385250:G322D	.|G	-|-	.|2	.|0	PSG5|PSG5	48371206|48371206	0.321000|0.321000	0.24625|0.24625	0.181000|0.181000	0.23098|0.23098	0.040000|0.040000	0.13550|0.13550	0.696000|0.696000	0.25541|0.25541	0.644000|0.644000	0.30656|0.30656	0.184000|0.184000	0.17185|0.17185	.|GGT	.	.	.	none		0.463	PSG5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323055.1	NM_002781	Intron
NLRP8	126205	hgsc.bcm.edu	37	19	56487643	56487643	+	Silent	SNP	C	C	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr19:56487643C>T	ENST00000291971.3	+	8	2921	c.2850C>T	c.(2848-2850)aaC>aaT	p.N950N	NLRP8_ENST00000590542.1_Silent_p.N931N	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	950					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CCCTGAAGAACCCTGACTGTA	0.453																																					p.N950N		Atlas-SNP	.											.	NLRP8	225	.	0			c.C2850T						PASS	.						139.0	135.0	136.0					19																	56487643		2203	4300	6503	SO:0001819	synonymous_variant	126205	exon8			GAAGAACCCTGAC	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2850C>T	chr19.hg19:g.56487643C>T		188.0	0.0	.		151.0	22.0	.	NM_176811	Q7RTR4	Silent	SNP	ENST00000291971.3	hg19	CCDS12937.1																																																																																			.	.	.	none		0.453	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
ACTR5	79913	hgsc.bcm.edu	37	20	37383625	37383625	+	Silent	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr20:37383625T>C	ENST00000243903.4	+	4	838	c.801T>C	c.(799-801)gaT>gaC	p.D267D		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	267					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				GGTGTCCTGATTATTATGAGA	0.418																																					p.D267D		Atlas-SNP	.											.	ACTR5	44	.	0			c.T801C						PASS	.						67.0	71.0	70.0					20																	37383625		2203	4300	6503	SO:0001819	synonymous_variant	79913	exon4			TCCTGATTATTAT	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.801T>C	chr20.hg19:g.37383625T>C		245.0	0.0	.		256.0	56.0	.	NM_024855	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	hg19	CCDS13308.1																																																																																			.	.	.	none		0.418	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
PREX1	57580	hgsc.bcm.edu	37	20	47361658	47361658	+	Silent	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr20:47361658G>A	ENST00000371941.3	-	3	340	c.318C>T	c.(316-318)atC>atT	p.I106I	PREX1_ENST00000396220.1_Silent_p.I106I	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	106	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GAACTTCCAGGATGTCTTCGA	0.473																																					p.I106I		Atlas-SNP	.											.	PREX1	441	.	0			c.C318T						PASS	.						159.0	163.0	162.0					20																	47361658		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon3			TTCCAGGATGTCT	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.318C>T	chr20.hg19:g.47361658G>A		130.0	0.0	.		79.0	22.0	.	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.	.	none		0.473	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
GSTT1	2952	hgsc.bcm.edu	37	22	24384206	24384206	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr22:24384206A>T	ENST00000248935.5	-	1	78	c.26T>A	c.(25-27)cTg>cAg	p.L9Q	GSTT1_ENST00000439996.2_5'UTR	NM_000853.2	NP_000844.2	P30711	GSTT1_HUMAN		9	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)	6					Carboplatin(DB00958)|Cisplatin(DB00515)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)	CTGGGACAGCAGGTCCAGGTA	0.592									Myelodysplasia and Acute Myeloid Leukemia (AML), Familial																												p.L9Q		Atlas-SNP	.											.	GSTT1	14	.	0			c.T26A						PASS	.						77.0	72.0	74.0					22																	24384206		1700	3601	5301	SO:0001583	missense	2952	exon1	Familial Cancer Database	incl.: Familial Myelodysplastic syndrome (late-onset), Familial AML, Familial Monocytic Leukemia, Familial Monosomy 7 and AML	GACAGCAGGTCCA																												ENST00000248935.5:c.26T>A	chr22.hg19:g.24384206A>T	ENSP00000248935:p.Leu9Gln	86.0	0.0	.		84.0	22.0	.	NM_000853	O00226|Q5TZY2|Q6IC69|Q969K8|Q96IY3	Missense_Mutation	SNP	ENST00000248935.5	hg19	CCDS13822.1	.	.	.	.	.	.	.	.	.	.	.	28.3	4.911220	0.92178	.	.	ENSG00000184674	ENST00000248935;ENST00000382792;ENST00000452369;ENST00000417870;ENST00000447865	T;T;T	0.64085	-0.08;-0.08;-0.08	5.31	5.31	0.75309	Glutathione S-transferase, N-terminal (1);Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000006	T	0.77922	0.4203	M	0.80508	2.5	0.80722	D	1	D	0.63046	0.992	D	0.63957	0.92	T	0.81464	-0.0921	10	0.87932	D	0	-11.7318	13.568	0.61830	1.0:0.0:0.0:0.0	.	9	P30711	GSTT1_HUMAN	Q	9	ENSP00000248935:L9Q;ENSP00000406003:L9Q;ENSP00000397362:L9Q	ENSP00000248935:L9Q	L	-	2	0	GSTT1	22714206	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	8.005000	0.88553	2.163000	0.67991	0.451000	0.29950	CTG	.	.	.	none		0.592	GSTT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320184.2		
MT-ND5	4540	hgsc.bcm.edu	37	M	13095	13095	+	Silent	SNP	T	T	C			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chrM:13095T>C	ENST00000361567.2	+	1	759	c.759T>C	c.(757-759)gtT>gtC	p.V253V	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	253			V -> A (in MT-C1D). {ECO:0000269|PubMed:20818383}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AGCACTATAGTTGTAGCAGGA	0.522																																					p.V253V		Atlas-SNP	.											.	.	.	.	0			c.T759C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			TATAGTTGTAGCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.759T>C	chrM.hg19:g.13095T>C		5.0	0.0	.		11.0	6.0	.	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.522	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-CYB	4519	hgsc.bcm.edu	37	M	15614	15614	+	Missense_Mutation	SNP	G	G	A			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chrM:15614G>A	ENST00000361789.2	+	1	868	c.868G>A	c.(868-870)Ggc>Agc	p.G290S	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	290			G -> D (in exercise intolerance). {ECO:0000269|PubMed:8910895}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACAAACTAGGAGGCGTCCTTG	0.458											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G290S		Atlas-SNP	.											.	.	.	.	0			c.G868A						PASS	.																																			SO:0001583	missense	0	exon1			CTAGGAGGCGTCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.868G>A	chrM.hg19:g.15614G>A	ENSP00000354554:p.Gly290Ser	9.0	0.0	.	585	15.0	8.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.458	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
ANKRD44	91526	hgsc.bcm.edu	37	2	197878244	197878244	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr2:197878244delG	ENST00000328737.2	-	18	1916	c.1840delC	c.(1840-1842)catfs	p.H614fs	ANKRD44_ENST00000282272.8_Frame_Shift_Del_p.H631fs|ANKRD44_ENST00000337207.5_Frame_Shift_Del_p.H614fs|ANKRD44_ENST00000450567.1_Frame_Shift_Del_p.H614fs			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	639										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCTGAGGCATGAAGTGGGGTT	0.443																																					p.H639fs		Atlas-Indel,Pindel	.											.	ANKRD44	281	.	0			c.1916delA						PASS	.						168.0	160.0	163.0					2																	197878244		2203	4300	6503	SO:0001589	frameshift_variant	91526	exon18			.	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1840delC	chr2.hg19:g.197878244delG	ENSP00000331516:p.His614fs	141.0	0.0	0		134.0	31.0	0.231343	NM_001195144	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Frame_Shift_Del	DEL	ENST00000328737.2	hg19																																																																																				.	.	.	none		0.443	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
SESN1	27244	hgsc.bcm.edu	37	6	109309823	109309823	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr6:109309823delT	ENST00000356644.7	-	9	1409	c.1315delA	c.(1315-1317)actfs	p.T439fs	SESN1_ENST00000302071.2_Frame_Shift_Del_p.T373fs|SESN1_ENST00000436639.2_Frame_Shift_Del_p.T498fs	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	439					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)				cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		CAAACAACAGTTTTGATATAA	0.343																																					p.T498fs		Atlas-Indel,Pindel	.											.	SESN1	29	.	0			c.1493delC						PASS	.						83.0	75.0	77.0					6																	109309823		2203	4300	6503	SO:0001589	frameshift_variant	27244	exon9			.	AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.1315delA	chr6.hg19:g.109309823delT	ENSP00000349061:p.Thr439fs	51.0	0.0	0		56.0	13.0	0.232143	NM_014454	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Frame_Shift_Del	DEL	ENST00000356644.7	hg19	CCDS56445.1																																																																																			.	.	.	none		0.343	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454	
TRPM3	80036	hgsc.bcm.edu	37	9	73151135	73151136	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr9:73151135_73151136insT	ENST00000377110.3	-	25	5100_5101	c.4857_4858insA	c.(4855-4860)tcagagfs	p.E1620fs	TRPM3_ENST00000423814.3_Frame_Shift_Ins_p.E1647fs|TRPM3_ENST00000377105.1_Frame_Shift_Ins_p.E1479fs|TRPM3_ENST00000396292.4_Frame_Shift_Ins_p.E1492fs|TRPM3_ENST00000358082.3_Frame_Shift_Ins_p.E1482fs|TRPM3_ENST00000408909.2_Frame_Shift_Ins_p.E1479fs|TRPM3_ENST00000396280.5_Frame_Shift_Ins_p.E1469fs|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000357533.2_Frame_Shift_Ins_p.E1624fs|TRPM3_ENST00000396285.1_Frame_Shift_Ins_p.E1479fs|TRPM3_ENST00000360823.2_Frame_Shift_Ins_p.E1482fs|TRPM3_ENST00000377106.1_Frame_Shift_Ins_p.E1492fs			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1645					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AGGGTTCTCTCTGAGTTATCAC	0.55																																					p.E1620fs		Atlas-Indel,Pindel	.											.	TRPM3	700	.	0			c.4858_4859insA						PASS	.																																			SO:0001589	frameshift_variant	80036	exon25			.	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4858dupA	chr9.hg19:g.73151136_73151136dupT	ENSP00000366314:p.Glu1620fs	148.0	0.0	0		129.0	15.0	0.116279	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Frame_Shift_Ins	INS	ENST00000377110.3	hg19	CCDS43835.1																																																																																			.	.	.	none		0.550	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	NM_206945	
SYVN1	84447	hgsc.bcm.edu	37	11	64900251	64900251	+	Splice_Site	DEL	T	T	-			TCGA-KV-A6GD-01A-11D-A31X-10	TCGA-KV-A6GD-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	971ca777-b810-45b5-bcca-7100b2935d0f	92ae44d5-c386-489b-b4aa-c3e169713c55	g.chr11:64900251delT	ENST00000377190.3	-	5	473	c.379delA	c.(379-381)atg>tg	p.M127fs	SYVN1_ENST00000526060.1_Splice_Site_p.M127fs|SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000307289.6_Intron|SYVN1_ENST00000294256.8_Splice_Site_p.M127fs	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	127					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CTGCGTTCCATCTGAGGCAGA	0.612																																					p.M127fs		Atlas-INDEL	.											.	SYVN1	55	.	0			c.380delT						PASS	.						97.0	97.0	97.0					11																	64900251		2201	4297	6498	SO:0001630	splice_region_variant	84447	exon5			.	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.379-1A>-	chr11.hg19:g.64900251delT		76.0	0.0	0		49.0	11.0	0.22449	NM_032431	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Frame_Shift_Del	DEL	ENST00000377190.3	hg19	CCDS31605.1																																																																																			.	.	.	none		0.612	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	Frame_Shift_Del
