#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIK3C2B	5287	hgsc.bcm.edu	37	1	204413511	204413511	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr1:204413511A>G	ENST00000367187.3	-	18	3276	c.2720T>C	c.(2719-2721)aTt>aCt	p.I907T	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.I879T	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	907	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GAGTGAGCCAATCCACTGCAC	0.582																																					p.I907T		Atlas-SNP	.											.	PIK3C2B	142	.	0			c.T2720C						PASS	.						83.0	68.0	73.0					1																	204413511		2203	4300	6503	SO:0001583	missense	5287	exon18			GAGCCAATCCACT	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2720T>C	chr1.hg19:g.204413511A>G	ENSP00000356155:p.Ile907Thr	54.0	0.0	.		43.0	23.0	.	NM_002646	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	hg19	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730234	0.89390	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.67345	-0.26;-0.26	5.98	5.98	0.97165	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.045667	0.85682	D	0.000000	D	0.82559	0.5063	M	0.85197	2.74	0.51482	D	0.999921	D;D	0.61697	0.98;0.99	P;P	0.62885	0.908;0.903	D	0.85512	0.1198	10	0.87932	D	0	.	16.1192	0.81329	1.0:0.0:0.0:0.0	.	879;907	F5GWN5;O00750	.;P3C2B_HUMAN	T	907;879	ENSP00000356155:I907T;ENSP00000400561:I879T	ENSP00000356155:I907T	I	-	2	0	PIK3C2B	202680134	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	9.339000	0.96797	2.288000	0.76882	0.482000	0.46254	ATT	.	.	.	none		0.582	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
TLR5	7100	hgsc.bcm.edu	37	1	223286235	223286235	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr1:223286235T>A	ENST00000540964.1	-	4	600	c.139A>T	c.(139-141)Acc>Tcc	p.T47S	TLR5_ENST00000342210.6_Missense_Mutation_p.T47S			O60602	TLR5_HUMAN	toll-like receptor 5	47					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		CTCTCAGTGGTGTTGAGGACC	0.547																																					p.T47S		Atlas-SNP	.											.	TLR5	86	.	0			c.A139T						PASS	.						62.0	63.0	62.0					1																	223286235		2203	4300	6503	SO:0001583	missense	7100	exon6			CAGTGGTGTTGAG		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.139A>T	chr1.hg19:g.223286235T>A	ENSP00000440643:p.Thr47Ser	140.0	0.0	.		168.0	70.0	.	NM_003268	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	ENST00000540964.1	hg19	CCDS31033.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.480409	0.26598	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	D;D;D	0.82526	-1.62;-1.62;-1.62	4.75	3.6	0.41247	.	0.354369	0.30510	N	0.009461	T	0.70430	0.3223	L	0.48362	1.52	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.50516	-0.8819	10	0.09084	T	0.74	.	3.4825	0.07607	0.0:0.2019:0.2085:0.5896	.	47	O60602	TLR5_HUMAN	S	47	ENSP00000440643:T47S;ENSP00000355846:T47S;ENSP00000340089:T47S	ENSP00000340089:T47S	T	-	1	0	TLR5	221352858	0.318000	0.24598	0.004000	0.12327	0.995000	0.86356	0.650000	0.24858	0.751000	0.32900	0.533000	0.62120	ACC	.	.	.	none		0.547	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268	
TTN	7273	hgsc.bcm.edu	37	2	179424419	179424419	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr2:179424419T>A	ENST00000591111.1	-	276	81741	c.81517A>T	c.(81517-81519)Aat>Tat	p.N27173Y	TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.N26246Y|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.N19749Y|TTN_ENST00000359218.5_Missense_Mutation_p.N19874Y|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N28814Y|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N19941Y|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27173	Ig-like 129.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTTGGCATTTTCAATGGTC	0.423																																					p.N28814Y		Atlas-SNP	.											.	TTN	18412	.	0			c.A86440T						PASS	.						167.0	157.0	160.0					2																	179424419		2006	4191	6197	SO:0001583	missense	7273	exon326			TGGCATTTTCAAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81517A>T	chr2.hg19:g.179424419T>A	ENSP00000465570:p.Asn27173Tyr	104.0	0.0	.		163.0	44.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.56	1.673934	0.29693	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51941	0.1704	M	0.70595	2.14	0.39978	D	0.974889	P;P;P;P	0.49253	0.921;0.921;0.921;0.921	B;B;B;B	0.42163	0.378;0.378;0.378;0.378	T	0.62742	-0.6790	9	0.87932	D	0	.	16.383	0.83481	0.0:0.0:0.0:1.0	.	19749;19874;19941;27173	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Y	26246;19749;19941;19874;19746	ENSP00000343764:N26246Y;ENSP00000434586:N19749Y;ENSP00000340554:N19941Y;ENSP00000352154:N19874Y	ENSP00000340554:N19941Y	N	-	1	0	TTN	179132665	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.039000	0.57325	2.326000	0.78906	0.533000	0.62120	AAT	.	.	.	none		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
EDEM1	9695	hgsc.bcm.edu	37	3	5229984	5229984	+	Missense_Mutation	SNP	C	C	G			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr3:5229984C>G	ENST00000256497.4	+	1	627	c.494C>G	c.(493-495)cCc>cGc	p.P165R	EDEM1_ENST00000445686.1_5'Flank|AC026202.1_ENST00000600805.1_5'Flank|AC026202.3_ENST00000439325.1_RNA	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	165					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		GGCCGTGGGCCCGACCGCGGG	0.736																																					p.P165R		Atlas-SNP	.											.	EDEM1	45	.	0			c.C494G						PASS	.						8.0	10.0	10.0					3																	5229984		2079	4182	6261	SO:0001583	missense	9695	exon1			GTGGGCCCGACCG	D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.494C>G	chr3.hg19:g.5229984C>G	ENSP00000256497:p.Pro165Arg	44.0	0.0	.		54.0	32.0	.	NM_014674	A8K9C8|B4DXP3	Missense_Mutation	SNP	ENST00000256497.4	hg19	CCDS33686.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679794	0.47886	.	.	ENSG00000134109	ENST00000256497	T	0.81415	-1.49	4.81	4.81	0.61882	.	0.109188	0.64402	D	0.000005	T	0.69097	0.3073	N	0.25957	0.775	0.80722	D	1	B	0.32653	0.379	B	0.34180	0.177	T	0.66685	-0.5861	10	0.05959	T	0.93	-8.2011	17.4653	0.87631	0.0:1.0:0.0:0.0	.	165	Q92611	EDEM1_HUMAN	R	165	ENSP00000256497:P165R	ENSP00000256497:P165R	P	+	2	0	EDEM1	5204984	1.000000	0.71417	0.691000	0.30163	0.932000	0.56968	5.419000	0.66435	2.199000	0.70637	0.491000	0.48974	CCC	.	.	.	none		0.736	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337566.2	NM_014674	
ACY1	95	hgsc.bcm.edu	37	3	52022828	52022828	+	Missense_Mutation	SNP	C	C	A			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr3:52022828C>A	ENST00000404366.2	+	14	1194	c.1048C>A	c.(1048-1050)Cgc>Agc	p.R350S	ACY1_ENST00000494103.1_Missense_Mutation_p.R278S|ACY1_ENST00000458031.2_Missense_Mutation_p.R440S|ABHD14A-ACY1_ENST00000463937.1_Missense_Mutation_p.R451S|ACY1_ENST00000476351.1_Missense_Mutation_p.R315S|ACY1_ENST00000476854.1_Missense_Mutation_p.R285S	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	350					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CACTGACAACCGCTATATCCG	0.567																																					p.R350S		Atlas-SNP	.											.	ACY1	35	.	0			c.C1048A						PASS	.						160.0	172.0	168.0					3																	52022828		2203	4300	6503	SO:0001583	missense	95	exon14			GACAACCGCTATA	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.1048C>A	chr3.hg19:g.52022828C>A	ENSP00000384296:p.Arg350Ser	85.0	0.0	.		138.0	65.0	.	NM_001198895	C9J6I6|C9J9D8|C9JWD4	Missense_Mutation	SNP	ENST00000404366.2	hg19	CCDS2844.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709106	0.68615	.	.	ENSG00000114786;ENSG00000114786;ENSG00000114786;ENSG00000243989;ENSG00000243989;ENSG00000243989;ENSG00000243989	ENST00000458031;ENST00000463937;ENST00000232907;ENST00000476854;ENST00000476351;ENST00000494103;ENST00000404366	T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.75766	0.3894	M	0.91872	3.25	0.80722	D	1	D;D	0.76494	0.991;0.999	D;D	0.68039	0.955;0.951	T	0.80522	-0.1345	10	0.62326	D	0.03	-13.0341	19.4166	0.94703	0.0:1.0:0.0:0.0	.	440;350	B4DNW0;Q03154	.;ACY1_HUMAN	S	440;451;350;285;315;278;350	ENSP00000390557:R440S;ENSP00000420487:R451S;ENSP00000419262:R285S;ENSP00000417056:R315S;ENSP00000417618:R278S;ENSP00000384296:R350S	ENSP00000384296:R350S	R	+	1	0	ACY1;RP11-155D18.11	51997868	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	6.896000	0.75665	2.679000	0.91253	0.655000	0.94253	CGC	.	.	.	none		0.567	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666	
PLXND1	23129	hgsc.bcm.edu	37	3	129281631	129281631	+	Splice_Site	SNP	A	A	G			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr3:129281631A>G	ENST00000324093.4	-	27	5002	c.4824T>C	c.(4822-4824)ctT>ctC	p.L1608L	PLXND1_ENST00000393239.1_Splice_Site_p.L1608L	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1608					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CCCACCCACCAAGGTCGACGT	0.627																																					p.L1608L	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.T4824C						PASS	.						64.0	56.0	58.0					3																	129281631		2203	4300	6503	SO:0001630	splice_region_variant	23129	exon27			CCCACCAAGGTCG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.4825+1T>C	chr3.hg19:g.129281631A>G		25.0	0.0	.		50.0	25.0	.	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Silent	SNP	ENST00000324093.4	hg19	CCDS33854.1																																																																																			.	.	.	none		0.627	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	Silent
MDGA1	266727	hgsc.bcm.edu	37	6	37622225	37622225	+	Silent	SNP	G	G	T			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr6:37622225G>T	ENST00000434837.3	-	6	1985	c.807C>A	c.(805-807)ccC>ccA	p.P269P	MDGA1_ENST00000297153.7_Silent_p.P269P|MDGA1_ENST00000505425.1_Silent_p.P269P	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	269	Ig-like 3.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						GCTGGGGGAGGGGATCACCGC	0.642																																					p.P269P		Atlas-SNP	.											.	MDGA1	104	.	0			c.C807A						PASS	.						45.0	48.0	47.0					6																	37622225		2076	4205	6281	SO:0001819	synonymous_variant	266727	exon6			GGGGAGGGGATCA	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.807C>A	chr6.hg19:g.37622225G>T		115.0	0.0	.		79.0	34.0	.	NM_153487	A6NHG0|Q8NBE3	Silent	SNP	ENST00000434837.3	hg19	CCDS47417.1																																																																																			.	.	.	none		0.642	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3		
USP45	85015	hgsc.bcm.edu	37	6	99894085	99894085	+	Silent	SNP	T	T	C			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr6:99894085T>C	ENST00000327681.6	-	14	2095	c.1563A>G	c.(1561-1563)agA>agG	p.R521R	USP45_ENST00000369233.2_Silent_p.R473R|USP45_ENST00000539675.1_Intron|USP45_ENST00000500704.2_Silent_p.R521R|USP45_ENST00000392738.2_Silent_p.R201R	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	521	USP.		R -> T (in dbSNP:rs41288947). {ECO:0000269|PubMed:15489334}.		protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		CACTACTGGATCTGAACAGCC	0.483																																					p.R521R		Atlas-SNP	.											.	USP45	56	.	0			c.A1563G						PASS	.						83.0	69.0	74.0					6																	99894085		2203	4300	6503	SO:0001819	synonymous_variant	85015	exon14			ACTGGATCTGAAC	AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.1563A>G	chr6.hg19:g.99894085T>C		69.0	0.0	.		60.0	23.0	.	NM_001080481	B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Silent	SNP	ENST00000327681.6	hg19	CCDS34501.1																																																																																			.	.	.	none		0.483	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041609.2	NM_032929	
GBA2	57704	hgsc.bcm.edu	37	9	35736272	35736272	+	IGR	SNP	T	T	C			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr9:35736272T>C	ENST00000378103.3	-	0	3611				CREB3_ENST00000486056.1_3'UTR|CREB3_ENST00000353704.2_Missense_Mutation_p.S249P|GBA2_ENST00000467252.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TATGTACTCCTCTGACACAAG	0.552											OREG0019176	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S249P		Atlas-SNP	.											.	CREB3	24	.	0			c.T745C						PASS	.						220.0	207.0	211.0					9																	35736272		2203	4300	6503	SO:0001628	intergenic_variant	10488	exon8			TACTCCTCTGACA	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		chr9.hg19:g.35736272T>C		75.0	0.0	.	857	55.0	23.0	.	NM_006368	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	hg19	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.018246	0.75275	.	.	ENSG00000107175	ENST00000353704	T	0.67865	-0.29	5.68	4.56	0.56223	.	0.238919	0.43260	D	0.000597	T	0.74068	0.3668	L	0.56769	1.78	0.42787	D	0.993883	D;D	0.76494	0.999;0.996	D;D	0.66196	0.942;0.919	T	0.71394	-0.4606	10	0.26408	T	0.33	.	10.8203	0.46601	0.0:0.0743:0.0:0.9257	.	273;249	O43889;O43889-2	CREB3_HUMAN;.	P	249	ENSP00000342136:S249P	ENSP00000342136:S249P	S	+	1	0	CREB3	35726272	0.999000	0.42202	0.698000	0.30274	0.980000	0.70556	3.862000	0.56009	2.182000	0.69389	0.533000	0.62120	TCT	.	.	.	none		0.552	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
MAP3K8	1326	hgsc.bcm.edu	37	10	30748425	30748425	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr10:30748425T>G	ENST00000263056.1	+	8	1964	c.1268T>G	c.(1267-1269)aTt>aGt	p.I423S	MAP3K8_ENST00000542547.1_Missense_Mutation_p.I423S|MAP3K8_ENST00000375321.1_Missense_Mutation_p.I423S	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	423			Missing (in oncogenic form).		cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				CCTGAGAACATTGCTGGTAGG	0.527																																					p.I423S		Atlas-SNP	.											.	MAP3K8	46	.	0			c.T1268G						PASS	.						70.0	62.0	65.0					10																	30748425		2203	4300	6503	SO:0001583	missense	1326	exon7			AGAACATTGCTGG	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.1268T>G	chr10.hg19:g.30748425T>G	ENSP00000263056:p.Ile423Ser	48.0	0.0	.		42.0	17.0	.	NM_001244134	A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Missense_Mutation	SNP	ENST00000263056.1	hg19	CCDS7166.1	.	.	.	.	.	.	.	.	.	.	T	15.81	2.944339	0.53079	.	.	ENSG00000107968	ENST00000375328;ENST00000263056;ENST00000542547;ENST00000375321	T;T;T	0.70749	-0.51;-0.51;-0.51	4.91	4.91	0.64330	Protein kinase-like domain (1);	0.048008	0.85682	D	0.000000	T	0.52517	0.1739	N	0.24115	0.695	0.80722	D	1	P	0.35575	0.51	B	0.32211	0.142	T	0.52638	-0.8549	10	0.08599	T	0.76	.	14.5659	0.68176	0.0:0.0:0.0:1.0	.	423	P41279	M3K8_HUMAN	S	423	ENSP00000263056:I423S;ENSP00000443610:I423S;ENSP00000364470:I423S	ENSP00000263056:I423S	I	+	2	0	MAP3K8	30788431	1.000000	0.71417	0.979000	0.43373	0.850000	0.48378	5.323000	0.65858	1.850000	0.53721	0.519000	0.50382	ATT	.	.	.	none		0.527	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204	
DNHD1	144132	hgsc.bcm.edu	37	11	6592937	6592937	+	Silent	SNP	G	G	T	rs544585664		TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr11:6592937G>T	ENST00000527990.2	+	41	13983	c.13983G>T	c.(13981-13983)gcG>gcT	p.A4661A	DNHD1_ENST00000254579.6_Silent_p.A4661A			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4661					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCCTACATGCGGAGTGGGACC	0.627																																					p.A4661A		Atlas-SNP	.											.	DNHD1	198	.	0			c.G13983T						PASS	.						36.0	46.0	43.0					11																	6592937		2097	4219	6316	SO:0001819	synonymous_variant	144132	exon43			ACATGCGGAGTGG	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.13983G>T	chr11.hg19:g.6592937G>T		92.0	0.0	.		74.0	4.0	.	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	ENST00000527990.2	hg19	CCDS44532.1																																																																																			.	.	.	none		0.627	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
VSIG10	54621	hgsc.bcm.edu	37	12	118506351	118506351	+	Silent	SNP	C	C	T	rs373328738		TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr12:118506351C>T	ENST00000359236.5	-	8	1674	c.1398G>A	c.(1396-1398)gaG>gaA	p.E466E		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	466	Glu-rich.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						cctcctcctcctcttcctctt	0.458																																					p.E466E		Atlas-SNP	.											.	VSIG10	41	.	0			c.G1398A						PASS	.						96.0	91.0	92.0					12																	118506351		2045	4191	6236	SO:0001819	synonymous_variant	54621	exon8			CTCCTCCTCTTCC		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1398G>A	chr12.hg19:g.118506351C>T		100.0	0.0	.		132.0	8.0	.	NM_019086	Q9NWQ7	Silent	SNP	ENST00000359236.5	hg19	CCDS44992.1																																																																																			.	.	.	weak		0.458	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
PRMT5	10419	hgsc.bcm.edu	37	14	23397402	23397402	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr14:23397402A>G	ENST00000324366.8	-	3	471	c.248T>C	c.(247-249)gTg>gCg	p.V83A	PRMT5_ENST00000553641.1_5'UTR|PRMT5_ENST00000553897.1_Intron|PRMT5-AS1_ENST00000595662.1_RNA|RP11-298I3.1_ENST00000548322.1_RNA|PRMT5_ENST00000216350.8_Intron|PRMT5_ENST00000397440.4_Missense_Mutation_p.V66A|PRMT5_ENST00000397441.2_Missense_Mutation_p.V66A|PRMT5-AS1_ENST00000587245.2_RNA|PRMT5_ENST00000538452.1_5'UTR|RP11-298I3.1_ENST00000548819.1_RNA|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5-AS1_ENST00000599580.2_RNA	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	83	TIM barrel. {ECO:0000269|PubMed:23071334}.				cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		AAGCTTTCCCACAATTAGCGT	0.433																																					p.V83A		Atlas-SNP	.											.	PRMT5	101	.	0			c.T248C						PASS	.						92.0	82.0	85.0					14																	23397402		2203	4300	6503	SO:0001583	missense	10419	exon3			TTTCCCACAATTA	AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.248T>C	chr14.hg19:g.23397402A>G	ENSP00000319169:p.Val83Ala	59.0	0.0	.		85.0	33.0	.	NM_006109	A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	ENST00000324366.8	hg19	CCDS9579.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.564340	0.86335	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000397440;ENST00000553550;ENST00000554867;ENST00000556616;ENST00000554910;ENST00000421938	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.80534	0.4641	M	0.84683	2.71	0.80722	D	1	D;D;D	0.71674	0.963;0.991;0.998	D;P;D	0.68765	0.959;0.73;0.96	D	0.83988	0.0336	9	0.87932	D	0	-13.1665	14.9141	0.70781	1.0:0.0:0.0:0.0	.	66;83;66	A8MTP3;O14744;A8MZ91	.;ANM5_HUMAN;.	A	83;66;66;83;83;45;41;93	.	ENSP00000319169:V83A	V	-	2	0	PRMT5	22467242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.199000	0.89731	2.176000	0.68965	0.455000	0.32223	GTG	.	.	.	none		0.433	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071674.3		
PRMT7	54496	hgsc.bcm.edu	37	16	68386313	68386313	+	Splice_Site	SNP	G	G	A			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr16:68386313G>A	ENST00000339507.5	+	15	2405		c.e15+1		PRMT7_ENST00000441236.1_Splice_Site|PRMT7_ENST00000348497.4_Splice_Site|PRMT7_ENST00000449359.3_Splice_Site			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7						cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		GGAGTTCAGGGTAGGCCACCC	0.622																																					.		Atlas-SNP	.											.	PRMT7	51	.	0			c.1425+1G>A						PASS	.						40.0	38.0	39.0					16																	68386313		2198	4300	6498	SO:0001630	splice_region_variant	54496	exon13			TTCAGGGTAGGCC	AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.1575+1G>A	chr16.hg19:g.68386313G>A		12.0	0.0	.		22.0	9.0	.	NM_001184824	B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Splice_Site	SNP	ENST00000339507.5	hg19	CCDS10866.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947713	0.73787	.	.	ENSG00000132600	ENST00000449359;ENST00000441236;ENST00000348497;ENST00000339507	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9994	0.80280	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRMT7	66943814	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	9.352000	0.97076	2.392000	0.81423	0.655000	0.94253	.	.	.	.	none		0.622	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268892.3	NM_019023	Intron
BLMH	642	hgsc.bcm.edu	37	17	28614937	28614937	+	Missense_Mutation	SNP	G	G	A			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr17:28614937G>A	ENST00000261714.6	-	4	524	c.350C>T	c.(349-351)gCt>gTt	p.A117V	BLMH_ENST00000582669.1_5'Flank|BLMH_ENST00000394819.3_Missense_Mutation_p.A30V|RNU6-1267P_ENST00000410747.1_RNA	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	117					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	GTCCACAAAAGCACTCAAGAA	0.388																																					p.A117V	Pancreas(127;628 1772 12912 33293 36203)	Atlas-SNP	.											.	BLMH	42	.	0			c.C350T						PASS	.						88.0	85.0	86.0					17																	28614937		2203	4300	6503	SO:0001583	missense	642	exon4			ACAAAAGCACTCA	X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.350C>T	chr17.hg19:g.28614937G>A	ENSP00000261714:p.Ala117Val	75.0	0.0	.		76.0	17.0	.	NM_000386	B2R796|Q53F86|Q9UER9	Missense_Mutation	SNP	ENST00000261714.6	hg19	CCDS32604.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769945	0.69992	.	.	ENSG00000108578	ENST00000261714;ENST00000394819	T;T	0.44881	0.91;0.91	5.95	5.95	0.96441	.	0.197192	0.52532	D	0.000067	T	0.45637	0.1352	M	0.63208	1.945	0.51233	D	0.999918	B;B	0.23540	0.087;0.036	B;B	0.25759	0.063;0.039	T	0.31530	-0.9940	10	0.49607	T	0.09	-8.7167	17.5491	0.87871	0.0:0.0:1.0:0.0	.	30;117	E7EMN3;Q13867	.;BLMH_HUMAN	V	117;30	ENSP00000261714:A117V;ENSP00000378296:A30V	ENSP00000261714:A117V	A	-	2	0	BLMH	25639063	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.945000	0.63568	2.824000	0.97209	0.655000	0.94253	GCT	.	.	.	none		0.388	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447940.1	NM_000386	
ZNF677	342926	hgsc.bcm.edu	37	19	53740610	53740610	+	Missense_Mutation	SNP	T	T	C			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr19:53740610T>C	ENST00000598513.1	-	5	1520	c.1370A>G	c.(1369-1371)aAa>aGa	p.K457R	ZNF677_ENST00000333952.4_Missense_Mutation_p.K457R	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TTTGTAAGGTTTTTCTCCAGT	0.378																																					p.K457R		Atlas-SNP	.											.	ZNF677	94	.	0			c.A1370G						PASS	.						54.0	52.0	53.0					19																	53740610		2203	4300	6503	SO:0001583	missense	342926	exon5			TAAGGTTTTTCTC	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1370A>G	chr19.hg19:g.53740610T>C	ENSP00000469391:p.Lys457Arg	65.0	0.0	.		80.0	23.0	.	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	hg19	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	T	16.82	3.227295	0.58668	.	.	ENSG00000197928	ENST00000333952	T	0.24908	1.83	2.21	1.14	0.20703	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37393	N	0.002104	T	0.26085	0.0636	N	0.13272	0.32	0.25071	N	0.990998	D	0.67145	0.996	D	0.69142	0.962	T	0.05194	-1.0900	10	0.72032	D	0.01	.	6.5871	0.22626	0.0:0.0:0.2456:0.7543	.	457	Q86XU0	ZN677_HUMAN	R	457	ENSP00000334394:K457R	ENSP00000334394:K457R	K	-	2	0	ZNF677	58432422	0.880000	0.30214	0.998000	0.56505	0.997000	0.91878	0.417000	0.21214	0.277000	0.22141	0.533000	0.62120	AAA	.	.	.	none		0.378	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		Atlas-SNP	.											.	ZNF814	93	.	0			c.C968A						PASS	.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	chr19.hg19:g.58385790G>T	ENSP00000410545:p.Pro323His	87.0	0.0	.		115.0	8.0	.	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	hg19	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	.	G|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	chr19.hg19:g.58385793C>T	ENSP00000410545:p.Arg322Lys	81.0	0.0	.		107.0	8.0	.	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	hg19	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	.	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
TRAPPC10	7109	hgsc.bcm.edu	37	21	45502876	45502876	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr21:45502876G>A	ENST00000291574.4	+	14	2106	c.1931G>A	c.(1930-1932)tGg>tAg	p.W644*		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	644					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						ACTGCGGAGTGGCTTACCAAG	0.512																																					p.W644X		Atlas-SNP	.											.	TRAPPC10	109	.	0			c.G1931A						PASS	.						162.0	150.0	154.0					21																	45502876		2203	4300	6503	SO:0001587	stop_gained	7109	exon14			CGGAGTGGCTTAC	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1931G>A	chr21.hg19:g.45502876G>A	ENSP00000291574:p.Trp644*	121.0	0.0	.		67.0	32.0	.	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Nonsense_Mutation	SNP	ENST00000291574.4	hg19	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	G	38	7.254018	0.98168	.	.	ENSG00000160218	ENST00000291574	.	.	.	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	19.1791	0.93615	0.0:0.0:1.0:0.0	.	.	.	.	X	644	.	ENSP00000291574:W644X	W	+	2	0	TRAPPC10	44327304	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	5.397000	0.66302	2.622000	0.88805	0.655000	0.94253	TGG	.	.	.	none		0.512	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
F13A1	2162	hgsc.bcm.edu	37	6	6222265	6222266	+	Splice_Site	INS	-	-	CACA			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr6:6222265_6222266insCACA	ENST00000264870.3	-	8	1377_1378		c.e8+1			NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide						blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	ATCAAACTCACCACACTGAATC	0.376																																					.		Atlas-Indel,Pindel	.											.	F13A1	135	.	0			c.1112+1->TGTG						PASS	.																																			SO:0001630	splice_region_variant	2162	exon9			.	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1112+1->TGTG	chr6.hg19:g.6222266_6222269dupCACA		55.0	0.0	0		56.0	22.0	0.392857	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Splice_Site	INS	ENST00000264870.3	hg19	CCDS4496.1																																																																																			.	.	.	none		0.376	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	Intron
ENPP1	5167	hgsc.bcm.edu	37	6	132211511	132211511	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr6:132211511delG	ENST00000360971.2	+	25	2658	c.2638delG	c.(2638-2640)gaafs	p.E880fs		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	880	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	ATGGGTTGAAGAATTGTTAAT	0.388																																					p.E879fs	Colon(104;336 1535 5856 11019 33782)	Atlas-INDEL	.											.	ENPP1	108	.	0			c.2637delA						PASS	.						132.0	123.0	126.0					6																	132211511		2203	4300	6503	SO:0001589	frameshift_variant	5167	exon25			.	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2638delG	chr6.hg19:g.132211511delG	ENSP00000354238:p.Glu880fs	165.0	0.0	0		167.0	46.0	0.275449	NM_006208	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Frame_Shift_Del	DEL	ENST00000360971.2	hg19	CCDS5150.2																																																																																			.	.	.	none		0.388	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2		
ARHGEF5	7984	hgsc.bcm.edu	37	7	144063479	144063479	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr7:144063479delG	ENST00000056217.5	+	3	3360	c.3186delG	c.(3184-3186)ccgfs	p.P1062fs	ARHGEF5_ENST00000471847.2_5'UTR	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1062					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					AGAAACATCCGGGACCCTCAG	0.483																																					p.P1062fs		Atlas-INDEL	.											.	ARHGEF5	73	.	0			c.3185delC						PASS	.						41.0	40.0	40.0					7																	144063479		2196	4273	6469	SO:0001589	frameshift_variant	7984	exon3			.	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.3186delG	chr7.hg19:g.144063479delG	ENSP00000056217:p.Pro1062fs	514.0	0.0	0		900.0	80.0	0.0888889	NM_005435	A6NNJ2|Q6ZML7	Frame_Shift_Del	DEL	ENST00000056217.5	hg19	CCDS34771.1																																																																																			.	.	.	none		0.483	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
ENPP1	5167	hgsc.bcm.edu	37	6	132211511	132211512	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-KV-A6GE-01A-11D-A31X-10	TCGA-KV-A6GE-10A-01D-A31X-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aff18e57-af36-44a3-8a58-5c8633a7ae20	24f06120-19b5-449d-88bf-45b846e314f7	g.chr6:132211511_132211512delGA	ENST00000360971.2	+	25	2658_2659	c.2638_2639delGA	c.(2638-2640)gaafs	p.E880fs		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	880	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	ATGGGTTGAAGAATTGTTAATG	0.391																																					p.879_880del	Colon(104;336 1535 5856 11019 33782)	Pindel	.											.	ENPP1	108	.	0			c.2637_2638del						PASS	.																																			SO:0001589	frameshift_variant	5167	exon25			.	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2638_2639delGA	chr6.hg19:g.132211511_132211512delGA	ENSP00000354238:p.Glu880fs	167.0	0.0	.		167.0	33.0	0.198	NM_006208	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Frame_Shift_Del	DEL	ENST00000360971.2	hg19	CCDS5150.2																																																																																			.	.	.	none		0.391	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2		
