#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LRP1B	53353	hgsc.bcm.edu	37	2	141122239	141122239	+	Missense_Mutation	SNP	C	C	A	rs200747526	byFrequency	TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr2:141122239C>A	ENST00000389484.3	-	72	12093	c.11122G>T	c.(11122-11124)Gat>Tat	p.D3708Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3708	LDL-receptor class A 30. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCACACATATCAGGGGCTTCA	0.443										TSP Lung(27;0.18)																											p.D3708Y	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.G11122T						PASS	.						97.0	94.0	95.0					2																	141122239		2203	4300	6503	SO:0001583	missense	53353	exon72			ACATATCAGGGGC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11122G>T	chr2.hg19:g.141122239C>A	ENSP00000374135:p.Asp3708Tyr	233.0	0.0	.		258.0	27.0	.	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430671	0.62844	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.87571	-2.27	5.48	5.48	0.80851	.	0.124779	0.52532	D	0.000065	D	0.87569	0.6210	N	0.19112	0.55	0.53005	D	0.999963	P	0.45474	0.859	P	0.55455	0.776	D	0.88303	0.2951	10	0.54805	T	0.06	.	19.711	0.96096	0.0:1.0:0.0:0.0	.	3708	Q9NZR2	LRP1B_HUMAN	Y	3708;3646	ENSP00000374135:D3708Y	ENSP00000374135:D3708Y	D	-	1	0	LRP1B	140838709	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	4.566000	0.60843	2.726000	0.93360	0.655000	0.94253	GAT	.	C|1.000;G|0.000	.	alt		0.443	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
DHRS9	10170	hgsc.bcm.edu	37	2	169952139	169952139	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr2:169952139T>G	ENST00000327239.4	+	8	2326	c.822T>G	c.(820-822)agT>agG	p.S274R	DHRS9_ENST00000428522.1_Missense_Mutation_p.S274R|DHRS9_ENST00000602501.1_Missense_Mutation_p.S274R|DHRS9_ENST00000436483.2_Missense_Mutation_p.S274R|DHRS9_ENST00000357546.2_Missense_Mutation_p.S274R|DHRS9_ENST00000432060.2_Missense_Mutation_p.S334R|DHRS9_ENST00000412271.1_Missense_Mutation_p.S274R|DHRS9_ENST00000421653.1_Missense_Mutation_p.S127R	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9	274					9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						CTCTAACAAGTCTCTTCCCTA	0.428																																					p.S274R		Atlas-SNP	.											.	DHRS9	29	.	0			c.T822G						PASS	.						143.0	137.0	139.0					2																	169952139		2203	4300	6503	SO:0001583	missense	10170	exon8			AACAAGTCTCTTC	AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.822T>G	chr2.hg19:g.169952139T>G	ENSP00000316670:p.Ser274Arg	220.0	0.0	.		275.0	181.0	.	NM_005771	B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Missense_Mutation	SNP	ENST00000327239.4	hg19	CCDS2231.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.239485	0.79800	.	.	ENSG00000073737	ENST00000327239;ENST00000357546;ENST00000432060;ENST00000428522;ENST00000421653;ENST00000436483;ENST00000412271	D;D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	5.93	3.6	0.41247	NAD(P)-binding domain (1);	0.083052	0.85682	D	0.000000	D	0.91436	0.7297	M	0.89353	3.025	0.43683	D	0.996124	D;D	0.76494	0.999;0.998	D;D	0.72338	0.969;0.977	D	0.90197	0.4254	10	0.56958	D	0.05	.	6.2354	0.20760	0.0:0.3359:0.0:0.6641	.	334;274	B7Z416;Q9BPW9	.;DHRS9_HUMAN	R	274;274;334;274;127;274;274	ENSP00000316670:S274R;ENSP00000350154:S274R;ENSP00000389241:S334R;ENSP00000388564:S274R;ENSP00000388066:S127R;ENSP00000407167:S274R;ENSP00000407747:S274R	ENSP00000316670:S274R	S	+	3	2	DHRS9	169660385	0.908000	0.30866	1.000000	0.80357	0.991000	0.79684	1.156000	0.31712	1.081000	0.41110	0.533000	0.62120	AGT	.	.	.	none		0.428	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333612.3	NM_005771	
UNC80	285175	hgsc.bcm.edu	37	2	210636827	210636827	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr2:210636827G>T	ENST00000439458.1	+	1	111	c.31G>T	c.(31-33)Gag>Tag	p.E11*	UNC80_ENST00000272845.6_Nonsense_Mutation_p.E11*|UNC80_ENST00000478701.1_3'UTR	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	11					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CGAGGGCCAGGAGCAGGACGG	0.716																																					p.E11X		Atlas-SNP	.											.	UNC80	280	.	0			c.G31T						PASS	.						13.0	16.0	15.0					2																	210636827		1792	3436	5228	SO:0001587	stop_gained	285175	exon1			GGCCAGGAGCAGG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.31G>T	chr2.hg19:g.210636827G>T	ENSP00000391088:p.Glu11*	273.0	0.0	.		321.0	37.0	.	NM_182587	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Nonsense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042129	0.93685	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	.	.	.	4.43	4.43	0.53597	.	0.153946	0.45361	D	0.000375	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	17.288	0.87147	0.0:0.0:1.0:0.0	.	.	.	.	X	11	.	ENSP00000272845:E11X	E	+	1	0	UNC80	210345072	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	8.744000	0.91596	2.333000	0.79357	0.184000	0.17185	GAG	.	.	.	none		0.716	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
TTLL4	9654	hgsc.bcm.edu	37	2	219617904	219617904	+	Missense_Mutation	SNP	C	C	A			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr2:219617904C>A	ENST00000392102.1	+	18	3594	c.3254C>A	c.(3253-3255)cCa>cAa	p.P1085Q	TTLL4_ENST00000457313.1_Missense_Mutation_p.P920Q|TTLL4_ENST00000442769.1_Missense_Mutation_p.P1021Q|TTLL4_ENST00000258398.4_Missense_Mutation_p.P1085Q	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	1085					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		GATTCTGCTCCAGTGGTGAGT	0.537																																					p.P1085Q	GBM(172;1818 2053 15407 20943 49753)	Atlas-SNP	.											.	TTLL4	96	.	0			c.C3254A						PASS	.						201.0	188.0	193.0					2																	219617904		2203	4300	6503	SO:0001583	missense	9654	exon18			CTGCTCCAGTGGT		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.3254C>A	chr2.hg19:g.219617904C>A	ENSP00000375951:p.Pro1085Gln	68.0	0.0	.		65.0	40.0	.	NM_014640	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	hg19	CCDS2422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.48|12.48	1.950870|1.950870	0.34471|0.34471	.|.	.|.	ENSG00000135912|ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398|ENST00000417855	T;T;T;T|.	0.03982|.	3.95;4.16;3.74;4.16|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.860350|.	0.10371|.	N|.	0.682880|.	T|T	0.57858|0.57858	0.2082|0.2082	L|L	0.43701|0.43701	1.375|1.375	0.39078|0.39078	D|D	0.960852|0.960852	B;B;P|.	0.40834|.	0.085;0.158;0.73|.	B;B;B|.	0.35550|.	0.017;0.031;0.205|.	T|T	0.56432|0.56432	-0.7980|-0.7980	10|5	0.12430|.	T|.	0.62|.	.|.	11.2543|11.2543	0.49045|0.49045	0.1951:0.8049:0.0:0.0|0.1951:0.8049:0.0:0.0	.|.	920;1021;1085|.	E9PH58;E7EX20;Q14679|.	.;.;TTLL4_HUMAN|.	Q|K	920;1085;1021;1085|109	ENSP00000393332:P920Q;ENSP00000375951:P1085Q;ENSP00000396555:P1021Q;ENSP00000258398:P1085Q|.	ENSP00000258398:P1085Q|.	P|Q	+|+	2|1	0|0	TTLL4|TTLL4	219326148|219326148	0.819000|0.819000	0.29175|0.29175	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.040000|2.040000	0.41203|0.41203	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	CCA|CAG	.	.	.	none		0.537	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
LYAR	55646	hgsc.bcm.edu	37	4	4270271	4270271	+	Nonsense_Mutation	SNP	T	T	A			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr4:4270271T>A	ENST00000343470.4	-	9	1231	c.991A>T	c.(991-993)Aag>Tag	p.K331*	LYAR_ENST00000452476.1_Nonsense_Mutation_p.K331*	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	331	Lys-rich.					nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TTCCTTAGCTTTTTGATGGTT	0.318																																					p.K331X		Atlas-SNP	.											.	LYAR	36	.	0			c.A991T						PASS	.						222.0	211.0	215.0					4																	4270271		2203	4300	6503	SO:0001587	stop_gained	55646	exon9			TTAGCTTTTTGAT	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.991A>T	chr4.hg19:g.4270271T>A	ENSP00000345917:p.Lys331*	89.0	0.0	.		62.0	9.0	.	NM_017816	D3DVS4|Q6FI78|Q9NYS1	Nonsense_Mutation	SNP	ENST00000343470.4	hg19	CCDS3374.1	.	.	.	.	.	.	.	.	.	.	T	39	7.639047	0.98406	.	.	ENSG00000145220	ENST00000343470;ENST00000452476	.	.	.	5.93	5.93	0.95920	.	0.088101	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.5133	16.0564	0.80809	0.0:0.0:0.0:1.0	.	.	.	.	X	331	.	ENSP00000345917:K331X	K	-	1	0	LYAR	4321172	1.000000	0.71417	0.989000	0.46669	0.871000	0.50021	6.068000	0.71201	2.271000	0.75665	0.459000	0.35465	AAG	.	.	.	none		0.318	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816	
SULT1B1	27284	hgsc.bcm.edu	37	4	70620844	70620844	+	Missense_Mutation	SNP	A	A	G			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr4:70620844A>G	ENST00000310613.3	-	2	389	c.92T>C	c.(91-93)aTt>aCt	p.I31T		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	31					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						GAACTGTTCAATTTTTTCCCA	0.408																																					p.I31T		Atlas-SNP	.											.	SULT1B1	46	.	0			c.T92C						PASS	.						153.0	149.0	151.0					4																	70620844		2203	4300	6503	SO:0001583	missense	27284	exon2			TGTTCAATTTTTT	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.92T>C	chr4.hg19:g.70620844A>G	ENSP00000308770:p.Ile31Thr	106.0	0.0	.		98.0	10.0	.	NM_014465	O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	ENST00000310613.3	hg19	CCDS3530.1	.	.	.	.	.	.	.	.	.	.	A	14.36	2.511687	0.44660	.	.	ENSG00000173597	ENST00000310613;ENST00000510821;ENST00000512870	T;T;T	0.01918	4.56;4.56;4.56	4.97	2.53	0.30540	.	0.374774	0.22569	N	0.058373	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	B	0.32939	0.391	P	0.46758	0.526	T	0.44544	-0.9321	10	0.62326	D	0.03	.	6.2024	0.20583	0.73:0.1821:0.0879:0.0	.	31	O43704	ST1B1_HUMAN	T	31;31;12	ENSP00000308770:I31T;ENSP00000425464:I31T;ENSP00000427536:I12T	ENSP00000308770:I31T	I	-	2	0	SULT1B1	70655433	0.070000	0.21116	0.000000	0.03702	0.011000	0.07611	3.739000	0.55075	0.329000	0.23460	0.482000	0.46254	ATT	.	.	.	none		0.408	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251563.2	NM_014465	
ATOH1	474	hgsc.bcm.edu	37	4	94750489	94750489	+	Missense_Mutation	SNP	G	G	T			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr4:94750489G>T	ENST00000306011.3	+	1	448	c.412G>T	c.(412-414)Gac>Tac	p.D138Y		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	138					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		GGTGGTGGTAGACGAGCTGGG	0.667																																					p.D138Y		Atlas-SNP	.											.	ATOH1	40	.	0			c.G412T						PASS	.						30.0	40.0	37.0					4																	94750489		2203	4299	6502	SO:0001583	missense	474	exon1			GTGGTAGACGAGC	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.412G>T	chr4.hg19:g.94750489G>T	ENSP00000302216:p.Asp138Tyr	114.0	0.0	.		101.0	48.0	.	NM_005172	Q14CT9	Missense_Mutation	SNP	ENST00000306011.3	hg19	CCDS3638.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238517	0.22711	.	.	ENSG00000172238	ENST00000306011	D	0.97752	-4.52	4.27	4.27	0.50696	.	0.421469	0.22988	N	0.053226	D	0.93789	0.8014	N	0.19112	0.55	0.27027	N	0.964335	P	0.39576	0.679	B	0.37833	0.259	D	0.90439	0.4430	10	0.62326	D	0.03	-14.0929	12.1655	0.54127	0.0:0.0:1.0:0.0	.	138	Q92858	ATOH1_HUMAN	Y	138	ENSP00000302216:D138Y	ENSP00000302216:D138Y	D	+	1	0	ATOH1	94969512	1.000000	0.71417	0.923000	0.36655	0.915000	0.54546	4.756000	0.62205	2.229000	0.72834	0.543000	0.68304	GAC	.	.	.	none		0.667	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253585.1	NM_005172	
LPL	4023	hgsc.bcm.edu	37	8	19813385	19813385	+	Missense_Mutation	SNP	G	G	A	rs118204062		TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr8:19813385G>A	ENST00000311322.8	+	6	1279	c.809G>A	c.(808-810)cGc>cAc	p.R270H		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	270			R -> C (in LPL deficiency). {ECO:0000269|PubMed:15256764, ECO:0000269|PubMed:7906986, ECO:0000269|PubMed:8778602, ECO:0000269|PubMed:9279761}.|R -> H (in LPL deficiency; loss of activity). {ECO:0000269|PubMed:15256764, ECO:0000269|PubMed:1619366, ECO:0000269|PubMed:1702428, ECO:0000269|PubMed:1752947, ECO:0000269|PubMed:7906986, ECO:0000269|PubMed:9714430}.		chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	TCCCACGAGCGCTCCATTCAT	0.458																																					p.R270H		Atlas-SNP	.											.	LPL	78	.	0			c.G809A	GRCh37	CM910265|CM962613	LPL	M	rs118204062	PASS	.						93.0	95.0	94.0					8																	19813385		2203	4300	6503	SO:0001583	missense	4023	exon6			ACGAGCGCTCCAT		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.809G>A	chr8.hg19:g.19813385G>A	ENSP00000309757:p.Arg270His	83.0	0.0	.		86.0	25.0	.	NM_000237	B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	ENST00000311322.8	hg19	CCDS6012.1	.	.	.	.	.	.	.	.	.	.	G	35	5.534310	0.96460	.	.	ENSG00000175445	ENST00000311322;ENST00000538071;ENST00000535763	D	0.97209	-4.29	6.07	6.07	0.98685	Lipase, N-terminal (1);	0.043982	0.85682	N	0.000000	D	0.98570	0.9522	M	0.85630	2.765	0.41185	D	0.986265	D	0.89917	1.0	D	0.97110	1.0	D	0.98779	1.0731	8	.	.	.	-20.7835	18.2083	0.89861	0.0:0.0:1.0:0.0	.	270	P06858	LIPL_HUMAN	H	270;194;256	ENSP00000309757:R270H	.	R	+	2	0	LPL	19857665	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	9.807000	0.99171	2.902000	0.99343	0.650000	0.86243	CGC	.	.	.	weak		0.458	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3		
ZFAND1	79752	hgsc.bcm.edu	37	8	82615255	82615255	+	Missense_Mutation	SNP	A	A	T			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr8:82615255A>T	ENST00000220669.5	-	7	603	c.585T>A	c.(583-585)ttT>ttA	p.F195L	ZFAND1_ENST00000519523.1_Missense_Mutation_p.F195L|ZFAND1_ENST00000521895.1_Missense_Mutation_p.F88L|ZFAND1_ENST00000517588.1_Missense_Mutation_p.F88L|ZFAND1_ENST00000523096.1_Missense_Mutation_p.F188L|ZFAND1_ENST00000519338.1_5'UTR|ZFAND1_ENST00000521287.1_Missense_Mutation_p.F88L|ZFAND1_ENST00000522520.1_Missense_Mutation_p.F88L	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	195							zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						GAGAAGCGGCAAAGTCTATGG	0.338																																					p.F195L		Atlas-SNP	.											.	ZFAND1	29	.	0			c.T585A						PASS	.						28.0	24.0	26.0					8																	82615255		2201	4300	6501	SO:0001583	missense	79752	exon7			AGCGGCAAAGTCT		CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.585T>A	chr8.hg19:g.82615255A>T	ENSP00000220669:p.Phe195Leu	160.0	0.0	.		135.0	49.0	.	NM_001170797	E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Missense_Mutation	SNP	ENST00000220669.5	hg19	CCDS6232.1	.	.	.	.	.	.	.	.	.	.	A	7.672	0.687266	0.14973	.	.	ENSG00000104231	ENST00000523096;ENST00000220669;ENST00000522520;ENST00000521895;ENST00000521287;ENST00000520635;ENST00000517588;ENST00000519523;ENST00000520604	.	.	.	5.83	-0.666	0.11399	.	0.284392	0.41097	D	0.000944	T	0.39708	0.1088	L	0.33137	0.985	0.41542	D	0.988525	B;B	0.21905	0.062;0.062	B;B	0.21546	0.024;0.035	T	0.13388	-1.0511	9	0.15952	T	0.53	.	10.4054	0.44254	0.7039:0.0:0.2961:0.0	.	188;195	E5RIG0;Q8TCF1	.;ZFAN1_HUMAN	L	188;195;88;88;88;88;88;195;88	.	ENSP00000220669:F195L	F	-	3	2	ZFAND1	82777810	0.829000	0.29322	0.165000	0.22776	0.449000	0.32228	0.912000	0.28597	-0.326000	0.08564	0.477000	0.44152	TTT	.	.	.	none		0.338	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379739.1	NM_024699	
PSD	5662	hgsc.bcm.edu	37	10	104173691	104173691	+	Missense_Mutation	SNP	G	G	T			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr10:104173691G>T	ENST00000020673.5	-	5	1914	c.1388C>A	c.(1387-1389)cCt>cAt	p.P463H	PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_Missense_Mutation_p.P463H	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	463	Pro-rich.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CGGTTCAAGAGGGGCAAGTGG	0.667																																					p.P463H		Atlas-SNP	.											.	PSD	164	.	0			c.C1388A						PASS	.						38.0	45.0	43.0					10																	104173691		2203	4299	6502	SO:0001583	missense	5662	exon6			TCAAGAGGGGCAA	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1388C>A	chr10.hg19:g.104173691G>T	ENSP00000020673:p.Pro463His	147.0	0.0	.		103.0	38.0	.	NM_001270965	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	hg19	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472957	0.26423	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.44482	0.92;0.92	4.65	2.76	0.32466	.	0.402362	0.25006	N	0.033862	T	0.19208	0.0461	N	0.08118	0	0.29532	N	0.85272	B	0.25609	0.13	B	0.17098	0.017	T	0.09530	-1.0670	10	0.41790	T	0.15	.	5.7397	0.18087	0.1616:0.0:0.587:0.2514	.	463	A5PKW4	PSD1_HUMAN	H	463;366;463	ENSP00000020673:P463H;ENSP00000384830:P463H	ENSP00000020673:P463H	P	-	2	0	PSD	104163681	0.999000	0.42202	0.798000	0.32154	0.751000	0.42716	1.776000	0.38594	0.390000	0.25115	0.456000	0.33151	CCT	.	.	.	none		0.667	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
PSD	5662	hgsc.bcm.edu	37	10	104173704	104173704	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr10:104173704C>T	ENST00000020673.5	-	5	1901	c.1375G>A	c.(1375-1377)Gcc>Acc	p.A459T	PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_Missense_Mutation_p.A459T	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	459	Pro-rich.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GCAAGTGGGGCGGGAGCTGGT	0.657																																					p.A459T		Atlas-SNP	.											.	PSD	164	.	0			c.G1375A						PASS	.						36.0	44.0	42.0					10																	104173704		2203	4298	6501	SO:0001583	missense	5662	exon6			GTGGGGCGGGAGC	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1375G>A	chr10.hg19:g.104173704C>T	ENSP00000020673:p.Ala459Thr	134.0	0.0	.		99.0	40.0	.	NM_001270965	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	hg19	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847795	0.51164	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.49720	0.77;0.77	4.78	4.78	0.61160	.	0.277670	0.29396	N	0.012273	T	0.31544	0.0800	L	0.27053	0.805	0.35766	D	0.820535	P	0.35551	0.509	B	0.20184	0.028	T	0.37314	-0.9711	10	0.19147	T	0.46	.	17.8792	0.88835	0.0:1.0:0.0:0.0	.	459	A5PKW4	PSD1_HUMAN	T	459;362;459	ENSP00000020673:A459T;ENSP00000384830:A459T	ENSP00000020673:A459T	A	-	1	0	PSD	104163694	1.000000	0.71417	0.995000	0.50966	0.271000	0.26615	5.034000	0.64152	2.224000	0.72417	0.555000	0.69702	GCC	.	.	.	none		0.657	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
C11orf95	65998	hgsc.bcm.edu	37	11	63533337	63533337	+	lincRNA	SNP	C	C	T	rs373116664		TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr11:63533337C>T	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							cctcttcttcctcctcctcct	0.667																																					p.E193E		Atlas-SNP	.											.	.	.	.	0			c.G579A						PASS	.						23.0	19.0	20.0					11																	63533337		692	1591	2283			65998	exon2			TTCTTCCTCCTCC																													chr11.hg19:g.63533337C>T		19.0	0.0	.		25.0	4.0	.	NM_001144936		Silent	SNP	ENST00000546282.2	hg19																																																																																				.	.	.	none		0.667	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000396567.2		
MAP1A	4130	hgsc.bcm.edu	37	15	43819753	43819753	+	Missense_Mutation	SNP	T	T	G			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr15:43819753T>G	ENST00000300231.5	+	4	6532	c.6082T>G	c.(6082-6084)Tct>Gct	p.S2028A	MAP1A_ENST00000399453.1_Missense_Mutation_p.S2028A|MAP1A_ENST00000382031.1_Missense_Mutation_p.S2266A			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2028					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GAGCCTCCAGTCTGACACTCC	0.607																																					p.S2028A		Atlas-SNP	.											.	MAP1A	189	.	0			c.T6082G						PASS	.						62.0	65.0	64.0					15																	43819753		2017	4190	6207	SO:0001583	missense	4130	exon4			CTCCAGTCTGACA	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.6082T>G	chr15.hg19:g.43819753T>G	ENSP00000300231:p.Ser2028Ala	55.0	0.0	.		47.0	26.0	.	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	hg19	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	T	8.252	0.809130	0.16537	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01388	4.95;4.95;4.95	4.9	-3.21	0.05140	.	0.508000	0.14891	N	0.292432	T	0.01029	0.0034	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45848	-0.9233	10	0.62326	D	0.03	0.7505	2.4176	0.04440	0.1129:0.2765:0.3846:0.2261	.	2028	P78559	MAP1A_HUMAN	A	2266;2028;2028	ENSP00000371462:S2266A;ENSP00000382380:S2028A;ENSP00000300231:S2028A	ENSP00000300231:S2028A	S	+	1	0	MAP1A	41607045	0.000000	0.05858	0.351000	0.25721	0.994000	0.84299	-1.453000	0.02383	-0.183000	0.10585	0.533000	0.62120	TCT	.	.	.	none		0.607	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
RTTN	25914	hgsc.bcm.edu	37	18	67816232	67816232	+	Silent	SNP	G	G	T			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr18:67816232G>T	ENST00000255674.6	-	17	2500	c.2214C>A	c.(2212-2214)ctC>ctA	p.L738L	RTTN_ENST00000454359.1_Silent_p.L738L|RTTN_ENST00000437017.1_Silent_p.L738L	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	738					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TGCTTAGAAGGAGAATGCAGT	0.393																																					p.L738L		Atlas-SNP	.											.	RTTN	184	.	0			c.C2214A						PASS	.						158.0	149.0	151.0					18																	67816232		1857	4100	5957	SO:0001819	synonymous_variant	25914	exon17			TAGAAGGAGAATG	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.2214C>A	chr18.hg19:g.67816232G>T		117.0	0.0	.		71.0	12.0	.	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	hg19	CCDS42443.1																																																																																			.	.	.	none		0.393	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
HUNK	30811	hgsc.bcm.edu	37	21	33371184	33371184	+	Missense_Mutation	SNP	T	T	A			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr21:33371184T>A	ENST00000270112.2	+	11	2192	c.1832T>A	c.(1831-1833)cTc>cAc	p.L611H		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	611					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						ATGTCGCCTCTCCATACTCCT	0.572																																					p.L611H		Atlas-SNP	.											.	HUNK	74	.	0			c.T1832A						PASS	.						53.0	50.0	51.0					21																	33371184		2203	4300	6503	SO:0001583	missense	30811	exon11			CGCCTCTCCATAC	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1832T>A	chr21.hg19:g.33371184T>A	ENSP00000270112:p.Leu611His	101.0	0.0	.		41.0	34.0	.	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	hg19	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	T	11.43	1.635034	0.29068	.	.	ENSG00000142149	ENST00000270112	T	0.69561	-0.41	4.39	1.92	0.25849	.	0.706815	0.12389	N	0.473175	T	0.49321	0.1550	N	0.19112	0.55	0.09310	N	0.999995	D	0.57257	0.979	P	0.46975	0.533	T	0.31998	-0.9923	10	0.15499	T	0.54	-12.9944	5.8389	0.18623	0.0:0.1007:0.1799:0.7194	.	611	P57058	HUNK_HUMAN	H	611	ENSP00000270112:L611H	ENSP00000270112:L611H	L	+	2	0	HUNK	32293055	0.002000	0.14202	0.023000	0.16930	0.286000	0.27126	0.915000	0.28638	0.712000	0.32039	0.402000	0.26972	CTC	.	.	.	none		0.572	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
NEFH	4744	hgsc.bcm.edu	37	22	29885585	29885586	+	In_Frame_Ins	INS	-	-	AAGTCCCCTGAGAAGGCC	rs200984527|rs267607533		TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr22:29885585_29885586insAAGTCCCCTGAGAAGGCC	ENST00000310624.6	+	4	1989_1990	c.1956_1957insAAGTCCCCTGAGAAGGCC	c.(1957-1959)aag>AAGTCCCCTGAGAAGGCCaag	p.653_653K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	659	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CTGAGAAGGCCAAGTCCCCAGA	0.564																																					p.A652delinsAKSPEKA		Atlas-INDEL	.											.,1	NEFH	178	.	0			c.1956_1957insAAGTCCCCTGAGAAGGCC						PASS	.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1939_1956dupAAGTCCCCTGAGAAGGCC	chr22.hg19:g.29885585_29885586insAAGTCCCCTGAGAAGGCC	ENSP00000311997:p.SerProGluLysAlaLys653dup	142.0	0.0	0		142.0	33.0	0.232394	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.	.	none		0.564	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
BRD1	23774	hgsc.bcm.edu	37	22	50170697	50170697	+	Missense_Mutation	SNP	C	C	T			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr22:50170697C>T	ENST00000216267.8	-	9	3199	c.2713G>A	c.(2713-2715)Gcc>Acc	p.A905T	BRD1_ENST00000404034.1_Missense_Mutation_p.A905T|BRD1_ENST00000342989.5_Missense_Mutation_p.A631T|BRD1_ENST00000404760.1_Missense_Mutation_p.A1036T|BRD1_ENST00000457780.2_3'UTR|BRD1_ENST00000542442.1_Missense_Mutation_p.A593T	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	905					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GCGATCCTGGCCGCCTTGGCG	0.647																																					p.A905T		Atlas-SNP	.											.	BRD1	144	.	0			c.G2713A						PASS	.						70.0	68.0	69.0					22																	50170697		2203	4300	6503	SO:0001583	missense	23774	exon9			TCCTGGCCGCCTT	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.2713G>A	chr22.hg19:g.50170697C>T	ENSP00000216267:p.Ala905Thr	83.0	0.0	.		80.0	35.0	.	NM_014577	A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	hg19	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561093	0.65538	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000542442;ENST00000342989;ENST00000419212	T;T;T;T;T	0.31510	2.45;2.45;2.48;1.49;1.87	4.98	4.98	0.66077	.	0.105193	0.64402	D	0.000004	T	0.51618	0.1685	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.89917	0.967;0.988;1.0;0.989	P;P;D;D	0.80764	0.629;0.815;0.994;0.91	T	0.41998	-0.9477	10	0.16896	T	0.51	.	18.245	0.89982	0.0:1.0:0.0:0.0	.	1036;631;905;1036	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	T	905;905;1036;593;631;496	ENSP00000216267:A905T;ENSP00000384076:A905T;ENSP00000385858:A1036T;ENSP00000437514:A593T;ENSP00000345886:A631T	ENSP00000216267:A905T	A	-	1	0	BRD1	48556701	1.000000	0.71417	0.874000	0.34290	0.485000	0.33311	5.458000	0.66679	2.300000	0.77407	0.655000	0.94253	GCC	.	.	.	none		0.647	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	
AFF1	4299	hgsc.bcm.edu	37	4	88048262	88048262	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr4:88048262delT	ENST00000307808.6	+	14	3295	c.2875delT	c.(2875-2877)tttfs	p.F959fs	AFF1_ENST00000395146.4_Frame_Shift_Del_p.F966fs|AFF1_ENST00000544085.1_Frame_Shift_Del_p.F597fs	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	959					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		TCAAGTGAAGTTTGACAAGTA	0.438																																					p.K965fs		Atlas-Indel,Pindel	.											.	AFF1	102	.	0			c.2895delG						PASS	.						111.0	114.0	113.0					4																	88048262		2203	4300	6503	SO:0001589	frameshift_variant	4299	exon15			.	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.2875delT	chr4.hg19:g.88048262delT	ENSP00000305689:p.Phe959fs	69.0	0.0	0		61.0	25.0	0.409836	NM_001166693	B4DTU1|E9PBM3	Frame_Shift_Del	DEL	ENST00000307808.6	hg19	CCDS3616.1																																																																																			.	.	.	none		0.438	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
ARHGEF38	54848	hgsc.bcm.edu	37	4	106473951	106473951	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr4:106473951delA	ENST00000420470.2	+	1	173	c.29delA	c.(28-30)gaafs	p.E10fs	ARHGEF38_ENST00000265154.2_Frame_Shift_Del_p.E10fs|AC004066.3_ENST00000514879.1_RNA	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	10						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						ACTGGGAAAGAAAACATGGTC	0.473																																					p.E10fs		Atlas-Indel,Pindel	.											.	ARHGEF38	52	.	0			c.28delG						PASS	.						87.0	85.0	86.0					4																	106473951		2203	4300	6503	SO:0001589	frameshift_variant	54848	exon1			.	AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.29delA	chr4.hg19:g.106473951delA	ENSP00000416125:p.Glu10fs	89.0	0.0	0		83.0	13.0	0.156627	NM_017700	C9JIB4	Frame_Shift_Del	DEL	ENST00000420470.2	hg19	CCDS56338.1																																																																																			.	.	.	none		0.473	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000336934.3	NM_017700	
TSC2	7249	hgsc.bcm.edu	37	16	2135239	2135240	+	Frame_Shift_Ins	INS	-	-	T	rs45514391|rs137854329|rs137854407		TCGA-KV-A74V-01A-11D-A33Q-10	TCGA-KV-A74V-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	df25a569-f993-4bbe-9766-cdc2a7c40750	9a716ea4-aa7c-4d1a-b9ec-9fb71edb7024	g.chr16:2135239_2135240insT	ENST00000219476.3	+	36	5208_5209	c.4578_4579insT	c.(4579-4581)tttfs	p.F1527fs	TSC2_ENST00000382538.6_Frame_Shift_Ins_p.F1412fs|TSC2_ENST00000353929.4_Frame_Shift_Ins_p.F1484fs|TSC2_ENST00000401874.2_Frame_Shift_Ins_p.F1460fs|TSC2_ENST00000568454.1_Frame_Shift_Ins_p.F1471fs|TSC2_ENST00000350773.4_Frame_Shift_Ins_p.F1504fs|TSC2_ENST00000439673.2_Frame_Shift_Ins_p.F1424fs	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1527					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				AGTCACAGTCCTTTGAGCGGTC	0.668			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.S1526fs		Atlas-INDEL	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.4578_4579insT						PASS	.																																			SO:0001589	frameshift_variant	7249	exon36	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	.	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4581dupT	chr16.hg19:g.2135242_2135242dupT	ENSP00000219476:p.Phe1527fs	76.0	0.0	0		93.0	10.0	0.107527	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Ins	INS	ENST00000219476.3	hg19	CCDS10458.1																																																																																			.	.	.	none		0.668	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
