#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MECR	51102	hgsc.bcm.edu	37	1	29557328	29557328	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:29557328C>T	ENST00000263702.6	-	1	116	c.91G>A	c.(91-93)Gcc>Acc	p.A31T	MECR_ENST00000489248.1_5'UTR|MECR_ENST00000373791.3_5'UTR			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	31					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		TAGGAGGAGGCGGCAGGTCCG	0.701																																					p.A31T		Atlas-SNP	.											.	MECR	31	.	0			c.G91A						PASS	.						9.0	12.0	11.0					1																	29557328		2186	4279	6465	SO:0001583	missense	51102	exon1			AGGAGGCGGCAGG		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.91G>A	chr1.hg19:g.29557328C>T	ENSP00000263702:p.Ala31Thr	44.0	0.0	.		30.0	20.0	.	NM_016011	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	hg19	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106638	0.37145	.	.	ENSG00000116353	ENST00000263702	T	0.03496	3.91	4.92	-0.97	0.10306	.	1.626230	0.03313	N	0.190804	T	0.02807	0.0084	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.44817	-0.9303	9	.	.	.	.	4.5591	0.12151	0.5172:0.3021:0.0:0.1807	.	31	Q9BV79	MECR_HUMAN	T	31	ENSP00000263702:A31T	.	A	-	1	0	MECR	29429915	0.000000	0.05858	0.002000	0.10522	0.434000	0.31775	-1.074000	0.03427	-0.262000	0.09392	-0.140000	0.14226	GCC	.	.	.	none		0.701	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011	
AGO3	192669	hgsc.bcm.edu	37	1	36475164	36475164	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:36475164C>T	ENST00000373191.4	+	9	1467	c.1118C>T	c.(1117-1119)gCa>gTa	p.A373V	RP4-665N4.8_ENST00000479395.2_RNA|AGO3_ENST00000246314.6_Missense_Mutation_p.A139V|RP4-665N4.8_ENST00000466576.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	373					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GCAAGATCTGCACCAGATAGA	0.378																																					p.A373V		Atlas-SNP	.											.	.	.	.	0			c.C1118T						PASS	.						105.0	98.0	100.0					1																	36475164		2203	4300	6503	SO:0001583	missense	192669	exon9			GATCTGCACCAGA	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1118C>T	chr1.hg19:g.36475164C>T	ENSP00000362287:p.Ala373Val	309.0	0.0	.		254.0	99.0	.	NM_024852	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	hg19	CCDS399.1	.	.	.	.	.	.	.	.	.	.	C	36	5.888335	0.97068	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.10960	2.82;2.82	6.17	6.17	0.99709	Argonaute/Dicer protein, PAZ (1);	0.000000	0.85682	D	0.000000	T	0.45135	0.1327	M	0.93283	3.4	0.80722	D	1	D	0.71674	0.998	P	0.62491	0.903	T	0.55023	-0.8205	10	0.87932	D	0	-12.0124	20.8794	0.99867	0.0:1.0:0.0:0.0	.	373	Q9H9G7	AGO3_HUMAN	V	373;139	ENSP00000362287:A373V;ENSP00000246314:A139V	ENSP00000246314:A139V	A	+	2	0	EIF2C3	36247751	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCA	.	.	.	none		0.378	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
INTS3	65123	hgsc.bcm.edu	37	1	153740253	153740253	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:153740253G>T	ENST00000318967.2	+	21	2762	c.2194G>T	c.(2194-2196)Gag>Tag	p.E732*	INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000512605.1_Nonsense_Mutation_p.E526*|INTS3_ENST00000435409.2_Nonsense_Mutation_p.E732*|INTS3_ENST00000456435.1_Nonsense_Mutation_p.E526*	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	733					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGCCTGCCAGGAGGACGATGT	0.612																																					p.E732X		Atlas-SNP	.											.	INTS3	83	.	0			c.G2194T						PASS	.						113.0	94.0	100.0					1																	153740253		2203	4300	6503	SO:0001587	stop_gained	65123	exon21			TGCCAGGAGGACG	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2194G>T	chr1.hg19:g.153740253G>T	ENSP00000318641:p.Glu732*	78.0	0.0	.		95.0	33.0	.	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Nonsense_Mutation	SNP	ENST00000318967.2	hg19	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	G	42	9.404468	0.99161	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	15.6279	0.76878	0.0:0.0:1.0:0.0	.	.	.	.	X	732;526;732;526	.	ENSP00000318641:E732X	E	+	1	0	INTS3	152006877	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.055000	0.93873	2.768000	0.95171	0.561000	0.74099	GAG	.	.	.	none		0.612	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
CFH	3075	hgsc.bcm.edu	37	1	196654324	196654324	+	Silent	SNP	A	A	G	rs1061147	byFrequency	TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:196654324A>G	ENST00000359637.2	+	6	791	c.729A>G	c.(727-729)gcA>gcG	p.A243A	CFH_ENST00000439155.2_Silent_p.A307A|CFH_ENST00000367429.4_Silent_p.A307A			P08603	CFAH_HUMAN	complement factor H	307	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GAAATACAGCAAAATGCACAA	0.393																																					p.A307A		Atlas-SNP	.											.	CFH	251	.	0			c.A921G	GRCh37	CM057396	CFH	M	rs1061147	PASS	.						119.0	108.0	112.0					1																	196654324		2203	4300	6503	SO:0001819	synonymous_variant	3075	exon7			TACAGCAAAATGC	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.729A>G	chr1.hg19:g.196654324A>G		292.0	0.0	.		239.0	84.0	.	NM_001014975	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000359637.2	hg19																																																																																				.	A|0.352;C|0.648	.	alt		0.393	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186	
PTPRC	5788	hgsc.bcm.edu	37	1	198678922	198678922	+	Silent	SNP	C	C	T	rs200643724		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:198678922C>T	ENST00000367376.2	+	11	1305	c.1134C>T	c.(1132-1134)aaC>aaT	p.N378N	PTPRC_ENST00000352140.3_Silent_p.N330N|PTPRC_ENST00000594404.1_Silent_p.N217N|PTPRC_ENST00000348564.6_Silent_p.N219N|PTPRC_ENST00000442510.2_Silent_p.N380N	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	378					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AGTTTACTAACGCAAGTAAAA	0.269																																					p.N380N		Atlas-SNP	.											.	PTPRC	229	.	0			c.C1140T						PASS	.	C	,	0,4398		0,0,2199	74.0	89.0	84.0		1134,651	-9.0	0.0	1		84	2,8534	2.2+/-6.3	0,2,4266	no	coding-synonymous,coding-synonymous	PTPRC	NM_002838.3,NM_080921.2	,	0,2,6465	TT,TC,CC		0.0234,0.0,0.0155	,	378/1305,217/1144	198678922	2,12932	2199	4268	6467	SO:0001819	synonymous_variant	5788	exon11			TACTAACGCAAGT	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1134C>T	chr1.hg19:g.198678922C>T		222.0	0.0	.		149.0	40.0	.	NM_002838	A8K7W6|Q16614|Q9H0Y6	Silent	SNP	ENST00000367376.2	hg19																																																																																				.	C|0.999;T|0.001	0.001	weak		0.269	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
GPR37L1	9283	hgsc.bcm.edu	37	1	202097357	202097357	+	Silent	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:202097357C>T	ENST00000367282.5	+	2	1225	c.1119C>T	c.(1117-1119)ctC>ctT	p.L373L		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	373					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						TCTGCACCCTCCCAGAGAACG	0.622																																					p.L373L		Atlas-SNP	.											.	GPR37L1	33	.	0			c.C1119T						PASS	.						157.0	139.0	145.0					1																	202097357		2203	4300	6503	SO:0001819	synonymous_variant	9283	exon2			CACCCTCCCAGAG	AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.1119C>T	chr1.hg19:g.202097357C>T		124.0	0.0	.		108.0	8.0	.	NM_004767	B2R7M9|Q5SXP7|Q86VP7	Silent	SNP	ENST00000367282.5	hg19	CCDS1420.1																																																																																			.	.	.	none		0.622	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2	NM_004767	
RCOR3	55758	hgsc.bcm.edu	37	1	211449723	211449723	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:211449723G>C	ENST00000367005.4	+	4	446	c.305G>C	c.(304-306)aGt>aCt	p.S102T	RCOR3_ENST00000419091.2_Missense_Mutation_p.S160T|RCOR3_ENST00000452621.2_Missense_Mutation_p.S160T|RCOR3_ENST00000367006.4_Missense_Mutation_p.S160T	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	102	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		CAAGCCTTTAGTTTTCATGGA	0.363																																					p.S160T		Atlas-SNP	.											.	RCOR3	51	.	0			c.G479C						PASS	.						164.0	162.0	163.0					1																	211449723		2203	4300	6503	SO:0001583	missense	55758	exon5			CCTTTAGTTTTCA	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.305G>C	chr1.hg19:g.211449723G>C	ENSP00000355972:p.Ser102Thr	105.0	0.0	.		104.0	9.0	.	NM_001136223	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	hg19	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435982	0.83885	.	.	ENSG00000117625	ENST00000533469;ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	5.02	5.02	0.67125	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.45377	0.1339	L	0.35542	1.07	0.80722	D	1	D;B;B;B	0.56035	0.974;0.065;0.364;0.389	D;B;B;B	0.70487	0.969;0.066;0.341;0.198	T	0.21177	-1.0253	9	.	.	.	-4.1499	18.6937	0.91593	0.0:0.0:1.0:0.0	.	160;102;160;160	Q9P2K3-3;Q9P2K3;Q9P2K3-2;Q9P2K3-4	.;RCOR3_HUMAN;.;.	T	102;160;160;160;102	ENSP00000436838:S102T;ENSP00000355973:S160T;ENSP00000398558:S160T;ENSP00000413929:S160T;ENSP00000355972:S102T	.	S	+	2	0	RCOR3	209516346	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.639000	0.98448	2.495000	0.84180	0.484000	0.47621	AGT	.	.	.	none		0.363	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
CENPF	1063	hgsc.bcm.edu	37	1	214815375	214815375	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:214815375G>T	ENST00000366955.3	+	12	3862	c.3694G>T	c.(3694-3696)Gag>Tag	p.E1232*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E1232*(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAAGGAGAAGGAGTGCCTGCA	0.373																																					p.E1232X	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											CENPF,NS,carcinoma,0,1	CENPF	321	.	1	Substitution - Nonsense(1)	lung(1)	c.G3694T						PASS	.						42.0	46.0	45.0					1																	214815375		2203	4298	6501	SO:0001587	stop_gained	1063	exon12			GAGAAGGAGTGCC	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3694G>T	chr1.hg19:g.214815375G>T	ENSP00000355922:p.Glu1232*	187.0	1.0	.		118.0	33.0	.	NM_016343	Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	42	9.517275	0.99193	.	.	ENSG00000117724	ENST00000366955	.	.	.	5.17	2.19	0.27852	.	1.270870	0.05898	N	0.629477	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	6.3943	0.21603	0.1645:0.1498:0.6857:0.0	.	.	.	.	X	1232	.	ENSP00000355922:E1232X	E	+	1	0	CENPF	212881998	0.848000	0.29623	0.000000	0.03702	0.898000	0.52572	0.913000	0.28611	0.168000	0.19655	0.511000	0.50034	GAG	.	.	.	none		0.373	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
SNAP47	116841	hgsc.bcm.edu	37	1	227946738	227946738	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:227946738C>A	ENST00000366759.4	+	3	1089	c.675C>A	c.(673-675)agC>agA	p.S225R	SNAP47_ENST00000366760.1_5'UTR|SNAP47_ENST00000315781.5_Missense_Mutation_p.S225R	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	225					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						GGCCCTTTAGCTCCAAGCTTT	0.433																																					p.S225R		Atlas-SNP	.											.	SNAP47	42	.	0			c.C675A						PASS	.						86.0	94.0	91.0					1																	227946738		2203	4300	6503	SO:0001583	missense	116841	exon3			CTTTAGCTCCAAG	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.675C>A	chr1.hg19:g.227946738C>A	ENSP00000355721:p.Ser225Arg	91.0	0.0	.		73.0	4.0	.	NM_053052	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	ENST00000366759.4	hg19	CCDS1562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.74|10.74	1.434984|1.434984	0.25813|0.25813	.|.	.|.	ENSG00000143740|ENSG00000143740	ENST00000418653;ENST00000426344|ENST00000366759;ENST00000315781	.|T;T	.|0.17054	.|2.3;2.3	4.95|4.95	0.434|0.434	0.16539|0.16539	.|.	.|0.129162	.|0.64402	.|D	.|0.000001	T|T	0.31231|0.31231	0.0790|0.0790	M|M	0.78637|0.78637	2.42|2.42	0.30113|0.30113	N|N	0.8064|0.8064	.|D;D	.|0.67145	.|0.989;0.996	.|P;P	.|0.61201	.|0.885;0.885	T|T	0.20638|0.20638	-1.0269|-1.0269	5|10	.|0.26408	.|T	.|0.33	-7.4349|-7.4349	8.0504|8.0504	0.30575|0.30575	0.0:0.4696:0.0:0.5304|0.0:0.4696:0.0:0.5304	.|.	.|225;225	.|Q5SQN1;Q5SQN1-2	.|SNP47_HUMAN;.	I|R	38;217|225	.|ENSP00000355721:S225R;ENSP00000314157:S225R	.|ENSP00000314157:S225R	L|S	+|+	1|3	0|2	SNAP47|SNAP47	226013361|226013361	0.994000|0.994000	0.37717|0.37717	0.678000|0.678000	0.29963|0.29963	0.565000|0.565000	0.35776|0.35776	0.206000|0.206000	0.17375|0.17375	-0.047000|-0.047000	0.13423|0.13423	0.561000|0.561000	0.74099|0.74099	CTC|AGC	.	.	.	none		0.433	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	NM_053052	
SDCCAG8	10806	hgsc.bcm.edu	37	1	243419490	243419490	+	Silent	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:243419490G>A	ENST00000366541.3	+	1	133	c.15G>A	c.(13-15)ccG>ccA	p.P5P	SDCCAG8_ENST00000391846.1_Silent_p.P5P|SDCCAG8_ENST00000355875.4_Silent_p.P5P|CEP170_ENST00000366544.1_5'Flank|CEP170_ENST00000366543.1_5'Flank|SDCCAG8_ENST00000343783.6_5'UTR|CEP170_ENST00000366542.1_5'Flank	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	5					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CGAAGTCCCCGGAGAACTCTA	0.617																																					p.P5P		Atlas-SNP	.											.	SDCCAG8	73	.	0			c.G15A						PASS	.						78.0	79.0	78.0					1																	243419490		2203	4300	6503	SO:0001819	synonymous_variant	10806	exon1			GTCCCCGGAGAAC	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.15G>A	chr1.hg19:g.243419490G>A		146.0	0.0	.		123.0	7.0	.	NM_006642	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Silent	SNP	ENST00000366541.3	hg19	CCDS31075.1																																																																																			.	.	.	none		0.617	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642	
MOGS	7841	hgsc.bcm.edu	37	2	74688599	74688599	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr2:74688599C>T	ENST00000233616.4	-	4	2479	c.2317G>A	c.(2317-2319)Gag>Aag	p.E773K	MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000452063.2_Missense_Mutation_p.E667K	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	773					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						TGAGGACCCTCCAGATGCCCA	0.592																																					p.E773K		Atlas-SNP	.											.	MOGS	58	.	0			c.G2317A						PASS	.						80.0	88.0	85.0					2																	74688599		2075	4200	6275	SO:0001583	missense	7841	exon4			GACCCTCCAGATG	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.2317G>A	chr2.hg19:g.74688599C>T	ENSP00000233616:p.Glu773Lys	248.0	0.0	.		197.0	56.0	.	NM_006302	A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	hg19	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	C	7.668	0.686371	0.14973	.	.	ENSG00000115275	ENST00000233616;ENST00000452063	T;T	0.48522	0.81;0.81	4.48	0.633	0.17712	Six-hairpin glycosidase-like (1);	0.109437	0.64402	N	0.000010	T	0.35508	0.0934	L	0.55103	1.725	0.80722	D	1	B	0.06786	0.001	B	0.14023	0.01	T	0.14008	-1.0488	10	0.11794	T	0.64	-2.6164	8.6268	0.33895	0.0:0.6721:0.0:0.3279	.	773	Q13724	MOGS_HUMAN	K	773;667	ENSP00000233616:E773K;ENSP00000388201:E667K	ENSP00000233616:E773K	E	-	1	0	MOGS	74542107	0.580000	0.26733	0.793000	0.32043	0.621000	0.37620	1.175000	0.31944	0.004000	0.14682	-0.244000	0.11960	GAG	.	.	.	none		0.592	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302	
ACMSD	130013	hgsc.bcm.edu	37	2	135621133	135621133	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr2:135621133G>A	ENST00000356140.5	+	5	554	c.418G>A	c.(418-420)Ggg>Agg	p.G140R	ACMSD_ENST00000392928.1_Missense_Mutation_p.G82R|ACMSD_ENST00000283054.4_Missense_Mutation_p.G82R|AC016725.4_ENST00000392929.2_RNA	NM_138326.2	NP_612199.2	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	140					cellular nitrogen compound metabolic process (GO:0034641)|quinolinate metabolic process (GO:0046874)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(4)|lung(6)|skin(1)	14				BRCA - Breast invasive adenocarcinoma(221;0.115)		GGGCTTTCCCGGGGTCCAAAT	0.632																																					p.G140R		Atlas-SNP	.											.	ACMSD	43	.	0			c.G418A						PASS	.						71.0	58.0	62.0					2																	135621133		2203	4300	6503	SO:0001583	missense	130013	exon5			TTTCCCGGGGTCC	AB071418	CCDS2173.2	2q21.3	2008-03-11			ENSG00000153086	ENSG00000153086	4.1.1.45		19288	protein-coding gene	gene with protein product		608889				12140278	Standard	NM_138326		Approved		uc002ttz.3	Q8TDX5	OTTHUMG00000131711	ENST00000356140.5:c.418G>A	chr2.hg19:g.135621133G>A	ENSP00000348459:p.Gly140Arg	116.0	0.0	.		98.0	6.0	.	NM_138326	Q3B7X3|Q53SR5|Q96KY2	Missense_Mutation	SNP	ENST00000356140.5	hg19	CCDS2173.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950082	0.92660	.	.	ENSG00000153086	ENST00000356140;ENST00000283054;ENST00000392928	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.90518	0.7029	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93490	0.6835	9	0.87932	D	0	-10.2027	19.6085	0.95589	0.0:0.0:1.0:0.0	.	82;140	Q53SR5;Q8TDX5	.;ACMSD_HUMAN	R	140;82;82	.	ENSP00000283054:G82R	G	+	1	0	ACMSD	135337603	1.000000	0.71417	0.959000	0.39883	0.755000	0.42902	9.463000	0.97652	2.618000	0.88619	0.561000	0.74099	GGG	.	.	.	none		0.632	ACMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254627.1		
SSFA2	6744	hgsc.bcm.edu	37	2	182774650	182774650	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr2:182774650C>G	ENST00000431877.2	+	9	1617	c.1438C>G	c.(1438-1440)Cct>Gct	p.P480A	SSFA2_ENST00000428267.2_Missense_Mutation_p.P327A|SSFA2_ENST00000320370.7_Missense_Mutation_p.P480A|SSFA2_ENST00000409136.1_5'Flank|SSFA2_ENST00000409001.1_Missense_Mutation_p.P480A	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	480						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GGGAGAAGCTCCTCATGTTCC	0.368																																					p.P480A		Atlas-SNP	.											.	SSFA2	130	.	0			c.C1438G						PASS	.						71.0	62.0	65.0					2																	182774650		2203	4300	6503	SO:0001583	missense	6744	exon9			GAAGCTCCTCATG	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1438C>G	chr2.hg19:g.182774650C>G	ENSP00000388731:p.Pro480Ala	120.0	0.0	.		92.0	39.0	.	NM_001130445	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	hg19	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304280	0.81136	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267	T;T;T;T	0.15372	2.66;2.43;2.66;2.66	5.98	5.98	0.97165	.	0.175872	0.50627	D	0.000116	T	0.44138	0.1279	M	0.73598	2.24	0.58432	D	0.999993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.997;0.997	T	0.04946	-1.0916	10	0.33141	T	0.24	-18.1989	18.6367	0.91380	0.0:1.0:0.0:0.0	.	327;480;480;480	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	A	480;480;480;327	ENSP00000388731:P480A;ENSP00000314669:P480A;ENSP00000387319:P480A;ENSP00000409867:P327A	ENSP00000314669:P480A	P	+	1	0	SSFA2	182482895	0.994000	0.37717	1.000000	0.80357	0.889000	0.51656	3.435000	0.52849	2.847000	0.97988	0.591000	0.81541	CCT	.	.	.	none		0.368	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
KCNH8	131096	hgsc.bcm.edu	37	3	19554559	19554559	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:19554559C>T	ENST00000328405.2	+	13	2443	c.2177C>T	c.(2176-2178)tCc>tTc	p.S726F		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	726					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						gaggCAGTCTCCCTCTCTCCC	0.532																																					p.S726F	NSCLC(124;1625 1765 8018 24930 42026)	Atlas-SNP	.											KCNH8,NS,malignant_melanoma,0,1	KCNH8	189	.	0			c.C2177T						PASS	.						67.0	55.0	59.0					3																	19554559		2203	4300	6503	SO:0001583	missense	131096	exon13			CAGTCTCCCTCTC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2177C>T	chr3.hg19:g.19554559C>T	ENSP00000328813:p.Ser726Phe	248.0	0.0	.		265.0	13.0	.	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	hg19	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441905	0.43326	.	.	ENSG00000183960	ENST00000328405	D	0.98792	-5.14	5.44	5.44	0.79542	.	0.000000	0.31709	U	0.007193	D	0.97495	0.9180	L	0.47716	1.5	0.80722	D	1	P	0.37158	0.585	B	0.42188	0.379	D	0.97417	1.0006	9	.	.	.	.	17.4503	0.87590	0.0:1.0:0.0:0.0	.	726	Q96L42	KCNH8_HUMAN	F	726	ENSP00000328813:S726F	.	S	+	2	0	KCNH8	19529563	0.164000	0.22935	0.087000	0.20705	0.252000	0.25951	1.912000	0.39946	2.559000	0.86315	0.585000	0.79938	TCC	.	.	.	none		0.532	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
TRANK1	9881	hgsc.bcm.edu	37	3	36874430	36874430	+	Missense_Mutation	SNP	C	C	T	rs370553712		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:36874430C>T	ENST00000429976.2	-	21	6759	c.6512G>A	c.(6511-6513)cGt>cAt	p.R2171H	TRANK1_ENST00000301807.6_Missense_Mutation_p.R1621H|TRANK1_ENST00000428977.2_Missense_Mutation_p.R1621H	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2171							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GGCTTCACAACGCCGCAGAGG	0.438																																					p.R2171H		Atlas-SNP	.											.	TRANK1	398	.	0			c.G6512A						PASS	.	C	HIS/ARG	0,3780		0,0,1890	32.0	32.0	32.0		6512	5.2	0.9	3		32	1,8203		0,1,4101	no	missense	TRANK1	NM_014831.2	29	0,1,5991	TT,TC,CC		0.0122,0.0,0.0083	probably-damaging	2171/2926	36874430	1,11983	1890	4102	5992	SO:0001583	missense	9881	exon21			TCACAACGCCGCA	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6512G>A	chr3.hg19:g.36874430C>T	ENSP00000416168:p.Arg2171His	42.0	0.0	.		22.0	10.0	.	NM_014831	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	hg19	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812080	0.50527	0.0	1.22E-4	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.34667	1.35;1.76;1.35	5.16	5.16	0.70880	.	0.000000	0.48767	D	0.000162	T	0.40743	0.1129	L	0.34521	1.04	0.22156	N	0.999323	D	0.76494	0.999	P	0.57324	0.818	T	0.28459	-1.0043	10	0.72032	D	0.01	.	9.7288	0.40348	0.0:0.8452:0.0:0.1548	.	2171	O15050	TRNK1_HUMAN	H	1621;2171;1621	ENSP00000416826:R1621H;ENSP00000416168:R2171H;ENSP00000301807:R1621H	ENSP00000301807:R1621H	R	-	2	0	TRANK1	36849434	0.977000	0.34250	0.855000	0.33649	0.731000	0.41821	3.068000	0.50018	2.562000	0.86427	0.555000	0.69702	CGT	.	.	.	weak		0.438	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
BAP1	8314	hgsc.bcm.edu	37	3	52439275	52439275	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:52439275C>A	ENST00000460680.1	-	11	1438	c.967G>T	c.(967-969)Gcc>Tcc	p.A323S	BAP1_ENST00000296288.5_Missense_Mutation_p.A305S	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P324fs*7(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TGGGATGGGGCTTGTGCGCAT	0.592			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.A323S	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	1	Deletion - Frameshift(1)	pleura(1)	c.G967T						PASS	.						113.0	118.0	116.0					3																	52439275		2203	4300	6503	SO:0001583	missense	8314	exon11			ATGGGGCTTGTGC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.967G>T	chr3.hg19:g.52439275C>A	ENSP00000417132:p.Ala323Ser	99.0	0.0	.		84.0	65.0	.	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.375375	0.24857	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.55588	0.51;0.51	5.7	4.82	0.62117	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.290995	0.39341	N	0.001388	T	0.41789	0.1174	L	0.44542	1.39	0.21782	N	0.999546	B	0.09022	0.002	B	0.14023	0.01	T	0.24512	-1.0158	10	0.24483	T	0.36	-12.9423	9.1237	0.36801	0.0:0.8178:0.0:0.1822	.	323	Q92560	BAP1_HUMAN	S	323;305	ENSP00000417132:A323S;ENSP00000296288:A305S	ENSP00000296288:A305S	A	-	1	0	BAP1	52414315	0.962000	0.33011	0.955000	0.39395	0.115000	0.19883	0.927000	0.28818	1.398000	0.46701	0.655000	0.94253	GCC	.	.	.	none		0.592	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
OSBPL11	114885	hgsc.bcm.edu	37	3	125250787	125250787	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:125250787G>A	ENST00000296220.5	-	12	2385	c.2096C>T	c.(2095-2097)aCc>aTc	p.T699I		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	699					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						TTCTTCCAGGGTATGCTTATG	0.403																																					p.T699I		Atlas-SNP	.											.	OSBPL11	64	.	0			c.C2096T						PASS	.						177.0	165.0	169.0					3																	125250787		2203	4300	6503	SO:0001583	missense	114885	exon12			TCCAGGGTATGCT	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.2096C>T	chr3.hg19:g.125250787G>A	ENSP00000296220:p.Thr699Ile	118.0	0.0	.		102.0	5.0	.	NM_022776	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	hg19	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853695	0.32791	.	.	ENSG00000144909	ENST00000296220	T	0.30182	1.54	4.59	4.59	0.56863	.	0.550827	0.19443	N	0.114129	T	0.16981	0.0408	N	0.04508	-0.205	0.21355	N	0.999719	B	0.20164	0.042	B	0.15870	0.014	T	0.09207	-1.0685	10	0.23891	T	0.37	-2.1904	17.9326	0.89002	0.0:0.0:1.0:0.0	.	699	Q9BXB4	OSB11_HUMAN	I	699	ENSP00000296220:T699I	ENSP00000296220:T699I	T	-	2	0	OSBPL11	126733477	1.000000	0.71417	0.715000	0.30552	0.961000	0.63080	4.367000	0.59498	2.542000	0.85734	0.462000	0.41574	ACC	.	.	.	none		0.403	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
CLDN11	5010	hgsc.bcm.edu	37	3	170141043	170141043	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:170141043C>T	ENST00000064724.3	+	2	521	c.319C>T	c.(319-321)Cgg>Tgg	p.R107W	CLDN11_ENST00000486975.1_Missense_Mutation_p.R107W|CLDN11_ENST00000489485.1_3'UTR|CLDN11_ENST00000451576.1_Missense_Mutation_p.R107W	NM_005602.5	NP_005593.2	O75508	CLD11_HUMAN	claudin 11	107					axon ensheathment (GO:0008366)|calcium-independent cell-cell adhesion (GO:0016338)|spermatogenesis (GO:0007283)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|liver(2)|lung(3)|ovary(2)	12	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TCCCTGCATCCGGATGGGCCA	0.607																																					p.R107W		Atlas-SNP	.											.	CLDN11	28	.	0			c.C319T						PASS	.						111.0	105.0	107.0					3																	170141043		2203	4300	6503	SO:0001583	missense	5010	exon2			TGCATCCGGATGG	AF068863	CCDS3213.1	3q26.2-q26.3	2008-08-01	2008-08-01		ENSG00000013297	ENSG00000013297		"""Claudins"""	8514	protein-coding gene	gene with protein product		601326	"""oligodendrocyte transmembrane protein"""	OTM		8661061, 8797478	Standard	NM_005602		Approved	OSP	uc003fgx.3	O75508	OTTHUMG00000158940	ENST00000064724.3:c.319C>T	chr3.hg19:g.170141043C>T	ENSP00000064724:p.Arg107Trp	210.0	0.0	.		174.0	15.0	.	NM_005602	B2R7C1|D3DNQ5|Q5U0P3	Missense_Mutation	SNP	ENST00000064724.3	hg19	CCDS3213.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128510	0.77549	.	.	ENSG00000013297	ENST00000064724;ENST00000486975;ENST00000451576	D;D;D	0.89681	-2.55;-2.55;-2.55	5.81	4.91	0.64330	.	0.175301	0.50627	D	0.000106	D	0.94265	0.8158	M	0.79123	2.44	0.47621	D	0.999477	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.949	D	0.94887	0.8044	10	0.87932	D	0	.	15.8994	0.79362	0.1364:0.8636:0.0:0.0	.	107;107	B4DFI2;O75508	.;CLD11_HUMAN	W	107	ENSP00000064724:R107W;ENSP00000417434:R107W;ENSP00000410185:R107W	ENSP00000064724:R107W	R	+	1	2	CLDN11	171623737	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	2.422000	0.44696	1.391000	0.46566	0.557000	0.71058	CGG	.	.	.	none		0.607	CLDN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352403.1	NM_005602	
MFN1	55669	hgsc.bcm.edu	37	3	179082985	179082985	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:179082985C>G	ENST00000471841.1	+	7	851	c.725C>G	c.(724-726)tCt>tGt	p.S242C	MFN1_ENST00000280653.7_Missense_Mutation_p.S242C|MFN1_ENST00000263969.5_Missense_Mutation_p.S242C	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	242	Dynamin-type G.				mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TGGGATGCCTCTGCATCAGAG	0.328																																					p.S242C		Atlas-SNP	.											.	MFN1	72	.	0			c.C725G						PASS	.						50.0	54.0	53.0					3																	179082985		2203	4300	6503	SO:0001583	missense	55669	exon7			ATGCCTCTGCATC	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.725C>G	chr3.hg19:g.179082985C>G	ENSP00000420617:p.Ser242Cys	120.0	0.0	.		86.0	66.0	.	NM_033540	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	hg19	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927490	0.73327	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000489329;ENST00000474903	D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.66;-3.66	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.98128	0.9382	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;P;P	0.87578	0.998;0.907;0.907	D	0.98003	1.0361	10	0.48119	T	0.1	-19.0836	19.7394	0.96219	0.0:1.0:0.0:0.0	.	242;270;242	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	C	242;242;242;242;95;105	ENSP00000420617:S242C;ENSP00000280653:S242C;ENSP00000263969:S242C;ENSP00000420148:S95C;ENSP00000419926:S105C	ENSP00000263969:S242C	S	+	2	0	MFN1	180565679	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.739000	0.68622	2.649000	0.89929	0.563000	0.77884	TCT	.	.	.	none		0.328	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
FGG	2266	hgsc.bcm.edu	37	4	155526043	155526043	+	Silent	SNP	T	T	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr4:155526043T>C	ENST00000336098.3	-	9	1343	c.1305A>G	c.(1303-1305)agA>agG	p.R435R	FGG_ENST00000407946.1_Silent_p.R443R|FGG_ENST00000404648.3_Intron|FGG_ENST00000405164.1_Intron	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	435	Platelet aggregation and Staphylococcus clumping.			R -> Y (in Ref. 15; AA sequence). {ECO:0000305}.	blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GGTGCTCTGGTCTGACCTGTT	0.433																																					p.R435R		Atlas-SNP	.											.	FGG	71	.	0			c.A1305G						PASS	.						198.0	188.0	192.0					4																	155526043		2203	4300	6503	SO:0001819	synonymous_variant	2266	exon9			CTCTGGTCTGACC		CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.1305A>G	chr4.hg19:g.155526043T>C		66.0	0.0	.		93.0	37.0	.	NM_021870	A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Silent	SNP	ENST00000336098.3	hg19	CCDS3788.1																																																																																			.	.	.	none		0.433	FGG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317581.1	NM_021870	
PAPD4	167153	hgsc.bcm.edu	37	5	78941013	78941013	+	Silent	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr5:78941013C>T	ENST00000296783.3	+	9	1118	c.819C>T	c.(817-819)gtC>gtT	p.V273V	PAPD4_ENST00000504233.1_Silent_p.V273V|PAPD4_ENST00000423041.2_Silent_p.V269V|PAPD4_ENST00000453514.1_Silent_p.V273V|PAPD4_ENST00000428308.2_Silent_p.V273V			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	273					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		GGGATAAAGTCAGGTAAATAA	0.338																																					p.V273V		Atlas-SNP	.											.	PAPD4	51	.	0			c.C819T						PASS	.						91.0	94.0	93.0					5																	78941013		2203	4300	6503	SO:0001819	synonymous_variant	167153	exon9			TAAAGTCAGGTAA	AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.819C>T	chr5.hg19:g.78941013C>T		121.0	0.0	.		100.0	4.0	.	NM_173797	Q86WZ2|Q8N927	Silent	SNP	ENST00000296783.3	hg19	CCDS4048.1																																																																																			.	.	.	none		0.338	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226967.1	NM_173797	
THSD7A	221981	hgsc.bcm.edu	37	7	11675888	11675888	+	Silent	SNP	G	G	A	rs375820480		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:11675888G>A	ENST00000423059.4	-	2	1142	c.891C>T	c.(889-891)cgC>cgT	p.R297R	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	297					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TAATAAGCTCGCGGGCTTCTG	0.463										HNSCC(18;0.044)																											p.R297R		Atlas-SNP	.											.	THSD7A	219	.	0			c.C891T						PASS	.	G		0,3716		0,0,1858	137.0	131.0	133.0		891	-11.2	0.6	7		133	1,8219		0,1,4109	no	coding-synonymous	THSD7A	NM_015204.2		0,1,5967	AA,AG,GG		0.0122,0.0,0.0084		297/1658	11675888	1,11935	1858	4110	5968	SO:0001819	synonymous_variant	221981	exon2			AAGCTCGCGGGCT		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.891C>T	chr7.hg19:g.11675888G>A		80.0	0.0	.		46.0	21.0	.	NM_015204		Silent	SNP	ENST00000423059.4	hg19	CCDS47543.1																																																																																			.	.	.	weak		0.463	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
IMMP2L	83943	hgsc.bcm.edu	37	7	111161447	111161447	+	Silent	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:111161447G>A	ENST00000405709.2	-	2	499	c.57C>T	c.(55-57)ttC>ttT	p.F19F	IMMP2L_ENST00000452895.1_Silent_p.F19F|IMMP2L_ENST00000437687.1_Silent_p.F19F|IMMP2L_ENST00000447215.1_Silent_p.F19F|IMMP2L_ENST00000415362.1_Silent_p.F19F|IMMP2L_ENST00000331762.3_Silent_p.F19F	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)	19					ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		CCGCCACAAAGAAGCCTTTAC	0.433																																					p.F19F		Atlas-SNP	.											.	IMMP2L	32	.	0			c.C57T						PASS	.						107.0	106.0	106.0					7																	111161447		2203	4300	6503	SO:0001819	synonymous_variant	83943	exon2			CACAAAGAAGCCT	AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.57C>T	chr7.hg19:g.111161447G>A		86.0	0.0	.		58.0	17.0	.	NM_032549	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Silent	SNP	ENST00000405709.2	hg19	CCDS5753.1																																																																																			.	.	.	none		0.433	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338109.4	NM_032549	
KIAA1147	57189	hgsc.bcm.edu	37	7	141365048	141365048	+	Silent	SNP	A	A	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:141365048A>T	ENST00000536163.1	-	6	890	c.891T>A	c.(889-891)ccT>ccA	p.P297P	KIAA1147_ENST00000482493.1_Silent_p.P193P|RP5-894A10.6_ENST00000602609.1_RNA	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	297										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					CGTAGAAGAAAGGTTTGGACT	0.597																																					p.P297P		Atlas-SNP	.											.	KIAA1147	32	.	0			c.T891A						PASS	.						82.0	89.0	87.0					7																	141365048		2145	4228	6373	SO:0001819	synonymous_variant	57189	exon6			GAAGAAAGGTTTG	AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.891T>A	chr7.hg19:g.141365048A>T		250.0	0.0	.		190.0	65.0	.	NM_001080392	Q9ULS3	Silent	SNP	ENST00000536163.1	hg19	CCDS47726.1																																																																																			.	.	.	none		0.597	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349104.1		
CUL1	8454	hgsc.bcm.edu	37	7	148496376	148496376	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:148496376G>A	ENST00000325222.4	+	21	2425	c.2146G>A	c.(2146-2148)Gtg>Atg	p.V716M	CUL1_ENST00000602748.1_Missense_Mutation_p.V716M|CUL1_ENST00000409469.1_Missense_Mutation_p.V716M	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	716					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GGCGGCCATCGTGAGAATCAT	0.478																																					p.V716M		Atlas-SNP	.											.	CUL1	80	.	0			c.G2146A						PASS	.						139.0	106.0	117.0					7																	148496376		2203	4300	6503	SO:0001583	missense	8454	exon21			GCCATCGTGAGAA	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.2146G>A	chr7.hg19:g.148496376G>A	ENSP00000326804:p.Val716Met	181.0	0.0	.		114.0	42.0	.	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	hg19	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	.	28.3	4.905971	0.92107	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000433865	D;D	0.89270	-2.49;-2.49	5.3	5.3	0.74995	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96417	0.8831	H	0.96633	3.855	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.65233	0.933;0.64	D	0.97776	1.0229	10	0.87932	D	0	-16.3531	18.9531	0.92647	0.0:0.0:1.0:0.0	.	643;716	E7EWR0;Q13616	.;CUL1_HUMAN	M	716;716;643	ENSP00000387160:V716M;ENSP00000326804:V716M	ENSP00000326804:V716M	V	+	1	0	CUL1	148127309	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.472000	0.97709	2.467000	0.83353	0.557000	0.71058	GTG	.	.	.	none		0.478	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
DEFA6	1671	hgsc.bcm.edu	37	8	6783427	6783427	+	Missense_Mutation	SNP	G	G	A	rs371286175		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr8:6783427G>A	ENST00000297436.2	-	1	171	c.131C>T	c.(130-132)gCa>gTa	p.A44V	GS1-24F4.3_ENST00000526235.1_RNA	NM_001926.3	NP_001917.1	Q01524	DEF6_HUMAN	defensin, alpha 6, Paneth cell-specific	44					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)				lung(4)	4			STAD - Stomach adenocarcinoma(24;0.0322)	COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CTGGTCATTTGCCCCACGCTG	0.557																																					p.A44V		Atlas-SNP	.											.	DEFA6	9	.	0			c.C131T						PASS	.	G	VAL/ALA	0,4406		0,0,2203	70.0	58.0	62.0		131	-3.3	0.0	8		62	1,8599		0,1,4299	no	missense	DEFA6	NM_001926.3	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	44/101	6783427	1,13005	2203	4300	6503	SO:0001583	missense	1671	exon1			TCATTTGCCCCAC	M98331	CCDS5960.1	8p23.1	2007-02-20			ENSG00000164822	ENSG00000164822		"""Defensins, alpha"""	2765	protein-coding gene	gene with protein product		600471				8417977	Standard	NM_001926		Approved	HD-6, DEF6	uc003wqt.3	Q01524	OTTHUMG00000149984	ENST00000297436.2:c.131C>T	chr8.hg19:g.6783427G>A	ENSP00000297436:p.Ala44Val	101.0	0.0	.		65.0	25.0	.	NM_001926	Q6EZF9	Missense_Mutation	SNP	ENST00000297436.2	hg19	CCDS5960.1	.	.	.	.	.	.	.	.	.	.	.	2.180	-0.387804	0.04932	0.0	1.16E-4	ENSG00000164822	ENST00000297436	T	0.32023	1.47	1.85	-3.35	0.04928	Defensin propeptide (1);	2.198720	0.02497	N	0.090070	T	0.24624	0.0597	L	0.39245	1.2	0.09310	N	1	B	0.30763	0.294	B	0.29942	0.109	T	0.12293	-1.0553	10	0.44086	T	0.13	.	5.9699	0.19346	0.0:0.1529:0.3749:0.4722	.	44	Q01524	DEF6_HUMAN	V	44	ENSP00000297436:A44V	ENSP00000297436:A44V	A	-	2	0	DEFA6	6770837	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.753000	0.04792	-1.668000	0.01471	-1.471000	0.01009	GCA	.	.	.	weak		0.557	DEFA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206739.1	NM_001926	
MFHAS1	9258	hgsc.bcm.edu	37	8	8655002	8655002	+	Splice_Site	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr8:8655002C>A	ENST00000276282.6	-	2	3585		c.e2-1		MFHAS1_ENST00000520091.1_Splice_Site	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1											endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		AGCAACTCCCCTGTAGGAGGA	0.547																																					.	Melanoma(103;1201 2045 17515 28966)	Atlas-SNP	.											.	MFHAS1	58	.	0			c.2999-1G>T						PASS	.						78.0	66.0	70.0					8																	8655002		2203	4300	6503	SO:0001630	splice_region_variant	9258	exon3			ACTCCCCTGTAGG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2999-1G>T	chr8.hg19:g.8655002C>A		120.0	0.0	.		116.0	47.0	.	NM_004225	Q96CI0	Splice_Site	SNP	ENST00000276282.6	hg19	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752676	0.89753	.	.	ENSG00000147324	ENST00000276282	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.882	0.92358	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MFHAS1	8692412	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.251000	0.78297	2.703000	0.92315	0.551000	0.68910	.	.	.	.	none		0.547	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	Intron
SETX	23064	hgsc.bcm.edu	37	9	135163729	135163729	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr9:135163729A>G	ENST00000224140.5	-	17	6400	c.6218T>C	c.(6217-6219)tTa>tCa	p.L2073S	SETX_ENST00000372169.2_Missense_Mutation_p.L2073S|SETX_ENST00000393220.1_Missense_Mutation_p.L2073S	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2073					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATGAGAAGGTAACTCTTTTTC	0.358																																					p.L2073S		Atlas-SNP	.											.	SETX	234	.	0			c.T6218C						PASS	.						33.0	32.0	32.0					9																	135163729		2203	4300	6503	SO:0001583	missense	23064	exon17			GAAGGTAACTCTT	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6218T>C	chr9.hg19:g.135163729A>G	ENSP00000224140:p.Leu2073Ser	78.0	0.0	.		63.0	25.0	.	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	hg19	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.108442	0.37242	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.90900	-2.18;-2.75;-2.26;-1.87	5.5	5.5	0.81552	.	0.381500	0.24779	N	0.035673	D	0.89406	0.6706	L	0.31476	0.935	0.39629	D	0.970154	B;D;D	0.76494	0.203;0.999;0.998	B;D;P	0.68483	0.075;0.958;0.876	D	0.85262	0.1051	10	0.09338	T	0.73	.	8.5286	0.33319	0.9131:0.0:0.0869:0.0	.	2073;2073;2073	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	S	2073;315;2073;2073	ENSP00000224140:L2073S;ENSP00000409143:L315S;ENSP00000361242:L2073S;ENSP00000376913:L2073S	ENSP00000224140:L2073S	L	-	2	0	SETX	134153550	0.972000	0.33761	0.996000	0.52242	0.786000	0.44442	2.256000	0.43231	2.221000	0.72209	0.528000	0.53228	TTA	.	.	.	none		0.358	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
TAF3	83860	hgsc.bcm.edu	37	10	8007636	8007636	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:8007636G>C	ENST00000344293.5	+	3	2369	c.2163G>C	c.(2161-2163)aaG>aaC	p.K721N		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	721	Lys-rich.				maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						agaaggagaaggaaagagaga	0.383																																					p.K721N		Atlas-SNP	.											.	TAF3	93	.	0			c.G2163C						PASS	.						18.0	18.0	18.0					10																	8007636		1856	4075	5931	SO:0001583	missense	83860	exon3			GGAGAAGGAAAGA	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2163G>C	chr10.hg19:g.8007636G>C	ENSP00000340271:p.Lys721Asn	66.0	0.0	.		82.0	21.0	.	NM_031923	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	hg19	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735163	0.30774	.	.	ENSG00000165632	ENST00000344293	T	0.08634	3.07	5.68	4.59	0.56863	.	0.459877	0.21158	N	0.079203	T	0.13798	0.0334	M	0.81802	2.56	0.49299	D	0.999772	P	0.46706	0.883	B	0.40375	0.327	T	0.02301	-1.1180	10	0.36615	T	0.2	-14.6137	13.0132	0.58743	0.1321:0.0:0.8679:0.0	.	721	Q5VWG9	TAF3_HUMAN	N	721	ENSP00000340271:K721N	ENSP00000340271:K721N	K	+	3	2	TAF3	8047642	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	2.385000	0.44371	2.689000	0.91719	0.655000	0.94253	AAG	.	.	.	none		0.383	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
DHTKD1	55526	hgsc.bcm.edu	37	10	12139749	12139749	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:12139749G>C	ENST00000263035.4	+	8	1487	c.1425G>C	c.(1423-1425)gaG>gaC	p.E475D	DHTKD1_ENST00000465617.1_3'UTR	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	475					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TGACGCAGGAGGAGGTGTCTG	0.488																																					p.E475D		Atlas-SNP	.											.	DHTKD1	104	.	0			c.G1425C						PASS	.						67.0	62.0	64.0					10																	12139749		2203	4300	6503	SO:0001583	missense	55526	exon8			GCAGGAGGAGGTG	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.1425G>C	chr10.hg19:g.12139749G>C	ENSP00000263035:p.Glu475Asp	116.0	0.0	.		125.0	53.0	.	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	hg19	CCDS7087.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.11|12.11	1.839538|1.839538	0.32513|0.32513	.|.	.|.	ENSG00000181192|ENSG00000181192	ENST00000263035|ENST00000448829	T|.	0.16196|.	2.36|.	5.35|5.35	1.27|1.27	0.21489|0.21489	Dehydrogenase, E1 component (1);|.	0.112246|.	0.64402|.	D|.	0.000014|.	T|T	0.35770|0.35770	0.0943|0.0943	N|N	0.25144|0.25144	0.715|0.715	0.41129|0.41129	D|D	0.985874|0.985874	B|.	0.14012|.	0.009|.	B|.	0.17979|.	0.02|.	T|T	0.07046|0.07046	-1.0793|-1.0793	10|5	0.24483|.	T|.	0.36|.	-13.3397|-13.3397	4.01|4.01	0.09618|0.09618	0.3596:0.0:0.3864:0.254|0.3596:0.0:0.3864:0.254	.|.	475|.	Q96HY7|.	DHTK1_HUMAN|.	D|R	475|27	ENSP00000263035:E475D|.	ENSP00000263035:E475D|.	E|G	+|+	3|1	2|0	DHTKD1|DHTKD1	12179755|12179755	0.982000|0.982000	0.34865|0.34865	1.000000|1.000000	0.80357|0.80357	0.863000|0.863000	0.49368|0.49368	0.093000|0.093000	0.15086|0.15086	0.264000|0.264000	0.21851|0.21851	0.462000|0.462000	0.41574|0.41574	GAG|GGA	.	.	.	none		0.488	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
DNA2	1763	hgsc.bcm.edu	37	10	70182074	70182074	+	Missense_Mutation	SNP	C	C	T	rs369018277		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:70182074C>T	ENST00000358410.3	-	17	2655	c.2605G>A	c.(2605-2607)Gaa>Aaa	p.E869K	DNA2_ENST00000399180.2_Missense_Mutation_p.E955K|DNA2_ENST00000399179.2_Intron	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	869	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						AATTCCAGTTCCAGCTTCACA	0.393																																					p.E869K		Atlas-SNP	.											.	DNA2	76	.	0			c.G2605A						PASS	.	C	LYS/GLU	0,3782		0,0,1891	90.0	87.0	88.0		2605	3.0	1.0	10		88	1,8241		0,1,4120	no	missense	DNA2	NM_001080449.2	56	0,1,6011	TT,TC,CC		0.0121,0.0,0.0083	possibly-damaging	869/1061	70182074	1,12023	1891	4121	6012	SO:0001583	missense	1763	exon17			CCAGTTCCAGCTT	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2605G>A	chr10.hg19:g.70182074C>T	ENSP00000351185:p.Glu869Lys	156.0	0.0	.		167.0	58.0	.	NM_001080449	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.14|16.14	3.040039|3.040039	0.55003|0.55003	0.0|0.0	1.21E-4|1.21E-4	ENSG00000138346|ENSG00000138346	ENST00000399180;ENST00000358410|ENST00000440722	D;D|.	0.91464|.	-2.85;-2.83|.	4.93|4.93	3.02|3.02	0.34903|0.34903	.|.	1.268580|.	0.05029|.	N|.	0.474288|.	T|T	0.58779|0.58779	0.2146|0.2146	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	P|.	0.49358|.	0.923|.	P|.	0.46796|.	0.527|.	T|T	0.54931|0.54931	-0.8219|-0.8219	10|5	0.11182|.	T|.	0.66|.	.|.	10.956|10.956	0.47358|0.47358	0.0:0.845:0.0:0.155|0.0:0.845:0.0:0.155	.|.	869|.	P51530|.	DNA2L_HUMAN|.	K|E	955;869|190	ENSP00000382133:E955K;ENSP00000351185:E869K|.	ENSP00000351185:E869K|.	E|G	-|-	1|2	0|0	DNA2|DNA2	69852080|69852080	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.905000|0.905000	0.53344|0.53344	2.929000|2.929000	0.48916|0.48916	1.035000|1.035000	0.39972|0.39972	0.655000|0.655000	0.94253|0.94253	GAA|GGA	.	.	.	none		0.393	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
HPSE2	60495	hgsc.bcm.edu	37	10	100481443	100481443	+	Silent	SNP	C	C	T	rs200916817		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:100481443C>T	ENST00000370552.3	-	5	986	c.927G>A	c.(925-927)ccG>ccA	p.P309P	HPSE2_ENST00000370549.1_Silent_p.P251P|HPSE2_ENST00000404542.1_Silent_p.P197P|HPSE2_ENST00000370546.1_Silent_p.P309P	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	309					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CATTCTTCCTCGGCCGCCCAA	0.438																																					p.P309P		Atlas-SNP	.											.	HPSE2	203	.	0			c.G927A						PASS	.						55.0	54.0	54.0					10																	100481443		2203	4300	6503	SO:0001819	synonymous_variant	60495	exon5			CTTCCTCGGCCGC	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.927G>A	chr10.hg19:g.100481443C>T		59.0	0.0	.		64.0	7.0	.	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	hg19	CCDS7477.1																																																																																			.	C|0.999;T|0.001	0.001	weak		0.438	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
CARNS1	57571	hgsc.bcm.edu	37	11	67186592	67186592	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:67186592G>C	ENST00000307823.3	+	4	813	c.361G>C	c.(361-363)Gga>Cga	p.G121R	CARNS1_ENST00000445895.2_Missense_Mutation_p.G244R|CARNS1_ENST00000423745.2_Missense_Mutation_p.G121R|CARNS1_ENST00000531040.1_Missense_Mutation_p.G244R	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	121					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						GCTGCTGCGGGGAGGGGATGC	0.652																																					p.G244R		Atlas-SNP	.											.	CARNS1	60	.	0			c.G730C						PASS	.						5.0	7.0	6.0					11																	67186592		1871	3990	5861	SO:0001583	missense	57571	exon5			CTGCGGGGAGGGG		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.361G>C	chr11.hg19:g.67186592G>C	ENSP00000308268:p.Gly121Arg	46.0	0.0	.		37.0	20.0	.	NM_001166222	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	ENST00000307823.3	hg19	CCDS44658.1	.	.	.	.	.	.	.	.	.	.	G	9.966	1.224062	0.22457	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000539452;ENST00000423745;ENST00000445895	T;T;T;T	0.32753	1.44;1.47;1.47;1.47	4.38	2.5	0.30297	.	.	.	.	.	T	0.31765	0.0807	N	0.19112	0.55	0.09310	N	1	D;P;D	0.62365	0.982;0.94;0.991	P;P;P	0.60068	0.868;0.605;0.868	T	0.09552	-1.0669	9	0.41790	T	0.15	.	7.4523	0.27246	0.2888:0.0:0.7112:0.0	.	244;121;260	F5H427;A5YM72;A5YM72-3	.;CRNS1_HUMAN;.	R	244;121;244;260;121;244	ENSP00000431670:G244R;ENSP00000308268:G121R;ENSP00000401519:G121R;ENSP00000389009:G244R	ENSP00000308268:G121R	G	+	1	0	CARNS1	66943168	0.111000	0.22076	0.569000	0.28460	0.012000	0.07955	2.541000	0.45735	0.487000	0.27698	0.561000	0.74099	GGA	.	.	.	none		0.652	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811	
C11orf53	341032	hgsc.bcm.edu	37	11	111156468	111156468	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:111156468A>C	ENST00000280325.4	+	4	547	c.400A>C	c.(400-402)Agt>Cgt	p.S134R		NM_198498.1	NP_940900.1	Q8IXP5	CK053_HUMAN	chromosome 11 open reading frame 53	134										endometrium(1)|large_intestine(2)|lung(3)|skin(2)	8		all_cancers(61;2.05e-09)|Melanoma(852;4.04e-05)|all_epithelial(67;6.15e-05)|all_hematologic(158;0.000826)|Acute lymphoblastic leukemia(157;0.000966)|all_neural(223;0.0332)|Medulloblastoma(222;0.0425)|Breast(348;0.147)		Epithelial(105;1.7e-06)|BRCA - Breast invasive adenocarcinoma(274;3.16e-06)|all cancers(92;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0507)		ACCCAGCACGAGTTGCCTCTC	0.632																																					p.S134R		Atlas-SNP	.											.	C11orf53	17	.	0			c.A400C						PASS	.						76.0	69.0	71.0					11																	111156468		2201	4297	6498	SO:0001583	missense	341032	exon4			AGCACGAGTTGCC	BC039669	CCDS31674.1	11q23.1	2012-05-31			ENSG00000150750	ENSG00000150750			30527	protein-coding gene	gene with protein product						12477932	Standard	NM_198498		Approved	MGC50104	uc001plc.3	Q8IXP5	OTTHUMG00000166656	ENST00000280325.4:c.400A>C	chr11.hg19:g.111156468A>C	ENSP00000280325:p.Ser134Arg	101.0	0.0	.		50.0	16.0	.	NM_198498		Missense_Mutation	SNP	ENST00000280325.4	hg19	CCDS31674.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908387	0.52333	.	.	ENSG00000150750	ENST00000280325	.	.	.	4.8	0.97	0.19692	.	0.382752	0.29198	N	0.012842	T	0.39009	0.1062	L	0.55481	1.735	0.09310	N	0.999997	P	0.43701	0.815	P	0.45681	0.49	T	0.21415	-1.0246	9	0.42905	T	0.14	-1.3318	7.5852	0.27989	0.7125:0.0:0.2875:0.0	.	134	Q8IXP5	CK053_HUMAN	R	134	.	ENSP00000280325:S134R	S	+	1	0	C11orf53	110661678	0.055000	0.20627	0.041000	0.18516	0.940000	0.58332	1.282000	0.33226	-0.088000	0.12506	0.459000	0.35465	AGT	.	.	.	none		0.632	C11orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390989.1	NM_198498	
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789342	117789342	+	Missense_Mutation	SNP	T	T	C	rs75037497		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:117789342T>C	ENST00000430170.2	-	2	320	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	TMPRSS13_ENST00000445164.2_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.Q78R	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	78	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGGAGATGCCTGGGCTGGAGA	0.672																																					p.Q78R		Atlas-SNP	.											.,4	TMPRSS13	75	.	0			c.A233G						PASS	.						40.0	48.0	46.0					11																	117789342		1932	4119	6051	SO:0001583	missense	84000	exon2			GATGCCTGGGCTG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.233A>G	chr11.hg19:g.117789342T>C	ENSP00000387702:p.Gln78Arg	73.0	0.0	.		52.0	7.0	.	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	hg19	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	t	0.008	-1.884785	0.00532	.	.	ENSG00000137747	ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	D;D;D;D;D	0.87966	-2.32;-2.25;-2.25;-2.25;-2.14	3.14	-4.2	0.03823	.	0.847229	0.09877	N	0.744233	T	0.60090	0.2242	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.55780	-0.8087	9	0.11182	T	0.66	.	9.3313	0.38023	0.0:0.381:0.0:0.619	.	78	E9PRA0	.	R	78	ENSP00000435813:Q78R;ENSP00000434279:Q78R;ENSP00000387702:Q78R;ENSP00000394114:Q78R;ENSP00000436502:Q78R	ENSP00000387702:Q78R	Q	-	2	0	TMPRSS13	117294552	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.313000	0.08103	-0.789000	0.04498	-1.186000	0.01703	CAG	.	T|0.500;C|0.500	0.500	weak		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
C14orf39	317761	hgsc.bcm.edu	37	14	60921717	60921717	+	Splice_Site	SNP	A	A	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr14:60921717A>T	ENST00000321731.3	-	16	1663		c.e16+1			NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39						multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTCTCATATTACCTGATCTGA	0.313																																					.		Atlas-SNP	.											.	C14orf39	79	.	0			c.1503+2T>A						PASS	.						36.0	39.0	38.0					14																	60921717		2198	4285	6483	SO:0001630	splice_region_variant	317761	exon17			CATATTACCTGAT	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1503+1T>A	chr14.hg19:g.60921717A>T		24.0	0.0	.		15.0	8.0	.	NM_174978	Q08AQ4	Splice_Site	SNP	ENST00000321731.3	hg19	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.563953	0.65651	.	.	ENSG00000179008	ENST00000321731	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5881	0.61944	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C14orf39	59991470	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.199000	0.65152	2.234000	0.73211	0.459000	0.35465	.	.	.	.	none		0.313	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	Intron
FAM98B	283742	hgsc.bcm.edu	37	15	38776827	38776827	+	IGR	SNP	T	T	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr15:38776827T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G423G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		gtggtggtggtggtggtggag	0.443																																					p.G423G		Atlas-SNP	.											FAM98B_ENST00000397609,NS,carcinoma,0,1	FAM98B	53	.	0			c.T1269A						PASS	.						19.0	18.0	18.0					15																	38776827		1515	3413	4928	SO:0001628	intergenic_variant	283742	exon8			TGGTGGTGGTGGT		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		chr15.hg19:g.38776827T>A		17.0	0.0	.		18.0	4.0	.	NM_173611	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	hg19	CCDS42015.1																																																																																			.	.	.	none		0.443	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
ATAD5	79915	hgsc.bcm.edu	37	17	29162089	29162089	+	Silent	SNP	T	T	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:29162089T>A	ENST00000321990.4	+	2	1368	c.990T>A	c.(988-990)ccT>ccA	p.P330P	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	330					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGGTTCACCCTATTCCGCCCA	0.378																																					p.P330P		Atlas-SNP	.											.	ATAD5	150	.	0			c.T990A						PASS	.						49.0	51.0	50.0					17																	29162089		2139	4265	6404	SO:0001819	synonymous_variant	79915	exon2			TCACCCTATTCCG		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.990T>A	chr17.hg19:g.29162089T>A		189.0	0.0	.		167.0	75.0	.	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Silent	SNP	ENST00000321990.4	hg19	CCDS11260.1																																																																																			.	.	.	none		0.378	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
ORMDL3	94103	hgsc.bcm.edu	37	17	38078866	38078866	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:38078866G>C	ENST00000394169.1	-	6	1893	c.399C>G	c.(397-399)agC>agG	p.S133R	ORMDL3_ENST00000304046.2_Missense_Mutation_p.S133R|ORMDL3_ENST00000584220.1_Missense_Mutation_p.S117R|ORMDL3_ENST00000579695.1_Missense_Mutation_p.S133R			Q8N138	ORML3_HUMAN	ORMDL sphingolipid biosynthesis regulator 3	133					ceramide metabolic process (GO:0006672)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|SPOTS complex (GO:0035339)				endometrium(3)|kidney(1)|lung(1)	5	Colorectal(19;0.000442)		Lung(15;0.0234)			GGATAAGCACGCTCATCAGGG	0.557																																					p.S133R		Atlas-SNP	.											.	ORMDL3	15	.	0			c.C399G						PASS	.						149.0	142.0	144.0					17																	38078866		2203	4300	6503	SO:0001583	missense	94103	exon4			AAGCACGCTCATC		CCDS11355.1	17q12	2014-06-16	2014-06-16		ENSG00000172057	ENSG00000172057			16038	protein-coding gene	gene with protein product		610075	"""ORM1 (S. cerevisiae)-like 3"", ""ORM1-like 3 (S. cerevisiae)"""			23066021	Standard	NM_139280		Approved		uc002htj.2	Q8N138	OTTHUMG00000133249	ENST00000394169.1:c.399C>G	chr17.hg19:g.38078866G>C	ENSP00000377724:p.Ser133Arg	159.0	0.0	.		141.0	29.0	.	NM_139280	B3KS83|Q6UY83	Missense_Mutation	SNP	ENST00000394169.1	hg19	CCDS11355.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582713	0.65992	.	.	ENSG00000172057	ENST00000304046;ENST00000394169	.	.	.	5.39	-5.34	0.02705	.	0.110120	0.64402	D	0.000008	T	0.59432	0.2193	M	0.65975	2.015	0.34860	D	0.74254	P	0.37573	0.6	P	0.47744	0.556	T	0.65915	-0.6052	9	0.51188	T	0.08	-14.1116	13.4255	0.61022	0.658:0.0:0.342:0.0	.	133	Q8N138	ORML3_HUMAN	R	133	.	ENSP00000304858:S133R	S	-	3	2	ORMDL3	35332392	0.062000	0.20869	0.906000	0.35671	0.939000	0.58152	-0.588000	0.05774	-1.031000	0.03308	-0.345000	0.07892	AGC	.	.	.	none		0.557	ORMDL3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257003.1	NM_139280	
HELZ	9931	hgsc.bcm.edu	37	17	65110487	65110487	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:65110487T>G	ENST00000358691.5	-	28	4037	c.3871A>C	c.(3871-3873)Att>Ctt	p.I1291L	HELZ_ENST00000580168.1_Missense_Mutation_p.I1292L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1291						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ATCTTATTAATTTCAGGTCCG	0.348																																					p.I1291L		Atlas-SNP	.											.	HELZ	160	.	0			c.A3871C						PASS	.						152.0	136.0	141.0					17																	65110487		1802	4071	5873	SO:0001583	missense	9931	exon28			TATTAATTTCAGG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.3871A>C	chr17.hg19:g.65110487T>G	ENSP00000351524:p.Ile1291Leu	21.0	0.0	.		47.0	31.0	.	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	hg19	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	T	12.72	2.022328	0.35701	.	.	ENSG00000198265	ENST00000358691	D	0.82344	-1.6	5.65	4.56	0.56223	.	0.541833	0.21875	N	0.067829	T	0.64283	0.2584	N	0.14661	0.345	0.28505	N	0.913814	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.50625	-0.8806	10	0.10111	T	0.7	-10.9431	7.073	0.25189	0.0:0.078:0.1469:0.7752	.	1292;1291	B7ZLW2;P42694	.;HELZ_HUMAN	L	1291	ENSP00000351524:I1291L	ENSP00000351524:I1291L	I	-	1	0	HELZ	62540949	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.522000	0.45572	2.154000	0.67381	0.445000	0.29226	ATT	.	.	.	none		0.348	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
UNC13D	201294	hgsc.bcm.edu	37	17	73831821	73831821	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:73831821C>T	ENST00000207549.4	-	19	2013	c.1634G>A	c.(1633-1635)gGt>gAt	p.G545D	UNC13D_ENST00000412096.2_Missense_Mutation_p.G545D	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	545					defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			CACTACATCACCCACAACCGT	0.617									Familial Hemophagocytic Lymphohistiocytosis																												p.G545D		Atlas-SNP	.											.	UNC13D	68	.	0			c.G1634A						PASS	.						66.0	65.0	65.0					17																	73831821		2203	4300	6503	SO:0001583	missense	201294	exon19	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	ACATCACCCACAA	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.1634G>A	chr17.hg19:g.73831821C>T	ENSP00000207549:p.Gly545Asp	129.0	0.0	.		123.0	5.0	.	NM_199242	B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	hg19	CCDS11730.1	.	.	.	.	.	.	.	.	.	.	C	2.310	-0.358240	0.05138	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.70164	-0.44;-0.46	4.81	4.81	0.61882	.	0.476497	0.22373	N	0.060904	T	0.56441	0.1985	L	0.43152	1.355	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.002	T	0.37957	-0.9683	10	0.14656	T	0.56	-0.4305	13.3603	0.60652	0.0:1.0:0.0:0.0	.	545;545	Q70J99-3;Q70J99	.;UN13D_HUMAN	D	545	ENSP00000207549:G545D;ENSP00000388093:G545D	ENSP00000207549:G545D	G	-	2	0	UNC13D	71343416	0.024000	0.19004	0.057000	0.19452	0.016000	0.09150	2.518000	0.45537	2.202000	0.70862	0.561000	0.74099	GGT	.	.	.	none		0.617	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
CREB3L3	84699	hgsc.bcm.edu	37	19	4171149	4171149	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:4171149G>T	ENST00000078445.2	+	8	1099	c.952G>T	c.(952-954)Gcc>Tcc	p.A318S	CREB3L3_ENST00000595923.1_Missense_Mutation_p.A317S|CREB3L3_ENST00000252587.3_Intron|CREB3L3_ENST00000602147.1_Missense_Mutation_p.S282I|CREB3L3_ENST00000602257.1_Missense_Mutation_p.A316S	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	318					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCAAGTCAGCCCAGACAGG	0.607																																					p.A318S		Atlas-SNP	.											.	CREB3L3	53	.	0			c.G952T						PASS	.						75.0	70.0	72.0					19																	4171149		2203	4300	6503	SO:0001583	missense	84699	exon8			AAGTCAGCCCAGA		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.952G>T	chr19.hg19:g.4171149G>T	ENSP00000078445:p.Ala318Ser	147.0	0.0	.		115.0	42.0	.	NM_032607	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	ENST00000078445.2	hg19	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462217	0.26248	.	.	ENSG00000060566	ENST00000078445;ENST00000381943	D	0.84800	-1.9	4.58	4.58	0.56647	.	0.130552	0.51477	D	0.000098	D	0.87172	0.6111	M	0.67569	2.06	0.52099	D	0.999947	D;P;P	0.62365	0.991;0.712;0.589	P;B;B	0.57204	0.815;0.396;0.223	D	0.84697	0.0726	10	0.26408	T	0.33	-0.2402	8.6838	0.34225	0.1062:0.0:0.8938:0.0	.	316;317;318	B7ZL69;Q68CJ9-2;Q68CJ9	.;.;CR3L3_HUMAN	S	318;276	ENSP00000078445:A318S	ENSP00000078445:A318S	A	+	1	0	CREB3L3	4122149	0.995000	0.38212	0.954000	0.39281	0.235000	0.25334	4.071000	0.57556	2.093000	0.63338	0.561000	0.74099	GCC	.	.	.	none		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	
ZNF227	7770	hgsc.bcm.edu	37	19	44739325	44739325	+	Nonsense_Mutation	SNP	A	A	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:44739325A>T	ENST00000313040.7	+	6	947	c.742A>T	c.(742-744)Aaa>Taa	p.K248*	ZNF227_ENST00000589005.1_Nonsense_Mutation_p.K197*|ZNF227_ENST00000391961.2_Nonsense_Mutation_p.K197*	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				CTTAGGAGAGAAACCCCATCC	0.428																																					p.K248X		Atlas-SNP	.											.	ZNF227	62	.	0			c.A742T						PASS	.						50.0	52.0	51.0					19																	44739325		2203	4300	6503	SO:0001587	stop_gained	7770	exon6			GGAGAGAAACCCC	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.742A>T	chr19.hg19:g.44739325A>T	ENSP00000321049:p.Lys248*	99.0	0.0	.		73.0	29.0	.	NM_182490	B3KRU7|B7Z5P9	Nonsense_Mutation	SNP	ENST00000313040.7	hg19	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	A	37	6.426321	0.97559	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980	.	.	.	4.04	1.86	0.25419	.	.	.	.	.	.	.	.	.	.	.	0.23150	N	0.99822	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6647	0.23035	0.7832:0.0:0.2168:0.0	.	.	.	.	X	248;205;197;227	.	ENSP00000321049:K248X	K	+	1	0	ZNF227	49431165	0.006000	0.16342	0.000000	0.03702	0.751000	0.42716	2.219000	0.42899	0.218000	0.20820	0.460000	0.39030	AAA	.	.	.	none		0.428	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
SIGLEC5	8778	hgsc.bcm.edu	37	19	52131213	52131213	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:52131213T>A	ENST00000534261.2	-	6	1270	c.871A>T	c.(871-873)Acc>Tcc	p.T291S	SIGLEC5_ENST00000599649.1_Missense_Mutation_p.T291S|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.T291S|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.T291S|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.T291S			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	291	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GAGATGGGGGTGGCGTTCAGG	0.647																																					p.T291S		Atlas-SNP	.											.	SIGLEC5	67	.	0			c.A871T						PASS	.						64.0	71.0	69.0					19																	52131213		2203	4300	6503	SO:0001583	missense	8778	exon5			TGGGGGTGGCGTT	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.871A>T	chr19.hg19:g.52131213T>A	ENSP00000473238:p.Thr291Ser	82.0	0.0	.		93.0	37.0	.	NM_003830		Missense_Mutation	SNP	ENST00000534261.2	hg19	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	T	3.867	-0.028769	0.07589	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.13420	2.59;2.59	3.76	-6.36	0.01969	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.943120	0.02702	N	0.111846	T	0.04952	0.0133	N	0.11560	0.145	0.09310	N	1	B	0.32829	0.386	B	0.35931	0.214	T	0.26883	-1.0090	10	0.02654	T	1	.	1.2256	0.01932	0.4652:0.1053:0.2382:0.1914	.	291	O15389	SIGL5_HUMAN	S	291	ENSP00000222107:T291S;ENSP00000415200:T291S	ENSP00000222107:T291S	T	-	1	0	SIGLEC5	56823025	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.639000	0.02011	-1.347000	0.02208	0.383000	0.25322	ACC	.	.	.	none		0.647	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
TGIF2	60436	hgsc.bcm.edu	37	20	35219589	35219589	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr20:35219589C>A	ENST00000373874.2	+	3	668	c.469C>A	c.(469-471)Ctg>Atg	p.L157M	RP5-977B1.11_ENST00000561134.1_RNA|TGIF2_ENST00000373872.4_Missense_Mutation_p.L157M|TGIF2-C20orf24_ENST00000558530.1_Intron	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	157	Repressive function.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				TCCCAAGCCCCTGGTGACCCC	0.632																																					p.L157M		Atlas-SNP	.											.	TGIF2	26	.	0			c.C469A						PASS	.						36.0	42.0	40.0					20																	35219589		2203	4300	6503	SO:0001583	missense	60436	exon3			AAGCCCCTGGTGA	AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.469C>A	chr20.hg19:g.35219589C>A	ENSP00000362981:p.Leu157Met	89.0	0.0	.		53.0	30.0	.	NM_021809	B2R9U3|E1P5T9|H0YNI0	Missense_Mutation	SNP	ENST00000373874.2	hg19	CCDS13278.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390012	0.42410	.	.	ENSG00000118707	ENST00000373874;ENST00000373872	T;T	0.65732	-0.17;-0.17	5.57	2.49	0.30216	.	3.072470	0.00622	N	0.000451	T	0.50718	0.1632	N	0.14661	0.345	0.80722	D	1	P	0.47106	0.89	P	0.44990	0.466	T	0.35822	-0.9773	10	0.46703	T	0.11	-14.2668	5.1002	0.14754	0.1452:0.6315:0.0:0.2233	.	157	Q9GZN2	TGIF2_HUMAN	M	157	ENSP00000362981:L157M;ENSP00000362979:L157M	ENSP00000362979:L157M	L	+	1	2	TGIF2	34653003	0.043000	0.20138	0.816000	0.32577	0.586000	0.36452	0.322000	0.19576	0.262000	0.21774	0.561000	0.74099	CTG	.	.	.	none		0.632	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809	
SUSD2	56241	hgsc.bcm.edu	37	22	24583996	24583996	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr22:24583996C>A	ENST00000358321.3	+	13	2495	c.2234C>A	c.(2233-2235)tCc>tAc	p.S745Y		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	745	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CTGGCGGGTTCCACCATCTAC	0.642																																					p.S745Y		Atlas-SNP	.											.	SUSD2	68	.	0			c.C2234A						PASS	.						80.0	82.0	81.0					22																	24583996		2203	4300	6503	SO:0001583	missense	56241	exon13			CGGGTTCCACCAT	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.2234C>A	chr22.hg19:g.24583996C>A	ENSP00000351075:p.Ser745Tyr	472.0	0.0	.		357.0	138.0	.	NM_019601	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	hg19	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366350	0.61513	.	.	ENSG00000099994	ENST00000358321	T	0.68181	-0.31	4.75	4.75	0.60458	Complement control module (2);Sushi/SCR/CCP (3);	0.119454	0.64402	D	0.000016	D	0.83403	0.5247	M	0.89414	3.03	0.41536	D	0.988484	D	0.76494	0.999	D	0.77004	0.989	D	0.86729	0.1947	10	0.72032	D	0.01	-53.0137	13.6888	0.62533	0.0:1.0:0.0:0.0	.	745	Q9UGT4	SUSD2_HUMAN	Y	745	ENSP00000351075:S745Y	ENSP00000351075:S745Y	S	+	2	0	SUSD2	22913996	0.999000	0.42202	0.998000	0.56505	0.451000	0.32288	4.155000	0.58131	2.383000	0.81215	0.505000	0.49811	TCC	.	.	.	none		0.642	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
CACNG2	10369	hgsc.bcm.edu	37	22	37098581	37098581	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr22:37098581G>T	ENST00000300105.6	-	1	1022	c.41C>A	c.(40-42)aCc>aAc	p.T14N	RP1-293L6.1_ENST00000430281.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	14					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						AGCACCAACGGTGGTTAAAAG	0.488																																					p.T14N		Atlas-SNP	.											.	CACNG2	43	.	0			c.C41A						PASS	.						154.0	142.0	146.0					22																	37098581		2203	4300	6503	SO:0001583	missense	10369	exon1			CCAACGGTGGTTA	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.41C>A	chr22.hg19:g.37098581G>T	ENSP00000300105:p.Thr14Asn	104.0	0.0	.		149.0	56.0	.	NM_006078	Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	SNP	ENST00000300105.6	hg19	CCDS13931.1	.	.	.	.	.	.	.	.	.	.	g	19.64	3.865847	0.71949	.	.	ENSG00000166862	ENST00000300105	D	0.89681	-2.55	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.94971	0.8373	M	0.84948	2.725	0.80722	D	1	D	0.62365	0.991	D	0.76071	0.987	D	0.95765	0.8804	10	0.72032	D	0.01	-20.8031	17.8661	0.88795	0.0:0.0:1.0:0.0	.	14	Q9Y698	CCG2_HUMAN	N	14	ENSP00000300105:T14N	ENSP00000300105:T14N	T	-	2	0	CACNG2	35428527	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.265000	0.95647	2.192000	0.70111	0.546000	0.68486	ACC	.	.	.	none		0.488	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
FAM47A	158724	hgsc.bcm.edu	37	X	34148936	34148936	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chrX:34148936C>T	ENST00000346193.3	-	1	1511	c.1460G>A	c.(1459-1461)cGg>cAg	p.R487Q		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	487								p.R487Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACTGGACCTCCGACGTGTCTT	0.642																																					p.R487Q		Atlas-SNP	.											.	FAM47A	249	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1460A						PASS	.						47.0	54.0	51.0					X																	34148936		2192	4286	6478	SO:0001583	missense	158724	exon1			GACCTCCGACGTG	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1460G>A	chrX.hg19:g.34148936C>T	ENSP00000345029:p.Arg487Gln	91.0	0.0	.		70.0	4.0	.	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	9.489	1.100058	0.20552	.	.	ENSG00000185448	ENST00000346193	T	0.16196	2.36	0.446	0.446	0.16602	.	.	.	.	.	T	0.10380	0.0254	N	0.24115	0.695	0.09310	N	1	D	0.62365	0.991	P	0.44811	0.461	T	0.23762	-1.0179	8	0.13470	T	0.59	.	.	.	.	.	487	Q5JRC9	FA47A_HUMAN	Q	487	ENSP00000345029:R487Q	ENSP00000345029:R487Q	R	-	2	0	FAM47A	34058857	0.022000	0.18835	0.006000	0.13384	0.016000	0.09150	0.010000	0.13242	0.435000	0.26365	0.183000	0.17082	CGG	.	.	.	none		0.642	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
ZNF233	353355	hgsc.bcm.edu	37	19	44778797	44778797	+	Frame_Shift_Del	DEL	T	T	-	rs386809644|rs386809645|rs2884015	byFrequency	TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:44778797delT	ENST00000391958.2	+	5	2111	c.1984delT	c.(1984-1986)ttgfs	p.L662fs	ZNF233_ENST00000592581.1_3'UTR|ZNF233_ENST00000334152.1_Frame_Shift_Del_p.L644fs|ZNF235_ENST00000589799.1_Intron	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				TAAGAGTTCGTTGTCTTCAGA	0.413																																					p.S661fs		Atlas-INDEL	.											.,8	ZNF233	73	.	0			c.1983delG						PASS	.		,	2463,1797		712,1039,379	70.0	79.0	75.0		,	-8.4	0.0	19	dbSNP_129	61	1034,7216		69,896,3160	no	frameshift,frameshift	ZNF233	NM_181756.2,NM_001207005.1	,	781,1935,3539	A1A1,A1R,RR		12.5333,42.1831,27.9536	,	,	44778797	3497,9013	2201	4300	6501	SO:0001589	frameshift_variant	353355	exon5			.	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1984delT	chr19.hg19:g.44778797delT	ENSP00000375820:p.Leu662fs	61.0	0.0	0		56.0	20.0	0.357143	NM_001207005	B2RN78|B2RN79|Q86WL8	Frame_Shift_Del	DEL	ENST00000391958.2	hg19	CCDS33047.1																																																																																			.	.	.	none		0.413	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
HNF4A	3172	hgsc.bcm.edu	37	20	43052875	43052876	+	Frame_Shift_Ins	INS	-	-	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr20:43052875_43052876insC	ENST00000316099.4	+	8	1199_1200	c.1110_1111insC	c.(1111-1113)cagfs	p.Q371fs	HNF4A_ENST00000457232.1_Frame_Shift_Ins_p.Q349fs|HNF4A_ENST00000609795.1_Frame_Shift_Ins_p.Q349fs|AL132772.1_ENST00000581483.1_RNA|HNF4A_ENST00000415691.2_Frame_Shift_Ins_p.Q371fs|HNF4A_ENST00000443598.2_Frame_Shift_Ins_p.Q371fs|HNF4A_ENST00000316673.4_Frame_Shift_Ins_p.Q349fs	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	371					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACAACCTGTTGCAGGAGATGCT	0.609																																					p.L370fs	Colon(79;2 1269 8820 14841 52347)	Atlas-Indel,Pindel	.											.	HNF4A	150	.	0			c.1110_1111insC						PASS	.																																			SO:0001589	frameshift_variant	3172	exon8			.	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1111dupC	chr20.hg19:g.43052876_43052876dupC	ENSP00000312987:p.Gln371fs	185.0	0.0	0		148.0	50.0	0.337838	NM_178849	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Frame_Shift_Ins	INS	ENST00000316099.4	hg19	CCDS13330.1																																																																																			.	.	.	none		0.609	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		
LAMA3	3909	hgsc.bcm.edu	37	18	21511118	21511118	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr18:21511118delT	ENST00000313654.9	+	65	8770	c.8529delT	c.(8527-8529)tatfs	p.Y2843fs	LAMA3_ENST00000399516.3_Frame_Shift_Del_p.Y2787fs|LAMA3_ENST00000269217.6_Frame_Shift_Del_p.Y1234fs|LAMA3_ENST00000587184.1_Frame_Shift_Del_p.Y1178fs|LAMA3_ENST00000588770.1_3'UTR	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2843	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CACAGACGTATATGGATGGTT	0.428																																					p.Y2843fs		Atlas-INDEL	.											.	LAMA3	397	.	0			c.8528delA						PASS	.						112.0	111.0	111.0					18																	21511118		2203	4300	6503	SO:0001589	frameshift_variant	3909	exon65			.	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8529delT	chr18.hg19:g.21511118delT	ENSP00000324532:p.Tyr2843fs	54.0	0.0	0		57.0	13.0	0.22807	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Frame_Shift_Del	DEL	ENST00000313654.9	hg19	CCDS42419.1																																																																																			.	.	.	none		0.428	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
GBF1	8729	hgsc.bcm.edu	37	10	104123472	104123472	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:104123472delA	ENST00000369983.3	+	17	2280	c.2020delA	c.(2020-2022)aaafs	p.K675fs		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	675					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CCTAGCTGACAAAAAGTTTGC	0.423																																					p.D674fs		Atlas-Indel,Pindel	.											.	GBF1	142	.	0			c.2022delC						PASS	.						113.0	119.0	117.0					10																	104123472		2203	4300	6503	SO:0001589	frameshift_variant	8729	exon17			.	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2020delA	chr10.hg19:g.104123472delA	ENSP00000359000:p.Lys675fs	76.0	0.0	0		69.0	19.0	0.275362	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Frame_Shift_Del	DEL	ENST00000369983.3	hg19	CCDS7533.1																																																																																			.	.	.	none		0.423	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
LAMA3	3909	hgsc.bcm.edu	37	18	21511115	21511115	+	Frame_Shift_Del	DEL	G	G	-	rs546328935		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr18:21511115delG	ENST00000313654.9	+	65	8767	c.8526delG	c.(8524-8526)acgfs	p.T2842fs	LAMA3_ENST00000399516.3_Frame_Shift_Del_p.T2786fs|LAMA3_ENST00000269217.6_Frame_Shift_Del_p.T1233fs|LAMA3_ENST00000587184.1_Frame_Shift_Del_p.T1177fs|LAMA3_ENST00000588770.1_3'UTR	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2842	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTCCACAGACGTATATGGATG	0.428																																					p.T2842fs		Atlas-INDEL	.											.	LAMA3	397	.	0			c.8525delC						PASS	.						110.0	110.0	110.0					18																	21511115		2203	4300	6503	SO:0001589	frameshift_variant	3909	exon65			.	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8526delG	chr18.hg19:g.21511115delG	ENSP00000324532:p.Thr2842fs	52.0	0.0	0		49.0	13.0	0.265306	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Frame_Shift_Del	DEL	ENST00000313654.9	hg19	CCDS42419.1																																																																																			.	.	.	none		0.428	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
BAP1	8314	hgsc.bcm.edu	37	3	52439271	52439271	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:52439271delG	ENST00000460680.1	-	11	1442	c.971delC	c.(970-972)ccafs	p.P324fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.P306fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P324fs*11(1)|p.A323fs*71(1)|p.P324fs*7(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GCTGTGGGATGGGGCTTGTGC	0.592			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.P324fs	GBM(101;493 1458 7992 21037 25532)	Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	3	Deletion - Frameshift(3)	eye(1)|kidney(1)|pleura(1)	c.972delA						PASS	.						115.0	120.0	118.0					3																	52439271		2203	4300	6503	SO:0001589	frameshift_variant	8314	exon11			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.971delC	chr3.hg19:g.52439271delG	ENSP00000417132:p.Pro324fs	100.0	0.0	0		81.0	60.0	0.740741	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.	.	none		0.592	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
LAMA3	3909	hgsc.bcm.edu	37	18	21511115	21511118	+	Frame_Shift_Del	DEL	GTAT	GTAT	-	rs546328935		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	GTAT	GTAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr18:21511115_21511118delGTAT	ENST00000313654.9	+	65	8767_8770	c.8526_8529delGTAT	c.(8524-8529)acgtatfs	p.TY2842fs	LAMA3_ENST00000399516.3_Frame_Shift_Del_p.TY2786fs|LAMA3_ENST00000269217.6_Frame_Shift_Del_p.TY1233fs|LAMA3_ENST00000587184.1_Frame_Shift_Del_p.TY1177fs|LAMA3_ENST00000588770.1_3'UTR	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2842	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTCCACAGACGTATATGGATGGTT	0.431																																					p.2842_2843del		Pindel	.											.	LAMA3	397	.	0			c.8525_8528del						PASS	.																																			SO:0001589	frameshift_variant	3909	exon65			.	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8526_8529delGTAT	chr18.hg19:g.21511115_21511118delGTAT	ENSP00000324532:p.Thr2842fs	51.0	0.0	.		54.0	14.0	0.259	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Frame_Shift_Del	DEL	ENST00000313654.9	hg19	CCDS42419.1																																																																																			.	.	.	none		0.431	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
