#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGTRAP	57085	hgsc.bcm.edu	37	1	11808542	11808542	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:11808542G>A	ENST00000314340.5	+	4	293	c.239G>A	c.(238-240)aGc>aAc	p.S80N	AGTRAP_ENST00000376629.4_Missense_Mutation_p.S80N|AGTRAP_ENST00000452018.2_Silent_p.Q112Q|AGTRAP_ENST00000491346.1_3'UTR|AGTRAP_ENST00000510878.1_Missense_Mutation_p.A45T|AGTRAP_ENST00000376627.2_Silent_p.Q124Q|AGTRAP_ENST00000376637.3_Silent_p.Q68Q|AGTRAP_ENST00000400895.2_Silent_p.Q112Q	NM_020350.4	NP_065083.3	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein	80					regulation of blood pressure (GO:0008217)|response to hypoxia (GO:0001666)	cell cortex (GO:0005938)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)		AGTRAP/BRAF(2)	endometrium(1)|lung(3)|prostate(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CCGCGGGTCAGCCTCACGGAC	0.602																																					p.S80N		Atlas-SNP	.											.	AGTRAP	9	.	0			c.G239A						PASS	.						125.0	94.0	105.0					1																	11808542		2203	4300	6503	SO:0001583	missense	57085	exon4			GGGTCAGCCTCAC	AF165187	CCDS136.1, CCDS30585.1, CCDS30586.1, CCDS41248.1, CCDS44056.1	1p36.22	2008-02-05			ENSG00000177674	ENSG00000177674			13539	protein-coding gene	gene with protein product		608729				11733189	Standard	NM_001040194		Approved	ATRAP	uc001asv.3	Q6RW13	OTTHUMG00000002230	ENST00000314340.5:c.239G>A	chr1.hg19:g.11808542G>A	ENSP00000319713:p.Ser80Asn	60.0	0.0	.		50.0	21.0	.	NM_001040194	A8MVQ5|Q5SNV4|Q5SNV5|Q96AC0|Q96PL4|Q9NRW9	Missense_Mutation	SNP	ENST00000314340.5	hg19	CCDS136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.143|3.143	-0.175891|-0.175891	0.06421|0.06421	.|.	.|.	ENSG00000177674|ENSG00000177674	ENST00000510878|ENST00000376629;ENST00000314340	.|T;T	.|0.40225	.|1.04;1.04	4.06|4.06	-8.12|-8.12	0.01078|0.01078	.|.	.|1.568190	.|0.04398	.|N	.|0.363603	T|T	0.17323|0.17323	0.0416|0.0416	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.0;0.001	T|T	0.12477|0.12477	-1.0546|-1.0546	5|9	0.87932|0.14656	D|T	0|0.56	4.0859|4.0859	3.1848|3.1848	0.06597|0.06597	0.3059:0.3606:0.2425:0.0911|0.3059:0.3606:0.2425:0.0911	.|.	.|80;80	.|Q6RW13-2;Q6RW13	.|.;ATRAP_HUMAN	T|N	45|80	.|ENSP00000365816:S80N;ENSP00000319713:S80N	ENSP00000422647:A45T|ENSP00000319713:S80N	A|S	+|+	1|2	0|0	AGTRAP|AGTRAP	11731129|11731129	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-1.508000|-1.508000	0.02266|0.02266	-1.874000|-1.874000	0.01133|0.01133	-1.263000|-1.263000	0.01449|0.01449	GCC|AGC	.	.	.	none		0.602	AGTRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006335.1	NM_020350	
ALPL	249	hgsc.bcm.edu	37	1	21890580	21890580	+	Silent	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:21890580C>A	ENST00000374840.3	+	6	769	c.519C>A	c.(517-519)acC>acA	p.T173T	ALPL_ENST00000468526.1_3'UTR|ALPL_ENST00000374832.1_Silent_p.T173T|ALPL_ENST00000539907.1_Silent_p.T96T|ALPL_ENST00000540617.1_Silent_p.T118T|ALPL_ENST00000425315.2_Silent_p.T173T	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	173					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	ACCATGCCACCCCCAGCGCCG	0.627																																					p.T173T		Atlas-SNP	.											.	ALPL	50	.	0			c.C519A						PASS	.						75.0	70.0	72.0					1																	21890580		2203	4300	6503	SO:0001819	synonymous_variant	249	exon6			TGCCACCCCCAGC	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.519C>A	chr1.hg19:g.21890580C>A		22.0	0.0	.		28.0	12.0	.	NM_000478	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Silent	SNP	ENST00000374840.3	hg19	CCDS217.1																																																																																			.	.	.	none		0.627	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008202.1	NM_000478	
SZT2	23334	hgsc.bcm.edu	37	1	43893320	43893320	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:43893320T>C	ENST00000562955.1	+	25	3547	c.3547T>C	c.(3547-3549)Tac>Cac	p.Y1183H	SZT2_ENST00000372442.1_Missense_Mutation_p.Y341H	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1240					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GTGTCCTGTCTACATCTACAG	0.597																																					p.Y1183H		Atlas-SNP	.											.	SZT2	383	.	0			c.T3547C						PASS	.						60.0	66.0	64.0					1																	43893320		2203	4300	6503	SO:0001583	missense	23334	exon25			CCTGTCTACATCT	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.3547T>C	chr1.hg19:g.43893320T>C	ENSP00000457168:p.Tyr1183His	41.0	0.0	.		41.0	14.0	.	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	hg19	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	T	20.6	4.016875	0.75161	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.26	5.26	0.73747	.	0.222108	0.39615	N	0.001304	T	0.61615	0.2361	M	0.63843	1.955	0.25906	N	0.983298	D	0.54964	0.969	P	0.57620	0.824	T	0.59568	-0.7430	9	0.87932	D	0	.	15.3531	0.74405	0.0:0.0:0.0:1.0	.	1183	Q5T011-5	.	H	341	.	ENSP00000361519:Y341H	Y	+	1	0	SZT2	43665907	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.185000	0.77714	2.207000	0.71202	0.533000	0.62120	TAC	.	.	.	none		0.597	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
C8B	732	hgsc.bcm.edu	37	1	57409426	57409426	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:57409426A>T	ENST00000371237.4	-	8	1243	c.1177T>A	c.(1177-1179)Tac>Aac	p.Y393N	C8B_ENST00000535057.1_Missense_Mutation_p.Y331N|C8B_ENST00000543257.1_Missense_Mutation_p.Y341N	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	393	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						AGACTGACGTAGACCTCTTCA	0.398																																					p.Y393N		Atlas-SNP	.											.	C8B	107	.	0			c.T1177A						PASS	.						234.0	201.0	212.0					1																	57409426		2203	4300	6503	SO:0001583	missense	732	exon8			TGACGTAGACCTC	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1177T>A	chr1.hg19:g.57409426A>T	ENSP00000360281:p.Tyr393Asn	122.0	0.0	.		126.0	54.0	.	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	hg19	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	A	12.59	1.984073	0.35036	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.26223	1.91;1.92;1.75	4.59	2.17	0.27698	Membrane attack complex component/perforin (MACPF) domain (3);	0.397983	0.29246	N	0.012719	T	0.31295	0.0792	M	0.80183	2.485	0.38163	D	0.939107	P;P;P	0.42871	0.753;0.753;0.792	B;B;P	0.44860	0.332;0.332;0.462	T	0.15093	-1.0449	10	0.25106	T	0.35	-7.8974	7.3585	0.26733	0.708:0.1492:0.0:0.1428	.	341;331;393	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	N	393;341;331	ENSP00000360281:Y393N;ENSP00000442548:Y341N;ENSP00000440113:Y331N	ENSP00000360281:Y393N	Y	-	1	0	C8B	57182014	0.422000	0.25473	0.042000	0.18584	0.025000	0.11179	0.822000	0.27352	0.461000	0.27071	0.533000	0.62120	TAC	.	.	.	none		0.398	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
CCBL2	56267	hgsc.bcm.edu	37	1	89409053	89409053	+	Nonsense_Mutation	SNP	T	T	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:89409053T>A	ENST00000260508.4	-	12	1532	c.1195A>T	c.(1195-1197)Aaa>Taa	p.K399*	CCBL2_ENST00000370491.3_Nonsense_Mutation_p.K365*|CCBL2_ENST00000370485.2_3'UTR|CCBL2_ENST00000446900.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	399					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		GTCATCCATTTCACAAACTTA	0.313																																					p.K399X		Atlas-SNP	.											.	CCBL2	138	.	0			c.A1195T						PASS	.						99.0	99.0	99.0					1																	89409053		2203	4300	6503	SO:0001587	stop_gained	56267	exon12			TCCATTTCACAAA	AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.1195A>T	chr1.hg19:g.89409053T>A	ENSP00000260508:p.Lys399*	197.0	0.0	.		193.0	69.0	.	NM_001008661	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Nonsense_Mutation	SNP	ENST00000260508.4	hg19	CCDS30766.1	.	.	.	.	.	.	.	.	.	.	T	38	6.926121	0.97940	.	.	ENSG00000137944	ENST00000370491;ENST00000260508	.	.	.	5.65	5.65	0.86999	.	0.046579	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.8953	12.9534	0.58413	0.0:0.0:0.1346:0.8654	.	.	.	.	X	365;399	.	ENSP00000260508:K399X	K	-	1	0	CCBL2	89181641	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.403000	0.66338	2.149000	0.67028	0.460000	0.39030	AAA	.	.	.	none		0.313	CCBL2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000029300.3	NM_001008661	
ZNF644	84146	hgsc.bcm.edu	37	1	91405923	91405923	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:91405923C>T	ENST00000370440.1	-	3	1205	c.988G>A	c.(988-990)Gaa>Aaa	p.E330K	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.E330K|ZNF644_ENST00000361321.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TGTAGCTCTTCATTTTGTTCT	0.358																																					p.E330K		Atlas-SNP	.											.	ZNF644	120	.	0			c.G988A						PASS	.						100.0	99.0	99.0					1																	91405923		2203	4299	6502	SO:0001583	missense	84146	exon3			GCTCTTCATTTTG	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.988G>A	chr1.hg19:g.91405923C>T	ENSP00000359469:p.Glu330Lys	84.0	0.0	.		87.0	26.0	.	NM_201269	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	hg19	CCDS731.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732778	0.30684	.	.	ENSG00000122482	ENST00000370440;ENST00000337393	T;T	0.00596	6.32;6.32	5.58	5.58	0.84498	.	0.230912	0.44688	D	0.000434	T	0.00524	0.0017	L	0.29908	0.895	0.46564	D	0.999104	D	0.56521	0.976	P	0.47603	0.551	D	0.85156	0.0989	10	0.72032	D	0.01	-17.5126	19.5736	0.95432	0.0:1.0:0.0:0.0	.	330	Q9H582	ZN644_HUMAN	K	330	ENSP00000359469:E330K;ENSP00000337008:E330K	ENSP00000337008:E330K	E	-	1	0	ZNF644	91178511	1.000000	0.71417	0.999000	0.59377	0.521000	0.34408	2.652000	0.46682	2.636000	0.89361	0.655000	0.94253	GAA	.	.	.	none		0.358	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
OVGP1	5016	hgsc.bcm.edu	37	1	111957099	111957099	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:111957099T>C	ENST00000369732.3	-	11	2079	c.2024A>G	c.(2023-2025)gAt>gGt	p.D675G		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	675					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGCTTCTTCATCCACAGCAGA	0.453																																					p.D675G		Atlas-SNP	.											.	OVGP1	177	.	0			c.A2024G						PASS	.						66.0	72.0	70.0					1																	111957099		2202	4300	6502	SO:0001583	missense	5016	exon11			TCTTCATCCACAG	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.2024A>G	chr1.hg19:g.111957099T>C	ENSP00000358747:p.Asp675Gly	48.0	0.0	.		47.0	14.0	.	NM_002557	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	hg19	CCDS834.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.254760	0.22965	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.05717	3.4	4.92	2.54	0.30619	.	22.625600	0.00748	N	0.001042	T	0.01835	0.0058	N	0.22421	0.69	0.09310	N	1	B;B	0.15719	0.014;0.005	B;B	0.12156	0.007;0.004	T	0.41378	-0.9512	10	0.72032	D	0.01	.	6.616	0.22776	0.0:0.2102:0.0:0.7898	.	675;739	Q12889;Q59HH5	OVGP1_HUMAN;.	G	675;739;483	ENSP00000358747:D675G	ENSP00000358743:D739G	D	-	2	0	OVGP1	111758622	0.000000	0.05858	0.004000	0.12327	0.364000	0.29643	0.283000	0.18846	0.418000	0.25898	0.477000	0.44152	GAT	.	.	.	none		0.453	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
DDX20	11218	hgsc.bcm.edu	37	1	112299304	112299304	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:112299304C>G	ENST00000369702.4	+	2	958	c.338C>G	c.(337-339)aCc>aGc	p.T113S	DDX20_ENST00000536167.1_Missense_Mutation_p.T113S|FAM212B_ENST00000412270.1_5'Flank|FAM212B_ENST00000444059.2_5'Flank	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	113	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCGGGAAAACCTGTGTGTTC	0.433																																					p.T113S		Atlas-SNP	.											.	DDX20	50	.	0			c.C338G						PASS	.						113.0	106.0	108.0					1																	112299304		2203	4300	6503	SO:0001583	missense	11218	exon2			GGAAAACCTGTGT	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.338C>G	chr1.hg19:g.112299304C>G	ENSP00000358716:p.Thr113Ser	95.0	0.0	.		85.0	21.0	.	NM_007204	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	ENST00000369702.4	hg19	CCDS842.1	.	.	.	.	.	.	.	.	.	.	C	32	5.118880	0.94385	.	.	ENSG00000064703	ENST00000369702;ENST00000536167	T;T	0.72505	0.88;-0.66	5.61	5.61	0.85477	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86062	0.5843	M	0.90922	3.16	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.88501	0.3082	10	0.72032	D	0.01	-14.8317	17.412	0.87488	0.0:1.0:0.0:0.0	.	113	Q9UHI6	DDX20_HUMAN	S	113	ENSP00000358716:T113S;ENSP00000439026:T113S	ENSP00000358716:T113S	T	+	2	0	DDX20	112100827	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.770000	0.74990	2.644000	0.89710	0.561000	0.74099	ACC	.	.	.	none		0.433	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033063.2	NM_007204	
S100A16	140576	hgsc.bcm.edu	37	1	153580138	153580138	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:153580138G>C	ENST00000368704.1	-	3	369	c.184C>G	c.(184-186)Ctc>Gtc	p.L62V	S100A16_ENST00000368703.2_Missense_Mutation_p.L62V|S100A16_ENST00000368705.2_Missense_Mutation_p.L62V|S100A16_ENST00000368706.4_Missense_Mutation_p.L62V|S100A16_ENST00000474991.1_5'UTR			Q96FQ6	S10AG_HUMAN	S100 calcium binding protein A16	62	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(1)|prostate(1)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCTGGATGAGCTTATCCGCA	0.587																																					p.L62V	Melanoma(71;1388 1729 37039 46098)	Atlas-SNP	.											.	S100A16	7	.	0			c.C184G						PASS	.						89.0	81.0	84.0					1																	153580138		2203	4300	6503	SO:0001583	missense	140576	exon3			GGATGAGCTTATC	BC010541	CCDS1045.1	1q21	2014-01-28			ENSG00000188643	ENSG00000188643		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	20441	protein-coding gene	gene with protein product						9417904	Standard	NM_080388		Approved	S100F, DT1P1A7, MGC17528	uc001fcd.1	Q96FQ6	OTTHUMG00000013545	ENST00000368704.1:c.184C>G	chr1.hg19:g.153580138G>C	ENSP00000357693:p.Leu62Val	63.0	0.0	.		60.0	22.0	.	NM_080388	A8K439|D3DV52|Q5RHS6	Missense_Mutation	SNP	ENST00000368704.1	hg19	CCDS1045.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.082152	0.55861	.	.	ENSG00000188643	ENST00000368704;ENST00000368705;ENST00000368706;ENST00000368703	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	4.38	4.38	0.52667	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	0.140645	0.33110	N	0.005273	T	0.73737	0.3625	L	0.55481	1.735	0.42070	D	0.991207	D	0.64830	0.994	D	0.70716	0.97	T	0.70597	-0.4828	10	0.30078	T	0.28	-4.9853	14.8714	0.70459	0.0:0.0:1.0:0.0	.	62	Q96FQ6	S10AG_HUMAN	V	62	ENSP00000357693:L62V;ENSP00000357694:L62V;ENSP00000357695:L62V;ENSP00000357692:L62V	ENSP00000357692:L62V	L	-	1	0	S100A16	151846762	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	3.803000	0.55560	2.462000	0.83206	0.456000	0.33151	CTC	.	.	.	none		0.587	S100A16-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037713.1	NM_080388	
SLC19A2	10560	hgsc.bcm.edu	37	1	169454887	169454887	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:169454887A>G	ENST00000236137.5	-	1	354	c.118T>C	c.(118-120)Tac>Cac	p.Y40H	SLC19A2_ENST00000367804.4_Missense_Mutation_p.Y40H	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	40					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	AAGAAGCCGTAGGCGCAGAGC	0.721																																					p.Y40H		Atlas-SNP	.											.	SLC19A2	35	.	0			c.T118C						PASS	.						7.0	9.0	8.0					1																	169454887		2081	4110	6191	SO:0001583	missense	10560	exon1			AGCCGTAGGCGCA	AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.118T>C	chr1.hg19:g.169454887A>G	ENSP00000236137:p.Tyr40His	51.0	0.0	.		58.0	29.0	.	NM_006996	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Missense_Mutation	SNP	ENST00000236137.5	hg19	CCDS1280.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.958638	0.74016	.	.	ENSG00000117479	ENST00000236137;ENST00000367804;ENST00000367802	D;D;D	0.89552	-2.53;-2.46;-2.53	4.38	4.38	0.52667	Major facilitator superfamily domain, general substrate transporter (1);	0.068558	0.64402	D	0.000011	D	0.91821	0.7412	M	0.80422	2.495	0.43977	D	0.996660	P;D	0.59357	0.834;0.985	B;P	0.60345	0.363;0.873	D	0.93069	0.6481	9	0.62326	D	0.03	-10.2171	13.7581	0.62948	1.0:0.0:0.0:0.0	.	40;40	O60779-2;O60779	.;S19A2_HUMAN	H	40	ENSP00000236137:Y40H;ENSP00000356778:Y40H;ENSP00000356776:Y40H	ENSP00000236137:Y40H	Y	-	1	0	SLC19A2	167721511	1.000000	0.71417	1.000000	0.80357	0.331000	0.28603	6.838000	0.75359	1.821000	0.53095	0.482000	0.46254	TAC	.	.	.	none		0.721	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1	NM_006996	
ETNK2	55224	hgsc.bcm.edu	37	1	204118891	204118892	+	Missense_Mutation	DNP	TA	TA	CG	rs377403947		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:204118891_204118892TA>CG	ENST00000367202.4	-	2	607_608	c.457_458TA>CG	c.(457-459)TAt>CGt	p.Y153R	ETNK2_ENST00000367201.3_Missense_Mutation_p.Y153R|ETNK2_ENST00000367199.2_Missense_Mutation_p.Y125R|ETNK2_ENST00000367198.2_5'Flank	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	153					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CATGTACTCATAGCACAGCCCA	0.584																																					p.Y153C|p.Y153H		Atlas-SNP	.											.	ETNK2	48	.	0			c.A458G|c.T457C						PASS	.																																			SO:0001583	missense	55224	exon2			TACTCATAGCACA|ACTCATAGCACAG	AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.457_458delinsCG	chr1.hg19:g.204118891_204118892delinsCG	ENSP00000356170:p.Tyr153Arg	29.0	0.0	.		38.0|37.0	12.0	.	NM_018208	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	ENST00000367202.4	hg19	CCDS1442.2																																																																																			.	.	.	none		0.584	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087893.1	NM_018208	
USH2A	7399	hgsc.bcm.edu	37	1	215807830	215807830	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:215807830T>G	ENST00000307340.3	-	70	15654	c.15268A>C	c.(15268-15270)Aat>Cat	p.N5090H	USH2A_ENST00000366943.2_Missense_Mutation_p.N5090H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	5090					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGGTAAACATTCAATGGAGAC	0.418										HNSCC(13;0.011)																											p.N5090H		Atlas-SNP	.											.	USH2A	1168	.	0			c.A15268C						PASS	.						101.0	103.0	102.0					1																	215807830		2203	4300	6503	SO:0001583	missense	7399	exon70			AAACATTCAATGG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.15268A>C	chr1.hg19:g.215807830T>G	ENSP00000305941:p.Asn5090His	110.0	0.0	.		118.0	46.0	.	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.468710	0.43839	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13196	2.62;2.61	5.74	4.61	0.57282	.	0.644992	0.13425	N	0.388859	T	0.13372	0.0324	L	0.36672	1.1	0.24098	N	0.995885	P	0.38642	0.641	B	0.37833	0.259	T	0.11036	-1.0604	10	0.59425	D	0.04	.	11.4143	0.49943	0.0:0.0705:0.0:0.9295	.	5090	O75445	USH2A_HUMAN	H	5090	ENSP00000305941:N5090H;ENSP00000355910:N5090H	ENSP00000305941:N5090H	N	-	1	0	USH2A	213874453	0.985000	0.35326	0.093000	0.20910	0.197000	0.23852	2.127000	0.42035	1.005000	0.39183	0.533000	0.62120	AAT	.	.	.	none		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
PARP1	142	hgsc.bcm.edu	37	1	226570809	226570809	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:226570809C>T	ENST00000366794.5	-	8	1230	c.1087G>A	c.(1087-1089)Gcc>Acc	p.A363T		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	363					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GCCACGGAGGCGCTGGTTTCT	0.498								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.A363T		Atlas-SNP	.											.	PARP1	100	.	0			c.G1087A						PASS	.						102.0	128.0	119.0					1																	226570809		2203	4300	6503	SO:0001583	missense	142	exon8			CGGAGGCGCTGGT	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1087G>A	chr1.hg19:g.226570809C>T	ENSP00000355759:p.Ala363Thr	72.0	0.0	.		68.0	30.0	.	NM_001618	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	hg19	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	C	0.062	-1.220740	0.01530	.	.	ENSG00000143799	ENST00000366794	T	0.08896	3.04	5.26	-3.57	0.04612	.	0.543121	0.22223	N	0.062926	T	0.03011	0.0089	N	0.08118	0	0.35886	D	0.829289	B	0.02656	0.0	B	0.01281	0.0	T	0.49466	-0.8937	10	0.05833	T	0.94	.	12.1841	0.54227	0.0:0.4939:0.0:0.5061	.	363	P09874	PARP1_HUMAN	T	363	ENSP00000355759:A363T	ENSP00000355759:A363T	A	-	1	0	PARP1	224637432	0.014000	0.17966	0.001000	0.08648	0.056000	0.15407	0.261000	0.18442	-0.521000	0.06426	-0.266000	0.10368	GCC	.	.	.	none		0.498	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
OBSCN	84033	hgsc.bcm.edu	37	1	228461691	228461691	+	Silent	SNP	C	C	T	rs374335072		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:228461691C>T	ENST00000422127.1	+	18	5402	c.5358C>T	c.(5356-5358)agC>agT	p.S1786S	OBSCN_ENST00000359599.6_Silent_p.S633S|OBSCN_ENST00000366709.4_5'UTR|RP5-1139B12.3_ENST00000602529.1_RNA|RP5-1139B12.2_ENST00000602517.1_RNA|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.S1786S|OBSCN_ENST00000570156.2_Silent_p.S2161S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1786	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TTCTGGACAGCGCCATCTACA	0.667																																					p.S2161S		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C6483T						PASS	.	T	,	1,4235		0,1,2117	18.0	23.0	21.0		5358,5358	-7.9	0.1	1		21	0,8424		0,0,4212	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	0,1,6329	TT,TC,CC		0.0,0.0236,0.0079	,	1786/7969,1786/6621	228461691	1,12659	2118	4212	6330	SO:0001819	synonymous_variant	84033	exon22			GGACAGCGCCATC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5358C>T	chr1.hg19:g.228461691C>T		76.0	0.0	.		56.0	20.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.	.	none		0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
GREB1	9687	hgsc.bcm.edu	37	2	11751041	11751041	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr2:11751041A>G	ENST00000381486.2	+	18	3194	c.2894A>G	c.(2893-2895)gAg>gGg	p.E965G	GREB1_ENST00000234142.5_Missense_Mutation_p.E965G|GREB1_ENST00000396123.1_5'Flank	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	965						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GTGGCCTATGAGCGGCTGGCC	0.682																																					p.E965G	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.A2894G						PASS	.						14.0	18.0	17.0					2																	11751041		2015	4146	6161	SO:0001583	missense	9687	exon18			CCTATGAGCGGCT		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.2894A>G	chr2.hg19:g.11751041A>G	ENSP00000370896:p.Glu965Gly	87.0	0.0	.		72.0	19.0	.	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.960016	0.74016	.	.	ENSG00000196208	ENST00000381486;ENST00000234142	T;T	0.50813	0.73;0.73	5.17	5.17	0.71159	.	0.219003	0.38897	N	0.001534	T	0.67832	0.2935	M	0.73217	2.22	0.42070	D	0.991201	D	0.89917	1.0	D	0.85130	0.997	T	0.72734	-0.4204	10	0.87932	D	0	-44.6127	15.0084	0.71530	1.0:0.0:0.0:0.0	.	965	Q4ZG55	GREB1_HUMAN	G	965	ENSP00000370896:E965G;ENSP00000234142:E965G	ENSP00000234142:E965G	E	+	2	0	GREB1	11668492	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	3.663000	0.54518	1.951000	0.56629	0.460000	0.39030	GAG	.	.	.	none		0.682	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
GKN1	56287	hgsc.bcm.edu	37	2	69207188	69207188	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr2:69207188G>A	ENST00000377938.2	+	5	564	c.501G>A	c.(499-501)atG>atA	p.M167I		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	167					digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)				breast(2)|large_intestine(4)|lung(5)	11						CTGAGGAGATGCAAGGTGAGT	0.502																																					p.M167I		Atlas-SNP	.											.	GKN1	24	.	0			c.G501A						PASS	.						141.0	101.0	115.0					2																	69207188		2203	4300	6503	SO:0001583	missense	56287	exon5			GGAGATGCAAGGT	AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.501G>A	chr2.hg19:g.69207188G>A	ENSP00000367172:p.Met167Ile	58.0	0.0	.		43.0	24.0	.	NM_019617	Q8IUA9	Missense_Mutation	SNP	ENST00000377938.2	hg19	CCDS1891.2	.	.	.	.	.	.	.	.	.	.	G	0.082	-1.182600	0.01620	.	.	ENSG00000169605	ENST00000377938	T	0.39787	1.06	5.35	0.0642	0.14352	.	0.896583	0.09689	N	0.768723	T	0.16727	0.0402	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29912	-0.9996	10	0.08381	T	0.77	-3.1782	6.6465	0.22939	0.2552:0.0:0.4241:0.3207	.	167	Q9NS71	GKN1_HUMAN	I	167	ENSP00000367172:M167I	ENSP00000367172:M167I	M	+	3	0	GKN1	69060692	0.000000	0.05858	0.127000	0.21898	0.582000	0.36321	-0.098000	0.11024	-0.111000	0.12001	-1.506000	0.00953	ATG	.	.	.	none		0.502	GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617	
KDM3A	55818	hgsc.bcm.edu	37	2	86709089	86709089	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr2:86709089T>G	ENST00000409556.1	+	18	2914	c.2549T>G	c.(2548-2550)aTc>aGc	p.I850S	KDM3A_ENST00000542128.1_Missense_Mutation_p.I798S|KDM3A_ENST00000409064.1_Missense_Mutation_p.I850S|KDM3A_ENST00000312912.5_Missense_Mutation_p.I850S			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	850					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AAGAATGAAATCAAATGCCTT	0.363																																					p.I850S	NSCLC(96;1150 1523 6936 46253 49736)	Atlas-SNP	.											.	KDM3A	179	.	0			c.T2549G						PASS	.						127.0	120.0	122.0					2																	86709089		2203	4300	6503	SO:0001583	missense	55818	exon17			ATGAAATCAAATG	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2549T>G	chr2.hg19:g.86709089T>G	ENSP00000386660:p.Ile850Ser	126.0	0.0	.		108.0	44.0	.	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	hg19	CCDS1990.1	.	.	.	.	.	.	.	.	.	.	T	7.548	0.662024	0.14645	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.55930	0.49;0.49;0.49;0.5	5.8	3.36	0.38483	.	0.221574	0.38778	N	0.001577	T	0.20251	0.0487	N	0.01874	-0.695	0.29435	N	0.859551	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.09975	-1.0650	10	0.20046	T	0.44	.	5.2614	0.15576	0.3072:0.0:0.128:0.5648	.	798;850	F5H070;Q9Y4C1	.;KDM3A_HUMAN	S	850;850;850;850;798	ENSP00000386660:I850S;ENSP00000323659:I850S;ENSP00000386516:I850S;ENSP00000438324:I798S	ENSP00000323659:I850S	I	+	2	0	KDM3A	86562600	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.125000	0.42016	2.216000	0.71823	0.533000	0.62120	ATC	.	.	.	none		0.363	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
UBR3	130507	hgsc.bcm.edu	37	2	170936421	170936421	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr2:170936421G>A	ENST00000272793.5	+	37	5347	c.5297G>A	c.(5296-5298)tGt>tAt	p.C1766Y	UBR3_ENST00000392631.1_Missense_Mutation_p.C587Y|UBR3_ENST00000418381.1_Missense_Mutation_p.C1766Y			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1766	Cys-rich.				embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						AGAAAAACCTGTAGTGTCTGC	0.413																																					p.C1766Y		Atlas-SNP	.											.	UBR3	182	.	0			c.G5297A						PASS	.						136.0	125.0	129.0					2																	170936421		2203	4300	6503	SO:0001583	missense	130507	exon37			AAACCTGTAGTGT	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.5297G>A	chr2.hg19:g.170936421G>A	ENSP00000272793:p.Cys1766Tyr	227.0	0.0	.		207.0	78.0	.	NM_172070	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.675813|4.675813	0.88445|0.88445	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681|ENST00000392632	T;T;T;T|.	0.71698|.	-0.59;-0.59;-0.59;-0.59|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83225|0.83225	0.5208|0.5208	M|M	0.84511|0.84511	2.7|2.7	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.995;0.999;0.98|.	D;D;D|.	0.83275|.	0.986;0.996;0.974|.	D|D	0.84171|0.84171	0.0434|0.0434	10|5	0.52906|.	T|.	0.07|.	.|.	19.7411|19.7411	0.96231|0.96231	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1766;587;1795|.	Q6ZT12;Q6ZT12-2;E7EVK3|.	UBR3_HUMAN;.;.|.	Y|I	1766;1795;1766;587;466|828	ENSP00000272793:C1766Y;ENSP00000396068:C1766Y;ENSP00000376408:C587Y;ENSP00000389097:C466Y|.	ENSP00000272793:C1766Y|.	C|V	+|+	2|1	0|0	UBR3|UBR3	170644667|170644667	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.476000|9.476000	0.97823|0.97823	2.653000|2.653000	0.90120|0.90120	0.650000|0.650000	0.86243|0.86243	TGT|GTA	.	.	.	none		0.413	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
ALS2	57679	hgsc.bcm.edu	37	2	202625787	202625787	+	Silent	SNP	A	A	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr2:202625787A>T	ENST00000264276.6	-	4	1302	c.930T>A	c.(928-930)gcT>gcA	p.A310A	ALS2_ENST00000467448.1_Silent_p.A310A|ALS2_ENST00000496244.1_5'Flank	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	310					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TTGTGATCTGAGCACTTACTG	0.458																																					p.A310A		Atlas-SNP	.											.	ALS2	172	.	0			c.T930A						PASS	.						208.0	196.0	200.0					2																	202625787		2071	4220	6291	SO:0001819	synonymous_variant	57679	exon4			GATCTGAGCACTT	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.930T>A	chr2.hg19:g.202625787A>T		233.0	0.0	.		239.0	106.0	.	NM_001135745	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.	.	none		0.458	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
XIRP1	165904	hgsc.bcm.edu	37	3	39226976	39226976	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:39226976T>G	ENST00000340369.3	-	2	4189	c.3961A>C	c.(3961-3963)Aag>Cag	p.K1321Q	XIRP1_ENST00000396251.1_3'UTR|XIRP1_ENST00000421646.1_Missense_Mutation_p.K4Q	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1321	Pro-rich.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GGCTTCTTCTTTGGGGGCATG	0.607																																					p.K1321Q		Atlas-SNP	.											.	XIRP1	173	.	0			c.A3961C						PASS	.						39.0	46.0	44.0					3																	39226976		2195	4299	6494	SO:0001583	missense	165904	exon2			TCTTCTTTGGGGG	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3961A>C	chr3.hg19:g.39226976T>G	ENSP00000343140:p.Lys1321Gln	62.0	0.0	.		36.0	16.0	.	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	hg19	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	T	7.981	0.751161	0.15778	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	T;T	0.19938	3.83;2.11	4.38	0.707	0.18139	.	2.505940	0.01310	N	0.010586	T	0.12178	0.0296	N	0.22421	0.69	0.09310	N	1	B	0.22276	0.067	B	0.17433	0.018	T	0.13953	-1.0490	10	0.11182	T	0.66	.	1.3649	0.02199	0.1779:0.0999:0.1852:0.537	.	1321	Q702N8	XIRP1_HUMAN	Q	1321;4	ENSP00000343140:K1321Q;ENSP00000391645:K4Q	ENSP00000343140:K1321Q	K	-	1	0	XIRP1	39201980	0.713000	0.27926	0.148000	0.22405	0.462000	0.32619	0.540000	0.23191	0.119000	0.18210	0.533000	0.62120	AAG	.	.	.	none		0.607	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
CXCR6	10663	hgsc.bcm.edu	37	3	45988859	45988859	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:45988859C>G	ENST00000458629.1	+	1	2349	c.886C>G	c.(886-888)Cga>Gga	p.R296G	FYCO1_ENST00000296137.2_Intron|FYCO1_ENST00000438446.1_Intron|CXCR6_ENST00000304552.4_Missense_Mutation_p.R296G|FYCO1_ENST00000535325.1_Intron|CXCR6_ENST00000457814.1_Missense_Mutation_p.R296G|CXCR6_ENST00000438735.1_Missense_Mutation_p.R296G			O00574	CXCR6_HUMAN	chemokine (C-X-C motif) receptor 6	296					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|viral genome replication (GO:0019079)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(3)|lung(1)|prostate(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CCTGAAGTTTCGAAAGAACTT	0.478																																					p.R296G	Esophageal Squamous(63;1005 1117 15521 45762 47089)	Atlas-SNP	.											.	CXCR6	17	.	0			c.C886G						PASS	.						113.0	101.0	105.0					3																	45988859		2203	4300	6503	SO:0001583	missense	10663	exon2			AAGTTTCGAAAGA	AF007545	CCDS2735.1	3p21	2012-08-08			ENSG00000172215	ENSG00000172215		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	16647	protein-coding gene	gene with protein product		605163				9166430, 9230441	Standard	XM_005264809		Approved	TYMSTR, STRL33, BONZO, CD186	uc003cpc.1	O00574	OTTHUMG00000133448	ENST00000458629.1:c.886C>G	chr3.hg19:g.45988859C>G	ENSP00000395704:p.Arg296Gly	81.0	0.0	.		74.0	38.0	.	NM_006564	O00575|Q9HCA5	Missense_Mutation	SNP	ENST00000458629.1	hg19	CCDS2735.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243587	0.58995	.	.	ENSG00000172215	ENST00000438735;ENST00000304552;ENST00000458629;ENST00000457814	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.83	3.86	0.44501	.	0.049616	0.85682	D	0.000000	T	0.64853	0.2636	M	0.68952	2.095	0.40450	D	0.980135	D	0.64830	0.994	P	0.57911	0.829	T	0.71241	-0.4651	10	0.87932	D	0	.	13.1958	0.59738	0.3957:0.6043:0.0:0.0	.	296	O00574	CXCR6_HUMAN	G	296	ENSP00000396218:R296G;ENSP00000304414:R296G;ENSP00000395704:R296G;ENSP00000396886:R296G	ENSP00000304414:R296G	R	+	1	2	CXCR6	45963863	0.092000	0.21681	0.939000	0.37840	0.975000	0.68041	0.375000	0.20518	1.454000	0.47793	-0.314000	0.08810	CGA	.	.	.	none		0.478	CXCR6-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344395.1		
SLC38A3	10991	hgsc.bcm.edu	37	3	50254733	50254733	+	RNA	SNP	G	G	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:50254733G>C	ENST00000420502.1	+	0	765									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		TTCTGCCCCTGGCACTGATGC	0.587																																					p.L204L		Atlas-SNP	.											.	SLC38A3	22	.	0			c.G612C						PASS	.						61.0	65.0	64.0					3																	50254733		2040	4208	6248			10991	exon8			GCCCCTGGCACTG	U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		chr3.hg19:g.50254733G>C		42.0	0.0	.		62.0	27.0	.	NM_006841		Silent	SNP	ENST00000420502.1	hg19																																																																																				.	.	.	none		0.587	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841	
CACNA2D2	9254	hgsc.bcm.edu	37	3	50416403	50416403	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:50416403C>T	ENST00000479441.1	-	13	1281	c.1282G>A	c.(1282-1284)Gtg>Atg	p.V428M	CACNA2D2_ENST00000423994.2_Missense_Mutation_p.V428M|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.V428M|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.V428M|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.V428M|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.V359M|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.V428M|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.V428M			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	428	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TGCTGCCCCACGGAGAAAGTA	0.607																																					p.V428M		Atlas-SNP	.											.	CACNA2D2	82	.	0			c.G1282A						PASS	.						83.0	74.0	77.0					3																	50416403		2203	4300	6503	SO:0001583	missense	9254	exon13			GCCCCACGGAGAA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.1282G>A	chr3.hg19:g.50416403C>T	ENSP00000418081:p.Val428Met	37.0	0.0	.		32.0	12.0	.	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	hg19	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412276	0.83340	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	D;D;D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	4.3	4.3	0.51218	von Willebrand factor, type A (3);	0.063724	0.64402	D	0.000008	D	0.91178	0.7221	L	0.58810	1.83	0.58432	D	0.999995	D;D	0.65815	0.995;0.982	P;P	0.61328	0.887;0.493	D	0.92409	0.5936	10	0.87932	D	0	-16.6573	17.3344	0.87276	0.0:1.0:0.0:0.0	.	428;428	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	M	428;428;428;359;428;428;428;428	ENSP00000407393:V428M;ENSP00000404631:V428M;ENSP00000266039:V428M;ENSP00000354228:V359M;ENSP00000390526:V428M;ENSP00000378519:V428M;ENSP00000390329:V428M;ENSP00000418081:V428M	ENSP00000266039:V428M	V	-	1	0	CACNA2D2	50391407	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.689000	0.68234	2.396000	0.81511	0.557000	0.71058	GTG	.	.	.	none		0.607	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
STAB1	23166	hgsc.bcm.edu	37	3	52548199	52548199	+	Silent	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:52548199C>T	ENST00000321725.6	+	33	3592	c.3516C>T	c.(3514-3516)tcC>tcT	p.S1172S		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1172	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCAACCGCTCCCTGGAGGCCC	0.637																																					p.S1172S		Atlas-SNP	.											.	STAB1	178	.	0			c.C3516T						PASS	.						68.0	68.0	68.0					3																	52548199		2203	4300	6503	SO:0001819	synonymous_variant	23166	exon33			CCGCTCCCTGGAG	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3516C>T	chr3.hg19:g.52548199C>T		51.0	0.0	.		38.0	15.0	.	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	hg19	CCDS33768.1																																																																																			.	.	.	none		0.637	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
NIT2	56954	hgsc.bcm.edu	37	3	100074091	100074091	+	Silent	SNP	T	T	A	rs144496756		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:100074091T>A	ENST00000394140.4	+	10	901	c.810T>A	c.(808-810)gcT>gcA	p.A270A		NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	270	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)			breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						ACCTCTATGCTGTGGAGATGA	0.378																																					p.A270A		Atlas-SNP	.											.	NIT2	35	.	0			c.T810A						PASS	.						78.0	77.0	77.0					3																	100074091		2203	4300	6503	SO:0001819	synonymous_variant	56954	exon10			CTATGCTGTGGAG	AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.810T>A	chr3.hg19:g.100074091T>A		62.0	0.0	.		82.0	24.0	.	NM_020202	B2R9A3|D3DN47|Q8WUF0	Silent	SNP	ENST00000394140.4	hg19	CCDS33806.1																																																																																			.	T|0.999;C|0.001	.	alt		0.378	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353142.2	NM_020202	
ADCY5	111	hgsc.bcm.edu	37	3	123038548	123038548	+	Silent	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:123038548G>A	ENST00000462833.1	-	10	3441	c.2229C>T	c.(2227-2229)acC>acT	p.T743T	ADCY5_ENST00000491190.1_Silent_p.T376T|ADCY5_ENST00000309879.5_Silent_p.T393T	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	743					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GCTCCCTGAAGGTCAGGAGGA	0.577																																					p.T743T		Atlas-SNP	.											.	ADCY5	169	.	0			c.C2229T						PASS	.						87.0	76.0	79.0					3																	123038548		2203	4300	6503	SO:0001819	synonymous_variant	111	exon10			CCTGAAGGTCAGG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2229C>T	chr3.hg19:g.123038548G>A		27.0	0.0	.		28.0	10.0	.	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	hg19	CCDS3022.1																																																																																			.	.	.	none		0.577	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
ZNF639	51193	hgsc.bcm.edu	37	3	179050906	179050906	+	Missense_Mutation	SNP	C	C	G	rs75079502		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:179050906C>G	ENST00000326361.3	+	6	744	c.299C>G	c.(298-300)tCt>tGt	p.S100C	ZNF639_ENST00000484866.1_Missense_Mutation_p.S100C|ZNF639_ENST00000466663.1_3'UTR|ZNF639_ENST00000496856.1_Missense_Mutation_p.S100C	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	100					negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			actgcctTTTCTACAGGTTGG	0.353																																					p.S100C		Atlas-SNP	.											.	ZNF639	45	.	0			c.C299G						PASS	.						63.0	58.0	59.0					3																	179050906		2203	4298	6501	SO:0001583	missense	51193	exon6			CCTTTTCTACAGG	BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.299C>G	chr3.hg19:g.179050906C>G	ENSP00000325634:p.Ser100Cys	75.0	0.0	.		56.0	13.0	.	NM_016331	A9X3Z9|D3DNR3	Missense_Mutation	SNP	ENST00000326361.3	hg19	CCDS3227.1	.	.	.	.	.	.	.	.	.	.	C	8.257	0.810266	0.16537	.	.	ENSG00000121864	ENST00000496856;ENST00000491818;ENST00000481587;ENST00000326361;ENST00000466264;ENST00000484866;ENST00000494234	T;T;T;T	0.03831	3.79;3.79;4.42;3.79	5.86	5.86	0.93980	.	0.861759	0.10491	N	0.668436	T	0.05410	0.0143	N	0.24115	0.695	0.23238	N	0.998063	P	0.34462	0.454	B	0.29942	0.109	T	0.40776	-0.9545	10	0.72032	D	0.01	.	16.0536	0.80779	0.0:1.0:0.0:0.0	.	100	Q9UID6	ZN639_HUMAN	C	100	ENSP00000417740:S100C;ENSP00000325634:S100C;ENSP00000419650:S100C;ENSP00000418766:S100C	ENSP00000325634:S100C	S	+	2	0	ZNF639	180533600	0.777000	0.28628	0.523000	0.27875	0.355000	0.29361	3.174000	0.50847	2.937000	0.99478	0.650000	0.86243	TCT	.	C|0.750;T|0.250	.	alt		0.353	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348855.1	NM_016331	
PPP1R2	5504	hgsc.bcm.edu	37	3	195251642	195251642	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr3:195251642T>C	ENST00000328432.3	-	3	643	c.283A>G	c.(283-285)Atg>Gtg	p.M95V	RNU6ATAC24P_ENST00000516811.1_RNA	NM_006241.4	NP_006232.1	P41236	IPP2_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 2	95					generation of precursor metabolites and energy (GO:0006091)|glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of signal transduction (GO:0009966)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)			endometrium(2)|kidney(1)|large_intestine(1)|urinary_tract(2)	6	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)		Epithelial(36;2.64e-22)|all cancers(36;2.69e-20)|OV - Ovarian serous cystadenocarcinoma(49;3.52e-19)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;9.55e-05)		TCTGGCGCCATGGCTTCAGTG	0.448																																					p.M95V		Atlas-SNP	.											.	PPP1R2	11	.	0			c.A283G						PASS	.						108.0	91.0	97.0					3																	195251642		2203	4300	6503	SO:0001583	missense	5504	exon3			GCGCCATGGCTTC	U68111	CCDS3309.1	3q29	2012-04-17			ENSG00000184203	ENSG00000184203	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9288	protein-coding gene	gene with protein product		601792				9126490, 8119416	Standard	XM_006713682		Approved	IPP2	uc003fup.3	P41236	OTTHUMG00000155887	ENST00000328432.3:c.283A>G	chr3.hg19:g.195251642T>C	ENSP00000328178:p.Met95Val	161.0	0.0	.		152.0	50.0	.	NM_006241		Missense_Mutation	SNP	ENST00000328432.3	hg19	CCDS3309.1	.	.	.	.	.	.	.	.	.	.	T	4.282	0.051444	0.08291	.	.	ENSG00000184203	ENST00000328432	.	.	.	5.46	-3.69	0.04450	.	0.286677	0.35096	N	0.003456	T	0.15305	0.0369	N	0.05230	-0.09	0.30048	N	0.812	B	0.02656	0.0	B	0.01281	0.0	T	0.33137	-0.9880	9	0.11182	T	0.66	.	9.8244	0.40903	0.0:0.1674:0.5827:0.2498	.	95	P41236	IPP2_HUMAN	V	95	.	ENSP00000328178:M95V	M	-	1	0	PPP1R2	196732931	0.317000	0.24589	0.499000	0.27577	0.039000	0.13416	-0.917000	0.04025	-0.316000	0.08690	-0.334000	0.08254	ATG	.	.	.	none		0.448	PPP1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342133.1	NM_006241	
ADD1	118	hgsc.bcm.edu	37	4	2910285	2910285	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr4:2910285A>T	ENST00000398129.1	+	11	1579	c.1559A>T	c.(1558-1560)cAg>cTg	p.Q520L	ADD1_ENST00000503455.2_Missense_Mutation_p.Q551L|ADD1_ENST00000513328.2_Missense_Mutation_p.Q520L|ADD1_ENST00000398125.1_Missense_Mutation_p.Q551L|ADD1_ENST00000355842.3_Missense_Mutation_p.Q520L|ADD1_ENST00000264758.7_Missense_Mutation_p.Q551L|ADD1_ENST00000446856.1_Missense_Mutation_p.Q520L|ADD1_ENST00000398123.2_Missense_Mutation_p.Q551L			P35611	ADDA_HUMAN	adducin 1 (alpha)	520					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCTGGCCCTCAGTCCCAGGTT	0.572																																					p.Q551L	Esophageal Squamous(71;505 1201 20414 34538 37449)	Atlas-SNP	.											.	ADD1	56	.	0			c.A1652T						PASS	.						175.0	139.0	151.0					4																	2910285		2203	4300	6503	SO:0001583	missense	118	exon12			GCCCTCAGTCCCA	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1559A>T	chr4.hg19:g.2910285A>T	ENSP00000381197:p.Gln520Leu	73.0	0.0	.		81.0	33.0	.	NM_176801	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	ENST00000398129.1	hg19	CCDS43205.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.322861|5.322861	0.95708|0.95708	.|.	.|.	ENSG00000087274|ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398125;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129;ENST00000536424|ENST00000514940	T;T;T;T;T;T;T;T;T|.	0.21191|.	2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78704|0.78704	0.4325|0.4325	M|M	0.82823|0.82823	2.61|2.61	0.80722|0.80722	D|D	1|1	D;D;D;D;P|.	0.67145|.	0.985;0.996;0.958;0.992;0.93|.	D;D;P;D;P|.	0.74348|.	0.983;0.954;0.749;0.979;0.566|.	T|T	0.80329|0.80329	-0.1428|-0.1428	10|5	0.62326|.	D|.	0.03|.	-26.831|-26.831	16.3512|16.3512	0.83208|0.83208	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	520;520;551;520;551|.	Q86XM2;P35611;P35611-3;P35611-2;A2A3N8|.	.;ADDA_HUMAN;.;.;.|.	L|C	551;520;551;520;551;520;551;520;20|257	ENSP00000264758:Q551L;ENSP00000399828:Q520L;ENSP00000381193:Q551L;ENSP00000421907:Q520L;ENSP00000423024:Q551L;ENSP00000348100:Q520L;ENSP00000381191:Q551L;ENSP00000381197:Q520L;ENSP00000438069:Q20L|.	ENSP00000264758:Q551L|.	Q|S	+|+	2|1	0|0	ADD1|ADD1	2880083|2880083	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.845000|8.845000	0.92153|0.92153	2.266000|2.266000	0.75297|0.75297	0.533000|0.533000	0.62120|0.62120	CAG|AGT	.	.	.	none		0.572	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
TRMT44	152992	hgsc.bcm.edu	37	4	8456486	8456486	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr4:8456486T>G	ENST00000389737.4	+	6	1149	c.1149T>G	c.(1147-1149)atT>atG	p.I383M	TRMT44_ENST00000513449.2_Missense_Mutation_p.I142M|RP11-689P11.3_ENST00000515186.1_RNA	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	383					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										GCAGAGGGATTGATGTCCGAA	0.393																																					p.I383M		Atlas-SNP	.											.	TRMT44	7	.	0			c.T1149G						PASS	.						126.0	122.0	123.0					4																	8456486		2203	4300	6503	SO:0001583	missense	152992	exon6			AGGGATTGATGTC	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1149T>G	chr4.hg19:g.8456486T>G	ENSP00000374387:p.Ile383Met	96.0	0.0	.		68.0	29.0	.	NM_152544	Q8NA95	Missense_Mutation	SNP	ENST00000389737.4	hg19	CCDS3402.2	.	.	.	.	.	.	.	.	.	.	t	17.24	3.340592	0.60963	.	.	ENSG00000155275	ENST00000513449;ENST00000389737	T;T	0.35789	1.29;1.29	4.33	-3.76	0.04359	.	0.063137	0.64402	U	0.000008	T	0.52661	0.1748	M	0.91300	3.195	0.58432	D	0.99999	P;D	0.56746	0.856;0.977	P;P	0.61477	0.858;0.889	T	0.53954	-0.8365	10	0.87932	D	0	-10.8156	3.5823	0.07958	0.2523:0.2232:0.0:0.5245	.	383;142	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	M	142;383	ENSP00000424643:I142M;ENSP00000374387:I383M	ENSP00000374387:I383M	I	+	3	3	METTL19	8507386	0.954000	0.32549	0.962000	0.40283	0.990000	0.78478	-0.081000	0.11321	-0.892000	0.03935	0.524000	0.50904	ATT	.	.	.	none		0.393	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
NIPAL1	152519	hgsc.bcm.edu	37	4	48037631	48037631	+	Silent	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr4:48037631G>A	ENST00000295461.5	+	6	741	c.675G>A	c.(673-675)ttG>ttA	p.L225L		NM_207330.1	NP_997213.1	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1	225						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|large_intestine(1)|lung(3)|skin(2)	8						TGCTGATTTTGATTGTGGCTC	0.383																																					p.L225L		Atlas-SNP	.											.	NIPAL1	29	.	0			c.G675A						PASS	.						117.0	117.0	117.0					4																	48037631		2203	4300	6503	SO:0001819	synonymous_variant	152519	exon6			GATTTTGATTGTG	BC067881	CCDS3479.1	4p12	2009-03-24		2009-03-24	ENSG00000163293	ENSG00000163293			27194	protein-coding gene	gene with protein product				NPAL1			Standard	NM_207330		Approved	DKFZp686A06115	uc003gxw.3	Q6NVV3	OTTHUMG00000128622	ENST00000295461.5:c.675G>A	chr4.hg19:g.48037631G>A		148.0	0.0	.		139.0	45.0	.	NM_207330	B3KTB0|Q68DA9	Silent	SNP	ENST00000295461.5	hg19	CCDS3479.1																																																																																			.	.	.	none		0.383	NIPAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250491.4	NM_207330	
EPHA5	2044	hgsc.bcm.edu	37	4	66201790	66201790	+	Silent	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr4:66201790A>G	ENST00000273854.3	-	16	3312	c.2712T>C	c.(2710-2712)ccT>ccC	p.P904P	EPHA5_ENST00000511294.1_Silent_p.P905P|EPHA5_ENST00000354839.4_Silent_p.P882P|EPHA5_ENST00000432638.2_Silent_p.P741P	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	904	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AGAGAGCAGCAGGACAATCCA	0.453										TSP Lung(17;0.13)																											p.P904P		Atlas-SNP	.											.	EPHA5	315	.	0			c.T2712C						PASS	.						112.0	96.0	101.0					4																	66201790		2203	4299	6502	SO:0001819	synonymous_variant	2044	exon16			AGCAGCAGGACAA	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2712T>C	chr4.hg19:g.66201790A>G		84.0	0.0	.		70.0	31.0	.	NM_004439	Q7Z3F2	Silent	SNP	ENST00000273854.3	hg19	CCDS3513.1																																																																																			.	.	.	none		0.453	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
SH3TC2	79628	hgsc.bcm.edu	37	5	148407090	148407090	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr5:148407090C>A	ENST00000515425.1	-	11	2306	c.2205G>T	c.(2203-2205)ttG>ttT	p.L735F	SH3TC2_ENST00000394358.2_Missense_Mutation_p.L620F|SH3TC2_ENST00000538184.1_Missense_Mutation_p.L282F|SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000512049.1_Missense_Mutation_p.L728F	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	735					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGGGCAGGCCAAGGCAGAAA	0.572																																					p.L735F		Atlas-SNP	.											.	SH3TC2	178	.	0			c.G2205T						PASS	.						61.0	64.0	63.0					5																	148407090		2203	4300	6503	SO:0001583	missense	79628	exon11			GCAGGCCAAGGCA	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.2205G>T	chr5.hg19:g.148407090C>A	ENSP00000423660:p.Leu735Phe	51.0	0.0	.		50.0	22.0	.	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	hg19	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846276	0.32606	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049;ENST00000394358	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	6.16	6.16	0.99307	.	0.082696	0.51477	D	0.000086	T	0.78483	0.4290	L	0.59436	1.845	0.43814	D	0.996379	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.78314	0.991;0.972;0.972;0.972	T	0.78168	-0.2309	10	0.59425	D	0.04	-4.7214	13.9788	0.64291	0.0:0.9314:0.0:0.0686	.	620;728;735;735	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	F	282;735;728;620	ENSP00000441427:L282F;ENSP00000423660:L735F;ENSP00000421860:L728F;ENSP00000377886:L620F	ENSP00000377886:L620F	L	-	3	2	SH3TC2	148387283	0.991000	0.36638	0.997000	0.53966	0.200000	0.23975	0.534000	0.23098	2.937000	0.99478	0.650000	0.86243	TTG	.	.	.	none		0.572	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
MGAT4B	11282	hgsc.bcm.edu	37	5	179225417	179225417	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr5:179225417C>A	ENST00000292591.7	-	13	1790	c.1440G>T	c.(1438-1440)aaG>aaT	p.K480N	MGAT4B_ENST00000337755.5_Missense_Mutation_p.K495N|MIR1229_ENST00000408467.1_RNA|MGAT4B_ENST00000521305.1_5'Flank	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	480					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGGGCCTCCTTGTCTGACT	0.662																																					p.K495N	GBM(13;414 434 4098 22176 23230)	Atlas-SNP	.											.	MGAT4B	41	.	0			c.G1485T						PASS	.						33.0	34.0	33.0					5																	179225417		2203	4299	6502	SO:0001583	missense	11282	exon12			GGCCTCCTTGTCT	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1440G>T	chr5.hg19:g.179225417C>A	ENSP00000292591:p.Lys480Asn	45.0	0.0	.		32.0	14.0	.	NM_054013	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	ENST00000292591.7	hg19	CCDS4448.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	23.8|23.8|23.8	4.456538|4.456538|4.456538	0.84317|0.84317|0.84317	.|.|.	.|.|.	ENSG00000161013|ENSG00000161013|ENSG00000161013	ENST00000518778;ENST00000520875|ENST00000337755;ENST00000292591;ENST00000519836|ENST00000520969;ENST00000518980;ENST00000518867	.|T;T|.	.|0.33654|.	.|1.4;1.42|.	5.09|5.09|5.09	2.14|2.14|2.14	0.27477|0.27477|0.27477	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	.|T|T	.|0.54447|0.54447	.|0.1859|0.1859	L|L|L	0.50333|0.50333|0.50333	1.59|1.59|1.59	0.58432|0.58432|0.58432	D|D|D	0.999998|0.999998|0.999998	.|P;P;D|.	.|0.76494|.	.|0.906;0.906;0.999|.	.|B;B;D|.	.|0.78314|.	.|0.264;0.444;0.991|.	.|T|T	.|0.45891|0.45891	.|-0.9230|-0.9230	.|10|5	.|0.17832|.	.|T|.	.|0.49|.	-31.9236|-31.9236|-31.9236	6.435|6.435|6.435	0.21819|0.21819|0.21819	0.0:0.6875:0.1492:0.1633|0.0:0.6875:0.1492:0.1633|0.0:0.6875:0.1492:0.1633	.|.|.	.|480;495;479|.	.|Q9UQ53;A8MPR0;Q9UQ53-2|.	.|MGT4B_HUMAN;.;.|.	X|N|M	305;261|495;480;348|172;226;241	.|ENSP00000338487:K495N;ENSP00000292591:K480N|.	.|ENSP00000292591:K480N|.	G|K|R	-|-|-	1|3|2	0|2|0	MGAT4B|MGAT4B|MGAT4B	179158023|179158023|179158023	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.968000|0.968000|0.968000	0.65278|0.65278|0.65278	0.894000|0.894000|0.894000	0.28350|0.28350|0.28350	0.547000|0.547000|0.547000	0.28938|0.28938|0.28938	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GGA|AAG|AGG	.	.	.	none		0.662	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275	
VARS2	57176	hgsc.bcm.edu	37	6	30886640	30886640	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:30886640C>G	ENST00000321897.5	+	10	1654	c.1022C>G	c.(1021-1023)aCg>aGg	p.T341R	VARS2_ENST00000542001.1_Missense_Mutation_p.T201R|VARS2_ENST00000541562.1_Missense_Mutation_p.T371R|VARS2_ENST00000416670.2_Missense_Mutation_p.T341R			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	341					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						AGGCCAGAGACGCTGCCTGGA	0.547																																					p.T371R		Atlas-SNP	.											.	VARS2	60	.	0			c.C1112G						PASS	.						102.0	85.0	91.0					6																	30886640		1510	2707	4217	SO:0001583	missense	57176	exon11			CAGAGACGCTGCC	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1022C>G	chr6.hg19:g.30886640C>G	ENSP00000316092:p.Thr341Arg	31.0	0.0	.		40.0	19.0	.	NM_001167734	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	hg19	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.432661	0.83776	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	4.54	4.54	0.55810	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	D	0.82715	0.5097	H	0.98446	4.235	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89538	0.3790	10	0.87932	D	0	-12.4516	14.7942	0.69865	0.0:1.0:0.0:0.0	.	341;371;341	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	R	341;341;201;371	ENSP00000316092:T341R;ENSP00000394802:T341R;ENSP00000438200:T201R;ENSP00000441000:T371R	ENSP00000316092:T341R	T	+	2	0	VARS2	30994619	1.000000	0.71417	0.934000	0.37439	0.976000	0.68499	6.793000	0.75130	2.093000	0.63338	0.563000	0.77884	ACG	.	.	.	none		0.547	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
BRPF3	27154	hgsc.bcm.edu	37	6	36181792	36181792	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:36181792A>G	ENST00000357641.6	+	8	2871	c.2618A>G	c.(2617-2619)aAg>aGg	p.K873R	BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000339717.7_Intron|BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000534400.1_Missense_Mutation_p.K873R|BRPF3_ENST00000543502.1_Intron	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	873					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						AGGTTCCTAAAGCCCAGAAAG	0.517																																					p.K873R		Atlas-SNP	.											.	BRPF3	93	.	0			c.A2618G						PASS	.						55.0	57.0	56.0					6																	36181792		2203	4300	6503	SO:0001583	missense	27154	exon8			TCCTAAAGCCCAG	AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.2618A>G	chr6.hg19:g.36181792A>G	ENSP00000350267:p.Lys873Arg	44.0	0.0	.		41.0	18.0	.	NM_015695	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	hg19	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.780396	0.49891	.	.	ENSG00000096070	ENST00000357641;ENST00000534400;ENST00000394572	T;T	0.18338	2.41;2.22	5.86	5.86	0.93980	.	0.345140	0.33938	N	0.004413	T	0.05593	0.0147	L	0.43923	1.385	0.80722	D	1	B	0.25390	0.125	B	0.20184	0.028	T	0.13845	-1.0494	10	0.10377	T	0.69	.	10.7757	0.46348	0.9265:0.0:0.0735:0.0	.	873	Q9ULD4	BRPF3_HUMAN	R	873;873;287	ENSP00000350267:K873R;ENSP00000436504:K873R	ENSP00000350267:K873R	K	+	2	0	BRPF3	36289770	1.000000	0.71417	0.976000	0.42696	0.742000	0.42306	6.518000	0.73764	2.241000	0.73720	0.413000	0.27773	AAG	.	.	.	none		0.517	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695	
PNPLA1	285848	hgsc.bcm.edu	37	6	36259229	36259229	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:36259229A>G	ENST00000394571.2	+	2	338	c.338A>G	c.(337-339)tAc>tGc	p.Y113C	PNPLA1_ENST00000388715.3_Missense_Mutation_p.Y18C|PNPLA1_ENST00000312917.5_Missense_Mutation_p.Y18C	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	113	Patatin.				lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						GAGGACTCCTACAAGGTCACC	0.577																																					p.Y113C		Atlas-SNP	.											.	PNPLA1	92	.	0			c.A338G						PASS	.						90.0	79.0	83.0					6																	36259229		2203	4300	6503	SO:0001583	missense	285848	exon2			ACTCCTACAAGGT		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.338A>G	chr6.hg19:g.36259229A>G	ENSP00000378072:p.Tyr113Cys	53.0	0.0	.		45.0	21.0	.	NM_001145717	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	ENST00000394571.2	hg19	CCDS54997.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.131417	0.56828	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	5.48	5.48	0.80851	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.087844	0.45606	D	0.000353	T	0.81791	0.4897	L	0.54323	1.7	0.46222	D	0.998936	P;D	0.89917	0.515;1.0	B;D	0.87578	0.141;0.998	D	0.84518	0.0626	10	0.72032	D	0.01	-22.4818	13.5137	0.61528	1.0:0.0:0.0:0.0	.	113;18	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	C	18;18;113;113	ENSP00000373367:Y18C;ENSP00000321116:Y18C;ENSP00000391868:Y113C;ENSP00000378072:Y113C	ENSP00000321116:Y18C	Y	+	2	0	PNPLA1	36367207	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	7.908000	0.87438	2.070000	0.61991	0.383000	0.25322	TAC	.	.	.	none		0.577	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
ABCC10	89845	hgsc.bcm.edu	37	6	43403598	43403598	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:43403598T>C	ENST00000372530.4	+	5	1933	c.1718T>C	c.(1717-1719)cTt>cCt	p.L573P	ABCC10_ENST00000244533.3_Missense_Mutation_p.L530P	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	573					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	CGGATCCAGCTTTTCCTCGAC	0.567																																					p.L573P		Atlas-SNP	.											.	ABCC10	118	.	0			c.T1718C						PASS	.						111.0	101.0	104.0					6																	43403598		2203	4300	6503	SO:0001583	missense	89845	exon5			TCCAGCTTTTCCT	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1718T>C	chr6.hg19:g.43403598T>C	ENSP00000361608:p.Leu573Pro	94.0	0.0	.		77.0	37.0	.	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	hg19	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	T	10.98	1.505257	0.26949	.	.	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.94280	-3.39;-2.7;-2.71	5.12	3.32	0.38043	ABC transporter, transmembrane domain, type 1 (1);	0.651192	0.16159	N	0.226849	T	0.80199	0.4579	N	0.22421	0.69	0.37531	D	0.917901	B;B	0.21688	0.059;0.046	B;B	0.32677	0.15;0.026	T	0.71981	-0.4428	10	0.42905	T	0.14	-26.4903	4.7311	0.12964	0.2033:0.0:0.5197:0.277	.	530;573	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	P	129;573;530	ENSP00000361593:L129P;ENSP00000361608:L573P;ENSP00000244533:L530P	ENSP00000244533:L530P	L	+	2	0	ABCC10	43511576	0.999000	0.42202	0.998000	0.56505	0.973000	0.67179	1.147000	0.31602	0.558000	0.29135	-0.656000	0.03901	CTT	.	.	.	none		0.567	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
REV3L	5980	hgsc.bcm.edu	37	6	111680124	111680124	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:111680124A>G	ENST00000358835.3	-	18	7427	c.6973T>C	c.(6973-6975)Ttc>Ctc	p.F2325L	REV3L_ENST00000435970.1_Missense_Mutation_p.F2247L|REV3L-IT1_ENST00000411895.1_RNA|REV3L_ENST00000368805.1_Missense_Mutation_p.F2325L|REV3L_ENST00000368802.3_Missense_Mutation_p.F2325L			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2325					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ATGCAGTAGAACAGAGCACAG	0.408								DNA polymerases (catalytic subunits)																													p.F2325L		Atlas-SNP	.											.	REV3L	386	.	0			c.T6973C						PASS	.						163.0	151.0	155.0					6																	111680124		2203	4300	6503	SO:0001583	missense	5980	exon17			AGTAGAACAGAGC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6973T>C	chr6.hg19:g.111680124A>G	ENSP00000351697:p.Phe2325Leu	125.0	0.0	.		121.0	48.0	.	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	hg19	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	A	33	5.272863	0.95429	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.09163	3.01;3.01;3.01;3.01	5.65	5.65	0.86999	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	M	0.88310	2.945	0.53005	D	0.999969	P	0.51240	0.943	D	0.66716	0.946	T	0.22417	-1.0217	10	0.87932	D	0	.	15.883	0.79216	1.0:0.0:0.0:0.0	.	2325	O60673	DPOLZ_HUMAN	L	2325;2325;2325;2247;398	ENSP00000357792:F2325L;ENSP00000357795:F2325L;ENSP00000351697:F2325L;ENSP00000402003:F2247L	ENSP00000351697:F2325L	F	-	1	0	REV3L	111786817	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.721000	0.91446	2.150000	0.67090	0.455000	0.32223	TTC	.	.	.	none		0.408	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
KPNA5	3841	hgsc.bcm.edu	37	6	117023282	117023282	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:117023282T>C	ENST00000368564.1	+	6	684	c.536T>C	c.(535-537)cTt>cCt	p.L179P	KPNA5_ENST00000356348.1_Missense_Mutation_p.L179P			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	176	NLS binding site (major). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		ATCAAACTTCTTAATTCTGAA	0.348																																					p.L179P		Atlas-SNP	.											.	KPNA5	57	.	0			c.T536C						PASS	.						103.0	102.0	102.0					6																	117023282		2203	4300	6503	SO:0001583	missense	3841	exon6			AACTTCTTAATTC	AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.536T>C	chr6.hg19:g.117023282T>C	ENSP00000357552:p.Leu179Pro	113.0	0.0	.		100.0	39.0	.	NM_002269	B2RAI5|Q86X23	Missense_Mutation	SNP	ENST00000368564.1	hg19	CCDS5111.1	.	.	.	.	.	.	.	.	.	.	T	18.68	3.675139	0.67928	.	.	ENSG00000196911	ENST00000368564;ENST00000356348	D;D	0.84516	-1.86;-1.86	5.51	3.09	0.35607	Armadillo-like helical (1);Armadillo-type fold (1);	0.079936	0.50627	N	0.000102	D	0.92583	0.7644	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91539	0.5248	10	0.87932	D	0	.	7.462	0.27300	0.1275:0.0696:0.0:0.8029	.	176	O15131	IMA5_HUMAN	P	179	ENSP00000357552:L179P;ENSP00000348704:L179P	ENSP00000348704:L179P	L	+	2	0	KPNA5	117129975	1.000000	0.71417	0.649000	0.29536	0.997000	0.91878	7.376000	0.79658	0.378000	0.24764	0.482000	0.46254	CTT	.	.	.	none		0.348	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041967.1	NM_002269	
RFX6	222546	hgsc.bcm.edu	37	6	117246661	117246661	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:117246661T>C	ENST00000332958.2	+	16	1740	c.1724T>C	c.(1723-1725)cTg>cCg	p.L575P		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	575					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						TCATGCTTTCTGGCCAACCGT	0.458																																					p.L575P		Atlas-SNP	.											.	RFX6	141	.	0			c.T1724C						PASS	.						136.0	137.0	137.0					6																	117246661		2203	4300	6503	SO:0001583	missense	222546	exon16			GCTTTCTGGCCAA	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1724T>C	chr6.hg19:g.117246661T>C	ENSP00000332208:p.Leu575Pro	71.0	0.0	.		73.0	21.0	.	NM_173560	Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	hg19	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.651636	0.88056	.	.	ENSG00000185002	ENST00000332958	T	0.70516	-0.49	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.78142	0.4237	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78635	-0.2127	10	0.48119	T	0.1	-11.6703	16.5763	0.84648	0.0:0.0:0.0:1.0	.	575	Q8HWS3	RFX6_HUMAN	P	575	ENSP00000332208:L575P	ENSP00000332208:L575P	L	+	2	0	RFX6	117353354	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.649000	0.83500	2.317000	0.78254	0.459000	0.35465	CTG	.	.	.	none		0.458	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
EPB41L2	2037	hgsc.bcm.edu	37	6	131216219	131216219	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:131216219T>C	ENST00000337057.3	-	9	1458	c.1277A>G	c.(1276-1278)aAt>aGt	p.N426S	EPB41L2_ENST00000528282.1_Missense_Mutation_p.N426S|EPB41L2_ENST00000530481.1_Missense_Mutation_p.N426S|EPB41L2_ENST00000527411.1_Missense_Mutation_p.N426S|EPB41L2_ENST00000525271.1_Missense_Mutation_p.N426S|EPB41L2_ENST00000529208.1_Missense_Mutation_p.N426S|EPB41L2_ENST00000392427.3_Missense_Mutation_p.N426S|EPB41L2_ENST00000445890.2_Missense_Mutation_p.N426S|EPB41L2_ENST00000525193.1_Missense_Mutation_p.N426S|EPB41L2_ENST00000368128.2_Missense_Mutation_p.N426S|EPB41L2_ENST00000527659.1_Missense_Mutation_p.N426S	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	426	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		GAGAAGTCCATTAGCACACAC	0.398																																					p.N426S		Atlas-SNP	.											.	EPB41L2	96	.	0			c.A1277G						PASS	.						166.0	146.0	153.0					6																	131216219		2203	4300	6503	SO:0001583	missense	2037	exon9			AGTCCATTAGCAC	AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.1277A>G	chr6.hg19:g.131216219T>C	ENSP00000338481:p.Asn426Ser	69.0	0.0	.		57.0	27.0	.	NM_001135554	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	ENST00000337057.3	hg19	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	T	9.975	1.226513	0.22542	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	D;D;D;D;D;D;D;D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11	5.68	5.68	0.88126	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.72011	0.3408	N	0.01535	-0.81	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.996;0.998;0.998;0.996	T	0.76258	-0.3025	10	0.02654	T	1	.	15.9369	0.79717	0.0:0.0:0.0:1.0	.	426;426;426;426;426	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	S	426	ENSP00000434308:N426S;ENSP00000434576:N426S;ENSP00000402041:N426S;ENSP00000338481:N426S;ENSP00000376222:N426S;ENSP00000357110:N426S;ENSP00000436348:N426S;ENSP00000432803:N426S;ENSP00000431988:N426S;ENSP00000431647:N426S;ENSP00000436641:N426S	ENSP00000338481:N426S	N	-	2	0	EPB41L2	131257912	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.155000	0.64900	2.172000	0.68678	0.533000	0.62120	AAT	.	.	.	none		0.398	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042204.3		
EYA4	2070	hgsc.bcm.edu	37	6	133849906	133849906	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:133849906T>C	ENST00000367895.5	+	20	2347	c.1883T>C	c.(1882-1884)cTg>cCg	p.L628P	EYA4_ENST00000431403.2_Missense_Mutation_p.L628P|EYA4_ENST00000355286.6_Missense_Mutation_p.L605P|EYA4_ENST00000525849.1_Missense_Mutation_p.L605P|EYA4_ENST00000531901.1_Missense_Mutation_p.L634P|EYA4_ENST00000452339.2_Missense_Mutation_p.L574P|EYA4_ENST00000355167.3_Missense_Mutation_p.L628P|EYA4_ENST00000430974.2_Intron|RP3-323P13.2_ENST00000607033.1_RNA	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	628					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TCAGACCTCCTGGCTCTCCAC	0.448																																					p.L628P	Melanoma(57;398 1237 3528 4702 7415)	Atlas-SNP	.											.	EYA4	196	.	0			c.T1883C						PASS	.						274.0	253.0	260.0					6																	133849906		2203	4300	6503	SO:0001583	missense	2070	exon20			ACCTCCTGGCTCT	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1883T>C	chr6.hg19:g.133849906T>C	ENSP00000356870:p.Leu628Pro	164.0	0.0	.		137.0	47.0	.	NM_172105	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	hg19	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	T	18.29	3.590941	0.66219	.	.	ENSG00000112319	ENST00000452339;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54;-2.54;-2.54	6.07	6.07	0.98685	EYA (1);	0.000000	0.85682	D	0.000000	D	0.90817	0.7116	L	0.53249	1.67	0.80722	D	1	D;D;D;P;D	0.76494	0.96;0.998;0.999;0.871;0.96	P;P;D;P;P	0.68943	0.689;0.899;0.961;0.574;0.782	D	0.89304	0.3628	10	0.30854	T	0.27	-8.0266	16.6407	0.85098	0.0:0.0:0.0:1.0	.	634;574;605;628;628	F2Z2Y1;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;EYA4_HUMAN	P	574;628;628;605;634;605;628	ENSP00000395916:L574P;ENSP00000356870:L628P;ENSP00000347294:L628P;ENSP00000347434:L605P;ENSP00000432770:L634P;ENSP00000433219:L605P;ENSP00000404558:L628P	ENSP00000347294:L628P	L	+	2	0	EYA4	133891599	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.015000	0.88690	2.326000	0.78906	0.533000	0.62120	CTG	.	.	.	none		0.448	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
THSD7A	221981	hgsc.bcm.edu	37	7	11581118	11581118	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:11581118A>G	ENST00000423059.4	-	6	2001	c.1750T>C	c.(1750-1752)Tgc>Cgc	p.C584R		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	584					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCTGGCTCGCAGTTTCCCAGT	0.498										HNSCC(18;0.044)																											p.C584R		Atlas-SNP	.											.	THSD7A	219	.	0			c.T1750C						PASS	.						101.0	101.0	101.0					7																	11581118		1996	4162	6158	SO:0001583	missense	221981	exon6			GCTCGCAGTTTCC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1750T>C	chr7.hg19:g.11581118A>G	ENSP00000406482:p.Cys584Arg	123.0	0.0	.		129.0	57.0	.	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	hg19	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.360480	0.82353	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.76060	-0.99	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.91479	0.7310	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94288	0.7526	10	0.62326	D	0.03	.	16.1381	0.81502	1.0:0.0:0.0:0.0	.	584	Q9UPZ6	THS7A_HUMAN	R	584	ENSP00000406482:C584R	ENSP00000262042:C584R	C	-	1	0	THSD7A	11547643	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	8.880000	0.92407	2.258000	0.74832	0.533000	0.62120	TGC	.	.	.	none		0.498	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
LSM5	23658	hgsc.bcm.edu	37	7	32527353	32527353	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:32527353C>T	ENST00000450169.2	-	4	239	c.187G>A	c.(187-189)Gga>Aga	p.G63R	LSM5_ENST00000409987.1_Silent_p.K58K|LSM5_ENST00000409292.1_Missense_Mutation_p.G34R|LSM5_ENST00000409952.3_Missense_Mutation_p.G34R|LSM5_ENST00000409909.3_Missense_Mutation_p.G34R|LSM5_ENST00000409782.1_Missense_Mutation_p.G34R|LSM5_ENST00000410044.1_Missense_Mutation_p.G34R	NM_001130710.1|NM_012322.2	NP_001124182.1|NP_036454.1	Q9Y4Y9	LSM5_HUMAN	LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)	63					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			breast(1)|cervix(1)|large_intestine(1)|lung(1)|stomach(1)	5			GBM - Glioblastoma multiforme(11;0.152)			ATCCTTCTTCCTTCTGGTGTG	0.318																																					p.G63R		Atlas-SNP	.											.	LSM5	9	.	0			c.G187A						PASS	.						84.0	84.0	84.0					7																	32527353		2200	4297	6497	SO:0001583	missense	23658	exon4			TTCTTCCTTCTGG	AF182291	CCDS5438.1, CCDS47571.1	7p14.3	2003-02-17			ENSG00000106355	ENSG00000106355			17162	protein-coding gene	gene with protein product		607285				10369684, 12515382	Standard	NM_001130710		Approved	YER146W	uc003tct.2	Q9Y4Y9	OTTHUMG00000022913	ENST00000450169.2:c.187G>A	chr7.hg19:g.32527353C>T	ENSP00000410758:p.Gly63Arg	77.0	0.0	.		56.0	24.0	.	NM_012322		Missense_Mutation	SNP	ENST00000450169.2	hg19	CCDS5438.1	.	.	.	.	.	.	.	.	.	.	C	33	5.281048	0.95489	.	.	ENSG00000106355	ENST00000450169;ENST00000409909;ENST00000409292;ENST00000410044;ENST00000409782;ENST00000409952	.	.	.	6.17	6.17	0.99709	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	D	0.84028	0.5382	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83775	0.0222	8	0.62326	D	0.03	.	20.4745	0.99168	0.0:1.0:0.0:0.0	.	63	Q9Y4Y9	LSM5_HUMAN	R	63;34;34;34;34;34	.	ENSP00000386814:G34R	G	-	1	0	LSM5	32493878	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.191000	0.77763	2.941000	0.99782	0.655000	0.94253	GGA	.	.	.	none		0.318	LSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215102.2		
PCLO	27445	hgsc.bcm.edu	37	7	82784425	82784425	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:82784425G>A	ENST00000333891.9	-	2	1869	c.1532C>T	c.(1531-1533)cCt>cTt	p.P511L	PCLO_ENST00000423517.2_Missense_Mutation_p.P511L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGCTGTTGAGGTGGGGGTTT	0.597																																					p.P511L		Atlas-SNP	.											.	PCLO	1506	.	0			c.C1532T						PASS	.						134.0	143.0	140.0					7																	82784425		1971	4164	6135	SO:0001583	missense	27445	exon2			TGTTGAGGTGGGG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1532C>T	chr7.hg19:g.82784425G>A	ENSP00000334319:p.Pro511Leu	66.0	0.0	.		61.0	20.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	3.408	-0.120889	0.06838	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16196	2.36;2.36	4.65	4.65	0.58169	.	.	.	.	.	T	0.14787	0.0357	L	0.35854	1.095	0.18873	N	0.999983	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.09164	-1.0687	9	0.87932	D	0	.	8.9393	0.35720	0.1036:0.0:0.8964:0.0	.	511;511	Q9Y6V0-5;Q9Y6V0-6	.;.	L	457;511;511	ENSP00000334319:P511L;ENSP00000388393:P511L	ENSP00000334319:P511L	P	-	2	0	PCLO	82622361	0.015000	0.18098	0.325000	0.25375	0.071000	0.16799	1.788000	0.38714	2.176000	0.68965	0.089000	0.15464	CCT	.	.	.	none		0.597	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
DMTF1	9988	hgsc.bcm.edu	37	7	86808921	86808921	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:86808921G>C	ENST00000394703.5	+	10	1143	c.580G>C	c.(580-582)Gat>Cat	p.D194H	DMTF1_ENST00000432937.2_Missense_Mutation_p.D106H|DMTF1_ENST00000414194.2_5'UTR|DMTF1_ENST00000411766.2_Missense_Mutation_p.D153H|DMTF1_ENST00000331242.7_Missense_Mutation_p.D194H|DMTF1_ENST00000394702.3_Missense_Mutation_p.D194H|DMTF1_ENST00000413276.2_Missense_Mutation_p.D194H	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	194	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Interaction with CCND2. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					CGAAAGAAAAGATTTCTACAG	0.388																																					p.D194H		Atlas-SNP	.											.	DMTF1	48	.	0			c.G580C						PASS	.						78.0	75.0	76.0					7																	86808921		2203	4300	6503	SO:0001583	missense	9988	exon8			AGAAAAGATTTCT	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.580G>C	chr7.hg19:g.86808921G>C	ENSP00000378193:p.Asp194His	45.0	0.0	.		49.0	18.0	.	NM_001142327	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	ENST00000394703.5	hg19	CCDS5601.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686016	0.88639	.	.	ENSG00000135164	ENST00000331242;ENST00000394702;ENST00000413276;ENST00000447863;ENST00000425406;ENST00000411766;ENST00000432937;ENST00000394703;ENST00000412139	T;T;T;T	0.50277	0.75;0.83;0.77;0.75	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.63710	0.2534	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	T	0.64093	-0.6488	10	0.51188	T	0.08	-18.0197	17.6427	0.88141	0.0:0.0:1.0:0.0	.	194	Q9Y222	DMTF1_HUMAN	H	194;194;194;194;153;153;106;194;194	ENSP00000332171:D194H;ENSP00000402627:D194H;ENSP00000412532:D106H;ENSP00000378193:D194H	ENSP00000332171:D194H	D	+	1	0	DMTF1	86646857	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	9.813000	0.99286	2.475000	0.83589	0.313000	0.20887	GAT	.	.	.	none		0.388	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	
STEAP4	79689	hgsc.bcm.edu	37	7	87910335	87910335	+	Nonsense_Mutation	SNP	A	A	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:87910335A>C	ENST00000380079.4	-	4	1145	c.1044T>G	c.(1042-1044)taT>taG	p.Y348*	STEAP4_ENST00000301959.5_Nonsense_Mutation_p.Y172*|AC003991.3_ENST00000595121.1_RNA|AC003991.3_ENST00000600908.1_RNA|AC003991.3_ENST00000434733.1_RNA|AC003991.3_ENST00000447758.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	348	Ferric oxidoreductase.				copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					CCAAAGCCACATATGAATCAC	0.388																																					p.Y348X		Atlas-SNP	.											.	STEAP4	54	.	0			c.T1044G						PASS	.						91.0	89.0	89.0					7																	87910335		1881	4112	5993	SO:0001587	stop_gained	79689	exon5			AGCCACATATGAA	AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.1044T>G	chr7.hg19:g.87910335A>C	ENSP00000369419:p.Tyr348*	78.0	0.0	.		76.0	34.0	.	NM_001205315	Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Nonsense_Mutation	SNP	ENST00000380079.4	hg19	CCDS43611.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.896109	0.72639	.	.	ENSG00000127954	ENST00000380079;ENST00000301959	.	.	.	6.08	-0.826	0.10805	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.35668	D	0.81311	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7158	12.1658	0.54129	0.5099:0.0:0.4901:0.0	.	.	.	.	X	348;172	.	ENSP00000305545:Y172X	Y	-	3	2	STEAP4	87748271	0.002000	0.14202	0.072000	0.20136	0.834000	0.47266	0.053000	0.14184	-0.081000	0.12662	0.482000	0.46254	TAT	.	.	.	none		0.388	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332712.4	NM_024636	
SLC12A9	56996	hgsc.bcm.edu	37	7	100463464	100463464	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:100463464C>T	ENST00000354161.3	+	14	2107	c.1982C>T	c.(1981-1983)gCt>gTt	p.A661V	TRIP6_ENST00000200457.4_5'Flank	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	661					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGTTCCCCAGCTCTGAGCACC	0.647																																					p.A661V		Atlas-SNP	.											.	SLC12A9	81	.	0			c.C1982T						PASS	.						48.0	50.0	49.0					7																	100463464		2203	4300	6503	SO:0001583	missense	56996	exon14			CCCCAGCTCTGAG	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1982C>T	chr7.hg19:g.100463464C>T	ENSP00000275730:p.Ala661Val	77.0	0.0	.		58.0	18.0	.	NM_020246	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Missense_Mutation	SNP	ENST00000354161.3	hg19	CCDS5707.1	.	.	.	.	.	.	.	.	.	.	C	7.488	0.650158	0.14516	.	.	ENSG00000146828	ENST00000354161;ENST00000539308	D	0.91295	-2.82	4.92	4.92	0.64577	.	0.481191	0.19531	N	0.112040	T	0.79822	0.4512	N	0.08118	0	0.80722	D	1	B	0.22146	0.065	B	0.13407	0.009	T	0.74881	-0.3513	10	0.11182	T	0.66	.	15.6446	0.77039	0.0:1.0:0.0:0.0	.	661	Q9BXP2	S12A9_HUMAN	V	661;287	ENSP00000275730:A661V	ENSP00000275730:A661V	A	+	2	0	SLC12A9	100301400	0.967000	0.33354	0.857000	0.33713	0.106000	0.19336	2.366000	0.44204	2.564000	0.86499	0.555000	0.69702	GCT	.	.	.	none		0.647	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246	
PSMC2	5701	hgsc.bcm.edu	37	7	103008247	103008247	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:103008247A>T	ENST00000435765.1	+	12	1546	c.1135A>T	c.(1135-1137)Aat>Tat	p.N379Y	PSMC2_ENST00000292644.3_Missense_Mutation_p.N379Y|SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000356767.4_Intron|PSMC2_ENST00000544811.1_Missense_Mutation_p.N242Y|SLC26A5_ENST00000339444.6_Intron	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	379					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						ACTGTGTCCAAATAGCACTGG	0.388																																					p.N379Y		Atlas-SNP	.											.	PSMC2	38	.	0			c.A1135T						PASS	.						107.0	110.0	109.0					7																	103008247		2203	4300	6503	SO:0001583	missense	5701	exon11			TGTCCAAATAGCA	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.1135A>T	chr7.hg19:g.103008247A>T	ENSP00000391211:p.Asn379Tyr	94.0	0.0	.		92.0	41.0	.	NM_002803	A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Missense_Mutation	SNP	ENST00000435765.1	hg19	CCDS5731.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.217729	0.79352	.	.	ENSG00000161057	ENST00000435765;ENST00000292644;ENST00000544811	D;D;D	0.95137	-3.62;-3.62;-3.62	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.95893	0.8663	L	0.48877	1.53	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.96294	0.9216	10	0.62326	D	0.03	-31.875	14.9258	0.70878	1.0:0.0:0.0:0.0	.	379	P35998	PRS7_HUMAN	Y	379;379;242	ENSP00000391211:N379Y;ENSP00000292644:N379Y;ENSP00000445546:N242Y	ENSP00000292644:N379Y	N	+	1	0	PSMC2	102795483	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.978000	0.93450	1.917000	0.55516	0.524000	0.50904	AAT	.	.	.	none		0.388	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803	
DNAJB6	10049	hgsc.bcm.edu	37	7	157178258	157178258	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:157178258G>T	ENST00000262177.4	+	8	849	c.644G>T	c.(643-645)aGa>aTa	p.R215I	DNAJB6_ENST00000429029.2_Missense_Mutation_p.R215I|DNAJB6_ENST00000452797.2_Missense_Mutation_p.R166I|DNAJB6_ENST00000443280.1_Intron	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	215	Interaction with KRT18.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		GGTCAAGAAAGAGTAGAAGTT	0.373																																					p.R215I	Esophageal Squamous(46;195 967 1350 20350 43814)	Atlas-SNP	.											.	DNAJB6	39	.	0			c.G644T						PASS	.						118.0	130.0	126.0					7																	157178258		2203	4300	6503	SO:0001583	missense	10049	exon8			AAGAAAGAGTAGA	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.644G>T	chr7.hg19:g.157178258G>T	ENSP00000262177:p.Arg215Ile	99.0	0.0	.		96.0	40.0	.	NM_058246	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Missense_Mutation	SNP	ENST00000262177.4	hg19	CCDS5946.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.13|16.13	3.034822|3.034822	0.54896|0.54896	.|.	.|.	ENSG00000105993|ENSG00000105993	ENST00000421417|ENST00000429029;ENST00000262177;ENST00000417758;ENST00000452797	.|T;T;T;T	.|0.46819	.|0.86;0.86;0.86;0.86	5.58|5.58	3.62|3.62	0.41486|0.41486	.|.	.|0.106321	.|0.34088	.|N	.|0.004272	.|T	.|0.60881	.|0.2303	M|M	0.79693|0.79693	2.465|2.465	0.80722|0.80722	D|D	1|1	.|D;D;P;P	.|0.59357	.|0.985;0.974;0.883;0.498	.|P;P;P;B	.|0.51135	.|0.66;0.459;0.459;0.444	.|T	.|0.71159	.|-0.4674	.|10	0.18276|0.87932	T|D	0.48|0	.|.	15.4173|15.4173	0.74980|0.74980	0.0:0.2635:0.7365:0.0|0.0:0.2635:0.7365:0.0	.|.	.|166;215;215;215	.|B4DN73;A8KAG0;O75190;O75190-2	.|.;.;DNJB6_HUMAN;.	X|I	215|215;215;215;166	.|ENSP00000397556:R215I;ENSP00000262177:R215I;ENSP00000400665:R215I;ENSP00000402270:R166I	ENSP00000416129:E215X|ENSP00000262177:R215I	E|R	+|+	1|2	0|0	DNAJB6|DNAJB6	156871019|156871019	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.591000|4.591000	0.61019|0.61019	1.318000|1.318000	0.45170|0.45170	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.	.	.	none		0.373	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
ZBTB10	65986	hgsc.bcm.edu	37	8	81399773	81399773	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr8:81399773T>C	ENST00000430430.1	+	2	1507	c.728T>C	c.(727-729)aTg>aCg	p.M243T	Y_RNA_ENST00000605948.1_RNA|ZBTB10_ENST00000379091.4_Intron|ZBTB10_ENST00000455036.3_Missense_Mutation_p.M243T|ZBTB10_ENST00000426744.2_Missense_Mutation_p.M243T	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			AAGTCTCTAATGCAGAAGCTC	0.612																																					p.M243T		Atlas-SNP	.											.	ZBTB10	51	.	0			c.T728C						PASS	.						31.0	34.0	33.0					8																	81399773		2002	4174	6176	SO:0001583	missense	65986	exon1			CTCTAATGCAGAA	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.728T>C	chr8.hg19:g.81399773T>C	ENSP00000387462:p.Met243Thr	33.0	0.0	.		60.0	24.0	.	NM_023929	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	hg19	CCDS47880.1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.962697	0.34659	.	.	ENSG00000205189	ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T	0.09630	2.96;2.96;2.96	4.52	4.52	0.55395	.	0.171155	0.37095	N	0.002246	T	0.06600	0.0169	N	0.08118	0	0.33778	D	0.623847	B;B;B	0.26547	0.039;0.039;0.152	B;B;B	0.20955	0.01;0.01;0.032	T	0.12477	-1.0546	10	0.87932	D	0	.	13.9929	0.64378	0.0:0.0:0.0:1.0	.	99;243;243	A8E4L4;Q96DT7;Q96DT7-2	.;ZBT10_HUMAN;.	T	243;243;243;71	ENSP00000387462:M243T;ENSP00000412036:M243T;ENSP00000416134:M243T	ENSP00000416134:M243T	M	+	2	0	ZBTB10	81562328	1.000000	0.71417	0.977000	0.42913	0.191000	0.23601	6.246000	0.72405	1.878000	0.54408	0.533000	0.62120	ATG	.	.	.	none		0.612	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
SLC25A32	81034	hgsc.bcm.edu	37	8	104419932	104419932	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr8:104419932G>A	ENST00000297578.4	-	2	401	c.235C>T	c.(235-237)Cgg>Tgg	p.R79W	SLC25A32_ENST00000543107.1_De_novo_Start_OutOfFrame	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	79					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	TAAAGTCCCCGTAGTCCATCA	0.398																																					p.R79W		Atlas-SNP	.											.	SLC25A32	36	.	0			c.C235T						PASS	.						163.0	164.0	164.0					8																	104419932		2203	4300	6503	SO:0001583	missense	81034	exon2			GTCCCCGTAGTCC	AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.235C>T	chr8.hg19:g.104419932G>A	ENSP00000297578:p.Arg79Trp	62.0	0.0	.		75.0	24.0	.	NM_030780	Q96JZ6|Q96SU7	Missense_Mutation	SNP	ENST00000297578.4	hg19	CCDS6300.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514039	0.85389	.	.	ENSG00000164933	ENST00000297578;ENST00000424899	T	0.80909	-1.43	6.05	6.05	0.98169	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.92273	0.7549	M	0.90252	3.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92648	0.6130	10	0.87932	D	0	-11.9646	20.6013	0.99457	0.0:0.0:1.0:0.0	.	79	Q9H2D1	MFTC_HUMAN	W	79;63	ENSP00000297578:R79W	ENSP00000297578:R79W	R	-	1	2	SLC25A32	104489108	1.000000	0.71417	0.959000	0.39883	0.987000	0.75469	5.692000	0.68256	2.878000	0.98634	0.650000	0.86243	CGG	.	.	.	none		0.398	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380290.2	NM_030780	
RANBP6	26953	hgsc.bcm.edu	37	9	6012658	6012658	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr9:6012658T>G	ENST00000259569.5	-	1	2960	c.2950A>C	c.(2950-2952)Ata>Cta	p.I984L	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	984					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I984L(4)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATCTTCCCTATTGCTGAGATA	0.363																																					p.I984L		Atlas-SNP	.											RANBP6,bladder,carcinoma,0,7	RANBP6	127	.	4	Substitution - Missense(4)	lung(2)|endometrium(1)|kidney(1)	c.A2950C						PASS	.						110.0	103.0	106.0					9																	6012658		2203	4300	6503	SO:0001583	missense	26953	exon1			TCCCTATTGCTGA	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2950A>C	chr9.hg19:g.6012658T>G	ENSP00000259569:p.Ile984Leu	130.0	0.0	.		133.0	6.0	.	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	hg19	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.451466	0.26074	.	.	ENSG00000137040	ENST00000259569	T	0.08807	3.05	4.79	2.63	0.31362	Armadillo-like helical (1);Armadillo-type fold (1);	0.121890	0.53938	D	0.000050	T	0.03263	0.0095	N	0.11341	0.13	0.36993	D	0.894861	B;B;B	0.17268	0.021;0.012;0.021	B;B;B	0.16722	0.016;0.011;0.016	T	0.36648	-0.9739	10	0.06891	T	0.86	-4.4735	5.2001	0.15258	0.0:0.4849:0.0:0.5151	.	151;572;984	B4E340;B4DTX6;O60518	.;.;RNBP6_HUMAN	L	984	ENSP00000259569:I984L	ENSP00000259569:I984L	I	-	1	0	RANBP6	6002658	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.090000	0.50191	0.682000	0.31407	0.533000	0.62120	ATA	.	.	.	none		0.363	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
AQP3	360	hgsc.bcm.edu	37	9	33447468	33447468	+	Silent	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr9:33447468G>A	ENST00000297991.4	-	1	141	c.61C>T	c.(61-63)Ctg>Ttg	p.L21L	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	21					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		TGTCGGAGCAGCCGGTAGCGG	0.711																																					p.L21L		Atlas-SNP	.											.	AQP3	18	.	0			c.C61T						PASS	.						18.0	21.0	20.0					9																	33447468		2188	4289	6477	SO:0001819	synonymous_variant	360	exon1			GGAGCAGCCGGTA		CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.61C>T	chr9.hg19:g.33447468G>A		84.0	0.0	.		91.0	37.0	.	NM_004925	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Silent	SNP	ENST00000297991.4	hg19	CCDS6542.1																																																																																			.	.	.	weak		0.711	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052055.1	NM_004925	
SPTLC1	10558	hgsc.bcm.edu	37	9	94809499	94809499	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr9:94809499C>T	ENST00000262554.2	-	11	1041	c.1036G>A	c.(1036-1038)Gct>Act	p.A346T		NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	346					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	GCTGCAGCAGCTAACAGGGGA	0.438																																					p.A346T		Atlas-SNP	.											.	SPTLC1	42	.	0			c.G1036A						PASS	.						147.0	141.0	143.0					9																	94809499		2203	4300	6503	SO:0001583	missense	10558	exon11			CAGCAGCTAACAG	Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.1036G>A	chr9.hg19:g.94809499C>T	ENSP00000262554:p.Ala346Thr	43.0	0.0	.		43.0	10.0	.	NM_006415	A8K681|Q5VWB4|Q96IX6	Missense_Mutation	SNP	ENST00000262554.2	hg19	CCDS6692.1	.	.	.	.	.	.	.	.	.	.	C	33	5.247472	0.95305	.	.	ENSG00000090054	ENST00000262554	D	0.96200	-3.94	5.25	5.25	0.73442	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.048440	0.85682	D	0.000000	D	0.94785	0.8316	L	0.51422	1.61	0.80722	D	1	B;P	0.37914	0.314;0.611	B;B	0.43274	0.393;0.414	D	0.93830	0.7127	10	0.38643	T	0.18	-11.2377	19.0877	0.93212	0.0:1.0:0.0:0.0	.	346;346	Q6NUL7;O15269	.;SPTC1_HUMAN	T	346	ENSP00000262554:A346T	ENSP00000262554:A346T	A	-	1	0	SPTLC1	93849320	1.000000	0.71417	0.964000	0.40570	0.985000	0.73830	7.543000	0.82106	2.733000	0.93635	0.650000	0.86243	GCT	.	.	.	none		0.438	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055553.1	NM_006415	
KLF4	9314	hgsc.bcm.edu	37	9	110249965	110249965	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr9:110249965G>A	ENST00000374672.4	-	3	1183	c.710C>T	c.(709-711)gCc>gTc	p.A237V		NM_004235.4	NP_004226.3	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	237	Pro-rich.				cellular response to cycloheximide (GO:0071409)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|epidermal cell differentiation (GO:0009913)|epidermis morphogenesis (GO:0048730)|fat cell differentiation (GO:0045444)|mesodermal cell fate determination (GO:0007500)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of muscle hyperplasia (GO:0014740)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic camera-type eye development (GO:0031077)|post-embryonic hemopoiesis (GO:0035166)|regulation of cell differentiation (GO:0045595)|response to retinoic acid (GO:0032526)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001010)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(5)|large_intestine(1)|lung(3)|pancreas(1)|prostate(2)	16						GCTGCCAGGGGCGCTCAGCGA	0.701																																					p.A237V		Atlas-SNP	.											.	KLF4	106	.	0			c.C710T						PASS	.						10.0	11.0	11.0					9																	110249965		2160	4246	6406	SO:0001583	missense	9314	exon3			CCAGGGGCGCTCA	AF022184	CCDS6770.2	9q31	2013-01-08			ENSG00000136826	ENSG00000136826		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6348	protein-coding gene	gene with protein product		602253				9422764, 16372018	Standard	NM_004235		Approved	EZF, GKLF	uc004bdg.3	O43474	OTTHUMG00000020449	ENST00000374672.4:c.710C>T	chr9.hg19:g.110249965G>A	ENSP00000363804:p.Ala237Val	27.0	0.0	.		27.0	11.0	.	NM_004235	B2R8S4|B3KT79|L0R3I6|L0R4N5|P78338|Q5T3J8|Q5T3J9|Q8N717|Q9UNP3	Missense_Mutation	SNP	ENST00000374672.4	hg19	CCDS6770.2	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317561	0.40996	.	.	ENSG00000136826	ENST00000374672;ENST00000411706	T	0.04809	3.55	3.38	3.38	0.38709	.	0.605659	0.13877	N	0.356593	T	0.02119	0.0066	N	0.03608	-0.345	0.21416	N	0.999697	B;B	0.11235	0.004;0.003	B;B	0.12156	0.007;0.004	T	0.40403	-0.9565	10	0.06099	T	0.92	.	10.5918	0.45314	0.0:0.0:1.0:0.0	.	237;237	O43474;O43474-1	KLF4_HUMAN;.	V	237;228	ENSP00000363804:A237V	ENSP00000363804:A237V	A	-	2	0	KLF4	109289786	1.000000	0.71417	0.914000	0.36105	0.647000	0.38526	2.120000	0.41968	2.191000	0.70037	0.655000	0.94253	GCC	.	.	.	none		0.701	KLF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053556.2	NM_004235	
RPL7A	6130	hgsc.bcm.edu	37	9	136216882	136216882	+	Silent	SNP	G	G	T	rs7700	byFrequency	TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr9:136216882G>T	ENST00000323345.6	+	4	420	c.390G>T	c.(388-390)acG>acT	p.T130T	SNORD36A_ENST00000362874.1_RNA|SNORD24_ENST00000383884.1_RNA|MED22_ENST00000471524.1_5'Flank|SURF1_ENST00000495952.1_5'Flank|RPL7A_ENST00000463740.1_3'UTR|SNORD36B_ENST00000363961.1_RNA|SNORD36C_ENST00000516733.1_RNA|MED22_ENST00000476080.1_5'Flank|MED22_ENST00000491289.1_5'Flank|MED22_ENST00000344469.5_5'Flank|MED22_ENST00000371999.1_5'Flank|RPL7A_ENST00000315731.4_Silent_p.T15T|MED22_ENST00000343730.5_5'Flank	NM_000972.2	NP_000963.1	P62424	RL7A_HUMAN	ribosomal protein L7a	130					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		ACGTCCCAACGAAGAGACCAC	0.557																																					p.T130T		Atlas-SNP	.											.	RPL7A	9	.	0			c.G390T						PASS	.						58.0	63.0	61.0					9																	136216882		2203	4300	6503	SO:0001819	synonymous_variant	6130	exon4			CCCAACGAAGAGA	BC005128	CCDS6965.1	9q34	2011-04-06			ENSG00000148303	ENSG00000148303		"""L ribosomal proteins"""	10364	protein-coding gene	gene with protein product	"""surfeit 3"", ""PLA-X polypeptide"", ""surfeit locus protein 3"", ""60S ribosomal protein L7a"", "";"", ""thyroid hormone receptor uncoupling protein"""	185640				2403926, 2966065	Standard	NM_000972		Approved	SURF3, TRUP, L7A	uc004cde.1	P62424	OTTHUMG00000020864	ENST00000323345.6:c.390G>T	chr9.hg19:g.136216882G>T		32.0	0.0	.		27.0	11.0	.	NM_000972	P11518|Q5T8U4	Silent	SNP	ENST00000323345.6	hg19	CCDS6965.1																																																																																			.	G|0.942;A|0.058	.	alt		0.557	RPL7A-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054869.1	NM_000972	
COL5A1	1289	hgsc.bcm.edu	37	9	137710604	137710604	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr9:137710604C>T	ENST00000371817.3	+	55	4747	c.4333C>T	c.(4333-4335)Cct>Tct	p.P1445S		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1445	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GATCCCTGGCCCTGTGGTGAG	0.667																																					p.P1445S		Atlas-SNP	.											.	COL5A1	323	.	0			c.C4333T						PASS	.						22.0	23.0	23.0					9																	137710604		2203	4297	6500	SO:0001583	missense	1289	exon55			CCTGGCCCTGTGG	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4333C>T	chr9.hg19:g.137710604C>T	ENSP00000360882:p.Pro1445Ser	41.0	0.0	.		28.0	10.0	.	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.726665	0.30593	.	.	ENSG00000130635	ENST00000371817	D	0.96802	-4.13	4.69	3.79	0.43588	.	0.068028	0.64402	U	0.000012	D	0.94889	0.8348	M	0.78049	2.395	0.53005	D	0.999969	B	0.30914	0.3	B	0.29077	0.098	D	0.92543	0.6043	10	0.29301	T	0.29	.	12.715	0.57109	0.0:0.9191:0.0:0.0809	.	1445	P20908	CO5A1_HUMAN	S	1445	ENSP00000360882:P1445S	ENSP00000360882:P1445S	P	+	1	0	COL5A1	136850425	0.994000	0.37717	0.977000	0.42913	0.632000	0.37999	3.040000	0.49799	0.968000	0.38212	0.448000	0.29417	CCT	.	.	.	none		0.667	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
ANK3	288	hgsc.bcm.edu	37	10	61842390	61842390	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr10:61842390G>C	ENST00000280772.2	-	34	4497	c.4306C>G	c.(4306-4308)Ctg>Gtg	p.L1436V	ANK3_ENST00000373827.2_Missense_Mutation_p.L1430V|ANK3_ENST00000503366.1_Missense_Mutation_p.L1437V|ANK3_ENST00000355288.2_Missense_Mutation_p.L570V|Y_RNA_ENST00000365320.1_RNA	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1436					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGTGCTGGCAGAGTGATATTT	0.413																																					p.L1437V		Atlas-SNP	.											.	ANK3	703	.	0			c.C4309G						PASS	.						183.0	178.0	180.0					10																	61842390		2203	4300	6503	SO:0001583	missense	288	exon35			CTGGCAGAGTGAT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4306C>G	chr10.hg19:g.61842390G>C	ENSP00000280772:p.Leu1436Val	72.0	0.0	.		76.0	32.0	.	NM_001204404	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390947	0.42410	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304	T;T;D;T;T	0.82344	1.47;1.47;-1.6;1.47;1.47	5.89	4.05	0.47172	.	0.239554	0.21461	N	0.074162	D	0.88851	0.6549	M	0.64080	1.96	0.80722	D	1	B;D;D;B;D;P	0.89917	0.427;0.998;1.0;0.148;0.993;0.956	B;D;D;B;D;D	0.87578	0.342;0.99;0.998;0.089;0.946;0.931	D	0.88474	0.3064	10	0.87932	D	0	.	11.7562	0.51875	0.1961:0.0:0.8039:0.0	.	1437;570;1430;1436;671;570	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;ANK3_HUMAN;.;.	V	1436;1430;19;570;570;1437;1416;671;1071;1071	ENSP00000280772:L1436V;ENSP00000362933:L1430V;ENSP00000362926:L19V;ENSP00000347436:L570V;ENSP00000425236:L1437V	ENSP00000280772:L1436V	L	-	1	2	ANK3	61512396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.338000	0.52128	0.835000	0.34877	0.557000	0.71058	CTG	.	.	.	none		0.413	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
GBF1	8729	hgsc.bcm.edu	37	10	104126202	104126202	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr10:104126202G>A	ENST00000369983.3	+	19	2629	c.2369G>A	c.(2368-2370)cGt>cAt	p.R790H		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	790	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GAAGCCTTCCGTTTGCCTGGG	0.547																																					p.R791H		Atlas-SNP	.											.	GBF1	142	.	0			c.G2372A						PASS	.						124.0	105.0	112.0					10																	104126202		2203	4300	6503	SO:0001583	missense	8729	exon19			CCTTCCGTTTGCC	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2369G>A	chr10.hg19:g.104126202G>A	ENSP00000359000:p.Arg790His	131.0	0.0	.		95.0	18.0	.	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	hg19	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	36	5.911085	0.97093	.	.	ENSG00000107862	ENST00000369983	T	0.58210	0.35	6.03	6.03	0.97812	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.79240	0.4412	M	0.89163	3.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	T	0.81497	-0.0906	10	0.87932	D	0	-13.0608	20.5568	0.99304	0.0:0.0:1.0:0.0	.	790;790;790	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	H	790	ENSP00000359000:R790H	ENSP00000359000:R790H	R	+	2	0	GBF1	104116192	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.824000	0.99380	2.861000	0.98227	0.655000	0.94253	CGT	.	.	.	none		0.547	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
CCDC186	55088	hgsc.bcm.edu	37	10	115922488	115922488	+	Silent	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr10:115922488T>G	ENST00000369287.3	-	2	806	c.540A>C	c.(538-540)gtA>gtC	p.V180V	C10orf118_ENST00000369285.3_Silent_p.V180V|C10orf118_ENST00000369286.1_Silent_p.V180V	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		180										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		TTCCATTTGGTACTCGATGTT	0.333																																					p.V180V		Atlas-SNP	.											.	C10orf118	70	.	0			c.A540C						PASS	.						76.0	72.0	73.0					10																	115922488		2202	4298	6500	SO:0001819	synonymous_variant	55088	exon2			ATTTGGTACTCGA																												ENST00000369287.3:c.540A>C	chr10.hg19:g.115922488T>G		255.0	0.0	.		176.0	66.0	.	NM_018017	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Silent	SNP	ENST00000369287.3	hg19	CCDS7587.1																																																																																			.	.	.	none		0.333	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1		
PSMC3	5702	hgsc.bcm.edu	37	11	47446781	47446781	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr11:47446781A>G	ENST00000298852.3	-	3	333	c.176T>C	c.(175-177)gTg>gCg	p.V59A	PSMC3_ENST00000530912.1_Intron|PSMC3_ENST00000602866.1_Missense_Mutation_p.V43A	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	59					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GACTCTCAACACTTCACTCTT	0.478																																					p.V59A		Atlas-SNP	.											.	PSMC3	35	.	0			c.T176C						PASS	.						195.0	170.0	178.0					11																	47446781		2201	4298	6499	SO:0001583	missense	5702	exon3			CTCAACACTTCAC	M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.176T>C	chr11.hg19:g.47446781A>G	ENSP00000298852:p.Val59Ala	100.0	0.0	.		84.0	37.0	.	NM_002804	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Missense_Mutation	SNP	ENST00000298852.3	hg19	CCDS7935.1	.	.	.	.	.	.	.	.	.	.	A	14.56	2.572615	0.45798	.	.	ENSG00000165916	ENST00000298852;ENST00000524447;ENST00000531051;ENST00000530887;ENST00000530651;ENST00000527906;ENST00000526993;ENST00000531653;ENST00000528362	D	0.94417	-3.42	5.5	5.5	0.81552	.	0.176985	0.48767	D	0.000178	D	0.92014	0.7470	L	0.53249	1.67	0.58432	D	0.999999	B	0.25441	0.126	B	0.24701	0.055	D	0.89317	0.3637	10	0.17369	T	0.5	-33.9881	15.6076	0.76685	1.0:0.0:0.0:0.0	.	59	P17980	PRS6A_HUMAN	A	59;24;24;24;24;24;67;43;43	ENSP00000298852:V59A	ENSP00000298852:V59A	V	-	2	0	PSMC3	47403357	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.576000	0.82467	2.094000	0.63399	0.454000	0.30748	GTG	.	.	.	none		0.478	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395660.2	NM_002804	
B3GAT3	26229	hgsc.bcm.edu	37	11	62388048	62388048	+	Missense_Mutation	SNP	G	G	A	rs374687580		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr11:62388048G>A	ENST00000265471.5	-	2	405	c.178C>T	c.(178-180)Cgg>Tgg	p.R60W	B3GAT3_ENST00000534026.1_Missense_Mutation_p.R60W|B3GAT3_ENST00000531383.1_Missense_Mutation_p.R60W	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	60					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						GGGGGTGGCCGTCGGAGTTCC	0.637																																					p.R60W		Atlas-SNP	.											.	B3GAT3	24	.	0			c.C178T						PASS	.						20.0	27.0	24.0					11																	62388048		2202	4293	6495	SO:0001583	missense	26229	exon2			GTGGCCGTCGGAG	AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.178C>T	chr11.hg19:g.62388048G>A	ENSP00000265471:p.Arg60Trp	39.0	0.0	.		49.0	18.0	.	NM_012200	B7ZAB3|Q96I06|Q9UEP0	Missense_Mutation	SNP	ENST00000265471.5	hg19	CCDS8025.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668430	0.88348	.	.	ENSG00000149541	ENST00000265471;ENST00000531383;ENST00000534026;ENST00000534715	T;T;T;T	0.66460	-0.18;-0.19;-0.21;0.75	5.53	5.53	0.82687	.	0.436137	0.23323	N	0.049434	T	0.75184	0.3815	L	0.44542	1.39	0.49687	D	0.999812	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.66979	0.948;0.948;0.824	T	0.76509	-0.2933	10	0.66056	D	0.02	.	14.9659	0.71193	0.0:0.0:1.0:0.0	.	60;66;60	B7ZAB3;Q5U676;O94766	.;.;B3GA3_HUMAN	W	60;60;60;83	ENSP00000265471:R60W;ENSP00000431359:R60W;ENSP00000432474:R60W;ENSP00000432854:R83W	ENSP00000265471:R60W	R	-	1	2	B3GAT3	62144624	0.941000	0.31946	0.966000	0.40874	0.882000	0.50991	2.038000	0.41184	2.599000	0.87857	0.655000	0.94253	CGG	.	.	.	alt		0.637	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1	NM_012200	
LRRC32	2615	hgsc.bcm.edu	37	11	76371152	76371152	+	Silent	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr11:76371152G>A	ENST00000407242.2	-	3	1727	c.1485C>T	c.(1483-1485)gtC>gtT	p.V495V	LRRC32_ENST00000404995.1_Silent_p.V495V|LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000260061.5_Silent_p.V495V	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	495					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GCAGTGCCAGGACCTCCAAGG	0.647																																					p.V495V		Atlas-SNP	.											.	LRRC32	74	.	0			c.C1485T						PASS	.						27.0	28.0	27.0					11																	76371152		2200	4292	6492	SO:0001819	synonymous_variant	2615	exon3			TGCCAGGACCTCC	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1485C>T	chr11.hg19:g.76371152G>A		34.0	0.0	.		23.0	14.0	.	NM_005512	Q86V06	Silent	SNP	ENST00000407242.2	hg19	CCDS8245.1																																																																																			.	.	.	none		0.647	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
CACNA2D4	93589	hgsc.bcm.edu	37	12	1993454	1993454	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:1993454C>T	ENST00000382722.5	-	12	1668	c.1306G>A	c.(1306-1308)Gtg>Atg	p.V436M	CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.V372M|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.V436M|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.V436M|CACNA2D4_ENST00000585708.1_Missense_Mutation_p.V372M	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	436	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GCAAAAGACACTTCTCTCCCA	0.502																																					p.V436M	Colon(2;101 179 21030 23310 28141)	Atlas-SNP	.											.	CACNA2D4	220	.	0			c.G1306A						PASS	.						72.0	80.0	77.0					12																	1993454		2051	4204	6255	SO:0001583	missense	93589	exon12			AAGACACTTCTCT	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.1306G>A	chr12.hg19:g.1993454C>T	ENSP00000372169:p.Val436Met	29.0	0.0	.		57.0	33.0	.	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	hg19	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283451	0.40394	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.08282	3.11	5.27	5.27	0.74061	von Willebrand factor, type A (3);	0.107037	0.64402	D	0.000003	T	0.09598	0.0236	L	0.28556	0.865	0.80722	D	1	B	0.12013	0.005	B	0.20384	0.029	T	0.15292	-1.0442	10	0.49607	T	0.09	.	18.8984	0.92433	0.0:1.0:0.0:0.0	.	436	Q7Z3S7	CA2D4_HUMAN	M	372;436;436	ENSP00000372169:V436M	ENSP00000280663:V436M	V	-	1	0	CACNA2D4	1863715	1.000000	0.71417	0.976000	0.42696	0.827000	0.46813	3.017000	0.49615	2.463000	0.83235	0.603000	0.83216	GTG	.	.	.	none		0.502	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
NCAPD2	9918	hgsc.bcm.edu	37	12	6639960	6639960	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:6639960C>A	ENST00000315579.5	+	30	4740	c.3941C>A	c.(3940-3942)cCa>cAa	p.P1314Q	RP5-940J5.3_ENST00000537921.1_RNA|NCAPD2_ENST00000545962.1_Missense_Mutation_p.P1269Q	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1314					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						CAGAGAGCGCCATCAGCCAAG	0.512																																					p.P1314Q		Atlas-SNP	.											.	NCAPD2	99	.	0			c.C3941A						PASS	.						62.0	64.0	63.0					12																	6639960		2203	4300	6503	SO:0001583	missense	9918	exon30			GAGCGCCATCAGC	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.3941C>A	chr12.hg19:g.6639960C>A	ENSP00000325017:p.Pro1314Gln	38.0	0.0	.		47.0	16.0	.	NM_014865	D3DUR4|Q8N6U3	Missense_Mutation	SNP	ENST00000315579.5	hg19	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068903	0.36470	.	.	ENSG00000010292	ENST00000315579;ENST00000545962	T;T	0.17854	2.52;2.25	5.63	2.8	0.32819	.	0.513361	0.21089	N	0.080360	T	0.11024	0.0269	L	0.38838	1.175	0.09310	N	1	B;B	0.21071	0.025;0.051	B;B	0.18871	0.023;0.008	T	0.32455	-0.9906	10	0.22109	T	0.4	-3.6593	4.7752	0.13175	0.2099:0.5563:0.0:0.2337	.	1269;1314	F5GZJ1;Q15021	.;CND1_HUMAN	Q	1314;1269	ENSP00000325017:P1314Q;ENSP00000444417:P1269Q	ENSP00000325017:P1314Q	P	+	2	0	NCAPD2	6510221	0.000000	0.05858	0.403000	0.26384	0.250000	0.25880	0.275000	0.18698	0.305000	0.22832	0.561000	0.74099	CCA	.	.	.	none		0.512	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
GPR162	27239	hgsc.bcm.edu	37	12	6933104	6933104	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:6933104C>T	ENST00000311268.3	+	2	827	c.40C>T	c.(40-42)Cgc>Tgc	p.R14C	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron|GPR162_ENST00000541431.1_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						GGCCTCCCTGCGCTCCAACGC	0.682																																					p.R14C		Atlas-SNP	.											.	GPR162	55	.	0			c.C40T						PASS	.						11.0	11.0	11.0					12																	6933104		2197	4291	6488	SO:0001583	missense	27239	exon2			TCCCTGCGCTCCA	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.40C>T	chr12.hg19:g.6933104C>T	ENSP00000311528:p.Arg14Cys	19.0	0.0	.		24.0	17.0	.	NM_019858	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	hg19	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557714	0.65425	.	.	ENSG00000250510	ENST00000311268	T	0.09073	3.02	4.74	4.74	0.60224	.	.	.	.	.	T	0.07773	0.0195	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.999;0.993	P;B	0.50490	0.642;0.348	T	0.36040	-0.9764	9	0.54805	T	0.06	.	12.9402	0.58337	0.162:0.838:0.0:0.0	.	14;14	B7Z3U3;Q16538	.;GP162_HUMAN	C	14	ENSP00000311528:R14C	ENSP00000311528:R14C	R	+	1	0	GPR162	6803365	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	3.946000	0.56644	2.464000	0.83262	0.561000	0.74099	CGC	.	.	.	none		0.682	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Atlas-SNP	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,66	KRAS	30930	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T						PASS	.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	155.0	0.0	.		201.0	132.0	.	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	hg19	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.	.	.	weak		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KRT83	3889	hgsc.bcm.edu	37	12	52710705	52710705	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:52710705C>A	ENST00000293670.3	-	5	915	c.853G>T	c.(853-855)Gca>Tca	p.A285S		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	285	Coil 2.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCATACTGTGCCTTGATCTCG	0.582																																					p.A285S	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	Atlas-SNP	.											.	KRT83	64	.	0			c.G853T						PASS	.						174.0	143.0	154.0					12																	52710705		2203	4300	6503	SO:0001583	missense	3889	exon5			ACTGTGCCTTGAT	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.853G>T	chr12.hg19:g.52710705C>A	ENSP00000293670:p.Ala285Ser	68.0	0.0	.		93.0	50.0	.	NM_002282	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	ENST00000293670.3	hg19	CCDS8823.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168355	0.57584	.	.	ENSG00000170523	ENST00000293670	T	0.76578	-1.03	3.9	3.9	0.45041	Filament (1);	0.184777	0.25490	U	0.030304	T	0.82107	0.4965	M	0.71581	2.175	0.38260	D	0.941851	P	0.36465	0.554	P	0.45506	0.483	D	0.86574	0.1849	10	0.66056	D	0.02	.	16.2457	0.82445	0.0:1.0:0.0:0.0	.	285	P78385	KRT83_HUMAN	S	285	ENSP00000293670:A285S	ENSP00000293670:A285S	A	-	1	0	KRT83	50996972	1.000000	0.71417	0.999000	0.59377	0.344000	0.29017	5.625000	0.67770	1.894000	0.54839	0.561000	0.74099	GCA	.	.	.	none		0.582	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
KDM2B	84678	hgsc.bcm.edu	37	12	121881963	121881963	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:121881963C>T	ENST00000377071.4	-	16	2375	c.2303G>A	c.(2302-2304)aGt>aAt	p.S768N	KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Missense_Mutation_p.S136N|KDM2B_ENST00000377069.4_Missense_Mutation_p.S737N	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	768					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CTCACACTCACTCCTCCGCTT	0.632											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S768N		Atlas-SNP	.											.	KDM2B	218	.	0			c.G2303A						PASS	.						82.0	86.0	85.0					12																	121881963		2058	4202	6260	SO:0001583	missense	84678	exon16			CACTCACTCCTCC	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2303G>A	chr12.hg19:g.121881963C>T	ENSP00000366271:p.Ser768Asn	29.0	0.0	.	1514	29.0	15.0	.	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	hg19	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077467	0.36662	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043;ENST00000261824	T;T;T	0.24151	2.2;2.47;1.87	5.95	5.04	0.67666	.	0.487539	0.19689	N	0.108332	T	0.12944	0.0314	N	0.08118	0	0.80722	D	1	B;B;B;B	0.28128	0.054;0.055;0.201;0.128	B;B;B;B	0.18871	0.016;0.008;0.023;0.023	T	0.12041	-1.0563	10	0.17832	T	0.49	-2.6873	13.955	0.64142	0.2761:0.7239:0.0:0.0	.	208;768;737;211	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	N	768;136;737;768;211;771	ENSP00000437821:S136N;ENSP00000366269:S737N;ENSP00000366271:S768N	ENSP00000261824:S771N	S	-	2	0	KDM2B	120366346	0.986000	0.35501	0.968000	0.41197	0.715000	0.41141	2.987000	0.49378	1.461000	0.47929	0.655000	0.94253	AGT	.	.	.	none		0.632	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
HCAR2	338442	hgsc.bcm.edu	37	12	123187139	123187139	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:123187139G>T	ENST00000328880.5	-	1	751	c.692C>A	c.(691-693)aCc>aAc	p.T231N	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	231					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	CATGATGAAGGTGATGGCTCT	0.567																																					p.T231N		Atlas-SNP	.											.	HCAR2	36	.	0			c.C692A						PASS	.						72.0	61.0	65.0					12																	123187139		2203	4297	6500	SO:0001583	missense	338442	exon1			ATGAAGGTGATGG	AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.692C>A	chr12.hg19:g.123187139G>T	ENSP00000375066:p.Thr231Asn	146.0	0.0	.		174.0	37.0	.	NM_177551	A0PJL5|A7LGG3	Missense_Mutation	SNP	ENST00000328880.5	hg19	CCDS9235.1	.	.	.	.	.	.	.	.	.	.	G	4.367	0.067602	0.08436	.	.	ENSG00000182782	ENST00000328880;ENST00000536970	T	0.37584	1.19	4.97	0.684	0.18003	GPCR, rhodopsin-like superfamily (1);	0.595355	0.15261	N	0.271792	T	0.10294	0.0252	N	0.00879	-1.12	0.18873	N	0.999981	B	0.02656	0.0	B	0.06405	0.002	T	0.23976	-1.0173	10	0.39692	T	0.17	-13.1354	4.7774	0.13185	0.0:0.2263:0.1698:0.6039	.	231	Q8TDS4	HCAR2_HUMAN	N	231	ENSP00000375066:T231N	ENSP00000375066:T231N	T	-	2	0	HCAR2	121753092	0.000000	0.05858	0.962000	0.40283	0.413000	0.31143	-0.028000	0.12350	0.136000	0.18733	-0.457000	0.05445	ACC	.	.	.	none		0.567	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370202.1	NM_177551	
XPO4	64328	hgsc.bcm.edu	37	13	21370348	21370348	+	Silent	SNP	C	C	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr13:21370348C>G	ENST00000255305.6	-	18	2735	c.2664G>C	c.(2662-2664)gtG>gtC	p.V888V	XPO4_ENST00000400602.2_Silent_p.V888V			Q9C0E2	XPO4_HUMAN	exportin 4	888					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		TCTTAGAATACACTTGCAACA	0.353																																					p.V888V		Atlas-SNP	.											.	XPO4	153	.	0			c.G2664C						PASS	.						103.0	90.0	94.0					13																	21370348		1817	4081	5898	SO:0001819	synonymous_variant	64328	exon18			AGAATACACTTGC	AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.2664G>C	chr13.hg19:g.21370348C>G		46.0	0.0	.		62.0	29.0	.	NM_022459	Q5VUZ5|Q8N3V6|Q9H934	Silent	SNP	ENST00000255305.6	hg19	CCDS41872.1																																																																																			.	.	.	none		0.353	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459	
SMAD9	4093	hgsc.bcm.edu	37	13	37427774	37427774	+	Missense_Mutation	SNP	C	C	T	rs375386551		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr13:37427774C>T	ENST00000399275.2	-	5	1181	c.1042G>A	c.(1042-1044)Gag>Aag	p.E348K	SMAD9_ENST00000350148.5_Missense_Mutation_p.E311K|SMAD9_ENST00000379826.4_Missense_Mutation_p.E348K			O15198	SMAD9_HUMAN	SMAD family member 9	348	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		CTCACGCACTCGGCATACACC	0.562																																					p.E348K		Atlas-SNP	.											.	SMAD9	91	.	0			c.G1042A						PASS	.	C	LYS/GLU,LYS/GLU	0,4406		0,0,2203	148.0	92.0	111.0		1042,931	5.5	1.0	13		111	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SMAD9	NM_001127217.2,NM_005905.5	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	348/468,311/431	37427774	1,13005	2203	4300	6503	SO:0001583	missense	4093	exon6			CGCACTCGGCATA		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.1042G>A	chr13.hg19:g.37427774C>T	ENSP00000382216:p.Glu348Lys	52.0	0.0	.		54.0	23.0	.	NM_001127217	A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	ENST00000399275.2	hg19	CCDS45032.1	.	.	.	.	.	.	.	.	.	.	C	35	5.571853	0.96553	0.0	1.16E-4	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	D;D;D	0.97455	-4.39;-4.28;-4.39	5.54	5.54	0.83059	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.97517	0.9187	M	0.81614	2.55	0.80722	D	1	P;D	0.56035	0.888;0.974	B;P	0.49301	0.325;0.606	D	0.97979	1.0348	10	0.62326	D	0.03	.	18.4694	0.90767	0.0:1.0:0.0:0.0	.	311;348	O15198-2;O15198	.;SMAD9_HUMAN	K	348;311;348	ENSP00000382216:E348K;ENSP00000239885:E311K;ENSP00000369154:E348K	ENSP00000239885:E311K	E	-	1	0	SMAD9	36325774	1.000000	0.71417	0.986000	0.45419	0.933000	0.57130	7.630000	0.83225	2.600000	0.87896	0.655000	0.94253	GAG	.	.	.	weak		0.562	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905	
FAM124A	220108	hgsc.bcm.edu	37	13	51825756	51825756	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr13:51825756C>T	ENST00000322475.8	+	3	388	c.253C>T	c.(253-255)Cgg>Tgg	p.R85W	FAM124A_ENST00000280057.6_Missense_Mutation_p.R121W	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	85										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		GTCCGAGAGGCGGGCGTCCCG	0.697																																					p.R121W		Atlas-SNP	.											.	FAM124A	61	.	0			c.C361T						PASS	.						11.0	11.0	11.0					13																	51825756		2185	4266	6451	SO:0001583	missense	220108	exon4			GAGAGGCGGGCGT	AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.253C>T	chr13.hg19:g.51825756C>T	ENSP00000324625:p.Arg85Trp	35.0	0.0	.		53.0	16.0	.	NM_145019	A2A324|Q8N8P9|Q8NE66|Q96NJ9	Missense_Mutation	SNP	ENST00000322475.8	hg19	CCDS55900.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938493	0.34189	.	.	ENSG00000150510	ENST00000322475;ENST00000280057	T;T	0.46063	0.88;0.88	5.79	-0.131	0.13494	.	0.245963	0.38720	N	0.001584	T	0.56217	0.1970	M	0.63843	1.955	0.33264	D	0.560112	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.984;0.997	T	0.64807	-0.6320	10	0.72032	D	0.01	-3.7704	10.7279	0.46079	0.2612:0.5921:0.1467:0.0	.	85;121;85	Q86V42;Q86V42-2;Q86V42-3	F124A_HUMAN;.;.	W	85;121	ENSP00000324625:R85W;ENSP00000280057:R121W	ENSP00000280057:R121W	R	+	1	2	FAM124A	50723757	0.880000	0.30214	0.002000	0.10522	0.008000	0.06430	0.233000	0.17911	-0.243000	0.09653	-0.176000	0.13171	CGG	.	.	.	none		0.697	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045019.3	NM_145019	
CARKD	55739	hgsc.bcm.edu	37	13	111279816	111279816	+	Missense_Mutation	SNP	G	G	T	rs553217045	byFrequency	TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr13:111279816G>T	ENST00000309957.2	+	5	431	c.417G>T	c.(415-417)gaG>gaT	p.E139D	CARKD_ENST00000458711.2_Intron|CARKD_ENST00000424185.2_Missense_Mutation_p.E29D|CARKD_ENST00000397191.4_Missense_Mutation_p.E76D|CARKD_ENST00000470164.2_3'UTR	NM_001242881.1|NM_018210.3	NP_001229810.1|NP_060680.2			carbohydrate kinase domain containing											NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	15						ATGAGGTGGAGAAGTGGCTGC	0.478																																					p.E139D		Atlas-SNP	.											.	CARKD	36	.	0			c.G417T						PASS	.						117.0	98.0	104.0					13																	111279816		2203	4300	6503	SO:0001583	missense	55739	exon5			GGTGGAGAAGTGG	AF151071	CCDS9513.1, CCDS55903.1	13q34	2008-12-19			ENSG00000213995	ENSG00000213995			25576	protein-coding gene	gene with protein product		615910					Standard	NM_018210		Approved	LP3298, FLJ10769	uc001vrc.3	Q8IW45	OTTHUMG00000017345	ENST00000309957.2:c.417G>T	chr13.hg19:g.111279816G>T	ENSP00000311984:p.Glu139Asp	89.0	0.0	.		90.0	36.0	.	NM_018210		Missense_Mutation	SNP	ENST00000309957.2	hg19	CCDS9513.1	.	.	.	.	.	.	.	.	.	.	G	7.687	0.690257	0.15039	.	.	ENSG00000213995	ENST00000424185;ENST00000439607;ENST00000397191;ENST00000309957	T;T;T	0.21932	1.98;1.98;1.98	5.13	-7.72	0.01250	Uncharacterised domain, carbohydrate kinase-related (3);	0.167564	0.51477	D	0.000087	T	0.06872	0.0175	N	0.17594	0.5	0.23492	N	0.997562	B;B;B;B;B	0.19200	0.004;0.002;0.034;0.005;0.002	B;B;B;B;B	0.21360	0.007;0.012;0.034;0.012;0.012	T	0.24333	-1.0163	10	0.15952	T	0.53	-16.6414	3.5533	0.07855	0.4722:0.2722:0.1641:0.0915	.	29;121;76;139;139	Q8IW45-4;B4DKX7;B7Z3Q0;Q8IW45-2;Q8IW45	.;.;.;.;CARKD_HUMAN	D	29;121;76;139	ENSP00000413191:E29D;ENSP00000380375:E76D;ENSP00000311984:E139D	ENSP00000311984:E139D	E	+	3	2	CARKD	110077817	0.116000	0.22171	0.001000	0.08648	0.319000	0.28217	-0.813000	0.04491	-1.320000	0.02283	-0.367000	0.07326	GAG	.	.	.	none		0.478	CARKD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045764.1	NM_018210	
CHAMP1	283489	hgsc.bcm.edu	37	13	115089604	115089604	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr13:115089604A>G	ENST00000361283.1	+	3	596	c.287A>G	c.(286-288)aAa>aGa	p.K96R		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	96					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										GATAAACCAAAAAATCAGTTG	0.408																																					p.K96R		Atlas-SNP	.											.	.	.	.	0			c.A287G						PASS	.						71.0	72.0	72.0					13																	115089604		2203	4300	6503	SO:0001583	missense	283489	exon3			AACCAAAAAATCA	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.287A>G	chr13.hg19:g.115089604A>G	ENSP00000354730:p.Lys96Arg	97.0	0.0	.		72.0	28.0	.	NM_001164144	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	ENST00000361283.1	hg19	CCDS9545.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.851053	0.71719	.	.	ENSG00000198824	ENST00000361283	T	0.01516	4.81	5.96	4.76	0.60689	.	0.095542	0.45361	D	0.000361	T	0.02047	0.0064	L	0.32530	0.975	0.34976	D	0.753647	P	0.51537	0.946	B	0.41860	0.368	T	0.62483	-0.6845	9	.	.	.	-12.7091	12.2897	0.54810	0.9335:0.0:0.0665:0.0	.	96	Q96JM3	ZN828_HUMAN	R	96	ENSP00000354730:K96R	.	K	+	2	0	ZNF828	114107706	1.000000	0.71417	0.793000	0.32043	0.806000	0.45545	3.930000	0.56522	1.046000	0.40249	0.533000	0.62120	AAA	.	.	.	none		0.408	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436	
SPTLC2	9517	hgsc.bcm.edu	37	14	78021667	78021667	+	Silent	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr14:78021667A>G	ENST00000216484.2	-	8	1345	c.1152T>C	c.(1150-1152)tcT>tcC	p.S384S	SPTLC2_ENST00000556264.1_5'Flank	NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	384					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	TATATCCTCCAGAAGCACCAA	0.502																																					p.S384S		Atlas-SNP	.											.	SPTLC2	55	.	0			c.T1152C						PASS	.						127.0	129.0	129.0					14																	78021667		2203	4300	6503	SO:0001819	synonymous_variant	9517	exon8			TCCTCCAGAAGCA	AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.1152T>C	chr14.hg19:g.78021667A>G		52.0	0.0	.		23.0	17.0	.	NM_004863	Q16685	Silent	SNP	ENST00000216484.2	hg19	CCDS9865.1	.	.	.	.	.	.	.	.	.	.	A	9.959	1.222330	0.22457	.	.	ENSG00000100596	ENST00000554901	.	.	.	4.8	3.62	0.41486	.	.	.	.	.	T	0.59649	0.2209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55829	-0.8079	4	.	.	.	-1.2399	9.9746	0.41774	0.7231:0.0:0.0:0.2769	.	.	.	.	R	321	.	.	W	-	1	0	SPTLC2	77091420	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.726000	0.38085	0.930000	0.37217	0.477000	0.44152	TGG	.	.	.	none		0.502	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1	NM_004863	
TCF12	6938	hgsc.bcm.edu	37	15	57484401	57484401	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr15:57484401C>A	ENST00000267811.5	+	7	740	c.436C>A	c.(436-438)Cta>Ata	p.L146I	TCF12_ENST00000557843.1_Missense_Mutation_p.L146I|TCF12_ENST00000333725.5_Missense_Mutation_p.L146I|TCF12_ENST00000452095.2_Missense_Mutation_p.L142I|TCF12_ENST00000438423.2_Missense_Mutation_p.L146I	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	146					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CCCAGCACAGCTATCTTCTTC	0.473			T	TEC	extraskeletal myxoid chondrosarcoma																																p.L146I		Atlas-SNP	.		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	.	TCF12	242	.	0			c.C436A						PASS	.						93.0	94.0	94.0					15																	57484401		2192	4292	6484	SO:0001583	missense	6938	exon7			GCACAGCTATCTT	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.436C>A	chr15.hg19:g.57484401C>A	ENSP00000267811:p.Leu146Ile	47.0	0.0	.		35.0	13.0	.	NM_207036	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	ENST00000267811.5	hg19	CCDS10159.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309405	0.40895	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.57	2.22	0.28083	.	0.065136	0.64402	D	0.000010	T	0.55321	0.1913	L	0.41356	1.27	0.36082	D	0.842877	D;P;P;P	0.58268	0.982;0.587;0.478;0.612	D;B;B;B	0.67548	0.952;0.177;0.069;0.144	T	0.57556	-0.7791	10	0.27082	T	0.32	-7.5425	7.2908	0.26364	0.1392:0.6718:0.0:0.189	.	142;198;146;146	E9PGY0;F5H6Z6;Q99081;Q99081-3	.;.;HTF4_HUMAN;.	I	198;146;146;142;146	ENSP00000267811:L146I;ENSP00000388940:L146I;ENSP00000396881:L142I;ENSP00000331057:L146I	ENSP00000267811:L146I	L	+	1	2	TCF12	55271693	0.994000	0.37717	0.998000	0.56505	0.986000	0.74619	0.554000	0.23407	0.689000	0.31550	0.561000	0.74099	CTA	.	.	.	none		0.473	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205	
CLCN7	1186	hgsc.bcm.edu	37	16	1507707	1507707	+	Silent	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr16:1507707C>T	ENST00000382745.4	-	8	1331	c.726G>A	c.(724-726)ctG>ctA	p.L242L	CLCN7_ENST00000448525.1_Silent_p.L218L|CLCN7_ENST00000262318.8_Silent_p.L218L	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	242					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				TTCCCACGGCCAGGCCCCCGA	0.632																																					p.L242L		Atlas-SNP	.											.	CLCN7	53	.	0			c.G726A						PASS	.						79.0	71.0	74.0					16																	1507707		2199	4300	6499	SO:0001819	synonymous_variant	1186	exon8			CACGGCCAGGCCC	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.726G>A	chr16.hg19:g.1507707C>T		21.0	0.0	.		26.0	19.0	.	NM_001287	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Silent	SNP	ENST00000382745.4	hg19	CCDS32361.1																																																																																			.	.	.	none		0.632	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
TSC2	7249	hgsc.bcm.edu	37	16	2098730	2098730	+	Silent	SNP	T	T	C	rs397515078		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr16:2098730T>C	ENST00000219476.3	+	2	744	c.114T>C	c.(112-114)ttT>ttC	p.F38F	TSC2_ENST00000353929.4_Silent_p.F38F|TSC2_ENST00000350773.4_Silent_p.F38F|TSC2_ENST00000401874.2_Silent_p.F38F|TSC2_ENST00000382538.6_Intron|TSC2_ENST00000568454.1_Silent_p.F49F|TSC2_ENST00000439673.2_Silent_p.F38F|NTHL1_ENST00000219066.1_5'Flank	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	38	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				AGACGGAGTTTATCATCACCG	0.498			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.F38F		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.T114C	GRCh37	CD090959	TSC2	D	rs137854355	PASS	.						174.0	145.0	155.0					16																	2098730		2198	4299	6497	SO:0001819	synonymous_variant	7249	exon2	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GGAGTTTATCATC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.114T>C	chr16.hg19:g.2098730T>C		76.0	0.0	.		77.0	18.0	.	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	hg19	CCDS10458.1																																																																																			.	.	.	none		0.498	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
SRRM2	23524	hgsc.bcm.edu	37	16	2814755	2814755	+	Missense_Mutation	SNP	C	C	T	rs141353583		TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr16:2814755C>T	ENST00000301740.8	+	11	4775	c.4226C>T	c.(4225-4227)gCt>gTt	p.A1409V		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1409	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GTGCTTGATGCTGTACCCAGA	0.478																																					p.A1409V		Atlas-SNP	.											.	SRRM2	263	.	0			c.C4226T						PASS	.						202.0	198.0	199.0					16																	2814755		2198	4300	6498	SO:0001583	missense	23524	exon11			TTGATGCTGTACC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4226C>T	chr16.hg19:g.2814755C>T	ENSP00000301740:p.Ala1409Val	30.0	0.0	.		42.0	10.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	6.871	0.530146	0.13127	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.25749	1.78	6.17	2.93	0.34026	.	0.538685	0.18243	N	0.147187	T	0.12347	0.0300	N	0.14661	0.345	0.22050	N	0.999392	B	0.09022	0.002	B	0.04013	0.001	T	0.24154	-1.0168	10	0.22109	T	0.4	-3.2971	5.9401	0.19187	0.118:0.5991:0.2041:0.0788	.	1409	Q9UQ35	SRRM2_HUMAN	V	1409;1409;661	ENSP00000301740:A1409V	ENSP00000301740:A1409V	A	+	2	0	SRRM2	2754756	0.061000	0.20836	0.898000	0.35279	0.656000	0.38851	0.077000	0.14738	0.920000	0.36970	-0.136000	0.14681	GCT	.	C|1.000;A|0.000	.	alt		0.478	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
GTF3C1	2975	hgsc.bcm.edu	37	16	27480845	27480845	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr16:27480845T>C	ENST00000356183.4	-	32	4856	c.4841A>G	c.(4840-4842)gAt>gGt	p.D1614G	GTF3C1_ENST00000561623.1_Missense_Mutation_p.D1614G	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1614	Asp/Glu-rich (acidic).				5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						ATCCTCGTCATCCTCCAGGCT	0.587																																					p.D1614G		Atlas-SNP	.											.	GTF3C1	210	.	0			c.A4841G						PASS	.						168.0	145.0	153.0					16																	27480845		2197	4300	6497	SO:0001583	missense	2975	exon32			TCGTCATCCTCCA	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4841A>G	chr16.hg19:g.27480845T>C	ENSP00000348510:p.Asp1614Gly	92.0	0.0	.		111.0	33.0	.	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	hg19	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	12.98	2.100315	0.37048	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.30981	1.51	4.7	4.7	0.59300	.	0.225071	0.37906	N	0.001883	T	0.29749	0.0743	L	0.34521	1.04	0.42457	D	0.992774	P;P	0.42692	0.605;0.787	B;P	0.46585	0.26;0.521	T	0.03384	-1.1042	10	0.21540	T	0.41	-9.7129	13.8623	0.63569	0.0:0.0:0.0:1.0	.	1614;1614	Q12789;Q12789-3	TF3C1_HUMAN;.	G	1614;1610	ENSP00000348510:D1614G	ENSP00000348510:D1614G	D	-	2	0	GTF3C1	27388346	1.000000	0.71417	0.324000	0.25361	0.042000	0.13812	7.485000	0.81204	1.757000	0.51966	0.402000	0.26972	GAT	.	.	.	none		0.587	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
NLGN2	57555	hgsc.bcm.edu	37	17	7317791	7317791	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr17:7317791A>C	ENST00000302926.2	+	3	710	c.637A>C	c.(637-639)Aac>Cac	p.N213H	NLGN2_ENST00000575301.1_Missense_Mutation_p.N213H	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	213					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				AGCCACGCTCAACTACCGTCT	0.622																																					p.N213H		Atlas-SNP	.											.	NLGN2	61	.	0			c.A637C						PASS	.						105.0	91.0	95.0					17																	7317791		2203	4300	6503	SO:0001583	missense	57555	exon3			ACGCTCAACTACC	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.637A>C	chr17.hg19:g.7317791A>C	ENSP00000305288:p.Asn213His	44.0	0.0	.		39.0	17.0	.	NM_020795	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	hg19	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	A	17.81	3.481491	0.63849	.	.	ENSG00000169992	ENST00000302926	T	0.65178	-0.14	4.69	4.69	0.59074	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.83133	0.5188	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.87417	0.2379	10	0.87932	D	0	.	12.1593	0.54096	1.0:0.0:0.0:0.0	.	213	Q8NFZ4	NLGN2_HUMAN	H	213	ENSP00000305288:N213H	ENSP00000305288:N213H	N	+	1	0	NLGN2	7258515	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.079000	0.94032	1.989000	0.58080	0.379000	0.24179	AAC	.	.	.	none		0.622	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	
NEUROD2	4761	hgsc.bcm.edu	37	17	37762540	37762540	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr17:37762540C>A	ENST00000302584.4	-	2	533	c.313G>T	c.(313-315)Ggg>Tgg	p.G105W		NM_006160.3	NP_006151.3	Q15784	NDF2_HUMAN	neuronal differentiation 2	105					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|cellular response to calcium ion (GO:0071277)|cellular response to electrical stimulus (GO:0071257)|cerebellar cortex development (GO:0021695)|negative regulation of synapse maturation (GO:2000297)|nervous system development (GO:0007399)|neuron development (GO:0048666)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Lung(15;0.00549)|LUAD - Lung adenocarcinoma(14;0.0664)			TTCTTGGGCCCGCGCTTCTTG	0.667																																					p.G105W		Atlas-SNP	.											.	NEUROD2	21	.	0			c.G313T						PASS	.						33.0	27.0	29.0					17																	37762540		2203	4300	6503	SO:0001583	missense	4761	exon2			TGGGCCCGCGCTT	U58681	CCDS11338.1	17q12	2013-05-21	2012-02-22		ENSG00000171532	ENSG00000171532		"""Basic helix-loop-helix proteins"""	7763	protein-coding gene	gene with protein product		601725	"""neurogenic differentiation 2"""			9119405	Standard	XM_005257409		Approved	NDRF, bHLHa1	uc002hry.3	Q15784	OTTHUMG00000133211	ENST00000302584.4:c.313G>T	chr17.hg19:g.37762540C>A	ENSP00000306754:p.Gly105Trp	38.0	0.0	.		43.0	17.0	.	NM_006160	Q8TBI7|Q9UQC6	Missense_Mutation	SNP	ENST00000302584.4	hg19	CCDS11338.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995471	0.74703	.	.	ENSG00000171532	ENST00000302584	D	0.97378	-4.36	5.25	5.25	0.73442	.	0.000000	0.85682	U	0.000000	D	0.98124	0.9381	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99331	1.0909	10	0.87932	D	0	-5.6865	17.6108	0.88053	0.0:1.0:0.0:0.0	.	105	Q15784	NDF2_HUMAN	W	105	ENSP00000306754:G105W	ENSP00000306754:G105W	G	-	1	0	NEUROD2	35016066	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.661000	0.83786	2.451000	0.82905	0.511000	0.50034	GGG	.	.	.	none		0.667	NEUROD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256931.2	NM_006160	
UBTF	7343	hgsc.bcm.edu	37	17	42288679	42288679	+	Silent	SNP	C	C	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr17:42288679C>A	ENST00000302904.4	-	11	1560	c.1068G>T	c.(1066-1068)gtG>gtT	p.V356V	UBTF_ENST00000526094.1_Silent_p.V319V|UBTF_ENST00000436088.1_Silent_p.V356V|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000533177.1_Silent_p.V319V|UBTF_ENST00000529383.1_Silent_p.V356V|UBTF_ENST00000343638.5_Silent_p.V319V|UBTF_ENST00000393606.3_Silent_p.V319V|UBTF_ENST00000527034.1_Silent_p.V319V			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	356					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GGAGCAGCTCCACCTCGTAAT	0.567																																					p.V356V		Atlas-SNP	.											.	UBTF	65	.	0			c.G1068T						PASS	.						79.0	68.0	72.0					17																	42288679		2203	4300	6503	SO:0001819	synonymous_variant	7343	exon11			CAGCTCCACCTCG	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1068G>T	chr17.hg19:g.42288679C>A		40.0	0.0	.		32.0	12.0	.	NM_014233	A8K6R8	Silent	SNP	ENST00000302904.4	hg19	CCDS11480.1																																																																																			.	.	.	none		0.567	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	
C17orf104	284071	hgsc.bcm.edu	37	17	42750780	42750780	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr17:42750780T>G	ENST00000409122.2	+	7	2646	c.2504T>G	c.(2503-2505)cTt>cGt	p.L835R	RP11-1072C15.4_ENST00000591628.1_RNA	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	835										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						AGTTCTCTTCTTCATGCCAGT	0.388																																					p.L835R		Atlas-SNP	.											.	C17orf104	75	.	0			c.T2504G						PASS	.						226.0	189.0	201.0					17																	42750780		692	1591	2283	SO:0001583	missense	284071	exon7			CTCTTCTTCATGC		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.2504T>G	chr17.hg19:g.42750780T>G	ENSP00000386452:p.Leu835Arg	109.0	0.0	.		93.0	37.0	.	NM_001145080	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	ENST00000409122.2	hg19	CCDS45703.2	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416623	0.83449	.	.	ENSG00000180336	ENST00000409122	T	0.39229	1.09	5.67	5.67	0.87782	.	.	.	.	.	T	0.51856	0.1699	L	0.38175	1.15	0.80722	D	1	D	0.54397	0.966	P	0.58970	0.849	T	0.54649	-0.8262	9	0.87932	D	0	-18.7971	15.9161	0.79521	0.0:0.0:0.0:1.0	.	835	A2RUB1	CQ104_HUMAN	R	835	ENSP00000386452:L835R	ENSP00000386452:L835R	L	+	2	0	C17orf104	40106306	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.948000	0.75965	2.171000	0.68590	0.528000	0.53228	CTT	.	.	.	none		0.388	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080	
MUC16	94025	hgsc.bcm.edu	37	19	9074934	9074934	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr19:9074934G>C	ENST00000397910.4	-	3	12715	c.12512C>G	c.(12511-12513)cCt>cGt	p.P4171R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4173	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AATATTGGAAGGCGAGGTTGT	0.512																																					p.P4171R		Atlas-SNP	.											.	MUC16	4315	.	0			c.C12512G						PASS	.						157.0	145.0	149.0					19																	9074934		1973	4162	6135	SO:0001583	missense	94025	exon3			TTGGAAGGCGAGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12512C>G	chr19.hg19:g.9074934G>C	ENSP00000381008:p.Pro4171Arg	97.0	0.0	.		96.0	35.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.519	0.280650	0.10458	.	.	ENSG00000181143	ENST00000397910	T	0.25250	1.81	1.49	1.49	0.22878	.	.	.	.	.	T	0.30417	0.0764	L	0.43152	1.355	.	.	.	D	0.65815	0.995	P	0.55011	0.766	T	0.40683	-0.9550	8	0.87932	D	0	.	6.41	0.21686	0.0:0.0:1.0:0.0	.	4171	B5ME49	.	R	4171	ENSP00000381008:P4171R	ENSP00000381008:P4171R	P	-	2	0	MUC16	8935934	0.002000	0.14202	0.001000	0.08648	0.416000	0.31233	1.136000	0.31467	1.138000	0.42230	0.313000	0.20887	CCT	.	.	.	none		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ANO8	57719	hgsc.bcm.edu	37	19	17438617	17438617	+	Silent	SNP	G	G	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr19:17438617G>A	ENST00000159087.4	-	14	2457	c.2299C>T	c.(2299-2301)Ctg>Ttg	p.L767L		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	767					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						AGCGCCGCCAGGGGGAAGGCG	0.652																																					p.L767L		Atlas-SNP	.											.	ANO8	67	.	0			c.C2299T						PASS	.						112.0	102.0	105.0					19																	17438617		2203	4300	6503	SO:0001819	synonymous_variant	57719	exon14			CCGCCAGGGGGAA	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.2299C>T	chr19.hg19:g.17438617G>A		98.0	0.0	.		86.0	34.0	.	NM_020959	A6NIJ0	Silent	SNP	ENST00000159087.4	hg19	CCDS32949.1																																																																																			.	.	.	none		0.652	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41774184	41774184	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr19:41774184C>T	ENST00000392006.3	+	2	525	c.352C>T	c.(352-354)Caa>Taa	p.Q118*	HNRNPUL1_ENST00000352456.3_Nonsense_Mutation_p.Q18*|HNRNPUL1_ENST00000263367.3_Nonsense_Mutation_p.Q29*|HNRNPUL1_ENST00000594207.1_3'UTR|HNRNPUL1_ENST00000593587.1_Nonsense_Mutation_p.Q18*|HNRNPUL1_ENST00000602130.1_Nonsense_Mutation_p.Q118*|HNRNPUL1_ENST00000378215.4_Nonsense_Mutation_p.Q75*|HNRNPUL1_ENST00000595018.1_Nonsense_Mutation_p.Q18*	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	118					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						AGTCATCAAACAAGAAAACGA	0.443																																					p.Q118X		Atlas-SNP	.											.	HNRNPUL1	73	.	0			c.C352T						PASS	.						127.0	99.0	108.0					19																	41774184		2203	4300	6503	SO:0001587	stop_gained	11100	exon2			ATCAAACAAGAAA	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.352C>T	chr19.hg19:g.41774184C>T	ENSP00000375863:p.Gln118*	64.0	0.0	.		52.0	24.0	.	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Nonsense_Mutation	SNP	ENST00000392006.3	hg19	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	37	6.423845	0.97555	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	.	.	.	5.11	4.07	0.47477	.	0.259681	0.37437	N	0.002091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-6.0125	11.2434	0.48982	0.1822:0.8178:0.0:0.0	.	.	.	.	X	18;118;75;29	.	ENSP00000263367:Q29X	Q	+	1	0	HNRNPUL1	46466024	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	2.263000	0.43293	1.524000	0.49035	0.655000	0.94253	CAA	.	.	.	none		0.443	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
SRRM5	100170229	hgsc.bcm.edu	37	19	44117767	44117767	+	Silent	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr19:44117767A>G	ENST00000607544.1	+	3	1816	c.1494A>G	c.(1492-1494)agA>agG	p.R498R	SRRM5_ENST00000526798.1_Silent_p.R513R|ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Silent_p.R498R			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	498	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						GAGATCACAGACGATCTAGAA	0.527																																					p.R498R		Atlas-SNP	.											.	SRRM5	38	.	0			c.A1494G						PASS	.						88.0	91.0	90.0					19																	44117767		692	1591	2283	SO:0001819	synonymous_variant	100170229	exon1			TCACAGACGATCT	AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1494A>G	chr19.hg19:g.44117767A>G		19.0	0.0	.		17.0	7.0	.	NM_001145641	B4DNF0	Silent	SNP	ENST00000607544.1	hg19	CCDS46095.1																																																																																			.	.	.	none		0.527	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000384398.2	NM_001145641	
FKRP	79147	hgsc.bcm.edu	37	19	47260096	47260096	+	Silent	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr19:47260096C>T	ENST00000318584.5	+	4	1686	c.1389C>T	c.(1387-1389)aaC>aaT	p.N463N	FKRP_ENST00000600646.1_Intron|FKRP_ENST00000391909.3_Silent_p.N463N	NM_001039885.2|NM_024301.4	NP_001034974.1|NP_077277.1	Q9H9S5	FKRP_HUMAN	fukutin related protein	463			N -> D (in MDDGB5). {ECO:0000269|PubMed:17336067}.		glycoprotein biosynthetic process (GO:0009101)|protein processing (GO:0016485)	dystrophin-associated glycoprotein complex (GO:0016010)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)	transferase activity (GO:0016740)			NS(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_epithelial(76;5.08e-05)|Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000541)|all cancers(93;0.00128)|Epithelial(262;0.0207)|GBM - Glioblastoma multiforme(486;0.0336)		AGGCGCCTAACAACTACCGCC	0.657																																					p.N463N		Atlas-SNP	.											.	FKRP	16	.	0			c.C1389T						PASS	.						12.0	12.0	12.0					19																	47260096		2197	4282	6479	SO:0001819	synonymous_variant	79147	exon4			GCCTAACAACTAC	AJ314847	CCDS12691.1	19q13.32	2014-09-17			ENSG00000181027	ENSG00000181027			17997	protein-coding gene	gene with protein product		606596				11592034, 11741828	Standard	NM_024301		Approved	LGMD2I, MDC1C	uc002pfp.2	Q9H9S5		ENST00000318584.5:c.1389C>T	chr19.hg19:g.47260096C>T		33.0	0.0	.		26.0	15.0	.	NM_024301	A8K5G7	Silent	SNP	ENST00000318584.5	hg19	CCDS12691.1																																																																																			.	.	.	none		0.657	FKRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465473.1	NM_024301	
DBP	1628	hgsc.bcm.edu	37	19	49136867	49136867	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr19:49136867A>G	ENST00000222122.5	-	3	1039	c.596T>C	c.(595-597)gTg>gCg	p.V199A	DBP_ENST00000599385.1_5'UTR|DBP_ENST00000593500.1_5'UTR|DBP_ENST00000601104.1_Missense_Mutation_p.V199A	NM_001352.3	NP_001343.2	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box) binding protein	199	Pro-rich (proline/acidic region (PAR)).				liver development (GO:0001889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		CAACACCTCCACGGTGTCTGG	0.557																																					p.V199A		Atlas-SNP	.											.	DBP	16	.	0			c.T596C						PASS	.						146.0	129.0	135.0					19																	49136867		2203	4300	6503	SO:0001583	missense	1628	exon3			ACCTCCACGGTGT	U06936	CCDS12728.1	19q13.33	2013-09-20			ENSG00000105516	ENSG00000105516			2697	protein-coding gene	gene with protein product		124097				1535333, 7835883	Standard	XR_243907		Approved	DABP	uc002pjx.4	Q10586	OTTHUMG00000183319	ENST00000222122.5:c.596T>C	chr19.hg19:g.49136867A>G	ENSP00000222122:p.Val199Ala	73.0	0.0	.		51.0	19.0	.	NM_001352	A2I2P4	Missense_Mutation	SNP	ENST00000222122.5	hg19	CCDS12728.1	.	.	.	.	.	.	.	.	.	.	A	17.21	3.331769	0.60853	.	.	ENSG00000105516	ENST00000222122	.	.	.	5.11	5.11	0.69529	.	0.834711	0.10336	U	0.686922	T	0.49915	0.1585	L	0.49126	1.545	0.30737	N	0.746626	B	0.19935	0.04	B	0.19148	0.024	T	0.49908	-0.8889	9	0.41790	T	0.15	-24.4839	13.1676	0.59579	1.0:0.0:0.0:0.0	.	199	Q10586	DBP_HUMAN	A	199	.	ENSP00000222122:V199A	V	-	2	0	DBP	53828679	0.997000	0.39634	0.998000	0.56505	0.998000	0.95712	5.022000	0.64078	2.064000	0.61679	0.533000	0.62120	GTG	.	.	.	none		0.557	DBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466167.1	NM_001352	
FITM2	128486	hgsc.bcm.edu	37	20	42935653	42935653	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr20:42935653T>A	ENST00000396825.3	-	2	421	c.401A>T	c.(400-402)cAc>cTc	p.H134L		NM_001080472.1	NP_001073941.1	Q8N6M3	FITM2_HUMAN	fat storage-inducing transmembrane protein 2	134					cellular triglyceride homeostasis (GO:0035356)|cytoskeleton organization (GO:0007010)|lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of cell morphogenesis (GO:0022604)|regulation of triglyceride biosynthetic process (GO:0010866)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)				endometrium(2)|lung(2)|skin(2)	6						CTTGCTCTGGTGTTCCTTTCT	0.567																																					p.H134L		Atlas-SNP	.											.	FITM2	15	.	0			c.A401T						PASS	.						119.0	87.0	98.0					20																	42935653		2203	4300	6503	SO:0001583	missense	128486	exon2			CTCTGGTGTTCCT	BC029662	CCDS33473.1	20q13.12	2009-04-29	2009-04-29	2009-04-29	ENSG00000197296	ENSG00000197296			16135	protein-coding gene	gene with protein product	"""fat inducing transcript 2"""	612029	"""chromosome 20 open reading frame 142"""	C20orf142		18160536	Standard	NM_001080472		Approved	dJ881L22.2, FIT2	uc002xlr.1	Q8N6M3	OTTHUMG00000032522	ENST00000396825.3:c.401A>T	chr20.hg19:g.42935653T>A	ENSP00000380037:p.His134Leu	46.0	0.0	.		44.0	13.0	.	NM_001080472	A1L492|B9EGQ4|Q5TE59|Q9H3Y1	Missense_Mutation	SNP	ENST00000396825.3	hg19	CCDS33473.1	.	.	.	.	.	.	.	.	.	.	T	9.891	1.204219	0.22205	.	.	ENSG00000197296	ENST00000396825	.	.	.	5.84	-4.83	0.03161	.	0.696249	0.15653	N	0.251278	T	0.13884	0.0336	N	0.17082	0.46	0.09310	N	1	B	0.18013	0.025	B	0.18871	0.023	T	0.29305	-1.0016	9	0.11794	T	0.64	.	4.3673	0.11230	0.2017:0.0597:0.4168:0.3218	.	134	Q8N6M3	FITM2_HUMAN	L	134	.	ENSP00000380037:H134L	H	-	2	0	FITM2	42369067	0.000000	0.05858	0.002000	0.10522	0.762000	0.43233	-1.102000	0.03332	-0.380000	0.07894	0.533000	0.62120	CAC	.	.	.	none		0.567	FITM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079342.2	XM_371399	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47568002	47568002	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr20:47568002T>G	ENST00000371917.4	+	4	419	c.419T>G	c.(418-420)aTt>aGt	p.I140S		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	140	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TTACAAATAATTAAGGTATGC	0.423																																					p.I140S	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.T419G						PASS	.						90.0	93.0	92.0					20																	47568002		2203	4300	6503	SO:0001583	missense	10564	exon4			AAATAATTAAGGT	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.419T>G	chr20.hg19:g.47568002T>G	ENSP00000360985:p.Ile140Ser	58.0	0.0	.		86.0	22.0	.	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.289541	0.80914	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.31247	1.5	6.05	4.95	0.65309	Armadillo-type fold (1);	0.071289	0.85682	D	0.000000	T	0.57858	0.2082	M	0.88906	2.99	0.80722	D	1	D	0.67145	0.996	D	0.63703	0.917	T	0.64296	-0.6441	10	0.56958	D	0.05	.	11.9957	0.53201	0.0:0.0671:0.0:0.9329	.	140	Q9Y6D5	BIG2_HUMAN	S	140	ENSP00000360985:I140S	ENSP00000360985:I140S	I	+	2	0	ARFGEF2	47001409	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	1.118000	0.41863	0.528000	0.53228	ATT	.	.	.	none		0.423	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
HSPA13	6782	hgsc.bcm.edu	37	21	15746414	15746414	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr21:15746414C>T	ENST00000285667.3	-	5	1007	c.940G>A	c.(940-942)Gag>Aag	p.E314K	HSPA13_ENST00000544452.1_Missense_Mutation_p.E106K	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	314						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						TCCTGCTCCTCCACCGTTAGT	0.453																																					p.E314K		Atlas-SNP	.											.	HSPA13	44	.	0			c.G940A						PASS	.						116.0	89.0	98.0					21																	15746414		2203	4300	6503	SO:0001583	missense	6782	exon5			GCTCCTCCACCGT		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.940G>A	chr21.hg19:g.15746414C>T	ENSP00000285667:p.Glu314Lys	88.0	0.0	.		71.0	27.0	.	NM_006948	B2R616|Q8NE40	Missense_Mutation	SNP	ENST00000285667.3	hg19	CCDS13567.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.527733	0.27299	.	.	ENSG00000155304	ENST00000285667;ENST00000544452	T;T	0.00966	5.49;5.49	5.86	4.97	0.65823	.	0.638912	0.16716	N	0.202467	T	0.01320	0.0043	L	0.41415	1.275	0.09310	N	1	P	0.35226	0.491	B	0.34536	0.185	T	0.48854	-0.8998	10	0.87932	D	0	-14.9378	12.2841	0.54783	0.1155:0.7214:0.1631:0.0	.	314	P48723	HSP13_HUMAN	K	314;106	ENSP00000285667:E314K;ENSP00000441986:E106K	ENSP00000285667:E314K	E	-	1	0	HSPA13	14668285	1.000000	0.71417	0.890000	0.34922	0.117000	0.20001	2.613000	0.46351	1.598000	0.50083	0.650000	0.86243	GAG	.	.	.	none		0.453	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
CABIN1	23523	hgsc.bcm.edu	37	22	24480737	24480737	+	Splice_Site	SNP	A	A	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr22:24480737A>T	ENST00000398319.2	+	21	3501	c.3116A>T	c.(3115-3117)gAg>gTg	p.E1039V	CABIN1_ENST00000405822.2_Splice_Site_p.E989V|CABIN1_ENST00000263119.5_Splice_Site_p.E1039V	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1039					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						ACTTCAACTGAGGTGGGCCCA	0.547																																					p.E1039V		Atlas-SNP	.											.	CABIN1	153	.	0			c.A3116T						PASS	.						59.0	47.0	51.0					22																	24480737		2203	4300	6503	SO:0001630	splice_region_variant	23523	exon21			CAACTGAGGTGGG	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3117+1A>T	chr22.hg19:g.24480737A>T		72.0	0.0	.		64.0	29.0	.	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	hg19	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	A	16.41	3.115392	0.56505	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.65364	0.06;-0.15;0.06	5.56	5.56	0.83823	.	0.051340	0.85682	D	0.000000	T	0.57301	0.2044	L	0.34521	1.04	0.80722	D	1	P;P	0.45827	0.867;0.791	P;B	0.44897	0.463;0.273	T	0.61987	-0.6949	10	0.59425	D	0.04	.	15.2547	0.73576	1.0:0.0:0.0:0.0	.	989;1039	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	V	1039;989;1039	ENSP00000263119:E1039V;ENSP00000384694:E989V;ENSP00000381364:E1039V	ENSP00000263119:E1039V	E	+	2	0	CABIN1	22810737	1.000000	0.71417	0.993000	0.49108	0.260000	0.26232	8.121000	0.89582	2.259000	0.74868	0.529000	0.55759	GAG	.	.	.	none		0.547	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	Missense_Mutation
SMTN	6525	hgsc.bcm.edu	37	22	31487406	31487406	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr22:31487406A>C	ENST00000347557.2	+	10	1615	c.1397A>C	c.(1396-1398)aAg>aCg	p.K466T	SMTN_ENST00000358743.1_Missense_Mutation_p.K466T|SMTN_ENST00000333137.7_Missense_Mutation_p.K466T|SMTN_ENST00000404574.1_5'Flank	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	466					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						ATCGAGATCAAGGACGGCCGT	0.682																																					p.K522T		Atlas-SNP	.											.	SMTN	219	.	0			c.A1565C						PASS	.						22.0	26.0	25.0					22																	31487406		2050	4150	6200	SO:0001583	missense	6525	exon9			AGATCAAGGACGG	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.1397A>C	chr22.hg19:g.31487406A>C	ENSP00000328635:p.Lys466Thr	20.0	0.0	.		21.0	9.0	.	NM_001207018	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	hg19	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.494882	0.85069	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	T;T;T	0.76060	-0.55;-0.99;-0.99	5.07	5.07	0.68467	.	0.000000	0.36034	N	0.002826	D	0.84211	0.5422	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999;1.0	D;D;D;D;D;D	0.91635	0.997;0.996;0.991;0.997;0.991;0.999	D	0.86070	0.1537	10	0.87932	D	0	-35.7001	13.7041	0.62627	1.0:0.0:0.0:0.0	.	522;520;458;466;466;466	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	T	466;466;466;464;458	ENSP00000351593:K466T;ENSP00000328635:K466T;ENSP00000329532:K466T	ENSP00000329393:K464T	K	+	2	0	SMTN	29817406	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.535000	0.73838	2.049000	0.60858	0.402000	0.26972	AAG	.	.	.	none		0.682	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
MED12	9968	hgsc.bcm.edu	37	X	70355044	70355044	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chrX:70355044T>G	ENST00000374080.3	+	36	4998	c.4966T>G	c.(4966-4968)Tcc>Gcc	p.S1656A	MED12_ENST00000333646.6_Missense_Mutation_p.S1656A|MED12_ENST00000374102.1_Missense_Mutation_p.S1656A			Q93074	MED12_HUMAN	mediator complex subunit 12	1656	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GCCACAGGGCTCCCTTATCGA	0.557			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.S1656A		Atlas-SNP	.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	.	0			c.T4966G						PASS	.						84.0	80.0	81.0					X																	70355044		2105	4205	6310	SO:0001583	missense	9968	exon36			CAGGGCTCCCTTA	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4966T>G	chrX.hg19:g.70355044T>G	ENSP00000363193:p.Ser1656Ala	143.0	0.0	.		119.0	47.0	.	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	hg19	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	-	16.44	3.124037	0.56613	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	T;T;T;T;T	0.58652	0.33;0.32;0.32;0.33;1.37	3.97	3.97	0.46021	.	0.000000	0.85682	D	0.000000	T	0.60560	0.2278	L	0.34521	1.04	0.58432	D	0.999999	B;B;D;B	0.60160	0.383;0.342;0.987;0.264	B;B;P;B	0.61003	0.155;0.092;0.882;0.168	T	0.59257	-0.7488	10	0.36615	T	0.2	-13.3161	12.5429	0.56182	0.0:0.0:0.0:1.0	.	1656;1503;1656;1656	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	A	1656;1656;1656;1656;1624;401	ENSP00000333125:S1656A;ENSP00000363215:S1656A;ENSP00000363193:S1656A;ENSP00000414203:S1624A;ENSP00000408388:S401A	ENSP00000333125:S1656A	S	+	1	0	MED12	70271769	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.864000	0.87037	1.595000	0.50050	0.430000	0.28490	TCC	.	.	.	none		0.557	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
WDR44	54521	hgsc.bcm.edu	37	X	117526785	117526785	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chrX:117526785G>C	ENST00000254029.3	+	4	772	c.377G>C	c.(376-378)aGt>aCt	p.S126T	WDR44_ENST00000371825.3_Missense_Mutation_p.S126T|WDR44_ENST00000371822.5_Missense_Mutation_p.S101T|WDR44_ENST00000493448.1_3'UTR	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	126	Binding activity.					endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AAGGCAGAGAGTCAGAATACA	0.403																																					p.S126T		Atlas-SNP	.											.	WDR44	188	.	0			c.G377C						PASS	.						87.0	84.0	85.0					X																	117526785		2203	4300	6503	SO:0001583	missense	54521	exon4			CAGAGAGTCAGAA	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.377G>C	chrX.hg19:g.117526785G>C	ENSP00000254029:p.Ser126Thr	124.0	0.0	.		154.0	73.0	.	NM_001184965	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	hg19	CCDS14572.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.225|7.225	0.598130|0.598130	0.13939|0.13939	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371848|ENST00000371822;ENST00000254029;ENST00000371825	T|T;T;T	0.64803|0.73258	-0.12|-0.73;-0.15;-0.02	5.58|5.58	4.53|4.53	0.55603|0.55603	.|.	.|0.401797	.|0.29924	.|N	.|0.010857	T|T	0.48169|0.48169	0.1485|0.1485	N|N	0.14661|0.14661	0.345|0.345	0.19775|0.19775	N|N	0.999955|0.999955	.|B;B;B	.|0.09022	.|0.002;0.001;0.002	.|B;B;B	.|0.11329	.|0.006;0.002;0.002	T|T	0.21793|0.21793	-1.0235|-1.0235	7|10	0.18710|0.12430	T|T	0.47|0.62	-15.6424|-15.6424	8.5425|8.5425	0.33402|0.33402	0.2406:0.0:0.7594:0.0|0.2406:0.0:0.7594:0.0	.|.	.|101;126;126	.|F8W913;Q5JSH3-2;Q5JSH3	.|.;.;WDR44_HUMAN	D|T	25|101;126;126	ENSP00000360914:E25D|ENSP00000360887:S101T;ENSP00000254029:S126T;ENSP00000360890:S126T	ENSP00000360914:E25D|ENSP00000254029:S126T	E|S	+|+	3|2	2|0	WDR44|WDR44	117410813|117410813	0.461000|0.461000	0.25783|0.25783	0.998000|0.998000	0.56505|0.56505	0.467000|0.467000	0.32768|0.32768	0.667000|0.667000	0.25112|0.25112	2.333000|2.333000	0.79357|0.79357	0.600000|0.600000	0.82982|0.82982	GAG|AGT	.	.	.	none		0.403	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
G6PD	2539	hgsc.bcm.edu	37	X	153770658	153770658	+	Intron	SNP	G	G	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chrX:153770658G>T	ENST00000393564.2	-	2	233				IKBKG_ENST00000369607.1_Intron|IKBKG_ENST00000369609.5_Missense_Mutation_p.W60C|G6PD_ENST00000369620.2_Intron|G6PD_ENST00000497281.1_Intron|G6PD_ENST00000393562.2_Intron	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase						carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GAGCTTTCTGGAAGGGGGCAG	0.582																																					p.W60C		Atlas-SNP	.											.	IKBKG	17	.	0			c.G180T						PASS	.						56.0	48.0	50.0					X																	153770658		1568	3582	5150	SO:0001627	intron_variant	8517	exon1			TTTCTGGAAGGGG	X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.120+3592C>A	chrX.hg19:g.153770658G>T		53.0	0.0	.		44.0	21.0	.	NM_001099856	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	hg19	CCDS44023.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.593948	0.28445	.	.	ENSG00000073009	ENST00000369609	D	0.91843	-2.92	2.6	1.67	0.24075	.	.	.	.	.	D	0.87414	0.6171	.	.	.	0.09310	N	0.999993	P	0.44006	0.824	B	0.40285	0.325	T	0.79147	-0.1923	8	0.87932	D	0	.	5.8132	0.18477	0.0:0.0:0.6857:0.3143	.	60	Q9Y6K9-2	.	C	60	ENSP00000358622:W60C	ENSP00000358622:W60C	W	+	3	0	IKBKG	153423852	0.002000	0.14202	0.002000	0.10522	0.556000	0.35491	0.859000	0.27858	0.481000	0.27557	0.483000	0.47432	TGG	.	.	.	none		0.582	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402	
MT-CO1	4512	hgsc.bcm.edu	37	M	6685	6685	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chrM:6685A>G	ENST00000361624.2	+	1	782	c.782A>G	c.(781-783)tAc>tGc	p.Y261C	MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	261					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TGTAACTTACTACTCCGGAAA	0.388																																					p.Y261C		Atlas-SNP	.											.	.	.	.	0			c.A782G						PASS	.																																			SO:0001583	missense	5742	exon1			CTTACTACTCCGG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.782A>G	chrM.hg19:g.6685A>G	ENSP00000354499:p.Tyr261Cys	4.0	0.0	.		188.0	12.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.388	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND4	4538	hgsc.bcm.edu	37	M	11869	11869	+	Silent	SNP	C	C	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chrM:11869C>T	ENST00000361381.2	+	1	1110	c.1110C>T	c.(1108-1110)ccC>ccT	p.P370P	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	370					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CTCGCCTTACCCCCCACTATT	0.448																																					p.P370P		Atlas-SNP	.											.	.	.	.	0			c.C1110T						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CTTACCCCCCACT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.1110C>T	chrM.hg19:g.11869C>T		3.0	0.0	.		204.0	138.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Silent	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.448	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
CLIC6	54102	hgsc.bcm.edu	37	21	36080328	36080329	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr21:36080328_36080329delAG	ENST00000360731.3	+	4	1625_1626	c.1625_1626delAG	c.(1624-1626)aagfs	p.K542fs	CLIC6_ENST00000349499.2_Frame_Shift_Del_p.K524fs			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	542						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						GATGTGAATAAGATCGAGGAGT	0.485																																					p.524_524del		Atlas-Indel,Pindel	.											.	CLIC6	49	.	0			c.1570_1571del						PASS	.																																			SO:0001589	frameshift_variant	54102	exon3			.	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.1625_1626delAG	chr21.hg19:g.36080328_36080329delAG	ENSP00000353959:p.Lys542fs	52.0	0.0	0		61.0	23.0	0.377049	NM_053277	A8K0U8|Q8IX31	Frame_Shift_Del	DEL	ENST00000360731.3	hg19																																																																																				.	.	.	none		0.485	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
TFR2	7036	hgsc.bcm.edu	37	7	100238810	100238819	+	Frame_Shift_Del	DEL	ACGCTGGTAG	ACGCTGGTAG	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	ACGCTGGTAG	ACGCTGGTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr7:100238810_100238819delACGCTGGTAG	ENST00000462107.1	-	3	353_362	c.66_75delCTACCAGCGT	c.(64-75)gtctaccagcgtfs	p.VYQR22fs	TFR2_ENST00000223051.3_Frame_Shift_Del_p.VYQR22fs|TFR2_ENST00000431692.1_Frame_Shift_Del_p.VYQR22fs			Q9UP52	TFR2_HUMAN	transferrin receptor 2	22			V -> I (in HFE3). {ECO:0000269|PubMed:14633868}.		cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)	p.R25H(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GGCCTTCCACACGCTGGTAGACGGTCTGAG	0.638																																					p.23_26del		Atlas-Indel,Pindel	.											.	TFR2	53	.	1	Substitution - Missense(1)	large_intestine(1)	c.67_76del						PASS	.																																			SO:0001589	frameshift_variant	7036	exon2			.	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.66_75delCTACCAGCGT	chr7.hg19:g.100238810_100238819delACGCTGGTAG	ENSP00000420525:p.Val22fs	28.0	0.0	0		28.0	10.0	0.357143	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Frame_Shift_Del	DEL	ENST00000462107.1	hg19	CCDS34707.1																																																																																			.	.	.	none		0.638	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
CCBL2	56267	hgsc.bcm.edu	37	1	89409051	89409051	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:89409051delT	ENST00000260508.4	-	12	1534	c.1197delA	c.(1195-1197)aaafs	p.K399fs	CCBL2_ENST00000370491.3_Frame_Shift_Del_p.K365fs|CCBL2_ENST00000370485.2_3'UTR|CCBL2_ENST00000446900.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	399					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		TAGTCATCCATTTCACAAACT	0.308																																					p.W400fs		Atlas-INDEL	.											.	CCBL2	138	.	0			c.1198delT						PASS	.						99.0	99.0	99.0					1																	89409051		2203	4300	6503	SO:0001589	frameshift_variant	56267	exon12			.	AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.1197delA	chr1.hg19:g.89409051delT	ENSP00000260508:p.Lys399fs	195.0	0.0	0		196.0	69.0	0.352041	NM_001008661	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Frame_Shift_Del	DEL	ENST00000260508.4	hg19	CCDS30766.1																																																																																			.	.	.	none		0.308	CCBL2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000029300.3	NM_001008661	
MT1H	4496	hgsc.bcm.edu	37	16	56704825	56704826	+	Frame_Shift_Ins	INS	-	-	C			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr16:56704825_56704826insC	ENST00000332374.4	+	3	181_182	c.110_111insC	c.(109-114)tgccccfs	p.CP37fs	MT1G_ENST00000444837.2_5'Flank|MT1H_ENST00000569155.1_3'UTR|MT1G_ENST00000379811.3_5'Flank|MT1G_ENST00000569500.1_5'Flank|MT1G_ENST00000568675.1_5'Flank	NM_005951.2	NP_005942.1	P80294	MT1H_HUMAN	metallothionein 1H	37	Alpha.				cellular response to cadmium ion (GO:0071276)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			lung(5)	5						TGCTCCTGTTGCCCCCTGGGCT	0.609																																					p.C37fs		Atlas-Indel,Pindel	.											.	MT1H	19	.	0			c.110_111insC						PASS	.																																			SO:0001589	frameshift_variant	4496	exon3			.	BC008408	CCDS10767.1	16q13	2008-02-05			ENSG00000205358	ENSG00000205358		"""Metallothioneins"""	7400	protein-coding gene	gene with protein product		156354		MT1		2286373, 8049263	Standard	NM_005951		Approved		uc002ejw.3	P80294	OTTHUMG00000133283	ENST00000332374.4:c.115dupC	chr16.hg19:g.56704830_56704830dupC	ENSP00000330587:p.Cys37fs	101.0	0.0	0		119.0	53.0	0.445378	NM_005951	B2RUY6	Frame_Shift_Ins	INS	ENST00000332374.4	hg19	CCDS10767.1																																																																																			.	.	.	none		0.609	MT1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257063.1	NM_005951	
ZNF749	388567	hgsc.bcm.edu	37	19	57956719	57956719	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr19:57956719delA	ENST00000334181.4	+	3	2453	c.2203delA	c.(2203-2205)aaafs	p.K735fs	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	735					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGACTTCAACAAATGTAATAC	0.393																																					p.N734fs		Atlas-Indel,Pindel	.											.	ZNF749	75	.	0			c.2202delC						PASS	.						106.0	109.0	108.0					19																	57956719		2203	4300	6503	SO:0001589	frameshift_variant	388567	exon3			.	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.2203delA	chr19.hg19:g.57956719delA	ENSP00000333980:p.Lys735fs	67.0	0.0	0		59.0	27.0	0.457627	NM_001023561		Frame_Shift_Del	DEL	ENST00000334181.4	hg19	CCDS33132.2																																																																																			.	.	.	none		0.393	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
TAF3	83860	hgsc.bcm.edu	37	10	8006138	8006138	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr10:8006138delA	ENST00000344293.5	+	3	871	c.665delA	c.(664-666)caafs	p.Q222fs		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	222					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						ATAAATACTCAAAAGATCCCA	0.507																																					p.Q222fs		Atlas-Indel,Pindel	.											.	TAF3	93	.	0			c.664delC						PASS	.						86.0	88.0	87.0					10																	8006138		1952	4142	6094	SO:0001589	frameshift_variant	83860	exon3			.	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.665delA	chr10.hg19:g.8006138delA	ENSP00000340271:p.Gln222fs	74.0	0.0	0		95.0	43.0	0.452632	NM_031923	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Frame_Shift_Del	DEL	ENST00000344293.5	hg19	CCDS41487.1																																																																																			.	.	.	none		0.507	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
MYF6	4618	hgsc.bcm.edu	37	12	81102003	81102003	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr12:81102003delC	ENST00000228641.3	+	1	727	c.505delC	c.(505-507)cccfs	p.P169fs		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	169				P -> S (in Ref. 3; CAG46563). {ECO:0000305}.	muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						CAGCTACAGACCCAAACAAGA	0.577																																					p.R168fs		Atlas-Indel,Pindel	.											.	MYF6	74	.	0			c.504delA						PASS	.						32.0	36.0	35.0					12																	81102003		2201	4297	6498	SO:0001589	frameshift_variant	4618	exon1			.		CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.505delC	chr12.hg19:g.81102003delC	ENSP00000228641:p.Pro169fs	19.0	0.0	0		19.0	12.0	0.631579	NM_002469	B2R898|Q53X80|Q6FHI9	Frame_Shift_Del	DEL	ENST00000228641.3	hg19	CCDS9019.1																																																																																			.	.	.	none		0.577	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1	NM_002469	
WDR44	54521	hgsc.bcm.edu	37	X	117526809	117526809	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chrX:117526809delA	ENST00000254029.3	+	4	796	c.401delA	c.(400-402)gaafs	p.E134fs	WDR44_ENST00000371825.3_Frame_Shift_Del_p.E134fs|WDR44_ENST00000371822.5_Frame_Shift_Del_p.E109fs|WDR44_ENST00000493448.1_3'UTR	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	134	Binding activity.					endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						GAAGAGACTGAATTAGAATTA	0.383																																					p.E134fs		Atlas-Indel,Pindel	.											.	WDR44	188	.	0			c.400delG						PASS	.						85.0	83.0	84.0					X																	117526809		2203	4300	6503	SO:0001589	frameshift_variant	54521	exon4			.	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.401delA	chrX.hg19:g.117526809delA	ENSP00000254029:p.Glu134fs	118.0	0.0	0		131.0	64.0	0.48855	NM_001184965	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Frame_Shift_Del	DEL	ENST00000254029.3	hg19	CCDS14572.1																																																																																			.	.	.	none		0.383	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
NOX3	50508	hgsc.bcm.edu	37	6	155776915	155776915	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:155776915delA	ENST00000159060.2	-	1	122	c.20delT	c.(19-21)ttgfs	p.L7fs		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	7					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		ACCCTCATTCAAAATCCAGCA	0.378																																					p.L7fs		Atlas-Indel,Pindel	.											.	NOX3	93	.	0			c.21delG						PASS	.						96.0	91.0	93.0					6																	155776915		2203	4300	6503	SO:0001589	frameshift_variant	50508	exon1			.	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.20delT	chr6.hg19:g.155776915delA	ENSP00000159060:p.Leu7fs	175.0	0.0	0		134.0	74.0	0.552239	NM_015718	Q9HBJ9	Frame_Shift_Del	DEL	ENST00000159060.2	hg19	CCDS5250.1																																																																																			.	.	.	none		0.378	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
PAPSS2	9060	hgsc.bcm.edu	37	10	89474565	89474566	+	Frame_Shift_Ins	INS	-	-	T			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr10:89474565_89474566insT	ENST00000361175.4	+	5	953_954	c.584_585insT	c.(583-588)aatttgfs	p.L196fs	PAPSS2_ENST00000456849.1_Frame_Shift_Ins_p.L196fs|PAPSS2_ENST00000427144.2_Frame_Shift_Ins_p.L200fs	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	196					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		CTTAAAACCAATTTGTCCACAG	0.401																																					p.N195fs		Atlas-Indel,Pindel	.											.	PAPSS2	46	.	0			c.584_585insT						PASS	.																																			SO:0001589	frameshift_variant	9060	exon5			.	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.587dupT	chr10.hg19:g.89474568_89474568dupT	ENSP00000354436:p.Leu196fs	100.0	0.0	0		96.0	31.0	0.322917	NM_001015880	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Frame_Shift_Ins	INS	ENST00000361175.4	hg19	CCDS7385.1																																																																																			.	.	.	none		0.401	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1		
AGPAT5	55326	hgsc.bcm.edu	37	8	6590118	6590118	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr8:6590118delA	ENST00000285518.6	+	4	754	c.442delA	c.(442-444)aacfs	p.N148fs		NM_018361.3	NP_060831.2	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	148					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		AGPAT5/MCPH1(2)	endometrium(2)|kidney(2)|large_intestine(4)|lung(3)	11			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		TGCCAAATTTAACGAGAAAGA	0.418																																					p.F147fs		Atlas-Indel,Pindel	.											.	AGPAT5	31	.	0			c.441delT						PASS	.						67.0	66.0	66.0					8																	6590118		2203	4300	6503	SO:0001589	frameshift_variant	55326	exon4			.	AF375789	CCDS34796.1	8p23.1	2013-02-05	2013-02-05		ENSG00000155189	ENSG00000155189	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20886	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, epsilon"""	614796	"""1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)"""				Standard	NM_018361		Approved	FLJ11210, LPAAT-e, LPAAT-epsilon	uc003wqo.3	Q9NUQ2	OTTHUMG00000163656	ENST00000285518.6:c.442delA	chr8.hg19:g.6590118delA	ENSP00000285518:p.Asn148fs	271.0	0.0	0		280.0	128.0	0.457143	NM_018361	Q8IZ47|Q9BQG4	Frame_Shift_Del	DEL	ENST00000285518.6	hg19	CCDS34796.1																																																																																			.	.	.	none		0.418	AGPAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374684.1	NM_018361	
CEP162	22832	hgsc.bcm.edu	37	6	84936099	84936099	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr6:84936099delA	ENST00000403245.3	-	2	127	c.13delT	c.(13-15)tccfs	p.S5fs	KIAA1009_ENST00000257766.4_Intron	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TCTTCTTGGGAACAGTTAGCC	0.318																																					p.S5fs		Atlas-Indel,Pindel	.											.	KIAA1009	119	.	0			c.14delC						PASS	.						65.0	60.0	61.0					6																	84936099		1839	4066	5905	SO:0001589	frameshift_variant	22832	exon2			.																												ENST00000403245.3:c.13delT	chr6.hg19:g.84936099delA	ENSP00000385215:p.Ser5fs	71.0	0.0	0		71.0	34.0	0.478873	NM_014895		Frame_Shift_Del	DEL	ENST00000403245.3	hg19	CCDS34494.2																																																																																			.	.	.	none		0.318	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
CCBL2	56267	hgsc.bcm.edu	37	1	89409052	89409053	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-MH-A854-01A-11D-A34Z-10	TCGA-MH-A854-10A-01D-A34Z-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cfe2ae5e-1b05-49e9-896c-0dfe0c7bb0e0	c013eb32-4377-46f2-8ed8-eb0f3d494642	g.chr1:89409052_89409053delTT	ENST00000260508.4	-	12	1532_1533	c.1195_1196delAA	c.(1195-1197)aaafs	p.K399fs	CCBL2_ENST00000370491.3_Frame_Shift_Del_p.K365fs|CCBL2_ENST00000370485.2_3'UTR|CCBL2_ENST00000446900.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	399					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		AGTCATCCATTTCACAAACTTA	0.312																																					p.399_399del		Pindel	.											.	CCBL2	138	.	0			c.1196_1197del						PASS	.																																			SO:0001589	frameshift_variant	56267	exon12			.	AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.1195_1196delAA	chr1.hg19:g.89409052_89409053delTT	ENSP00000260508:p.Lys399fs	200.0	0.0	.		196.0	51.0	0.260	NM_001008661	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Frame_Shift_Del	DEL	ENST00000260508.4	hg19	CCDS30766.1																																																																																			.	.	.	none		0.312	CCBL2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000029300.3	NM_001008661	
