#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HCRTR1	3061	hgsc.bcm.edu	37	1	32092534	32092534	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:32092534A>C	ENST00000373706.5	+	7	1384	c.1231A>C	c.(1231-1233)Atc>Ctc	p.I411L	HCRTR1_ENST00000373705.1_Intron|HCRTR1_ENST00000403528.2_Missense_Mutation_p.I411L|HCRTR1_ENST00000468521.1_Intron			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	411					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CATCTCCAAAATCTCTGAGCA	0.652																																					p.I411L		Atlas-SNP	.											.	HCRTR1	20	.	0			c.A1231C						PASS	.						103.0	101.0	102.0					1																	32092534		2203	4300	6503	SO:0001583	missense	3061	exon9			TCCAAAATCTCTG	AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.1231A>C	chr1.hg19:g.32092534A>C	ENSP00000362810:p.Ile411Leu	43.0	0.0	.		36.0	14.0	.	NM_001525	A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	hg19	CCDS344.1	.	.	.	.	.	.	.	.	.	.	A	0.048	-1.258738	0.01445	.	.	ENSG00000121764	ENST00000403528;ENST00000373706	T;T	0.59364	0.27;0.27	4.58	0.0883	0.14454	.	0.624474	0.15468	N	0.260782	T	0.22898	0.0553	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23226	-1.0194	10	0.06625	T	0.88	.	5.0151	0.14331	0.4204:0.1475:0.4321:0.0	.	411	O43613	OX1R_HUMAN	L	411	ENSP00000384387:I411L;ENSP00000362810:I411L	ENSP00000362810:I411L	I	+	1	0	HCRTR1	31865121	0.988000	0.35896	0.023000	0.16930	0.847000	0.48162	0.244000	0.18124	-0.388000	0.07797	-2.581000	0.00168	ATC	.	.	.	none		0.652	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525	
MUTYH	4595	hgsc.bcm.edu	37	1	45797966	45797966	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:45797966G>C	ENST00000372098.3	-	10	929	c.796C>G	c.(796-798)Ctg>Gtg	p.L266V	MUTYH_ENST00000529984.1_Intron|MUTYH_ENST00000528332.2_Intron|MUTYH_ENST00000456914.2_Missense_Mutation_p.L241V|MUTYH_ENST00000372100.5_Missense_Mutation_p.L252V|MUTYH_ENST00000488731.2_Intron|MUTYH_ENST00000528013.2_Missense_Mutation_p.L255V|MUTYH_ENST00000355498.2_Missense_Mutation_p.L241V|MUTYH_ENST00000450313.1_Missense_Mutation_p.L269V|MUTYH_ENST00000372115.3_Missense_Mutation_p.L255V|MUTYH_ENST00000372110.3_Missense_Mutation_p.L256V|MUTYH_ENST00000354383.6_Missense_Mutation_p.L242V|MUTYH_ENST00000372104.1_Missense_Mutation_p.L241V|MUTYH_ENST00000448481.1_Missense_Mutation_p.L252V|MUTYH_ENST00000531105.1_Intron			Q9UIF7	MUTYH_HUMAN	mutY homolog	266					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA repair (GO:0006281)|mismatch repair (GO:0006298)	mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|metal ion binding (GO:0046872)|MutSalpha complex binding (GO:0032407)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					GGGTCCACCAGCTGCTGGGCT	0.592			Mis			colorectal		Base excision repair (BER), DNA glycosylases	MUTYH-associated polyposis																												p.L269V		Atlas-SNP	.	yes	Rec		Adenomatous polyposis coli	1	1p34.3-1p32.1	4595	mutY homolog (E. coli)		E	.	MUTYH	38	.	0			c.C805G						PASS	.						29.0	30.0	30.0					1																	45797966		2203	4300	6503	SO:0001583	missense	4595	exon10	Familial Cancer Database	MAP, MYH-associated polyposis	CCACCAGCTGCTG	U63329	CCDS520.1, CCDS41320.1, CCDS41321.1, CCDS41322.1, CCDS72776.1, CCDS72777.1	1p34.1	2014-09-17	2013-09-12		ENSG00000132781	ENSG00000132781			7527	protein-coding gene	gene with protein product		604933	"""mutY (E. coli) homolog"", ""mutY homolog (E. coli)"""			7823963, 10684930	Standard	NM_012222		Approved	MYH	uc009vxp.3	Q9UIF7	OTTHUMG00000007682	ENST00000372098.3:c.796C>G	chr1.hg19:g.45797966G>C	ENSP00000361170:p.Leu266Val	54.0	0.0	.		46.0	10.0	.	NM_001128425	D3DPZ4|Q15830|Q9UBP2|Q9UBS7|Q9UIF4|Q9UIF5|Q9UIF6	Missense_Mutation	SNP	ENST00000372098.3	hg19	CCDS520.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.803564	0.31869	.	.	ENSG00000132781	ENST00000372104;ENST00000448481;ENST00000456914;ENST00000354383;ENST00000355498;ENST00000372098;ENST00000372110;ENST00000372115;ENST00000450313;ENST00000372100;ENST00000525481;ENST00000412971;ENST00000435155	D;D;D;D;D;D;D;D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36	5.64	3.71	0.42584	HhH-GPD domain (1);DNA glycosylase (1);Helix-turn-helix, base-excision DNA repair, C-terminal (1);	0.075116	0.53938	D	0.000042	D	0.94518	0.8235	M	0.68952	2.095	0.46317	D	0.998987	D;P;D;P;D;P;D	0.57571	0.965;0.695;0.98;0.695;0.965;0.92;0.965	P;B;P;B;P;P;P	0.57009	0.578;0.217;0.811;0.217;0.578;0.578;0.652	D	0.93723	0.7034	10	0.72032	D	0.01	-15.3824	11.2119	0.48804	0.1549:0.0:0.8451:0.0	.	269;266;256;266;255;149;242	E5KP25;E5KP26;Q9UIF7-2;Q9UIF7;E5KP27;D3DPZ6;E5KP28	.;.;.;MUTYH_HUMAN;.;.;.	V	241;252;241;242;241;266;256;255;269;252;113;113;252	ENSP00000361176:L241V;ENSP00000409718:L252V;ENSP00000407590:L241V;ENSP00000346354:L242V;ENSP00000347685:L241V;ENSP00000361170:L266V;ENSP00000361182:L256V;ENSP00000361187:L255V;ENSP00000408176:L269V;ENSP00000361172:L252V;ENSP00000410263:L113V;ENSP00000403655:L252V	ENSP00000346354:L242V	L	-	1	2	MUTYH	45570553	0.782000	0.28689	0.997000	0.53966	0.320000	0.28249	1.025000	0.30090	0.676000	0.31285	-0.150000	0.13652	CTG	.	.	.	none		0.592	MUTYH-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020529.1	NM_012222	
LRP8	7804	hgsc.bcm.edu	37	1	53722944	53722944	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:53722944A>C	ENST00000306052.6	-	15	2503	c.2402T>G	c.(2401-2403)cTa>cGa	p.L801R	LRP8_ENST00000371454.2_Missense_Mutation_p.L801R|LRP8_ENST00000460214.1_5'UTR|LRP8_ENST00000465675.1_Missense_Mutation_p.L354R|LRP8_ENST00000347547.2_Missense_Mutation_p.L631R|LRP8_ENST00000354412.3_Intron	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	801					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						TGCAGGGCTTAGGGTAGACGG	0.562																																					p.L801R		Atlas-SNP	.											.	LRP8	58	.	0			c.T2402G						PASS	.						175.0	154.0	161.0					1																	53722944		2203	4300	6503	SO:0001583	missense	7804	exon15			GGGCTTAGGGTAG	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2402T>G	chr1.hg19:g.53722944A>C	ENSP00000303634:p.Leu801Arg	142.0	0.0	.		197.0	82.0	.	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	hg19	CCDS578.1	.	.	.	.	.	.	.	.	.	.	A	4.412	0.076180	0.08485	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000347547	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.94	2.98	0.34508	.	.	.	.	.	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	B;B;P;B;B	0.34757	0.0;0.38;0.467;0.043;0.001	B;B;B;B;B	0.29176	0.001;0.076;0.099;0.021;0.002	T	0.31223	-0.9951	9	0.16420	T	0.52	.	5.4585	0.16604	0.2396:0.0:0.6203:0.1401	.	354;631;801;801;354	B3KU40;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;LRP8_HUMAN;.	R	801;801;354;631	ENSP00000303634:L801R;ENSP00000360509:L801R;ENSP00000437009:L354R;ENSP00000334522:L631R	ENSP00000303634:L801R	L	-	2	0	LRP8	53495532	0.486000	0.25980	0.454000	0.27019	0.839000	0.47603	0.158000	0.16422	0.364000	0.24374	-0.248000	0.11899	CTA	.	.	.	none		0.562	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
PIGK	10026	hgsc.bcm.edu	37	1	77620232	77620232	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:77620232T>G	ENST00000370812.3	-	9	911	c.888A>C	c.(886-888)aaA>aaC	p.K296N	PIGK_ENST00000359130.1_Missense_Mutation_p.K296N|PIGK_ENST00000445065.1_Missense_Mutation_p.K202N|PIGK_ENST00000478391.1_5'UTR|PIGK_ENST00000370813.5_Missense_Mutation_p.K220N	NM_005482.2	NP_005473.1	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class K	296					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|GPI-anchor transamidase activity (GO:0003923)|protein disulfide isomerase activity (GO:0003756)			endometrium(5)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	19						TCAGTACATTTTTAGGATCCC	0.358																																					p.K296N		Atlas-SNP	.											.	PIGK	46	.	0			c.A888C						PASS	.						107.0	103.0	104.0					1																	77620232		2203	4300	6503	SO:0001583	missense	10026	exon9			TACATTTTTAGGA	AF022913	CCDS674.1	1p31.1	2013-02-26	2006-06-28		ENSG00000142892	ENSG00000142892		"""Phosphatidylinositol glycan anchor biosynthesis"""	8965	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	605087	"""phosphatidylinositol glycan, class K"""			9356492	Standard	NM_005482		Approved	hGPI8, GPI8	uc001dhk.3	Q92643	OTTHUMG00000009686	ENST00000370812.3:c.888A>C	chr1.hg19:g.77620232T>G	ENSP00000359848:p.Lys296Asn	162.0	0.0	.		219.0	88.0	.	NM_005482	B2R7K3|B4E2M3|O14822|Q5TG77	Missense_Mutation	SNP	ENST00000370812.3	hg19	CCDS674.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.741690	0.30865	.	.	ENSG00000142892	ENST00000370812;ENST00000445065;ENST00000370813;ENST00000359130	T;T;T;T	0.46063	0.89;0.88;0.88;0.89	5.11	3.98	0.46160	.	0.370552	0.31897	N	0.006890	T	0.10035	0.0246	N	0.19112	0.55	0.33023	D	0.529102	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.15052	0.012;0.008;0.008;0.008	T	0.12915	-1.0529	10	0.22109	T	0.4	-14.8515	4.9815	0.14168	0.1415:0.1428:0.0:0.7157	.	220;202;296;296	B4E2M3;B1AK81;A6NEM5;Q92643	.;.;.;GPI8_HUMAN	N	296;202;220;296	ENSP00000359848:K296N;ENSP00000388854:K202N;ENSP00000359849:K220N;ENSP00000352041:K296N	ENSP00000352041:K296N	K	-	3	2	PIGK	77392820	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.781000	0.26774	2.050000	0.60909	0.482000	0.46254	AAA	.	.	.	none		0.358	PIGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026687.1	NM_005482	
GON4L	54856	hgsc.bcm.edu	37	1	155823224	155823224	+	Silent	SNP	T	T	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:155823224T>G	ENST00000368331.1	-	2	396	c.348A>C	c.(346-348)atA>atC	p.I116I	GON4L_ENST00000437809.1_Silent_p.I116I|GON4L_ENST00000271883.5_Silent_p.I116I|GON4L_ENST00000361040.5_Silent_p.I116I|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	116					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TACCAATGTGTATATTAAGGG	0.458																																					p.I116I		Atlas-SNP	.											.	GON4L	392	.	0			c.A348C						PASS	.						123.0	121.0	122.0					1																	155823224		2203	4300	6503	SO:0001819	synonymous_variant	54856	exon2			AATGTGTATATTA	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.348A>C	chr1.hg19:g.155823224T>G		133.0	0.0	.		106.0	35.0	.	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	hg19																																																																																				.	.	.	none		0.458	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
BRINP2	57795	hgsc.bcm.edu	37	1	177245534	177245534	+	Missense_Mutation	SNP	T	T	C	rs368629885		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:177245534T>C	ENST00000361539.4	+	6	1288	c.976T>C	c.(976-978)Tcc>Ccc	p.S326P	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	326					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GATCCAGGACTCCTGGGCCAC	0.567																																					p.S326P		Atlas-SNP	.											.	FAM5B	191	.	0			c.T976C						PASS	.						63.0	55.0	58.0					1																	177245534		2203	4300	6503	SO:0001583	missense	57795	exon6			CAGGACTCCTGGG		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.976T>C	chr1.hg19:g.177245534T>C	ENSP00000354481:p.Ser326Pro	117.0	0.0	.		150.0	59.0	.	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	hg19	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.871574	0.51695	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.15256	2.44	6.07	0.802	0.18686	.	0.390200	0.28209	N	0.016191	T	0.13114	0.0318	L	0.39898	1.24	0.36544	D	0.871453	B;P;B	0.37038	0.256;0.579;0.037	B;B;B	0.38755	0.189;0.281;0.029	T	0.12708	-1.0537	10	0.72032	D	0.01	-17.6413	6.0285	0.19667	0.3365:0.0:0.3715:0.2919	.	76;221;326	F5H8E0;Q9C0B6-2;Q9C0B6	.;.;FAM5B_HUMAN	P	76;326	ENSP00000354481:S326P	ENSP00000354481:S326P	S	+	1	0	FAM5B	175512157	0.029000	0.19370	1.000000	0.80357	0.994000	0.84299	0.314000	0.19432	0.475000	0.27415	0.533000	0.62120	TCC	.	.	.	none		0.567	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
JMJD4	65094	hgsc.bcm.edu	37	1	227921688	227921688	+	Silent	SNP	C	C	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:227921688C>G	ENST00000366758.3	-	3	611	c.612G>C	c.(610-612)tcG>tcC	p.S204S	SNAP47_ENST00000366760.1_Intron|JMJD4_ENST00000438896.2_Silent_p.S204S|SNAP47_ENST00000366759.4_5'Flank|JMJD4_ENST00000485807.1_5'UTR|SNAP47_ENST00000315781.5_5'Flank|SNAP47_ENST00000480897.1_3'UTR	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	204	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.									endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				GCCAGTCGGACGAGAAGTACA	0.612																																					p.S204S		Atlas-SNP	.											.	JMJD4	28	.	0			c.G612C						PASS	.						145.0	115.0	125.0					1																	227921688		2203	4300	6503	SO:0001819	synonymous_variant	65094	exon3			GTCGGACGAGAAG	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.612G>C	chr1.hg19:g.227921688C>G		24.0	0.0	.		22.0	6.0	.	NM_023007	Q5TBZ1|Q5TBZ6|Q9H970	Silent	SNP	ENST00000366758.3	hg19	CCDS1561.1	.	.	.	.	.	.	.	.	.	.	.	0.076	-1.192619	0.01607	.	.	ENSG00000081692	ENST00000438896	.	.	.	4.16	-8.31	0.01001	.	.	.	.	.	T	0.42086	0.1187	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52616	-0.8552	4	.	.	.	-14.4929	3.4793	0.07597	0.176:0.329:0.3564:0.1386	.	.	.	.	P	197	.	.	R	-	2	0	JMJD4	225988311	0.000000	0.05858	0.022000	0.16811	0.139000	0.21198	-2.996000	0.00655	-3.988000	0.00084	-4.550000	0.00004	CGT	.	.	.	none		0.612	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
ABCB10	23456	hgsc.bcm.edu	37	1	229666004	229666004	+	Silent	SNP	A	A	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:229666004A>G	ENST00000344517.4	-	8	1629	c.1587T>C	c.(1585-1587)agT>agC	p.S529S		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	529	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TGCCAGAACCACTTGGGCCAA	0.537																																					p.S529S		Atlas-SNP	.											.	ABCB10	71	.	0			c.T1587C						PASS	.						111.0	102.0	105.0					1																	229666004		2203	4300	6503	SO:0001819	synonymous_variant	23456	exon8			AGAACCACTTGGG	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1587T>C	chr1.hg19:g.229666004A>G		27.0	0.0	.		34.0	14.0	.	NM_012089	Q13040|Q6P1Q8|Q9H3V0	Silent	SNP	ENST00000344517.4	hg19	CCDS1580.1																																																																																			.	.	.	none		0.537	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089	
TGOLN2	10618	hgsc.bcm.edu	37	2	85554384	85554384	+	Silent	SNP	C	C	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr2:85554384C>T	ENST00000409232.3	-	2	532	c.471G>A	c.(469-471)gaG>gaA	p.E157E	TGOLN2_ENST00000409015.1_Silent_p.E157E|TGOLN2_ENST00000444342.2_Silent_p.E157E|TGOLN2_ENST00000398263.2_Silent_p.E157E|TGOLN2_ENST00000282120.2_Intron|TGOLN2_ENST00000377386.3_Silent_p.E157E			O43493	TGON2_HUMAN	trans-golgi network protein 2	157	14 X 14 AA tandem repeats.					Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)											GGGTCTTTGCCTCCGCACCCG	0.587																																					p.E157E		Atlas-SNP	.											.	TGOLN2	32	.	0			c.G471A						PASS	.						298.0	303.0	301.0					2																	85554384		1962	4150	6112	SO:0001819	synonymous_variant	10618	exon2			CTTTGCCTCCGCA	AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.471G>A	chr2.hg19:g.85554384C>T		237.0	0.0	.		159.0	63.0	.	NM_001206841	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Silent	SNP	ENST00000409232.3	hg19	CCDS56126.1																																																																																			.	.	.	none		0.587	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329045.2	NM_006464	
GPR39	2863	hgsc.bcm.edu	37	2	133174849	133174849	+	Silent	SNP	G	G	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr2:133174849G>T	ENST00000329321.3	+	1	703	c.234G>T	c.(232-234)tcG>tcT	p.S78S		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	78					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGGCTTGCTCGGACATCTTGG	0.552																																					p.S78S		Atlas-SNP	.											.	GPR39	60	.	0			c.G234T						PASS	.						247.0	222.0	231.0					2																	133174849		2203	4300	6503	SO:0001819	synonymous_variant	2863	exon1			TTGCTCGGACATC	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.234G>T	chr2.hg19:g.133174849G>T		45.0	0.0	.		74.0	21.0	.	NM_001508	B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	ENST00000329321.3	hg19	CCDS2170.1																																																																																			.	.	.	none		0.552	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1		
R3HDM1	23518	hgsc.bcm.edu	37	2	136467748	136467748	+	Missense_Mutation	SNP	C	C	G	rs143703596		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr2:136467748C>G	ENST00000264160.4	+	22	2948	c.2578C>G	c.(2578-2580)Cac>Gac	p.H860D	R3HDM1_ENST00000409606.1_Missense_Mutation_p.H861D|R3HDM1_ENST00000409478.1_Missense_Mutation_p.H732D|R3HDM1_ENST00000329971.3_Missense_Mutation_p.H731D|R3HDM1_ENST00000410054.1_Missense_Mutation_p.H805D	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	860							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		TTACTGTGATCACCAGAGAGG	0.413											OREG0014997	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H860D		Atlas-SNP	.											.	R3HDM1	84	.	0			c.C2578G						PASS	.						138.0	124.0	129.0					2																	136467748		2203	4300	6503	SO:0001583	missense	23518	exon22			TGTGATCACCAGA	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.2578C>G	chr2.hg19:g.136467748C>G	ENSP00000264160:p.His860Asp	108.0	0.0	.	1626	88.0	31.0	.	NM_015361	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	ENST00000264160.4	hg19	CCDS2177.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	4.899|4.899|4.899	0.167091|0.167091|0.167091	0.09339|0.09339|0.09339	.|.|.	.|.|.	ENSG00000048991|ENSG00000048991|ENSG00000048991	ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606|ENST00000445855|ENST00000429703	T;T;T;T;T|.|.	0.29655|.|.	1.57;1.56;1.57;1.56;1.56|.|.	5.49|5.49|5.49	3.66|3.66|3.66	0.41972|0.41972|0.41972	.|.|.	0.381500|.|.	0.28241|.|.	N|.|.	0.016076|.|.	T|T|.	0.35799|0.35799|.	0.0944|0.0944|.	L|L|L	0.33485|0.33485|0.33485	1.01|1.01|1.01	0.28870|0.28870|0.28870	N|N|N	0.89501|0.89501|0.89501	P;P;P;P|.|.	0.52316|.|.	0.952;0.704;0.651;0.651|.|.	P;B;B;B|.|.	0.49922|.|.	0.626;0.079;0.115;0.058|.|.	T|T|.	0.21759|0.21759|.	-1.0236|-1.0236|.	10|5|.	0.10902|.|.	T|.|.	0.67|.|.	-3.3318|-3.3318|-3.3318	10.1209|10.1209|10.1209	0.42621|0.42621|0.42621	0.1369:0.7911:0.0:0.072|0.1369:0.7911:0.0:0.072|0.1369:0.7911:0.0:0.072	.|.|.	732;861;805;860|.|.	G5E9G8;E9PBB4;E9PG42;Q15032|.|.	.;.;.;R3HD1_HUMAN|.|.	D|M|X	732;860;731;805;861|155|583	ENSP00000386457:H732D;ENSP00000264160:H860D;ENSP00000331396:H731D;ENSP00000386877:H805D;ENSP00000387010:H861D|.|.	ENSP00000264160:H860D|.|.	H|I|S	+|+|+	1|3|2	0|3|0	R3HDM1|R3HDM1|R3HDM1	136184218|136184218|136184218	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.996000|0.996000|0.996000	0.88848|0.88848|0.88848	5.896000|5.896000|5.896000	0.69822|0.69822|0.69822	0.652000|0.652000|0.652000	0.30806|0.30806|0.30806	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	CAC|ATC|TCA	.	C|1.000;T|0.000	.	alt		0.413	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	
GPR155	151556	hgsc.bcm.edu	37	2	175330526	175330526	+	Silent	SNP	G	G	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr2:175330526G>T	ENST00000392552.2	-	7	1609	c.1371C>A	c.(1369-1371)acC>acA	p.T457T	GPR155_ENST00000392551.2_Silent_p.T457T|GPR155_ENST00000295500.4_Silent_p.T457T	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	457					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T457T(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						TCCACAGGTAGGTGCTATAGA	0.393																																					p.T457T		Atlas-SNP	.											GPR155,NS,carcinoma,0,1	GPR155	76	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1371A						PASS	.						48.0	51.0	50.0					2																	175330526		2203	4300	6503	SO:0001819	synonymous_variant	151556	exon8			CAGGTAGGTGCTA	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1371C>A	chr2.hg19:g.175330526G>T		203.0	0.0	.		194.0	68.0	.	NM_001033045	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Silent	SNP	ENST00000392552.2	hg19	CCDS2259.1																																																																																			.	.	.	none		0.393	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
PER2	8864	hgsc.bcm.edu	37	2	239155118	239155118	+	Silent	SNP	T	T	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr2:239155118T>A	ENST00000254657.3	-	23	3945	c.3666A>T	c.(3664-3666)ccA>ccT	p.P1222P	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	1222	CRY binding domain. {ECO:0000250|UniProtKB:Q9Z301}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CTTCCTCATATGGTATGCAAA	0.383																																					p.P1222P		Atlas-SNP	.											.	PER2	85	.	0			c.A3666T						PASS	.						94.0	81.0	86.0					2																	239155118		2203	4300	6503	SO:0001819	synonymous_variant	8864	exon23			CTCATATGGTATG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.3666A>T	chr2.hg19:g.239155118T>A		53.0	0.0	.		68.0	26.0	.	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	hg19	CCDS2528.1																																																																																			.	.	.	none		0.383	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
KIF1A	547	hgsc.bcm.edu	37	2	241686666	241686666	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr2:241686666T>C	ENST00000320389.7	-	27	2905	c.2747A>G	c.(2746-2748)cAg>cGg	p.Q916R	KIF1A_ENST00000498729.2_Missense_Mutation_p.Q1017R	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	916					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TTCAAAATGCTGGTCATCAAA	0.557																																					p.Q1017R		Atlas-SNP	.											.	KIF1A	152	.	0			c.A3050G						PASS	.						64.0	70.0	68.0					2																	241686666		1951	4152	6103	SO:0001583	missense	547	exon29			AAATGCTGGTCAT	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2747A>G	chr2.hg19:g.241686666T>C	ENSP00000322791:p.Gln916Arg	38.0	0.0	.		49.0	18.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.81|15.81	2.943532|2.943532	0.53079|0.53079	.|.	.|.	ENSG00000130294|ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283|ENST00000415042	T;T;T|.	0.72282|.	-0.64;-0.64;-0.64|.	4.61|4.61	4.61|4.61	0.57282|0.57282	.|.	0.062457|.	0.64402|.	U|.	0.000004|.	T|T	0.54224|0.54224	0.1845|0.1845	L|L	0.34521|0.34521	1.04|1.04	0.43399|0.43399	D|D	0.99552|0.99552	B;B;P|.	0.37122|.	0.01;0.29;0.583|.	B;B;B|.	0.29077|.	0.014;0.098;0.08|.	T|T	0.51419|0.51419	-0.8708|-0.8708	10|5	0.20519|.	T|.	0.43|.	.|.	12.9905|12.9905	0.58616|0.58616	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1017;1017;916|.	F5H045;Q12756-2;Q12756|.	.;.;KIF1A_HUMAN|.	R|G	916;1017;1017;1017|43	ENSP00000322791:Q916R;ENSP00000438388:Q1017R;ENSP00000384231:Q1017R|.	ENSP00000322791:Q916R|.	Q|S	-|-	2|1	0|0	KIF1A|KIF1A	241335339|241335339	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.876000|0.876000	0.50452|0.50452	4.868000|4.868000	0.63021|0.63021	1.728000|1.728000	0.51552|0.51552	0.383000|0.383000	0.25322|0.25322	CAG|AGC	.	.	.	none		0.557	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
CADPS	8618	hgsc.bcm.edu	37	3	62535723	62535723	+	Silent	SNP	G	G	A	rs528317538		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr3:62535723G>A	ENST00000383710.4	-	11	2170	c.1821C>T	c.(1819-1821)gaC>gaT	p.D607D	CADPS_ENST00000357948.3_Silent_p.D607D|CADPS_ENST00000283269.9_Silent_p.D607D	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	607	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CTTGTTCATCGTCACTGGCAA	0.552																																					p.D607D		Atlas-SNP	.											.	CADPS	387	.	0			c.C1821T						PASS	.						166.0	148.0	154.0					3																	62535723		2203	4300	6503	SO:0001819	synonymous_variant	8618	exon11			TTCATCGTCACTG	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1821C>T	chr3.hg19:g.62535723G>A		111.0	0.0	.		136.0	6.0	.	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	ENST00000383710.4	hg19	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	G	9.080	0.999051	0.19121	.	.	ENSG00000163618	ENST00000478434	.	.	.	4.49	-2.99	0.05497	.	.	.	.	.	T	0.57592	0.2064	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57608	-0.7782	4	.	.	.	.	12.1907	0.54270	0.415:0.0:0.585:0.0	.	.	.	.	M	38	.	.	T	-	2	0	CADPS	62510763	0.985000	0.35326	0.989000	0.46669	0.989000	0.77384	0.352000	0.20113	-0.363000	0.08101	-0.224000	0.12420	ACG	.	.	.	none		0.552	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
EIF4A2	1974	hgsc.bcm.edu	37	3	186504962	186504962	+	Missense_Mutation	SNP	T	T	C	rs34583258		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr3:186504962T>C	ENST00000323963.5	+	8	882	c.818T>C	c.(817-819)aTt>aCt	p.I273T	RP11-573D15.9_ENST00000577781.1_RNA|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363548.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.I274T|EIF4A2_ENST00000356531.5_Missense_Mutation_p.I178T|SNORA63_ENST00000363450.1_RNA|SNORA81_ENST00000408493.2_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	273	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		ACACTGACCATTACACAGGCT	0.418			T	BCL6	NHL																																p.I273T		Atlas-SNP	.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	EIF4A2	55	.	0			c.T818C						PASS	.						117.0	117.0	117.0					3																	186504962		2203	4300	6503	SO:0001583	missense	1974	exon8			TGACCATTACACA	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.818T>C	chr3.hg19:g.186504962T>C	ENSP00000326381:p.Ile273Thr	212.0	0.0	.		165.0	56.0	.	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	hg19	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.729313	0.48833	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.04654	3.58;3.58;3.58	5.12	5.12	0.69794	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.13586	0.0329	L	0.47078	1.49	0.80722	D	1	D;D;P;B	0.61080	0.989;0.978;0.499;0.366	P;P;B;B	0.62560	0.904;0.828;0.159;0.076	T	0.00293	-1.1841	10	0.87932	D	0	-13.5813	13.1874	0.59688	0.0:0.0:0.0:1.0	.	129;178;274;273	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	T	273;274;178	ENSP00000326381:I273T;ENSP00000398370:I274T;ENSP00000348925:I178T	ENSP00000326381:I273T	I	+	2	0	EIF4A2	187987656	1.000000	0.71417	0.996000	0.52242	0.736000	0.42039	5.699000	0.68310	2.272000	0.75746	0.460000	0.39030	ATT	.	.	.	none		0.418	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
LSG1	55341	hgsc.bcm.edu	37	3	194366904	194366904	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr3:194366904C>G	ENST00000265245.5	-	12	1926	c.1612G>C	c.(1612-1614)Gac>Cac	p.D538H	AC046143.3_ENST00000447139.1_RNA	NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	538					GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		CTGACATAGTCCTTCAGGATG	0.448																																					p.D538H		Atlas-SNP	.											.	LSG1	38	.	0			c.G1612C						PASS	.						217.0	191.0	200.0					3																	194366904		2203	4300	6503	SO:0001583	missense	55341	exon12			CATAGTCCTTCAG		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.1612G>C	chr3.hg19:g.194366904C>G	ENSP00000265245:p.Asp538His	97.0	0.0	.		112.0	48.0	.	NM_018385	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	hg19	CCDS33922.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.082680|4.082680	0.76528|0.76528	.|.	.|.	ENSG00000041802|ENSG00000041802	ENST00000265245|ENST00000437613	T|.	0.26810|.	1.71|.	5.58|5.58	5.58|5.58	0.84498|0.84498	GTP-binding protein, orthogonal bundle domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84224|0.84224	0.5425|0.5425	M|M	0.87827|0.87827	2.91|2.91	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.85647|0.85647	0.1280|0.1280	10|5	0.62326|.	D|.	0.03|.	.|.	19.5831|19.5831	0.95478|0.95478	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	538|.	Q9H089|.	LSG1_HUMAN|.	H|S	538|254	ENSP00000265245:D538H|.	ENSP00000265245:D538H|.	D|R	-|-	1|3	0|2	LSG1|LSG1	195848193|195848193	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.451000|0.451000	0.32288|0.32288	7.783000|7.783000	0.85696|0.85696	2.641000|2.641000	0.89580|0.89580	0.563000|0.563000	0.77884|0.77884	GAC|AGG	.	.	.	none		0.448	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385	
RGS12	6002	hgsc.bcm.edu	37	4	3418678	3418678	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr4:3418678T>G	ENST00000344733.5	+	8	3370	c.2466T>G	c.(2464-2466)ttT>ttG	p.F822L	RGS12_ENST00000543385.1_3'UTR|RGS12_ENST00000382788.3_Missense_Mutation_p.F822L|RGS12_ENST00000338806.4_Missense_Mutation_p.F174L|RGS12_ENST00000538395.1_Missense_Mutation_p.F164L|RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000336727.3_Missense_Mutation_p.F822L|RGS12_ENST00000306648.7_Missense_Mutation_p.F220L	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	822	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACACTCGCTTTCTGAAGTCCC	0.587																																					p.F822L		Atlas-SNP	.											.	RGS12	128	.	0			c.T2466G						PASS	.						79.0	81.0	80.0					4																	3418678		2203	4300	6503	SO:0001583	missense	6002	exon8			TCGCTTTCTGAAG	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2466T>G	chr4.hg19:g.3418678T>G	ENSP00000339381:p.Phe822Leu	109.0	0.0	.		88.0	30.0	.	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	hg19	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.249521	0.80024	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77;2.77	4.5	-5.97	0.02227	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	H	0.94503	3.545	0.53688	D	0.99997	P;D;D;D;P;D;P;P;P	0.89917	0.947;0.966;1.0;0.966;0.889;0.985;0.947;0.798;0.759	P;P;D;P;P;D;P;P;P	0.97110	0.869;0.785;1.0;0.785;0.841;0.954;0.908;0.847;0.762	T	0.55811	-0.8082	10	0.87932	D	0	-21.6848	13.8554	0.63524	0.0:0.5296:0.0:0.4704	.	164;21;164;21;164;174;220;822;822	B7Z764;B3KVS7;B7Z8B8;A8K440;O14924-2;O14924-3;Q8WX95;O14924;O14924-4	.;.;.;.;.;.;.;RGS12_HUMAN;.	L	822;822;822;220;174;164	ENSP00000339381:F822L;ENSP00000338509:F822L;ENSP00000372238:F822L;ENSP00000304459:F220L;ENSP00000342133:F174L;ENSP00000438888:F164L	ENSP00000304459:F220L	F	+	3	2	RGS12	3388476	0.983000	0.35010	0.632000	0.29296	0.673000	0.39480	0.177000	0.16801	-1.100000	0.03030	-0.315000	0.08773	TTT	.	.	.	none		0.587	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
SLC34A2	10568	hgsc.bcm.edu	37	4	25664375	25664375	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr4:25664375A>T	ENST00000382051.3	+	3	211	c.161A>T	c.(160-162)tAc>tTc	p.Y54F	SLC34A2_ENST00000503434.1_Missense_Mutation_p.Y53F|SLC34A2_ENST00000504570.1_Missense_Mutation_p.Y53F	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	54					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				CTGCCGTCCTACTCCACGGCT	0.517			T	ROS1	NSCLC																																p.Y54F		Atlas-SNP	.		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	SLC34A2	93	.	0			c.A161T						PASS	.						138.0	137.0	137.0					4																	25664375		2203	4300	6503	SO:0001583	missense	10568	exon3			CGTCCTACTCCAC	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.161A>T	chr4.hg19:g.25664375A>T	ENSP00000371483:p.Tyr54Phe	109.0	0.0	.		96.0	28.0	.	NM_006424	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	hg19	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.760566	0.31137	.	.	ENSG00000157765	ENST00000513204;ENST00000504570;ENST00000382051;ENST00000503434;ENST00000507530	T;T;T;T;T	0.55930	0.49;1.93;1.93;1.93;0.49	5.45	1.6	0.23607	.	0.529195	0.21573	N	0.072361	T	0.40956	0.1138	L	0.56769	1.78	0.09310	N	0.999994	B;B	0.14012	0.007;0.009	B;B	0.13407	0.009;0.004	T	0.25710	-1.0124	10	0.22706	T	0.39	-9.0718	4.4856	0.11788	0.6159:0.0:0.14:0.2441	.	53;54	O95436-2;O95436	.;NPT2B_HUMAN	F	53;53;54;53;54	ENSP00000423038:Y53F;ENSP00000425501:Y53F;ENSP00000371483:Y54F;ENSP00000423021:Y53F;ENSP00000424266:Y54F	ENSP00000371483:Y54F	Y	+	2	0	SLC34A2	25273473	0.137000	0.22531	0.004000	0.12327	0.176000	0.22953	1.990000	0.40717	0.052000	0.16007	0.528000	0.53228	TAC	.	.	.	none		0.517	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
KDR	3791	hgsc.bcm.edu	37	4	55979601	55979601	+	Silent	SNP	C	C	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr4:55979601C>T	ENST00000263923.4	-	7	1141	c.846G>A	c.(844-846)ggG>ggA	p.G282G		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	282	Ig-like C2-type 3.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCATCTCACTCCCAGACTGGG	0.428			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.G282G		Atlas-SNP	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	307	.	0			c.G846A						PASS	.						143.0	136.0	138.0					4																	55979601		2203	4300	6503	SO:0001819	synonymous_variant	3791	exon7			CTCACTCCCAGAC	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.846G>A	chr4.hg19:g.55979601C>T		133.0	0.0	.		134.0	53.0	.	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	hg19	CCDS3497.1																																																																																			.	.	.	none		0.428	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
C4orf32	132720	hgsc.bcm.edu	37	4	113066846	113066846	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr4:113066846C>A	ENST00000309733.5	+	1	294	c.110C>A	c.(109-111)gCg>gAg	p.A37E		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	37						integral component of membrane (GO:0016021)							Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		gatcccggggcgagcccgcgg	0.831																																					p.A37E		Atlas-SNP	.											.	C4orf32	6	.	0			c.C110A						PASS	.						2.0	4.0	4.0					4																	113066846		1213	2632	3845	SO:0001583	missense	132720	exon1			CCGGGGCGAGCCC	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749			26813	protein-coding gene	gene with protein product						12477932	Standard	NM_152400		Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.110C>A	chr4.hg19:g.113066846C>A	ENSP00000310182:p.Ala37Glu	3.0	0.0	.		12.0	9.0	.	NM_152400	Q49A91|Q4W5C7|Q8TBF9	Missense_Mutation	SNP	ENST00000309733.5	hg19	CCDS3695.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783857	0.49891	.	.	ENSG00000174749	ENST00000309733	T	0.52526	0.66	3.18	1.33	0.21861	.	0.896444	0.09366	U	0.812075	T	0.36110	0.0955	L	0.44542	1.39	0.27426	N	0.954157	B	0.11235	0.004	B	0.16289	0.015	T	0.33137	-0.9880	10	0.45353	T	0.12	-0.8497	3.6435	0.08176	0.2659:0.5956:0.0:0.1385	.	37	Q8N8J7	CD032_HUMAN	E	37	ENSP00000310182:A37E	ENSP00000310182:A37E	A	+	2	0	C4orf32	113286295	0.732000	0.28121	0.982000	0.44146	0.008000	0.06430	0.121000	0.15667	0.147000	0.19030	0.305000	0.20034	GCG	.	.	.	none		0.831	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2	NM_152400	
KIAA1109	84162	hgsc.bcm.edu	37	4	123236769	123236769	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr4:123236769G>A	ENST00000264501.4	+	61	10838	c.10465G>A	c.(10465-10467)Gac>Aac	p.D3489N	KIAA1109_ENST00000455637.1_Missense_Mutation_p.D3489N|KIAA1109_ENST00000388738.3_Missense_Mutation_p.D3489N			Q2LD37	K1109_HUMAN	KIAA1109	3489					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D3489N(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGACATTGCTGACTTAAATTC	0.393																																					p.D3489N		Atlas-SNP	.											KIAA1109,NS,carcinoma,0,1	KIAA1109	424	.	1	Substitution - Missense(1)	lung(1)	c.G10465A						PASS	.						172.0	157.0	162.0					4																	123236769		1989	4174	6163	SO:0001583	missense	84162	exon59			ATTGCTGACTTAA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10465G>A	chr4.hg19:g.123236769G>A	ENSP00000264501:p.Asp3489Asn	103.0	0.0	.		114.0	44.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	G	35	5.483944	0.96307	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637;ENST00000438707;ENST00000421930	T;T;T;T	0.43294	2.43;2.43;1.84;0.95	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	L	0.51422	1.61	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.79784	0.993;0.984	T	0.57124	-0.7865	10	0.42905	T	0.14	.	19.379	0.94523	0.0:0.0:1.0:0.0	.	3489;3489	Q2LD37-6;Q2LD37	.;K1109_HUMAN	N	3489;3489;3489;105;63	ENSP00000264501:D3489N;ENSP00000373390:D3489N;ENSP00000389925:D3489N;ENSP00000410874:D105N	ENSP00000264501:D3489N	D	+	1	0	KIAA1109	123456219	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.787000	0.99055	2.653000	0.90120	0.650000	0.86243	GAC	.	.	.	none		0.393	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
JADE1	79960	hgsc.bcm.edu	37	4	129793111	129793111	+	Silent	SNP	T	T	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr4:129793111T>A	ENST00000226319.6	+	11	2503	c.2223T>A	c.(2221-2223)ccT>ccA	p.P741P	PHF17_ENST00000512960.1_Silent_p.P741P|PHF17_ENST00000452328.2_Silent_p.P729P	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CTACAACACCTGCCAGCCCAG	0.547																																					p.P741P		Atlas-SNP	.											.	PHF17	63	.	0			c.T2223A						PASS	.						34.0	38.0	36.0					4																	129793111		2203	4299	6502	SO:0001819	synonymous_variant	79960	exon11			AACACCTGCCAGC																												ENST00000226319.6:c.2223T>A	chr4.hg19:g.129793111T>A		48.0	0.0	.		83.0	32.0	.	NM_199320		Silent	SNP	ENST00000226319.6	hg19	CCDS34062.1																																																																																			.	.	.	none		0.547	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
TARS	6897	hgsc.bcm.edu	37	5	33441209	33441209	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr5:33441209C>A	ENST00000265112.3	+	1	328	c.17C>A	c.(16-18)gCc>gAc	p.A6D	TARS_ENST00000455217.2_Missense_Mutation_p.A6D|CTD-2203K17.1_ENST00000507251.1_RNA|TARS_ENST00000414361.2_5'UTR|TARS_ENST00000541634.1_5'UTR|TARS_ENST00000502553.1_Missense_Mutation_p.A6D	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	6					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	GAGGAGAAGGCCAGCAGTCCT	0.612																																					p.A6D		Atlas-SNP	.											.	TARS	66	.	0			c.C17A						PASS	.						86.0	74.0	78.0					5																	33441209		2203	4300	6503	SO:0001583	missense	6897	exon1			AGAAGGCCAGCAG	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.17C>A	chr5.hg19:g.33441209C>A	ENSP00000265112:p.Ala6Asp	82.0	0.0	.		61.0	28.0	.	NM_152295	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	ENST00000265112.3	hg19	CCDS3899.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.262597	0.39995	.	.	ENSG00000113407	ENST00000502553;ENST00000514259;ENST00000265112;ENST00000455217	T;T;T;T	0.48836	0.9;0.8;0.9;0.81	4.74	0.646	0.17789	.	0.527644	0.20999	N	0.081888	T	0.23370	0.0565	N	0.16478	0.41	0.21020	N	0.999804	B	0.24721	0.11	B	0.22386	0.039	T	0.08932	-1.0698	10	0.27082	T	0.32	-7.084	2.7791	0.05356	0.3274:0.4217:0.1591:0.0918	.	6	P26639	SYTC_HUMAN	D	6	ENSP00000424387:A6D;ENSP00000422130:A6D;ENSP00000265112:A6D;ENSP00000387710:A6D	ENSP00000265112:A6D	A	+	2	0	TARS	33476966	0.001000	0.12720	0.003000	0.11579	0.663000	0.39108	-0.265000	0.08644	-0.003000	0.14444	0.591000	0.81541	GCC	.	.	.	none		0.612	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207367.1	NM_152295	
EPB41L4A	64097	hgsc.bcm.edu	37	5	111594984	111594984	+	Missense_Mutation	SNP	C	C	T	rs539290653		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr5:111594984C>T	ENST00000261486.5	-	9	1013	c.737G>A	c.(736-738)cGg>cAg	p.R246Q	RP11-526F3.1_ENST00000504004.1_RNA	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	246	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)		p.R246L(2)|p.R246Q(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CTTTGTAATCCGAGGCCTAAA	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		20668	0.0		0.0	False		,,,				2504	0.001				p.R246Q		Atlas-SNP	.											EPB41L4A,caecum,carcinoma,0,5	EPB41L4A	130	.	3	Substitution - Missense(3)	lung(2)|haematopoietic_and_lymphoid_tissue(1)	c.G737A						PASS	.						148.0	130.0	136.0					5																	111594984		1807	4092	5899	SO:0001583	missense	64097	exon9			GTAATCCGAGGCC	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.737G>A	chr5.hg19:g.111594984C>T	ENSP00000261486:p.Arg246Gln	56.0	0.0	.		73.0	33.0	.	NM_022140	A4FUI6	Missense_Mutation	SNP	ENST00000261486.5	hg19	CCDS43350.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046182	0.93740	.	.	ENSG00000129595	ENST00000261486	D	0.82081	-1.57	5.28	5.28	0.74379	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.87830	0.6276	M	0.64997	1.995	0.40889	D	0.984053	D	0.69078	0.997	P	0.55545	0.778	D	0.89465	0.3739	10	0.87932	D	0	.	18.0454	0.89330	0.0:1.0:0.0:0.0	.	246	Q9HCS5	E41LA_HUMAN	Q	246	ENSP00000261486:R246Q	ENSP00000261486:R246Q	R	-	2	0	EPB41L4A	111622883	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.751000	0.68720	2.644000	0.89710	0.655000	0.94253	CGG	.	.	.	none		0.393	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		
TRIM31	11074	hgsc.bcm.edu	37	6	30072974	30072974	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr6:30072974T>A	ENST00000376734.3	-	7	1054	c.929A>T	c.(928-930)aAa>aTa	p.K310I	TRIM31_ENST00000485864.1_5'UTR|TRIM31-AS1_ENST00000440874.1_RNA|TRIM31_ENST00000540829.1_Missense_Mutation_p.K310I	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	310					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						ATTCATGCTTTTGAAGAATCT	0.413																																					p.K310I		Atlas-SNP	.											.	TRIM31	40	.	0			c.A929T						PASS	.						181.0	181.0	181.0					6																	30072974		1511	2709	4220	SO:0001583	missense	11074	exon7			ATGCTTTTGAAGA	AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.929A>T	chr6.hg19:g.30072974T>A	ENSP00000365924:p.Lys310Ile	190.0	0.0	.		171.0	59.0	.	NM_007028	A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Missense_Mutation	SNP	ENST00000376734.3	hg19	CCDS34374.1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.004393	0.35320	.	.	ENSG00000204616	ENST00000376734;ENST00000376728;ENST00000540829	T;T	0.68331	-0.32;-0.32	4.05	-2.76	0.05896	.	.	.	.	.	T	0.19685	0.0473	N	0.14661	0.345	0.09310	N	1	P	0.46020	0.871	B	0.39935	0.314	T	0.14839	-1.0458	9	0.18710	T	0.47	.	5.621	0.17457	0.0:0.492:0.1825:0.3254	.	310	Q9BZY9	TRI31_HUMAN	I	310	ENSP00000365924:K310I;ENSP00000444311:K310I	ENSP00000365918:K310I	K	-	2	0	TRIM31	30180953	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.376000	0.07465	-0.375000	0.07955	-0.517000	0.04412	AAA	.	.	.	none		0.413	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076081.2		
COL11A2	1302	hgsc.bcm.edu	37	6	33137181	33137181	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr6:33137181A>T	ENST00000374708.4	-	49	3777	c.3519T>A	c.(3517-3519)gaT>gaA	p.D1173E	COL11A2_ENST00000374712.1_Missense_Mutation_p.D1178E|COL11A2_ENST00000361917.1_Missense_Mutation_p.D1152E|COL11A2_ENST00000374713.1_Missense_Mutation_p.D1212E|COL11A2_ENST00000357486.1_Missense_Mutation_p.D1238E|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000395197.1_Missense_Mutation_p.D1199E|COL11A2_ENST00000341947.2_Missense_Mutation_p.D1259E|COL11A2_ENST00000374714.1_Missense_Mutation_p.D1233E	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1259	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						TGGGGCCATCATCGCCTGTGG	0.627																																					p.D1259E	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											.	COL11A2	124	.	0			c.T3777A						PASS	.						47.0	42.0	44.0					6																	33137181		1510	2707	4217	SO:0001583	missense	1302	exon51			GCCATCATCGCCT	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.3519T>A	chr6.hg19:g.33137181A>T	ENSP00000363840:p.Asp1173Glu	31.0	0.0	.		17.0	8.0	.	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	hg19	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.295457	0.23564	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.94138	-3.36;-3.23;-3.23;-3.23;-3.36;-3.36;-3.36;-3.36	4.88	-5.47	0.02600	.	0.000000	0.85682	D	0.000000	D	0.84665	0.5522	N	0.05230	-0.09	0.48762	D	0.999704	D;D;D	0.61697	0.99;0.99;0.984	D;D;D	0.75484	0.986;0.986;0.967	D	0.84632	0.0690	10	0.23891	T	0.37	.	13.4632	0.61239	0.4166:0.0:0.5834:0.0	.	1152;1173;1259	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	E	1173;1259;1238;1233;1212;1199;1178;1152	ENSP00000363840:D1173E;ENSP00000339915:D1259E;ENSP00000350079:D1238E;ENSP00000363846:D1233E;ENSP00000363845:D1212E;ENSP00000378623:D1199E;ENSP00000363844:D1178E;ENSP00000355123:D1152E	ENSP00000339915:D1259E	D	-	3	2	COL11A2	33245159	0.628000	0.27138	0.139000	0.22197	0.512000	0.34134	-0.096000	0.11059	-1.298000	0.02348	-0.398000	0.06409	GAT	.	.	.	none		0.627	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
FOXP4	116113	hgsc.bcm.edu	37	6	41553179	41553179	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr6:41553179A>G	ENST00000307972.4	+	4	446	c.434A>G	c.(433-435)tAc>tGc	p.Y145C	FOXP4_ENST00000373057.3_Missense_Mutation_p.Y143C|FOXP4_ENST00000373063.3_Missense_Mutation_p.Y145C|FOXP4_ENST00000373060.1_Missense_Mutation_p.Y145C|FOXP4_ENST00000409208.1_Missense_Mutation_p.Y145C			Q8IVH2	FOXP4_HUMAN	forkhead box P4	145	Gln-rich.				embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					CTACAGGAGTACTACAAGAAG	0.637																																					p.Y145C		Atlas-SNP	.											.	FOXP4	83	.	0			c.A434G						PASS	.						58.0	50.0	53.0					6																	41553179		2203	4300	6503	SO:0001583	missense	116113	exon5			AGGAGTACTACAA	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.434A>G	chr6.hg19:g.41553179A>G	ENSP00000309823:p.Tyr145Cys	110.0	0.0	.		100.0	30.0	.	NM_138457	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	hg19	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.401051	0.62288	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	T;D;T;T;T	0.90620	1.32;-2.7;1.32;1.32;1.32	4.94	4.94	0.65067	.	0.000000	0.64402	D	0.000001	D	0.89462	0.6722	L	0.57536	1.79	0.47308	D	0.999388	D;D;D	0.67145	0.996;0.996;0.996	P;P;P	0.54372	0.75;0.75;0.75	D	0.90770	0.4671	10	0.72032	D	0.01	.	11.009	0.47652	0.8606:0.0:0.0:0.1394	.	145;143;145	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	C	145;145;145;143;145	ENSP00000362151:Y145C;ENSP00000362154:Y145C;ENSP00000386958:Y145C;ENSP00000362148:Y143C;ENSP00000309823:Y145C	ENSP00000309823:Y145C	Y	+	2	0	FOXP4	41661157	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.189000	0.42621	1.856000	0.53863	0.454000	0.30748	TAC	.	.	.	none		0.637	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457	
XPO5	57510	hgsc.bcm.edu	37	6	43499248	43499248	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr6:43499248G>T	ENST00000265351.7	-	22	2719	c.2509C>A	c.(2509-2511)Cag>Aag	p.Q837K		NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	837					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AAGAAACGCTGCATTCTTTCC	0.433																																					p.Q837K		Atlas-SNP	.											.	XPO5	79	.	0			c.C2509A						PASS	.						137.0	127.0	130.0					6																	43499248		1895	4125	6020	SO:0001583	missense	57510	exon22			AACGCTGCATTCT	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.2509C>A	chr6.hg19:g.43499248G>T	ENSP00000265351:p.Gln837Lys	115.0	0.0	.		105.0	40.0	.	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	ENST00000265351.7	hg19	CCDS47430.1	.	.	.	.	.	.	.	.	.	.	G	32	5.191726	0.94923	.	.	ENSG00000124571	ENST00000265351;ENST00000436943;ENST00000372258;ENST00000439465	T	0.66099	-0.19	5.61	5.61	0.85477	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72137	0.3423	M	0.64567	1.98	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.68652	-0.5352	10	0.39692	T	0.17	-16.0687	18.182	0.89781	0.0:0.0:1.0:0.0	.	837	Q9HAV4	XPO5_HUMAN	K	837;542;377;465	ENSP00000265351:Q837K	ENSP00000265351:Q837K	Q	-	1	0	XPO5	43607226	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.420000	0.97426	2.793000	0.96121	0.655000	0.94253	CAG	.	.	.	none		0.433	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
HNRNPA2B1	3181	hgsc.bcm.edu	37	7	26235474	26235474	+	Silent	SNP	T	T	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr7:26235474T>C	ENST00000354667.4	-	8	918	c.750A>G	c.(748-750)ggA>ggG	p.G250G	HNRNPA2B1_ENST00000356674.7_Silent_p.G238G	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	250	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						GACCTCCAGGTCCTCCTCCAT	0.358			T	ETV1	prostate																																p.G250G		Atlas-SNP	.		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.	HNRNPA2B1	70	.	0			c.A750G						PASS	.						113.0	99.0	104.0					7																	26235474		2203	4300	6503	SO:0001819	synonymous_variant	3181	exon8			TCCAGGTCCTCCT	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.750A>G	chr7.hg19:g.26235474T>C		87.0	0.0	.		82.0	37.0	.	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	Silent	SNP	ENST00000354667.4	hg19	CCDS43557.1	.	.	.	.	.	.	.	.	.	.	T	9.789	1.177349	0.21787	.	.	ENSG00000122566	ENST00000409814	.	.	.	5.93	0.584	0.17422	.	.	.	.	.	T	0.42404	0.1201	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20907	-1.0261	4	.	.	.	.	1.8406	0.03149	0.1924:0.1811:0.0996:0.5269	.	.	.	.	G	184	.	.	D	-	2	0	HNRNPA2B1	26201999	0.999000	0.42202	0.998000	0.56505	0.941000	0.58515	0.264000	0.18497	-0.088000	0.12506	-2.424000	0.00217	GAC	.	.	.	none		0.358	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
DMTF1	9988	hgsc.bcm.edu	37	7	86820330	86820330	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr7:86820330T>G	ENST00000394703.5	+	16	2044	c.1481T>G	c.(1480-1482)tTt>tGt	p.F494C	DMTF1_ENST00000331242.7_Missense_Mutation_p.F494C|DMTF1_ENST00000432937.2_Missense_Mutation_p.F406C|DMTF1_ENST00000413276.2_Missense_Mutation_p.F424C|DMTF1_ENST00000414194.2_Missense_Mutation_p.F228C	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	494	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Required for transcriptional activation. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					CTACAGACATTTGAGATTCTT	0.388																																					p.F494C		Atlas-SNP	.											DMTF1,colon,carcinoma,0,1	DMTF1	48	.	0			c.T1481G						PASS	.						173.0	135.0	148.0					7																	86820330		2203	4300	6503	SO:0001583	missense	9988	exon14			AGACATTTGAGAT	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.1481T>G	chr7.hg19:g.86820330T>G	ENSP00000378193:p.Phe494Cys	40.0	0.0	.		54.0	20.0	.	NM_001142327	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	ENST00000394703.5	hg19	CCDS5601.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.630090	0.87660	.	.	ENSG00000135164	ENST00000331242;ENST00000413276;ENST00000432937;ENST00000394703;ENST00000414194	T;T;T;T;T	0.65364	-0.15;0.15;-0.09;-0.15;-0.15	5.74	5.74	0.90152	.	0.125440	0.64402	D	0.000001	T	0.66915	0.2838	N	0.24115	0.695	0.58432	D	0.999997	D	0.76494	0.999	D	0.70716	0.97	T	0.67337	-0.5696	10	0.38643	T	0.18	-13.4366	15.2105	0.73219	0.0:0.0:0.0:1.0	.	494	Q9Y222	DMTF1_HUMAN	C	494;424;406;494;228	ENSP00000332171:F494C;ENSP00000402627:F424C;ENSP00000412532:F406C;ENSP00000378193:F494C;ENSP00000415910:F228C	ENSP00000332171:F494C	F	+	2	0	DMTF1	86658266	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.407000	0.80029	2.185000	0.69588	0.455000	0.32223	TTT	.	.	.	none		0.388	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	
TMEM213	155006	hgsc.bcm.edu	37	7	138486107	138486107	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr7:138486107C>A	ENST00000442682.2	+	2	271	c.118C>A	c.(118-120)Cac>Aac	p.H40N	TMEM213_ENST00000458494.1_Intron|TMEM213_ENST00000413208.1_Missense_Mutation_p.H40N|TMEM213_ENST00000422794.2_Missense_Mutation_p.H90N|TMEM213_ENST00000397602.3_Missense_Mutation_p.H39N	NM_001085429.1	NP_001078898.1	A2RRL7	TM213_HUMAN	transmembrane protein 213	40						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|lung(1)	6						CTTGACCGCTCACCACCCAGA	0.537																																					p.H40N		Atlas-SNP	.											.	TMEM213	20	.	0			c.C118A						PASS	.						38.0	44.0	42.0					7																	138486107		1966	4157	6123	SO:0001583	missense	155006	exon2			ACCGCTCACCACC		CCDS47722.1	7q34	2008-08-08			ENSG00000214128	ENSG00000214128			27220	protein-coding gene	gene with protein product							Standard	NM_001085429		Approved		uc010lna.3	A2RRL7	OTTHUMG00000157182	ENST00000442682.2:c.118C>A	chr7.hg19:g.138486107C>A	ENSP00000390407:p.His40Asn	62.0	0.0	.		46.0	17.0	.	NM_001085429	A4D1R3|C9JH49|C9JX41|C9K0P0	Missense_Mutation	SNP	ENST00000442682.2	hg19	CCDS47722.1	.	.	.	.	.	.	.	.	.	.	C	6.873	0.530421	0.13127	.	.	ENSG00000214128	ENST00000422794;ENST00000397602;ENST00000442682;ENST00000413208	.	.	.	5.33	5.33	0.75918	.	0.227351	0.21672	U	0.070852	T	0.38532	0.1044	L	0.34521	1.04	0.09310	N	0.999999	P;P	0.36535	0.557;0.557	B;B	0.41988	0.372;0.372	T	0.28004	-1.0057	9	0.30854	T	0.27	-30.7942	14.8724	0.70468	0.0:1.0:0.0:0.0	.	39;40	A2RRL7-3;A2RRL7	.;TM213_HUMAN	N	90;39;40;40	.	ENSP00000380727:H39N	H	+	1	0	TMEM213	138136647	0.005000	0.15991	0.294000	0.24946	0.007000	0.05969	1.234000	0.32660	2.636000	0.89361	0.655000	0.94253	CAC	.	.	.	none		0.537	TMEM213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347800.2	NM_001085429	
ADCK2	90956	hgsc.bcm.edu	37	7	140374550	140374550	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr7:140374550T>C	ENST00000072869.4	+	2	1251	c.1073T>C	c.(1072-1074)gTc>gCc	p.V358A	ADCK2_ENST00000476491.1_Missense_Mutation_p.V358A	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	358	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					AAGCTGATGGTCCAACAGGTG	0.458																																					p.V358A		Atlas-SNP	.											.	ADCK2	37	.	0			c.T1073C						PASS	.						122.0	105.0	110.0					7																	140374550		2203	4300	6503	SO:0001583	missense	90956	exon2			TGATGGTCCAACA	AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.1073T>C	chr7.hg19:g.140374550T>C	ENSP00000072869:p.Val358Ala	99.0	0.0	.		99.0	49.0	.	NM_052853	Q96CN6|Q9Y6T5	Missense_Mutation	SNP	ENST00000072869.4	hg19	CCDS5861.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.641354	0.29157	.	.	ENSG00000133597	ENST00000072869;ENST00000476491	T;T	0.53640	0.61;0.61	5.35	4.21	0.49690	ABC-1 (1);	0.566619	0.18600	N	0.136484	T	0.31389	0.0795	L	0.31157	0.91	0.30831	N	0.736681	B;B	0.31153	0.129;0.31	B;B	0.30251	0.113;0.113	T	0.26395	-1.0104	10	0.15499	T	0.54	-42.3317	8.4754	0.33009	0.0:0.1506:0.0:0.8494	.	358;358	C9JE15;Q7Z695	.;ADCK2_HUMAN	A	358	ENSP00000072869:V358A;ENSP00000420512:V358A	ENSP00000072869:V358A	V	+	2	0	ADCK2	140021019	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	2.242000	0.43106	0.983000	0.38602	0.533000	0.62120	GTC	.	.	.	none		0.458	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348734.1	NM_052853	
DDHD2	23259	hgsc.bcm.edu	37	8	38092031	38092031	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr8:38092031A>G	ENST00000397166.2	+	3	865	c.340A>G	c.(340-342)Acg>Gcg	p.T114A	DDHD2_ENST00000520272.2_Missense_Mutation_p.T114A	NM_015214.2	NP_056029.2	O94830	DDHD2_HUMAN	DDHD domain containing 2	114					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)|urinary_tract(2)	28	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			GAGACGATGTACGTGGTTTTA	0.433																																					p.T114A		Atlas-SNP	.											.	DDHD2	60	.	0			c.A340G						PASS	.						229.0	230.0	229.0					8																	38092031		2203	4300	6503	SO:0001583	missense	23259	exon3			CGATGTACGTGGT	AK056525	CCDS34883.1	8p11.23	2014-03-03	2004-04-05	2004-04-07				"""Sterile alpha motif (SAM) domain containing"""	29106	protein-coding gene	gene with protein product		615003	"""SAM, WWE and DDHD domain containing 1"""	SAMWD1		9872452, 11788596, 19632984, 20932832	Standard	NM_015214		Approved	KIAA0725, SPG54	uc003xlc.3	O94830		ENST00000397166.2:c.340A>G	chr8.hg19:g.38092031A>G	ENSP00000380352:p.Thr114Ala	153.0	0.0	.		126.0	44.0	.	NM_001164232	B3KWV2|B3KXB5|Q9H8X7	Missense_Mutation	SNP	ENST00000397166.2	hg19	CCDS34883.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.394179	0.83011	.	.	ENSG00000085788	ENST00000527834;ENST00000397166;ENST00000533100;ENST00000528358;ENST00000529642;ENST00000532222;ENST00000520272	T;T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34;1.34	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.59528	0.2200	M	0.73217	2.22	0.80722	D	1	B;D	0.76494	0.157;0.999	B;D	0.78314	0.129;0.991	T	0.61802	-0.6988	10	0.56958	D	0.05	-16.5827	14.9594	0.71144	1.0:0.0:0.0:0.0	.	114;114	O94830;E9PKE6	DDHD2_HUMAN;.	A	114;114;114;112;18;114;114	ENSP00000432433:T114A;ENSP00000380352:T114A;ENSP00000432678:T114A;ENSP00000433118:T112A;ENSP00000436444:T18A;ENSP00000433578:T114A;ENSP00000429932:T114A	ENSP00000380352:T114A	T	+	1	0	DDHD2	38211188	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	8.398000	0.90195	2.207000	0.71202	0.533000	0.62120	ACG	.	.	.	none		0.433	DDHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377251.2	XM_291291	
PLEC	5339	hgsc.bcm.edu	37	8	144997605	144997605	+	Silent	SNP	G	G	A	rs575031901	byFrequency	TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr8:144997605G>A	ENST00000322810.4	-	31	7072	c.6903C>T	c.(6901-6903)gaC>gaT	p.D2301D	PLEC_ENST00000356346.3_Silent_p.D2150D|PLEC_ENST00000345136.3_Silent_p.D2164D|PLEC_ENST00000354589.3_Silent_p.D2164D|PLEC_ENST00000357649.2_Silent_p.D2168D|PLEC_ENST00000436759.2_Silent_p.D2191D|PLEC_ENST00000527096.1_Silent_p.D2187D|PLEC_ENST00000398774.2_Silent_p.D2132D|PLEC_ENST00000354958.2_Silent_p.D2142D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2301	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCATCTCCGCGTCAGCTGCCT	0.672													G|||	3	0.000599042	0.0	0.0	5008	,	,		11719	0.0		0.0	False		,,,				2504	0.0031				p.D2301D		Atlas-SNP	.											.	PLEC	1144	.	0			c.C6903T						PASS	.						11.0	14.0	13.0					8																	144997605		2085	4221	6306	SO:0001819	synonymous_variant	5339	exon31			CTCCGCGTCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6903C>T	chr8.hg19:g.144997605G>A		86.0	0.0	.		66.0	6.0	.	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	hg19	CCDS43772.1																																																																																			.	.	.	none		0.672	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
LOXL4	84171	hgsc.bcm.edu	37	10	100020789	100020789	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr10:100020789C>A	ENST00000260702.3	-	4	702	c.552G>T	c.(550-552)gaG>gaT	p.E184D		NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	184	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GCCAGTGGCCCTCATACTTCA	0.667																																					p.E184D		Atlas-SNP	.											.	LOXL4	60	.	0			c.G552T						PASS	.						106.0	79.0	88.0					10																	100020789		2203	4300	6503	SO:0001583	missense	84171	exon4			GTGGCCCTCATAC	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.552G>T	chr10.hg19:g.100020789C>A	ENSP00000260702:p.Glu184Asp	56.0	0.0	.		60.0	24.0	.	NM_032211	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	ENST00000260702.3	hg19	CCDS7473.1	.	.	.	.	.	.	.	.	.	.	C	8.607	0.888261	0.17540	.	.	ENSG00000138131	ENST00000260702	T	0.27557	1.66	5.53	-6.5	0.01884	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.474502	0.24985	N	0.034025	T	0.07863	0.0197	N	0.04508	-0.205	0.19300	N	0.999974	B	0.10296	0.003	B	0.13407	0.009	T	0.25572	-1.0128	10	0.12430	T	0.62	.	3.1247	0.06403	0.1631:0.1373:0.4253:0.2743	.	184	Q96JB6	LOXL4_HUMAN	D	184	ENSP00000260702:E184D	ENSP00000260702:E184D	E	-	3	2	LOXL4	100010779	0.004000	0.15560	0.578000	0.28575	0.859000	0.49053	-1.149000	0.03182	-1.027000	0.03325	-1.045000	0.02358	GAG	.	.	.	none		0.667	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211	
BIRC2	329	hgsc.bcm.edu	37	11	102220675	102220675	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr11:102220675T>G	ENST00000227758.2	+	2	1489	c.90T>G	c.(88-90)gaT>gaG	p.D30E	BIRC2_ENST00000532672.1_Missense_Mutation_p.D9E|BIRC2_ENST00000530675.1_Intron|BIRC2_ENST00000527910.1_3'UTR	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	30					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		TCTTGTCAGATTGGACAAACA	0.428																																					p.D30E		Atlas-SNP	.											.	BIRC2	51	.	0			c.T90G						PASS	.						121.0	118.0	119.0					11																	102220675		2203	4299	6502	SO:0001583	missense	329	exon2			GTCAGATTGGACA	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.90T>G	chr11.hg19:g.102220675T>G	ENSP00000227758:p.Asp30Glu	187.0	0.0	.		152.0	64.0	.	NM_001256163	B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	hg19	CCDS8316.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.647966	0.29336	.	.	ENSG00000110330	ENST00000227758;ENST00000541741;ENST00000532672;ENST00000527465	T;T;T	0.62232	2.13;2.12;0.04	5.5	3.2	0.36748	Baculoviral inhibition of apoptosis protein repeat (1);	0.583137	0.21661	N	0.071015	T	0.35885	0.0947	N	0.08118	0	0.09310	N	0.999993	B	0.13594	0.008	B	0.15484	0.013	T	0.15780	-1.0425	10	0.25106	T	0.35	-3.5714	5.9772	0.19387	0.0:0.1492:0.1389:0.7119	.	30	Q13490	BIRC2_HUMAN	E	30;30;9;9	ENSP00000227758:D30E;ENSP00000434979:D9E;ENSP00000434708:D9E	ENSP00000227758:D30E	D	+	3	2	BIRC2	101725885	0.069000	0.21087	0.937000	0.37676	0.729000	0.41735	0.134000	0.15932	0.519000	0.28406	-0.254000	0.11334	GAT	.	.	.	none		0.428	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166	
DLAT	1737	hgsc.bcm.edu	37	11	111899514	111899514	+	Splice_Site	SNP	A	A	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr11:111899514A>T	ENST00000280346.6	+	4	1165		c.e4-1		DLAT_ENST00000393051.1_Splice_Site|DLAT_ENST00000537636.1_Intron	NM_001931.4	NP_001922.2	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase						cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue acetyltransferase activity (GO:0004742)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)	22		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)		TCTCTTCCTTAGGCCTGAGGA	0.428																																					.		Atlas-SNP	.											.	DLAT	39	.	0			c.507-2A>T						PASS	.						70.0	78.0	76.0					11																	111899514		2201	4297	6498	SO:0001630	splice_region_variant	1737	exon4			TTCCTTAGGCCTG	Y00978	CCDS8354.1	11q23.1	2008-02-05	2008-02-04		ENSG00000150768	ENSG00000150768	2.3.1.12		2896	protein-coding gene	gene with protein product	"""E2 component of pyruvate dehydrogenase complex"""	608770		DLTA		8102256	Standard	NM_001931		Approved	PDC-E2	uc001pmo.3	P10515	OTTHUMG00000133751	ENST00000280346.6:c.507-1A>T	chr11.hg19:g.111899514A>T		99.0	0.0	.		68.0	25.0	.	NM_001931	Q16783|Q53EP3	Splice_Site	SNP	ENST00000280346.6	hg19	CCDS8354.1	.	.	.	.	.	.	.	.	.	.	A	19.61	3.860721	0.71834	.	.	ENSG00000150768	ENST00000280346;ENST00000534998;ENST00000393051	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4904	0.67647	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DLAT	111404724	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	7.704000	0.84595	1.836000	0.53414	0.377000	0.23210	.	.	.	.	none		0.428	DLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258167.1	NM_001931	Intron
ARHGAP32	9743	hgsc.bcm.edu	37	11	128846491	128846491	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr11:128846491C>G	ENST00000310343.9	-	19	2118	c.2119G>C	c.(2119-2121)Gag>Cag	p.E707Q	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.E633Q|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.E358Q|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.E358Q	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	707					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						AGAGACTCCTCACTTTTAGCT	0.363																																					p.E707Q		Atlas-SNP	.											ARHGAP32_ENST00000310343,right_lower_lobe,carcinoma,0,2	ARHGAP32	307	.	0			c.G2119C						PASS	.						107.0	108.0	108.0					11																	128846491		2201	4297	6498	SO:0001583	missense	9743	exon19			ACTCCTCACTTTT	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2119G>C	chr11.hg19:g.128846491C>G	ENSP00000310561:p.Glu707Gln	151.0	0.0	.		182.0	67.0	.	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	hg19	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	C	33	5.210996	0.95069	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.42314	0.1197	M	0.66939	2.045	0.58432	D	0.999999	P;P	0.52577	0.778;0.954	P;B	0.49451	0.611;0.393	T	0.17319	-1.0373	10	0.59425	D	0.04	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	641;707	Q86T64;A7KAX9	.;RHG32_HUMAN	Q	707;358;633;641;358	ENSP00000310561:E707Q;ENSP00000376425:E358Q;ENSP00000432468:E633Q;ENSP00000432862:E358Q	ENSP00000310561:E707Q	E	-	1	0	ARHGAP32	128351701	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	7.277000	0.78572	2.885000	0.99019	0.655000	0.94253	GAG	.	.	.	none		0.363	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
KRT5	3852	hgsc.bcm.edu	37	12	52910546	52910546	+	Silent	SNP	G	G	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr12:52910546G>A	ENST00000252242.4	-	7	1704	c.1314C>T	c.(1312-1314)gcC>gcT	p.A438A		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	438	Coil 2.|Rod.		A -> D (in WC-EBS). {ECO:0000269|PubMed:12655565}.		cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTTCTGCAGGGCCTCCTCCA	0.632																																					p.A438A		Atlas-SNP	.											KRT5,NS,haematopoietic_neoplasm,0,1	KRT5	88	.	0			c.C1314T						PASS	.						97.0	87.0	90.0					12																	52910546		2203	4300	6503	SO:0001819	synonymous_variant	3852	exon7			CTGCAGGGCCTCC		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.1314C>T	chr12.hg19:g.52910546G>A		76.0	0.0	.		73.0	24.0	.	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Silent	SNP	ENST00000252242.4	hg19	CCDS8830.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.547660	0.27652	.	.	ENSG00000186081	ENST00000548409	.	.	.	5.93	3.09	0.35607	.	.	.	.	.	T	0.55705	0.1937	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46707	-0.9172	4	.	.	.	.	7.3447	0.26656	0.2475:0.1167:0.6358:0.0	.	.	.	.	S	146	.	.	P	-	1	0	KRT5	51196813	0.156000	0.22821	0.991000	0.47740	0.976000	0.68499	-0.471000	0.06631	0.389000	0.25086	0.655000	0.94253	CCT	.	.	.	none		0.632	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
ESYT1	23344	hgsc.bcm.edu	37	12	56536880	56536880	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr12:56536880A>G	ENST00000394048.5	+	28	3331	c.3067A>G	c.(3067-3069)Aag>Gag	p.K1023E	ESYT1_ENST00000541590.1_Missense_Mutation_p.K1033E|ESYT1_ENST00000267113.4_Missense_Mutation_p.K1033E	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	1023	C2 5. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Required for phosphatidylinositol 4,5- bisphosphate-dependent location at the cell membrane. {ECO:0000250}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CCGAGGCACCAAGAGGAGGAC	0.522																																					p.K1033E		Atlas-SNP	.											.	ESYT1	84	.	0			c.A3097G						PASS	.						133.0	127.0	129.0					12																	56536880		2203	4300	6503	SO:0001583	missense	23344	exon28			GGCACCAAGAGGA	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.3067A>G	chr12.hg19:g.56536880A>G	ENSP00000377612:p.Lys1023Glu	66.0	0.0	.		53.0	26.0	.	NM_001184796	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	hg19	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.744295	0.89663	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.70869	-0.52;-0.52;-0.52	5.22	5.22	0.72569	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.107964	0.64402	D	0.000011	D	0.84570	0.5501	M	0.88512	2.96	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.994	D	0.83962	0.0322	10	0.22109	T	0.4	-23.4658	12.9417	0.58348	1.0:0.0:0.0:0.0	.	1033;1023	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	E	1023;977;1033;1033	ENSP00000377612:K1023E;ENSP00000267113:K1033E;ENSP00000445952:K1033E	ENSP00000267113:K1033E	K	+	1	0	ESYT1	54823147	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.577000	0.67444	2.107000	0.64212	0.459000	0.35465	AAG	.	.	.	none		0.522	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
IFT81	28981	hgsc.bcm.edu	37	12	110618356	110618356	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr12:110618356G>A	ENST00000242591.5	+	12	1824	c.1318G>A	c.(1318-1320)Gaa>Aaa	p.E440K	IFT81_ENST00000552912.1_Missense_Mutation_p.E440K	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	440					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						GCAACGTCATGAAAATATTCA	0.353																																					p.E440K		Atlas-SNP	.											.	IFT81	86	.	0			c.G1318A						PASS	.						74.0	66.0	69.0					12																	110618356		1826	4083	5909	SO:0001583	missense	28981	exon12			CGTCATGAAAATA	AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.1318G>A	chr12.hg19:g.110618356G>A	ENSP00000242591:p.Glu440Lys	77.0	0.0	.		61.0	21.0	.	NM_014055	Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	ENST00000242591.5	hg19	CCDS41831.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.712746	0.68730	.	.	ENSG00000122970	ENST00000552912;ENST00000242591	T;T	0.16743	2.32;2.32	6.07	5.19	0.71726	.	0.346210	0.36815	N	0.002382	T	0.22475	0.0542	M	0.65975	2.015	0.80722	D	1	P	0.39862	0.692	B	0.39840	0.311	T	0.02852	-1.1102	10	0.22706	T	0.39	-12.7522	15.5714	0.76341	0.0659:0.0:0.9341:0.0	.	440	Q8WYA0	IFT81_HUMAN	K	440	ENSP00000449718:E440K;ENSP00000242591:E440K	ENSP00000242591:E440K	E	+	1	0	IFT81	109102739	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	5.664000	0.68045	1.580000	0.49851	-0.150000	0.13652	GAA	.	.	.	none		0.353	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	NM_014055	
IFT81	28981	hgsc.bcm.edu	37	12	110618362	110618362	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr12:110618362A>T	ENST00000242591.5	+	12	1830	c.1324A>T	c.(1324-1326)Att>Ttt	p.I442F	IFT81_ENST00000552912.1_Missense_Mutation_p.I442F	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	442					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						TCATGAAAATATTCAACAACA	0.338																																					p.I442F		Atlas-SNP	.											.	IFT81	86	.	0			c.A1324T						PASS	.						70.0	63.0	66.0					12																	110618362		1829	4082	5911	SO:0001583	missense	28981	exon12			GAAAATATTCAAC	AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.1324A>T	chr12.hg19:g.110618362A>T	ENSP00000242591:p.Ile442Phe	74.0	0.0	.		59.0	20.0	.	NM_014055	Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	ENST00000242591.5	hg19	CCDS41831.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.326704	0.41197	.	.	ENSG00000122970	ENST00000552912;ENST00000242591	T;T	0.17691	2.26;2.26	6.07	4.92	0.64577	.	0.309061	0.39210	N	0.001424	T	0.14270	0.0345	L	0.38838	1.175	0.80722	D	1	B	0.12013	0.005	B	0.13407	0.009	T	0.05649	-1.0872	10	0.27785	T	0.31	-12.4757	12.5221	0.56065	0.9341:0.0:0.0659:0.0	.	442	Q8WYA0	IFT81_HUMAN	F	442	ENSP00000449718:I442F;ENSP00000242591:I442F	ENSP00000242591:I442F	I	+	1	0	IFT81	109102745	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.247000	0.58750	2.326000	0.78906	0.533000	0.62120	ATT	.	.	.	none		0.338	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	NM_014055	
CIPC	85457	hgsc.bcm.edu	37	14	77580331	77580331	+	Silent	SNP	C	C	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr14:77580331C>T	ENST00000361786.2	+	4	1187	c.870C>T	c.(868-870)agC>agT	p.S290S	RP11-463C8.4_ENST00000557752.1_Intron	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		290					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		CTAATTATAGCTCACCTTTAT	0.542																																					p.S290S		Atlas-SNP	.											.	KIAA1737	26	.	0			c.C870T						PASS	.						99.0	93.0	95.0					14																	77580331		2203	4300	6503	SO:0001819	synonymous_variant	85457	exon4			TTATAGCTCACCT																												ENST00000361786.2:c.870C>T	chr14.hg19:g.77580331C>T		80.0	0.0	.		62.0	26.0	.	NM_033426	B2RCI1|Q8N389|Q8NDZ1	Silent	SNP	ENST00000361786.2	hg19	CCDS9855.1																																																																																			.	.	.	none		0.542	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414278.1		
CHTF18	63922	hgsc.bcm.edu	37	16	841194	841194	+	Missense_Mutation	SNP	T	T	G	rs374149034		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr16:841194T>G	ENST00000262315.9	+	8	991	c.928T>G	c.(928-930)Ttg>Gtg	p.L310V	CHTF18_ENST00000317063.6_Missense_Mutation_p.L505V|CHTF18_ENST00000455171.2_Missense_Mutation_p.L338V|CHTF18_ENST00000491530.1_3'UTR|RPUSD1_ENST00000007264.2_5'Flank|RPUSD1_ENST00000567114.1_5'Flank|RPUSD1_ENST00000565809.1_5'Flank	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	310					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				GTGGCTGAAGTTGTGGGACCT	0.662																																					p.L310V		Atlas-SNP	.											.	CHTF18	52	.	0			c.T928G						PASS	.	T	VAL/LEU	0,4244		0,0,2122	20.0	25.0	23.0		928	2.8	1.0	16		23	1,8443		0,1,4221	no	missense	CHTF18	NM_022092.2	32	0,1,6343	GG,GT,TT		0.0118,0.0,0.0079	probably-damaging	310/976	841194	1,12687	2122	4222	6344	SO:0001583	missense	63922	exon8			CTGAAGTTGTGGG	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.928T>G	chr16.hg19:g.841194T>G	ENSP00000262315:p.Leu310Val	36.0	0.0	.		51.0	19.0	.	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	hg19	CCDS45371.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.44|15.44	2.832785|2.832785	0.50951|0.50951	0.0|0.0	1.18E-4|1.18E-4	ENSG00000127586|ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315|ENST00000426047	T;T;T|.	0.17691|.	2.26;2.26;2.26|.	4.85|4.85	2.78|2.78	0.32641|0.32641	.|.	0.070845|.	0.56097|.	N|.	0.000026|.	T|T	0.73590|0.73590	0.3606|0.3606	M|M	0.85197|0.85197	2.74|2.74	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|T	0.72776|0.72776	-0.4191|-0.4191	10|5	0.30078|.	T|.	0.28|.	-21.219|-21.219	9.1807|9.1807	0.37141|0.37141	0.0:0.8168:0.0:0.1832|0.0:0.8168:0.0:0.1832	.|.	338;310|.	Q8WVB6-2;Q8WVB6|.	.;CTF18_HUMAN|.	V|G	505;338;310|205	ENSP00000313029:L505V;ENSP00000406252:L338V;ENSP00000262315:L310V|.	ENSP00000262315:L310V|.	L|V	+|+	1|2	2|0	CHTF18|CHTF18	781195|781195	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.967000|0.967000	0.64934|0.64934	3.942000|3.942000	0.56614|0.56614	0.564000|0.564000	0.29238|0.29238	-0.301000|-0.301000	0.09380|0.09380	TTG|GTT	.	.	.	weak		0.662	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
CREBBP	1387	hgsc.bcm.edu	37	16	3860645	3860645	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr16:3860645T>C	ENST00000262367.5	-	3	1743	c.934A>G	c.(934-936)Aca>Gca	p.T312A	CREBBP_ENST00000382070.3_Missense_Mutation_p.T312A	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	312	Interaction with SRCAP.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTGATATCTGTAGGGAAGGTG	0.527			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.T312A		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.A934G						PASS	.						215.0	196.0	203.0					16																	3860645		2197	4300	6497	SO:0001583	missense	1387	exon3			TATCTGTAGGGAA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.934A>G	chr16.hg19:g.3860645T>C	ENSP00000262367:p.Thr312Ala	121.0	0.0	.		95.0	29.0	.	NM_001079846	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	hg19	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	T	10.24	1.294678	0.23564	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.82433	-1.61;-1.52	5.28	-6.97	0.01616	.	0.454713	0.21929	N	0.067045	T	0.55847	0.1946	N	0.19112	0.55	0.22737	N	0.998795	B;B	0.24721	0.069;0.11	B;B	0.21546	0.035;0.011	T	0.60078	-0.7333	10	0.05525	T	0.97	-0.0051	5.1164	0.14836	0.2035:0.4842:0.0877:0.2246	.	380;312	Q4LE28;Q92793	.;CBP_HUMAN	A	312;380;312	ENSP00000262367:T312A;ENSP00000371502:T312A	ENSP00000262367:T312A	T	-	1	0	CREBBP	3800646	0.001000	0.12720	0.643000	0.29450	0.974000	0.67602	-0.279000	0.08479	-0.852000	0.04141	0.460000	0.39030	ACA	.	.	.	none		0.527	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
TMEM186	25880	hgsc.bcm.edu	37	16	8890188	8890188	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr16:8890188G>A	ENST00000333050.6	-	2	296	c.263C>T	c.(262-264)cCa>cTa	p.P88L	PMM2_ENST00000537352.1_5'Flank|PMM2_ENST00000268261.4_5'Flank|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000566983.1_Intron|PMM2_ENST00000539622.1_5'Flank|PMM2_ENST00000569958.1_5'Flank	NM_015421.3	NP_056236.2	Q96B77	TM186_HUMAN	transmembrane protein 186	88						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9						GTAATAGCCTGGTGGCAAAGC	0.527																																					p.P88L		Atlas-SNP	.											.	TMEM186	21	.	0			c.C263T						PASS	.						113.0	99.0	104.0					16																	8890188		2197	4300	6497	SO:0001583	missense	25880	exon2			TAGCCTGGTGGCA	BC015912	CCDS10535.1	16p13.2	2008-02-05	2007-02-08	2007-02-08	ENSG00000184857	ENSG00000184857			24530	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 51"""	C16orf51		11230166	Standard	NM_015421		Approved	DKFZP564K2062	uc002cze.3	Q96B77	OTTHUMG00000129696	ENST00000333050.6:c.263C>T	chr16.hg19:g.8890188G>A	ENSP00000331640:p.Pro88Leu	70.0	0.0	.		57.0	23.0	.	NM_015421	B2RAY0|Q9Y4T4	Missense_Mutation	SNP	ENST00000333050.6	hg19	CCDS10535.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022735	0.35701	.	.	ENSG00000184857	ENST00000333050	.	.	.	5.36	3.38	0.38709	.	0.000000	0.45606	D	0.000348	T	0.51126	0.1656	M	0.63428	1.95	0.54753	D	0.999989	P	0.37207	0.587	B	0.34242	0.178	T	0.54715	-0.8252	9	0.46703	T	0.11	-11.2014	10.9642	0.47403	0.1567:0.0:0.8433:0.0	.	88	Q96B77	TM186_HUMAN	L	88	.	ENSP00000331640:P88L	P	-	2	0	TMEM186	8797689	1.000000	0.71417	0.011000	0.14972	0.025000	0.11179	6.023000	0.70848	1.275000	0.44379	0.561000	0.74099	CCA	.	.	.	none		0.527	TMEM186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251903.1	NM_015421	
SRCAP	10847	hgsc.bcm.edu	37	16	30731535	30731535	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr16:30731535G>A	ENST00000262518.4	+	19	3255	c.2870G>A	c.(2869-2871)cGa>cAa	p.R957Q	SRCAP_ENST00000344771.4_Missense_Mutation_p.R957Q|SRCAP_ENST00000395059.2_Missense_Mutation_p.R957Q	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	957					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CGTGTCTCTCGATATGAGGCA	0.542																																					p.R957Q		Atlas-SNP	.											.	SRCAP	298	.	0			c.G2870A						PASS	.						183.0	184.0	183.0					16																	30731535		2197	4300	6497	SO:0001583	missense	10847	exon19			TCTCTCGATATGA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2870G>A	chr16.hg19:g.30731535G>A	ENSP00000262518:p.Arg957Gln	159.0	0.0	.		143.0	60.0	.	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971261	0.92919	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92249	-3.0;-2.87;-2.94	5.45	5.45	0.79879	.	0.000000	0.48286	D	0.000186	D	0.94574	0.8252	L	0.47716	1.5	0.43347	D	0.995408	D;D;D	0.89917	0.994;1.0;1.0	P;D;D	0.85130	0.884;0.997;0.994	D	0.94120	0.7378	10	0.45353	T	0.12	-7.4366	18.0556	0.89363	0.0:0.0:1.0:0.0	.	957;957;957	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	Q	957	ENSP00000262518:R957Q;ENSP00000378499:R957Q;ENSP00000343042:R957Q	ENSP00000262518:R957Q	R	+	2	0	SRCAP	30639036	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.067000	0.93955	2.569000	0.86673	0.484000	0.47621	CGA	.	.	.	none		0.542	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
CIRH1A	84916	hgsc.bcm.edu	37	16	69170698	69170698	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr16:69170698G>A	ENST00000314423.7	+	3	436	c.259G>A	c.(259-261)Gat>Aat	p.D87N	CIRH1A_ENST00000352319.4_Missense_Mutation_p.D87N|CIRH1A_ENST00000563094.1_Missense_Mutation_p.D87N			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	87					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		TATGGAGTATGATTTACAGGC	0.488																																					p.D87N	Melanoma(69;1156 1278 4951 8715 52012)	Atlas-SNP	.											.	CIRH1A	48	.	0			c.G259A						PASS	.						239.0	237.0	238.0					16																	69170698		2198	4300	6498	SO:0001583	missense	84916	exon3			GAGTATGATTTAC	AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.259G>A	chr16.hg19:g.69170698G>A	ENSP00000327179:p.Asp87Asn	304.0	0.0	.		226.0	85.0	.	NM_032830	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	ENST00000314423.7	hg19	CCDS10872.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926883	0.52759	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.44482	0.92;0.92	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	L	0.52905	1.665	0.80722	D	1	P;D	0.61080	0.929;0.989	B;P	0.49683	0.296;0.619	T	0.37244	-0.9714	10	0.33940	T	0.23	.	19.6231	0.95667	0.0:0.0:1.0:0.0	.	87;87	Q969X6;Q969X6-3	CIR1A_HUMAN;.	N	87	ENSP00000327179:D87N;ENSP00000339164:D87N	ENSP00000327179:D87N	D	+	1	0	CIRH1A	67728199	1.000000	0.71417	1.000000	0.80357	0.486000	0.33341	8.755000	0.91646	2.818000	0.97014	0.655000	0.94253	GAT	.	.	.	none		0.488	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	NM_032830	
ATP2C2	9914	hgsc.bcm.edu	37	16	84482189	84482189	+	Silent	SNP	C	C	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr16:84482189C>T	ENST00000262429.4	+	17	1643	c.1554C>T	c.(1552-1554)cgC>cgT	p.R518R	ATP2C2_ENST00000416219.2_Silent_p.R518R|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	518					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						AGGTGATCCGCTACTGCACCA	0.532																																					p.R518R		Atlas-SNP	.											.	ATP2C2	75	.	0			c.C1554T						PASS	.						84.0	91.0	89.0					16																	84482189		1988	4150	6138	SO:0001819	synonymous_variant	9914	exon17			GATCCGCTACTGC	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1554C>T	chr16.hg19:g.84482189C>T		91.0	0.0	.		80.0	24.0	.	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Silent	SNP	ENST00000262429.4	hg19	CCDS42207.1																																																																																			.	.	.	none		0.532	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
MLLT6	4302	hgsc.bcm.edu	37	17	36865775	36865775	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr17:36865775G>C	ENST00000325718.7	+	6	590	c.499G>C	c.(499-501)Gag>Cag	p.E167Q	MLLT6_ENST00000378137.5_Missense_Mutation_p.E167Q	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	167					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					AGAAGTGCTGGAGGTGGACAA	0.562			T	MLL	AL																																p.E167Q		Atlas-SNP	.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	80	.	0			c.G499C						PASS	.						154.0	110.0	124.0					17																	36865775		2203	4300	6503	SO:0001583	missense	4302	exon6			GTGCTGGAGGTGG		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.499G>C	chr17.hg19:g.36865775G>C	ENSP00000316426:p.Glu167Gln	51.0	0.0	.		46.0	10.0	.	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Missense_Mutation	SNP	ENST00000325718.7	hg19	CCDS11327.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223152	0.58668	.	.	ENSG00000108292	ENST00000325718;ENST00000378137	T;T	0.14640	2.49;2.49	4.35	3.37	0.38596	Zinc finger, PHD-finger (1);Zinc finger, PHD-type (1);	0.066588	0.64402	D	0.000018	T	0.23926	0.0579	L	0.41356	1.27	0.45747	D	0.998647	D;D;D	0.63046	0.971;0.971;0.992	P;P;D	0.65233	0.786;0.786;0.933	T	0.01375	-1.1371	10	0.26408	T	0.33	.	13.395	0.60846	0.0:0.1591:0.8408:0.0	.	167;167;167	E9PEP1;Q6P2C6;P55198	.;.;AF17_HUMAN	Q	167	ENSP00000316426:E167Q;ENSP00000367377:E167Q	ENSP00000316426:E167Q	E	+	1	0	MLLT6	34119301	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.257000	0.95545	1.161000	0.42604	0.591000	0.81541	GAG	.	.	.	none		0.562	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
ACLY	47	hgsc.bcm.edu	37	17	40054090	40054090	+	Silent	SNP	C	C	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr17:40054090C>T	ENST00000352035.2	-	13	1471	c.1341G>A	c.(1339-1341)acG>acA	p.T447T	ACLY_ENST00000590151.1_Silent_p.T447T|ACLY_ENST00000393896.2_Silent_p.T447T|ACLY_ENST00000353196.1_Silent_p.T447T|ACLY_ENST00000537919.1_Silent_p.T186T	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	447					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				TGGGGGCTGGCGTCTGGGGTG	0.522																																					p.T447T	Colon(64;807 1396 15971 30971)	Atlas-SNP	.											.	ACLY	85	.	0			c.G1341A						PASS	.						37.0	38.0	38.0					17																	40054090		2203	4300	6503	SO:0001819	synonymous_variant	47	exon13			GGCTGGCGTCTGG	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.1341G>A	chr17.hg19:g.40054090C>T		31.0	0.0	.		35.0	15.0	.	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	ENST00000352035.2	hg19	CCDS11412.1																																																																																			.	.	.	none		0.522	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
CABLES1	91768	hgsc.bcm.edu	37	18	20793942	20793942	+	Splice_Site	SNP	A	A	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr18:20793942A>G	ENST00000256925.7	+	4	1012	c.1012A>G	c.(1012-1014)Ata>Gta	p.I338V	CABLES1_ENST00000420687.2_Splice_Site_p.I73V|CABLES1_ENST00000585061.1_Intron|TMEM241_ENST00000450466.2_Intron|CABLES1_ENST00000400473.2_Splice_Site_p.I11V	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	338	Interacts with CDK3. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATTTTTTAGAATAGTCCTTAT	0.348																																					p.I338V		Atlas-SNP	.											.	CABLES1	32	.	0			c.A1012G						PASS	.						82.0	75.0	77.0					18																	20793942		1857	4091	5948	SO:0001630	splice_region_variant	91768	exon4			TTTAGAATAGTCC	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.1011-1A>G	chr18.hg19:g.20793942A>G		60.0	0.0	.		65.0	26.0	.	NM_001100619	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Missense_Mutation	SNP	ENST00000256925.7	hg19	CCDS42417.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339421	0.81911	.	.	ENSG00000134508	ENST00000400473;ENST00000256925;ENST00000420687	T;T;T	0.49432	0.78;0.78;0.82	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.62282	0.2415	L	0.56280	1.765	0.80722	D	1	P;D	0.59357	0.65;0.985	P;D	0.67548	0.743;0.952	T	0.57631	-0.7778	10	0.27082	T	0.32	-17.3786	15.8255	0.78703	1.0:0.0:0.0:0.0	.	73;338	Q8TDN4-2;Q8TDN4	.;CABL1_HUMAN	V	11;338;73	ENSP00000383321:I11V;ENSP00000256925:I338V;ENSP00000413851:I73V	ENSP00000256925:I338V	I	+	1	0	CABLES1	19047940	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.722000	0.91452	2.224000	0.72417	0.477000	0.44152	ATA	.	.	.	none		0.348	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2	NM_138375	Missense_Mutation
EFNA2	1943	hgsc.bcm.edu	37	19	1295670	1295670	+	Silent	SNP	C	C	T	rs561395362		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr19:1295670C>T	ENST00000215368.2	+	2	282	c.267C>T	c.(265-267)taC>taT	p.Y89Y	MUM1_ENST00000344663.3_Intron	NM_001405.3	NP_001396.2	O43921	EFNA2_HUMAN	ephrin-A2	89	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|olfactory bulb development (GO:0021772)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			lung(2)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGCACTACGTGCTGTACA	0.706													C|||	1	0.000199681	0.0	0.0	5008	,	,		8346	0.0		0.0	False		,,,				2504	0.001				p.Y89Y		Atlas-SNP	.											.	EFNA2	8	.	0			c.C267T						PASS	.						25.0	21.0	22.0					19																	1295670		2198	4290	6488	SO:0001819	synonymous_variant	1943	exon2			GCACTACGTGCTG		CCDS12061.1	19p13	2011-03-09			ENSG00000099617	ENSG00000099617		"""Ephrins"""	3222	protein-coding gene	gene with protein product		602756		EPLG6			Standard	NM_001405		Approved	ELF-1, LERK6	uc002lry.2	O43921		ENST00000215368.2:c.267C>T	chr19.hg19:g.1295670C>T		54.0	0.0	.		52.0	22.0	.	NM_001405	O76020	Silent	SNP	ENST00000215368.2	hg19	CCDS12061.1																																																																																			.	.	.	none		0.706	EFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450016.1	NM_001405	
KDM4B	23030	hgsc.bcm.edu	37	19	5039997	5039997	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr19:5039997T>C	ENST00000159111.4	+	4	510	c.292T>C	c.(292-294)Tac>Cac	p.Y98H	KDM4B_ENST00000536461.1_Missense_Mutation_p.Y98H|KDM4B_ENST00000381759.4_Missense_Mutation_p.Y98H	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	98					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						AGTGGGCGAGTACCGCCGCCT	0.697																																					p.Y98H		Atlas-SNP	.											.	KDM4B	120	.	0			c.T292C						PASS	.						45.0	40.0	42.0					19																	5039997		2203	4300	6503	SO:0001583	missense	23030	exon4			GGCGAGTACCGCC	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.292T>C	chr19.hg19:g.5039997T>C	ENSP00000159111:p.Tyr98His	57.0	0.0	.		46.0	23.0	.	NM_015015	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	ENST00000159111.4	hg19	CCDS12138.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505972	0.85282	.	.	ENSG00000127663	ENST00000159111;ENST00000381759;ENST00000536461	T;T;T	0.50277	0.75;0.75;0.75	4.04	4.04	0.47022	.	0.075962	0.56097	D	0.000036	T	0.67496	0.2899	M	0.76838	2.35	0.58432	D	0.999999	D;D;D	0.67145	0.996;0.993;0.994	D;D;D	0.74348	0.983;0.951;0.92	T	0.73170	-0.4067	10	0.87932	D	0	-36.4153	13.4363	0.61086	0.0:0.0:0.0:1.0	.	98;98;98	F5GX28;O94953-2;O94953	.;.;KDM4B_HUMAN	H	98	ENSP00000159111:Y98H;ENSP00000371178:Y98H;ENSP00000440495:Y98H	ENSP00000159111:Y98H	Y	+	1	0	KDM4B	4990997	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.730000	0.84881	1.817000	0.53016	0.379000	0.24179	TAC	.	.	.	none		0.697	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
ANGPTL4	51129	hgsc.bcm.edu	37	19	8438718	8438718	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr19:8438718T>A	ENST00000301455.2	+	7	1340	c.1169T>A	c.(1168-1170)cTg>cAg	p.L390Q	ANGPTL4_ENST00000541807.1_Missense_Mutation_p.L223Q|RAB11B-AS1_ENST00000597407.1_RNA|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.L352Q|RAB11B-AS1_ENST00000597785.1_RNA|RAB11B-AS1_ENST00000593581.1_RNA	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	390	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						TACTACCCGCTGCAGGCCACC	0.622																																					p.L390Q		Atlas-SNP	.											.	ANGPTL4	21	.	0			c.T1169A						PASS	.						67.0	75.0	72.0					19																	8438718		2203	4300	6503	SO:0001583	missense	51129	exon7			ACCCGCTGCAGGC	AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.1169T>A	chr19.hg19:g.8438718T>A	ENSP00000301455:p.Leu390Gln	59.0	0.0	.		47.0	19.0	.	NM_139314	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	ENST00000301455.2	hg19	CCDS12200.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.237776	0.79800	.	.	ENSG00000167772	ENST00000301455;ENST00000393962;ENST00000541807	T;T;T	0.80393	-1.37;-1.37;-1.37	5.62	5.62	0.85841	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.64402	D	0.000004	D	0.92080	0.7490	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93951	0.7232	10	0.87932	D	0	.	14.6557	0.68831	0.0:0.0:0.0:1.0	.	352;390	A8MY84;Q9BY76	.;ANGL4_HUMAN	Q	390;352;223	ENSP00000301455:L390Q;ENSP00000377534:L352Q;ENSP00000439833:L223Q	ENSP00000301455:L390Q	L	+	2	0	ANGPTL4	8344718	1.000000	0.71417	0.934000	0.37439	0.634000	0.38068	7.489000	0.81451	2.136000	0.66102	0.533000	0.62120	CTG	.	.	.	none		0.622	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460322.1	NM_139314	
RASGRP4	115727	hgsc.bcm.edu	37	19	38903684	38903684	+	Silent	SNP	C	C	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr19:38903684C>T	ENST00000587738.1	-	12	1492	c.1422G>A	c.(1420-1422)gtG>gtA	p.V474V	RASGRP4_ENST00000586305.1_Silent_p.V460V|RASGRP4_ENST00000426920.2_Silent_p.V285V|RASGRP4_ENST00000433821.2_Silent_p.V382V|RASGRP4_ENST00000587753.1_Silent_p.V405V|RASGRP4_ENST00000293062.9_Silent_p.V377V|RASGRP4_ENST00000454404.2_Silent_p.V440V			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	474	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AATTCTTGAACACAGACTTCA	0.532																																					p.V474V		Atlas-SNP	.											.	RASGRP4	54	.	0			c.G1422A						PASS	.						50.0	53.0	52.0					19																	38903684		1927	4137	6064	SO:0001819	synonymous_variant	115727	exon12			CTTGAACACAGAC	AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.1422G>A	chr19.hg19:g.38903684C>T		53.0	0.0	.		40.0	19.0	.	NM_170604	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	ENST00000587738.1	hg19	CCDS46068.1																																																																																			.	.	.	none		0.532	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460540.1	NM_170604	
DLGAP4	22839	hgsc.bcm.edu	37	20	35060886	35060886	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr20:35060886A>G	ENST00000373907.2	+	2	965	c.766A>G	c.(766-768)Acc>Gcc	p.T256A	DLGAP4_ENST00000373913.3_Missense_Mutation_p.T256A|DLGAP4_ENST00000339266.5_Missense_Mutation_p.T256A|DLGAP4_ENST00000401952.2_Missense_Mutation_p.T256A			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	256					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CATGCTCAAAACCACCAAGAA	0.627																																					p.T256A		Atlas-SNP	.											.	DLGAP4	111	.	0			c.A766G						PASS	.						69.0	66.0	67.0					20																	35060886		2203	4300	6503	SO:0001583	missense	22839	exon2			CTCAAAACCACCA	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.766A>G	chr20.hg19:g.35060886A>G	ENSP00000363014:p.Thr256Ala	78.0	0.0	.		67.0	26.0	.	NM_014902	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	ENST00000373907.2	hg19		.	.	.	.	.	.	.	.	.	.	A	2.470	-0.322180	0.05350	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	5.37	-1.76	0.08006	.	0.677891	0.15516	N	0.258311	T	0.04952	0.0133	N	0.04018	-0.295	0.25098	N	0.990804	B	0.02656	0.0	B	0.01281	0.0	T	0.40496	-0.9560	10	0.09590	T	0.72	.	4.2281	0.10590	0.3059:0.0:0.3662:0.3279	.	256	Q9Y2H0-1	.	A	256	ENSP00000363023:T256A;ENSP00000384954:T256A;ENSP00000363014:T256A;ENSP00000341633:T256A	ENSP00000341633:T256A	T	+	1	0	DLGAP4	34494300	0.992000	0.36948	0.904000	0.35570	0.983000	0.72400	0.322000	0.19576	-0.216000	0.10048	-0.252000	0.11476	ACC	.	.	.	none		0.627	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902	
RAD23A	5886	hgsc.bcm.edu	37	19	13060221	13060221	+	Splice_Site	DEL	A	A	-			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr19:13060221delA	ENST00000586534.1	+	7	873	c.812delA	c.(811-813)cag>cg	p.Q272fs	RAD23A_ENST00000588826.2_3'UTR|RAD23A_ENST00000541222.1_Splice_Site_p.Q107fs|RAD23A_ENST00000592268.1_Splice_Site_p.Q271fs|RAD23A_ENST00000316856.3_Splice_Site_p.Q271fs			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	272					nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						CAGCTTTTACAGGTGTGGTCC	0.602								Nucleotide excision repair (NER)																													p.Q271fs		Atlas-Indel,Pindel	.											.	RAD23A	29	.	0			c.811delC						PASS	.						53.0	57.0	56.0					19																	13060221		2203	4300	6503	SO:0001630	splice_region_variant	5886	exon7			.		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.813+1A>-	chr19.hg19:g.13060221delA		65.0	0.0	0		52.0	25.0	0.480769	NM_005053	K7ESE3|Q59EU8|Q5M7Z1	Frame_Shift_Del	DEL	ENST00000586534.1	hg19	CCDS12289.1																																																																																			.	.	.	none		0.602	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	Frame_Shift_Del
SEMA3F	6405	hgsc.bcm.edu	37	3	50222188	50222188	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr3:50222188delT	ENST00000002829.3	+	13	1881	c.1397delT	c.(1396-1398)attfs	p.I466fs	SEMA3F_ENST00000434342.1_Frame_Shift_Del_p.I435fs|SEMA3F_ENST00000413852.1_Frame_Shift_Del_p.I367fs	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	466	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		CTTACCACTATTGCCGTGGAC	0.652																																					p.I466fs		Atlas-Indel,Pindel	.											.	SEMA3F	62	.	0			c.1396delA						PASS	.						69.0	58.0	61.0					3																	50222188		2203	4299	6502	SO:0001589	frameshift_variant	6405	exon13			.	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.1397delT	chr3.hg19:g.50222188delT	ENSP00000002829:p.Ile466fs	66.0	0.0	0		73.0	23.0	0.315068	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Frame_Shift_Del	DEL	ENST00000002829.3	hg19	CCDS2811.1																																																																																			.	.	.	none		0.652	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
SLC25A11	8402	hgsc.bcm.edu	37	17	4841106	4841107	+	Frame_Shift_Ins	INS	-	-	G			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr17:4841106_4841107insG	ENST00000225665.7	-	8	1214_1215	c.874_875insC	c.(874-876)cacfs	p.H292fs	RNF167_ENST00000576229.1_5'Flank|RNF167_ENST00000571816.1_5'Flank|RNF167_ENST00000575111.1_5'Flank|RNF167_ENST00000572430.1_5'Flank|RNF167_ENST00000262482.6_5'Flank|SLC25A11_ENST00000544061.2_Frame_Shift_Ins_p.H241fs	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	292					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						GAGGACGGTGTGGGGGCCCAGG	0.609																																					p.H292fs	Esophageal Squamous(144;1178 2388 18010 48797)	Atlas-Indel,Pindel	.											.	SLC25A11	22	.	0			c.875_876insC						PASS	.																																			SO:0001589	frameshift_variant	8402	exon8			.	X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.875dupC	chr17.hg19:g.4841111_4841111dupG	ENSP00000225665:p.His292fs	42.0	0.0	0		45.0	20.0	0.444444	NM_003562	F5GY65|O75537|Q969P7	Frame_Shift_Ins	INS	ENST00000225665.7	hg19	CCDS11059.1																																																																																			.	.	.	none		0.609	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216852.4	NM_003562	
ARG1	383	hgsc.bcm.edu	37	6	131903762	131903762	+	Splice_Site	DEL	T	T	-	rs200319835		TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr6:131903762delT	ENST00000368087.3	+	5	606	c.467delT	c.(466-468)att>at	p.I156fs	MED23_ENST00000354577.4_Intron|ARG1_ENST00000356962.2_Splice_Site_p.I164fs			P05089	ARGI1_HUMAN	arginase 1	156					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|liver development (GO:0001889)|lung development (GO:0030324)|mammary gland involution (GO:0060056)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of endothelial cell proliferation (GO:0001938)|protein homotrimerization (GO:0070207)|regulation of L-arginine import (GO:0010963)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to herbicide (GO:0009635)|response to manganese ion (GO:0010042)|response to methylmercury (GO:0051597)|response to selenium ion (GO:0010269)|response to vitamin A (GO:0033189)|response to vitamin E (GO:0033197)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	arginase activity (GO:0004053)|manganese ion binding (GO:0030145)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|skin(3)	14	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0106)|OV - Ovarian serous cystadenocarcinoma(155;0.0713)	L-Ornithine(DB00129)	TAATTTTAGATTCCCGATGTG	0.393																																					p.I164fs		Atlas-Indel,Pindel	.											.	ARG1	33	.	0			c.490delA						PASS	.						127.0	121.0	123.0					6																	131903762		2203	4300	6503	SO:0001630	splice_region_variant	383	exon5			.		CCDS5145.1, CCDS59038.1	6q23	2013-05-01	2013-05-01		ENSG00000118520	ENSG00000118520	3.5.3.1		663	protein-coding gene	gene with protein product		608313	"""arginase, liver"""			22959135	Standard	NM_000045		Approved		uc003qcp.2	P05089	OTTHUMG00000015566	ENST00000368087.3:c.466-1T>-	chr6.hg19:g.131903762delT		95.0	0.0	0		138.0	40.0	0.289855	NM_001244438	A6NEA0|Q5JWT5|Q5JWT6|Q8TE72|Q9BS50	Frame_Shift_Del	DEL	ENST00000368087.3	hg19	CCDS5145.1																																																																																			.	.	.	none		0.393	ARG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042223.1		Frame_Shift_Del
HIVEP3	59269	hgsc.bcm.edu	37	1	42047342	42047343	+	Frame_Shift_Ins	INS	-	-	T			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr1:42047342_42047343insT	ENST00000372583.1	-	4	4011_4012	c.3126_3127insA	c.(3124-3129)aaatgcfs	p.C1043fs	HIVEP3_ENST00000247584.5_Frame_Shift_Ins_p.C1043fs|HIVEP3_ENST00000429157.2_Frame_Shift_Ins_p.C1043fs|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000372584.1_Frame_Shift_Ins_p.C1043fs	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1043	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				ACCAAGAAGCATTTTCTTCTCT	0.589																																					p.C1043fs		Atlas-Indel,Pindel	.											.	HIVEP3	235	.	0			c.3127_3128insA						PASS	.																																			SO:0001589	frameshift_variant	59269	exon4			.	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.3127dupA	chr1.hg19:g.42047346_42047346dupT	ENSP00000361664:p.Cys1043fs	50.0	0.0	0		60.0	19.0	0.316667	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Frame_Shift_Ins	INS	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.	.	none		0.589	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
SLC17A8	246213	hgsc.bcm.edu	37	12	100774514	100774514	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr12:100774514delT	ENST00000323346.5	+	2	450	c.137delT	c.(136-138)attfs	p.I46fs	SLC17A8_ENST00000392989.3_Frame_Shift_Del_p.I46fs	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	46					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						GAAGATAACATTGAGCTGAAT	0.473																																					p.I46fs		Atlas-Indel,Pindel	.											.	SLC17A8	89	.	0			c.136delA						PASS	.						116.0	121.0	119.0					12																	100774514		2203	4300	6503	SO:0001589	frameshift_variant	246213	exon2			.	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.137delT	chr12.hg19:g.100774514delT	ENSP00000316909:p.Ile46fs	112.0	0.0	0		99.0	33.0	0.333333	NM_001145288	B3KXZ6|B7ZKV4|Q17RQ8	Frame_Shift_Del	DEL	ENST00000323346.5	hg19	CCDS9077.1																																																																																			.	.	.	none		0.473	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
DAZAP1	26528	hgsc.bcm.edu	37	19	1428952	1428953	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr19:1428952_1428953delGG	ENST00000233078.4	+	8	819_820	c.658_659delGG	c.(658-660)ggcfs	p.G220fs	DAZAP1_ENST00000336761.6_Frame_Shift_Del_p.G220fs	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	220					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCTGGGCAGGCCAGCCCCCG	0.688																																					p.219_220del		Atlas-Indel,Pindel	.											.	DAZAP1	52	.	0			c.657_658del						PASS	.																																			SO:0001589	frameshift_variant	26528	exon8			.		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.658_659delGG	chr19.hg19:g.1428952_1428953delGG	ENSP00000233078:p.Gly220fs	71.0	0.0	0		59.0	20.0	0.338983	NM_018959	Q96MJ3|Q9NRR9	Frame_Shift_Del	DEL	ENST00000233078.4	hg19	CCDS12065.1																																																																																			.	.	.	none		0.688	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
MOCS2	4338	hgsc.bcm.edu	37	5	52396318	52396318	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr5:52396318delC	ENST00000396954.3	-	6	1101	c.424delG	c.(424-426)gccfs	p.A142fs	MOCS2_ENST00000361377.4_3'UTR|MOCS2_ENST00000510818.2_Splice_Site|MOCS2_ENST00000582677.1_3'UTR|MOCS2_ENST00000527216.1_3'UTR|MOCS2_ENST00000508922.1_Intron|MOCS2_ENST00000584946.1_3'UTR|MOCS2_ENST00000450852.3_3'UTR	NM_004531.3	NP_004522.1			molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				GCTCTGTGGGCTGAGGACACA	0.393																																					p.A142fs		Atlas-Indel,Pindel	.											.	MOCS2	28	.	0			c.425delC						PASS	.						80.0	80.0	80.0					5																	52396318		2203	4300	6503	SO:0001589	frameshift_variant	4338	exon6			.	AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000396954.3:c.424delG	chr5.hg19:g.52396318delC	ENSP00000380157:p.Ala142fs	121.0	0.0	0		165.0	57.0	0.345455	NM_004531		Frame_Shift_Del	DEL	ENST00000396954.3	hg19	CCDS3958.1																																																																																			.	.	.	none		0.393	MOCS2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214053.3	NM_183418	
CACNA2D1	781	hgsc.bcm.edu	37	7	82072743	82072744	+	Frame_Shift_Ins	INS	-	-	A			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr7:82072743_82072744insA	ENST00000356253.5	-	1	287_288	c.32_33insT	c.(31-33)ctgfs	p.L11fs	CACNA2D1_ENST00000356860.3_Frame_Shift_Ins_p.L11fs|CACNA2D1_ENST00000423588.1_Frame_Shift_Ins_p.L11fs			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	11					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGAAAAGTGTCAGAGTCAAGGC	0.673																																					p.L11fs		Atlas-Indel,Pindel	.											.	CACNA2D1	191	.	0			c.33_34insT						PASS	.																																			SO:0001589	frameshift_variant	781	exon1			.	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.33dupT	chr7.hg19:g.82072744_82072744dupA	ENSP00000348589:p.Leu11fs	74.0	0.0	0		68.0	22.0	0.323529	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Frame_Shift_Ins	INS	ENST00000356253.5	hg19																																																																																				.	.	.	none		0.673	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
HMG20A	10363	hgsc.bcm.edu	37	15	77756629	77756629	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A856-01A-11D-A34Z-10	TCGA-MH-A856-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	08268f2c-7eb1-4f12-8ef8-7878585d4e39	e6f69dd8-8606-463e-a198-de6007153945	g.chr15:77756629delC	ENST00000381714.3	+	4	565	c.137delC	c.(136-138)accfs	p.T46fs	HMG20A_ENST00000336216.4_Frame_Shift_Del_p.T46fs	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	46					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ACATCATCCACCAACAATCCA	0.433																																					p.T46fs		Pindel	.											.	HMG20A	48	.	0			c.136delA						PASS	.						143.0	120.0	128.0					15																	77756629		2196	4294	6490	SO:0001589	frameshift_variant	10363	exon4			.	AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.137delC	chr15.hg19:g.77756629delC	ENSP00000371133:p.Thr46fs	241.0	0.0	.		211.0	56.0	0.265	NM_018200	A6NHY3|D3DW78|Q53G31|Q9NSF6	Frame_Shift_Del	DEL	ENST00000381714.3	hg19	CCDS10295.1																																																																																			.	.	.	none		0.433	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	
