#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	hgsc.bcm.edu	37	1	11174395	11174395	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr1:11174395A>T	ENST00000361445.4	-	53	7356	c.7280T>A	c.(7279-7281)cTg>cAg	p.L2427Q	MTOR_ENST00000376838.1_Missense_Mutation_p.L632Q	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2427	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCTCCAGTTCAGCAAGGGGTC	0.537																																					p.L2427Q		Atlas-SNP	.											MTOR,NS,carcinoma,+1,2	MTOR	327	.	0			c.T7280A						PASS	.						135.0	115.0	122.0					1																	11174395		2203	4300	6503	SO:0001583	missense	2475	exon53			CAGTTCAGCAAGG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7280T>A	chr1.hg19:g.11174395A>T	ENSP00000354558:p.Leu2427Gln	70.0	0.0	.		44.0	14.0	.	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	hg19	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.842624	0.91197	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	T;T;T	0.80033	-1.33;-1.33;-1.33	5.89	5.89	0.94794	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.89966	0.6868	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91209	0.4997	10	0.87932	D	0	-16.8498	15.497	0.75662	1.0:0.0:0.0:0.0	.	2427	P42345	MTOR_HUMAN	Q	2427;632;83	ENSP00000354558:L2427Q;ENSP00000366034:L632Q;ENSP00000398745:L83Q	ENSP00000354558:L2427Q	L	-	2	0	MTOR	11096982	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.923000	0.92808	2.254000	0.74563	0.533000	0.62120	CTG	.	.	.	none		0.537	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
DENND2C	163259	hgsc.bcm.edu	37	1	115130431	115130431	+	Silent	SNP	G	G	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr1:115130431G>T	ENST00000393274.1	-	19	3199	c.2574C>A	c.(2572-2574)tcC>tcA	p.S858S	DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393277.1_Silent_p.S746S|DENND2C_ENST00000393276.3_Silent_p.S801S	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	858	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACACTTCGGGAGGTGTGGG	0.478																																					p.S858S		Atlas-SNP	.											.	DENND2C	105	.	0			c.C2574A						PASS	.						104.0	87.0	93.0					1																	115130431		2203	4300	6503	SO:0001819	synonymous_variant	163259	exon19			ACTTCGGGAGGTG		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2574C>A	chr1.hg19:g.115130431G>T		149.0	0.0	.		95.0	5.0	.	NM_001256404	B1AL26|Q5TCX6|Q6P3R3	Silent	SNP	ENST00000393274.1	hg19	CCDS58018.1																																																																																			.	.	.	none		0.478	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
LYST	1130	hgsc.bcm.edu	37	1	235827769	235827769	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr1:235827769C>A	ENST00000389794.3	-	51	11365	c.11191G>T	c.(11191-11193)Gta>Tta	p.V3731L	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.V3731L			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3731					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCTTACCTTACAATTCCATTT	0.373																																					p.V3731L		Atlas-SNP	.											.	LYST	370	.	0			c.G11191T						PASS	.						66.0	65.0	66.0					1																	235827769		2203	4300	6503	SO:0001583	missense	1130	exon51			ACCTTACAATTCC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.11191G>T	chr1.hg19:g.235827769C>A	ENSP00000374444:p.Val3731Leu	81.0	0.0	.		60.0	20.0	.	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	hg19	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	34	5.390459	0.95988	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.32988	1.43;1.43	5.98	5.98	0.97165	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51176	0.1659	L	0.46614	1.455	0.80722	D	1	D	0.69078	0.997	D	0.66979	0.948	T	0.41233	-0.9520	10	0.59425	D	0.04	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	3731	Q99698	LYST_HUMAN	L	3731	ENSP00000374444:V3731L;ENSP00000374443:V3731L	ENSP00000374443:V3731L	V	-	1	0	LYST	233894392	1.000000	0.71417	0.994000	0.49952	0.950000	0.60333	7.818000	0.86416	2.835000	0.97688	0.650000	0.86243	GTA	.	.	.	none		0.373	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
B3GNT2	10678	hgsc.bcm.edu	37	2	62449390	62449390	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr2:62449390G>A	ENST00000301998.4	+	2	287	c.35G>A	c.(34-36)gGt>gAt	p.G12D	B3GNT2_ENST00000405767.1_Missense_Mutation_p.G12D	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	12					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			AAGTTGTTGGGTATCCTGATG	0.343																																					p.G12D		Atlas-SNP	.											.	B3GNT2	34	.	0			c.G35A						PASS	.						80.0	81.0	81.0					2																	62449390		2203	4300	6503	SO:0001583	missense	10678	exon2			TGTTGGGTATCCT	AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.35G>A	chr2.hg19:g.62449390G>A	ENSP00000305595:p.Gly12Asp	179.0	0.0	.		99.0	31.0	.	NM_006577	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	ENST00000301998.4	hg19	CCDS1870.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688762	0.68271	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	T;T	0.28895	1.59;1.59	6.02	6.02	0.97574	.	0.540943	0.20145	N	0.098292	T	0.53302	0.1788	M	0.72118	2.19	0.54753	D	0.999986	D	0.60575	0.988	P	0.56398	0.797	T	0.51498	-0.8698	10	0.66056	D	0.02	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	12	Q9NY97	B3GN2_HUMAN	D	12	ENSP00000305595:G12D;ENSP00000384692:G12D	ENSP00000305595:G12D	G	+	2	0	B3GNT2	62302894	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.305000	0.51873	2.865000	0.98341	0.655000	0.94253	GGT	.	.	.	none		0.343	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251606.2	NM_006577	
ST3GAL6	10402	hgsc.bcm.edu	37	3	98512536	98512536	+	Silent	SNP	G	G	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr3:98512536G>T	ENST00000483910.1	+	10	1216	c.927G>T	c.(925-927)gtG>gtT	p.V309V	ST3GAL6_ENST00000265261.6_Silent_p.V191V|ST3GAL6_ENST00000394162.1_Silent_p.V309V|ST3GAL6_ENST00000462152.1_3'UTR	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	309					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						ATCACAATGTGACTGCAGAGC	0.353																																					p.V362V		Atlas-SNP	.											.	ST3GAL6	41	.	0			c.G1086T						PASS	.						115.0	120.0	118.0					3																	98512536		2203	4300	6503	SO:0001819	synonymous_variant	10402	exon10			CAATGTGACTGCA	AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.927G>T	chr3.hg19:g.98512536G>T		140.0	0.0	.		87.0	25.0	.	NM_001271145	B2RCH2|B3KMI1|D3DN39|F8W6U0	Silent	SNP	ENST00000483910.1	hg19	CCDS2933.1																																																																																			.	.	.	none		0.353	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353013.2	NM_006100	
DSPP	1834	hgsc.bcm.edu	37	4	88537513	88537513	+	Missense_Mutation	SNP	A	A	C	rs112275895		TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr4:88537513A>C	ENST00000282478.7	+	4	3732	c.3699A>C	c.(3697-3699)gaA>gaC	p.E1233D	DSPP_ENST00000399271.1_Missense_Mutation_p.E1233D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1233	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcaatgaaagcagcgaca	0.547																																					p.E1233D		Atlas-SNP	.											.	DSPP	174	.	0			c.A3699C						PASS	.																																			SO:0001583	missense	1834	exon5			CAATGAAAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3699A>C	chr4.hg19:g.88537513A>C	ENSP00000282478:p.Glu1233Asp	116.0	0.0	.		88.0	13.0	.	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.785366	0.00628	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88741	-2.42;-2.42	2.61	-5.21	0.02815	.	.	.	.	.	T	0.57213	0.2038	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57347	-0.7827	9	0.02654	T	1	.	0.7125	0.00926	0.2623:0.1881:0.1298:0.4197	.	1233	Q9NZW4	DSPP_HUMAN	D	1233	ENSP00000382213:E1233D;ENSP00000282478:E1233D	ENSP00000282478:E1233D	E	+	3	2	DSPP	88756537	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-2.769000	0.00780	-2.252000	0.00699	-3.496000	0.00033	GAA	.	A|0.500;C|0.500	0.500	weak		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PCDHA10	56139	hgsc.bcm.edu	37	5	140236456	140236456	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr5:140236456G>T	ENST00000307360.5	+	1	823	c.823G>T	c.(823-825)Gaa>Taa	p.E275*	PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Nonsense_Mutation_p.E275*|PCDHA4_ENST00000512229.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	275	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATAAACAAGGAAATGATGTA	0.363																																					p.E275X		Atlas-SNP	.											.	PCDHA10	358	.	0			c.G823T						PASS	.						76.0	75.0	75.0					5																	140236456		2196	4270	6466	SO:0001587	stop_gained	56139	exon1			AACAAGGAAATGA	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.823G>T	chr5.hg19:g.140236456G>T	ENSP00000304234:p.Glu275*	158.0	0.0	.		127.0	52.0	.	NM_031859	A1L493|O75280|Q9NRU2	Nonsense_Mutation	SNP	ENST00000307360.5	hg19	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	G	36	5.642740	0.96704	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	17.2947	0.87167	0.0:0.0:1.0:0.0	.	.	.	.	X	275	.	ENSP00000304234:E275X	E	+	1	0	PCDHA10	140216640	0.849000	0.29639	0.913000	0.36048	0.983000	0.72400	1.747000	0.38298	2.383000	0.81215	0.561000	0.74099	GAA	.	.	.	none		0.363	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
ERGIC1	57222	hgsc.bcm.edu	37	5	172362237	172362237	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr5:172362237G>T	ENST00000393784.3	+	9	828	c.689G>T	c.(688-690)tGg>tTg	p.W230L		NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	230					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTGCAATCTGGTTCCGCTAC	0.582																																					p.W230L		Atlas-SNP	.											.	ERGIC1	35	.	0			c.G689T						PASS	.						91.0	84.0	86.0					5																	172362237		2203	4300	6503	SO:0001583	missense	57222	exon9			CAATCTGGTTCCG	AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.689G>T	chr5.hg19:g.172362237G>T	ENSP00000377374:p.Trp230Leu	113.0	0.0	.		83.0	4.0	.	NM_001031711	Q9H0L0|Q9H2J2|Q9ULN9	Missense_Mutation	SNP	ENST00000393784.3	hg19	CCDS34292.1	.	.	.	.	.	.	.	.	.	.	G	35	5.463136	0.96257	.	.	ENSG00000113719	ENST00000393784	.	.	.	5.88	5.88	0.94601	Domain of unknown function DUF1692 (1);	0.000000	0.85682	D	0.000000	D	0.83326	0.5230	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	0.985;1.0	P;D	0.91635	0.783;0.999	D	0.84050	0.0369	9	0.72032	D	0.01	-17.8113	19.8311	0.96636	0.0:0.0:1.0:0.0	.	175;230	B4E0N6;Q969X5	.;ERGI1_HUMAN	L	230	.	ENSP00000377374:W230L	W	+	2	0	ERGIC1	172294843	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.141000	0.94612	2.790000	0.95986	0.591000	0.81541	TGG	.	.	.	none		0.582	ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252938.3	NM_020462	
MRPS18B	28973	hgsc.bcm.edu	37	6	30594987	30594987	+	IGR	SNP	T	T	C			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr6:30594987T>C	ENST00000259873.4	+	0	1532				ATAT1_ENST00000329992.8_Intron|ATAT1_ENST00000376478.2_Intron|ATAT1_ENST00000376485.4_Intron|ATAT1_ENST00000319027.5_Intron|ATAT1_ENST00000468713.1_Intron|ATAT1_ENST00000376483.4_Intron|ATAT1_ENST00000330083.5_Silent_p.L3L|ATAT1_ENST00000318999.7_Intron	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B						translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						AAGGATGTGGTTGACCTGGCC	0.527																																					p.L3L		Atlas-SNP	.											ATAT1_ENST00000330083,NS,carcinoma,0,1	ATAT1	30	.	0			c.T7C						PASS	.						77.0	77.0	77.0					6																	30594987		2119	4259	6378	SO:0001628	intergenic_variant	79969	exon1			ATGTGGTTGACCT	AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268		chr6.hg19:g.30594987T>C		103.0	1.0	.		70.0	28.0	.	NM_001031722	A6NDQ0|Q659G4|Q9BS27	Silent	SNP	ENST00000259873.4	hg19	CCDS4682.1																																																																																			.	.	.	none		0.527	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076584.2		
PSORS1C1	170679	hgsc.bcm.edu	37	6	31085252	31085252	+	Intron	SNP	C	C	T	rs370680006	byFrequency	TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr6:31085252C>T	ENST00000259881.9	+	1	61				CDSN_ENST00000376288.2_Missense_Mutation_p.R47H|PSORS1C1_ENST00000467107.1_3'UTR	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						GGAGGTGATACGCGTGGGGTC	0.567													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18117	0.0		0.0	False		,,,				2504	0.0				p.R47H		Atlas-SNP	.											.	CDSN	48	.	0			c.G140A						PASS	.	C	HIS/ARG,	0,3564		0,0,1782	16.0	10.0	12.0		140,	4.9	0.0	6		12	1,7003		0,1,3501	no	missense,intron	CDSN,PSORS1C1	NM_001264.4,NM_014068.2	29,	0,1,5283	TT,TC,CC		0.0143,0.0,0.0095	probably-damaging,	47/530,	31085252	1,10567	1782	3502	5284	SO:0001627	intron_variant	1041	exon2			GTGATACGCGTGG	AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+2584C>T	chr6.hg19:g.31085252C>T		102.0	0.0	.		57.0	12.0	.	NM_001264	B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	hg19	CCDS34390.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717543	0.30413	0.0	1.43E-4	ENSG00000204539	ENST00000376288	T	0.12672	2.66	4.93	4.93	0.64822	.	0.000000	0.42682	D	0.000671	T	0.18923	0.0454	L	0.55990	1.75	0.09310	N	1	D	0.71674	0.998	D	0.63703	0.917	T	0.01371	-1.1372	10	0.72032	D	0.01	-8.1812	13.9681	0.64221	0.0:1.0:0.0:0.0	.	47	Q15517	CDSN_HUMAN	H	47	ENSP00000365465:R47H	ENSP00000365465:R47H	R	-	2	0	CDSN	31193231	0.055000	0.20627	0.016000	0.15963	0.057000	0.15508	3.491000	0.53252	2.461000	0.83175	0.549000	0.68633	CGT	.	.	.	weak		0.567	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068	
NPC1L1	29881	hgsc.bcm.edu	37	7	44561797	44561797	+	Silent	SNP	G	G	A	rs267601517		TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr7:44561797G>A	ENST00000289547.4	-	11	2737	c.2682C>T	c.(2680-2682)ttC>ttT	p.F894F	NPC1L1_ENST00000546276.1_Intron|NPC1L1_ENST00000381160.3_Silent_p.F894F	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	894					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CCCCCACCTCGAAGTAGCGGT	0.552																																					p.F894F		Atlas-SNP	.											.	NPC1L1	141	.	0			c.C2682T						PASS	.						58.0	56.0	57.0					7																	44561797		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon11			CACCTCGAAGTAG		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2682C>T	chr7.hg19:g.44561797G>A		40.0	0.0	.		21.0	7.0	.	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	hg19	CCDS5491.1																																																																																			.	.	.	none		0.552	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
SEMA3E	9723	hgsc.bcm.edu	37	7	83037688	83037688	+	Silent	SNP	C	C	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr7:83037688C>T	ENST00000307792.3	-	6	1133	c.666G>A	c.(664-666)ttG>ttA	p.L222L	SEMA3E_ENST00000427262.1_Silent_p.L162L	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	222	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				CCTTACCTTTCAACAGACGCT	0.428																																					p.L222L		Atlas-SNP	.											.	SEMA3E	125	.	0			c.G666A						PASS	.						69.0	66.0	67.0					7																	83037688		2203	4300	6503	SO:0001819	synonymous_variant	9723	exon6			ACCTTTCAACAGA	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.666G>A	chr7.hg19:g.83037688C>T		171.0	0.0	.		108.0	27.0	.	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	hg19	CCDS34674.1																																																																																			.	.	.	none		0.428	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
MLLT3	4300	hgsc.bcm.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000429426.2_Silent_p.S154S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,4	MLLT3	125	.	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T						PASS	.						9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	chr9.hg19:g.20414373G>A		110.0	1.0	.		96.0	6.0	.	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	hg19	CCDS6494.1																																																																																			.	.	.	none		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
SVIL	6840	hgsc.bcm.edu	37	10	29818641	29818641	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr10:29818641C>T	ENST00000355867.4	-	12	2991	c.2239G>A	c.(2239-2241)Gca>Aca	p.A747T	SVIL_ENST00000375398.2_Missense_Mutation_p.A747T|SVIL_ENST00000375400.3_Missense_Mutation_p.A353T	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	747					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TACGTGGCTGCGATGACCACC	0.493																																					p.A747T		Atlas-SNP	.											.	SVIL	226	.	0			c.G2239A						PASS	.						113.0	97.0	102.0					10																	29818641		2203	4300	6503	SO:0001583	missense	6840	exon12			TGGCTGCGATGAC	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2239G>A	chr10.hg19:g.29818641C>T	ENSP00000348128:p.Ala747Thr	98.0	0.0	.		60.0	4.0	.	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	hg19	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.836524	0.91117	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.63255	-0.03;-0.03;-0.03	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.79981	0.4540	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79232	-0.1888	9	.	.	.	-17.2812	19.571	0.95419	0.0:1.0:0.0:0.0	.	353;747	O95425-2;O95425	.;SVIL_HUMAN	T	353;747;747	ENSP00000364549:A353T;ENSP00000364547:A747T;ENSP00000348128:A747T	.	A	-	1	0	SVIL	29858647	1.000000	0.71417	0.467000	0.27180	0.599000	0.36880	7.354000	0.79424	2.709000	0.92574	0.655000	0.94253	GCA	.	.	.	none		0.493	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
PIWIL4	143689	hgsc.bcm.edu	37	11	94300728	94300728	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr11:94300728G>A	ENST00000299001.6	+	1	255	c.44G>A	c.(43-45)aGc>aAc	p.S15N	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	15					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ATCGCCCGCAGCCCCAGTGCC	0.557																																					p.S15N		Atlas-SNP	.											.	PIWIL4	70	.	0			c.G44A						PASS	.						59.0	44.0	49.0					11																	94300728		2199	4296	6495	SO:0001583	missense	143689	exon1			CCCGCAGCCCCAG	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.44G>A	chr11.hg19:g.94300728G>A	ENSP00000299001:p.Ser15Asn	105.0	0.0	.		71.0	25.0	.	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	hg19	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	g	12.40	1.925406	0.34002	.	.	ENSG00000134627	ENST00000299001	T	0.03982	3.74	4.01	3.09	0.35607	.	0.865945	0.09952	N	0.734526	T	0.05456	0.0144	L	0.43152	1.355	0.21527	N	0.999656	B	0.23937	0.094	B	0.21917	0.037	T	0.39078	-0.9631	10	0.30854	T	0.27	-0.0873	7.5657	0.27876	0.1179:0.0:0.8821:0.0	.	15	Q7Z3Z4	PIWL4_HUMAN	N	15	ENSP00000299001:S15N	ENSP00000299001:S15N	S	+	2	0	PIWIL4	93940376	0.001000	0.12720	0.002000	0.10522	0.129000	0.20672	0.946000	0.29069	1.034000	0.39945	0.555000	0.69702	AGC	.	.	.	none		0.557	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
C2CD5	9847	hgsc.bcm.edu	37	12	22676361	22676361	+	Splice_Site	SNP	C	C	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr12:22676361C>T	ENST00000333957.4	-	7	1054	c.799G>A	c.(799-801)Gag>Aag	p.E267K	C2CD5_ENST00000396028.2_Splice_Site_p.E267K|C2CD5_ENST00000545552.1_Splice_Site_p.E267K|C2CD5_ENST00000446597.1_Splice_Site_p.E267K|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000544930.1_Splice_Site_p.E69K|C2CD5_ENST00000542676.1_Splice_Site_p.E267K|C2CD5_ENST00000536386.1_Splice_Site_p.E267K	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	267					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CATACTTACTCCTTCATTTCT	0.363																																					p.E267K		Atlas-SNP	.											.	.	.	.	0			c.G799A						PASS	.						75.0	70.0	72.0					12																	22676361		2203	4300	6503	SO:0001630	splice_region_variant	9847	exon7			CTTACTCCTTCAT	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.800+1G>A	chr12.hg19:g.22676361C>T		133.0	0.0	.		104.0	29.0	.	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	hg19	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026154	0.93518	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930;ENST00000544281	T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.24	5.24	0.73138	.	0.054847	0.64402	D	0.000001	T	0.61035	0.2315	L	0.47716	1.5	0.54753	D	0.999981	B;B;D;B;D;B	0.76494	0.216;0.397;0.997;0.138;0.999;0.192	B;B;D;B;D;B	0.75484	0.108;0.085;0.972;0.032;0.986;0.038	T	0.52888	-0.8515	10	0.13470	T	0.59	-15.5681	18.8083	0.92047	0.0:1.0:0.0:0.0	.	267;267;69;267;267;267	F5H2A1;B4DRN7;F5H3N1;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;.;K0528_HUMAN	K	267;267;267;267;267;267;69;66	ENSP00000334229:E267K;ENSP00000388756:E267K;ENSP00000439392:E267K;ENSP00000379345:E267K;ENSP00000441951:E267K;ENSP00000443204:E267K;ENSP00000445288:E69K;ENSP00000443479:E66K	ENSP00000334229:E267K	E	-	1	0	KIAA0528	22567628	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.474000	0.81024	2.426000	0.82243	0.591000	0.81541	GAG;GAG;GAG;GAG;GAG;GAG;GAG;GAA	.	.	.	none		0.363	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	Missense_Mutation
PTPRR	5801	hgsc.bcm.edu	37	12	71286725	71286725	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr12:71286725C>T	ENST00000283228.2	-	2	543	c.91G>A	c.(91-93)Gca>Aca	p.A31T		NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	31					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		TGATTAATTGCCAAAAAATGA	0.378																																					p.A31T		Atlas-SNP	.											.	PTPRR	109	.	0			c.G91A						PASS	.						93.0	99.0	97.0					12																	71286725		2203	4299	6502	SO:0001583	missense	5801	exon2			TAATTGCCAAAAA	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.91G>A	chr12.hg19:g.71286725C>T	ENSP00000283228:p.Ala31Thr	276.0	0.0	.		243.0	79.0	.	NM_002849	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	hg19	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166559	0.57476	.	.	ENSG00000153233	ENST00000283228	T	0.04156	3.69	5.86	4.92	0.64577	.	0.423542	0.16942	U	0.193232	T	0.04543	0.0124	L	0.27053	0.805	0.80722	D	1	B	0.13594	0.008	B	0.06405	0.002	T	0.40515	-0.9559	10	0.45353	T	0.12	-1.9248	10.8509	0.46769	0.0:0.7948:0.1326:0.0725	.	31	Q15256	PTPRR_HUMAN	T	31	ENSP00000283228:A31T	ENSP00000283228:A31T	A	-	1	0	PTPRR	69572992	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	2.095000	0.41729	2.776000	0.95493	0.650000	0.86243	GCA	.	.	.	none		0.378	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	
RNF17	56163	hgsc.bcm.edu	37	13	25428149	25428149	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr13:25428149T>G	ENST00000255324.5	+	25	3529	c.3477T>G	c.(3475-3477)ttT>ttG	p.F1159L	RNF17_ENST00000339524.3_Missense_Mutation_p.F211L|RNF17_ENST00000381921.1_Missense_Mutation_p.F1159L	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1159					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TGTCTGAATTTCAGGAGAAAA	0.393																																					p.F1159L		Atlas-SNP	.											.	RNF17	259	.	0			c.T3477G						PASS	.						88.0	89.0	89.0					13																	25428149		2203	4300	6503	SO:0001583	missense	56163	exon25			TGAATTTCAGGAG	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3477T>G	chr13.hg19:g.25428149T>G	ENSP00000255324:p.Phe1159Leu	121.0	0.0	.		98.0	27.0	.	NM_031277	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	T	0.044	-1.274512	0.01410	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	T;T;T;T	0.21361	3.62;3.62;2.85;2.01	4.95	0.786	0.18590	.	1.172140	0.06091	N	0.663694	T	0.13884	0.0336	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.33803	-0.9854	10	0.08179	T	0.78	-0.6392	1.6021	0.02676	0.1715:0.0948:0.1782:0.5556	.	1155;211;1159;1159	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	L	1159;1159;1018;483;211	ENSP00000255324:F1159L;ENSP00000371346:F1159L;ENSP00000388892:F483L;ENSP00000344776:F211L	ENSP00000255324:F1159L	F	+	3	2	RNF17	24326149	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.083000	0.11286	0.421000	0.25980	0.477000	0.44152	TTT	.	.	.	none		0.393	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
EML5	161436	hgsc.bcm.edu	37	14	89109293	89109293	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr14:89109293C>T	ENST00000380664.5	-	29	4156	c.4157G>A	c.(4156-4158)gGt>gAt	p.G1386D	EML5_ENST00000352093.5_Missense_Mutation_p.G1348D|EML5_ENST00000554922.1_Missense_Mutation_p.G1394D			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1386						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TATATCATCACCATCATTTAA	0.343																																					p.G1394D		Atlas-SNP	.											.	EML5	141	.	0			c.G4181A						PASS	.						102.0	98.0	99.0					14																	89109293		1855	4103	5958	SO:0001583	missense	161436	exon30			TCATCACCATCAT	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4157G>A	chr14.hg19:g.89109293C>T	ENSP00000370039:p.Gly1386Asp	229.0	0.0	.		143.0	11.0	.	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045975	0.93685	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.68181	-0.31;-0.31;-0.31	5.7	5.7	0.88788	HELP (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83308	0.5226	M	0.77712	2.385	0.80722	D	1	D;D	0.89917	0.981;1.0	P;D	0.91635	0.9;0.999	D	0.84618	0.0682	10	0.87932	D	0	-24.0977	19.8242	0.96610	0.0:1.0:0.0:0.0	.	1394;1386	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	D	1394;1348;1386	ENSP00000451998:G1394D;ENSP00000298315:G1348D;ENSP00000370039:G1386D	ENSP00000298315:G1348D	G	-	2	0	EML5	88179046	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.442000	0.80503	2.669000	0.90835	0.591000	0.81541	GGT	.	.	.	none		0.343	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
CGNL1	84952	hgsc.bcm.edu	37	15	57815687	57815687	+	Splice_Site	SNP	G	G	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr15:57815687G>A	ENST00000281282.5	+	11	2794	c.2716G>A	c.(2716-2718)Gga>Aga	p.G906R		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	906						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		CCATTTGCAGGGAAATCTGAG	0.502																																					p.G906R		Atlas-SNP	.											.	CGNL1	125	.	0			c.G2716A						PASS	.						68.0	66.0	67.0					15																	57815687		2192	4292	6484	SO:0001630	splice_region_variant	84952	exon12			TTGCAGGGAAATC	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.2716-1G>A	chr15.hg19:g.57815687G>A		87.0	0.0	.		53.0	17.0	.	NM_001252335	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	hg19	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.607950	0.00842	.	.	ENSG00000128849	ENST00000281282	T	0.74209	-0.82	5.46	1.79	0.24919	.	0.721945	0.12888	N	0.430847	T	0.30727	0.0774	N	0.00135	-2.02	0.37102	D	0.899944	B	0.02656	0.0	B	0.04013	0.001	T	0.17228	-1.0376	9	.	.	.	-6.013	5.9639	0.19315	0.6491:0.1289:0.2219:0.0	.	906	Q0VF96	CGNL1_HUMAN	R	906	ENSP00000281282:G906R	.	G	+	1	0	CGNL1	55602979	1.000000	0.71417	0.610000	0.28997	0.079000	0.17450	2.572000	0.45999	0.112000	0.17975	-0.238000	0.12139	GGA	.	.	.	none		0.502	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	Missense_Mutation
EPG5	57724	hgsc.bcm.edu	37	18	43534423	43534423	+	Silent	SNP	T	T	C			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr18:43534423T>C	ENST00000282041.5	-	2	979	c.945A>G	c.(943-945)acA>acG	p.T315T		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	315					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GGCAATCAGATGTCAGAGTAA	0.453																																					p.T315T		Atlas-SNP	.											.	EPG5	199	.	0			c.A945G						PASS	.						105.0	102.0	103.0					18																	43534423		1934	4155	6089	SO:0001819	synonymous_variant	57724	exon2			ATCAGATGTCAGA	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.945A>G	chr18.hg19:g.43534423T>C		174.0	0.0	.		113.0	38.0	.	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	hg19	CCDS11926.2																																																																																			.	.	.	none		0.453	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
MAG	4099	hgsc.bcm.edu	37	19	35802844	35802844	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr19:35802844G>A	ENST00000392213.3	+	10	1799	c.1640G>A	c.(1639-1641)aGc>aAc	p.S547N	MAG_ENST00000361922.4_Missense_Mutation_p.S547N|MAG_ENST00000593348.1_3'UTR|MAG_ENST00000537831.2_Missense_Mutation_p.S522N	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	547					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GAGAGCCCCAGCTTCTCGGCA	0.607																																					p.S547N		Atlas-SNP	.											.	MAG	172	.	0			c.G1640A						PASS	.						50.0	37.0	41.0					19																	35802844		2203	4300	6503	SO:0001583	missense	4099	exon10			GCCCCAGCTTCTC	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1640G>A	chr19.hg19:g.35802844G>A	ENSP00000376048:p.Ser547Asn	140.0	0.0	.		83.0	37.0	.	NM_080600	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	hg19	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	g	22.6	4.314557	0.81358	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.65549	0.01;-0.16;-0.09	5.26	5.26	0.73747	.	0.169147	0.52532	D	0.000066	T	0.63628	0.2527	N	0.19112	0.55	0.35505	D	0.800098	D;P;P	0.57899	0.981;0.948;0.941	D;P;P	0.65140	0.932;0.508;0.607	T	0.64381	-0.6421	10	0.16896	T	0.51	.	16.3569	0.83237	0.0:0.0:1.0:0.0	.	584;547;547	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	N	584;547;547;522	ENSP00000355234:S547N;ENSP00000376048:S547N;ENSP00000440695:S522N	ENSP00000262624:S584N	S	+	2	0	MAG	40494684	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.547000	0.67249	2.466000	0.83321	0.556000	0.70494	AGC	.	.	.	none		0.607	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
SCAF1	58506	hgsc.bcm.edu	37	19	50156129	50156129	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr19:50156129C>A	ENST00000360565.3	+	7	2607	c.2483C>A	c.(2482-2484)tCc>tAc	p.S828Y		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	828	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		TCCTGTTCTTCCCGGAAGGTG	0.692																																					p.S828Y		Atlas-SNP	.											.	SCAF1	78	.	0			c.C2483A						PASS	.						64.0	72.0	69.0					19																	50156129		2201	4300	6501	SO:0001583	missense	58506	exon7			GTTCTTCCCGGAA	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.2483C>A	chr19.hg19:g.50156129C>A	ENSP00000353769:p.Ser828Tyr	57.0	0.0	.		26.0	9.0	.	NM_021228	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	hg19	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	C	3.923	-0.017817	0.07681	.	.	ENSG00000126461	ENST00000360565	T	0.36520	1.25	3.11	3.11	0.35812	.	0.761454	0.10799	N	0.632937	T	0.35307	0.0927	N	0.14661	0.345	0.09310	N	1	D	0.64830	0.994	P	0.59889	0.865	T	0.14282	-1.0478	9	.	.	.	-19.5321	9.2581	0.37595	0.0:0.6322:0.3678:0.0	.	828	Q9H7N4	SFR19_HUMAN	Y	828	ENSP00000353769:S828Y	.	S	+	2	0	SCAF1	54847941	.	.	0.243000	0.24186	0.174000	0.22865	.	.	2.046000	0.60703	0.561000	0.74099	TCC	.	.	.	none		0.692	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
MT-CO1	4512	hgsc.bcm.edu	37	M	6054	6054	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chrM:6054G>A	ENST00000361624.2	+	1	151	c.151G>A	c.(151-153)Gac>Aac	p.D51N	MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	51					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTCTAGGTAACGACCACATCT	0.478																																					p.D51N		Atlas-SNP	.											.	.	.	.	0			c.G151A						PASS	.																																			SO:0001583	missense	5742	exon1			GGTAACGACCACA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.151G>A	chrM.hg19:g.6054G>A	ENSP00000354499:p.Asp51Asn	11.0	0.0	.		118.0	8.0	.	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.	.	none		0.478	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-CO2	4513	hgsc.bcm.edu	37	M	8075	8075	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chrM:8075G>A	ENST00000361739.1	+	1	490	c.490G>A	c.(490-492)Gct>Act	p.A164T	MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	164					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TGCACTCATGAGCTGTCCCCA	0.488																																					p.A164T		Atlas-SNP	.											.	.	.	.	0			c.G490A						PASS	.																																			SO:0001583	missense	5743	exon1			TCATGAGCTGTCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.490G>A	chrM.hg19:g.8075G>A	ENSP00000354876:p.Ala164Thr	14.0	0.0	.		80.0	6.0	.	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.	.	none		0.488	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
KMT2A	4297	hgsc.bcm.edu	37	11	118377019	118377019	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr11:118377019delC	ENST00000389506.5	+	27	10403	c.10403delC	c.(10402-10404)tccfs	p.S3468fs	KMT2A_ENST00000354520.4_Frame_Shift_Del_p.S3430fs|KMT2A_ENST00000534358.1_Frame_Shift_Del_p.S3471fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3468					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ATTCATTCTTCCCAGCGTGAT	0.517																																					p.S3471fs		Atlas-Indel,Pindel	.											.	MLL	548	.	0			c.10411delT						PASS	.						129.0	119.0	123.0					11																	118377019		2200	4295	6495	SO:0001589	frameshift_variant	4297	exon27			.	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.10403delC	chr11.hg19:g.118377019delC	ENSP00000374157:p.Ser3468fs	112.0	0.0	0		90.0	34.0	0.377778	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	ENST00000389506.5	hg19	CCDS31686.1																																																																																			.	.	.	none		0.517	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
EFHB	151651	hgsc.bcm.edu	37	3	19947241	19947250	+	Splice_Site	DEL	CCTGTGGAAA	CCTGTGGAAA	-			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	CCTGTGGAAA	CCTGTGGAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr3:19947241_19947250delCCTGTGGAAA	ENST00000295824.9	-	6	1450	c.1289delTTTCCACAGG	c.(1288-1290)gtt>gt	p.V430fs	EFHB_ENST00000344838.4_Splice_Site_p.V300fs|EFHB_ENST00000498089.1_5'UTR	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	430							calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						CTTTGCCTCTCCTGTGGAAAAAGAAAGGAA	0.381																																					p.430_430del		Atlas-Indel,Pindel	.											.	EFHB	186	.	0			c.1289_1290del						PASS	.																																			SO:0001630	splice_region_variant	151651	exon6			.	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.1289-1TTTCCACAGG>-	chr3.hg19:g.19947241_19947250delCCTGTGGAAA		124.0	0.0	0		65.0	15.0	0.230769	NM_144715	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Frame_Shift_Del	DEL	ENST00000295824.9	hg19	CCDS33715.2																																																																																			.	.	.	none		0.381	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715	Frame_Shift_Del
NCOA6	23054	hgsc.bcm.edu	37	20	33329080	33329081	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr20:33329080_33329081delAA	ENST00000374796.2	-	12	7549_7550	c.4979_4980delTT	c.(4978-4980)tttfs	p.F1660fs	NCOA6_ENST00000359003.2_Frame_Shift_Del_p.F1660fs			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1660	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ATGAATTGATAAAGACAGGTGT	0.49																																					p.1660_1661del		Atlas-Indel,Pindel	.											.	NCOA6	219	.	0			c.4980_4981del						PASS	.																																			SO:0001589	frameshift_variant	23054	exon11			.	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4979_4980delTT	chr20.hg19:g.33329080_33329081delAA	ENSP00000363929:p.Phe1660fs	109.0	0.0	0		68.0	23.0	0.338235	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Frame_Shift_Del	DEL	ENST00000374796.2	hg19	CCDS13241.1																																																																																			.	.	.	none		0.490	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
OBSCN	84033	hgsc.bcm.edu	37	1	228547456	228547466	+	Intron	DEL	GCAGGCCGGAG	GCAGGCCGGAG	-	rs377484630|rs370692094		TCGA-MH-A857-01A-11D-A34Z-10	TCGA-MH-A857-10A-01D-A34Z-10	GCAGGCCGGAG	GCAGGCCGGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0299221a-3d27-41da-acfa-e3d9a0bf59cf	66cc7636-90d2-4545-99c6-ea90745ba8b1	g.chr1:228547456_228547466delGCAGGCCGGAG	ENST00000422127.1	+	80	18705				OBSCN_ENST00000570156.2_Intron|OBSCN_ENST00000366709.4_Frame_Shift_Del_p.RRPE3407fs|OBSCN_ENST00000284548.11_Frame_Shift_Del_p.RRPE6288fs|OBSCN_ENST00000366707.4_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCAGCCCCGCAGGCCGGAGGCAGAACCAG	0.706																																					p.6288_6291del		Atlas-Indel,Pindel	.											.	OBSCN	2142	.	0			c.18862_18872del						PASS	.																																			SO:0001627	intron_variant	84033	exon81			.	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18662-2811GCAGGCCGGAG>-	chr1.hg19:g.228547456_228547466delGCAGGCCGGAG		104.0	0.0	0		54.0	13.0	0.240741	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Del	DEL	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.	.	none		0.706	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
