#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DNAJC11	55735	hgsc.bcm.edu	37	1	6705133	6705133	+	Silent	SNP	A	A	G			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr1:6705133A>G	ENST00000377577.5	-	9	1071	c.948T>C	c.(946-948)gaT>gaC	p.D316D	DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000465508.1_5'Flank|DNAJC11_ENST00000294401.7_Silent_p.D316D|DNAJC11_ENST00000542246.1_Silent_p.D278D|DNAJC11_ENST00000377573.5_Silent_p.D226D	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	316						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGATCGTCATCTTGGAATT	0.532																																					p.D316D		Atlas-SNP	.											.	DNAJC11	93	.	0			c.T948C						PASS	.						299.0	274.0	282.0					1																	6705133		2203	4300	6503	SO:0001819	synonymous_variant	55735	exon9			ATCGTCATCTTGG	AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.948T>C	chr1.hg19:g.6705133A>G		77.0	0.0	.		73.0	26.0	.	NM_018198	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Silent	SNP	ENST00000377577.5	hg19	CCDS87.1																																																																																			.	.	.	none		0.532	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198	
NBPF1	55672	hgsc.bcm.edu	37	1	16918552	16918552	+	Splice_Site	SNP	C	C	T			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr1:16918552C>T	ENST00000430580.2	-	7	853		c.e7-1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GAGCCAGGGACTGGGGAGAAG	0.448																																					.		Atlas-SNP	.											.	.	.	.	0			.						PASS	.						194.0	194.0	194.0					1																	16918552		2186	4290	6476	SO:0001630	splice_region_variant	55672	.			CAGGGACTGGGGA	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.35-1G>A	chr1.hg19:g.16918552C>T		101.0	0.0	.		68.0	8.0	.	.	Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	hg19																																																																																				.	.	.	none		0.448	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	Intron
KDM4A	9682	hgsc.bcm.edu	37	1	44133641	44133641	+	Missense_Mutation	SNP	G	G	C			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr1:44133641G>C	ENST00000372396.3	+	9	1248	c.1114G>C	c.(1114-1116)Gag>Cag	p.E372Q		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	372					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						GTGCCCAGAGGAGGACATGGA	0.562																																					p.E372Q		Atlas-SNP	.											.	KDM4A	74	.	0			c.G1114C						PASS	.						145.0	139.0	141.0					1																	44133641		2203	4300	6503	SO:0001583	missense	9682	exon9			CCAGAGGAGGACA	AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.1114G>C	chr1.hg19:g.44133641G>C	ENSP00000361473:p.Glu372Gln	151.0	0.0	.		105.0	34.0	.	NM_014663	Q5VVB1	Missense_Mutation	SNP	ENST00000372396.3	hg19	CCDS491.1	.	.	.	.	.	.	.	.	.	.	G	13.74	2.328538	0.41197	.	.	ENSG00000066135	ENST00000372396	T	0.16196	2.36	5.58	5.58	0.84498	.	0.765572	0.13019	N	0.420245	T	0.17152	0.0412	L	0.48362	1.52	0.33669	D	0.610687	B;B	0.30482	0.281;0.068	B;B	0.22152	0.038;0.031	T	0.18272	-1.0342	10	0.13470	T	0.59	-2.168	17.7576	0.88453	0.0:0.0:1.0:0.0	.	372;372	B4DT38;O75164	.;KDM4A_HUMAN	Q	372	ENSP00000361473:E372Q	ENSP00000361473:E372Q	E	+	1	0	KDM4A	43906228	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	8.613000	0.90913	2.617000	0.88574	0.555000	0.69702	GAG	.	.	.	none		0.562	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1	NM_014663	
AGT	183	hgsc.bcm.edu	37	1	230839940	230839940	+	Splice_Site	SNP	T	T	C			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr1:230839940T>C	ENST00000366667.4	-	4	1482	c.1268A>G	c.(1267-1269)gAg>gGg	p.E423G		NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	423					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CACACATACCTCCCCCACCCT	0.597																																					p.E423G		Atlas-SNP	.											AGT,colon,carcinoma,0,1	AGT	62	.	0			c.A1268G						PASS	.						159.0	123.0	135.0					1																	230839940		2203	4300	6503	SO:0001630	splice_region_variant	183	exon4			CATACCTCCCCCA	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.1269+1A>G	chr1.hg19:g.230839940T>C		122.0	0.0	.		96.0	4.0	.	NM_000029	Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	hg19	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.086987	0.55861	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.88046	-2.33	5.33	5.33	0.75918	Serpin domain (3);	0.348276	0.35555	N	0.003140	D	0.84951	0.5586	L	0.36672	1.1	0.34358	D	0.690613	P;P	0.49862	0.929;0.929	P;P	0.47251	0.542;0.542	D	0.90471	0.4453	10	0.72032	D	0.01	.	14.1269	0.65228	0.0:0.0:0.0:1.0	.	423;423	B0ZBE2;P01019	.;ANGT_HUMAN	G	423;341	ENSP00000355627:E423G	ENSP00000355627:E423G	E	-	2	0	AGT	228906563	1.000000	0.71417	0.884000	0.34674	0.012000	0.07955	4.445000	0.60007	2.020000	0.59435	0.533000	0.62120	GAG	.	.	.	none		0.597	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029	Missense_Mutation
OR2W3	343171	hgsc.bcm.edu	37	1	248059782	248059782	+	Silent	SNP	G	G	A			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr1:248059782G>A	ENST00000360358.3	+	1	894	c.894G>A	c.(892-894)aaG>aaA	p.K298K	OR2W3_ENST00000537741.1_Silent_p.K298K	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGAGGTGAAGGGGGCACTGG	0.537																																					p.K298K		Atlas-SNP	.											.	OR2W3	113	.	0			c.G894A						PASS	.						39.0	40.0	40.0					1																	248059782		2203	4300	6503	SO:0001819	synonymous_variant	343171	exon1			GGTGAAGGGGGCA	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.894G>A	chr1.hg19:g.248059782G>A		78.0	0.0	.		88.0	8.0	.	NM_001001957	Q6IF06|Q8NG86	Silent	SNP	ENST00000360358.3	hg19	CCDS31099.1																																																																																			.	.	.	none		0.537	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957	
NLRC4	58484	hgsc.bcm.edu	37	2	32474767	32474767	+	Silent	SNP	A	A	G			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr2:32474767A>G	ENST00000404025.2	-	5	2654	c.2166T>C	c.(2164-2166)agT>agC	p.S722S	NLRC4_ENST00000402280.1_Silent_p.S722S|NLRC4_ENST00000360906.5_Silent_p.S722S|NLRC4_ENST00000342905.6_Intron			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	722					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TGGTGAGGGGACTGGCTTCCA	0.473																																					p.S722S		Atlas-SNP	.											.	NLRC4	165	.	0			c.T2166C						PASS	.						160.0	153.0	155.0					2																	32474767		2203	4300	6503	SO:0001819	synonymous_variant	58484	exon4			GAGGGGACTGGCT	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.2166T>C	chr2.hg19:g.32474767A>G		100.0	0.0	.		94.0	40.0	.	NM_001199138	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Silent	SNP	ENST00000404025.2	hg19	CCDS33174.1																																																																																			.	.	.	none		0.473	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
IQCJ	654502	hgsc.bcm.edu	37	3	158983179	158983179	+	Missense_Mutation	SNP	T	T	C			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr3:158983179T>C	ENST00000451172.1	+	5	572	c.467T>C	c.(466-468)cTc>cCc	p.L156P	IQCJ-SCHIP1_ENST00000467442.1_Intron|IQCJ_ENST00000482126.1_Missense_Mutation_p.L129P|IQCJ-SCHIP1_ENST00000476809.1_Intron|IQCJ-SCHIP1_ENST00000485419.1_Intron	NM_001042705.2	NP_001036170.1	Q1A5X6	IQCJ_HUMAN	IQ motif containing J	156										cervix(1)|endometrium(2)|large_intestine(2)|lung(10)	15			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CTTGGTTTTCTCACCCTCCAG	0.478																																					p.L156P		Atlas-SNP	.											.	IQCJ	28	.	0			c.T467C						PASS	.						92.0	88.0	89.0					3																	158983179		1892	4130	6022	SO:0001583	missense	654502	exon5			GTTTTCTCACCCT	DQ309553, DQ309554	CCDS46946.1, CCDS46947.1, CCDS56290.1	3q25.32	2011-03-24			ENSG00000214216	ENSG00000214216			32406	protein-coding gene	gene with protein product		611622				17045569	Standard	NM_001042705		Approved			Q1A5X6	OTTHUMG00000166440	ENST00000451172.1:c.467T>C	chr3.hg19:g.158983179T>C	ENSP00000402153:p.Leu156Pro	129.0	0.0	.		87.0	4.0	.	NM_001042705	B7ZMM2|B9EH97|Q1A5X5	Missense_Mutation	SNP	ENST00000451172.1	hg19	CCDS46946.1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.310205	0.23821	.	.	ENSG00000214216	ENST00000451172;ENST00000482126	.	.	.	3.53	-3.64	0.04515	.	.	.	.	.	T	0.22126	0.0533	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.20107	-1.0285	8	0.62326	D	0.03	.	6.7772	0.23626	0.1904:0.6487:0.0:0.1609	.	129;156	B7ZMM2;Q1A5X6	.;IQCJ_HUMAN	P	156;129	.	ENSP00000402153:L156P	L	+	2	0	IQCJ	160465873	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.646000	0.05403	-0.782000	0.04541	-0.250000	0.11733	CTC	.	.	.	none		0.478	IQCJ-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352395.1	NM_001042705.1	
FBXL17	64839	hgsc.bcm.edu	37	5	107700635	107700635	+	Missense_Mutation	SNP	A	A	T			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr5:107700635A>T	ENST00000542267.1	-	3	1584	c.1178T>A	c.(1177-1179)aTt>aAt	p.I393N	FBXL17_ENST00000496714.1_5'UTR|FBXL17_ENST00000359660.5_5'UTR	NM_001163315.2	NP_001156787.2	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	393										endometrium(1)|large_intestine(4)|lung(1)	6		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		ACAATCAGAAATGTTGATTTC	0.328																																					p.I393N		Atlas-SNP	.											.	FBXL17	60	.	0			c.T1178A						PASS	.						85.0	86.0	85.0					5																	107700635		2202	4299	6501	SO:0001583	missense	64839	exon3			TCAGAAATGTTGA	AL133602	CCDS54886.1	5q21.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000145743	ENSG00000145743		"""F-boxes / Leucine-rich repeats"""	13615	protein-coding gene	gene with protein product		609083	"""F-box only protein 13"""	FBXO13			Standard	NM_001163315		Approved	DKFZP434C1715, Fbx13, Fbl17	uc011cvc.2	Q9UF56	OTTHUMG00000159785	ENST00000542267.1:c.1178T>A	chr5.hg19:g.107700635A>T	ENSP00000437464:p.Ile393Asn	144.0	0.0	.		155.0	66.0	.	NM_001163315	A1A4E3	Missense_Mutation	SNP	ENST00000542267.1	hg19	CCDS54886.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539746	0.85917	.	.	ENSG00000145743	ENST00000542267	T	0.03181	4.02	5.59	5.59	0.84812	.	.	.	.	.	T	0.10551	0.0258	L	0.39898	1.24	0.80722	D	1	D	0.67145	0.996	P	0.59171	0.853	T	0.01409	-1.1362	9	0.87932	D	0	.	16.0612	0.80839	1.0:0.0:0.0:0.0	.	393	Q9UF56	FXL17_HUMAN	N	393	ENSP00000437464:I393N	ENSP00000437464:I393N	I	-	2	0	FBXL17	107728534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.870000	0.92336	2.250000	0.74265	0.477000	0.44152	ATT	.	.	.	none		0.328	FBXL17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LMNB1	4001	hgsc.bcm.edu	37	5	126154725	126154725	+	Missense_Mutation	SNP	G	G	T			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr5:126154725G>T	ENST00000261366.5	+	6	1412	c.1051G>T	c.(1051-1053)Gat>Tat	p.D351Y	LMNB1_ENST00000395354.1_Missense_Mutation_p.D351Y|LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	351	Coil 2.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		GGAAATAAGGGATCAAATGCA	0.423																																					p.D351Y		Atlas-SNP	.											.	LMNB1	49	.	0			c.G1051T						PASS	.						123.0	120.0	121.0					5																	126154725		2203	4300	6503	SO:0001583	missense	4001	exon6			ATAAGGGATCAAA	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.1051G>T	chr5.hg19:g.126154725G>T	ENSP00000261366:p.Asp351Tyr	172.0	0.0	.		166.0	62.0	.	NM_005573	B2R6J6|Q3SYN7|Q96EI6	Missense_Mutation	SNP	ENST00000261366.5	hg19	CCDS4140.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158723	0.78226	.	.	ENSG00000113368	ENST00000261366;ENST00000395354	D;D	0.89270	-2.49;-2.49	5.74	5.74	0.90152	Filament (1);	0.160581	0.53938	D	0.000058	D	0.92179	0.7520	M	0.72118	2.19	0.51767	D	0.999936	P	0.51791	0.948	P	0.56163	0.793	D	0.92360	0.5896	10	0.72032	D	0.01	.	13.954	0.64135	0.0783:0.0:0.9217:0.0	.	351	P20700	LMNB1_HUMAN	Y	351	ENSP00000261366:D351Y;ENSP00000378761:D351Y	ENSP00000261366:D351Y	D	+	1	0	LMNB1	126182624	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	3.942000	0.56614	2.873000	0.98535	0.563000	0.77884	GAT	.	.	.	none		0.423	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2	NM_005573	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140811391	140811391	+	Silent	SNP	G	G	T			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr5:140811391G>T	ENST00000252085.3	+	1	1207	c.1065G>T	c.(1063-1065)tcG>tcT	p.S355S	PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	355	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGCCAGCTCGGTTCCCGAAA	0.483																																					p.S355S		Atlas-SNP	.											.	PCDHGA12	271	.	0			c.G1065T						PASS	.						75.0	75.0	75.0					5																	140811391		2203	4300	6503	SO:0001819	synonymous_variant	26025	exon1			CAGCTCGGTTCCC	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1065G>T	chr5.hg19:g.140811391G>T		125.0	0.0	.		112.0	5.0	.	NM_032094	O15100|Q6UW70|Q9Y5D7	Silent	SNP	ENST00000252085.3	hg19	CCDS4260.1																																																																																			.	.	.	none		0.483	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
ERCC6	2074	hgsc.bcm.edu	37	10	50668440	50668440	+	Silent	SNP	T	T	C			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr10:50668440T>C	ENST00000355832.5	-	20	4119	c.4041A>G	c.(4039-4041)acA>acG	p.T1347T	ERCC6_ENST00000542458.1_Silent_p.T717T|ERCC6_ENST00000465653.1_5'UTR|RP11-123B3.2_ENST00000423283.1_RNA	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	1347					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTGTTGGAGATGTTGATGAAG	0.368								Direct reversal of damage;Nucleotide excision repair (NER)																													p.R1347R		Atlas-SNP	.											.	ERCC6	162	.	0			c.G4041G						PASS	.						117.0	115.0	115.0					10																	50668440		2203	4300	6503	SO:0001819	synonymous_variant	2074	exon20			TGGAGATGTTGAT	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.4041A>G	chr10.hg19:g.50668440T>C		75.0	0.0	.		49.0	20.0	.	NM_000124	D3DX94|Q5W0L9	Silent	SNP	ENST00000355832.5	hg19	CCDS7229.1																																																																																			.	.	.	none		0.368	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
MKI67	4288	hgsc.bcm.edu	37	10	129904962	129904962	+	Silent	SNP	G	G	T	rs372451114		TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr10:129904962G>T	ENST00000368654.3	-	13	5517	c.5142C>A	c.(5140-5142)atC>atA	p.I1714I	MKI67_ENST00000368653.3_Silent_p.I1354I	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1714	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGAAGAGCTCGATGAAGCCGG	0.493																																					p.I1714I		Atlas-SNP	.											.	MKI67	363	.	0			c.C5142A						PASS	.						109.0	98.0	102.0					10																	129904962		2203	4300	6503	SO:0001819	synonymous_variant	4288	exon13			GAGCTCGATGAAG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.5142C>A	chr10.hg19:g.129904962G>T		57.0	0.0	.		62.0	4.0	.	NM_002417	Q5VWH2	Silent	SNP	ENST00000368654.3	hg19	CCDS7659.1																																																																																			.	.	.	none		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
HSPA8	3312	hgsc.bcm.edu	37	11	122931977	122931977	+	Missense_Mutation	SNP	C	C	G			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr11:122931977C>G	ENST00000532636.1	-	2	175	c.56G>C	c.(55-57)gGt>gCt	p.G19A	HSPA8_ENST00000526110.1_Missense_Mutation_p.G19A|HSPA8_ENST00000534319.1_5'Flank|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000453788.2_Missense_Mutation_p.G19A|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000227378.3_Missense_Mutation_p.G19A|HSPA8_ENST00000533540.1_Missense_Mutation_p.G19A|HSPA8_ENST00000534624.1_Missense_Mutation_p.G19A|SNORD14C_ENST00000365382.1_RNA			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	19					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		CTGGAAAACACCCACACAAGA	0.438																																					p.G19A	Colon(21;486 594 5900 6733 14272)	Atlas-SNP	.											.	HSPA8	168	.	0			c.G56C						PASS	.						65.0	58.0	61.0					11																	122931977		2202	4299	6501	SO:0001583	missense	3312	exon2			AAAACACCCACAC	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.56G>C	chr11.hg19:g.122931977C>G	ENSP00000437125:p.Gly19Ala	107.0	0.0	.		77.0	43.0	.	NM_006597	Q9H3R6	Missense_Mutation	SNP	ENST00000532636.1	hg19	CCDS8440.1	.	.	.	.	.	.	.	.	.	.	C	33	5.209267	0.95069	.	.	ENSG00000109971	ENST00000532636;ENST00000533540;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000526110;ENST00000525463;ENST00000525624;ENST00000534567;ENST00000527387;ENST00000532182;ENST00000524590;ENST00000530391	T;T;T;T;T;T;T;T;T;T;T;T;T	0.02709	5.87;5.87;5.87;5.87;5.87;5.87;4.19;5.87;5.87;5.87;5.87;5.87;5.87	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.08358	0.0208	N	0.25094	0.71	0.80722	D	1	D;B;D;D;B	0.89917	0.993;0.337;1.0;1.0;0.337	P;P;D;D;P	0.80764	0.876;0.499;0.994;0.989;0.499	T	0.39522	-0.9610	10	0.87932	D	0	-19.7385	17.4081	0.87479	0.0:1.0:0.0:0.0	.	19;19;19;19;19	B4DTX2;Q53GZ6;E7ET08;P11142-2;P11142	.;.;.;.;HSP7C_HUMAN	A	19	ENSP00000437125:G19A;ENSP00000437189:G19A;ENSP00000432083:G19A;ENSP00000404372:G19A;ENSP00000227378:G19A;ENSP00000433584:G19A;ENSP00000436762:G19A;ENSP00000435154:G19A;ENSP00000431641:G19A;ENSP00000436183:G19A;ENSP00000434415:G19A;ENSP00000434565:G19A;ENSP00000434851:G19A	ENSP00000227378:G19A	G	-	2	0	HSPA8	122437187	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.151000	0.67156	0.484000	0.47621	GGT	.	.	.	none		0.438	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
MT1E	4493	hgsc.bcm.edu	37	16	56660835	56660835	+	Silent	SNP	G	G	A			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr16:56660835G>A	ENST00000306061.6	+	3	515	c.138G>A	c.(136-138)caG>caA	p.Q46Q	MT1E_ENST00000330439.6_3'UTR|MT1E_ENST00000568293.1_Silent_p.Q24Q	NM_175617.3	NP_783316.2	P04732	MT1E_HUMAN	metallothionein 1E	46	Alpha.				cellular response to cadmium ion (GO:0071276)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)										AGTGTGCCCAGGGCTGCGTCT	0.602																																					p.Q46Q		Atlas-SNP	.											.	MT1E	7	.	0			c.G138A						PASS	.						139.0	132.0	134.0					16																	56660835		2198	4300	6498	SO:0001819	synonymous_variant	4493	exon3			TGCCCAGGGCTGC	BC009699	CCDS10764.2	16q13	2008-08-11	2007-03-02		ENSG00000169715	ENSG00000169715		"""Metallothioneins"""	7397	protein-coding gene	gene with protein product		156351		MT1		6089206, 2581970	Standard	XM_005255956		Approved	MTD	uc002ejl.3	P04732	OTTHUMG00000133014	ENST00000306061.6:c.138G>A	chr16.hg19:g.56660835G>A		80.0	0.0	.		69.0	27.0	.	NM_175617	A2RRF7|Q86YX4|Q8TD51	Silent	SNP	ENST00000306061.6	hg19	CCDS10764.2																																																																																			.	.	.	none		0.602	MT1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256600.1	NM_175617	
SIRT7	51547	hgsc.bcm.edu	37	17	79870320	79870320	+	Missense_Mutation	SNP	T	T	C			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr17:79870320T>C	ENST00000328666.6	-	10	1237	c.1175A>G	c.(1174-1176)aAa>aGa	p.K392R	PCYT2_ENST00000331285.3_5'Flank|PCYT2_ENST00000538721.2_5'Flank|PCYT2_ENST00000570388.1_5'Flank|PCYT2_ENST00000570391.1_5'Flank|PCYT2_ENST00000538936.2_5'Flank|PCYT2_ENST00000571105.1_5'Flank	NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	392					histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TTTTGTGCGTTTTGTGCAGCC	0.602																																					p.K392R		Atlas-SNP	.											.	SIRT7	37	.	0			c.A1175G						PASS	.						155.0	138.0	144.0					17																	79870320		2203	4299	6502	SO:0001583	missense	51547	exon10			GTGCGTTTTGTGC	AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.1175A>G	chr17.hg19:g.79870320T>C	ENSP00000329466:p.Lys392Arg	81.0	0.0	.		97.0	4.0	.	NM_016538	A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Missense_Mutation	SNP	ENST00000328666.6	hg19	CCDS11792.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.918735	0.92249	.	.	ENSG00000187531	ENST00000328666	T	0.38240	1.15	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.56906	0.2017	M	0.67953	2.075	0.54753	D	0.999987	D;D	0.63880	0.993;0.993	D;D	0.72625	0.978;0.978	T	0.61362	-0.7078	10	0.87932	D	0	-14.0698	13.3565	0.60631	0.0:0.0:0.0:1.0	.	392;392	A8K2K0;Q9NRC8	.;SIRT7_HUMAN	R	392	ENSP00000329466:K392R	ENSP00000329466:K392R	K	-	2	0	SIRT7	77463612	1.000000	0.71417	0.911000	0.35937	0.977000	0.68977	6.029000	0.70895	1.996000	0.58369	0.402000	0.26972	AAA	.	.	.	none		0.602	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439961.1	NM_016538	
TSHZ3	57616	hgsc.bcm.edu	37	19	31768683	31768683	+	Silent	SNP	G	G	A	rs373477520		TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr19:31768683G>A	ENST00000240587.4	-	2	2343	c.2016C>T	c.(2014-2016)agC>agT	p.S672S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	672					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCCGCGGGGGGCTGGGGCTGT	0.657																																					p.S672S		Atlas-SNP	.											.	TSHZ3	549	.	0			c.C2016T						PASS	.	G		1,4391		0,1,2195	22.0	25.0	24.0		2016	0.8	1.0	19		24	0,8584		0,0,4292	no	coding-synonymous	TSHZ3	NM_020856.2		0,1,6487	AA,AG,GG		0.0,0.0228,0.0077		672/1082	31768683	1,12975	2196	4292	6488	SO:0001819	synonymous_variant	57616	exon2			CGGGGGGCTGGGG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2016C>T	chr19.hg19:g.31768683G>A		66.0	0.0	.		52.0	23.0	.	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	hg19	CCDS12421.2																																																																																			.	.	.	weak		0.657	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
C20orf195	79025	hgsc.bcm.edu	37	20	62187129	62187129	+	Missense_Mutation	SNP	G	G	T			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr20:62187129G>T	ENST00000370098.3	+	2	205	c.113G>T	c.(112-114)tGg>tTg	p.W38L	C20orf195_ENST00000370097.1_Missense_Mutation_p.W38L	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	38						extracellular vesicular exosome (GO:0070062)				large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CCAGAGGCGTGGAAGACCTAC	0.647																																					p.W38L		Atlas-SNP	.											.	C20orf195	21	.	0			c.G113T						PASS	.						51.0	47.0	48.0					20																	62187129		2203	4300	6503	SO:0001583	missense	79025	exon2			AGGCGTGGAAGAC		CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.113G>T	chr20.hg19:g.62187129G>T	ENSP00000359116:p.Trp38Leu	78.0	0.0	.		64.0	25.0	.	NM_024059		Missense_Mutation	SNP	ENST00000370098.3	hg19	CCDS13526.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877757	0.51801	.	.	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.26	5.26	0.73747	.	0.000000	0.47093	D	0.000260	T	0.66703	0.2816	L	0.29908	0.895	0.41621	D	0.988965	D	0.89917	1.0	D	0.87578	0.998	T	0.70070	-0.4973	9	0.62326	D	0.03	-15.2825	16.61	0.84880	0.0:0.0:1.0:0.0	.	38	Q9BVV2	CT195_HUMAN	L	38	.	ENSP00000359115:W38L	W	+	2	0	C20orf195	61657573	1.000000	0.71417	0.991000	0.47740	0.053000	0.15095	4.172000	0.58243	2.444000	0.82710	0.655000	0.94253	TGG	.	.	.	none		0.647	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080155.1	NM_024059	
TRAPPC10	7109	hgsc.bcm.edu	37	21	45518268	45518268	+	Missense_Mutation	SNP	C	C	A			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr21:45518268C>A	ENST00000291574.4	+	21	3374	c.3199C>A	c.(3199-3201)Ccc>Acc	p.P1067T		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1067					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						TGAGATCTTTCCCCCTTCGGG	0.483																																					p.P1067T		Atlas-SNP	.											.	TRAPPC10	109	.	0			c.C3199A						PASS	.						160.0	154.0	156.0					21																	45518268		2203	4300	6503	SO:0001583	missense	7109	exon21			ATCTTTCCCCCTT	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.3199C>A	chr21.hg19:g.45518268C>A	ENSP00000291574:p.Pro1067Thr	117.0	0.0	.		83.0	38.0	.	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	hg19	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867157	0.91511	.	.	ENSG00000160218	ENST00000291574;ENST00000542855	T	0.27104	1.69	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.45418	0.1341	L	0.47190	1.495	0.80722	D	1	D;D;D	0.59357	0.981;0.985;0.966	D;D;P	0.65233	0.91;0.933;0.773	T	0.12604	-1.0541	10	0.46703	T	0.11	.	19.8608	0.96783	0.0:1.0:0.0:0.0	.	172;326;1067	B4DV34;B4DI17;P48553	.;.;TPC10_HUMAN	T	1067;198	ENSP00000291574:P1067T	ENSP00000291574:P1067T	P	+	1	0	TRAPPC10	44342696	1.000000	0.71417	0.174000	0.22961	0.192000	0.23643	6.845000	0.75394	2.763000	0.94921	0.655000	0.94253	CCC	.	.	.	none		0.483	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
MYO18B	84700	hgsc.bcm.edu	37	22	26348362	26348362	+	Missense_Mutation	SNP	C	C	G			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr22:26348362C>G	ENST00000407587.2	+	38	6115	c.5946C>G	c.(5944-5946)ttC>ttG	p.F1982L	MYO18B_ENST00000335473.7_Missense_Mutation_p.F1981L|MYO18B_ENST00000536101.1_Missense_Mutation_p.F1981L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1981	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGACAGAGTTCCAGAAGGTGC	0.507																																					p.F1981L		Atlas-SNP	.											.	MYO18B	322	.	0			c.C5943G						PASS	.						68.0	72.0	70.0					22																	26348362		2022	4201	6223	SO:0001583	missense	84700	exon38			AGAGTTCCAGAAG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5946C>G	chr22.hg19:g.26348362C>G	ENSP00000386096:p.Phe1982Leu	110.0	0.0	.		87.0	40.0	.	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	17.33	3.363118	0.61513	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86497	-2.1;-2.1;-2.13	5.49	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.90407	0.6997	M	0.62016	1.91	0.39328	D	0.965364	P;P;D;P	0.89917	0.929;0.576;1.0;0.701	P;B;D;B	0.85130	0.597;0.073;0.997;0.153	D	0.87861	0.2664	10	0.12766	T	0.61	.	11.4231	0.49993	0.0:0.85:0.0:0.15	.	1494;1981;1982;1981	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	L	1981;1981;1982	ENSP00000441229:F1981L;ENSP00000334563:F1981L;ENSP00000386096:F1982L	ENSP00000334563:F1981L	F	+	3	2	MYO18B	24678362	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.324000	0.33712	1.337000	0.45525	0.655000	0.94253	TTC	.	.	.	none		0.507	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
ATF7IP	55729	hgsc.bcm.edu	37	12	14576874	14576874	+	Frame_Shift_Del	DEL	A	A	-			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr12:14576874delA	ENST00000540793.1	+	1	180	c.25delA	c.(25-27)aaafs	p.K10fs	ATF7IP_ENST00000543189.1_Frame_Shift_Del_p.K10fs|ATF7IP_ENST00000544627.1_Frame_Shift_Del_p.K18fs|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000536444.1_Frame_Shift_Del_p.K10fs|ATF7IP_ENST00000261168.4_Frame_Shift_Del_p.K10fs			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	10					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						AGAACCTCAGAAAAAAGTCTT	0.353																																					p.Q8fs		Atlas-Indel,Pindel	.											.	ATF7IP	136	.	0			c.24delG						PASS	.						48.0	47.0	47.0					12																	14576874		2203	4300	6503	SO:0001589	frameshift_variant	55729	exon2			.	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.25delA	chr12.hg19:g.14576874delA	ENSP00000444589:p.Lys10fs	91.0	0.0	0		86.0	34.0	0.395349	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Frame_Shift_Del	DEL	ENST00000540793.1	hg19	CCDS8663.1																																																																																			.	.	.	none		0.353	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
FRMD6	122786	hgsc.bcm.edu	37	14	52156560	52156561	+	Frame_Shift_Ins	INS	-	-	A			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr14:52156560_52156561insA	ENST00000344768.5	+	2	202_203	c.6_7insA	c.(7-9)aaafs	p.K3fs	RNA5SP385_ENST00000515947.1_RNA|FRMD6_ENST00000395718.2_Frame_Shift_Ins_p.K3fs|FRMD6_ENST00000356218.4_Frame_Shift_Ins_p.K3fs			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	3					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					ACACAATGAACAAATTGAATTT	0.485																																					p.N2fs		Atlas-Indel,Pindel	.											.	FRMD6	100	.	0			c.6_7insA						PASS	.																																			SO:0001589	frameshift_variant	122786	exon3			.	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.9dupA	chr14.hg19:g.52156563_52156563dupA	ENSP00000343899:p.Lys3fs	186.0	0.0	0		172.0	80.0	0.465116	NM_001042481	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Frame_Shift_Ins	INS	ENST00000344768.5	hg19	CCDS58318.1																																																																																			.	.	.	none		0.485	FRMD6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276881.1	NM_152330	
FOXP4	116113	hgsc.bcm.edu	37	6	41557563	41557563	+	Frame_Shift_Del	DEL	C	C	-			TCGA-O9-A75Z-01A-11D-A33Q-10	TCGA-O9-A75Z-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	11f95391-f644-4b23-b2b3-c3020648260b	b07e7c8d-9fc0-4376-89e2-8ceb9afcaa38	g.chr6:41557563delC	ENST00000307972.4	+	9	1132	c.1120delC	c.(1120-1122)cccfs	p.P374fs	FOXP4_ENST00000409208.1_Frame_Shift_Del_p.P374fs|FOXP4_ENST00000373063.3_Frame_Shift_Del_p.P373fs|FOXP4_ENST00000373060.1_Frame_Shift_Del_p.P374fs|FOXP4_ENST00000373057.3_Frame_Shift_Del_p.P372fs			Q8IVH2	FOXP4_HUMAN	forkhead box P4	374					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GCACATGCGGCCCTCGGAGCC	0.692											OREG0004066	type=REGULATORY REGION|Gene=FOXP4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R373fs		Atlas-INDEL	.											.	FOXP4	83	.	0			c.1119delG						PASS	.						34.0	37.0	36.0					6																	41557563		2203	4299	6502	SO:0001589	frameshift_variant	116113	exon10			.	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.1120delC	chr6.hg19:g.41557563delC	ENSP00000309823:p.Pro374fs	33.0	0.0	0	902	30.0	11.0	0.366667	NM_001012426	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Frame_Shift_Del	DEL	ENST00000307972.4	hg19	CCDS34447.1																																																																																			.	.	.	none		0.692	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457	
