#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GNB1	2782	hgsc.bcm.edu	37	1	1720557	1720557	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:1720557A>C	ENST00000378609.4	-	10	1182	c.851T>G	c.(850-852)cTc>cGc	p.L284R		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	284					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		AGCAAGGAGGAGGCGCCCGCT	0.572											OREG0012998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L284R		Atlas-SNP	.											.	GNB1	39	.	0			c.T851G						PASS	.						100.0	94.0	96.0					1																	1720557		2203	4300	6503	SO:0001583	missense	2782	exon10			AGGAGGAGGCGCC	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.851T>G	chr1.hg19:g.1720557A>C	ENSP00000367872:p.Leu284Arg	143.0	0.0	.	598	145.0	67.0	.	NM_002074	B1AJZ7|P04697|P04901|Q1RMY8	Missense_Mutation	SNP	ENST00000378609.4	hg19	CCDS34.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.4|22.4	4.290122|4.290122	0.80914|0.80914	.|.	.|.	ENSG00000078369|ENSG00000078369	ENST00000378609;ENST00000455156;ENST00000378606|ENST00000424622	T|.	0.62105|.	0.05|.	5.52|5.52	5.52|5.52	0.82312|0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76528|0.76528	0.4000|0.4000	M|M	0.80847|0.80847	2.515|2.515	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.81914|.	0.995|.	T|T	0.78219|0.78219	-0.2289|-0.2289	10|5	0.51188|.	T|.	0.08|.	-9.8798|-9.8798	14.8181|14.8181	0.70050|0.70050	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	284|.	P62873|.	GBB1_HUMAN|.	R|A	284;184;284|142	ENSP00000367872:L284R|.	ENSP00000367869:L284R|.	L|S	-|-	2|1	0|0	GNB1|GNB1	1710417|1710417	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.885000|0.885000	0.51271|0.51271	9.126000|9.126000	0.94411|0.94411	2.096000|2.096000	0.63516|0.63516	0.533000|0.533000	0.62120|0.62120	CTC|TCC	.	.	.	none		0.572	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074	
DNAJC16	23341	hgsc.bcm.edu	37	1	15855696	15855696	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:15855696A>C	ENST00000375847.3	+	2	260	c.96A>C	c.(94-96)agA>agC	p.R32S	CASP9_ENST00000469637.1_5'Flank|DNAJC16_ENST00000375838.1_Missense_Mutation_p.R32S|DNAJC16_ENST00000375849.1_Missense_Mutation_p.R32S	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	32	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ACCCATACAGAGTCCTAGGGG	0.443																																					p.R32S		Atlas-SNP	.											.	DNAJC16	59	.	0			c.A96C						PASS	.						109.0	107.0	108.0					1																	15855696		2203	4300	6503	SO:0001583	missense	23341	exon2			ATACAGAGTCCTA	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.96A>C	chr1.hg19:g.15855696A>C	ENSP00000365007:p.Arg32Ser	106.0	0.0	.		120.0	47.0	.	NM_015291	Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	ENST00000375847.3	hg19	CCDS30606.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.678494	0.47886	.	.	ENSG00000116138	ENST00000375847;ENST00000375838;ENST00000375849;ENST00000546230	T;T;T	0.72282	-0.64;-0.64;-0.64	5.41	5.41	0.78517	Heat shock protein DnaJ, N-terminal (5);	0.092613	0.64402	D	0.000001	T	0.41465	0.1160	N	0.02111	-0.68	0.24628	N	0.99364	B;B	0.28208	0.166;0.203	B;B	0.24848	0.056;0.052	T	0.29518	-1.0009	10	0.38643	T	0.18	-23.0336	8.0421	0.30527	0.9101:0.0:0.0899:0.0	.	32;32	Q9Y2G8;Q5TDG9	DJC16_HUMAN;.	S	32	ENSP00000365007:R32S;ENSP00000364998:R32S;ENSP00000365009:R32S	ENSP00000364998:R32S	R	+	3	2	DNAJC16	15728283	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.233000	0.51311	2.060000	0.61445	0.460000	0.39030	AGA	.	.	.	none		0.443	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
UBR4	23352	hgsc.bcm.edu	37	1	19500887	19500887	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:19500887G>T	ENST00000375254.3	-	22	2935	c.2908C>A	c.(2908-2910)Ctg>Atg	p.L970M	UBR4_ENST00000375226.2_Missense_Mutation_p.L970M|UBR4_ENST00000375217.2_Missense_Mutation_p.L970M|UBR4_ENST00000375267.2_Missense_Mutation_p.L970M	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	970					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGGGCTGTCAGTGCAGCATAA	0.438																																					p.L970M		Atlas-SNP	.											.	UBR4	415	.	0			c.C2908A						PASS	.						120.0	102.0	108.0					1																	19500887		2203	4300	6503	SO:0001583	missense	23352	exon22			CTGTCAGTGCAGC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.2908C>A	chr1.hg19:g.19500887G>T	ENSP00000364403:p.Leu970Met	52.0	0.0	.		37.0	11.0	.	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	hg19	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.982527	0.53827	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000419533	T;T;T;T	0.36699	1.26;1.26;1.24;1.24	5.76	-1.65	0.08291	.	0.000000	0.64402	D	0.000001	T	0.44371	0.1290	L	0.39898	1.24	0.80722	D	1	D	0.65815	0.995	D	0.70487	0.969	T	0.26467	-1.0102	10	0.87932	D	0	.	11.0624	0.47955	0.5235:0.0:0.4765:0.0	.	970	Q5T4S7	UBR4_HUMAN	M	970;970;970;970;186	ENSP00000364403:L970M;ENSP00000364416:L970M;ENSP00000364365:L970M;ENSP00000364374:L970M	ENSP00000364365:L970M	L	-	1	2	UBR4	19373474	0.850000	0.29656	0.011000	0.14972	0.823000	0.46562	1.167000	0.31847	-0.623000	0.05618	-0.768000	0.03414	CTG	.	.	.	none		0.438	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
USP48	84196	hgsc.bcm.edu	37	1	22073615	22073615	+	Silent	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:22073615A>G	ENST00000308271.9	-	8	1584	c.936T>C	c.(934-936)aaT>aaC	p.N312N	USP48_ENST00000400301.1_Silent_p.N312N|USP48_ENST00000421625.2_Silent_p.N312N|USP48_ENST00000529637.1_Silent_p.N312N	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	312	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CAATGTAGGTATTCAGCTTTT	0.313																																					p.N312N		Atlas-SNP	.											.	USP48	91	.	0			c.T936C						PASS	.						94.0	91.0	92.0					1																	22073615		2203	4300	6503	SO:0001819	synonymous_variant	84196	exon8			GTAGGTATTCAGC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.936T>C	chr1.hg19:g.22073615A>G		18.0	0.0	.		18.0	5.0	.	NM_001032730	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000308271.9	hg19	CCDS30623.1																																																																																			.	.	.	none		0.313	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
MECR	51102	hgsc.bcm.edu	37	1	29520638	29520638	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:29520638G>C	ENST00000263702.6	-	10	1043	c.1018C>G	c.(1018-1020)Ctc>Gtc	p.L340V	MECR_ENST00000373791.3_Missense_Mutation_p.L264V			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	340					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		GGGGCTGTGAGCTGGCCTCGG	0.572																																					p.L340V		Atlas-SNP	.											.	MECR	31	.	0			c.C1018G						PASS	.						102.0	109.0	107.0					1																	29520638		2203	4300	6503	SO:0001583	missense	51102	exon10			CTGTGAGCTGGCC		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.1018C>G	chr1.hg19:g.29520638G>C	ENSP00000263702:p.Leu340Val	67.0	0.0	.		96.0	30.0	.	NM_016011	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	hg19	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554761	0.65425	.	.	ENSG00000116353	ENST00000373791;ENST00000263702	T;T	0.05199	3.48;3.49	5.48	5.48	0.80851	NAD(P)-binding domain (1);	0.133396	0.53938	D	0.000051	T	0.27169	0.0666	M	0.88181	2.935	0.58432	D	0.999999	P	0.45348	0.856	P	0.55749	0.783	T	0.01583	-1.1319	10	0.59425	D	0.04	.	16.849	0.85988	0.0:0.0:1.0:0.0	.	340	Q9BV79	MECR_HUMAN	V	264;340	ENSP00000362896:L264V;ENSP00000263702:L340V	ENSP00000263702:L340V	L	-	1	0	MECR	29393225	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	6.509000	0.73725	2.584000	0.87258	0.563000	0.77884	CTC	.	.	.	none		0.572	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011	
INADL	10207	hgsc.bcm.edu	37	1	62271194	62271194	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:62271194A>G	ENST00000371158.2	+	13	1738	c.1624A>G	c.(1624-1626)Atg>Gtg	p.M542V	INADL_ENST00000316485.6_Missense_Mutation_p.M542V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	542					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TTATGAAGTAATGGTATGTTA	0.358																																					p.M542V		Atlas-SNP	.											.	INADL	179	.	0			c.A1624G						PASS	.						93.0	99.0	97.0					1																	62271194		2203	4300	6503	SO:0001583	missense	10207	exon13			GAAGTAATGGTAT	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.1624A>G	chr1.hg19:g.62271194A>G	ENSP00000360200:p.Met542Val	54.0	0.0	.		73.0	25.0	.	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	hg19	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	17.77	3.472247	0.63737	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.08546	3.27;3.08	5.69	5.69	0.88448	PDZ/DHR/GLGF (1);	0.057835	0.64402	D	0.000002	T	0.21186	0.0510	M	0.62723	1.935	0.80722	D	1	D;D;P	0.67145	0.996;0.986;0.488	D;D;P	0.77557	0.99;0.965;0.508	T	0.08868	-1.0701	10	0.02654	T	1	.	14.5128	0.67800	1.0:0.0:0.0:0.0	.	542;542;542	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	V	542	ENSP00000360200:M542V;ENSP00000326199:M542V	ENSP00000255202:M542V	M	+	1	0	INADL	62043782	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.401000	0.52601	2.174000	0.68829	0.528000	0.53228	ATG	.	.	.	none		0.358	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
PRMT6	55170	hgsc.bcm.edu	37	1	107599742	107599742	+	Silent	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:107599742C>T	ENST00000370078.1	+	1	442	c.405C>T	c.(403-405)gtC>gtT	p.V135V	PRMT6_ENST00000361318.5_Silent_p.V76V			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	135	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		GGGTGCACGTCCTGCCGGGAC	0.672																																					p.V135V		Atlas-SNP	.											.	PRMT6	55	.	0			c.C405T						PASS	.						72.0	85.0	81.0					1																	107599742		2178	4281	6459	SO:0001819	synonymous_variant	55170	exon1			GCACGTCCTGCCG	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.405C>T	chr1.hg19:g.107599742C>T		20.0	0.0	.		24.0	8.0	.	NM_018137	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Silent	SNP	ENST00000370078.1	hg19	CCDS41360.2	.	.	.	.	.	.	.	.	.	.	C	5.305	0.241690	0.10077	.	.	ENSG00000198890	ENST00000540389	.	.	.	5.75	1.4	0.22301	.	.	.	.	.	T	0.48537	0.1505	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53753	-0.8394	5	0.87932	D	0	-18.1897	6.1728	0.20427	0.0:0.3898:0.4219:0.1884	.	.	.	.	S	29	.	ENSP00000440829:P29S	P	+	1	0	PRMT6	107401265	0.574000	0.26684	0.997000	0.53966	0.007000	0.05969	-0.426000	0.07008	0.714000	0.32081	0.544000	0.68410	CCT	.	.	.	none		0.672	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137	
CRNN	49860	hgsc.bcm.edu	37	1	152384603	152384603	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:152384603A>G	ENST00000271835.3	-	2	169	c.107T>C	c.(106-108)cTc>cCc	p.L36P	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	36					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGCTCCAAGAGTCTTTTCAG	0.557																																					p.L36P		Atlas-SNP	.											.	CRNN	78	.	0			c.T107C						PASS	.						152.0	132.0	139.0					1																	152384603		2203	4300	6503	SO:0001583	missense	49860	exon2			TCCAAGAGTCTTT	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.107T>C	chr1.hg19:g.152384603A>G	ENSP00000271835:p.Leu36Pro	136.0	0.0	.		170.0	74.0	.	NM_016190	B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	hg19	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518486	0.64634	.	.	ENSG00000143536	ENST00000271835;ENST00000451038	T	0.36340	1.26	4.78	3.65	0.41850	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.164580	0.29021	N	0.013391	T	0.54175	0.1842	M	0.92507	3.315	0.51233	D	0.999918	D	0.89917	1.0	D	0.80764	0.994	T	0.61652	-0.7019	10	0.87932	D	0	.	7.0943	0.25301	0.8983:0.0:0.1017:0.0	.	36	Q9UBG3	CRNN_HUMAN	P	36	ENSP00000271835:L36P	ENSP00000271835:L36P	L	-	2	0	CRNN	150651227	0.903000	0.30736	0.739000	0.30968	0.985000	0.73830	3.133000	0.50531	0.861000	0.35504	0.482000	0.46254	CTC	.	.	.	none		0.557	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
DENND4B	9909	hgsc.bcm.edu	37	1	153907287	153907287	+	Missense_Mutation	SNP	G	G	C	rs3835302|rs199597671		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:153907287G>C	ENST00000361217.4	-	18	3140	c.2722C>G	c.(2722-2724)Cag>Gag	p.Q908E	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	908	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			tcctgctgctgctgctgctgc	0.632																																					p.Q908E		Atlas-SNP	.											.	DENND4B	210	.	0			c.C2722G						PASS	.						23.0	27.0	26.0					1																	153907287		2184	4281	6465	SO:0001583	missense	9909	exon18			GCTGCTGCTGCTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2722C>G	chr1.hg19:g.153907287G>C	ENSP00000354597:p.Gln908Glu	45.0	0.0	.		90.0	9.0	.	NM_014856	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	hg19	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	1.785	-0.481073	0.04383	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06294	3.33;3.32	2.67	0.673	0.17941	.	5.053470	0.00166	N	0.000001	T	0.00815	0.0027	N	0.14661	0.345	0.19300	N	0.999977	B	0.02656	0.0	B	0.04013	0.001	T	0.26573	-1.0099	10	0.02654	T	1	-2.4288	3.3651	0.07201	0.1454:0.0:0.5849:0.2697	.	908	O75064	DEN4B_HUMAN	E	908;919	ENSP00000354597:Q908E;ENSP00000357635:Q919E	ENSP00000354597:Q908E	Q	-	1	0	DENND4B	152173911	0.943000	0.32029	0.986000	0.45419	0.760000	0.43138	0.537000	0.23144	0.194000	0.20326	0.271000	0.19318	CAG	.	.	.	weak		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
DENND4B	9909	hgsc.bcm.edu	37	1	153907297	153907297	+	Silent	SNP	C	C	T	rs557071025|rs544489048	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:153907297C>T	ENST00000361217.4	-	18	3130	c.2712G>A	c.(2710-2712)caG>caA	p.Q904Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	904	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgctgctgtt	0.632													c|||	1	0.000199681	0.0	0.0	5008	,	,		16455	0.0		0.0	False		,,,				2504	0.001				p.Q904Q		Atlas-SNP	.											DENND4B_ENST00000361217,NS,carcinoma,0,6	DENND4B	210	.	0			c.G2712A						PASS	.						28.0	36.0	33.0					1																	153907297		2179	4277	6456	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGCTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2712G>A	chr1.hg19:g.153907297C>T		80.0	0.0	.		100.0	20.0	.	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	hg19	CCDS44228.1																																																																																			.	.	.	none		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
HDGF	3068	hgsc.bcm.edu	37	1	156713547	156713547	+	Missense_Mutation	SNP	C	C	T	rs375226201		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:156713547C>T	ENST00000357325.5	-	5	927	c.613G>A	c.(613-615)Ggc>Agc	p.G205S	HDGF_ENST00000368206.5_Missense_Mutation_p.G221S|MRPL24_ENST00000361531.2_5'Flank|MRPL24_ENST00000368211.4_5'Flank|HDGF_ENST00000368209.5_Missense_Mutation_p.G198S|HDGF_ENST00000465180.1_5'UTR|HDGF_ENST00000416666.2_Missense_Mutation_p.G173S|HDGF_ENST00000537739.1_Missense_Mutation_p.G205S	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor	205	Glu-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CGGCCAGAGCCGGGCTCAGAG	0.587																																					p.G221S		Atlas-SNP	.											.	HDGF	60	.	0			c.G661A						PASS	.	C	SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	30.0	33.0	32.0		661,592,613	0.6	0.1	1		32	1,8599		0,1,4299	no	missense,missense,missense	HDGF	NM_001126050.1,NM_001126051.1,NM_004494.2	56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	221/257,198/234,205/241	156713547	1,13005	2203	4300	6503	SO:0001583	missense	3068	exon5			CAGAGCCGGGCTC	D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.613G>A	chr1.hg19:g.156713547C>T	ENSP00000349878:p.Gly205Ser	28.0	0.0	.		63.0	33.0	.	NM_001126050	B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Missense_Mutation	SNP	ENST00000357325.5	hg19	CCDS1156.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352591	0.24512	0.0	1.16E-4	ENSG00000143321	ENST00000357325;ENST00000368209;ENST00000537739;ENST00000416666;ENST00000368206;ENST00000406805	T;T;T;T;T	0.30448	2.05;1.56;2.05;1.6;1.53	4.55	0.546	0.17196	.	1.032050	0.07707	N	0.941443	T	0.06280	0.0162	L	0.34521	1.04	0.09310	N	1	B;B;B;B	0.28291	0.206;0.206;0.034;0.014	B;B;B;B	0.14023	0.01;0.01;0.004;0.002	T	0.38628	-0.9652	10	0.15952	T	0.53	-2.1192	6.8306	0.23907	0.0:0.6085:0.0:0.3915	.	180;221;198;205	B7Z958;Q5SZ07;Q5SZ08;P51858	.;.;.;HDGF_HUMAN	S	205;198;205;173;221;228	ENSP00000349878:G205S;ENSP00000357192:G198S;ENSP00000443120:G205S;ENSP00000416752:G173S;ENSP00000357189:G221S	ENSP00000349878:G205S	G	-	1	0	HDGF	154980171	0.000000	0.05858	0.089000	0.20774	0.788000	0.44548	-0.589000	0.05767	-0.053000	0.13289	0.456000	0.33151	GGC	.	.	.	none		0.587	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098946.1	NM_004494	
IPO9	55705	hgsc.bcm.edu	37	1	201842054	201842054	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:201842054A>C	ENST00000361565.4	+	20	2744	c.2675A>C	c.(2674-2676)gAt>gCt	p.D892A		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	892					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TACAGCATGGATGAGGGCATC	0.532																																					p.D892A		Atlas-SNP	.											.	IPO9	98	.	0			c.A2675C						PASS	.						97.0	88.0	91.0					1																	201842054		2203	4300	6503	SO:0001583	missense	55705	exon20			GCATGGATGAGGG	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2675A>C	chr1.hg19:g.201842054A>C	ENSP00000354742:p.Asp892Ala	180.0	0.0	.		181.0	78.0	.	NM_018085	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	hg19	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.859721	0.51376	.	.	ENSG00000198700	ENST00000361565	.	.	.	5.23	5.23	0.72850	Armadillo-like helical (1);Armadillo-type fold (1);	0.136301	0.64402	D	0.000004	T	0.40498	0.1119	N	0.17723	0.515	0.80722	D	1	B	0.17038	0.02	B	0.16722	0.016	T	0.26677	-1.0096	9	0.12103	T	0.63	-31.3306	13.3919	0.60829	1.0:0.0:0.0:0.0	.	892	Q96P70	IPO9_HUMAN	A	892	.	ENSP00000354742:D892A	D	+	2	0	IPO9	200108677	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	8.726000	0.91474	2.107000	0.64212	0.533000	0.62120	GAT	.	.	.	none		0.532	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
CENPF	1063	hgsc.bcm.edu	37	1	214813548	214813548	+	Nonsense_Mutation	SNP	A	A	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:214813548A>T	ENST00000366955.3	+	12	2035	c.1867A>T	c.(1867-1869)Aaa>Taa	p.K623*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TTCTTGTTGGAAAAGTGAAAA	0.333																																					p.K623X	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											.	CENPF	321	.	0			c.A1867T						PASS	.						32.0	37.0	36.0					1																	214813548		2198	4298	6496	SO:0001587	stop_gained	1063	exon12			TGTTGGAAAAGTG	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1867A>T	chr1.hg19:g.214813548A>T	ENSP00000355922:p.Lys623*	64.0	0.0	.		51.0	21.0	.	NM_016343	Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	A	40	8.443638	0.98813	.	.	ENSG00000117724	ENST00000366955	.	.	.	5.6	5.6	0.85130	.	0.000000	0.39407	N	0.001364	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7907	0.78357	1.0:0.0:0.0:0.0	.	.	.	.	X	623	.	ENSP00000355922:K623X	K	+	1	0	CENPF	212880171	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.770000	0.85390	2.126000	0.65437	0.443000	0.29094	AAA	.	.	.	none		0.333	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
EPRS	2058	hgsc.bcm.edu	37	1	220154162	220154162	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:220154162G>C	ENST00000366923.3	-	25	3760	c.3491C>G	c.(3490-3492)aCt>aGt	p.T1164S		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1164	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	AAATTCACGAGTACGTAGGAA	0.388																																					p.T1164S		Atlas-SNP	.											.	EPRS	140	.	0			c.C3491G						PASS	.						64.0	60.0	61.0					1																	220154162		2203	4300	6503	SO:0001583	missense	2058	exon25			TCACGAGTACGTA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3491C>G	chr1.hg19:g.220154162G>C	ENSP00000355890:p.Thr1164Ser	202.0	0.0	.		207.0	80.0	.	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	hg19	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	G	32	5.174061	0.94807	.	.	ENSG00000136628	ENST00000366923	T	0.68025	-0.3	6.06	6.06	0.98353	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.78046	0.4222	L	0.39326	1.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76865	-0.2801	10	0.56958	D	0.05	-28.6459	20.6397	0.99537	0.0:0.0:1.0:0.0	.	1164	P07814	SYEP_HUMAN	S	1164	ENSP00000355890:T1164S	ENSP00000355890:T1164S	T	-	2	0	EPRS	218220785	1.000000	0.71417	0.980000	0.43619	0.980000	0.70556	9.577000	0.98196	2.880000	0.98712	0.650000	0.86243	ACT	.	.	.	none		0.388	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
CCDC185	164127	hgsc.bcm.edu	37	1	223567036	223567036	+	Silent	SNP	C	C	T	rs369292167	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:223567036C>T	ENST00000366875.3	+	1	322	c.219C>T	c.(217-219)cgC>cgT	p.R73R		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		73	Arg-rich.									breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		CTCGCAGGCGCGGGTGCTCAG	0.736													C|||	6	0.00119808	0.0045	0.0	5008	,	,		13138	0.0		0.0	False		,,,				2504	0.0				p.R73R		Atlas-SNP	.											.	C1orf65	71	.	0			c.C219T						PASS	.	C		15,3615		0,15,1800	4.0	6.0	5.0		219	0.3	0.0	1		5	0,7554		0,0,3777	no	coding-synonymous	C1orf65	NM_152610.2		0,15,5577	TT,TC,CC		0.0,0.4132,0.1341		73/624	223567036	15,11169	1815	3777	5592	SO:0001819	synonymous_variant	164127	exon1			CAGGCGCGGGTGC																												ENST00000366875.3:c.219C>T	chr1.hg19:g.223567036C>T		1.0	0.0	.		50.0	17.0	.	NM_152610	Q8N746|Q8NA93	Silent	SNP	ENST00000366875.3	hg19	CCDS1537.1																																																																																			.	.	.	none		0.736	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
OR2M5	127059	hgsc.bcm.edu	37	1	248309355	248309355	+	Silent	SNP	G	G	A	rs201158893	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:248309355G>A	ENST00000366476.1	+	1	906	c.906G>A	c.(904-906)agG>agA	p.R302R		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			GAGCACTCAGGAAAGTGTTAG	0.453													g|||	3	0.000599042	0.0	0.0	5008	,	,		17536	0.0		0.0	False		,,,				2504	0.0031				p.R302R		Atlas-SNP	.											.	OR2M5	117	.	0			c.G906A						PASS	.						62.0	58.0	59.0					1																	248309355		2203	4300	6503	SO:0001819	synonymous_variant	127059	exon1			ACTCAGGAAAGTG		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.906G>A	chr1.hg19:g.248309355G>A		137.0	0.0	.		175.0	8.0	.	NM_001004690		Silent	SNP	ENST00000366476.1	hg19	CCDS31105.1																																																																																			.	G|0.999;A|0.001	0.001	weak		0.453	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690	
MXD1	4084	hgsc.bcm.edu	37	2	70165384	70165384	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:70165384C>G	ENST00000264444.2	+	6	894	c.634C>G	c.(634-636)Cag>Gag	p.Q212E	MXD1_ENST00000465446.1_3'UTR|MXD1_ENST00000540449.1_Missense_Mutation_p.Q202E	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	212					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						AATAAAGCTGCAGGACAGTCA	0.547																																					p.Q212E		Atlas-SNP	.											.	MXD1	23	.	0			c.C634G						PASS	.						103.0	101.0	101.0					2																	70165384		2203	4300	6503	SO:0001583	missense	4084	exon6			AAGCTGCAGGACA		CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.634C>G	chr2.hg19:g.70165384C>G	ENSP00000264444:p.Gln212Glu	328.0	0.0	.		335.0	22.0	.	NM_002357	B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Missense_Mutation	SNP	ENST00000264444.2	hg19	CCDS1896.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677983	0.68042	.	.	ENSG00000059728	ENST00000435990;ENST00000264444;ENST00000540449	T;T;T	0.45276	0.9;0.91;0.91	5.75	5.75	0.90469	.	0.527941	0.22156	N	0.063844	T	0.35537	0.0935	N	0.22421	0.69	0.47214	D	0.999358	B;B;B	0.23316	0.083;0.083;0.083	B;B;B	0.24006	0.05;0.05;0.05	T	0.13072	-1.0523	10	0.66056	D	0.02	.	18.875	0.92331	0.0:1.0:0.0:0.0	.	202;211;212	B7ZLI6;B7ZLI7;Q05195	.;.;MAD1_HUMAN	E	180;212;202	ENSP00000410672:Q180E;ENSP00000264444:Q212E;ENSP00000443935:Q202E	ENSP00000264444:Q212E	Q	+	1	0	MXD1	70018888	1.000000	0.71417	0.999000	0.59377	0.853000	0.48598	5.131000	0.64751	2.866000	0.98385	0.650000	0.86243	CAG	.	.	.	none		0.547	MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251845.3	NM_002357	
RGPD4	285190	hgsc.bcm.edu	37	2	108488583	108488583	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:108488583A>G	ENST00000408999.3	+	20	4200	c.4123A>G	c.(4123-4125)Aaa>Gaa	p.K1375E	RGPD4_ENST00000354986.4_Missense_Mutation_p.K1375E	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1375	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGGTCAATGGAAAGAAAGGGG	0.353																																					p.K1375E		Atlas-SNP	.											.	RGPD4	112	.	0			c.A4123G						PASS	.						3.0	3.0	3.0					2																	108488583		568	1292	1860	SO:0001583	missense	285190	exon20			CAATGGAAAGAAA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.4123A>G	chr2.hg19:g.108488583A>G	ENSP00000386810:p.Lys1375Glu	237.0	1.0	.		290.0	198.0	.	NM_182588	B9A029	Missense_Mutation	SNP	ENST00000408999.3	hg19	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	12.87	2.068566	0.36470	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.53423	0.62;0.62	2.33	2.33	0.28932	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.70745	0.3259	M	0.91406	3.205	0.37032	D	0.896721	D	0.76494	0.999	D	0.80764	0.994	T	0.77611	-0.2523	9	0.87932	D	0	-35.6834	9.2036	0.37275	1.0:0.0:0.0:0.0	.	1375	Q7Z3J3	RGPD4_HUMAN	E	1375	ENSP00000347081:K1375E;ENSP00000386810:K1375E	ENSP00000347081:K1375E	K	+	1	0	RGPD4	107855015	1.000000	0.71417	1.000000	0.80357	0.405000	0.30901	9.032000	0.93736	1.072000	0.40860	0.136000	0.15936	AAA	.	.	.	none		0.353	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
SP5	389058	hgsc.bcm.edu	37	2	171572792	171572792	+	Silent	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:171572792G>A	ENST00000375281.3	+	2	237	c.75G>A	c.(73-75)ccG>ccA	p.P25P	SP5_ENST00000487037.1_3'UTR|AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	25					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(2)|lung(1)|prostate(1)	5						GCGCCTCCCCGGACCTGGGCA	0.736																																					p.P25P		Atlas-SNP	.											.	SP5	14	.	0			c.G75A						PASS	.						16.0	22.0	20.0					2																	171572792		2004	3993	5997	SO:0001819	synonymous_variant	389058	exon2			CTCCCCGGACCTG		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.75G>A	chr2.hg19:g.171572792G>A		1.0	0.0	.		5.0	5.0	.	NM_001003845		Silent	SNP	ENST00000375281.3	hg19	CCDS33322.1																																																																																			.	.	.	none		0.736	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
FZD7	8324	hgsc.bcm.edu	37	2	202900342	202900342	+	Nonsense_Mutation	SNP	C	C	G	rs571062625		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:202900342C>G	ENST00000286201.1	+	1	1033	c.972C>G	c.(970-972)taC>taG	p.Y324*	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	324					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						ACGATGGCTACCGCACGGTGG	0.632											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y324X		Atlas-SNP	.											.	FZD7	70	.	0			c.C972G						PASS	.						65.0	64.0	65.0					2																	202900342		2203	4300	6503	SO:0001587	stop_gained	8324	exon1			TGGCTACCGCACG	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.972C>G	chr2.hg19:g.202900342C>G	ENSP00000286201:p.Tyr324*	179.0	0.0	.	2133	217.0	67.0	.	NM_003507	O94816|Q53S59|Q96B74	Nonsense_Mutation	SNP	ENST00000286201.1	hg19	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	C	36	5.730939	0.96856	.	.	ENSG00000155760	ENST00000286201	.	.	.	5.54	5.54	0.83059	.	0.140083	0.49916	D	0.000138	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4882	0.95039	0.0:1.0:0.0:0.0	.	.	.	.	X	324	.	ENSP00000286201:Y324X	Y	+	3	2	FZD7	202608587	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.927000	0.63440	2.618000	0.88619	0.563000	0.77884	TAC	.	.	.	none		0.632	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
FAM117B	150864	hgsc.bcm.edu	37	2	203500481	203500481	+	Silent	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:203500481A>C	ENST00000392238.2	+	1	571	c.571A>C	c.(571-573)Agg>Cgg	p.R191R	FAM117B_ENST00000303116.6_5'UTR			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	191										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						GCCGGAGAAGAGGAGCCCCAG	0.731																																					p.R191R		Atlas-SNP	.											.	FAM117B	73	.	0			c.A571C						PASS	.						2.0	2.0	2.0					2																	203500481		404	1189	1593	SO:0001819	synonymous_variant	150864	exon1			GAGAAGAGGAGCC	AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.571A>C	chr2.hg19:g.203500481A>C		0.0	0.0	.		5.0	5.0	.	NM_173511	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Silent	SNP	ENST00000392238.2	hg19	CCDS33362.2																																																																																			.	.	.	none		0.731	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511	
RPE	6120	hgsc.bcm.edu	37	2	210881324	210881324	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:210881324G>A	ENST00000359429.6	+	4	533	c.436G>A	c.(436-438)Ggg>Agg	p.G146R	RPE_ENST00000354506.6_Missense_Mutation_p.G138R|RPE_ENST00000429921.1_Missense_Mutation_p.G96R|RPE_ENST00000452025.1_Missense_Mutation_p.G146R|RPE_ENST00000411934.2_Missense_Mutation_p.G78R|RPE_ENST00000454822.1_Missense_Mutation_p.G96R|RPE_ENST00000445268.1_Missense_Mutation_p.G78R|RPE_ENST00000429907.1_Missense_Mutation_p.G78R|RPE_ENST00000540255.1_Missense_Mutation_p.G146R|RPE_ENST00000438204.2_Missense_Mutation_p.G78R|RPE_ENST00000436630.2_Missense_Mutation_p.G96R|RPE_ENST00000435437.2_Missense_Mutation_p.G146R	NM_199229.1	NP_954699.1	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase	146	Substrate binding.				carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|ribulose-phosphate 3-epimerase activity (GO:0004750)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	9				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		AGTGGAACCGGGGTTTGGAGG	0.438																																					p.G146R		Atlas-SNP	.											.	RPE	29	.	0			c.G436A						PASS	.						132.0	129.0	130.0					2																	210881324		2203	4300	6503	SO:0001583	missense	6120	exon4			GAACCGGGGTTTG		CCDS2388.1, CCDS42810.1, CCDS63107.1, CCDS63108.1	2q32-q33.3	2012-10-02			ENSG00000197713	ENSG00000197713	5.1.3.1		10293	protein-coding gene	gene with protein product		180480					Standard	NM_199229		Approved		uc002vdn.4	Q96AT9	OTTHUMG00000154690	ENST00000359429.6:c.436G>A	chr2.hg19:g.210881324G>A	ENSP00000352401:p.Gly146Arg	177.0	0.0	.		159.0	118.0	.	NM_199229	A8K4S0|B4E016|C9JPQ7|O43767|Q53TV9|Q8N215|Q96N34|Q9BSB5	Missense_Mutation	SNP	ENST00000359429.6	hg19	CCDS2388.1	.	.	.	.	.	.	.	.	.	.	G	34	5.304604	0.95601	.	.	ENSG00000197713	ENST00000359429;ENST00000436630;ENST00000408981;ENST00000454822;ENST00000429921;ENST00000540255;ENST00000438265;ENST00000429907;ENST00000441588;ENST00000445268;ENST00000452025;ENST00000438204;ENST00000411934;ENST00000435437;ENST00000354506	.	.	.	5.45	5.45	0.79879	Aldolase-type TIM barrel (1);Ribulose-phosphate binding barrel (1);	0.000000	0.85682	D	0.000000	D	0.85852	0.5793	M	0.90369	3.11	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88209	0.2889	9	0.87932	D	0	-3.1604	19.2659	0.93985	0.0:0.0:1.0:0.0	.	146;138;146;146	B4E016;E7EW52;Q96AT9;C9J9T0	.;.;RPE_HUMAN;.	R	146;96;78;96;96;146;96;78;78;78;146;78;78;146;138	.	ENSP00000346501:G138R	G	+	1	0	RPE	210589569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.777000	0.99008	2.725000	0.93324	0.655000	0.94253	GGG	.	.	.	none		0.438	RPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336574.2	NM_006916	
BHLHE40	8553	hgsc.bcm.edu	37	3	5024970	5024970	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:5024970A>C	ENST00000256495.3	+	5	1435	c.832A>C	c.(832-834)Att>Ctt	p.I278L		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	278					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						GATCGGCGCAATTAAGCAAGA	0.537																																					p.I278L		Atlas-SNP	.											.	BHLHE40	35	.	0			c.A832C						PASS	.						76.0	77.0	77.0					3																	5024970		2203	4300	6503	SO:0001583	missense	8553	exon5			GGCGCAATTAAGC	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.832A>C	chr3.hg19:g.5024970A>C	ENSP00000256495:p.Ile278Leu	82.0	0.0	.		96.0	38.0	.	NM_003670	Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	hg19	CCDS2565.1	.	.	.	.	.	.	.	.	.	.	A	17.95	3.513068	0.64522	.	.	ENSG00000134107	ENST00000256495	T	0.79845	-1.31	5.62	4.47	0.54385	.	0.309371	0.35970	N	0.002872	D	0.85944	0.5815	M	0.75615	2.305	0.80722	D	1	D	0.56035	0.974	P	0.57911	0.829	D	0.85230	0.1032	10	0.46703	T	0.11	.	11.0922	0.48123	0.9283:0.0:0.0717:0.0	.	278	O14503	BHE40_HUMAN	L	278	ENSP00000256495:I278L	ENSP00000256495:I278L	I	+	1	0	BHLHE40	4999970	1.000000	0.71417	0.912000	0.35992	0.165000	0.22458	7.345000	0.79337	0.983000	0.38602	0.533000	0.62120	ATT	.	.	.	none		0.537	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
XPC	7508	hgsc.bcm.edu	37	3	14188804	14188804	+	Missense_Mutation	SNP	G	G	C	rs373301509		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:14188804G>C	ENST00000285021.7	-	15	2804	c.2590C>G	c.(2590-2592)Cgc>Ggc	p.R864G	RP11-434D12.1_ENST00000601399.1_Intron|RP11-434D12.1_ENST00000608606.1_Intron|XPC_ENST00000449060.2_Missense_Mutation_p.R827G|AC093495.4_ENST00000428681.3_RNA|AC093495.4_ENST00000420253.1_RNA	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	864	Interaction with CETN2.|Interaction with ERCC2 and GTF2H1.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGCCCGTAGCGACGCTTCAGC	0.547			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.R864G		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	.	XPC	60	.	0			c.C2590G						PASS	.						53.0	57.0	56.0					3																	14188804		1998	4157	6155	SO:0001583	missense	7508	exon15	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CGTAGCGACGCTT		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.2590C>G	chr3.hg19:g.14188804G>C	ENSP00000285021:p.Arg864Gly	60.0	0.0	.		110.0	8.0	.	NM_004628	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	ENST00000285021.7	hg19	CCDS46763.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770436	0.69992	.	.	ENSG00000154767	ENST00000285021;ENST00000449060	T;T	0.36157	1.27;1.29	5.18	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.59959	0.2232	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.996;0.999	P;D	0.70716	0.903;0.97	T	0.64437	-0.6408	10	0.49607	T	0.09	-14.9319	15.159	0.72767	0.0:0.0:0.8577:0.1423	.	827;864	E9PH69;Q01831	.;XPC_HUMAN	G	864;827	ENSP00000285021:R864G;ENSP00000404002:R827G	ENSP00000285021:R864G	R	-	1	0	XPC	14163805	1.000000	0.71417	0.891000	0.34965	0.837000	0.47467	6.671000	0.74472	1.385000	0.46445	0.591000	0.81541	CGC	.	.	.	alt		0.547	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3	NM_004628	
DAG1	1605	hgsc.bcm.edu	37	3	49568609	49568609	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:49568609T>C	ENST00000539901.1	+	3	1223	c.665T>C	c.(664-666)cTt>cCt	p.L222P	DAG1_ENST00000545947.1_Missense_Mutation_p.L222P|DAG1_ENST00000308775.2_Missense_Mutation_p.L222P|DAG1_ENST00000515359.2_Missense_Mutation_p.L222P|DAG1_ENST00000538711.1_Missense_Mutation_p.L222P|DAG1_ENST00000541308.1_Missense_Mutation_p.L222P	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	222	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GAAGTAGAGCTTCACAACATG	0.493																																					p.L222P		Atlas-SNP	.											.	DAG1	60	.	0			c.T665C						PASS	.						76.0	81.0	80.0					3																	49568609		2203	4300	6503	SO:0001583	missense	1605	exon4			TAGAGCTTCACAA	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.665T>C	chr3.hg19:g.49568609T>C	ENSP00000439334:p.Leu222Pro	124.0	0.0	.		116.0	47.0	.	NM_001177642	A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	hg19	CCDS2799.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798715	0.31777	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711;ENST00000415315	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.92	3.55	0.40652	.	0.170769	0.52532	N	0.000062	T	0.76652	0.4017	M	0.65975	2.015	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.70368	-0.4891	10	0.51188	T	0.08	-12.03	9.6231	0.39734	0.0:0.1436:0.0:0.8564	.	222	Q14118	DAG1_HUMAN	P	222;222;222;222;222;222;21	ENSP00000440705:L222P;ENSP00000312435:L222P;ENSP00000442600:L222P;ENSP00000440590:L222P;ENSP00000439334:L222P;ENSP00000438421:L222P	ENSP00000312435:L222P	L	+	2	0	DAG1	49543613	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	4.211000	0.58507	0.496000	0.27904	0.533000	0.62120	CTT	.	.	.	none		0.493	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
MAPKAPK3	7867	hgsc.bcm.edu	37	3	50685441	50685441	+	Silent	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:50685441C>G	ENST00000446044.1	+	13	1709	c.1113C>G	c.(1111-1113)ggC>ggG	p.G371G	MAPKAPK3_ENST00000357955.2_Silent_p.G371G	NM_001243926.1	NP_001230855.1	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated protein kinase 3	371					activation of MAPK activity (GO:0000187)|innate immune response (GO:0045087)|macropinocytosis (GO:0044351)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|Ras protein signal transduction (GO:0007265)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		AGCAGGCAGGCAGCTCCTCTG	0.562																																					p.G371G		Atlas-SNP	.											.	MAPKAPK3	32	.	0			c.C1113G						PASS	.						69.0	69.0	69.0					3																	50685441		2203	4300	6503	SO:0001819	synonymous_variant	7867	exon11			GGCAGGCAGCTCC	U43784	CCDS2832.1	3p21.3	2004-03-10			ENSG00000114738	ENSG00000114738			6888	protein-coding gene	gene with protein product		602130				8626550, 8622688	Standard	NM_004635		Approved	3pK, MAPKAP3, 3PK	uc003dba.2	Q16644	OTTHUMG00000156850	ENST00000446044.1:c.1113C>G	chr3.hg19:g.50685441C>G		246.0	1.0	.		260.0	110.0	.	NM_004635	B5BU67	Silent	SNP	ENST00000446044.1	hg19	CCDS2832.1	.	.	.	.	.	.	.	.	.	.	C	9.156	1.017372	0.19355	.	.	ENSG00000114738	ENST00000451680	.	.	.	5.73	2.59	0.31030	.	.	.	.	.	T	0.53626	0.1808	.	.	.	0.45733	D	0.998639	.	.	.	.	.	.	T	0.49194	-0.8965	4	.	.	.	-29.6661	6.4693	0.21999	0.2822:0.5832:0.0:0.1346	.	.	.	.	E	86	.	.	Q	+	1	0	MAPKAPK3	50660445	0.089000	0.21612	0.973000	0.42090	0.978000	0.69477	0.290000	0.18975	1.409000	0.46915	0.655000	0.94253	CAG	.	.	.	none		0.562	MAPKAPK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346237.1	NM_004635	
MAGI1	9223	hgsc.bcm.edu	37	3	65425597	65425597	+	Silent	SNP	C	C	T	rs571281009	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:65425597C>T	ENST00000497477.2	-	9	1226	c.1227G>A	c.(1225-1227)caG>caA	p.Q409Q	MAGI1_ENST00000402939.2_Silent_p.Q409Q|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000330909.8_Silent_p.Q409Q|MAGI1_ENST00000483466.1_Silent_p.Q409Q			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	409	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgttgctgctgctgttgct	0.532											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	49	0.00978435	0.0325	0.0043	5008	,	,		14951	0.003		0.0	False		,,,				2504	0.0				p.Q409Q		Atlas-SNP	.											.	MAGI1	481	.	0			c.G1227A						PASS	.						68.0	64.0	65.0					3																	65425597		2202	4296	6498	SO:0001819	synonymous_variant	9223	exon9			TTGCTGCTGCTGT	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1227G>A	chr3.hg19:g.65425597C>T		38.0	0.0	.	1084	41.0	7.0	.	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	hg19		.	.	.	.	.	.	.	.	.	.	C	1.115	-0.657141	0.03480	.	.	ENSG00000151276	ENST00000460329	.	.	.	3.23	1.37	0.22104	.	.	.	.	.	T	0.23014	0.0556	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.22277	-1.0221	4	.	.	.	0.0018	2.6711	0.05067	0.2253:0.507:0.0:0.2677	.	.	.	.	N	290	.	.	S	-	2	0	MAGI1	65400637	0.651000	0.27340	0.048000	0.18961	0.002000	0.02628	-0.987000	0.03743	0.095000	0.17434	-0.850000	0.03035	AGC	.	.	.	none		0.532	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
ABHD10	55347	hgsc.bcm.edu	37	3	111710242	111710242	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:111710242A>C	ENST00000273359.3	+	5	622	c.595A>C	c.(595-597)Atg>Ctg	p.M199L	ABHD10_ENST00000494817.1_3'UTR|ABHD10_ENST00000534857.1_Missense_Mutation_p.M42L	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	199					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						GGAAGTAGAGATGAAAGGTGT	0.323																																					p.M199L		Atlas-SNP	.											.	ABHD10	20	.	0			c.A595C						PASS	.						79.0	75.0	76.0					3																	111710242		2203	4300	6503	SO:0001583	missense	55347	exon5			GTAGAGATGAAAG	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.595A>C	chr3.hg19:g.111710242A>C	ENSP00000273359:p.Met199Leu	154.0	0.0	.		151.0	34.0	.	NM_018394	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	ENST00000273359.3	hg19	CCDS2963.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.064132	0.36373	.	.	ENSG00000144827	ENST00000534857;ENST00000273359	T;T	0.66099	1.02;-0.19	5.47	-3.29	0.05017	.	0.598228	0.18438	N	0.141217	T	0.33585	0.0868	N	0.19112	0.55	0.23445	N	0.997665	B	0.02656	0.0	B	0.06405	0.002	T	0.06661	-1.0814	10	0.30078	T	0.28	-12.4265	1.0289	0.01533	0.3041:0.125:0.3257:0.2452	.	199	Q9NUJ1	ABHDA_HUMAN	L	42;199	ENSP00000442932:M42L;ENSP00000273359:M199L	ENSP00000273359:M199L	M	+	1	0	ABHD10	113192932	1.000000	0.71417	0.986000	0.45419	0.987000	0.75469	1.234000	0.32660	-0.436000	0.07254	0.443000	0.29094	ATG	.	.	.	none		0.323	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394	
ARRDC3	57561	hgsc.bcm.edu	37	5	90669948	90669948	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:90669948A>C	ENST00000265138.3	-	6	1282	c.1016T>G	c.(1015-1017)cTt>cGt	p.L339R	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	339					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		TCTTTCAGGAAGTGATAAACT	0.373																																					p.L339R		Atlas-SNP	.											.	ARRDC3	56	.	0			c.T1016G						PASS	.						187.0	185.0	186.0					5																	90669948		2203	4300	6503	SO:0001583	missense	57561	exon6			TCAGGAAGTGATA	AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.1016T>G	chr5.hg19:g.90669948A>C	ENSP00000265138:p.Leu339Arg	105.0	0.0	.		113.0	33.0	.	NM_020801	A8K6T8|Q9P2H1	Missense_Mutation	SNP	ENST00000265138.3	hg19	CCDS34202.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.263139	0.80358	.	.	ENSG00000113369	ENST00000265138	T	0.08984	3.03	5.77	5.77	0.91146	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	M	0.62723	1.935	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.00473	-1.1718	10	0.34782	T	0.22	-10.2226	16.086	0.81049	1.0:0.0:0.0:0.0	.	339	Q96B67	ARRD3_HUMAN	R	339	ENSP00000265138:L339R	ENSP00000265138:L339R	L	-	2	0	ARRDC3	90705704	1.000000	0.71417	0.981000	0.43875	0.932000	0.56968	9.339000	0.96797	2.207000	0.71202	0.528000	0.53228	CTT	.	.	.	none		0.373	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369763.2	NM_020801	
PAM	5066	hgsc.bcm.edu	37	5	102285295	102285295	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:102285295C>T	ENST00000438793.3	+	9	1168	c.698C>T	c.(697-699)gCc>gTc	p.A233V	PAM_ENST00000346918.2_Missense_Mutation_p.A233V|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000455264.2_Missense_Mutation_p.A233V|PAM_ENST00000304400.7_Missense_Mutation_p.A233V|PAM_ENST00000274392.9_Missense_Mutation_p.A136V|PAM_ENST00000348126.2_Missense_Mutation_p.A233V	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	233	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	CATGTCTTTGCCTATAGAGTT	0.323																																					p.A233V		Atlas-SNP	.											.	PAM	180	.	0			c.C698T						PASS	.						106.0	108.0	107.0					5																	102285295		2203	4297	6500	SO:0001583	missense	5066	exon9			TCTTTGCCTATAG	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.698C>T	chr5.hg19:g.102285295C>T	ENSP00000396493:p.Ala233Val	264.0	0.0	.		259.0	24.0	.	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	hg19	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	C	32	5.156388	0.94686	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000274392;ENST00000455264	T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	6.02	6.02	0.97574	Copper type II, ascorbate-dependent monooxygenase, histidine-cluster-2 conserved site (1);PHM/PNGase F domain (1);Copper type II, ascorbate-dependent monooxygenase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91036	0.7180	M	0.90650	3.135	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.91659	0.5341	10	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	136;233;233;233;233;233	F8WE90;P19021;P19021-4;P19021-3;P19021-5;P19021-2	.;AMD_HUMAN;.;.;.;.	V	233;233;233;233;136;233	ENSP00000396493:A233V;ENSP00000282992:A233V;ENSP00000314638:A233V;ENSP00000306100:A233V;ENSP00000274392:A136V;ENSP00000403461:A233V	ENSP00000274392:A136V	A	+	2	0	PAM	102313194	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.290000	0.72712	2.857000	0.98124	0.650000	0.86243	GCC	.	.	.	none		0.323	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
PCDHGB6	56100	hgsc.bcm.edu	37	5	140788348	140788348	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:140788348G>T	ENST00000520790.1	+	1	579	c.579G>T	c.(577-579)gaG>gaT	p.E193D	PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	193	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATACCCAGAGTTATCTCTGG	0.403																																					p.E193D		Atlas-SNP	.											.	PCDHGB6	120	.	0			c.G579T						PASS	.						26.0	26.0	26.0					5																	140788348		1835	4088	5923	SO:0001583	missense	56100	exon1			CCCAGAGTTATCT	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.579G>T	chr5.hg19:g.140788348G>T	ENSP00000428603:p.Glu193Asp	38.0	0.0	.		53.0	22.0	.	NM_032100	Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	hg19	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	g	13.81	2.348524	0.41599	.	.	ENSG00000253305	ENST00000520790	T	0.21734	1.99	5.34	1.01	0.19927	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.40909	0.1136	M	0.77616	2.38	0.09310	N	0.999999	D;D	0.71674	0.994;0.998	D;D	0.70016	0.948;0.967	T	0.12760	-1.0535	9	0.66056	D	0.02	.	6.0351	0.19702	0.382:0.0:0.4936:0.1244	.	193;193	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	D	193	ENSP00000428603:E193D	ENSP00000428603:E193D	E	+	3	2	PCDHGB6	140768532	0.000000	0.05858	0.987000	0.45799	0.966000	0.64601	-1.583000	0.02115	0.257000	0.21650	-0.373000	0.07131	GAG	.	.	.	none		0.403	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926	
SPINK1	6690	hgsc.bcm.edu	37	5	147207646	147207646	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:147207646G>A	ENST00000296695.5	-	3	341	c.133C>T	c.(133-135)Cct>Tct	p.P45S	SPINK1_ENST00000510027.2_Missense_Mutation_p.P45S	NM_003122.3	NP_003113.2	P00995	ISK1_HUMAN	serine peptidase inhibitor, Kazal type 1	45	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of calcium ion import (GO:0090281)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of serine-type endopeptidase activity (GO:1900004)|regulation of acrosome reaction (GO:0060046)|regulation of store-operated calcium entry (GO:2001256)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACAGACAGGGTCATATATC	0.328									Hereditary Pancreatitis																												p.P45S		Atlas-SNP	.											.	SPINK1	9	.	0			c.C133T						PASS	.						126.0	119.0	121.0					5																	147207646		2203	4300	6503	SO:0001583	missense	6690	exon3	Familial Cancer Database		AGACAGGGTCATA		CCDS4286.1	5q32	2011-08-31	2005-08-17		ENSG00000164266	ENSG00000164266		"""Serine peptidase inhibitors, Kazal type"""	11244	protein-coding gene	gene with protein product		167790	"""serine protease inhibitor, Kazal type 1"""				Standard	XM_005268501		Approved	Spink3, PCTT, PSTI, TATI	uc003los.2	P00995	OTTHUMG00000129730	ENST00000296695.5:c.133C>T	chr5.hg19:g.147207646G>A	ENSP00000296695:p.Pro45Ser	106.0	0.0	.		114.0	24.0	.	NM_003122		Missense_Mutation	SNP	ENST00000296695.5	hg19	CCDS4286.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042553	0.55003	.	.	ENSG00000164266	ENST00000296695;ENST00000510027	D;D	0.85339	-1.97;-1.97	4.9	4.9	0.64082	Proteinase inhibitor I1, Kazal (3);	0.000000	0.64402	D	0.000001	D	0.91991	0.7463	.	.	.	0.43708	D	0.996175	D	0.89917	1.0	D	0.97110	1.0	D	0.92165	0.5739	9	0.56958	D	0.05	-21.6312	15.9791	0.80094	0.0:0.0:1.0:0.0	.	45	P00995	ISK1_HUMAN	S	45	ENSP00000296695:P45S;ENSP00000427376:P45S	ENSP00000296695:P45S	P	-	1	0	SPINK1	147187839	1.000000	0.71417	0.938000	0.37757	0.224000	0.24922	4.936000	0.63506	2.725000	0.93324	0.655000	0.94253	CCT	.	.	.	none		0.328	SPINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251940.2	NM_003122	
FNDC9	408263	hgsc.bcm.edu	37	5	156770121	156770121	+	Nonsense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr5:156770121C>A	ENST00000312349.4	-	2	611	c.424G>T	c.(424-426)Gag>Tag	p.E142*	CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000347377.6_Intron|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000318218.6_Intron|CYFIP2_ENST00000541131.1_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	142						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						CATCGCGGCTCATGGCAACGG	0.607											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E142X		Atlas-SNP	.											.	FNDC9	22	.	0			c.G424T						PASS	.						64.0	62.0	63.0					5																	156770121		2203	4300	6503	SO:0001587	stop_gained	408263	exon2			GCGGCTCATGGCA	BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.424G>T	chr5.hg19:g.156770121C>A	ENSP00000310594:p.Glu142*	116.0	0.0	.	1781	136.0	43.0	.	NM_001001343	A8K0Y6	Nonsense_Mutation	SNP	ENST00000312349.4	hg19	CCDS4337.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805183	0.70682	.	.	ENSG00000172568	ENST00000312349;ENST00000520782	.	.	.	5.08	4.15	0.48705	.	0.241065	0.28784	N	0.014157	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-4.2189	9.3255	0.37990	0.16:0.6848:0.1551:0.0	.	.	.	.	X	142	.	ENSP00000310594:E142X	E	-	1	0	FNDC9	156702699	0.304000	0.24472	0.997000	0.53966	0.674000	0.39518	0.688000	0.25422	2.369000	0.80426	0.491000	0.48974	GAG	.	.	.	none		0.607	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252573.2	NM_001001343	
FAM65B	9750	hgsc.bcm.edu	37	6	24843494	24843494	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:24843494C>G	ENST00000259698.4	-	14	1691	c.1516G>C	c.(1516-1518)Gag>Cag	p.E506Q	FAM65B_ENST00000378023.4_Missense_Mutation_p.E456Q|FAM65B_ENST00000510784.2_Missense_Mutation_p.E490Q|FAM65B_ENST00000540914.1_Missense_Mutation_p.E456Q|FAM65B_ENST00000538035.1_Missense_Mutation_p.E485Q|FAM65B_ENST00000473070.1_5'Flank	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	506					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						CTGGGCTCCTCTGGGTCTTCC	0.577																																					p.E506Q		Atlas-SNP	.											.	FAM65B	134	.	0			c.G1516C						PASS	.						86.0	82.0	83.0					6																	24843494		1916	4115	6031	SO:0001583	missense	9750	exon14			GCTCCTCTGGGTC	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1516G>C	chr6.hg19:g.24843494C>G	ENSP00000259698:p.Glu506Gln	83.0	0.0	.		99.0	33.0	.	NM_014722	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	hg19	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	C	9.393	1.076084	0.20227	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	4.3	2.46	0.29980	.	1.536000	0.03262	N	0.183420	T	0.06917	0.0176	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.16396	0.017;0.004;0.009;0.004	B;B;B;B	0.11329	0.006;0.003;0.004;0.004	T	0.23404	-1.0189	10	0.13853	T	0.58	-0.5328	7.1945	0.25845	0.0:0.6914:0.1422:0.1664	.	490;485;456;506	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	Q	506;485;456;456;490	ENSP00000259698:E506Q;ENSP00000441138:E485Q;ENSP00000367262:E456Q;ENSP00000438425:E456Q;ENSP00000441305:E490Q	ENSP00000259698:E506Q	E	-	1	0	FAM65B	24951473	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.333000	0.19768	0.417000	0.25871	0.655000	0.94253	GAG	.	.	.	none		0.577	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
HLA-E	3133	hgsc.bcm.edu	37	6	30459405	30459405	+	Silent	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:30459405T>C	ENST00000376630.4	+	5	1043	c.978T>C	c.(976-978)gcT>gcC	p.A326A		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	326					antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						TGGTTGCTGCTGTGATATGGA	0.557																																					p.A326A		Atlas-SNP	.											.	HLA-E	35	.	0			c.T978C						PASS	.						153.0	162.0	159.0					6																	30459405		1509	2709	4218	SO:0001819	synonymous_variant	3133	exon5			TGCTGCTGTGATA	M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.978T>C	chr6.hg19:g.30459405T>C		100.0	0.0	.		100.0	27.0	.	NM_005516	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Silent	SNP	ENST00000376630.4	hg19	CCDS34379.1																																																																																			.	.	.	none		0.557	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516	
PRICKLE4	29964	hgsc.bcm.edu	37	6	41751890	41751890	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:41751890G>A	ENST00000394260.1	+	1	34	c.34G>A	c.(34-36)Ggt>Agt	p.G12S	PRICKLE4_ENST00000458694.1_Missense_Mutation_p.G52S|PRICKLE4_ENST00000394259.1_Missense_Mutation_p.G12S|PRICKLE4_ENST00000394263.1_Missense_Mutation_p.G52S|PRICKLE4_ENST00000359201.5_Missense_Mutation_p.G52S			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)	12	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.					nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCTGAGCTTGGGTTCCCTTTG	0.542																																					p.G52S		Atlas-SNP	.											.	PRICKLE4	29	.	0			c.G154A						PASS	.						140.0	115.0	123.0					6																	41751890		2203	4300	6503	SO:0001583	missense	29964	exon4			AGCTTGGGTTCCC	AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.34G>A	chr6.hg19:g.41751890G>A	ENSP00000377803:p.Gly12Ser	154.0	0.0	.		169.0	58.0	.	NM_013397	A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	Missense_Mutation	SNP	ENST00000394260.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.41	2.826744	0.50739	.	.	ENSG00000124593	ENST00000458694;ENST00000359201;ENST00000394263;ENST00000394259;ENST00000394260	T;T;T;T;T	0.68624	-0.14;-0.33;-0.14;-0.34;-0.12	4.61	2.79	0.32731	.	0.160117	0.29892	N	0.010940	T	0.41442	0.1159	L	0.57536	1.79	0.09310	N	1	P	0.47910	0.902	P	0.46543	0.52	T	0.28650	-1.0037	10	0.15952	T	0.53	-8.6317	5.2819	0.15680	0.1041:0.0:0.6944:0.2015	.	52	Q2TBC4-3	.	S	52;52;52;12;12	ENSP00000404911:G52S;ENSP00000352128:G52S;ENSP00000377806:G52S;ENSP00000377802:G12S;ENSP00000377803:G12S	ENSP00000335185:G52S	G	+	1	0	PRICKLE4	41859868	0.041000	0.20044	0.003000	0.11579	0.193000	0.23685	1.999000	0.40806	0.540000	0.28808	0.491000	0.48974	GGT	.	.	.	none		0.542	PRICKLE4-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000303948.1	NM_013397	
CASP8AP2	9994	hgsc.bcm.edu	37	6	90578032	90578032	+	RNA	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:90578032G>C	ENST00000551025.1	+	0	6460									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CTCACACTCTGTTGGGGAACA	0.378																																					p.V1675L	Colon(187;1656 2025 17045 31481 39901)	Atlas-SNP	.											.	CASP8AP2	108	.	0			c.G5023C						PASS	.						49.0	50.0	49.0					6																	90578032		1888	4122	6010			9994	exon8			CACTCTGTTGGGG	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		chr6.hg19:g.90578032G>C		75.0	0.0	.		62.0	29.0	.	NM_001137667		Missense_Mutation	SNP	ENST00000551025.1	hg19																																																																																				.	.	.	none		0.378	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
NFE2L3	9603	hgsc.bcm.edu	37	7	26224503	26224503	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr7:26224503G>T	ENST00000056233.3	+	4	1444	c.1185G>T	c.(1183-1185)atG>atT	p.M395I		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	395					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TAAACTTAATGTCATTGGCCA	0.363																																					p.M395I		Atlas-SNP	.											NFE2L3,colon,carcinoma,0,1	NFE2L3	77	.	0			c.G1185T						PASS	.						89.0	93.0	92.0					7																	26224503		2203	4300	6503	SO:0001583	missense	9603	exon4			CTTAATGTCATTG	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1185G>T	chr7.hg19:g.26224503G>T	ENSP00000056233:p.Met395Ile	93.0	0.0	.		80.0	29.0	.	NM_004289	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	ENST00000056233.3	hg19	CCDS5396.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714423	0.30413	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.32988	1.43	5.12	1.16	0.20824	.	0.373144	0.32328	N	0.006247	T	0.33030	0.0849	M	0.78049	2.395	0.28293	N	0.923461	B	0.14805	0.011	B	0.13407	0.009	T	0.34950	-0.9808	10	0.54805	T	0.06	-0.9264	10.7382	0.46137	0.3412:0.0:0.6588:0.0	.	395	Q9Y4A8	NF2L3_HUMAN	I	395;101	ENSP00000056233:M395I	ENSP00000056233:M395I	M	+	3	0	NFE2L3	26191028	0.998000	0.40836	0.717000	0.30585	0.799000	0.45148	2.503000	0.45407	0.259000	0.21709	-0.229000	0.12294	ATG	.	.	.	none		0.363	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
POU6F2	11281	hgsc.bcm.edu	37	7	39500162	39500162	+	Silent	SNP	G	G	T	rs548578851		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr7:39500162G>T	ENST00000403058.1	+	10	1573	c.1419G>T	c.(1417-1419)gcG>gcT	p.A473A	POU6F2_ENST00000518318.2_Silent_p.A473A|POU6F2_ENST00000559001.1_Silent_p.A418A	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	473					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						AAACGGCAGCGGGTGAGGTGG	0.473																																					p.A473A		Atlas-SNP	.											.	POU6F2	117	.	0			c.G1419T						PASS	.						55.0	49.0	51.0					7																	39500162		2203	4300	6503	SO:0001819	synonymous_variant	11281	exon10			GGCAGCGGGTGAG	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1419G>T	chr7.hg19:g.39500162G>T		122.0	0.0	.		100.0	4.0	.	NM_007252	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	ENST00000403058.1	hg19	CCDS34620.2																																																																																			.	.	.	none		0.473	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
COL14A1	7373	hgsc.bcm.edu	37	8	121357692	121357692	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr8:121357692C>T	ENST00000297848.3	+	45	5237	c.4967C>T	c.(4966-4968)cCt>cTt	p.P1656L	COL14A1_ENST00000309791.4_Missense_Mutation_p.P1656L|COL14A1_ENST00000247781.3_Missense_Mutation_p.P1561L	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CAAGGGCCTCCTGGGGAGCCT	0.622																																					p.P1656L		Atlas-SNP	.											.	COL14A1	292	.	0			c.C4967T						PASS	.						59.0	58.0	58.0					8																	121357692		2203	4300	6503	SO:0001583	missense	7373	exon45			GGCCTCCTGGGGA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4967C>T	chr8.hg19:g.121357692C>T	ENSP00000297848:p.Pro1656Leu	103.0	0.0	.		97.0	40.0	.	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	hg19	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621078	0.87460	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000440844	D;D;D;D	0.98684	-3.87;-3.87;-3.87;-5.07	5.54	4.67	0.58626	.	0.048120	0.85682	D	0.000000	D	0.99032	0.9669	M	0.86502	2.82	0.80722	D	1	D	0.56746	0.977	D	0.69307	0.963	D	0.99226	1.0880	10	0.49607	T	0.09	.	12.3879	0.55343	0.0:0.9213:0.0:0.0787	.	1656	Q05707	COEA1_HUMAN	L	1656;1656;1561;3	ENSP00000311809:P1656L;ENSP00000297848:P1656L;ENSP00000247781:P1561L;ENSP00000403640:P3L	ENSP00000247781:P1561L	P	+	2	0	COL14A1	121426873	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.600000	0.74132	1.364000	0.46038	0.555000	0.69702	CCT	.	.	.	none		0.622	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
AGO2	27161	hgsc.bcm.edu	37	8	141557696	141557696	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr8:141557696A>G	ENST00000220592.5	-	13	1731	c.1619T>C	c.(1618-1620)cTg>cCg	p.L540P	AGO2_ENST00000519980.1_Missense_Mutation_p.L540P	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	540	Interaction with guide RNA.|Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GGCCATCCCCAGCACCGTGTC	0.637																																					p.L540P		Atlas-SNP	.											.	.	.	.	0			c.T1619C						PASS	.						182.0	140.0	154.0					8																	141557696		2203	4300	6503	SO:0001583	missense	27161	exon13			ATCCCCAGCACCG	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1619T>C	chr8.hg19:g.141557696A>G	ENSP00000220592:p.Leu540Pro	111.0	0.0	.		110.0	38.0	.	NM_012154	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	hg19	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.212273	0.79240	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.35236	1.32;1.32	5.49	5.49	0.81192	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.69958	0.3169	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.79259	-0.1877	10	0.87932	D	0	-13.6154	15.5836	0.76465	1.0:0.0:0.0:0.0	.	540;540	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	P	540	ENSP00000220592:L540P;ENSP00000430176:L540P	ENSP00000220592:L540P	L	-	2	0	EIF2C2	141626878	1.000000	0.71417	0.973000	0.42090	0.690000	0.40134	9.193000	0.94954	2.076000	0.62316	0.533000	0.62120	CTG	.	.	.	none		0.637	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4		
TRPM6	140803	hgsc.bcm.edu	37	9	77435298	77435298	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:77435298C>G	ENST00000360774.1	-	9	1293	c.1056G>C	c.(1054-1056)caG>caC	p.Q352H	TRPM6_ENST00000361255.3_Missense_Mutation_p.Q347H|TRPM6_ENST00000449912.2_Missense_Mutation_p.Q347H|TRPM6_ENST00000451710.3_Missense_Mutation_p.Q352H|TRPM6_ENST00000376871.3_Missense_Mutation_p.Q352H|TRPM6_ENST00000376864.4_Missense_Mutation_p.Q352H|TRPM6_ENST00000376872.3_Missense_Mutation_p.Q352H|TRPM6_ENST00000483186.1_5'UTR	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	352					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TGAAAGTGTTCTGAATCATGC	0.438																																					p.Q352H		Atlas-SNP	.											.	TRPM6	377	.	0			c.G1056C						PASS	.						148.0	135.0	140.0					9																	77435298		2203	4300	6503	SO:0001583	missense	140803	exon9			AGTGTTCTGAATC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1056G>C	chr9.hg19:g.77435298C>G	ENSP00000354006:p.Gln352His	83.0	0.0	.		87.0	8.0	.	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	hg19	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544685	0.65198	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.37	4.36	0.52297	.	0.122952	0.64402	D	0.000020	T	0.79476	0.4452	M	0.78456	2.415	0.43617	D	0.995992	D;D;P;P	0.71674	0.998;0.998;0.951;0.896	D;D;P;P	0.67382	0.951;0.951;0.765;0.694	T	0.81861	-0.0738	10	0.87932	D	0	.	11.9834	0.53133	0.0:0.8466:0.0:0.1534	.	352;352;352;347	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3	.;.;TRPM6_HUMAN;.	H	352;352;352;352;347;347;352;15;15	ENSP00000354006:Q352H;ENSP00000407341:Q352H;ENSP00000366068:Q352H;ENSP00000366067:Q352H;ENSP00000396672:Q347H;ENSP00000354962:Q347H;ENSP00000366060:Q352H	ENSP00000309693:Q15H	Q	-	3	2	TRPM6	76625118	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.737000	0.26144	2.500000	0.84329	0.655000	0.94253	CAG	.	.	.	none		0.438	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
TEX10	54881	hgsc.bcm.edu	37	9	103109141	103109141	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:103109141C>G	ENST00000374902.4	-	3	904	c.728G>C	c.(727-729)aGt>aCt	p.S243T	TEX10_ENST00000537512.1_Missense_Mutation_p.S178T|TEX10_ENST00000535814.1_Missense_Mutation_p.S246T	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	243						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TCTCAACCTACTGGATCCATC	0.448																																					p.S246T		Atlas-SNP	.											.	TEX10	99	.	0			c.G737C						PASS	.						122.0	118.0	119.0					9																	103109141		2203	4300	6503	SO:0001583	missense	54881	exon3			AACCTACTGGATC	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.728G>C	chr9.hg19:g.103109141C>G	ENSP00000364037:p.Ser243Thr	83.0	0.0	.		84.0	28.0	.	NM_001161584	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	hg19	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	C	9.748	1.166577	0.21621	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730;ENST00000537512	.	.	.	5.26	4.31	0.51392	Armadillo-type fold (1);	0.430875	0.29932	N	0.010833	T	0.29288	0.0729	N	0.12182	0.205	0.38372	D	0.944907	B;B;B;B;B	0.29766	0.002;0.007;0.11;0.256;0.002	B;B;B;B;B	0.21360	0.003;0.004;0.011;0.034;0.003	T	0.20638	-1.0269	9	0.29301	T	0.29	-9.3945	9.3406	0.38079	0.0:0.7187:0.1367:0.1446	.	178;246;111;111;243	B7Z9D5;B4DYV2;E7ERG2;B4DQR0;Q9NXF1	.;.;.;.;TEX10_HUMAN	T	246;243;111;178	.	ENSP00000364037:S243T	S	-	2	0	TEX10	102148962	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.669000	0.37492	2.450000	0.82876	0.655000	0.94253	AGT	.	.	.	none		0.448	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	
EGFL7	51162	hgsc.bcm.edu	37	9	139564703	139564703	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:139564703G>C	ENST00000371699.1	+	7	1403	c.492G>C	c.(490-492)tgG>tgC	p.W164C	EGFL7_ENST00000406555.3_Missense_Mutation_p.W164C|MIR126_ENST00000362291.1_RNA|EGFL7_ENST00000492002.1_3'UTR|EGFL7_ENST00000371698.3_Missense_Mutation_p.W164C|EGFL7_ENST00000308874.7_Missense_Mutation_p.W164C			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	164	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)			kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GCCAGTGTTGGGAGGGGCACA	0.652																																					p.W164C		Atlas-SNP	.											.	EGFL7	11	.	0			c.G492C						PASS	.						28.0	30.0	29.0					9																	139564703		2198	4297	6495	SO:0001583	missense	51162	exon8			GTGTTGGGAGGGG	AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.492G>C	chr9.hg19:g.139564703G>C	ENSP00000360764:p.Trp164Cys	129.0	0.0	.		157.0	47.0	.	NM_016215	B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Missense_Mutation	SNP	ENST00000371699.1	hg19	CCDS7002.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802260	0.50315	.	.	ENSG00000172889	ENST00000371699;ENST00000308874;ENST00000406555;ENST00000371698	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	5.26	2.31	0.28768	EGF-like calcium-binding (2);	1.149640	0.06146	N	0.673294	T	0.37785	0.1016	L	0.32530	0.975	0.45822	D	0.998694	D	0.56968	0.978	P	0.50754	0.649	T	0.04454	-1.0950	10	0.46703	T	0.11	-0.7885	7.8608	0.29509	0.1492:0.1325:0.7182:0.0	.	164	Q9UHF1	EGFL7_HUMAN	C	164	ENSP00000360764:W164C;ENSP00000307843:W164C;ENSP00000385639:W164C;ENSP00000360763:W164C	ENSP00000307843:W164C	W	+	3	0	EGFL7	138684524	0.247000	0.23920	0.257000	0.24404	0.612000	0.37316	0.439000	0.21575	0.188000	0.20168	0.561000	0.74099	TGG	.	.	.	none		0.652	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055094.1	NM_016215	
TRAF2	7186	hgsc.bcm.edu	37	9	139794876	139794876	+	Silent	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr9:139794876C>G	ENST00000247668.2	+	4	322	c.270C>G	c.(268-270)gcC>gcG	p.A90A	TRAF2_ENST00000359662.3_Silent_p.A90A|TRAF2_ENST00000536468.1_Silent_p.A90A	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	90					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		CTCCCCAGGCCTTCCCAGATA	0.577																																					p.A90A		Atlas-SNP	.											.	TRAF2	46	.	0			c.C270G						PASS	.						43.0	38.0	39.0					9																	139794876		2203	4300	6503	SO:0001819	synonymous_variant	7186	exon4			CCAGGCCTTCCCA	U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.270C>G	chr9.hg19:g.139794876C>G		51.0	0.0	.		50.0	14.0	.	NM_021138	A8K107|B4DPJ7|Q7Z337|Q96NT2	Silent	SNP	ENST00000247668.2	hg19	CCDS7013.1																																																																																			.	.	.	none		0.577	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055166.1	NM_021138	
VIM	7431	hgsc.bcm.edu	37	10	17278345	17278345	+	Silent	SNP	T	T	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:17278345T>G	ENST00000224237.5	+	8	1471	c.1326T>G	c.(1324-1326)ctT>ctG	p.L442L	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Silent_p.L442L			P08670	VIME_HUMAN	vimentin	442	Tail.			L -> F (in Ref. 1; AAA61279). {ECO:0000305}.	apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AAAGGACACTTCTGATTAAGA	0.348																																					p.L442L		Atlas-SNP	.											.	VIM	71	.	0			c.T1326G						PASS	.						150.0	165.0	160.0					10																	17278345		2203	4300	6503	SO:0001819	synonymous_variant	7431	exon9			GACACTTCTGATT	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1326T>G	chr10.hg19:g.17278345T>G		75.0	0.0	.		91.0	39.0	.	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Silent	SNP	ENST00000224237.5	hg19	CCDS7120.1																																																																																			.	.	.	none		0.348	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24873742	24873742	+	Missense_Mutation	SNP	C	C	T	rs370251256		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:24873742C>T	ENST00000396432.2	-	26	5962	c.5476G>A	c.(5476-5478)Ggg>Agg	p.G1826R		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1825	Interaction with CTNNA1.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TCTCTCTCCCCGCTCTGCTCA	0.498																																					p.G1826R		Atlas-SNP	.											ARHGAP21,right_upper_lobe,carcinoma,0,1	ARHGAP21	185	.	0			c.G5476A						PASS	.	C	ARG/GLY	0,4406		0,0,2203	62.0	63.0	63.0		5476	3.3	0.0	10		63	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARHGAP21	NM_020824.3	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1826/1959	24873742	1,13005	2203	4300	6503	SO:0001583	missense	57584	exon26			TCTCCCCGCTCTG	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.5476G>A	chr10.hg19:g.24873742C>T	ENSP00000379709:p.Gly1826Arg	93.0	0.0	.		101.0	53.0	.	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	hg19	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	C	1.589	-0.529652	0.04112	0.0	1.16E-4	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.11712	2.75	5.13	3.27	0.37495	.	1.152260	0.06177	N	0.678642	T	0.06416	0.0165	N	0.16307	0.4	0.18873	N	0.999984	B	0.09022	0.002	B	0.04013	0.001	T	0.42207	-0.9465	10	0.18710	T	0.47	.	2.6596	0.05023	0.2147:0.4829:0.0:0.3023	.	1825	Q5T5U3	RHG21_HUMAN	R	1826;1275	ENSP00000379709:G1826R	ENSP00000379709:G1826R	G	-	1	0	ARHGAP21	24913748	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.682000	0.25335	1.139000	0.42245	0.655000	0.94253	GGG	.	.	.	none		0.498	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
RBP3	5949	hgsc.bcm.edu	37	10	48388918	48388918	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:48388918G>C	ENST00000224600.4	-	1	2073	c.1960C>G	c.(1960-1962)Cca>Gca	p.P654A	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	654	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	ACGACCTCTGGCCGAGCATAG	0.672																																					p.P654A		Atlas-SNP	.											.	RBP3	152	.	0			c.C1960G						PASS	.						16.0	18.0	17.0					10																	48388918		2197	4286	6483	SO:0001583	missense	5949	exon1			CCTCTGGCCGAGC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1960C>G	chr10.hg19:g.48388918G>C	ENSP00000224600:p.Pro654Ala	58.0	0.0	.		102.0	43.0	.	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	hg19	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	G	7.421	0.636769	0.14386	.	.	ENSG00000107618	ENST00000224600	T	0.39997	1.05	5.53	5.53	0.82687	.	0.128692	0.53938	D	0.000058	T	0.47322	0.1439	M	0.76170	2.325	0.38359	D	0.944551	P	0.34562	0.457	B	0.31390	0.129	T	0.57894	-0.7732	10	0.87932	D	0	-14.2089	18.4586	0.90729	0.0:0.0:1.0:0.0	.	654	P10745	RET3_HUMAN	A	654	ENSP00000224600:P654A	ENSP00000224600:P654A	P	-	1	0	RBP3	48008924	1.000000	0.71417	0.047000	0.18901	0.002000	0.02628	5.637000	0.67854	2.628000	0.89032	0.561000	0.74099	CCA	.	.	.	none		0.672	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
ERCC6	2074	hgsc.bcm.edu	37	10	50681040	50681040	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:50681040C>T	ENST00000355832.5	-	15	2822	c.2744G>A	c.(2743-2745)cGg>cAg	p.R915Q	ERCC6_ENST00000465653.1_5'Flank|RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000542458.1_Missense_Mutation_p.R285Q	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	915	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GCCGCCCACCCGCGTGGTCAG	0.498								Direct reversal of damage;Nucleotide excision repair (NER)																													p.T915N		Atlas-SNP	.											.	ERCC6	162	.	0			c.C2744A						PASS	.						66.0	61.0	63.0					10																	50681040		2203	4300	6503	SO:0001583	missense	2074	exon15			CCCACCCGCGTGG	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2744G>A	chr10.hg19:g.50681040C>T	ENSP00000348089:p.Arg915Gln	224.0	0.0	.		231.0	92.0	.	NM_000124	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	hg19	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199652	0.79015	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	T;T	0.74842	-0.88;-0.88	5.88	5.88	0.94601	Helicase, C-terminal (3);	.	.	.	.	D	0.88093	0.6344	M	0.83603	2.65	0.48341	D	0.999631	D;D	0.89917	1.0;0.999	D;D	0.76575	0.987;0.988	D	0.88520	0.3095	9	0.72032	D	0.01	-20.7418	20.2422	0.98381	0.0:1.0:0.0:0.0	.	915;292	Q03468;Q59FF6	ERCC6_HUMAN;.	Q	915;292;285	ENSP00000348089:R915Q;ENSP00000445134:R285Q	ENSP00000348089:R915Q	R	-	2	0	ERCC6	50351046	0.998000	0.40836	0.702000	0.30337	0.338000	0.28826	3.873000	0.56093	2.782000	0.95742	0.655000	0.94253	CGG	.	.	.	none		0.498	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
CSTF2T	23283	hgsc.bcm.edu	37	10	53458361	53458361	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:53458361C>T	ENST00000331173.4	-	1	994	c.949G>A	c.(949-951)Gga>Aga	p.G317R	PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000373980.4_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	317	Gly-rich.				mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G317R(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		GTCACGGGTCCGCGAGGTATA	0.567																																					p.G317R		Atlas-SNP	.											CSTF2T,rectum,carcinoma,0,1	CSTF2T	64	.	1	Substitution - Missense(1)	large_intestine(1)	c.G949A						PASS	.						72.0	68.0	70.0					10																	53458361		2203	4300	6503	SO:0001583	missense	23283	exon1			CGGGTCCGCGAGG	AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.949G>A	chr10.hg19:g.53458361C>T	ENSP00000332444:p.Gly317Arg	59.0	0.0	.		64.0	14.0	.	NM_015235	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	hg19	CCDS7245.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169805	0.78452	.	.	ENSG00000177613	ENST00000331173	T	0.22539	1.95	4.7	4.7	0.59300	.	0.449653	0.22819	N	0.055255	T	0.41994	0.1183	L	0.55481	1.735	0.53688	D	0.999972	D	0.89917	1.0	D	0.97110	1.0	T	0.13737	-1.0498	10	0.52906	T	0.07	-7.9329	15.5353	0.75998	0.0:1.0:0.0:0.0	.	317	Q9H0L4	CSTFT_HUMAN	R	317	ENSP00000332444:G317R	ENSP00000332444:G317R	G	-	1	0	CSTF2T	53128367	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.116000	0.71571	2.613000	0.88420	0.655000	0.94253	GGA	.	.	.	none		0.567	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
COL13A1	1305	hgsc.bcm.edu	37	10	71562297	71562297	+	Missense_Mutation	SNP	C	C	T	rs561022104	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:71562297C>T	ENST00000398978.3	+	1	610	c.118C>T	c.(118-120)Ccg>Tcg	p.P40S	COL13A1_ENST00000398971.3_Missense_Mutation_p.P40S|COL13A1_ENST00000354547.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398969.3_Missense_Mutation_p.P40S|COL13A1_ENST00000520133.1_Missense_Mutation_p.P40S|COL13A1_ENST00000398972.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398974.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398973.3_Missense_Mutation_p.P40S|COL13A1_ENST00000356340.3_Missense_Mutation_p.P40S|COL13A1_ENST00000522165.1_Missense_Mutation_p.P40S|COL13A1_ENST00000357811.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398964.3_Missense_Mutation_p.P40S|COL13A1_ENST00000520267.1_Missense_Mutation_p.P40S|COL13A1_ENST00000398966.3_Missense_Mutation_p.P40S|COL13A1_ENST00000398968.3_Missense_Mutation_p.P40S|COL13A1_ENST00000517713.1_Missense_Mutation_p.P40S	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						CGCACGGCTGCCGAGTCCAGG	0.766													C|||	2	0.000399361	0.0015	0.0	5008	,	,		8844	0.0		0.0	False		,,,				2504	0.0				p.P40S		Atlas-SNP	.											.	COL13A1	133	.	0			c.C118T						PASS	.						12.0	14.0	13.0					10																	71562297		1839	3975	5814	SO:0001583	missense	1305	exon1			CGGCTGCCGAGTC	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.118C>T	chr10.hg19:g.71562297C>T	ENSP00000381949:p.Pro40Ser	0.0	0.0	.		17.0	4.0	.	NM_080802		Missense_Mutation	SNP	ENST00000398978.3	hg19	CCDS44419.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024834	0.54683	.	.	ENSG00000197467	ENST00000398974;ENST00000398971;ENST00000398968;ENST00000398966;ENST00000398964;ENST00000398969;ENST00000356340;ENST00000398972;ENST00000398973;ENST00000398978;ENST00000354547;ENST00000357811;ENST00000520267;ENST00000517713;ENST00000522165;ENST00000520133	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91686	-2.74;-2.66;-2.7;-2.79;-2.89;-2.7;-2.73;-2.6;-2.72;-2.72;-2.7;-2.71;-2.66;-2.61;-2.66;-2.61	5.24	5.24	0.73138	.	0.000000	0.42294	D	0.000732	D	0.92172	0.7518	N	0.22421	0.69	0.29823	N	0.830659	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.69078	0.993;0.996;0.997;0.993;0.994;0.994;0.994;0.997;0.994;0.994;0.997;0.997;0.997;0.996;0.997;0.997;0.994;0.996	D;D;P;D;P;P;P;D;P;P;P;P;D;D;P;P;P;D	0.78314	0.979;0.991;0.9;0.979;0.796;0.796;0.796;0.986;0.796;0.723;0.9;0.9;0.986;0.991;0.9;0.9;0.796;0.991	D	0.88496	0.3079	10	0.44086	T	0.13	-5.5417	13.2925	0.60278	0.0:0.9204:0.0:0.0796	.	40;40;40;40;40;40;40;40;40;40;40;40;40;40;40;40;40;40	Q5TAT6;Q5TAT6-5;Q5TAT6-6;E9PEG9;E7ES55;E7ES51;E7ES47;E7ES46;E7ES49;E7EWL8;Q5TAT6-3;Q5TAT6-4;E7EX21;Q5TAT6-7;Q5TAT6-8;Q5TAT6-2;E7ES56;G5E987	CODA1_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	40	ENSP00000381946:P40S;ENSP00000381943:P40S;ENSP00000381940:P40S;ENSP00000381938:P40S;ENSP00000381936:P40S;ENSP00000381941:P40S;ENSP00000348695:P40S;ENSP00000381944:P40S;ENSP00000381945:P40S;ENSP00000381949:P40S;ENSP00000346553:P40S;ENSP00000350463:P40S;ENSP00000428057:P40S;ENSP00000430061:P40S;ENSP00000428342:P40S;ENSP00000430173:P40S	ENSP00000346553:P40S	P	+	1	0	COL13A1	71232303	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	3.084000	0.50143	2.462000	0.83206	0.456000	0.33151	CCG	.	.	.	none		0.766	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
RNLS	55328	hgsc.bcm.edu	37	10	90342858	90342858	+	Silent	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:90342858A>C	ENST00000331772.4	-	1	112	c.90T>G	c.(88-90)ctT>ctG	p.L30L	Y_RNA_ENST00000364678.1_RNA|RNLS_ENST00000466945.1_5'UTR|RNLS_ENST00000437752.1_Silent_p.L30L|RNLS_ENST00000371947.3_Silent_p.L30L	NM_001031709.2	NP_001026879.2	Q5VYX0	RNLS_HUMAN	renalase, FAD-dependent amine oxidase	30					cardiac left ventricle morphogenesis (GO:0003214)|dopamine metabolic process (GO:0042417)|epinephrine metabolic process (GO:0042414)|heart contraction (GO:0060047)|norepinephrine metabolic process (GO:0042415)|phosphate ion homeostasis (GO:0055062)|regulation of systemic arterial blood pressure (GO:0003073)|response to epinephrine (GO:0071871)|response to ischemia (GO:0002931)|response to norepinephrine (GO:0071873)|response to salt (GO:1902074)	extracellular space (GO:0005615)	oxidoreductase activity (GO:0016491)			breast(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7						CCCACACAGCAAGGTACAAGG	0.632											OREG0020353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L30L		Atlas-SNP	.											.	RNLS	45	.	0			c.T90G						PASS	.						65.0	63.0	64.0					10																	90342858		2203	4300	6503	SO:0001819	synonymous_variant	55328	exon1			CACAGCAAGGTAC	BC005364	CCDS7388.1, CCDS31239.1	10q23.31	2009-04-22	2009-04-22	2009-04-22	ENSG00000184719	ENSG00000184719			25641	protein-coding gene	gene with protein product		609360	"""chromosome 10 open reading frame 59"""	C10orf59		15841207, 17565281	Standard	NM_001031709		Approved	FLJ11218, renalase	uc001kfe.3	Q5VYX0	OTTHUMG00000018692	ENST00000331772.4:c.90T>G	chr10.hg19:g.90342858A>C		121.0	0.0	.	1274	164.0	57.0	.	NM_001031709	Q9BS33|Q9NUP8	Silent	SNP	ENST00000331772.4	hg19	CCDS31239.1																																																																																			.	.	.	none		0.632	RNLS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049250.1	NM_018363	
NOC3L	64318	hgsc.bcm.edu	37	10	96121495	96121495	+	Silent	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:96121495T>C	ENST00000371361.3	-	2	244	c.144A>G	c.(142-144)aaA>aaG	p.K48K	NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000371350.1_Silent_p.K48K	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	48					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				CTTGCCTTAGTTTCCTCTGTT	0.368																																					p.K48K		Atlas-SNP	.											.	NOC3L	67	.	0			c.A144G						PASS	.						308.0	272.0	284.0					10																	96121495		2203	4300	6503	SO:0001819	synonymous_variant	64318	exon2			CCTTAGTTTCCTC	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.144A>G	chr10.hg19:g.96121495T>C		93.0	0.0	.		79.0	27.0	.	NM_022451	Q9H5M6|Q9H9D8	Silent	SNP	ENST00000371361.3	hg19	CCDS7433.1																																																																																			.	.	.	none		0.368	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
PDZD8	118987	hgsc.bcm.edu	37	10	119134718	119134718	+	Silent	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr10:119134718G>T	ENST00000334464.5	-	1	260	c.21C>A	c.(19-21)atC>atA	p.I7I		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	7					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		CCGACGCCAGGATCATGAGCA	0.741																																					p.I7I		Atlas-SNP	.											.	PDZD8	85	.	0			c.C21A						PASS	.																																			SO:0001819	synonymous_variant	118987	exon1			CGCCAGGATCATG	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.21C>A	chr10.hg19:g.119134718G>T		10.0	0.0	.		59.0	38.0	.	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Silent	SNP	ENST00000334464.5	hg19	CCDS7600.1																																																																																			.	.	.	none		0.741	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
ZFP91	80829	hgsc.bcm.edu	37	11	58346868	58346868	+	Silent	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:58346868G>A	ENST00000316059.6	+	1	285	c.114G>A	c.(112-114)gcG>gcA	p.A38A	ZFP91-CNTF_ENST00000389919.4_Silent_p.A38A|LPXN_ENST00000528489.1_5'Flank|LPXN_ENST00000528954.1_5'Flank	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	38	Ala-rich.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AGGCGGTCGCGGCGGCGCCTG	0.771																																					p.A38A		Atlas-SNP	.											.	ZFP91	66	.	0			c.G114A						PASS	.						2.0	2.0	2.0					11																	58346868		1047	2260	3307	SO:0001819	synonymous_variant	80829	exon1			GGTCGCGGCGGCG	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.114G>A	chr11.hg19:g.58346868G>A		0.0	0.0	.		15.0	8.0	.	NM_001197051	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Silent	SNP	ENST00000316059.6	hg19	CCDS31553.1																																																																																			.	.	.	none		0.771	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023	
ATG2A	23130	hgsc.bcm.edu	37	11	64681557	64681557	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:64681557C>A	ENST00000377264.3	-	3	595	c.483G>T	c.(481-483)gaG>gaT	p.E161D	ATG2A_ENST00000421419.2_Missense_Mutation_p.E161D	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	161					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GCTCACCAGTCTCAATGGTCT	0.667																																					p.E161D		Atlas-SNP	.											.	ATG2A	133	.	0			c.G483T						PASS	.						27.0	31.0	29.0					11																	64681557		2165	4236	6401	SO:0001583	missense	23130	exon3			ACCAGTCTCAATG		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.483G>T	chr11.hg19:g.64681557C>A	ENSP00000366475:p.Glu161Asp	129.0	0.0	.		154.0	54.0	.	NM_015104	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	hg19	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	c	16.16	3.045338	0.55110	.	.	ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459	T;T	0.56444	0.46;0.46	3.89	1.99	0.26369	.	0.000000	0.64402	D	0.000001	T	0.55449	0.1921	L	0.41236	1.265	0.44366	D	0.997264	D	0.63880	0.993	D	0.70016	0.967	T	0.49542	-0.8929	10	0.33940	T	0.23	.	5.9448	0.19213	0.0:0.666:0.0:0.334	.	161	Q2TAZ0	ATG2A_HUMAN	D	161	ENSP00000410522:E161D;ENSP00000366475:E161D	ENSP00000227459:E161D	E	-	3	2	ATG2A	64438133	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	0.697000	0.25556	0.439000	0.26476	0.457000	0.33378	GAG	.	.	.	none		0.667	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
C11orf80	79703	hgsc.bcm.edu	37	11	66610492	66610492	+	Silent	SNP	C	C	T	rs369989753	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:66610492C>T	ENST00000360962.4	+	16	1927	c.1920C>T	c.(1918-1920)caC>caT	p.H640H	C11orf80_ENST00000532565.2_Silent_p.H422H|RCE1_ENST00000525356.1_5'Flank|RCE1_ENST00000524506.1_5'Flank|RCE1_ENST00000309657.3_5'Flank|C11orf80_ENST00000346672.4_Silent_p.H449H|C11orf80_ENST00000525449.2_Silent_p.H448H|C11orf80_ENST00000540737.1_Silent_p.H474H|C11orf80_ENST00000527634.1_Silent_p.H423H	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	640										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						GCGAGGCTCACGGCAGGGCCC	0.766													C|||	13	0.00259585	0.0098	0.0	5008	,	,		10475	0.0		0.0	False		,,,				2504	0.0				p.H640H		Atlas-SNP	.											C11orf80,right_upper_lobe,carcinoma,0,1	C11orf80	31	.	0			c.C1920T						PASS	.	C		13,2905		0,13,1446	3.0	4.0	3.0		1920	1.1	0.0	11		3	0,6770		0,0,3385	no	coding-synonymous	C11orf80	NM_024650.3		0,13,4831	TT,TC,CC		0.0,0.4455,0.1342		640/678	66610492	13,9675	1459	3385	4844	SO:0001819	synonymous_variant	79703	exon16			GGCTCACGGCAGG			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.1920C>T	chr11.hg19:g.66610492C>T		1.0	1.0	.		9.0	6.0	.	NM_024650	Q9H677	Silent	SNP	ENST00000360962.4	hg19	CCDS53664.1																																																																																			.	.	.	weak		0.766	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
FOLR2	2350	hgsc.bcm.edu	37	11	71931920	71931920	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:71931920C>A	ENST00000298223.6	+	3	344	c.157C>A	c.(157-159)Ccc>Acc	p.P53T	FOLR2_ENST00000454954.2_Missense_Mutation_p.P12T|FOLR2_ENST00000449475.2_Missense_Mutation_p.P70T	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	53					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	CCAGTGCAGTCCCTGGAAGAA	0.587																																					p.P53T		Atlas-SNP	.											FOLR2,NS,carcinoma,0,1	FOLR2	29	.	0			c.C157A						PASS	.						46.0	44.0	44.0					11																	71931920		2200	4293	6493	SO:0001583	missense	2350	exon3			TGCAGTCCCTGGA	AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.157C>A	chr11.hg19:g.71931920C>A	ENSP00000298223:p.Pro53Thr	103.0	2.0	.		105.0	37.0	.	NM_001113535	Q05CA5|Q6GTE8	Missense_Mutation	SNP	ENST00000298223.6	hg19	CCDS8212.1	.	.	.	.	.	.	.	.	.	.	c	17.57	3.422312	0.62622	.	.	ENSG00000165457	ENST00000449475;ENST00000298223;ENST00000413873;ENST00000454954;ENST00000541003;ENST00000539412;ENST00000536778;ENST00000535625;ENST00000321324;ENST00000538353	T;T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	4.25	2.38	0.29361	Folate receptor-like (1);	0.000000	0.85682	D	0.000000	D	0.88976	0.6584	M	0.93678	3.445	0.39744	D	0.971793	D	0.89917	1.0	D	0.97110	1.0	D	0.88102	0.2820	10	0.56958	D	0.05	.	8.6185	0.33847	0.0:0.8112:0.0:0.1888	.	53	P14207	FOLR2_HUMAN	T	70;53;70;12;99;64;68;53;66;53	ENSP00000405638:P70T;ENSP00000298223:P53T;ENSP00000414094:P12T;ENSP00000443307:P99T;ENSP00000441547:P64T;ENSP00000438568:P68T;ENSP00000444794:P53T;ENSP00000321957:P66T;ENSP00000440337:P53T	ENSP00000298223:P53T	P	+	1	0	FOLR2	71609568	0.920000	0.31207	0.934000	0.37439	0.977000	0.68977	3.796000	0.55507	0.435000	0.26365	0.455000	0.32223	CCC	.	.	.	none		0.587	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803	
LIPT2	387787	hgsc.bcm.edu	37	11	74204479	74204479	+	Silent	SNP	G	G	T	rs533747475	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:74204479G>T	ENST00000310109.4	-	1	299	c.270C>A	c.(268-270)acC>acA	p.T90T	AP001372.2_ENST00000526036.1_lincRNA	NM_001144869.1	NP_001138341.1	A6NK58	LIPT2_HUMAN	lipoyl(octanoyl) transferase 2 (putative)	90	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.|Substrate binding. {ECO:0000250}.				cellular protein modification process (GO:0006464)|lipoate biosynthetic process (GO:0009107)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|lipoyl(octanoyl) transferase activity (GO:0033819)|octanoyltransferase activity (GO:0016415)			endometrium(1)|prostate(1)|stomach(1)	3						GGCCGTGGAAGGTGGCCAGGC	0.746													G|||	10	0.00199681	0.0068	0.0014	5008	,	,		12455	0.0		0.0	False		,,,				2504	0.0				p.T90T		Atlas-SNP	.											.	LIPT2	5	.	0			c.C270A						PASS	.						3.0	8.0	7.0					11																	74204479		586	1396	1982	SO:0001819	synonymous_variant	387787	exon1			GTGGAAGGTGGCC		CCDS44679.1	11q13.4	2009-09-09			ENSG00000175536	ENSG00000175536			37216	protein-coding gene	gene with protein product							Standard	NM_001144869		Approved		uc010rrk.2	A6NK58	OTTHUMG00000165646	ENST00000310109.4:c.270C>A	chr11.hg19:g.74204479G>T		0.0	0.0	.		6.0	6.0	.	NM_001144869		Silent	SNP	ENST00000310109.4	hg19	CCDS44679.1																																																																																			.	.	.	none		0.746	LIPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385544.1	NM_001144869	
BARX2	8538	hgsc.bcm.edu	37	11	129321185	129321185	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr11:129321185T>A	ENST00000281437.4	+	4	824	c.728T>A	c.(727-729)cTc>cAc	p.L243H	BARX2_ENST00000531946.1_Missense_Mutation_p.L121H|BARX2_ENST00000526127.1_Missense_Mutation_p.L98H	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	243					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CAGGAGGAGCTCTGTGAAGCA	0.582																																					p.L243H		Atlas-SNP	.											.	BARX2	40	.	0			c.T728A						PASS	.						72.0	66.0	68.0					11																	129321185		2201	4297	6498	SO:0001583	missense	8538	exon4			AGGAGCTCTGTGA	AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.728T>A	chr11.hg19:g.129321185T>A	ENSP00000281437:p.Leu243His	143.0	0.0	.		134.0	53.0	.	NM_003658	O43518|Q6NT51	Missense_Mutation	SNP	ENST00000281437.4	hg19	CCDS8481.1	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632445	0.67015	.	.	ENSG00000043039	ENST00000281437;ENST00000526127;ENST00000531946	D;D;D	0.90385	-2.66;-2.27;-2.27	5.51	-1.59	0.08453	.	0.906017	0.09601	N	0.780189	D	0.83769	0.5326	L	0.29908	0.895	0.09310	N	0.999999	P	0.45348	0.856	B	0.40101	0.319	T	0.72701	-0.4214	10	0.41790	T	0.15	.	12.1971	0.54303	0.0:0.6898:0.0:0.3102	.	243	Q9UMQ3	BARX2_HUMAN	H	243;98;121	ENSP00000281437:L243H;ENSP00000451113:L98H;ENSP00000450418:L121H	ENSP00000281437:L243H	L	+	2	0	BARX2	128826395	0.188000	0.23250	0.043000	0.18650	0.326000	0.28443	0.364000	0.20325	-0.288000	0.09051	0.533000	0.62120	CTC	.	.	.	none		0.582	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386153.1	NM_003658	
SHMT2	6472	hgsc.bcm.edu	37	12	57624649	57624649	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:57624649C>G	ENST00000328923.3	+	2	549	c.97C>G	c.(97-99)Cag>Gag	p.Q33E	Y_RNA_ENST00000365197.1_RNA|SHMT2_ENST00000393827.4_5'UTR|SHMT2_ENST00000557487.1_Missense_Mutation_p.Q33E|SHMT2_ENST00000414700.3_Missense_Mutation_p.Q12E|SHMT2_ENST00000449049.3_Missense_Mutation_p.Q12E|SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000553474.1_Missense_Mutation_p.Q12E	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	33					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	CAACGCAGCCCAGACTCAGAC	0.582																																					p.Q33E	Esophageal Squamous(150;1369 2416 49071 49364)	Atlas-SNP	.											.	SHMT2	40	.	0			c.C97G						PASS	.						92.0	77.0	82.0					12																	57624649		2203	4300	6503	SO:0001583	missense	6472	exon2			GCAGCCCAGACTC	AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.97C>G	chr12.hg19:g.57624649C>G	ENSP00000333667:p.Gln33Glu	346.0	0.0	.		402.0	161.0	.	NM_005412	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	hg19	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	C	8.946	0.966931	0.18659	.	.	ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000556689;ENST00000414700;ENST00000557703;ENST00000553529;ENST00000554310;ENST00000557427;ENST00000553474;ENST00000555773;ENST00000554975;ENST00000449049;ENST00000556737	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	4.81	3.85	0.44370	.	0.335256	0.29537	N	0.011879	T	0.10551	0.0258	N	0.08118	0	0.80722	D	1	B;B	0.11235	0.004;0.002	B;B	0.12837	0.008;0.005	T	0.31586	-0.9938	10	0.02654	T	1	-12.6294	3.4496	0.07493	0.1727:0.5679:0.1666:0.0929	.	33;33	Q8N1A5;P34897	.;GLYM_HUMAN	E	33;33;33;12;12;12;12;12;12;12;12;12;12	ENSP00000333667:Q33E;ENSP00000452315:Q33E;ENSP00000406881:Q12E;ENSP00000452419:Q12E;ENSP00000413770:Q12E	ENSP00000333667:Q33E	Q	+	1	0	SHMT2	55910916	0.139000	0.22563	1.000000	0.80357	0.972000	0.66771	0.472000	0.22116	2.668000	0.90789	0.655000	0.94253	CAG	.	.	.	none		0.582	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
FAM216A	29902	hgsc.bcm.edu	37	12	110906786	110906786	+	Missense_Mutation	SNP	C	C	T	rs202079205	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:110906786C>T	ENST00000377673.5	+	1	618	c.106C>T	c.(106-108)Ccg>Tcg	p.P36S	GPN3_ENST00000228827.3_5'Flank|GPN3_ENST00000552180.1_5'UTR|GPN3_ENST00000537466.2_5'Flank|GPN3_ENST00000543199.1_5'Flank	NM_013300.2	NP_037432.2	Q8WUB2	F216A_HUMAN	family with sequence similarity 216, member A	36																	TTCTGCAGAGCCGCCCGCTGT	0.771													C|||	12	0.00239617	0.0091	0.0	5008	,	,		13111	0.0		0.0	False		,,,				2504	0.0				p.P36S		Atlas-SNP	.											.	.	.	.	0			c.C106T						PASS	.	C	SER/PRO	24,3054		0,24,1515	2.0	2.0	2.0		106	3.3	0.1	12		2	0,6186		0,0,3093	yes	missense	C12orf24	NM_013300.2	74	0,24,4608	TT,TC,CC		0.0,0.7797,0.2591	probably-damaging	36/274	110906786	24,9240	1539	3093	4632	SO:0001583	missense	29902	exon1			GCAGAGCCGCCCG	U79274	CCDS31899.1	12q24.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000204856	ENSG00000204856			30180	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 24"""	C12orf24			Standard	NM_013300		Approved	HSU79274	uc001tqu.4	Q8WUB2	OTTHUMG00000169526	ENST00000377673.5:c.106C>T	chr12.hg19:g.110906786C>T	ENSP00000366901:p.Pro36Ser	0.0	0.0	.		22.0	15.0	.	NM_013300	A6NH30|Q99776	Missense_Mutation	SNP	ENST00000377673.5	hg19	CCDS31899.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171608	0.78452	0.007797	0.0	ENSG00000204856	ENST00000377673;ENST00000538285	T	0.51071	0.72	4.16	3.27	0.37495	.	0.000000	0.39544	N	0.001336	T	0.32645	0.0836	L	0.56769	1.78	0.27811	N	0.942126	B;B	0.30709	0.291;0.129	B;B	0.26693	0.072;0.031	T	0.41645	-0.9497	10	0.87932	D	0	-0.6948	9.2806	0.37727	0.0:0.8974:0.0:0.1026	.	36;36	F5GZE4;Q8WUB2	.;CL024_HUMAN	S	36	ENSP00000366901:P36S	ENSP00000366901:P36S	P	+	1	0	C12orf24	109391169	0.943000	0.32029	0.132000	0.22025	0.895000	0.52256	2.944000	0.49034	1.096000	0.41439	0.462000	0.41574	CCG	.	.	.	weak		0.771	FAM216A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404616.1	NM_013300	
CLYBL	171425	hgsc.bcm.edu	37	13	100258999	100258999	+	Missense_Mutation	SNP	C	C	T	rs200020595		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr13:100258999C>T	ENST00000376360.1	+	1	77	c.50C>T	c.(49-51)gCg>gTg	p.A17V	CLYBL_ENST00000339105.4_Missense_Mutation_p.A17V|CLYBL_ENST00000376354.1_Missense_Mutation_p.A17V|CLYBL_ENST00000376355.3_Missense_Mutation_p.A17V|CLYBL_ENST00000444838.2_Missense_Mutation_p.A17V			Q8N0X4	CLYBL_HUMAN	citrate lyase beta like	17						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|metal ion binding (GO:0046872)			NS(1)|kidney(6)|large_intestine(6)|lung(10)|skin(2)	25	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCGGCGGCGGCGCTGCTGAGG	0.776																																					p.A17V		Atlas-SNP	.											.	CLYBL	48	.	0			c.C50T						PASS	.						6.0	8.0	7.0					13																	100258999		1843	3595	5438	SO:0001583	missense	171425	exon1			CGGCGGCGCTGCT	AF428253	CCDS32002.1	13q32.3	2011-04-08			ENSG00000125246	ENSG00000125246			18355	protein-coding gene	gene with protein product		609686					Standard	XM_005254030		Approved	CLB	uc001vok.3	Q8N0X4	OTTHUMG00000017278	ENST00000376360.1:c.50C>T	chr13.hg19:g.100258999C>T	ENSP00000365538:p.Ala17Val	0.0	0.0	.		16.0	12.0	.	NM_206808	Q5W0F7|Q8TDH8	Missense_Mutation	SNP	ENST00000376360.1	hg19	CCDS32002.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689931	0.29962	.	.	ENSG00000125246	ENST00000376355;ENST00000376360;ENST00000444838;ENST00000376354;ENST00000339105	T;T;T;T;T	0.24350	1.86;1.88;1.86;1.86;1.88	3.41	1.64	0.23874	.	0.599921	0.15592	N	0.254333	T	0.10766	0.0263	N	0.08118	0	0.22552	N	0.998997	B;B;B	0.15719	0.014;0.01;0.003	B;B;B	0.10450	0.002;0.005;0.001	T	0.30357	-0.9981	10	0.23302	T	0.38	.	5.6733	0.17735	0.0:0.7452:0.0:0.2548	.	17;17;17	B4DU60;Q8N0X4-2;Q8N0X4	.;.;CLYBL_HUMAN	V	17	ENSP00000365533:A17V;ENSP00000365538:A17V;ENSP00000404768:A17V;ENSP00000365532:A17V;ENSP00000342991:A17V	ENSP00000342991:A17V	A	+	2	0	CLYBL	99057000	0.995000	0.38212	1.000000	0.80357	0.521000	0.34408	0.074000	0.14662	0.436000	0.26393	0.313000	0.20887	GCG	.	.	.	weak		0.776	CLYBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045611.1		
LGALS3	3958	hgsc.bcm.edu	37	14	55604955	55604955	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:55604955C>T	ENST00000254301.9	+	3	472	c.211C>T	c.(211-213)Ccc>Tcc	p.P71S	LGALS3_ENST00000553755.1_3'UTR|LGALS3_ENST00000554715.1_Missense_Mutation_p.P71S	NM_002306.3	NP_002297.2	P17931	LEG3_HUMAN	lectin, galactoside-binding, soluble, 3	71	8 X 9 AA tandem repeats of Y-P-G-X(3)-P- G-A.				eosinophil chemotaxis (GO:0048245)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|mononuclear cell migration (GO:0071674)|mRNA processing (GO:0006397)|negative regulation of endocytosis (GO:0045806)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of immunological synapse formation (GO:2000521)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell receptor signaling pathway (GO:0050860)|neutrophil chemotaxis (GO:0030593)|positive chemotaxis (GO:0050918)|positive regulation of calcium ion import (GO:0090280)|positive regulation of mononuclear cell migration (GO:0071677)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of T cell apoptotic process (GO:0070232)|regulation of T cell proliferation (GO:0042129)|RNA splicing (GO:0008380)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)	carbohydrate binding (GO:0030246)|chemoattractant activity (GO:0042056)|IgE binding (GO:0019863)|laminin binding (GO:0043236)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|prostate(1)	3						TGGAGCTTATCCCGGAGCACC	0.682																																					p.P71S		Atlas-SNP	.											.	LGALS3	10	.	0			c.C211T						PASS	.						21.0	24.0	23.0					14																	55604955		1813	4069	5882	SO:0001583	missense	3958	exon3			GCTTATCCCGGAG	M64303	CCDS41956.1	14q22.3	2014-03-19	2007-02-01		ENSG00000131981	ENSG00000131981		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6563	protein-coding gene	gene with protein product	"""galectin 3"""	153619		LGALS2		2009535, 8063692	Standard	NR_003225		Approved	MAC-2, GALIG	uc001xbr.3	P17931	OTTHUMG00000171030	ENST00000254301.9:c.211C>T	chr14.hg19:g.55604955C>T	ENSP00000254301:p.Pro71Ser	61.0	0.0	.		78.0	29.0	.	NM_002306	B2RC38|Q16005|Q6IBA7|Q96J47	Missense_Mutation	SNP	ENST00000254301.9	hg19	CCDS41956.1	.	.	.	.	.	.	.	.	.	.	C	7.633	0.679349	0.14907	.	.	ENSG00000131981	ENST00000553493;ENST00000254301;ENST00000554715	T;T;T	0.74315	-0.83;3.24;2.45	5.35	4.45	0.53987	.	0.209237	0.50627	N	0.000111	T	0.77751	0.4177	M	0.86178	2.8	0.45662	D	0.998582	B	0.11235	0.004	B	0.16722	0.016	T	0.73830	-0.3859	10	0.62326	D	0.03	.	14.3618	0.66776	0.0:0.921:0.0:0.079	.	71	P17931	LEG3_HUMAN	S	71	ENSP00000451526:P71S;ENSP00000254301:P71S;ENSP00000451381:P71S	ENSP00000254301:P71S	P	+	1	0	LGALS3	54674708	0.991000	0.36638	0.823000	0.32752	0.087000	0.18053	2.632000	0.46511	0.647000	0.30713	-0.797000	0.03246	CCC	.	.	.	none		0.682	LGALS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411309.1	NM_002306	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68268851	68268851	+	Silent	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:68268851G>T	ENST00000347230.4	-	10	1722	c.1584C>A	c.(1582-1584)ctC>ctA	p.L528L	ZFYVE26_ENST00000555452.1_Silent_p.L528L	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	528					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GGTCCTCAGAGAGGCTGTCTT	0.537																																					p.L528L		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.C1584A						PASS	.						139.0	126.0	130.0					14																	68268851		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon10			CTCAGAGAGGCTG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1584C>A	chr14.hg19:g.68268851G>T		128.0	0.0	.		188.0	71.0	.	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	hg19	CCDS9788.1																																																																																			.	.	.	none		0.537	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
GPR65	8477	hgsc.bcm.edu	37	14	88478074	88478074	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:88478074G>A	ENST00000267549.3	+	2	1441	c.883G>A	c.(883-885)Gaa>Aaa	p.E295K	RP11-300J18.2_ENST00000554433.1_RNA	NM_003608.3	NP_003599.2	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	295					actin cytoskeleton reorganization (GO:0031532)|activation of Rho GTPase activity (GO:0032862)|apoptotic process (GO:0006915)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of stress fiber assembly (GO:0051496)|response to acidic pH (GO:0010447)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)	16						TTTTGTAACCGAAACAGGAAG	0.353																																					p.E295K		Atlas-SNP	.											.	GPR65	48	.	0			c.G883A						PASS	.						95.0	90.0	91.0					14																	88478074		2203	4300	6503	SO:0001583	missense	8477	exon2			GTAACCGAAACAG	U95218	CCDS9879.1	14q31-q32.1	2012-08-21			ENSG00000140030	ENSG00000140030		"""GPCR / Class A : Orphans"""	4517	protein-coding gene	gene with protein product		604620				9655242	Standard	NM_003608		Approved	hTDAG8, TDAG8	uc001xvv.3	Q8IYL9	OTTHUMG00000028648	ENST00000267549.3:c.883G>A	chr14.hg19:g.88478074G>A	ENSP00000267549:p.Glu295Lys	204.0	0.0	.		185.0	10.0	.	NM_003608	O75819	Missense_Mutation	SNP	ENST00000267549.3	hg19	CCDS9879.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063367	0.93898	.	.	ENSG00000140030	ENST00000267549	T	0.30714	1.52	5.98	5.98	0.97165	.	0.000000	0.56097	D	0.000037	T	0.33556	0.0867	N	0.08118	0	0.44417	D	0.99733	D	0.71674	0.998	P	0.58820	0.846	T	0.20009	-1.0288	10	0.29301	T	0.29	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	295	Q8IYL9	PSYR_HUMAN	K	295	ENSP00000267549:E295K	ENSP00000267549:E295K	E	+	1	0	GPR65	87547827	1.000000	0.71417	0.654000	0.29608	0.919000	0.55068	6.201000	0.72124	2.835000	0.97688	0.650000	0.86243	GAA	.	.	.	none		0.353	GPR65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071564.4		
CEP170B	283638	hgsc.bcm.edu	37	14	105350539	105350539	+	Missense_Mutation	SNP	C	C	T	rs373443985		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr14:105350539C>T	ENST00000414716.3	+	9	1651	c.1423C>T	c.(1423-1425)Cgg>Tgg	p.R475W	CEP170B_ENST00000453495.1_Missense_Mutation_p.R476W|CEP170B_ENST00000418279.1_Missense_Mutation_p.R405W|CEP170B_ENST00000556508.1_Missense_Mutation_p.R405W	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	475						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GACAGAGGAACGGCTGGGCAG	0.736																																					p.R475W		Atlas-SNP	.											.	.	.	.	0			c.C1423T						PASS	.	C	TRP/ARG,TRP/ARG	2,3338		0,2,1668	4.0	7.0	6.0		1423,1213	4.1	1.0	14		6	1,7387		0,1,3693	no	missense,missense	KIAA0284	NM_001112726.2,NM_015005.2	101,101	0,3,5361	TT,TC,CC		0.0135,0.0599,0.028	probably-damaging,probably-damaging	475/1555,405/1520	105350539	3,10725	1670	3694	5364	SO:0001583	missense	283638	exon9			GAGGAACGGCTGG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.1423C>T	chr14.hg19:g.105350539C>T	ENSP00000404151:p.Arg475Trp	0.0	0.0	.		8.0	4.0	.	NM_001112726	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	hg19	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695399	0.68386	5.99E-4	1.35E-4	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.51574	0.71;0.7;0.71;0.71	4.09	4.09	0.47781	.	0.577739	0.16725	N	0.202119	T	0.61751	0.2372	L	0.49350	1.555	0.52501	D	0.999953	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.989	T	0.62845	-0.6768	10	0.62326	D	0.03	-12.0906	12.3112	0.54929	0.1701:0.8299:0.0:0.0	.	475;475;405	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	W	405;475;476;405	ENSP00000451249:R405W;ENSP00000404151:R475W;ENSP00000407238:R476W;ENSP00000415006:R405W	ENSP00000404151:R475W	R	+	1	2	KIAA0284	104421584	0.739000	0.28196	0.982000	0.44146	0.376000	0.30014	1.841000	0.39240	1.813000	0.52934	0.313000	0.20887	CGG	.	.	.	weak		0.736	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
NPAP1	23742	hgsc.bcm.edu	37	15	24923447	24923447	+	Silent	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:24923447T>A	ENST00000329468.2	+	1	2907	c.2433T>A	c.(2431-2433)tcT>tcA	p.S811S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	811					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GCAGTGCCTCTGCAGCATCGT	0.522																																					p.S811S		Atlas-SNP	.											.	.	.	.	0			c.T2433A						PASS	.						138.0	133.0	135.0					15																	24923447		2203	4300	6503	SO:0001819	synonymous_variant	23742	exon1			TGCCTCTGCAGCA	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2433T>A	chr15.hg19:g.24923447T>A		50.0	0.0	.		69.0	4.0	.	NM_018958		Silent	SNP	ENST00000329468.2	hg19	CCDS10015.1																																																																																			.	.	.	none		0.522	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
OTUD7A	161725	hgsc.bcm.edu	37	15	31818596	31818596	+	Silent	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:31818596G>A	ENST00000307050.4	-	6	920	c.828C>T	c.(826-828)agC>agT	p.S276S	OTUD7A_ENST00000382902.1_Silent_p.S283S	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	276	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TGCGCGGCTCGCTGGAGGCCA	0.677																																					p.S276S		Atlas-SNP	.											.	OTUD7A	89	.	0			c.C828T						PASS	.						37.0	34.0	35.0					15																	31818596		2202	4300	6502	SO:0001819	synonymous_variant	161725	exon6			CGGCTCGCTGGAG	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.828C>T	chr15.hg19:g.31818596G>A		25.0	0.0	.		22.0	5.0	.	NM_130901	Q8IWK5	Silent	SNP	ENST00000307050.4	hg19	CCDS10026.1																																																																																			.	.	.	none		0.677	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901	
C15orf53	400359	hgsc.bcm.edu	37	15	38988831	38988831	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:38988831A>C	ENST00000318792.1	+	1	33	c.23A>C	c.(22-24)gAg>gCg	p.E8A		NM_207444.2	NP_997327.1	Q8NAA6	CO053_HUMAN	chromosome 15 open reading frame 53	8										endometrium(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	6		all_cancers(109;1.75e-13)|all_epithelial(112;1.02e-11)|Lung NSC(122;1.9e-09)|all_lung(180;4.04e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;8.39e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0321)		GGGGCCCAAGAGGACCTGGGC	0.562																																					p.E8A		Atlas-SNP	.											.	C15orf53	12	.	0			c.A23C						PASS	.						96.0	91.0	93.0					15																	38988831		2200	4297	6497	SO:0001583	missense	400359	exon1			CCCAAGAGGACCT		CCDS10048.1	15q14	2007-11-21			ENSG00000175779	ENSG00000175779			33796	protein-coding gene	gene with protein product							Standard	NM_207444		Approved	FLJ35695	uc001zkf.1	Q8NAA6	OTTHUMG00000129841	ENST00000318792.1:c.23A>C	chr15.hg19:g.38988831A>C	ENSP00000325144:p.Glu8Ala	134.0	0.0	.		159.0	46.0	.	NM_207444		Missense_Mutation	SNP	ENST00000318792.1	hg19	CCDS10048.1	.	.	.	.	.	.	.	.	.	.	A	9.365	1.069014	0.20147	.	.	ENSG00000175779	ENST00000318792	T	0.34667	1.35	3.31	-1.66	0.08265	.	.	.	.	.	T	0.23330	0.0564	N	0.08118	0	0.09310	N	1	D	0.54207	0.965	P	0.52554	0.702	T	0.12477	-1.0546	9	0.87932	D	0	.	3.0108	0.06044	0.4664:0.0:0.3378:0.1958	.	8	Q8NAA6	CO053_HUMAN	A	8	ENSP00000325144:E8A	ENSP00000325144:E8A	E	+	2	0	C15orf53	36776123	0.001000	0.12720	0.000000	0.03702	0.074000	0.17049	0.566000	0.23593	-0.349000	0.08274	-0.415000	0.06103	GAG	.	.	.	none		0.562	C15orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252081.1	NM_207444	
MYO5A	4644	hgsc.bcm.edu	37	15	52680095	52680096	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr15:52680095_52680096AC>CA	ENST00000399231.3	-	14	1925_1926	c.1682_1683GT>TG	c.(1681-1683)tGT>tTG	p.C561L	MYO5A_ENST00000356338.6_Missense_Mutation_p.C561L|MYO5A_ENST00000399233.2_Missense_Mutation_p.C561L|MYO5A_ENST00000358212.6_Missense_Mutation_p.C561L|MYO5A_ENST00000553916.1_Missense_Mutation_p.C561L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	561	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GAAATCCTTCACACTGGTATTC	0.307																																					p.C561W|p.C561F		Atlas-SNP	.											.	MYO5A	145	.	0			c.T1683G|c.G1682T						PASS	.																																			SO:0001583	missense	4644	exon14			TCCTTCACACTGG|CCTTCACACTGGT		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1682_1683delinsCA	chr15.hg19:g.52680095_52680096delinsCA	ENSP00000382177:p.Cys561Leu	13.0	0.0	.		15.0|13.0	5.0	.	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	hg19	CCDS42037.1																																																																																			.	.	.	none		0.307	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
WDR90	197335	hgsc.bcm.edu	37	16	707787	707787	+	Silent	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:707787C>T	ENST00000293879.4	+	21	2499	c.2499C>T	c.(2497-2499)ccC>ccT	p.P833P	WDR90_ENST00000549091.1_Silent_p.P833P|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	833										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CGGATGCCCCCGCGAGCCCCA	0.726																																					p.P833P		Atlas-SNP	.											.	WDR90	107	.	0			c.C2499T						PASS	.						8.0	11.0	10.0					16																	707787		1929	4048	5977	SO:0001819	synonymous_variant	197335	exon21			TGCCCCCGCGAGC	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.2499C>T	chr16.hg19:g.707787C>T		35.0	0.0	.		281.0	89.0	.	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Silent	SNP	ENST00000293879.4	hg19	CCDS42092.1																																																																																			.	.	.	none		0.726	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
VASN	114990	hgsc.bcm.edu	37	16	4432672	4432672	+	Silent	SNP	T	T	C	rs370088997	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:4432672T>C	ENST00000304735.3	+	2	1949	c.1794T>C	c.(1792-1794)tgT>tgC	p.C598C	CORO7_ENST00000537233.2_Intron|CORO7_ENST00000423908.2_Intron|CORO7_ENST00000251166.4_Intron|CORO7_ENST00000539968.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000574025.1_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	598					cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						CAGCCTACTGTGTGCGGCGGG	0.741													T|||	5	0.000998403	0.0038	0.0	5008	,	,		13454	0.0		0.0	False		,,,				2504	0.0				p.C598C		Atlas-SNP	.											.	VASN	21	.	0			c.T1794C						PASS	.	T	,,,,	8,3802		0,8,1897	4.0	7.0	6.0		,,,,1794	-1.7	1.0	16		6	0,7642		0,0,3821	no	intron,intron,intron,intron,coding-synonymous	CORO7,VASN,CORO7-PAM16	NM_001201472.1,NM_001201473.1,NM_001201479.1,NM_024535.4,NM_138440.2	,,,,	0,8,5718	CC,CT,TT		0.0,0.21,0.0699	,,,,	,,,,598/674	4432672	8,11444	1905	3821	5726	SO:0001819	synonymous_variant	114990	exon2			CTACTGTGTGCGG	AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.1794T>C	chr16.hg19:g.4432672T>C		2.0	0.0	.		19.0	4.0	.	NM_138440	Q6UXL4|Q6UXL5|Q96CX1	Silent	SNP	ENST00000304735.3	hg19	CCDS10514.1																																																																																			.	.	.	weak		0.741	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251632.1	NM_138440	
TNRC6A	27327	hgsc.bcm.edu	37	16	24788401	24788401	+	Missense_Mutation	SNP	C	C	A	rs112426081|rs575176088	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:24788401C>A	ENST00000395799.3	+	5	440	c.311C>A	c.(310-312)cCg>cAg	p.P104Q	TNRC6A_ENST00000315183.7_Missense_Mutation_p.P104Q	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	104	Gln-rich.|Interaction with argonaute family proteins.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		cagcagcagccgcagcagcag	0.587													C|||	5	0.000998403	0.0038	0.0	5008	,	,		10840	0.0		0.0	False		,,,				2504	0.0				p.P104Q		Atlas-SNP	.											TNRC6A,NS,carcinoma,0,1	TNRC6A	171	.	0			c.C311A						PASS	.						17.0	25.0	22.0					16																	24788401		2009	4030	6039	SO:0001583	missense	27327	exon5			AGCAGCCGCAGCA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.311C>A	chr16.hg19:g.24788401C>A	ENSP00000379144:p.Pro104Gln	49.0	1.0	.		128.0	8.0	.	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	hg19	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.471905	0.00167	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.10668	2.85;2.89	4.41	-2.9	0.05648	.	0.157308	0.30193	N	0.010181	T	0.03827	0.0108	N	0.08118	0	0.58432	D	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.47711	-0.9096	10	0.12430	T	0.62	0.0105	8.8291	0.35074	0.3902:0.531:0.0787:0.0	.	104	Q8NDV7	TNR6A_HUMAN	Q	104	ENSP00000326900:P104Q;ENSP00000379144:P104Q	ENSP00000326900:P104Q	P	+	2	0	TNRC6A	24695902	0.031000	0.19500	0.019000	0.16419	0.020000	0.10135	-0.621000	0.05559	-0.679000	0.05217	-1.413000	0.01118	CCG	.	.	.	none		0.587	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
ITGAD	3681	hgsc.bcm.edu	37	16	31414951	31414951	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:31414951G>A	ENST00000389202.2	+	7	738	c.689G>A	c.(688-690)gGc>gAc	p.G230D	RP11-120K18.2_ENST00000567545.1_RNA	NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	230	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ACGGCCACGGGCATCCTGACA	0.607																																					p.G230D		Atlas-SNP	.											.	ITGAD	154	.	0			c.G689A						PASS	.						96.0	78.0	84.0					16																	31414951		2197	4300	6497	SO:0001583	missense	3681	exon7			CCACGGGCATCCT	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.689G>A	chr16.hg19:g.31414951G>A	ENSP00000373854:p.Gly230Asp	143.0	0.0	.		157.0	59.0	.	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	hg19	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810704	0.70797	.	.	ENSG00000156886	ENST00000316569;ENST00000444228;ENST00000389202	D	0.86030	-2.06	4.7	3.7	0.42460	von Willebrand factor, type A (3);	.	.	.	.	D	0.92492	0.7616	M	0.86864	2.845	0.34300	D	0.684244	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.996	D	0.94979	0.8124	9	0.87932	D	0	.	12.6978	0.57014	0.0:0.1801:0.8199:0.0	.	230;246;230	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	D	94;246;230	ENSP00000373854:G230D	ENSP00000323325:G94D	G	+	2	0	ITGAD	31322452	1.000000	0.71417	0.706000	0.30403	0.134000	0.20937	1.683000	0.37638	2.434000	0.82447	0.508000	0.49915	GGC	.	.	.	none		0.607	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
PHKB	5257	hgsc.bcm.edu	37	16	47622955	47622955	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:47622955G>A	ENST00000323584.5	+	10	1034	c.1010G>A	c.(1009-1011)gGg>gAg	p.G337E	PHKB_ENST00000455779.1_Missense_Mutation_p.G330E|PHKB_ENST00000566044.1_Missense_Mutation_p.G330E|PHKB_ENST00000299167.8_Missense_Mutation_p.G337E|PHKB_ENST00000567402.1_3'UTR	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	337					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TTGAGAGATGGGTATAGAACA	0.353																																					p.G337E		Atlas-SNP	.											.	PHKB	298	.	0			c.G1010A						PASS	.						70.0	74.0	73.0					16																	47622955		2201	4300	6501	SO:0001583	missense	5257	exon10			GAGATGGGTATAG		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1010G>A	chr16.hg19:g.47622955G>A	ENSP00000313504:p.Gly337Glu	69.0	0.0	.		107.0	27.0	.	NM_000293	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	hg19	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	31	5.099043	0.94197	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91792	-2.91;-2.91	5.83	5.83	0.93111	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.97232	0.9095	M	0.92923	3.36	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.79108	0.992;0.918	D	0.97532	1.0080	10	0.87932	D	0	-10.5585	20.127	0.97984	0.0:0.0:1.0:0.0	.	337;330	Q93100;Q93100-4	KPBB_HUMAN;.	E	330;330;337	ENSP00000414345:G330E;ENSP00000313504:G337E	ENSP00000299167:G330E	G	+	2	0	PHKB	46180456	1.000000	0.71417	0.964000	0.40570	0.946000	0.59487	9.717000	0.98755	2.775000	0.95449	0.585000	0.79938	GGG	.	.	.	none		0.353	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
PIEZO1	9780	hgsc.bcm.edu	37	16	88800408	88800408	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:88800408C>A	ENST00000301015.9	-	17	2481	c.2235G>T	c.(2233-2235)caG>caT	p.Q745H	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	745					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						gctgctgctgctgatgctcct	0.662																																					p.Q745H		Atlas-SNP	.											.	PIEZO1	79	.	0			c.G2235T						PASS	.						8.0	11.0	10.0					16																	88800408		687	1580	2267	SO:0001583	missense	9780	exon17			CTGCTGCTGATGC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2235G>T	chr16.hg19:g.88800408C>A	ENSP00000301015:p.Gln745His	88.0	0.0	.		159.0	16.0	.	NM_001142864	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	hg19	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	5.575|5.575	0.290826|0.290826	0.10567|0.10567	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.43294	.|0.95	1.14|1.14	1.14|1.14	0.20703|0.20703	.|.	.|1.855710	.|0.04115	.|U	.|0.315402	T|T	0.24967|0.24967	0.0606|0.0606	N|N	0.19112|0.19112	0.55|0.55	0.19300|0.19300	N|N	0.999978|0.999978	.|P	.|0.37101	.|0.582	.|B	.|0.20384	.|0.029	T|T	0.25502|0.25502	-1.0130|-1.0130	5|10	.|0.48119	.|T	.|0.1	.|.	7.9701|7.9701	0.30122|0.30122	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|745	.|Q92508	.|PIEZ1_HUMAN	S|H	691|745	.|ENSP00000301015:Q745H	.|ENSP00000301015:Q745H	A|Q	-|-	1|3	0|2	FAM38A|FAM38A	87327909|87327909	0.000000|0.000000	0.05858|0.05858	0.014000|0.014000	0.15608|0.15608	0.007000|0.007000	0.05969|0.05969	-0.205000|-0.205000	0.09411|0.09411	0.499000|0.499000	0.27970|0.27970	0.134000|0.134000	0.15878|0.15878	GCA|CAG	.	.	.	none		0.662	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
DBNDD1	79007	hgsc.bcm.edu	37	16	90075270	90075270	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:90075270T>A	ENST00000002501.6	-	3	372	c.241A>T	c.(241-243)Acc>Tcc	p.T81S	DBNDD1_ENST00000568838.1_Missense_Mutation_p.T201S|DBNDD1_ENST00000392973.3_Missense_Mutation_p.T87S|DBNDD1_ENST00000304733.3_Missense_Mutation_p.T101S	NM_001042610.1	NP_001036075.1	Q9H9R9	DBND1_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 1	81						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)		GACATGTCGGTGAGCTCAGTG	0.642																																					p.T101S		Atlas-SNP	.											.	DBNDD1	9	.	0			c.A301T						PASS	.						32.0	37.0	35.0					16																	90075270		2016	4160	6176	SO:0001583	missense	79007	exon3			TGTCGGTGAGCTC	AK090696	CCDS10991.2, CCDS42223.1, CCDS73931.1	16q24.3	2008-02-05			ENSG00000003249	ENSG00000003249			28455	protein-coding gene	gene with protein product						12477932	Standard	NM_001288708		Approved	MGC3101, FLJ12582	uc002fqe.1	Q9H9R9	OTTHUMG00000138984	ENST00000002501.6:c.241A>T	chr16.hg19:g.90075270T>A	ENSP00000002501:p.Thr81Ser	61.0	0.0	.		119.0	28.0	.	NM_024043	B4DQS3|Q69YT2|Q9BW25	Missense_Mutation	SNP	ENST00000002501.6	hg19	CCDS42223.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.480743	0.63849	.	.	ENSG00000003249	ENST00000304733;ENST00000002501;ENST00000392973	T;T	0.34072	1.38;1.38	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.61274	0.2334	M	0.78637	2.42	0.49299	D	0.999773	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.994	T	0.64415	-0.6413	9	.	.	.	-34.7701	15.1222	0.72453	0.0:0.0:0.0:1.0	.	81;101	Q9H9R9;Q9H9R9-2	DBND1_HUMAN;.	S	101;81;201	ENSP00000306407:T101S;ENSP00000002501:T81S	.	T	-	1	0	DBNDD1	88602771	1.000000	0.71417	0.992000	0.48379	0.282000	0.26991	5.761000	0.68801	1.992000	0.58205	0.260000	0.18958	ACC	.	.	.	none		0.642	DBNDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272872.1	NM_024043	
ZNF594	84622	hgsc.bcm.edu	37	17	5086862	5086862	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:5086862C>G	ENST00000399604.4	-	1	830	c.690G>C	c.(688-690)caG>caC	p.Q230H	ZNF594_ENST00000575779.1_Missense_Mutation_p.Q230H			Q96JF6	ZN594_HUMAN	zinc finger protein 594	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q230H(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TGTGGATTCTCTGGTGCAGGA	0.438																																					p.Q230H		Atlas-SNP	.											ZNF594,NS,carcinoma,0,1	ZNF594	89	.	1	Substitution - Missense(1)	cervix(1)	c.G690C						PASS	.						104.0	107.0	106.0					17																	5086862		2051	4221	6272	SO:0001583	missense	84622	exon2			GATTCTCTGGTGC	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.690G>C	chr17.hg19:g.5086862C>G	ENSP00000382513:p.Gln230His	73.0	0.0	.		68.0	32.0	.	NM_032530	Q6RFS0	Missense_Mutation	SNP	ENST00000399604.4	hg19	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	C	3.775	-0.046880	0.07407	.	.	ENSG00000180626	ENST00000399604	T	0.18502	2.21	2.36	1.36	0.22044	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22859	0.0552	L	0.48986	1.54	0.20638	N	0.99988	D	0.57899	0.981	P	0.53035	0.716	T	0.08186	-1.0734	9	0.52906	T	0.07	.	6.6334	0.22869	0.0:0.8341:0.0:0.1659	.	230	Q96JF6	ZN594_HUMAN	H	230	ENSP00000382513:Q230H	ENSP00000382513:Q230H	Q	-	3	2	ZNF594	5027586	0.000000	0.05858	0.612000	0.29024	0.229000	0.25112	-0.361000	0.07612	1.314000	0.45095	0.462000	0.41574	CAG	.	.	.	none		0.438	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
KIAA0100	9703	hgsc.bcm.edu	37	17	26971163	26971163	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:26971163C>A	ENST00000528896.2	-	2	185	c.111G>T	c.(109-111)aaG>aaT	p.K37N	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	37						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CCGCCTGCAGCTTCCGCTGAC	0.488											OREG0024280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K37N		Atlas-SNP	.											.	KIAA0100	175	.	0			c.G111T						PASS	.						59.0	69.0	65.0					17																	26971163		2203	4300	6503	SO:0001583	missense	9703	exon2			CTGCAGCTTCCGC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.111G>T	chr17.hg19:g.26971163C>A	ENSP00000436773:p.Lys37Asn	90.0	0.0	.	790	77.0	25.0	.	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673269	0.29693	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896	T	0.26373	1.74	5.18	4.2	0.49525	FMP27, N-terminal (1);	0.354102	0.32719	N	0.005740	T	0.19127	0.0459	L	0.27053	0.805	0.80722	D	1	B;B	0.15141	0.012;0.0	B;B	0.12156	0.007;0.002	T	0.03619	-1.1019	10	0.62326	D	0.03	.	11.8337	0.52309	0.1379:0.7294:0.1327:0.0	.	37;37	F6XS94;Q14667	.;K0100_HUMAN	N	37	ENSP00000436773:K37N	ENSP00000005905:K37N	K	-	3	2	KIAA0100	23995290	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.047000	0.30367	1.295000	0.44724	-0.310000	0.09108	AAG	.	.	.	none		0.488	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
NUFIP2	57532	hgsc.bcm.edu	37	17	27614566	27614566	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:27614566A>G	ENST00000225388.4	-	2	504	c.446T>C	c.(445-447)aTt>aCt	p.I149T	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	149						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			CTTGGTTTTAATTCCTGCTTT	0.408																																					p.I149T		Atlas-SNP	.											.	NUFIP2	60	.	0			c.T446C						PASS	.						121.0	120.0	121.0					17																	27614566		2203	4300	6503	SO:0001583	missense	57532	exon2			GTTTTAATTCCTG	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.446T>C	chr17.hg19:g.27614566A>G	ENSP00000225388:p.Ile149Thr	60.0	0.0	.		67.0	4.0	.	NM_020772	A1L3A6|Q9P2M5	Missense_Mutation	SNP	ENST00000225388.4	hg19	CCDS32600.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.020017	0.35606	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	6.17	0.99709	.	0.134082	0.52532	D	0.000080	T	0.41328	0.1154	N	0.12182	0.205	0.80722	D	1	B	0.24721	0.11	B	0.25291	0.059	T	0.37384	-0.9708	9	0.56958	D	0.05	-12.34	12.6398	0.56702	0.8623:0.1377:0.0:0.0	.	149	Q7Z417	NUFP2_HUMAN	T	149	.	ENSP00000225388:I149T	I	-	2	0	NUFIP2	24638692	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.852000	0.55934	2.371000	0.80710	0.533000	0.62120	ATT	.	.	.	none		0.408	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772	
KLHL11	55175	hgsc.bcm.edu	37	17	40011371	40011371	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:40011371T>C	ENST00000319121.3	-	2	808	c.748A>G	c.(748-750)Aga>Gga	p.R250G		NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	250	BACK.									NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				AGCCAGTCTCTAATGAGATGG	0.398																																					p.R250G		Atlas-SNP	.											.	KLHL11	44	.	0			c.A748G						PASS	.						57.0	58.0	58.0					17																	40011371		2203	4300	6503	SO:0001583	missense	55175	exon2			AGTCTCTAATGAG		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.748A>G	chr17.hg19:g.40011371T>C	ENSP00000314608:p.Arg250Gly	64.0	0.0	.		61.0	33.0	.	NM_018143		Missense_Mutation	SNP	ENST00000319121.3	hg19	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	T	6.149	0.395748	0.11638	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.69040	-0.37	4.99	4.01	0.46588	BTB/Kelch-associated (2);	0.068566	0.56097	D	0.000034	T	0.48892	0.1525	N	0.20986	0.625	0.50313	D	0.999866	P	0.46142	0.873	B	0.38264	0.269	T	0.41215	-0.9521	10	0.21540	T	0.41	-2.2119	13.3418	0.60549	0.0:0.0:0.5227:0.4773	.	250	Q9NVR0	KLH11_HUMAN	G	250;113	ENSP00000314608:R250G	ENSP00000314608:R250G	R	-	1	2	KLHL11	37264897	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.686000	0.37669	1.055000	0.40461	-0.452000	0.05504	AGA	.	.	.	none		0.398	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
KAT2A	2648	hgsc.bcm.edu	37	17	40269761	40269761	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:40269761G>C	ENST00000225916.5	-	9	1416	c.1363C>G	c.(1363-1365)Ccc>Gcc	p.P455A		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	455					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGCTCCATGGGGATGTCACCC	0.627																																					p.P455A		Atlas-SNP	.											.	KAT2A	54	.	0			c.C1363G						PASS	.						43.0	36.0	39.0					17																	40269761		2203	4300	6503	SO:0001583	missense	2648	exon9			CCATGGGGATGTC	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1363C>G	chr17.hg19:g.40269761G>C	ENSP00000225916:p.Pro455Ala	107.0	0.0	.		132.0	53.0	.	NM_021078	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	ENST00000225916.5	hg19	CCDS11417.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470462	0.84533	.	.	ENSG00000108773	ENST00000225916	T	0.08634	3.07	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	M	0.84683	2.71	0.80722	D	1	D	0.61080	0.989	D	0.63192	0.912	T	0.28744	-1.0034	10	0.72032	D	0.01	-17.8967	17.6406	0.88135	0.0:0.0:1.0:0.0	.	455	Q92830	KAT2A_HUMAN	A	455	ENSP00000225916:P455A	ENSP00000225916:P455A	P	-	1	0	KAT2A	37523287	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.811000	0.99226	2.164000	0.68074	0.561000	0.74099	CCC	.	.	.	none		0.627	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078	
KAT7	11143	hgsc.bcm.edu	37	17	47869395	47869395	+	Splice_Site	SNP	G	G	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr17:47869395G>A	ENST00000259021.4	+	2	443	c.163G>A	c.(163-165)Gat>Aat	p.D55N	KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000454930.2_Splice_Site_p.G55R|KAT7_ENST00000510819.1_Splice_Site_p.G55R|KAT7_ENST00000424009.2_Splice_Site_p.D55N|KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000509773.1_Splice_Site_p.D55N	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	55	Ser-rich.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GAGTTCTCAAGGTAAAAAAAC	0.493																																					p.G55R		Atlas-SNP	.											.	.	.	.	0			c.G163A						PASS	.						72.0	69.0	70.0					17																	47869395		2203	4300	6503	SO:0001630	splice_region_variant	11143	exon2			TCTCAAGGTAAAA	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.163+1G>A	chr17.hg19:g.47869395G>A		25.0	0.0	.		36.0	11.0	.	NM_001199158	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	hg19	CCDS11554.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.224482|5.224482	0.95139|0.95139	.|.	.|.	ENSG00000136504|ENSG00000136504	ENST00000259021;ENST00000509773;ENST00000424009|ENST00000454930;ENST00000510819	.|.	.|.	.|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.153798|.	0.56097|.	D|.	0.000026|.	T|T	0.76385|0.76385	0.3980|0.3980	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D;B;D|D;D	0.60575|0.89917	0.98;0.281;0.988|1.0;1.0	D;B;D|D;D	0.73708|0.97110	0.956;0.083;0.981|1.0;1.0	T|T	0.77747|0.77747	-0.2472|-0.2472	9|8	0.09843|0.87932	T|D	0.71|0	-15.7574|-15.7574	19.1747|19.1747	0.93599|0.93599	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	55;55;55|55;55	B4DFB4;O95251;G5E9K7|B4DFE0;E7ER15	.;KAT7_HUMAN;.|.;.	N|R	55|55	.|.	ENSP00000259021:D55N|ENSP00000413415:G55R	D|G	+|+	1|1	0|0	KAT7|KAT7	45224394|45224394	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	9.448000|9.448000	0.97600|0.97600	2.623000|2.623000	0.88846|0.88846	0.650000|0.650000	0.86243|0.86243	GAT|GGA	.	.	.	none		0.493	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	Missense_Mutation
CELF5	60680	hgsc.bcm.edu	37	19	3285978	3285978	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:3285978A>T	ENST00000292672.2	+	10	1178	c.1141A>T	c.(1141-1143)Agc>Tgc	p.S381C	CELF5_ENST00000588101.1_3'UTR|CELF5_ENST00000541430.2_Missense_Mutation_p.S356C	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	381					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						CATCGCGCACAGCGTCCCCCA	0.756																																					p.S381C		Atlas-SNP	.											.	CELF5	32	.	0			c.A1141T						PASS	.						12.0	12.0	12.0					19																	3285978		2081	4145	6226	SO:0001583	missense	60680	exon10			GCGCACAGCGTCC	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.1141A>T	chr19.hg19:g.3285978A>T	ENSP00000292672:p.Ser381Cys	4.0	0.0	.		67.0	37.0	.	NM_021938	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	hg19	CCDS12106.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.488587	0.84854	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.51071	0.72;1.66;1.56	4.15	4.15	0.48705	.	0.325407	0.28841	N	0.013971	T	0.53867	0.1823	L	0.36672	1.1	0.37559	D	0.919007	D;D;P	0.76494	0.985;0.999;0.944	P;D;P	0.63192	0.731;0.912;0.662	T	0.61451	-0.7060	10	0.62326	D	0.03	-4.5717	11.4083	0.49911	1.0:0.0:0.0:0.0	.	267;356;381	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	C	381;356;267	ENSP00000292672:S381C;ENSP00000443498:S356C;ENSP00000335182:S267C	ENSP00000292672:S381C	S	+	1	0	CELF5	3236978	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.948000	0.49066	1.666000	0.50821	0.402000	0.26972	AGC	.	.	.	none		0.756	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
ATP13A1	57130	hgsc.bcm.edu	37	19	19758062	19758062	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:19758062T>C	ENST00000357324.6	-	22	3007	c.2981A>G	c.(2980-2982)aAt>aGt	p.N994S	ATP13A1_ENST00000291503.5_Missense_Mutation_p.N876S	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	994						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GATGAGGGCATTGAGCGCCAG	0.632																																					p.N994S	Esophageal Squamous(142;920 1789 9047 14684 24777)	Atlas-SNP	.											.	ATP13A1	82	.	0			c.A2981G						PASS	.						108.0	109.0	109.0					19																	19758062		2203	4300	6503	SO:0001583	missense	57130	exon22			AGGGCATTGAGCG	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2981A>G	chr19.hg19:g.19758062T>C	ENSP00000349877:p.Asn994Ser	63.0	0.0	.		99.0	19.0	.	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	hg19	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	T	22.3	4.274546	0.80580	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.88354	-2.37;-2.37	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.91784	0.7401	M	0.75264	2.295	0.80722	D	1	D;D	0.59357	0.974;0.985	P;P	0.61592	0.78;0.891	D	0.89608	0.3839	10	0.11794	T	0.64	-19.537	12.2865	0.54795	0.0:0.0:0.0:1.0	.	994;876	Q9HD20;Q9HD20-2	AT131_HUMAN;.	S	876;994	ENSP00000291503:N876S;ENSP00000349877:N994S	ENSP00000291503:N876S	N	-	2	0	ATP13A1	19619062	1.000000	0.71417	0.855000	0.33649	0.995000	0.86356	7.576000	0.82467	1.789000	0.52484	0.529000	0.55759	AAT	.	.	.	none		0.632	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
GRAMD1A	57655	hgsc.bcm.edu	37	19	35506763	35506763	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:35506763C>T	ENST00000317991.5	+	11	1297	c.1105C>T	c.(1105-1107)Cgc>Tgc	p.R369C	GRAMD1A_ENST00000411896.2_Missense_Mutation_p.R362C|GRAMD1A_ENST00000599564.1_Missense_Mutation_p.R456C|GRAMD1A_ENST00000504615.2_Missense_Mutation_p.R135C|CTD-2527I21.14_ENST00000605640.1_RNA	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	369						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CCTCTCCGGCCGCCTCCTCAT	0.642																																					p.R369C		Atlas-SNP	.											.	GRAMD1A	39	.	0			c.C1105T						PASS	.						39.0	44.0	42.0					19																	35506763		2115	4223	6338	SO:0001583	missense	57655	exon11			TCCGGCCGCCTCC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.1105C>T	chr19.hg19:g.35506763C>T	ENSP00000441032:p.Arg369Cys	93.0	0.0	.		106.0	43.0	.	NM_020895	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	hg19	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127959	0.77549	.	.	ENSG00000089351	ENST00000453966;ENST00000504615;ENST00000317991;ENST00000411896	T;T;T	0.60548	0.18;1.34;1.3	5.01	5.01	0.66863	.	0.067735	0.64402	D	0.000013	T	0.75398	0.3844	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.96;0.994;0.917;0.975	T	0.78443	-0.2202	10	0.87932	D	0	.	10.8825	0.46946	0.1875:0.8125:0.0:0.0	.	369;369;135;362	Q96CP6-3;Q96CP6;B3KQF7;Q96CP6-2	.;GRM1A_HUMAN;.;.	C	455;135;369;362	ENSP00000423728:R135C;ENSP00000441032:R369C;ENSP00000439267:R362C	ENSP00000441032:R369C	R	+	1	0	GRAMD1A	40198603	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.193000	0.50997	2.615000	0.88500	0.555000	0.69702	CGC	.	.	.	none		0.642	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
RSPH6A	81492	hgsc.bcm.edu	37	19	46305454	46305454	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:46305454C>G	ENST00000221538.3	-	4	1864	c.1722G>C	c.(1720-1722)gaG>gaC	p.E574D	RSPH6A_ENST00000597055.1_Missense_Mutation_p.E574D|RSPH6A_ENST00000600188.1_Missense_Mutation_p.E310D	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	574	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						catctgccttctcttcctcct	0.622																																					p.E574D		Atlas-SNP	.											.	RSPH6A	70	.	0			c.G1722C						PASS	.						111.0	73.0	86.0					19																	46305454		2203	4300	6503	SO:0001583	missense	81492	exon4			TGCCTTCTCTTCC	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1722G>C	chr19.hg19:g.46305454C>G	ENSP00000221538:p.Glu574Asp	107.0	0.0	.		139.0	50.0	.	NM_030785	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	hg19	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.748680	0.30955	.	.	ENSG00000104941	ENST00000221538	T	0.19806	2.12	4.27	2.08	0.27032	.	0.108659	0.64402	D	0.000011	T	0.15912	0.0383	L	0.48986	1.54	0.27895	N	0.939171	P	0.41978	0.767	B	0.38985	0.287	T	0.08827	-1.0703	10	0.26408	T	0.33	-9.2878	6.3085	0.21151	0.0:0.764:0.0:0.236	.	574	Q9H0K4	RSH6A_HUMAN	D	574	ENSP00000221538:E574D	ENSP00000221538:E574D	E	-	3	2	RSPH6A	50997294	0.980000	0.34600	1.000000	0.80357	0.407000	0.30961	0.054000	0.14205	0.710000	0.31997	-0.390000	0.06520	GAG	.	.	.	none		0.622	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
GLTSCR1	29998	hgsc.bcm.edu	37	19	48183987	48183987	+	Silent	SNP	G	G	T	rs377326337		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr19:48183987G>T	ENST00000396720.3	+	6	1754	c.1560G>T	c.(1558-1560)ctG>ctT	p.L520L	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	520										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		ACCAGAACCTGGCGGGCCCAC	0.726																																					p.L520L		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.G1560T						PASS	.						26.0	32.0	30.0					19																	48183987		1884	4062	5946	SO:0001819	synonymous_variant	29998	exon6			GAACCTGGCGGGC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.1560G>T	chr19.hg19:g.48183987G>T		25.0	0.0	.		108.0	42.0	.	NM_015711	A8MW01	Silent	SNP	ENST00000396720.3	hg19	CCDS46134.1																																																																																			.	.	.	alt		0.726	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
ZBTB46	140685	hgsc.bcm.edu	37	20	62378613	62378613	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr20:62378613G>T	ENST00000245663.4	-	5	1590	c.1440C>A	c.(1438-1440)agC>agA	p.S480R	ZBTB46_ENST00000302995.2_Missense_Mutation_p.S480R|ZBTB46_ENST00000395104.1_Missense_Mutation_p.S480R|RP4-583P15.10_ENST00000447343.2_RNA|RP4-583P15.10_ENST00000433905.2_RNA	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	480					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					TGAAGACGCGGCTGCACACCT	0.701																																					p.S480R		Atlas-SNP	.											.	ZBTB46	72	.	0			c.C1440A						PASS	.						9.0	7.0	8.0					20																	62378613		2124	4163	6287	SO:0001583	missense	140685	exon5			GACGCGGCTGCAC	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.1440C>A	chr20.hg19:g.62378613G>T	ENSP00000245663:p.Ser480Arg	64.0	0.0	.		138.0	52.0	.	NM_025224	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	ENST00000245663.4	hg19	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.585999	0.46110	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.15487	2.42;2.42;2.42	4.29	3.16	0.36331	Zinc finger, C2H2-like (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.174840	0.48767	D	0.000179	T	0.11793	0.0287	L	0.28504	0.86	0.46336	D	0.998998	P	0.38048	0.616	B	0.35278	0.199	T	0.09509	-1.0671	10	0.39692	T	0.17	.	10.1961	0.43056	0.1118:0.0:0.8882:0.0	.	480	Q86UZ6	ZBT46_HUMAN	R	480	ENSP00000245663:S480R;ENSP00000303102:S480R;ENSP00000378536:S480R	ENSP00000245663:S480R	S	-	3	2	ZBTB46	61849057	1.000000	0.71417	0.991000	0.47740	0.822000	0.46500	2.148000	0.42235	0.504000	0.28082	0.462000	0.41574	AGC	.	.	.	none		0.701	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
RRP7A	27341	hgsc.bcm.edu	37	22	42912080	42912080	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr22:42912080C>A	ENST00000323013.6	-	3	294	c.279G>T	c.(277-279)aaG>aaT	p.K93N		NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)	93							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						CCAGGTCCGGCTTCTCCTGCA	0.617																																					p.K93N		Atlas-SNP	.											.	RRP7A	25	.	0			c.G279T						PASS	.						57.0	51.0	53.0					22																	42912080		2203	4300	6503	SO:0001583	missense	27341	exon3			GTCCGGCTTCTCC	BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891	ENST00000323013.6:c.279G>T	chr22.hg19:g.42912080C>A	ENSP00000321449:p.Lys93Asn	119.0	0.0	.		121.0	50.0	.	NM_015703	A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	Missense_Mutation	SNP	ENST00000323013.6	hg19	CCDS14036.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.907011	0.33628	.	.	ENSG00000189306	ENST00000323013	T	0.15952	2.38	3.93	2.9	0.33743	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.106611	0.64402	D	0.000007	T	0.30103	0.0754	M	0.72576	2.205	0.51012	D	0.999906	D	0.56035	0.974	P	0.55577	0.779	T	0.03818	-1.1001	10	0.72032	D	0.01	-34.7209	8.4778	0.33023	0.0:0.7373:0.0:0.2627	.	93	Q9Y3A4	RRP7A_HUMAN	N	93	ENSP00000321449:K93N	ENSP00000321449:K93N	K	-	3	2	RRP7A	41242024	1.000000	0.71417	0.993000	0.49108	0.007000	0.05969	0.731000	0.26058	0.946000	0.37632	-0.346000	0.07831	AAG	.	.	.	none		0.617	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320451.1	NM_015703	
ITPKB	3707	hgsc.bcm.edu	37	1	226924770	226924784	+	In_Frame_Del	DEL	CTTCCTCTTGGCCTC	CTTCCTCTTGGCCTC	-	rs140396711|rs144653273|rs531138740|rs563769960	byFrequency	TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	CTTCCTCTTGGCCTC	CTTCCTCTTGGCCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:226924770_226924784delCTTCCTCTTGGCCTC	ENST00000272117.3	-	1	375_389	c.376_390delGAGGCCAAGAGGAAG	c.(376-390)gaggccaagaggaagdel	p.EAKRK126del	ITPKB_ENST00000429204.1_In_Frame_Del_p.EAKRK126del|ITPKB_ENST00000366784.1_In_Frame_Del_p.EAKRK126del			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	126					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.A127A(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGATCCGCAGCTTCCTCTTGGCCTCCTCCGGCCCT	0.656																																					p.126_131del	Colon(84;110 1851 5306 33547)	Atlas-Indel,Pindel	.											.	ITPKB	158	.	1	Substitution - coding silent(1)	large_intestine(1)	c.377_391del						PASS	.																																			SO:0001651	inframe_deletion	3707	exon2			.	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.376_390delGAGGCCAAGAGGAAG	chr1.hg19:g.226924770_226924784delCTTCCTCTTGGCCTC	ENSP00000272117:p.Glu126_Lys130del	58.0	0.0	0		78.0	17.0	0.217949	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Del	DEL	ENST00000272117.3	hg19	CCDS1555.1																																																																																			.	.	.	none		0.656	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
TLR5	7100	hgsc.bcm.edu	37	1	223285316	223285316	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:223285316delC	ENST00000540964.1	-	4	1519	c.1058delG	c.(1057-1059)agtfs	p.S354fs	TLR5_ENST00000342210.6_Frame_Shift_Del_p.S354fs			O60602	TLR5_HUMAN	toll-like receptor 5	354					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		GAAATTCGAACTGTAAAGTTC	0.353																																					p.S353fs		Atlas-Indel,Pindel	.											.	TLR5	86	.	0			c.1059delT						PASS	.						93.0	93.0	93.0					1																	223285316		2203	4300	6503	SO:0001589	frameshift_variant	7100	exon6			.		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.1058delG	chr1.hg19:g.223285316delC	ENSP00000440643:p.Ser354fs	46.0	0.0	0		57.0	25.0	0.438596	NM_003268	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Frame_Shift_Del	DEL	ENST00000540964.1	hg19	CCDS31033.1																																																																																			.	.	.	none		0.353	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268	
MICAL3	57553	hgsc.bcm.edu	37	22	18300505	18300505	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr22:18300505delT	ENST00000441493.2	-	26	5274	c.4922delA	c.(4921-4923)cagfs	p.Q1641fs	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1641					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTCCTTGCCCTGGGAGGGTGC	0.711																																					p.Q1641fs		Atlas-INDEL	.											.	MICAL3	53	.	0			c.4923delG						PASS	.						13.0	18.0	16.0					22																	18300505		1932	4104	6036	SO:0001589	frameshift_variant	57553	exon26			.	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.4922delA	chr22.hg19:g.18300505delT	ENSP00000416015:p.Gln1641fs	4.0	0.0	0		29.0	12.0	0.413793	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Frame_Shift_Del	DEL	ENST00000441493.2	hg19	CCDS46659.1																																																																																			.	.	.	none		0.711	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
YOD1	55432	hgsc.bcm.edu	37	1	207222409	207222409	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:207222409delC	ENST00000315927.4	-	2	1049	c.1003delG	c.(1003-1005)gaafs	p.E335fs	YOD1_ENST00000391927.1_Frame_Shift_Del_p.E291fs|PFKFB2_ENST00000411990.2_5'Flank|YOD1_ENST00000367084.1_Frame_Shift_Del_p.E291fs	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	335					cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					TTGGCATGTTCCCTTGCTTCT	0.478																																					p.E335fs		Atlas-Indel,Pindel	.											.	YOD1	24	.	0			c.1004delA						PASS	.						271.0	251.0	257.0					1																	207222409		2203	4300	6503	SO:0001589	frameshift_variant	55432	exon2			.		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.1003delG	chr1.hg19:g.207222409delC	ENSP00000326813:p.Glu335fs	141.0	0.0	0		131.0	40.0	0.305344	NM_018566	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Frame_Shift_Del	DEL	ENST00000315927.4	hg19	CCDS31002.1																																																																																			.	.	.	none		0.478	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087837.1	NM_018566	
GAREM	64762	hgsc.bcm.edu	37	18	29867165	29867165	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr18:29867165delA	ENST00000269209.6	-	4	1398	c.1395delT	c.(1393-1395)catfs	p.H465fs	GAREM_ENST00000399218.4_Frame_Shift_Del_p.H465fs|GAREM_ENST00000578619.1_5'Flank|RP11-344B2.2_ENST00000579580.1_RNA			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	465					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										TGAGAGGCTGATGGCTGGGCT	0.527																																					p.Q466fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1396delC						PASS	.						104.0	102.0	103.0					18																	29867165		2203	4300	6503	SO:0001589	frameshift_variant	64762	exon4			.	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1395delT	chr18.hg19:g.29867165delA	ENSP00000269209:p.His465fs	93.0	0.0	0		66.0	27.0	0.409091	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Frame_Shift_Del	DEL	ENST00000269209.6	hg19	CCDS56057.1																																																																																			.	.	.	none		0.527	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
UMOD	7369	hgsc.bcm.edu	37	16	20355497	20355497	+	Intron	DEL	G	G	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr16:20355497delG	ENST00000570689.1	-	6	1329				UMOD_ENST00000424589.1_Intron|UMOD_ENST00000396134.2_Intron|UMOD_ENST00000570331.1_5'Flank|UMOD_ENST00000396142.2_Intron|UMOD_ENST00000302509.4_Intron|UMOD_ENST00000396138.4_Intron			P07911	UROM_HUMAN	uromodulin						cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)			endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TCATTCCTCTGTTGCAGGGAA	0.502																																					.		Atlas-Indel,Pindel	.											.	UMOD	128	.	0			c.1183-2C>-						PASS	.						102.0	90.0	94.0					16																	20355497		2203	4300	6503	SO:0001627	intron_variant	7369	exon7			.	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1183-3C>-	chr16.hg19:g.20355497delG		109.0	0.0	0		169.0	99.0	0.585799	NM_003361	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Splice_Site	DEL	ENST00000570689.1	hg19	CCDS10583.1																																																																																			.	.	.	none		0.502	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1		
CUL3	8452	hgsc.bcm.edu	37	2	225449678	225449678	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:225449678delG	ENST00000264414.4	-	1	387	c.49delC	c.(49-51)cggfs	p.R17fs	CUL3_ENST00000344951.4_Frame_Shift_Del_p.R17fs	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	17					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCCCGGATCCGCATCTTGGTG	0.736																																					p.R17fs		Atlas-INDEL	.											.	CUL3	96	.	0			c.50delG						PASS	.						37.0	35.0	35.0					2																	225449678		2200	4300	6500	SO:0001589	frameshift_variant	8452	exon1			.	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.49delC	chr2.hg19:g.225449678delG	ENSP00000264414:p.Arg17fs	76.0	0.0	0		126.0	89.0	0.706349	NM_001257197	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Frame_Shift_Del	DEL	ENST00000264414.4	hg19	CCDS2462.1																																																																																			.	.	.	none		0.736	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
RFX6	222546	hgsc.bcm.edu	37	6	117203548	117203548	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr6:117203548delC	ENST00000332958.2	+	4	539	c.523delC	c.(523-525)cccfs	p.P175fs		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	175					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CCAGAAGTTTCCCCTCCTAAC	0.413																																					p.F174fs		Atlas-Indel,Pindel	.											.	RFX6	141	.	0			c.522delT						PASS	.						105.0	92.0	96.0					6																	117203548		2203	4300	6503	SO:0001589	frameshift_variant	222546	exon4			.	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.523delC	chr6.hg19:g.117203548delC	ENSP00000332208:p.Pro175fs	54.0	0.0	0		77.0	35.0	0.454545	NM_173560	Q5T6B3	Frame_Shift_Del	DEL	ENST00000332958.2	hg19	CCDS5113.1																																																																																			.	.	.	none		0.413	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
NEFH	4744	hgsc.bcm.edu	37	22	29885589	29885590	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT	rs200984527|rs267607533		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr22:29885589_29885590insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1993_1994	c.1960_1961insCCCCTGAGAAGGCCAAGT	c.(1960-1962)tcc>tCCCCTGAGAAGGCCAAGTcc	p.654_654S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	660	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGGCCAAGTCCCCAGAGAAG	0.559																																					p.S654delinsSPEKAKS		Atlas-INDEL	.											.,4	NEFH	178	.	0			c.1960_1961insCCCCTGAGAAGGCCAAGT						PASS	.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	chr22.hg19:g.29885589_29885590insCCCCTGAGAAGGCCAAGT	ENSP00000311997:p.ProGluLysAlaLysSer654dup	158.0	0.0	0		201.0	77.0	0.383085	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.	.	none		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MYH15	22989	hgsc.bcm.edu	37	3	108174686	108174687	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr3:108174686_108174687insT	ENST00000273353.3	-	21	2274_2275	c.2218_2219insA	c.(2218-2220)aggfs	p.R740fs	MYH15_ENST00000495753.2_5'UTR	NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	740	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TGGAAAGGTCCTTGGATTCAGA	0.361																																					p.R740fs		Atlas-Indel,Pindel	.											.	MYH15	223	.	0			c.2219_2220insA						PASS	.																																			SO:0001589	frameshift_variant	22989	exon21			.	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.2219dupA	chr3.hg19:g.108174688_108174688dupT	ENSP00000273353:p.Arg740fs	38.0	0.0	0		55.0	15.0	0.272727	NM_014981		Frame_Shift_Ins	INS	ENST00000273353.3	hg19	CCDS43127.1																																																																																			.	.	.	none		0.361	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
CEP83	51134	hgsc.bcm.edu	37	12	94763803	94763804	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr12:94763803_94763804insT	ENST00000397809.5	-	9	1491_1492	c.942_943insA	c.(940-945)gaacttfs	p.L315fs	CCDC41_ENST00000547575.1_Frame_Shift_Ins_p.L315fs|CCDC41_ENST00000397807.2_Frame_Shift_Ins_p.L282fs|CCDC41_ENST00000339839.5_Frame_Shift_Ins_p.L315fs|CCDC41_ENST00000549352.1_5'UTR	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		307					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						GAATGTTTAAGTTCTTTTACCT	0.332																																					p.L315fs		Atlas-Indel,Pindel	.											.	CCDC41	59	.	0			c.943_944insA						PASS	.																																			SO:0001589	frameshift_variant	51134	exon8			.																												ENST00000397809.5:c.943dupA	chr12.hg19:g.94763805_94763805dupT	ENSP00000380911:p.Leu315fs	62.0	0.0	0		58.0	21.0	0.362069	NM_001042399	A4FVB1|Q08AP1	Frame_Shift_Ins	INS	ENST00000397809.5	hg19	CCDS41820.1																																																																																			.	.	.	none		0.332	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408147.3		
CUL3	8452	hgsc.bcm.edu	37	2	225449678	225449679	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr2:225449678_225449679delGC	ENST00000264414.4	-	1	386_387	c.48_49delGC	c.(46-51)atgcggfs	p.R17fs	CUL3_ENST00000344951.4_Frame_Shift_Del_p.R17fs	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	17					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCCCGGATCCGCATCTTGGTGT	0.733																																					p.17_17del		Pindel	.											.	CUL3	96	.	0			c.49_50del						PASS	.																																			SO:0001589	frameshift_variant	8452	exon1			.	U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.48_49delGC	chr2.hg19:g.225449678_225449679delGC	ENSP00000264414:p.Arg17fs	79.0	0.0	.		129.0	50.0	0.388	NM_001257197	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Frame_Shift_Del	DEL	ENST00000264414.4	hg19	CCDS2462.1																																																																																			.	.	.	none		0.733	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256871.2		
CCDC18	343099	hgsc.bcm.edu	37	1	93705010	93705043	+	Splice_Site	DEL	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	-	rs550574161		TCGA-P4-A5E6-01A-11D-A28G-10	TCGA-P4-A5E6-11A-22D-A28G-10	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c543688-1b5c-4af6-806b-9c9e444a740f	5b0f01b3-0aee-4950-87e0-0a6c395d73a4	g.chr1:93705010_93705043delTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	ENST00000343253.7	+	20	3246_3266	c.2744_2764delTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT	c.(2743-2766)ctagaaaagaaaacaaatgctggt>cgt	p.LEKKTNAG915fs	CCDC18_ENST00000421014.2_3'UTR|CCDC18_ENST00000557479.1_Splice_Site_p.LEKKTNAG1034fs|CCDC18_ENST00000334652.5_Splice_Site_p.LEKKTNAG211fs|CCDC18_ENST00000401026.3_Splice_Site_p.LEKKTNAG916fs|CCDC18_ENST00000338949.4_Splice_Site_p.LEKKTNAG671fs			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	915										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AAGACAGAGCTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGTTAGATGAGTA	0.363																																					p.916_923del		Pindel	.											.	CCDC18	93	.	0			c.2746_2767del						PASS	.																																			SO:0001630	splice_region_variant	343099	exon20			.			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2764+1TAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT>-	chr1.hg19:g.93705010_93705043delTAGAAAAGAAAACAAATGCTGGTAAGCAAGTGGT		168.0	0.0	.		130.0	14.0	0.108	NM_206886	Q6ZU17	Frame_Shift_Del	DEL	ENST00000343253.7	hg19																																																																																				.	.	.	none		0.363	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886	Frame_Shift_Del
