#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HMGCL	3155	hgsc.bcm.edu	37	1	24151846	24151846	+	Splice_Site	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:24151846A>G	ENST00000374490.3	-	1	103	c.60T>C	c.(58-60)gcT>gcC	p.A20A	HMGCL_ENST00000374483.4_Intron|HMGCL_ENST00000509389.1_5'UTR|HMGCL_ENST00000436439.2_Splice_Site_p.A20A	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	20					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		GGGCACTTACAGCCCGGAGGG	0.706																																					p.A20A		Atlas-SNP	.											.	HMGCL	22	.	0			c.T60C						PASS	.						10.0	11.0	10.0					1																	24151846		2085	4077	6162	SO:0001630	splice_region_variant	3155	exon1			ACTTACAGCCCGG	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.60+1T>C	chr1.hg19:g.24151846A>G		8.0	0.0	.		87.0	27.0	.	NM_000191	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Silent	SNP	ENST00000374490.3	hg19	CCDS243.1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.232145	0.58777	.	.	ENSG00000117305	ENST00000235958	.	.	.	5.66	2.13	0.27403	.	.	.	.	.	T	0.54549	0.1865	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45483	-0.9258	4	.	.	.	-1.3076	6.689	0.23161	0.7318:0.0:0.2682:0.0	.	.	.	.	P	16	.	.	L	-	2	0	HMGCL	24024433	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	0.764000	0.26532	0.516000	0.28340	0.533000	0.62120	CTG	.	.	.	none		0.706	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	Silent
SYNC	81493	hgsc.bcm.edu	37	1	33161106	33161106	+	Missense_Mutation	SNP	T	T	G	rs554437078		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:33161106T>G	ENST00000409190.3	-	2	1051	c.593A>C	c.(592-594)cAt>cCt	p.H198P	SYNC_ENST00000373484.3_Missense_Mutation_p.H198P	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	198	Coil 1A.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						TACAAGCTCATGGATGAGCTG	0.567																																					p.H198P		Atlas-SNP	.											.	SYNC	36	.	0			c.A593C						PASS	.						89.0	78.0	82.0					1																	33161106		692	1591	2283	SO:0001583	missense	81493	exon2			AGCTCATGGATGA	AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.593A>C	chr1.hg19:g.33161106T>G	ENSP00000386439:p.His198Pro	131.0	0.0	.		88.0	24.0	.	NM_001161708	B4DNK8|B4DY58|C9IY41	Missense_Mutation	SNP	ENST00000409190.3	hg19	CCDS367.2	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123508	0.56613	.	.	ENSG00000162520	ENST00000373484;ENST00000409190	T;T	0.24350	1.86;1.86	4.57	4.57	0.56435	Filament (1);	.	.	.	.	T	0.27559	0.0677	N	0.14661	0.345	0.31839	N	0.623691	D;D	0.76494	0.998;0.999	P;D	0.75020	0.905;0.985	T	0.17471	-1.0368	9	0.31617	T	0.26	-9.3582	5.8491	0.18683	0.0:0.0877:0.1689:0.7435	.	198;198	Q9H7C4-2;Q9H7C4	.;SYNCI_HUMAN	P	198	ENSP00000362583:H198P;ENSP00000386439:H198P	ENSP00000362583:H198P	H	-	2	0	SYNC	32933693	0.988000	0.35896	0.997000	0.53966	0.958000	0.62258	1.916000	0.39986	1.853000	0.53794	0.459000	0.35465	CAT	.	.	.	none		0.567	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022129.3	NM_030786	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37949045	37949045	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:37949045A>T	ENST00000373087.6	+	6	1749	c.1633A>T	c.(1633-1635)Agg>Tgg	p.R545W		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCGTGGGGCAGGGCAGGCAG	0.647																																					p.R545W		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.A1633T						PASS	.						48.0	58.0	55.0					1																	37949045		2203	4300	6503	SO:0001583	missense	80149	exon6			TGGGGCAGGGCAG		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1633A>T	chr1.hg19:g.37949045A>T	ENSP00000362179:p.Arg545Trp	135.0	0.0	.		196.0	53.0	.	NM_025079		Missense_Mutation	SNP	ENST00000373087.6	hg19	CCDS417.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.033050	0.35893	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.45668	0.89	5.15	2.9	0.33743	.	0.653715	0.14763	N	0.299862	T	0.37544	0.1007	N	0.22421	0.69	0.09310	N	0.999998	D;P	0.59767	0.986;0.923	P;B	0.52554	0.702;0.221	T	0.14868	-1.0457	10	0.66056	D	0.02	-9.4135	7.823	0.29298	0.2651:0.0:0.7349:0.0	.	340;545	B3KSD3;Q5D1E8	.;ZC12A_HUMAN	W	545	ENSP00000362179:R545W	ENSP00000362174:R545W	R	+	1	2	ZC3H12A	37721632	0.000000	0.05858	0.097000	0.21041	0.675000	0.39556	0.003000	0.13083	0.284000	0.22305	0.459000	0.35465	AGG	.	.	.	none		0.647	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
KTI12	112970	hgsc.bcm.edu	37	1	52499078	52499078	+	Missense_Mutation	SNP	A	A	G	rs563103084|rs377187997	byFrequency	TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:52499078A>G	ENST00000371614.1	-	1	410	c.356T>C	c.(355-357)gTg>gCg	p.V119A	RP11-91A18.4_ENST00000425802.1_RNA|TXNDC12_ENST00000371626.4_Intron	NM_138417.2	NP_612426.1	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated (S. cerevisiae)	119							ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)|urinary_tract(1)	12						CGCGCCCGCCACCTGAGGTCC	0.721																																					p.V119A		Atlas-SNP	.											.	KTI12	30	.	0			c.T356C						PASS	.						28.0	34.0	32.0					1																	52499078		2194	4277	6471	SO:0001583	missense	112970	exon1			CCCGCCACCTGAG		CCDS562.1	1p32.3	2008-02-05			ENSG00000198841	ENSG00000198841			25160	protein-coding gene	gene with protein product						11929532	Standard	NM_138417		Approved	TOT4, MGC20419, SBBI81	uc001ctj.1	Q96EK9	OTTHUMG00000008630	ENST00000371614.1:c.356T>C	chr1.hg19:g.52499078A>G	ENSP00000360676:p.Val119Ala	1.0	0.0	.		43.0	13.0	.	NM_138417		Missense_Mutation	SNP	ENST00000371614.1	hg19	CCDS562.1	.	.	.	.	.	.	.	.	.	.	A	9.740	1.164503	0.21538	.	.	ENSG00000198841	ENST00000371614	T	0.39997	1.05	4.93	-9.87	0.00470	.	.	.	.	.	T	0.11750	0.0286	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15150	-1.0447	9	0.05959	T	0.93	.	2.3401	0.04257	0.1327:0.1704:0.3566:0.3403	.	119	Q96EK9	KTI12_HUMAN	A	119	ENSP00000360676:V119A	ENSP00000360676:V119A	V	-	2	0	KTI12	52271666	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-2.926000	0.00691	-2.213000	0.00735	-0.256000	0.11100	GTG	.	.	.	none		0.721	KTI12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023821.1	NM_138417	
DHCR24	1718	hgsc.bcm.edu	37	1	55317995	55317995	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:55317995A>C	ENST00000371269.3	-	9	1560	c.1462T>G	c.(1462-1464)Tcc>Gcc	p.S488A	DHCR24_ENST00000537443.1_Missense_Mutation_p.S272A|DHCR24_ENST00000535035.1_Missense_Mutation_p.S447A	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase	488					amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						TGGTACAAGGAGCCATCAAAC	0.597																																					p.S488A	Pancreas(39;516 1021 24601 30715 32780)	Atlas-SNP	.											.	DHCR24	31	.	0			c.T1462G						PASS	.						141.0	123.0	130.0					1																	55317995		2203	4300	6503	SO:0001583	missense	1718	exon9			ACAAGGAGCCATC	AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.1462T>G	chr1.hg19:g.55317995A>C	ENSP00000360316:p.Ser488Ala	94.0	0.0	.		90.0	4.0	.	NM_014762	B7Z817|D3DQ51|Q9HBA8	Missense_Mutation	SNP	ENST00000371269.3	hg19	CCDS600.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.52|13.52	2.262766|2.262766	0.39995|0.39995	.|.	.|.	ENSG00000116133|ENSG00000116133	ENST00000436604|ENST00000539536;ENST00000371269;ENST00000537443;ENST00000535035	.|T;T;T	.|0.69306	.|-0.39;-0.39;-0.39	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.277164	.|0.40064	.|N	.|0.001199	T|T	0.47451|0.47451	0.1446|0.1446	N|N	0.16478|0.16478	0.41|0.41	0.36209|0.36209	D|D	0.851231|0.851231	.|B;B;B	.|0.16166	.|0.016;0.007;0.016	.|B;B;B	.|0.14023	.|0.01;0.004;0.007	T|T	0.51236|0.51236	-0.8731|-0.8731	5|10	.|0.14252	.|T	.|0.57	-42.9406|-42.9406	11.5029|11.5029	0.50448|0.50448	0.8501:0.1499:0.0:0.0|0.8501:0.1499:0.0:0.0	.|.	.|447;447;488	.|B7Z817;B7ZAV4;Q15392	.|.;.;DHC24_HUMAN	R|A	125|214;488;272;447	.|ENSP00000360316:S488A;ENSP00000439852:S272A;ENSP00000440191:S447A	.|ENSP00000360316:S488A	L|S	-|-	2|1	0|0	DHCR24|DHCR24	55090583|55090583	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.827000|0.827000	0.46813|0.46813	3.617000|3.617000	0.54181|0.54181	2.079000|2.079000	0.62486|0.62486	0.379000|0.379000	0.24179|0.24179	CTC|TCC	.	.	.	none		0.597	DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027680.1	NM_014762	
NRAS	4893	hgsc.bcm.edu	37	1	115256491	115256491	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:115256491T>A	ENST00000369535.4	-	3	473	c.220A>T	c.(220-222)Aca>Tca	p.T74S		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	74					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)			NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTTCGCCTGTCCTCATGTAT	0.418		50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.T74S		Atlas-SNP	.		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	.	NRAS	3766	.	0			c.A220T						PASS	.						186.0	159.0	168.0					1																	115256491		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CGCCTGTCCTCAT	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.220A>T	chr1.hg19:g.115256491T>A	ENSP00000358548:p.Thr74Ser	102.0	0.0	.		74.0	28.0	.	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	hg19	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.602254	0.87055	.	.	ENSG00000213281	ENST00000369535	T	0.76186	-1.0	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000022	T	0.46054	0.1373	N	0.04373	-0.215	0.80722	D	1	B	0.31640	0.333	B	0.37833	0.259	T	0.59209	-0.7497	10	0.51188	T	0.08	.	15.0132	0.71565	0.0:0.0:0.0:1.0	.	74	P01111	RASN_HUMAN	S	74	ENSP00000358548:T74S	ENSP00000358548:T74S	T	-	1	0	NRAS	115058014	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.787000	0.85759	2.120000	0.65058	0.533000	0.62120	ACA	.	.	.	none		0.418	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
DDR2	4921	hgsc.bcm.edu	37	1	162729664	162729664	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:162729664G>A	ENST00000367922.3	+	9	1188	c.750G>A	c.(748-750)gtG>gtA	p.V250V	DDR2_ENST00000367921.3_Silent_p.V250V	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	250					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	AATACCACGTGTGGCCCGGCT	0.532																																					p.V250V	NSCLC(161;314 2006 8283 19651 23192)	Atlas-SNP	.											.	DDR2	228	.	0			c.G750A						PASS	.						119.0	105.0	110.0					1																	162729664		2203	4300	6503	SO:0001819	synonymous_variant	4921	exon9			CCACGTGTGGCCC	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.750G>A	chr1.hg19:g.162729664G>A		198.0	0.0	.		172.0	52.0	.	NM_001014796	Q7Z730	Silent	SNP	ENST00000367922.3	hg19	CCDS1241.1																																																																																			.	.	.	none		0.532	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
FAM98A	25940	hgsc.bcm.edu	37	2	33813426	33813426	+	Silent	SNP	T	T	C	rs561820764		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:33813426T>C	ENST00000238823.8	-	4	638	c.498A>G	c.(496-498)caA>caG	p.Q166Q	FAM98A_ENST00000441530.2_Intron|FAM98A_ENST00000498340.1_Intron|FAM98A_ENST00000403368.1_Silent_p.Q166Q			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	166							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					CGCTGAAGAATTGGAACATAG	0.363																																					p.Q166Q		Atlas-SNP	.											.	FAM98A	42	.	0			c.A498G						PASS	.						173.0	175.0	174.0					2																	33813426		2203	4300	6503	SO:0001819	synonymous_variant	25940	exon4			GAAGAATTGGAAC		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.498A>G	chr2.hg19:g.33813426T>C		79.0	0.0	.		75.0	32.0	.	NM_015475	B2RNA2|Q9Y3Y6	Silent	SNP	ENST00000238823.8	hg19	CCDS33179.1																																																																																			.	.	.	none		0.363	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
TTC31	64427	hgsc.bcm.edu	37	2	74718487	74718487	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:74718487G>A	ENST00000233623.5	+	7	676	c.669G>A	c.(667-669)caG>caA	p.Q223Q	TTC31_ENST00000442235.2_Silent_p.Q79Q|TTC31_ENST00000463189.1_3'UTR|TTC31_ENST00000410003.1_Silent_p.Q223Q	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	223										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						TTCAGGGACAGTGTGGTGAAG	0.537																																					p.Q223Q		Atlas-SNP	.											.	TTC31	23	.	0			c.G669A						PASS	.						127.0	138.0	134.0					2																	74718487		1930	4124	6054	SO:0001819	synonymous_variant	64427	exon7			GGGACAGTGTGGT	AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.669G>A	chr2.hg19:g.74718487G>A		99.0	0.0	.		84.0	22.0	.	NM_022492	Q4KN40|Q53FD4|Q9H9F7	Silent	SNP	ENST00000233623.5	hg19	CCDS42701.1																																																																																			.	.	.	none		0.537	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328422.1	NM_022492	
SUCLG1	8802	hgsc.bcm.edu	37	2	84652539	84652539	+	Splice_Site	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:84652539C>T	ENST00000393868.2	-	8	1224	c.1014G>A	c.(1012-1014)aaG>aaA	p.K338K	SUCLG1_ENST00000491123.1_5'UTR	NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit	338					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	TGGAGCTCACCTTGTAGATCG	0.532																																					p.K338K	Ovarian(48;203 1101 37206 40305 50790)	Atlas-SNP	.											.	SUCLG1	30	.	0			c.G1014A						PASS	.						77.0	69.0	71.0					2																	84652539		2203	4300	6503	SO:0001630	splice_region_variant	8802	exon8			GCTCACCTTGTAG	Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.1014+1G>A	chr2.hg19:g.84652539C>T		98.0	0.0	.		119.0	36.0	.	NM_003849	Q9BWB0|Q9UNP6	Silent	SNP	ENST00000393868.2	hg19	CCDS1967.2																																																																																			.	.	.	none		0.532	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252298.2	NM_003849	Silent
KCNIP3	30818	hgsc.bcm.edu	37	2	95976175	95976175	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:95976175A>G	ENST00000295225.5	+	2	223	c.88A>G	c.(88-90)Atc>Gtc	p.I30V	KCNIP3_ENST00000360990.3_Missense_Mutation_p.I30V|KCNIP3_ENST00000377181.2_Intron	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin	30					apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		GAAGGAGGGTATCAAGTGGCA	0.622																																					p.I30V		Atlas-SNP	.											.	KCNIP3	52	.	0			c.A88G						PASS	.						79.0	86.0	84.0					2																	95976175		2203	4300	6503	SO:0001583	missense	30818	exon2			GAGGGTATCAAGT	AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.88A>G	chr2.hg19:g.95976175A>G	ENSP00000295225:p.Ile30Val	356.0	1.0	.		364.0	110.0	.	NM_013434	H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	Missense_Mutation	SNP	ENST00000295225.5	hg19	CCDS2013.1	.	.	.	.	.	.	.	.	.	.	A	0.862	-0.734899	0.03111	.	.	ENSG00000115041	ENST00000295225;ENST00000360990	T;T	0.69926	-0.27;-0.44	5.02	-2.69	0.06022	.	1.487590	0.04089	N	0.310881	T	0.38983	0.1061	N	0.01874	-0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23547	-1.0185	10	0.20519	T	0.43	.	11.1112	0.48235	0.6262:0.0:0.3738:0.0	.	30;30	Q9Y2W7;Q3YAC4	CSEN_HUMAN;.	V	30	ENSP00000295225:I30V;ENSP00000354261:I30V	ENSP00000295225:I30V	I	+	1	0	KCNIP3	95339902	0.154000	0.22792	0.361000	0.25849	0.847000	0.48162	0.311000	0.19380	-0.418000	0.07450	-0.810000	0.03169	ATC	.	.	.	none		0.622	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252770.1	NM_013434	
KCNIP3	30818	hgsc.bcm.edu	37	2	95976177	95976177	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:95976177C>T	ENST00000295225.5	+	2	225	c.90C>T	c.(88-90)atC>atT	p.I30I	KCNIP3_ENST00000360990.3_Silent_p.I30I|KCNIP3_ENST00000377181.2_Intron	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin	30					apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		AGGAGGGTATCAAGTGGCAGA	0.627																																					p.I30I		Atlas-SNP	.											.	KCNIP3	52	.	0			c.C90T						PASS	.						79.0	86.0	83.0					2																	95976177		2203	4300	6503	SO:0001819	synonymous_variant	30818	exon2			GGGTATCAAGTGG	AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.90C>T	chr2.hg19:g.95976177C>T		352.0	1.0	.		361.0	109.0	.	NM_013434	H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	Silent	SNP	ENST00000295225.5	hg19	CCDS2013.1																																																																																			.	.	.	none		0.627	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252770.1	NM_013434	
SLC5A7	60482	hgsc.bcm.edu	37	2	108604763	108604763	+	Nonsense_Mutation	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:108604763T>A	ENST00000264047.2	+	2	428	c.152T>A	c.(151-153)tTa>tAa	p.L51*	SLC5A7_ENST00000540517.1_Intron|SLC5A7_ENST00000409059.1_Nonsense_Mutation_p.L51*	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	51					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	GATATTGGTTTATTGGTTGGT	0.532																																					p.L51X		Atlas-SNP	.											.	SLC5A7	109	.	0			c.T152A						PASS	.						148.0	131.0	137.0					2																	108604763		2203	4300	6503	SO:0001587	stop_gained	60482	exon2			TTGGTTTATTGGT	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.152T>A	chr2.hg19:g.108604763T>A	ENSP00000264047:p.Leu51*	133.0	0.0	.		142.0	41.0	.	NM_021815	Q53TF2	Nonsense_Mutation	SNP	ENST00000264047.2	hg19	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	T	38	6.986976	0.97983	.	.	ENSG00000115665	ENST00000409059;ENST00000264047	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-15.1779	16.3634	0.83296	0.0:0.0:0.0:1.0	.	.	.	.	X	51	.	ENSP00000264047:L51X	L	+	2	0	SLC5A7	107971195	1.000000	0.71417	0.256000	0.24389	0.386000	0.30323	7.655000	0.83696	2.324000	0.78689	0.533000	0.62120	TTA	.	.	.	none		0.532	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
ZRANB3	84083	hgsc.bcm.edu	37	2	135988115	135988115	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:135988115C>T	ENST00000264159.6	-	13	2038	c.1922G>A	c.(1921-1923)tGt>tAt	p.C641Y	ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000401392.1_Missense_Mutation_p.C641Y|ZRANB3_ENST00000536680.1_Missense_Mutation_p.C641Y	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	641					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		ACACATTTCACAATAAGGTAA	0.473																																					p.C641Y		Atlas-SNP	.											.	ZRANB3	109	.	0			c.G1922A						PASS	.						111.0	103.0	105.0					2																	135988115		1967	4164	6131	SO:0001583	missense	84083	exon13			ATTTCACAATAAG	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1922G>A	chr2.hg19:g.135988115C>T	ENSP00000264159:p.Cys641Tyr	94.0	0.0	.		96.0	5.0	.	NM_032143	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	hg19	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360568	0.61403	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.99797	-6.79;-6.79;-6.79	5.61	5.61	0.85477	Zinc finger, RanBP2-type (4);	0.047816	0.85682	D	0.000000	D	0.99864	0.9936	H	0.96175	3.78	0.49213	D	0.999763	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96707	0.9522	10	0.87932	D	0	-12.7436	17.4074	0.87477	0.0:1.0:0.0:0.0	.	641;641	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	Y	106;106;641;641;641	ENSP00000383979:C641Y;ENSP00000264159:C641Y;ENSP00000441320:C641Y	ENSP00000264159:C641Y	C	-	2	0	ZRANB3	135704585	1.000000	0.71417	0.995000	0.50966	0.454000	0.32378	5.258000	0.65479	2.638000	0.89438	0.563000	0.77884	TGT	.	.	.	none		0.473	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
SSB	6741	hgsc.bcm.edu	37	2	170667495	170667495	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:170667495A>C	ENST00000409333.1	+	10	1185	c.938A>C	c.(937-939)gAa>gCa	p.E313A	METTL5_ENST00000409837.1_Intron|SSB_ENST00000260956.4_Missense_Mutation_p.E313A			P05455	LA_HUMAN	Sjogren syndrome antigen B (autoantigen La)	313					histone mRNA metabolic process (GO:0008334)|tRNA modification (GO:0006400)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(3)|large_intestine(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						GTGGAAAAAGAAGCACTGAAG	0.348																																					p.E313A		Atlas-SNP	.											.	SSB	28	.	0			c.A938C						PASS	.						66.0	68.0	67.0					2																	170667495		2203	4299	6502	SO:0001583	missense	6741	exon10			AAAAAGAAGCACT		CCDS2237.1	2q31.1	2014-02-14		2005-06-16	ENSG00000138385	ENSG00000138385		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	11316	protein-coding gene	gene with protein product	"""La ribonucleoprotein domain family, member 3"""	109090					Standard	NM_003142		Approved	LARP3, La, La/SSB	uc002ufk.3	P05455	OTTHUMG00000132212	ENST00000409333.1:c.938A>C	chr2.hg19:g.170667495A>C	ENSP00000386636:p.Glu313Ala	139.0	0.0	.		133.0	42.0	.	NM_003142	Q15367|Q53XJ4	Missense_Mutation	SNP	ENST00000409333.1	hg19	CCDS2237.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.217202	0.39201	.	.	ENSG00000138385	ENST00000260956;ENST00000409005;ENST00000409333	T;T	0.47528	0.84;0.84	4.86	-0.881	0.10607	Nucleotide-binding, alpha-beta plait (1);RNA-binding motif (1);	0.493908	0.22411	N	0.060419	T	0.49508	0.1561	M	0.85710	2.77	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.12156	0.003;0.007	T	0.50285	-0.8846	10	0.31617	T	0.26	-0.5081	14.1431	0.65331	0.4664:0.5336:0.0:0.0	.	313;313	E9PFH8;P05455	.;LA_HUMAN	A	313	ENSP00000260956:E313A;ENSP00000386636:E313A	ENSP00000260956:E313A	E	+	2	0	SSB	170375741	1.000000	0.71417	0.890000	0.34922	0.989000	0.77384	1.295000	0.33377	-0.310000	0.08766	0.383000	0.25322	GAA	.	.	.	none		0.348	SSB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333316.1	NM_003142	
TNS1	7145	hgsc.bcm.edu	37	2	218678511	218678511	+	Silent	SNP	C	C	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:218678511C>G	ENST00000171887.4	-	26	4898	c.4446G>C	c.(4444-4446)ccG>ccC	p.P1482P	TNS1_ENST00000430930.1_Silent_p.P1461P|TNS1_ENST00000419504.1_Silent_p.P1469P	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1482	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.P1482P(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGAAGGCCCCCGGCTCCTGGT	0.572																																					p.P1482P		Atlas-SNP	.											TNS1,colon,carcinoma,0,1	TNS1	251	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4446C						PASS	.						58.0	58.0	58.0					2																	218678511		2203	4300	6503	SO:0001819	synonymous_variant	7145	exon26			GGCCCCCGGCTCC	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.4446G>C	chr2.hg19:g.218678511C>G		124.0	0.0	.		110.0	34.0	.	NM_022648	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	hg19	CCDS2407.1																																																																																			.	.	.	none		0.572	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
ANKMY1	51281	hgsc.bcm.edu	37	2	241465102	241465102	+	Splice_Site	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr2:241465102C>T	ENST00000272972.3	-	6	1282	c.1068G>A	c.(1066-1068)caG>caA	p.Q356Q	ANKMY1_ENST00000361678.4_Splice_Site_p.Q215Q|ANKMY1_ENST00000401804.1_Splice_Site_p.Q445Q|ANKMY1_ENST00000403283.1_Splice_Site_p.Q294Q|ANKMY1_ENST00000406958.1_Splice_Site_p.Q215Q|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000536462.1_Splice_Site_p.Q168Q|ANKMY1_ENST00000405002.1_Splice_Site_p.Q126Q|ANKMY1_ENST00000373318.2_Splice_Site_p.Q215Q|ANKMY1_ENST00000373320.4_Splice_Site_p.Q126Q|ANKMY1_ENST00000405523.3_Splice_Site_p.Q215Q|ANKMY1_ENST00000391987.1_Splice_Site_p.Q356Q	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	356							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GGGGGCTTACCTGGGGCTCAG	0.587																																					p.Q356Q		Atlas-SNP	.											.	ANKMY1	112	.	0			c.G1068A						PASS	.						78.0	68.0	72.0					2																	241465102		2202	4300	6502	SO:0001630	splice_region_variant	51281	exon6			GCTTACCTGGGGC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1068+1G>A	chr2.hg19:g.241465102C>T		118.0	0.0	.		121.0	45.0	.	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	hg19	CCDS2536.1																																																																																			.	.	.	none		0.587	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	Silent
UBA7	7318	hgsc.bcm.edu	37	3	49842183	49842183	+	IGR	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:49842183A>C	ENST00000333486.3	-	0	3299				MIR5193_ENST00000584510.1_RNA|FAM212A_ENST00000333323.4_Missense_Mutation_p.E209D	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAGGGAGTGAAGGGGGTGACG	0.652																																					p.E209D		Atlas-SNP	.											.	.	.	.	0			c.A627C						PASS	.						78.0	78.0	78.0					3																	49842183		2203	4300	6503	SO:0001628	intergenic_variant	389119	exon2			GAGTGAAGGGGGT	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267		chr3.hg19:g.49842183A>C		93.0	0.0	.		305.0	151.0	.	NM_203370	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	hg19	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673205	0.47781	.	.	ENSG00000185614	ENST00000333323	.	.	.	5.64	-0.363	0.12556	.	0.000000	0.52532	D	0.000077	T	0.61627	0.2362	L	0.44542	1.39	0.39146	D	0.962132	D	0.71674	0.998	D	0.63488	0.915	T	0.62358	-0.6871	9	0.56958	D	0.05	.	10.7234	0.46052	0.5054:0.0:0.4946:0.0	.	207	Q96EL1	CC054_HUMAN	D	209	.	ENSP00000329735:E209D	E	+	3	2	C3orf54	49817187	1.000000	0.71417	0.885000	0.34714	0.348000	0.29142	0.471000	0.22100	-0.003000	0.14444	0.459000	0.35465	GAA	.	.	.	none		0.652	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
GOLGB1	2804	hgsc.bcm.edu	37	3	121415217	121415217	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:121415217G>A	ENST00000340645.5	-	13	4263	c.4138C>T	c.(4138-4140)Caa>Taa	p.Q1380*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.Q1385*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1380					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CCAGCAATTTGTAGTTGGCTG	0.413																																					p.Q1385X		Atlas-SNP	.											.	GOLGB1	319	.	0			c.C4153T						PASS	.						157.0	162.0	160.0					3																	121415217		2203	4299	6502	SO:0001587	stop_gained	2804	exon13			CAATTTGTAGTTG	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.4138C>T	chr3.hg19:g.121415217G>A	ENSP00000341848:p.Gln1380*	40.0	0.0	.		59.0	12.0	.	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	39	7.740962	0.98465	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	.	.	.	6.17	3.41	0.39046	.	0.324362	0.26746	N	0.022716	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.993	0.19478	0.0:0.6622:0.1652:0.1726	.	.	.	.	X	1380;1385;1344	.	ENSP00000341848:Q1380X	Q	-	1	0	GOLGB1	122897907	0.273000	0.24181	0.748000	0.31131	0.666000	0.39218	0.959000	0.29240	0.464000	0.27142	-0.165000	0.13383	CAA	.	.	.	none		0.413	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
ARMC8	25852	hgsc.bcm.edu	37	3	137982982	137982982	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:137982982C>T	ENST00000469044.1	+	14	1498	c.1227C>T	c.(1225-1227)caC>caT	p.H409H	ARMC8_ENST00000491704.1_Silent_p.H367H|ARMC8_ENST00000538260.1_Silent_p.H378H|ARMC8_ENST00000485396.1_Silent_p.H336H|NME9_ENST00000484930.1_Intron|ARMC8_ENST00000481646.1_Silent_p.H395H|ARMC8_ENST00000393058.3_Silent_p.H399H|NME9_ENST00000383180.2_Intron|NME9_ENST00000536478.1_Intron|ARMC8_ENST00000461822.1_Silent_p.H342H|NME9_ENST00000317876.4_Intron|NME9_ENST00000341790.5_Intron	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	409										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GATGTTTGCACAGTTTATCCA	0.368																																					p.H395H		Atlas-SNP	.											.	ARMC8	79	.	0			c.C1185T						PASS	.						100.0	89.0	92.0					3																	137982982		1850	4099	5949	SO:0001819	synonymous_variant	25852	exon15			TTTGCACAGTTTA		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1227C>T	chr3.hg19:g.137982982C>T		55.0	0.0	.		83.0	24.0	.	NM_015396	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Silent	SNP	ENST00000469044.1	hg19																																																																																				.	.	.	none		0.368	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	
RBP1	5947	hgsc.bcm.edu	37	3	139237296	139237296	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:139237296C>A	ENST00000232219.2	-	3	617	c.507G>T	c.(505-507)tgG>tgT	p.W169C	RP11-319G6.1_ENST00000515247.1_RNA	NM_002899.3	NP_002890.2	P09455	RET1_HUMAN	retinol binding protein 1, cellular	107					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	TCCACTGGGTCCAGCCACGCC	0.592																																					p.W169C		Atlas-SNP	.											.	RBP1	39	.	0			c.G507T						PASS	.						120.0	95.0	104.0					3																	139237296		2203	4300	6503	SO:0001583	missense	5947	exon3			CTGGGTCCAGCCA		CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000232219.2:c.507G>T	chr3.hg19:g.139237296C>A	ENSP00000232219:p.Trp169Cys	69.0	0.0	.		86.0	25.0	.	NM_002899	A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	ENST00000232219.2	hg19	CCDS3110.2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491184	0.84962	.	.	ENSG00000114115	ENST00000232219	T	0.23147	1.92	5.93	5.93	0.95920	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.54759	0.1878	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55477	-0.8135	10	0.72032	D	0.01	.	17.8376	0.88704	0.0:1.0:0.0:0.0	.	107	P09455	RET1_HUMAN	C	169	ENSP00000232219:W169C	ENSP00000232219:W169C	W	-	3	0	RBP1	140719986	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.088000	0.76901	2.815000	0.96918	0.561000	0.74099	TGG	.	.	.	none		0.592	RBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341495.1	NM_002899	
EXOC1	55763	hgsc.bcm.edu	37	4	56738102	56738102	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr4:56738102T>C	ENST00000381295.2	+	8	1400	c.1052T>C	c.(1051-1053)cTc>cCc	p.L351P	EXOC1_ENST00000346134.7_Missense_Mutation_p.L351P|EXOC1_ENST00000349598.6_Missense_Mutation_p.L351P	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	351					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					GCCAGTCACCTCAACAATGTT	0.393																																					p.L351P		Atlas-SNP	.											.	EXOC1	103	.	0			c.T1052C						PASS	.						76.0	76.0	76.0					4																	56738102		2203	4300	6503	SO:0001583	missense	55763	exon8			GTCACCTCAACAA	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1052T>C	chr4.hg19:g.56738102T>C	ENSP00000370695:p.Leu351Pro	129.0	0.0	.		73.0	4.0	.	NM_018261	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	hg19	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.548026	0.86022	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.80813	0.4695	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.83261	-0.0048	9	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	351;351	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	P	351	.	ENSP00000326514:L351P	L	+	2	0	EXOC1	56432859	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.546000	0.82137	2.323000	0.78572	0.528000	0.53228	CTC	.	.	.	none		0.393	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
REST	5978	hgsc.bcm.edu	37	4	57797826	57797826	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr4:57797826A>C	ENST00000309042.7	+	4	3116	c.2802A>C	c.(2800-2802)ttA>ttC	p.L934F		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	934					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					GTGAAACTTTAAATGGTAAAC	0.393																																					p.L934F		Atlas-SNP	.											.	REST	104	.	0			c.A2802C						PASS	.						63.0	61.0	62.0					4																	57797826		2203	4300	6503	SO:0001583	missense	5978	exon4			AACTTTAAATGGT	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.2802A>C	chr4.hg19:g.57797826A>C	ENSP00000311816:p.Leu934Phe	153.0	0.0	.		110.0	43.0	.	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	hg19	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.698194	0.30142	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.09445	2.98	5.44	-0.433	0.12287	.	1.916850	0.03006	N	0.148774	T	0.10337	0.0253	L	0.44542	1.39	0.09310	N	1	B;B	0.22146	0.065;0.002	B;B	0.19946	0.027;0.003	T	0.36890	-0.9729	10	0.62326	D	0.03	3.7839	2.7257	0.05213	0.5094:0.2758:0.0816:0.1332	.	911;934	F8WAN5;Q13127	.;REST_HUMAN	F	934;911	ENSP00000311816:L934F	ENSP00000311816:L934F	L	+	3	2	REST	57492583	0.001000	0.12720	0.000000	0.03702	0.092000	0.18411	0.791000	0.26915	0.082000	0.17018	0.459000	0.35465	TTA	.	.	.	none		0.393	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
SPATA24	202051	hgsc.bcm.edu	37	5	138739683	138739683	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr5:138739683G>A	ENST00000451821.2	-	1	73	c.67C>T	c.(67-69)Cgg>Tgg	p.R23W	SPATA24_ENST00000509959.1_Missense_Mutation_p.R23W|SPATA24_ENST00000507779.2_Missense_Mutation_p.R23W			Q86W54	SPA24_HUMAN	spermatogenesis associated 24	23					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										ATCACGTCCCGCAGTTGATCT	0.612																																					p.R23W		Atlas-SNP	.											.	.	.	.	0			c.C67T						PASS	.						72.0	66.0	68.0					5																	138739683		692	1591	2283	SO:0001583	missense	202051	exon1			CGTCCCGCAGTTG	AK098740	CCDS47274.1	5q31.2	2014-02-12	2009-09-30		ENSG00000170469	ENSG00000170469			27322	protein-coding gene	gene with protein product	"""coiled-coil domain containing 161"""					16146721	Standard	NM_194296		Approved	T6441, CCDC161	uc003lel.4	Q86W54	OTTHUMG00000163388	ENST00000451821.2:c.67C>T	chr5.hg19:g.138739683G>A	ENSP00000400524:p.Arg23Trp	89.0	0.0	.		99.0	4.0	.	NM_194296		Missense_Mutation	SNP	ENST00000451821.2	hg19		.	.	.	.	.	.	.	.	.	.	G	27.5	4.833603	0.91036	.	.	ENSG00000170469	ENST00000302091;ENST00000450845;ENST00000509959;ENST00000451821;ENST00000507779	.	.	.	5.18	5.18	0.71444	.	0.000000	0.44902	D	0.000416	T	0.61602	0.2360	N	0.14661	0.345	0.40647	D	0.982006	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.996;0.999	T	0.68334	-0.5436	9	0.87932	D	0	-17.9371	15.5398	0.76035	0.0:0.0:1.0:0.0	.	23;23;23	Q86W54-2;Q86W54;Q8N799	.;SPA24_HUMAN;.	W	23	.	ENSP00000302917:R23W	R	-	1	2	SPATA24	138767582	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.620000	0.54203	2.710000	0.92621	0.491000	0.48974	CGG	.	.	.	none		0.612	SPATA24-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000372986.1	NM_194296	
NQO2	4835	hgsc.bcm.edu	37	6	3010268	3010268	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:3010268T>C	ENST00000338130.2	+	6	729	c.17T>C	c.(16-18)gTa>gCa	p.V6A	NQO2_ENST00000380430.1_Missense_Mutation_p.V6A|NQO2_ENST00000380441.1_Missense_Mutation_p.V6A|NQO2_ENST00000380454.4_Missense_Mutation_p.V6A|NQO2_ENST00000606474.1_3'UTR|NQO2_ENST00000380455.4_Missense_Mutation_p.V6A			P16083	NQO2_HUMAN	NAD(P)H dehydrogenase, quinone 2	6					memory (GO:0007613)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	dihydronicotinamide riboside quinone reductase activity (GO:0001512)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADPH dehydrogenase (quinone) activity (GO:0008753)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Dabigatran etexilate(DB06695)|Flavin adenine dinucleotide(DB03147)|Melatonin(DB01065)|Menadione(DB00170)|Primaquine(DB01087)	GGTAAGAAAGTACTCATTGTC	0.423																																					p.V6A		Atlas-SNP	.											.	NQO2	21	.	0			c.T17C						PASS	.						97.0	87.0	90.0					6																	3010268		2203	4300	6503	SO:0001583	missense	4835	exon3			AGAAAGTACTCAT	U07736	CCDS4481.1, CCDS75388.1	6p25.2	2012-09-20	2001-11-30	2001-12-07	ENSG00000124588	ENSG00000124588	1.6.5.2		7856	protein-coding gene	gene with protein product		160998	"""NAD(P)H menadione oxidoreductase 2, dioxin-inducible"""	NMOR2		1691923	Standard	XM_005249152		Approved	QR2, DHQV, DIA6	uc003mus.2	P16083	OTTHUMG00000014130	ENST00000338130.2:c.17T>C	chr6.hg19:g.3010268T>C	ENSP00000337773:p.Val6Ala	123.0	0.0	.		104.0	30.0	.	NM_000904	B2R492|Q5TD04	Missense_Mutation	SNP	ENST00000338130.2	hg19	CCDS4481.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.034069	0.35893	.	.	ENSG00000124588	ENST00000426637;ENST00000380472;ENST00000538898;ENST00000397717;ENST00000338130;ENST00000380441;ENST00000380455;ENST00000380454;ENST00000380430	T;T;T;T;T;T;T;T	0.11930	2.81;2.73;2.73;2.81;2.81;2.81;2.81;2.81	5.63	5.63	0.86233	Flavodoxin-like fold (1);	0.123571	0.56097	D	0.000034	T	0.18800	0.0451	L	0.52823	1.66	0.44771	D	0.997777	P;D	0.89917	0.613;1.0	P;D	0.91635	0.851;0.999	T	0.06516	-1.0822	10	0.16896	T	0.51	-27.3633	13.5807	0.61901	0.0:0.0:0.0:1.0	.	6;53	P16083;Q59EN2	NQO2_HUMAN;.	A	6;6;53;6;6;6;6;6;6	ENSP00000406951:V6A;ENSP00000369839:V6A;ENSP00000380829:V6A;ENSP00000337773:V6A;ENSP00000369806:V6A;ENSP00000369822:V6A;ENSP00000369821:V6A;ENSP00000369795:V6A	ENSP00000337773:V6A	V	+	2	0	NQO2	2955267	0.985000	0.35326	1.000000	0.80357	0.371000	0.29859	1.927000	0.40094	2.140000	0.66376	0.460000	0.39030	GTA	.	.	.	none		0.423	NQO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039651.1		
GABBR1	2550	hgsc.bcm.edu	37	6	29595420	29595420	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:29595420C>T	ENST00000377034.4	-	6	835	c.500G>A	c.(499-501)cGg>cAg	p.R167Q	GABBR1_ENST00000377012.4_Missense_Mutation_p.R50Q|GABBR1_ENST00000376977.3_Missense_Mutation_p.R167Q|GABBR1_ENST00000355973.3_Missense_Mutation_p.R50Q|GABBR1_ENST00000377016.4_Missense_Mutation_p.R105Q	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	167					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CACTGCGCGCCGTTCTGAGGA	0.716																																					p.R167Q		Atlas-SNP	.											.	GABBR1	95	.	0			c.G500A						PASS	.						5.0	5.0	5.0					6																	29595420		1961	3937	5898	SO:0001583	missense	2550	exon6			GCGCGCCGTTCTG	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.500G>A	chr6.hg19:g.29595420C>T	ENSP00000366233:p.Arg167Gln	5.0	0.0	.		34.0	14.0	.	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313674	0.60414	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	D;T;D;D;T	0.82984	-1.67;-0.98;-1.57;-1.67;-0.45	3.25	3.25	0.37280	.	0.279410	0.27912	U	0.017356	T	0.57257	0.2041	L	0.46157	1.445	0.33376	D	0.574201	B;B;B;B	0.28208	0.071;0.065;0.063;0.203	B;B;B;B	0.21151	0.033;0.01;0.011;0.028	T	0.49263	-0.8958	10	0.22109	T	0.4	-24.9114	6.2007	0.20575	0.0:0.8596:0.0:0.1404	.	167;105;167;50	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	Q	50;167;105;50;167	ENSP00000348248:R50Q;ENSP00000366176:R167Q;ENSP00000366215:R105Q;ENSP00000366211:R50Q;ENSP00000366233:R167Q	ENSP00000348248:R50Q	R	-	2	0	GABBR1	29703399	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.661000	0.46758	1.645000	0.50612	0.455000	0.32223	CGG	.	.	.	none		0.716	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
NFKBIL1	4795	hgsc.bcm.edu	37	6	31526116	31526116	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:31526116G>A	ENST00000376148.4	+	4	988	c.874G>A	c.(874-876)Ggc>Agc	p.G292S	NFKBIL1_ENST00000376145.4_Missense_Mutation_p.G277S	NM_005007.3	NP_004998.3	Q9UBC1	IKBL1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1	292					cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of transcription factor (GO:0042994)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)	cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7						AGCGGGGAGGGGCAGCCTCTG	0.711																																					p.G292S		Atlas-SNP	.											.	NFKBIL1	17	.	0			c.G874A						PASS	.						7.0	7.0	7.0					6																	31526116		1474	2672	4146	SO:0001583	missense	4795	exon4			GGGAGGGGCAGCC	X77909	CCDS4700.1, CCDS47399.1, CCDS47400.1	6p21.3	2010-02-17			ENSG00000204498	ENSG00000204498			7800	protein-coding gene	gene with protein product		601022		NFKBIL		8081366	Standard	NM_005007		Approved	IKBL	uc003nub.3	Q9UBC1	OTTHUMG00000031038	ENST00000376148.4:c.874G>A	chr6.hg19:g.31526116G>A	ENSP00000365318:p.Gly292Ser	24.0	0.0	.		69.0	23.0	.	NM_005007	A6NL91|B4DUW1|Q14625|Q5HYU4|Q5RJ72|Q5ST96|Q5STV4|Q5STV5|Q9UBX4	Missense_Mutation	SNP	ENST00000376148.4	hg19	CCDS4700.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218538	0.39201	.	.	ENSG00000204498	ENST00000376146;ENST00000376148;ENST00000376145	T;T;T	0.30448	1.53;1.53;1.53	5.95	3.09	0.35607	.	0.261597	0.36555	N	0.002538	T	0.04318	0.0119	N	0.11560	0.145	0.31038	N	0.71666	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.39820	-0.9595	10	0.17369	T	0.5	-13.1009	5.6448	0.17584	0.1708:0.1613:0.6679:0.0	.	269;277;292	Q5STV6;Q5STV4;Q9UBC1	.;.;IKBL1_HUMAN	S	269;292;277	ENSP00000365316:G269S;ENSP00000365318:G292S;ENSP00000365315:G277S	ENSP00000365315:G277S	G	+	1	0	NFKBIL1	31634095	0.998000	0.40836	0.997000	0.53966	0.980000	0.70556	0.920000	0.28705	0.863000	0.35553	0.563000	0.77884	GGC	.	.	.	none		0.711	NFKBIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076036.3	NM_005007	
HCRTR2	3062	hgsc.bcm.edu	37	6	55039411	55039411	+	Missense_Mutation	SNP	C	C	G	rs76774128		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:55039411C>G	ENST00000370862.3	+	1	362	c.26C>G	c.(25-27)tCc>tGc	p.S9C		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	9					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)	p.P11fs*11(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTGGAGGACTCCCCCCCTTGT	0.567																																					p.S9C		Atlas-SNP	.											.,3	HCRTR2	112	.	1	Deletion - Frameshift(1)	upper_aerodigestive_tract(1)	c.C26G						PASS	.						101.0	96.0	98.0					6																	55039411		2203	4300	6503	SO:0001583	missense	3062	exon1			AGGACTCCCCCCC	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.26C>G	chr6.hg19:g.55039411C>G	ENSP00000359899:p.Ser9Cys	91.0	0.0	.		130.0	47.0	.	NM_001526	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	hg19	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922205	0.33908	.	.	ENSG00000137252	ENST00000370862	T	0.62232	0.04	4.81	3.94	0.45596	.	0.414369	0.27084	N	0.021005	T	0.30572	0.0769	L	0.36672	1.1	0.32083	N	0.592878	B	0.02656	0.0	B	0.04013	0.001	T	0.14227	-1.0480	10	0.42905	T	0.14	.	8.2548	0.31748	0.0:0.7582:0.1587:0.0831	.	9	O43614	OX2R_HUMAN	C	9	ENSP00000359899:S9C	ENSP00000359899:S9C	S	+	2	0	HCRTR2	55147370	0.019000	0.18553	1.000000	0.80357	0.907000	0.53573	0.521000	0.22893	1.246000	0.43901	-0.257000	0.10917	TCC	.	.	.	alt		0.567	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
COL12A1	1303	hgsc.bcm.edu	37	6	75848659	75848659	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:75848659G>T	ENST00000322507.8	-	28	5285	c.4976C>A	c.(4975-4977)aCa>aAa	p.T1659K	COL12A1_ENST00000483888.2_Missense_Mutation_p.T1659K|COL12A1_ENST00000416123.2_Missense_Mutation_p.T1659K|COL12A1_ENST00000345356.6_Missense_Mutation_p.T495K	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1659	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTTTAAGTTTGTTGGGGCTGG	0.403																																					p.T1659K		Atlas-SNP	.											.	COL12A1	385	.	0			c.C4976A						PASS	.						102.0	102.0	102.0					6																	75848659		1847	4078	5925	SO:0001583	missense	1303	exon28			AAGTTTGTTGGGG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4976C>A	chr6.hg19:g.75848659G>T	ENSP00000325146:p.Thr1659Lys	64.0	0.0	.		63.0	16.0	.	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.188|0.188	-1.055736|-1.055736	0.01965|0.01965	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|T;T;T;T	.|0.57752	.|0.38;0.38;0.38;0.38	5.95|5.95	4.98|4.98	0.66077|0.66077	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.429258	.|0.26428	.|N	.|0.024432	T|T	0.11410|0.11410	0.0278|0.0278	N|N	0.20685|0.20685	0.6|0.6	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.08055	.|0.002;0.003	T|T	0.34850|0.34850	-0.9812|-0.9812	5|10	.|0.02654	.|T	.|1	.|.	5.5016|5.5016	0.16831|0.16831	0.1314:0.0:0.661:0.2076|0.1314:0.0:0.661:0.2076	.|.	.|495;1659	.|Q99715-2;Q99715	.|.;COCA1_HUMAN	K|K	400|1659;1659;495;1659;1659	.|ENSP00000325146:T1659K;ENSP00000305147:T495K;ENSP00000412864:T1659K;ENSP00000421216:T1659K	.|ENSP00000325146:T1659K	N|T	-|-	3|2	2|0	COL12A1|COL12A1	75905379|75905379	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.021000|0.021000	0.10359|0.10359	2.434000|2.434000	0.44802|0.44802	2.827000|2.827000	0.97445|0.97445	0.650000|0.650000	0.86243|0.86243	AAC|ACA	.	.	.	none		0.403	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
AHR	196	hgsc.bcm.edu	37	7	17375399	17375399	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:17375399G>C	ENST00000242057.4	+	9	1792	c.1149G>C	c.(1147-1149)caG>caC	p.Q383H	AHR_ENST00000492120.1_3'UTR	NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	383	PAC.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q383H(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TTGTAACTCAGAGACCACTAA	0.348																																					p.Q383H		Atlas-SNP	.											AHR,NS,carcinoma,0,1	AHR	89	.	2	Substitution - Missense(2)	lung(2)	c.G1149C						PASS	.						71.0	63.0	66.0					7																	17375399		2202	4300	6502	SO:0001583	missense	196	exon9			AACTCAGAGACCA	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.1149G>C	chr7.hg19:g.17375399G>C	ENSP00000242057:p.Gln383His	57.0	0.0	.		71.0	40.0	.	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	hg19	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930150	0.52759	.	.	ENSG00000106546	ENST00000242057	T	0.05447	3.44	5.98	-1.41	0.08941	.	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	L	0.43152	1.355	0.44798	D	0.997802	B	0.28128	0.201	B	0.31390	0.129	T	0.22277	-1.0221	10	0.62326	D	0.03	.	12.8346	0.57765	0.6126:0.0:0.3874:0.0	.	383	P35869	AHR_HUMAN	H	383	ENSP00000242057:Q383H	ENSP00000242057:Q383H	Q	+	3	2	AHR	17341924	0.995000	0.38212	0.977000	0.42913	0.859000	0.49053	0.361000	0.20267	-0.292000	0.08999	0.591000	0.81541	CAG	.	.	.	none		0.348	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
AUTS2	26053	hgsc.bcm.edu	37	7	69364300	69364300	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:69364300G>A	ENST00000342771.4	+	2	659	c.338G>A	c.(337-339)cGt>cAt	p.R113H	AUTS2_ENST00000403018.2_Missense_Mutation_p.R113H|AUTS2_ENST00000406775.2_Missense_Mutation_p.R113H	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	113								p.R113L(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCTCAGGAACGTGTGGAGAAA	0.473																																					p.R113H		Atlas-SNP	.											AUTS2,caecum,carcinoma,+1,1	AUTS2	173	.	1	Substitution - Missense(1)	lung(1)	c.G338A						PASS	.						86.0	79.0	81.0					7																	69364300		2203	4300	6503	SO:0001583	missense	26053	exon2			AGGAACGTGTGGA	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.338G>A	chr7.hg19:g.69364300G>A	ENSP00000344087:p.Arg113His	73.0	0.0	.		130.0	22.0	.	NM_001127231	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	hg19	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345953	0.82022	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000403018	T;T	0.39787	1.06;1.08	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000019	T	0.56187	0.1968	L	0.46157	1.445	0.23872	N	0.9966	D;D;D	0.89917	0.997;0.994;1.0	P;P;D	0.69824	0.862;0.754;0.966	T	0.48980	-0.8986	9	.	.	.	-11.4592	14.7871	0.69810	0.0:0.2577:0.7423:0.0	.	113;113;113	Q8WXX7-2;Q8WXX7;Q6PJU5	.;AUTS2_HUMAN;.	H	113	ENSP00000385263:R113H;ENSP00000344087:R113H	.	R	+	2	0	AUTS2	69002236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.796000	0.62496	2.941000	0.99782	0.655000	0.94253	CGT	.	.	.	none		0.473	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
BAZ1B	9031	hgsc.bcm.edu	37	7	72873963	72873963	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:72873963A>G	ENST00000339594.4	-	13	3673	c.3335T>C	c.(3334-3336)tTc>tCc	p.F1112S	BAZ1B_ENST00000404251.1_Missense_Mutation_p.F1112S	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1112					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				GGGAGCCATGAAGCCTTGGAG	0.398																																					p.F1112S	Esophageal Squamous(112;1167 1561 21085 43672 48228)	Atlas-SNP	.											.	BAZ1B	147	.	0			c.T3335C						PASS	.						146.0	140.0	142.0					7																	72873963		2203	4300	6503	SO:0001583	missense	9031	exon13			GCCATGAAGCCTT	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.3335T>C	chr7.hg19:g.72873963A>G	ENSP00000342434:p.Phe1112Ser	60.0	0.0	.		70.0	43.0	.	NM_032408	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	hg19	CCDS5549.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.902860	0.92035	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.59364	0.27;0.27	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	L	0.32530	0.975	0.58432	D	0.999999	D	0.71674	0.998	D	0.71656	0.974	T	0.59963	-0.7355	10	0.22109	T	0.4	-20.6332	14.9627	0.71169	1.0:0.0:0.0:0.0	.	1112	Q9UIG0	BAZ1B_HUMAN	S	1112	ENSP00000342434:F1112S;ENSP00000385442:F1112S	ENSP00000342434:F1112S	F	-	2	0	BAZ1B	72511899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.697000	0.91307	2.125000	0.65367	0.533000	0.62120	TTC	.	.	.	none		0.398	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	
CUX1	1523	hgsc.bcm.edu	37	7	101882763	101882763	+	Silent	SNP	G	G	A	rs140169027		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:101882763G>A	ENST00000292535.7	+	23	3824	c.3786G>A	c.(3784-3786)gcG>gcA	p.A1262A	CUX1_ENST00000560541.1_Intron|CUX1_ENST00000546411.2_Silent_p.A1160A|AC005088.1_ENST00000580604.1_RNA|CUX1_ENST00000360264.3_Silent_p.A1273A|CUX1_ENST00000549414.2_Silent_p.A1240A|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Silent_p.A1104A|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000550008.2_Silent_p.A1206A	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1262					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TGAAACGAGCGTATCAGCAAA	0.597																																					p.A1273A		Atlas-SNP	.											CUX1,colon,carcinoma,0,1	CUX1	253	.	0			c.G3819A						PASS	.	G	,,,,,,	0,4406		0,0,2203	113.0	109.0	110.0		3819,,,,,,3786	-9.8	0.0	7	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron,intron,intron,intron,intron,coding-synonymous	CUX1	NM_001202543.1,NM_001202544.1,NM_001202545.1,NM_001202546.1,NM_001913.3,NM_181500.2,NM_181552.3	,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,	1273/1517,,,,,,1262/1506	101882763	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1523	exon23			ACGAGCGTATCAG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3786G>A	chr7.hg19:g.101882763G>A		57.0	0.0	.		158.0	98.0	.	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	ENST00000292535.7	hg19	CCDS5721.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.597	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
KMT2C	58508	hgsc.bcm.edu	37	7	151845991	151845991	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:151845991C>A	ENST00000262189.6	-	52	13239	c.13021G>T	c.(13021-13023)Ggg>Tgg	p.G4341W	KMT2C_ENST00000355193.2_Missense_Mutation_p.G4398W	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4341					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TCTTCAAACCCACCATGGACA	0.493																																					p.G4341W		Atlas-SNP	.											.	MLL3	1564	.	0			c.G13021T						PASS	.						63.0	59.0	60.0					7																	151845991		2203	4300	6503	SO:0001583	missense	58508	exon52			CAAACCCACCATG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13021G>T	chr7.hg19:g.151845991C>A	ENSP00000262189:p.Gly4341Trp	62.0	0.0	.		97.0	23.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.63|13.63	2.295838|2.295838	0.40594|0.40594	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.88975|.	-1.77;-1.77;-2.45|.	5.4|5.4	4.52|4.52	0.55395|0.55395	.|.	0.152286|.	0.29892|.	U|.	0.010923|.	T|T	0.64670|0.64670	0.2619|0.2619	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	D;D;D|.	0.69078|.	0.997;0.997;0.997|.	P;D;D|.	0.68483|.	0.907;0.958;0.958|.	T|T	0.63637|0.63637	-0.6592|-0.6592	10|5	0.49607|.	T|.	0.09|.	.|.	10.7105|10.7105	0.45980|0.45980	0.0:0.8351:0.0:0.1649|0.0:0.8351:0.0:0.1649	.|.	4341;3459;4398|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	W|L	4341;4398;958|1901	ENSP00000262189:G4341W;ENSP00000347325:G4398W;ENSP00000410411:G958W|.	ENSP00000262189:G4341W|.	G|W	-|-	1|2	0|0	MLL3|MLL3	151476924|151476924	0.007000|0.007000	0.16637|0.16637	0.015000|0.015000	0.15790|0.15790	0.970000|0.970000	0.65996|0.65996	1.934000|1.934000	0.40163|0.40163	1.273000|1.273000	0.44346|0.44346	0.650000|0.650000	0.86243|0.86243	GGG|TGG	.	.	.	none		0.493	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
VDAC3	7419	hgsc.bcm.edu	37	8	42259309	42259309	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr8:42259309G>C	ENST00000022615.4	+	7	395	c.327G>C	c.(325-327)aaG>aaC	p.K109N	VDAC3_ENST00000392935.3_Missense_Mutation_p.K110N|VDAC3_ENST00000521158.1_Missense_Mutation_p.K110N|VDAC3_ENST00000522572.1_Missense_Mutation_p.K110N			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	109					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	ATTGCAGAAAGAAGAGTGGGA	0.378																																					p.K110N		Atlas-SNP	.											.	VDAC3	17	.	0			c.G330C						PASS	.						100.0	100.0	100.0					8																	42259309		2203	4300	6503	SO:0001583	missense	7419	exon7			CAGAAAGAAGAGT	AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.327G>C	chr8.hg19:g.42259309G>C	ENSP00000022615:p.Lys109Asn	64.0	0.0	.		72.0	22.0	.	NM_001135694	Q9UIS0	Missense_Mutation	SNP	ENST00000022615.4	hg19	CCDS6131.1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761925	0.69763	.	.	ENSG00000078668	ENST00000518563;ENST00000392935;ENST00000520115;ENST00000522069;ENST00000522572;ENST00000521158;ENST00000022615	T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.64713	0.2623	M	0.73962	2.25	0.80722	D	1	D	0.67145	0.996	D	0.70935	0.971	T	0.61936	-0.6960	10	0.40728	T	0.16	-12.3041	17.6115	0.88055	0.0:0.0:1.0:0.0	.	109	Q9Y277	VDAC3_HUMAN	N	77;110;109;109;110;110;109	ENSP00000428977:K77N;ENSP00000442811:K110N;ENSP00000428519:K109N;ENSP00000429006:K109N;ENSP00000428029:K110N;ENSP00000428845:K110N;ENSP00000022615:K109N	ENSP00000022615:K109N	K	+	3	2	VDAC3	42378466	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.582000	0.74049	2.832000	0.97577	0.650000	0.86243	AAG	.	.	.	none		0.378	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377574.1		
SFMBT2	57713	hgsc.bcm.edu	37	10	7214001	7214001	+	Silent	SNP	G	G	A	rs370293109		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:7214001G>A	ENST00000361972.4	-	19	2361	c.2271C>T	c.(2269-2271)ccC>ccT	p.P757P	SFMBT2_ENST00000397167.1_Silent_p.P757P	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	757					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CGGCCCTCCGGGGCCGGGCCG	0.746																																					p.P757P		Atlas-SNP	.											.	SFMBT2	209	.	0			c.C2271T						PASS	.	G	,	0,4346		0,0,2173	12.0	15.0	14.0		2271,2271	0.9	1.0	10		14	1,8505		0,1,4252	no	coding-synonymous,coding-synonymous	SFMBT2	NM_001018039.1,NM_001029880.2	,	0,1,6425	AA,AG,GG		0.0118,0.0,0.0078	,	757/895,757/895	7214001	1,12851	2173	4253	6426	SO:0001819	synonymous_variant	57713	exon19			CCTCCGGGGCCGG	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2271C>T	chr10.hg19:g.7214001G>A		1.0	0.0	.		8.0	6.0	.	NM_001029880	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	hg19	CCDS31138.1																																																																																			.	.	.	none		0.746	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
PLXDC2	84898	hgsc.bcm.edu	37	10	20335920	20335920	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:20335920G>T	ENST00000377252.4	+	3	1288	c.447G>T	c.(445-447)ttG>ttT	p.L149F	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Intron	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	149					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						ATGGAATATTGTCCAATACTC	0.373																																					p.L149F		Atlas-SNP	.											.	PLXDC2	108	.	0			c.G447T						PASS	.						95.0	93.0	93.0					10																	20335920		2203	4300	6503	SO:0001583	missense	84898	exon3			AATATTGTCCAAT	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.447G>T	chr10.hg19:g.20335920G>T	ENSP00000366460:p.Leu149Phe	56.0	0.0	.		58.0	5.0	.	NM_032812	Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	hg19	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294191	0.60086	.	.	ENSG00000120594	ENST00000377252;ENST00000377238;ENST00000536022	T	0.78364	-1.17	5.61	0.195	0.15151	.	0.000000	0.85682	D	0.000000	D	0.82499	0.5050	M	0.79343	2.45	0.58432	D	0.999999	D	0.89917	1.0	D	0.71414	0.973	T	0.77335	-0.2626	10	0.87932	D	0	.	2.1328	0.03754	0.1312:0.2504:0.2267:0.3917	.	149	Q6UX71	PXDC2_HUMAN	F	149;12;135	ENSP00000366460:L149F	ENSP00000366446:L12F	L	+	3	2	PLXDC2	20375926	0.996000	0.38824	0.683000	0.30040	0.886000	0.51366	0.297000	0.19101	-0.233000	0.09797	-0.133000	0.14855	TTG	.	.	.	none		0.373	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
TET1	80312	hgsc.bcm.edu	37	10	70332130	70332130	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:70332130T>C	ENST00000373644.4	+	2	244	c.35T>C	c.(34-36)tTa>tCa	p.L12S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	12					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CCTTCCAGATTAGTCAGGAAG	0.433																																					p.L12S		Atlas-SNP	.											.	TET1	255	.	0			c.T35C						PASS	.						38.0	38.0	38.0					10																	70332130		2199	4299	6498	SO:0001583	missense	80312	exon2			CCAGATTAGTCAG	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.35T>C	chr10.hg19:g.70332130T>C	ENSP00000362748:p.Leu12Ser	93.0	0.0	.		85.0	28.0	.	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	T	13.35	2.210522	0.39102	.	.	ENSG00000138336	ENST00000373644	T	0.08458	3.09	5.24	0.299	0.15771	.	4.959980	0.00166	N	0.000012	T	0.06735	0.0172	N	0.19112	0.55	0.23501	N	0.997547	B	0.28512	0.214	B	0.21151	0.033	T	0.37502	-0.9703	10	0.28530	T	0.3	.	9.3061	0.37876	0.0:0.403:0.0:0.597	.	12	Q8NFU7	TET1_HUMAN	S	12	ENSP00000362748:L12S	ENSP00000362748:L12S	L	+	2	0	TET1	70002136	0.998000	0.40836	0.679000	0.29978	0.998000	0.95712	0.421000	0.21280	-0.188000	0.10499	0.460000	0.39030	TTA	.	.	.	none		0.433	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
PTEN	5728	hgsc.bcm.edu	37	10	89717690	89717690	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:89717690A>G	ENST00000371953.3	+	7	2072	c.715A>G	c.(715-717)Atg>Gtg	p.M239V	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	239	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R234fs*9(1)|p.K237_Y240>N(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGACAAGTTCATGTACTTTGA	0.418		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.M239V		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN	3652	.	50	Whole gene deletion(37)|Deletion - Frameshift(10)|Complex - deletion inframe(1)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|breast(4)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.A715G						PASS	.						153.0	130.0	138.0					10																	89717690		2203	4300	6503	SO:0001583	missense	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	AAGTTCATGTACT	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.715A>G	chr10.hg19:g.89717690A>G	ENSP00000361021:p.Met239Val	163.0	0.0	.		171.0	49.0	.	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.980414	0.34942	.	.	ENSG00000171862	ENST00000371953	D	0.84660	-1.88	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.038168	0.85682	D	0.000000	T	0.73567	0.3603	N	0.13352	0.335	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.67983	-0.5529	9	.	.	.	-3.0578	14.9657	0.71193	1.0:0.0:0.0:0.0	.	239	P60484	PTEN_HUMAN	V	239	ENSP00000361021:M239V	.	M	+	1	0	PTEN	89707670	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.918000	0.92759	1.928000	0.55862	0.477000	0.44152	ATG	.	.	.	none		0.418	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
PDZD8	118987	hgsc.bcm.edu	37	10	119043959	119043959	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:119043959G>T	ENST00000334464.5	-	5	2524	c.2285C>A	c.(2284-2286)cCt>cAt	p.P762H	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	762					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TATAGCCTTAGGTGAGGGGGC	0.403																																					p.P762H		Atlas-SNP	.											.	PDZD8	85	.	0			c.C2285A						PASS	.						125.0	111.0	116.0					10																	119043959		2203	4300	6503	SO:0001583	missense	118987	exon5			GCCTTAGGTGAGG	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.2285C>A	chr10.hg19:g.119043959G>T	ENSP00000334642:p.Pro762His	70.0	0.0	.		68.0	23.0	.	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	hg19	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075899	0.76415	.	.	ENSG00000165650	ENST00000334464	D	0.87256	-2.23	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.90889	0.7137	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90836	0.4720	10	0.59425	D	0.04	-12.5235	20.4116	0.99017	0.0:0.0:1.0:0.0	.	762	Q8NEN9	PDZD8_HUMAN	H	762	ENSP00000334642:P762H	ENSP00000334642:P762H	P	-	2	0	PDZD8	119033949	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	9.869000	0.99810	2.827000	0.97445	0.655000	0.94253	CCT	.	.	.	none		0.403	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
PWWP2B	170394	hgsc.bcm.edu	37	10	134218416	134218416	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr10:134218416C>T	ENST00000305233.5	+	2	471	c.412C>T	c.(412-414)Ctg>Ttg	p.L138L	PWWP2B_ENST00000368609.4_Silent_p.L138L	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	138	Pro-rich.									central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CACGTACAAGCTGTGGGTGCC	0.731																																					p.L138L		Atlas-SNP	.											.	PWWP2B	33	.	0			c.C412T						PASS	.						11.0	10.0	10.0					10																	134218416		1839	3661	5500	SO:0001819	synonymous_variant	170394	exon2			TACAAGCTGTGGG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.412C>T	chr10.hg19:g.134218416C>T		0.0	0.0	.		5.0	4.0	.	NM_001098637	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	hg19	CCDS7667.2																																																																																			.	.	.	none		0.731	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
MUC6	4588	hgsc.bcm.edu	37	11	1018068	1018068	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:1018068G>A	ENST00000421673.2	-	31	4783	c.4733C>T	c.(4732-4734)cCa>cTa	p.P1578L		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1578	Pro-rich.|Thr-rich.		P -> S (in dbSNP:rs10736904).		cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCTGTAGGTGGGGAGTGTGT	0.582																																					p.P1578L		Atlas-SNP	.											.	MUC6	408	.	0			c.C4733T						PASS	.						259.0	265.0	263.0					11																	1018068		2174	4263	6437	SO:0001583	missense	4588	exon31			GTAGGTGGGGAGT	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4733C>T	chr11.hg19:g.1018068G>A	ENSP00000406861:p.Pro1578Leu	394.0	0.0	.		411.0	70.0	.	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	hg19	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	9.977	1.227087	0.22542	.	.	ENSG00000184956	ENST00000421673	T	0.15603	2.41	2.31	1.29	0.21616	.	.	.	.	.	T	0.12689	0.0308	L	0.46157	1.445	0.09310	N	1	B	0.24963	0.115	B	0.19946	0.027	T	0.38520	-0.9657	9	0.10902	T	0.67	.	8.0503	0.30575	0.0:0.0:0.7368:0.2632	.	1578	Q6W4X9	MUC6_HUMAN	L	1578	ENSP00000406861:P1578L	ENSP00000406861:P1578L	P	-	2	0	MUC6	1008068	0.000000	0.05858	0.001000	0.08648	0.150000	0.21749	-0.194000	0.09559	0.226000	0.20979	0.297000	0.19635	CCA	.	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643254	1643254	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:1643254A>G	ENST00000399682.1	-	1	114	c.70T>C	c.(70-72)Tgt>Cgt	p.C24R		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccagagccacagcccccacag	0.687																																					p.C24R		Atlas-SNP	.											.	KRTAP5-4	78	.	0			c.T70C						PASS	.						4.0	8.0	7.0					11																	1643254		641	1519	2160	SO:0001583	missense	387267	exon1			AGCCACAGCCCCC	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.70T>C	chr11.hg19:g.1643254A>G	ENSP00000382590:p.Cys24Arg	57.0	0.0	.		133.0	6.0	.	NM_001012709		Missense_Mutation	SNP	ENST00000399682.1	hg19		.	.	.	.	.	.	.	.	.	.	A	7.309	0.614523	0.14129	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.01099	5.34	2.15	2.15	0.27550	.	.	.	.	.	T	0.06234	0.0161	M	0.87971	2.92	0.49389	D	0.999781	D	0.59357	0.985	D	0.70487	0.969	T	0.05273	-1.0895	9	0.56958	D	0.05	.	8.2253	0.31564	1.0:0.0:0.0:0.0	.	24	Q6L8H1	KRA54_HUMAN	R	24	ENSP00000382590:C24R	ENSP00000331603:C24R	C	-	1	0	KRTAP5-4	1599830	0.001000	0.12720	0.930000	0.37139	0.032000	0.12392	-0.060000	0.11712	1.242000	0.43836	0.367000	0.22151	TGT	.	.	.	none		0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
EEF1G	1937	hgsc.bcm.edu	37	11	62334912	62334912	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:62334912A>C	ENST00000329251.4	-	6	741	c.611T>G	c.(610-612)tTg>tGg	p.L204W	MIR3654_ENST00000496634.2_3'UTR|EEF1G_ENST00000378019.3_Missense_Mutation_p.L254W	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	204	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CACTTCGCCCAAGACAGCCCG	0.552																																					p.L204W		Atlas-SNP	.											.	EEF1G	33	.	0			c.T611G						PASS	.						44.0	41.0	42.0					11																	62334912		1926	4135	6061	SO:0001583	missense	1937	exon6			TCGCCCAAGACAG	X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.611T>G	chr11.hg19:g.62334912A>C	ENSP00000331901:p.Leu204Trp	70.0	0.0	.		99.0	32.0	.	NM_001404	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Missense_Mutation	SNP	ENST00000329251.4	hg19	CCDS44626.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.662133	0.88251	.	.	ENSG00000254772	ENST00000329251;ENST00000378019	T;T	0.21932	1.98;1.98	4.8	4.8	0.61643	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.64402	D	0.000002	T	0.54159	0.1841	M	0.92459	3.31	0.53005	D	0.999968	D;P	0.89917	1.0;0.905	D;P	0.80764	0.994;0.703	T	0.65487	-0.6156	10	0.72032	D	0.01	.	12.5918	0.56447	1.0:0.0:0.0:0.0	.	254;204	B4DTG2;P26641	.;EF1G_HUMAN	W	204;254	ENSP00000331901:L204W;ENSP00000367258:L254W	ENSP00000331901:L204W	L	-	2	0	EEF1G	62091488	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.903000	0.92573	1.928000	0.55862	0.459000	0.35465	TTG	.	.	.	weak		0.552	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395047.1	NM_001404	
DGAT2	84649	hgsc.bcm.edu	37	11	75509414	75509414	+	Missense_Mutation	SNP	G	G	C	rs145750206		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr11:75509414G>C	ENST00000228027.7	+	7	1212	c.952G>C	c.(952-954)Ggc>Cgc	p.G318R	DGAT2_ENST00000376262.3_Missense_Mutation_p.G275R|RP11-535A19.1_ENST00000534354.1_RNA	NM_032564.4	NP_115953.2	Q96PD7	DGAT2_HUMAN	diacylglycerol O-acyltransferase 2	318					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|cellular response to oleic acid (GO:0071400)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|diacylglycerol metabolic process (GO:0046339)|fat pad development (GO:0060613)|fatty acid homeostasis (GO:0055089)|glycerol metabolic process (GO:0006071)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)|protein homodimerization activity (GO:0042803)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(5)|lung(5)|prostate(2)|skin(2)	17	Ovarian(111;0.103)					CCATGGTCGAGGCCTCTTCTC	0.582																																					p.G318R	Melanoma(35;811 1096 8354 24009 39363)	Atlas-SNP	.											.	DGAT2	37	.	0			c.G952C						PASS	.						84.0	72.0	76.0					11																	75509414		2200	4293	6493	SO:0001583	missense	84649	exon7			GGTCGAGGCCTCT		CCDS31642.1, CCDS58162.1	11q13.3	2010-06-24	2010-06-24		ENSG00000062282	ENSG00000062282			16940	protein-coding gene	gene with protein product		606983	"""diacylglycerol O-acyltransferase homolog 2 (mouse)"""			11481335, 14970677	Standard	NM_032564		Approved		uc001oxa.3	Q96PD7	OTTHUMG00000165338	ENST00000228027.7:c.952G>C	chr11.hg19:g.75509414G>C	ENSP00000228027:p.Gly318Arg	77.0	0.0	.		97.0	33.0	.	NM_032564	A6ND76|Q5U810|Q68CL3|Q68DJ0|Q8NDB7|Q96BS0|Q9BYE5	Missense_Mutation	SNP	ENST00000228027.7	hg19	CCDS31642.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248066	0.80024	.	.	ENSG00000062282	ENST00000228027;ENST00000376262;ENST00000525612	T;T	0.18960	2.18;2.18	5.59	4.68	0.58851	.	0.090338	0.85682	D	0.000000	T	0.44498	0.1296	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.74674	0.984;0.955	T	0.44862	-0.9300	10	0.87932	D	0	-19.5496	9.867	0.41150	0.1582:0.0:0.8418:0.0	.	275;318	Q96PD7-2;Q96PD7	.;DGAT2_HUMAN	R	318;275;272	ENSP00000228027:G318R;ENSP00000365438:G275R	ENSP00000228027:G318R	G	+	1	0	DGAT2	75187062	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.726000	0.68515	1.501000	0.48654	0.655000	0.94253	GGC	.	G|0.999;A|0.001	.	alt		0.582	DGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383506.1	NM_032564	
DENND5B	160518	hgsc.bcm.edu	37	12	31551284	31551284	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:31551284C>T	ENST00000389082.5	-	17	3345	c.3081G>A	c.(3079-3081)ggG>ggA	p.G1027G	DENND5B_ENST00000536562.1_Silent_p.G1062G|RNU6-618P_ENST00000363518.1_RNA|DENND5B_ENST00000306833.6_Silent_p.G1062G	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1027	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CCAGCCACCGCCCACATGGGA	0.453																																					p.G1027G		Atlas-SNP	.											.	DENND5B	114	.	0			c.G3081A						PASS	.						45.0	41.0	42.0					12																	31551284		1778	3993	5771	SO:0001819	synonymous_variant	160518	exon17			CCACCGCCCACAT	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3081G>A	chr12.hg19:g.31551284C>T		44.0	0.0	.		24.0	9.0	.	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	ENST00000389082.5	hg19	CCDS44857.1																																																																																			.	.	.	none		0.453	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
PRPH	5630	hgsc.bcm.edu	37	12	49689459	49689459	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:49689459G>A	ENST00000257860.4	+	1	1975	c.476G>A	c.(475-477)gGc>gAc	p.G159D	RP11-161H23.9_ENST00000553259.1_RNA	NM_006262.3	NP_006253.2	P23942	PRPH2_HUMAN	peripherin	0					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(8)|skin(1)	12						GAGCTGTTGGGCCGCGAGCGT	0.766																																					p.G159D		Atlas-SNP	.											.	PRPH	26	.	0			c.G476A						PASS	.						2.0	3.0	3.0					12																	49689459		1611	3196	4807	SO:0001583	missense	5630	exon1			TGTTGGGCCGCGA		CCDS8783.1	12q12-q13	2013-01-16						"""Intermediate filaments type III"""	9461	protein-coding gene	gene with protein product		170710		NEF4		1378416	Standard	XM_005269025		Approved	PRPH1	uc001rtu.3	P41219		ENST00000257860.4:c.476G>A	chr12.hg19:g.49689459G>A	ENSP00000257860:p.Gly159Asp	0.0	0.0	.		7.0	4.0	.	NM_006262	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000257860.4	hg19	CCDS8783.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422107	0.62622	.	.	ENSG00000135406	ENST00000257860;ENST00000451891	D	0.88741	-2.42	4.51	2.61	0.31194	Filament (1);	0.000000	0.40554	N	0.001080	D	0.89022	0.6597	L	0.58669	1.825	0.46096	D	0.998869	P	0.46987	0.888	P	0.52109	0.69	D	0.84585	0.0663	10	0.18710	T	0.47	.	12.3528	0.55157	0.0:0.3262:0.6738:0.0	.	159	P41219	PERI_HUMAN	D	159;46	ENSP00000257860:G159D	ENSP00000257860:G159D	G	+	2	0	PRPH	47975726	0.835000	0.29415	0.999000	0.59377	0.608000	0.37181	1.757000	0.38400	0.501000	0.28013	0.462000	0.41574	GGC	.	.	.	none		0.766	PRPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393381.1	NM_006262	
KRT2	3849	hgsc.bcm.edu	37	12	53045499	53045499	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:53045499G>C	ENST00000309680.3	-	1	449	c.428C>G	c.(427-429)cCt>cGt	p.P143R		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	143	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		GTATCCTCCAGGCCCAAAGCC	0.597																																					p.P143R		Atlas-SNP	.											.	KRT2	94	.	0			c.C428G						PASS	.						82.0	83.0	83.0					12																	53045499		2203	4300	6503	SO:0001583	missense	3849	exon1			CCTCCAGGCCCAA		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.428C>G	chr12.hg19:g.53045499G>C	ENSP00000310861:p.Pro143Arg	120.0	0.0	.		117.0	39.0	.	NM_000423	Q4VAQ2	Missense_Mutation	SNP	ENST00000309680.3	hg19	CCDS8835.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938619	0.52972	.	.	ENSG00000172867	ENST00000309680	D	0.85556	-2.0	5.54	5.54	0.83059	.	.	.	.	.	D	0.92296	0.7556	M	0.83603	2.65	0.38710	D	0.953191	D	0.76494	0.999	D	0.69307	0.963	D	0.93716	0.7028	9	0.87932	D	0	.	15.3671	0.74531	0.0:0.0:1.0:0.0	.	143	P35908	K22E_HUMAN	R	143	ENSP00000310861:P143R	ENSP00000310861:P143R	P	-	2	0	KRT2	51331766	0.164000	0.22935	0.998000	0.56505	0.983000	0.72400	-0.229000	0.09098	2.791000	0.96007	0.655000	0.94253	CCT	.	.	.	none		0.597	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
MDM1	56890	hgsc.bcm.edu	37	12	68696605	68696605	+	Silent	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:68696605T>A	ENST00000303145.7	-	12	1853	c.1767A>T	c.(1765-1767)atA>atT	p.I589I	MDM1_ENST00000411698.2_Silent_p.I554I|MDM1_ENST00000540418.1_Silent_p.I309I	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	589					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		CAACTGTTTTTATACCAGCAG	0.358																																					p.I589I		Atlas-SNP	.											.	MDM1	74	.	0			c.A1767T						PASS	.						90.0	92.0	91.0					12																	68696605		2203	4300	6503	SO:0001819	synonymous_variant	56890	exon12			TGTTTTTATACCA	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.1767A>T	chr12.hg19:g.68696605T>A		37.0	0.0	.		27.0	6.0	.	NM_017440	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Silent	SNP	ENST00000303145.7	hg19	CCDS8983.1																																																																																			.	.	.	none		0.358	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128	
SRRM4	84530	hgsc.bcm.edu	37	12	119583229	119583229	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:119583229C>A	ENST00000267260.4	+	9	1203	c.815C>A	c.(814-816)gCc>gAc	p.A272D		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	272	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						ACCAAAACAGCCAGCCCGCTC	0.597																																					p.A272D		Atlas-SNP	.											.	SRRM4	131	.	0			c.C815A						PASS	.						27.0	29.0	29.0					12																	119583229		1987	4156	6143	SO:0001583	missense	84530	exon9			AAACAGCCAGCCC	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.815C>A	chr12.hg19:g.119583229C>A	ENSP00000267260:p.Ala272Asp	81.0	0.0	.		106.0	28.0	.	NM_194286	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	hg19	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431158	0.43122	.	.	ENSG00000139767	ENST00000267260	T	0.23147	1.92	5.48	3.26	0.37387	.	0.608931	0.17277	N	0.180174	T	0.16854	0.0405	L	0.40543	1.245	0.33704	D	0.614946	B	0.12013	0.005	B	0.09377	0.004	T	0.13469	-1.0508	9	.	.	.	-16.4361	4.1827	0.10383	0.2661:0.5295:0.1154:0.089	.	272	A7MD48	SRRM4_HUMAN	D	272	ENSP00000267260:A272D	.	A	+	2	0	SRRM4	118067612	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	1.389000	0.34453	1.274000	0.44362	0.655000	0.94253	GCC	.	.	.	none		0.597	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
RABGGTA	5875	hgsc.bcm.edu	37	14	24734893	24734893	+	Silent	SNP	C	C	T	rs369935041		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr14:24734893C>T	ENST00000399409.3	-	16	2115	c.1632G>A	c.(1630-1632)ccG>ccA	p.P544P	RABGGTA_ENST00000560777.1_Silent_p.P153P|TGM1_ENST00000544573.1_5'Flank|TGM1_ENST00000206765.6_5'Flank|RABGGTA_ENST00000216840.6_Silent_p.P544P	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	544					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		CTTGGCACAGCGGGTTACCCT	0.612																																					p.P544P		Atlas-SNP	.											RABGGTA,NS,lymphoid_neoplasm,0,1	RABGGTA	43	.	0			c.G1632A						PASS	.	C	,	0,4034		0,0,2017	38.0	42.0	41.0		1632,1632	-4.9	0.9	14		41	1,8365		0,1,4182	no	coding-synonymous,coding-synonymous	RABGGTA	NM_004581.3,NM_182836.1	,	0,1,6199	TT,TC,CC		0.012,0.0,0.0081	,	544/568,544/568	24734893	1,12399	2017	4183	6200	SO:0001819	synonymous_variant	5875	exon16			GCACAGCGGGTTA		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.1632G>A	chr14.hg19:g.24734893C>T		119.0	0.0	.		116.0	40.0	.	NM_004581	A8K5N2|D3DS69	Silent	SNP	ENST00000399409.3	hg19	CCDS45088.1																																																																																			.	.	.	weak		0.612	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36143779	36143779	+	Silent	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr14:36143779A>C	ENST00000389698.3	-	22	3633	c.3243T>G	c.(3241-3243)ccT>ccG	p.P1081P	RALGAPA1_ENST00000382366.3_Silent_p.P1094P|RALGAPA1_ENST00000258840.6_Silent_p.P1128P|RALGAPA1_ENST00000307138.6_Silent_p.P1081P	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1081					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CATGTATTTCAGGATCCATGA	0.388																																					p.P1081P		Atlas-SNP	.											.	RALGAPA1	289	.	0			c.T3243G						PASS	.						26.0	27.0	27.0					14																	36143779		2201	4288	6489	SO:0001819	synonymous_variant	253959	exon22			TATTTCAGGATCC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.3243T>G	chr14.hg19:g.36143779A>C		246.0	0.0	.		243.0	72.0	.	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Silent	SNP	ENST00000389698.3	hg19	CCDS32065.1																																																																																			.	.	.	none		0.388	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
NPAP1	23742	hgsc.bcm.edu	37	15	24923342	24923342	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr15:24923342C>T	ENST00000329468.2	+	1	2802	c.2328C>T	c.(2326-2328)gcC>gcT	p.A776A		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	776					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A776A(1)									AATTTGGGGCCCCTGATGGGC	0.552																																					p.A776A		Atlas-SNP	.											C15orf2,NS,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	lung(1)	c.C2328T						PASS	.						109.0	128.0	121.0					15																	24923342		2203	4300	6503	SO:0001819	synonymous_variant	23742	exon1			TGGGGCCCCTGAT	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2328C>T	chr15.hg19:g.24923342C>T		20.0	0.0	.		34.0	14.0	.	NM_018958		Silent	SNP	ENST00000329468.2	hg19	CCDS10015.1																																																																																			.	.	.	none		0.552	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
ZNF75A	7627	hgsc.bcm.edu	37	16	3363138	3363138	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr16:3363138T>A	ENST00000574298.1	+	4	536	c.63T>A	c.(61-63)gaT>gaA	p.D21E	ZNF75A_ENST00000498240.2_Intron	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	21	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						TCTACAATGATGTAATGCAGG	0.408																																					p.D21E		Atlas-SNP	.											.	ZNF75A	34	.	0			c.T63A						PASS	.						131.0	118.0	122.0					16																	3363138		2197	4300	6497	SO:0001583	missense	7627	exon4			CAATGATGTAATG	X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.63T>A	chr16.hg19:g.3363138T>A	ENSP00000459566:p.Asp21Glu	112.0	0.0	.		170.0	84.0	.	NM_153028	Q0VDI8|Q92669	Missense_Mutation	SNP	ENST00000574298.1	hg19	CCDS10501.1	.	.	.	.	.	.	.	.	.	.	T	14.16	2.452955	0.43531	.	.	ENSG00000162086	ENST00000293995	.	.	.	3.48	1.13	0.20643	Krueppel-associated box (4);	.	.	.	.	T	0.40694	0.1127	L	0.42487	1.325	0.80722	D	1	B	0.16603	0.018	B	0.16722	0.016	T	0.12760	-1.0535	8	0.22706	T	0.39	.	2.7142	0.05183	0.1927:0.2235:0.0:0.5838	.	21	Q96N20	ZN75A_HUMAN	E	21	.	ENSP00000293995:D21E	D	+	3	2	ZNF75A	3303139	0.292000	0.24362	0.996000	0.52242	0.996000	0.88848	-0.885000	0.04161	0.207000	0.20607	0.379000	0.24179	GAT	.	.	.	none		0.408	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251506.2	NM_153028	
ACADVL	37	hgsc.bcm.edu	37	17	7127679	7127679	+	Silent	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:7127679T>C	ENST00000356839.5	+	16	1751	c.1572T>C	c.(1570-1572)ctT>ctC	p.L524L	ACADVL_ENST00000543245.2_Silent_p.L547L|MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000350303.5_Silent_p.L502L	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	524					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TCAGCGGACTTGTCCACCCGG	0.657																																					p.L547L		Atlas-SNP	.											.	ACADVL	43	.	0			c.T1641C						PASS	.						54.0	54.0	54.0					17																	7127679		2203	4300	6503	SO:0001819	synonymous_variant	37	exon17			CGGACTTGTCCAC	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.1572T>C	chr17.hg19:g.7127679T>C		73.0	0.0	.		106.0	49.0	.	NM_001270447	B4DEB6|F5H2A9|O76056|Q8WUL0	Silent	SNP	ENST00000356839.5	hg19	CCDS11090.1																																																																																			.	.	.	none		0.657	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018	
POLR2A	5430	hgsc.bcm.edu	37	17	7405000	7405000	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:7405000G>A	ENST00000322644.6	+	14	2700	c.2301G>A	c.(2299-2301)aaG>aaA	p.K767K		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	767					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				ATAACTTCAAGTCTATGGTCG	0.488																																					p.K767K		Atlas-SNP	.											.	POLR2A	157	.	0			c.G2301A						PASS	.						71.0	67.0	68.0					17																	7405000		2203	4300	6503	SO:0001819	synonymous_variant	5430	exon14			CTTCAAGTCTATG			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2301G>A	chr17.hg19:g.7405000G>A		88.0	0.0	.		140.0	34.0	.	NM_000937	A6NN93|B9EH88|Q6NX41	Silent	SNP	ENST00000322644.6	hg19	CCDS32548.1																																																																																			.	.	.	none		0.488	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
GPR179	440435	hgsc.bcm.edu	37	17	36492994	36492994	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:36492994C>T	ENST00000342292.4	-	4	1114	c.1094G>A	c.(1093-1095)aGc>aAc	p.S365N		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	365					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ATCCATGCAGCTGGTGCAGCC	0.632																																					p.S365N		Atlas-SNP	.											.	GPR179	170	.	0			c.G1094A						PASS	.						27.0	31.0	29.0					17																	36492994		2097	4237	6334	SO:0001583	missense	440435	exon4			ATGCAGCTGGTGC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.1094G>A	chr17.hg19:g.36492994C>T	ENSP00000345060:p.Ser365Asn	25.0	0.0	.		78.0	14.0	.	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	hg19	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554853	0.65425	.	.	ENSG00000188888	ENST00000342292	T	0.52295	0.67	5.19	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.36248	0.0960	L	0.46157	1.445	0.32221	N	0.57526	B	0.34290	0.447	B	0.32149	0.141	T	0.46331	-0.9199	10	0.37606	T	0.19	-10.9887	7.967	0.30104	0.0:0.6539:0.2598:0.0863	.	365	Q6PRD1	GP179_HUMAN	N	365	ENSP00000345060:S365N	ENSP00000345060:S365N	S	-	2	0	GPR179	33746520	0.669000	0.27502	0.999000	0.59377	0.940000	0.58332	0.856000	0.27818	2.709000	0.92574	0.561000	0.74099	AGC	.	.	.	none		0.632	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
OTOP3	347741	hgsc.bcm.edu	37	17	72942796	72942796	+	Silent	SNP	G	G	A	rs200903740		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:72942796G>A	ENST00000328801.4	+	6	846	c.846G>A	c.(844-846)gcG>gcA	p.A282A		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	282						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					ATGCCACCGCGTGTGAAGCTT	0.567																																					p.A282A		Atlas-SNP	.											.	OTOP3	64	.	0			c.G846A						PASS	.	G		0,4406		0,0,2203	132.0	125.0	127.0		846	2.1	0.1	17		127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OTOP3	NM_178233.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		282/597	72942796	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	347741	exon6			CACCGCGTGTGAA	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.846G>A	chr17.hg19:g.72942796G>A		60.0	0.0	.		90.0	4.0	.	NM_178233		Silent	SNP	ENST00000328801.4	hg19	CCDS11709.1																																																																																			.	G|0.999;A|0.001	0.001	weak		0.567	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445308.1	NM_178233	
CBX4	8535	hgsc.bcm.edu	37	17	77807927	77807927	+	Missense_Mutation	SNP	A	A	G	rs200965379		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:77807927A>G	ENST00000269397.4	-	5	1691	c.1514T>C	c.(1513-1515)gTg>gCg	p.V505A		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	505	Interaction with BMI1.|Poly-Ala.			V -> VAA (in Ref. 3; ACA49234). {ECO:0000305}.	chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			tgccgccgccaccgccaccgc	0.711																																					p.V505A		Atlas-SNP	.											CBX4,uveal_tract,malignant_melanoma,0,1	CBX4	40	.	0			c.T1514C						PASS	.						15.0	21.0	19.0					17																	77807927		1776	3704	5480	SO:0001583	missense	8535	exon5			GCCGCCACCGCCA	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1514T>C	chr17.hg19:g.77807927A>G	ENSP00000269397:p.Val505Ala	4.0	1.0	.		27.0	6.0	.	NM_003655	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	hg19	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	a	0.008	-1.872700	0.00542	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	.	.	.	0.575	0.575	0.17374	.	2.519730	0.02140	N	0.057046	T	0.20333	0.0489	N	0.08118	0	0.19775	N	0.999955	B	0.13594	0.008	B	0.04013	0.001	T	0.16217	-1.0410	8	0.32370	T	0.25	.	.	.	.	.	505	O00257	CBX4_HUMAN	A	505;235	.	ENSP00000269397:V505A	V	-	2	0	CBX4	75422522	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	0.179000	0.16840	0.475000	0.27415	0.158000	0.16466	GTG	.	.	.	weak		0.711	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
HMHA1	23526	hgsc.bcm.edu	37	19	1081736	1081736	+	Splice_Site	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:1081736A>C	ENST00000313093.2	+	18	2609	c.2378A>C	c.(2377-2379)aAg>aCg	p.K793T	HMHA1_ENST00000536472.1_Splice_Site_p.K661T|HMHA1_ENST00000539243.2_Splice_Site_p.K809T|HMHA1_ENST00000590214.1_Splice_Site_p.K820T|HMHA1_ENST00000543365.1_Splice_Site_p.K676T|HMHA1_ENST00000590577.1_Splice_Site_p.K428T|HMHA1_ENST00000586866.1_Splice_Site_p.K797T	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	793	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCGCACCAAGGTGAGGCGG	0.731																																					p.K809T		Atlas-SNP	.											.	HMHA1	78	.	0			c.A2426C						PASS	.						6.0	7.0	7.0					19																	1081736		2129	4218	6347	SO:0001630	splice_region_variant	23526	exon18			GCACCAAGGTGAG	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2379+1A>C	chr19.hg19:g.1081736A>C		2.0	0.0	.		31.0	10.0	.	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	hg19	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	a	22.3	4.273106	0.80580	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	4.55	4.55	0.56014	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.43787	0.1263	L	0.49455	1.56	0.58432	D	0.999996	D;D;D;D;D	0.69078	0.997;0.993;0.996;0.993;0.995	D;D;D;P;D	0.74674	0.928;0.945;0.984;0.892;0.967	T	0.40421	-0.9564	10	0.87932	D	0	-45.2741	13.1017	0.59224	1.0:0.0:0.0:0.0	.	661;809;428;676;793	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	T	809;793;793;661;787;676	ENSP00000439601:K809T;ENSP00000316772:K793T;ENSP00000445109:K661T;ENSP00000438979:K676T	ENSP00000316772:K793T	K	+	2	0	HMHA1	1032736	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	8.654000	0.91092	1.684000	0.51022	0.449000	0.29647	AAG	.	.	.	none		0.731	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		Missense_Mutation
EVI5L	115704	hgsc.bcm.edu	37	19	7917990	7917990	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:7917990C>G	ENST00000270530.4	+	9	1202	c.1006C>G	c.(1006-1008)Ccc>Gcc	p.P336A	EVI5L_ENST00000538904.2_Missense_Mutation_p.P336A	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	336					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						GAGAGTGATCCCCCACCAGTT	0.627											OREG0025211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P336A		Atlas-SNP	.											.	EVI5L	43	.	0			c.C1006G						PASS	.						123.0	122.0	123.0					19																	7917990		2203	4300	6503	SO:0001583	missense	115704	exon8			GTGATCCCCCACC	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.1006C>G	chr19.hg19:g.7917990C>G	ENSP00000270530:p.Pro336Ala	79.0	0.0	.	645	112.0	43.0	.	NM_001159944	B9A6I9	Missense_Mutation	SNP	ENST00000270530.4	hg19	CCDS12188.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277895	0.80692	.	.	ENSG00000142459	ENST00000270530;ENST00000538904	T;T	0.23147	1.92;1.92	3.8	3.8	0.43715	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.46639	0.1403	M	0.64567	1.98	0.58432	D	0.999999	D;P	0.89917	1.0;0.951	D;P	0.91635	0.999;0.727	T	0.47497	-0.9113	10	0.59425	D	0.04	-42.9871	13.5149	0.61535	0.0:1.0:0.0:0.0	.	336;336	B9A6I9;Q96CN4	.;EVI5L_HUMAN	A	336	ENSP00000270530:P336A;ENSP00000445905:P336A	ENSP00000270530:P336A	P	+	1	0	EVI5L	7823990	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.584000	0.82572	2.124000	0.65301	0.462000	0.41574	CCC	.	.	.	none		0.627	EVI5L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461347.1	NM_145245	
PGLYRP2	114770	hgsc.bcm.edu	37	19	15582776	15582776	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:15582776G>A	ENST00000340880.4	-	3	1748	c.1268C>T	c.(1267-1269)aCg>aTg	p.T423M	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.T423M	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	423					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						TGCGCAGCGCGTGAAGTCCGT	0.672																																					p.T423M		Atlas-SNP	.											.	PGLYRP2	116	.	0			c.C1268T						PASS	.						63.0	53.0	56.0					19																	15582776		2203	4300	6503	SO:0001583	missense	114770	exon3			CAGCGCGTGAAGT	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1268C>T	chr19.hg19:g.15582776G>A	ENSP00000345968:p.Thr423Met	59.0	0.0	.		88.0	5.0	.	NM_052890	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	hg19	CCDS12330.2	.	.	.	.	.	.	.	.	.	.	G	6.484	0.457468	0.12342	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.14391	2.51;2.51	4.62	-7.33	0.01431	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	2.474620	0.01368	N	0.012465	T	0.17704	0.0425	L	0.60455	1.87	0.09310	N	1	P;P	0.52316	0.952;0.889	P;P	0.49597	0.616;0.505	T	0.48068	-0.9067	10	0.52906	T	0.07	-14.711	4.6458	0.12572	0.0767:0.2083:0.1616:0.5534	.	423;423	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	M	423	ENSP00000345968:T423M;ENSP00000292609:T423M	ENSP00000292609:T423M	T	-	2	0	PGLYRP2	15443776	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.143000	0.10296	-1.075000	0.03129	-1.001000	0.02504	ACG	.	.	.	none		0.672	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890	
TMEM38A	79041	hgsc.bcm.edu	37	19	16793291	16793291	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:16793291G>C	ENST00000187762.2	+	4	617	c.526G>C	c.(526-528)Gag>Cag	p.E176Q		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	176						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						CTGGAAGCCAGAGACCAACGA	0.582																																					p.E176Q		Atlas-SNP	.											.	TMEM38A	32	.	0			c.G526C						PASS	.						149.0	123.0	132.0					19																	16793291		2203	4300	6503	SO:0001583	missense	79041	exon4			AAGCCAGAGACCA	AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.526G>C	chr19.hg19:g.16793291G>C	ENSP00000187762:p.Glu176Gln	92.0	0.0	.		133.0	42.0	.	NM_024074	A8K9P9	Missense_Mutation	SNP	ENST00000187762.2	hg19	CCDS12349.1	.	.	.	.	.	.	.	.	.	.	g	24.0	4.482621	0.84747	.	.	ENSG00000072954	ENST00000187762	.	.	.	5.38	4.35	0.52113	.	0.053986	0.64402	D	0.000001	T	0.72835	0.3510	M	0.71206	2.165	0.58432	D	0.999998	D	0.57571	0.98	P	0.58130	0.833	T	0.74325	-0.3702	9	0.46703	T	0.11	-30.6059	13.1225	0.59336	0.077:0.0:0.923:0.0	.	176	Q9H6F2	TM38A_HUMAN	Q	176	.	ENSP00000187762:E176Q	E	+	1	0	TMEM38A	16654291	1.000000	0.71417	0.674000	0.29902	0.978000	0.69477	7.723000	0.84788	1.258000	0.44101	0.655000	0.94253	GAG	.	.	.	none		0.582	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462841.1	NM_024074	
BABAM1	29086	hgsc.bcm.edu	37	19	17384931	17384931	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:17384931T>C	ENST00000359435.4	+	5	674	c.481T>C	c.(481-483)Tcc>Ccc	p.S161P	BABAM1_ENST00000601043.1_Missense_Mutation_p.S161P|BABAM1_ENST00000447614.2_Missense_Mutation_p.S161P|BABAM1_ENST00000448635.2_Intron|BABAM1_ENST00000595632.1_Intron|CTD-2278I10.6_ENST00000596542.1_Missense_Mutation_p.S83P|BABAM1_ENST00000598188.1_Missense_Mutation_p.S161P	NM_001033549.1	NP_001028721.1	Q9NWV8	BABA1_HUMAN	BRISC and BRCA1 A complex member 1	161	VWFA-like.				chromatin modification (GO:0016568)|double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5						TGGCCTGACCTCCGACCCCCG	0.667																																					p.S161P		Atlas-SNP	.											.	BABAM1	14	.	0			c.T481C						PASS	.						57.0	66.0	63.0					19																	17384931		2060	4203	6263	SO:0001583	missense	29086	exon5			CTGACCTCCGACC	AK000578	CCDS46012.1, CCDS74310.1	19p13.11	2011-02-21	2011-02-21	2011-01-31	ENSG00000105393	ENSG00000105393			25008	protein-coding gene	gene with protein product	"""Mediator of Rap80 Interactions and Targeting 40 kD"", ""new component of the BRCA1 A complex"""	612766	"""chromosome 19 open reading frame 62"""	C19orf62		11042152	Standard	NM_001288756		Approved	FLJ20571, HSPC142, NBA1, MERIT40	uc002nfv.3	Q9NWV8		ENST00000359435.4:c.481T>C	chr19.hg19:g.17384931T>C	ENSP00000352408:p.Ser161Pro	40.0	0.0	.		51.0	23.0	.	NM_014173	A8MQT0|B4DRY9|B4DVR1|Q6FIA0|Q9P018	Missense_Mutation	SNP	ENST00000359435.4	hg19	CCDS46012.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812432	0.70912	.	.	ENSG00000105393	ENST00000359435;ENST00000447614;ENST00000300965	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.76666	0.4019	M	0.66939	2.045	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.77885	-0.2421	9	0.52906	T	0.07	-27.2018	14.0114	0.64498	0.0:0.0:0.0:1.0	.	161	Q9NWV8	BABA1_HUMAN	P	161;161;83	.	ENSP00000300965:S83P	S	+	1	0	BABAM1	17245931	1.000000	0.71417	0.979000	0.43373	0.276000	0.26787	5.510000	0.67018	2.192000	0.70111	0.533000	0.62120	TCC	.	.	.	none		0.667	BABAM1-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463471.1	NM_014173	
SUGP2	10147	hgsc.bcm.edu	37	19	19106027	19106027	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:19106027C>T	ENST00000601879.1	-	9	3351	c.3054G>A	c.(3052-3054)atG>atA	p.M1018I	SUGP2_ENST00000456085.2_Missense_Mutation_p.M787I|SUGP2_ENST00000600377.1_Missense_Mutation_p.M1032I|AC004447.2_ENST00000594142.1_RNA|SUGP2_ENST00000452918.2_Missense_Mutation_p.M1018I|SUGP2_ENST00000337018.6_Missense_Mutation_p.M1018I			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	1018	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCTTCTGCAGCATCTGGAAGC	0.627																																					p.M1018I		Atlas-SNP	.											.	SUGP2	107	.	0			c.G3054A						PASS	.						64.0	53.0	57.0					19																	19106027		2203	4300	6503	SO:0001583	missense	10147	exon9			CTGCAGCATCTGG	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.3054G>A	chr19.hg19:g.19106027C>T	ENSP00000472286:p.Met1018Ile	61.0	0.0	.		57.0	19.0	.	NM_014884	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	hg19	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.017731	0.93404	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.05	5.05	0.67936	D111/G-patch (3);	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	M	0.73962	2.25	0.58432	D	0.999999	D;D;D	0.59357	0.969;0.985;0.969	D;D;D	0.72338	0.968;0.977;0.951	T	0.65627	-0.6122	10	0.72032	D	0.01	-26.6822	16.9459	0.86230	0.0:1.0:0.0:0.0	.	787;1018;1018	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	I	1018;966;1018;787	ENSP00000337926:M1018I;ENSP00000332373:M966I;ENSP00000389380:M1018I;ENSP00000409603:M787I	ENSP00000332373:M966I	M	-	3	0	SUGP2	18967027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.709000	0.74665	2.349000	0.79799	0.462000	0.41574	ATG	.	.	.	none		0.627	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392	
VSTM2B	342865	hgsc.bcm.edu	37	19	30018151	30018151	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:30018151T>C	ENST00000335523.7	+	2	201	c.116T>C	c.(115-117)gTa>gCa	p.V39A	CTC-525D6.2_ENST00000579268.1_RNA|CTC-525D6.1_ENST00000582581.1_RNA	NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	39	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)	2						GATGTGACAGTACGGGAGGGA	0.617																																					p.V39A		Atlas-SNP	.											.	VSTM2B	15	.	0			c.T116C						PASS	.						48.0	55.0	53.0					19																	30018151		692	1591	2283	SO:0001583	missense	342865	exon2			TGACAGTACGGGA		CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.116T>C	chr19.hg19:g.30018151T>C	ENSP00000335038:p.Val39Ala	52.0	0.0	.		69.0	13.0	.	NM_001146339		Missense_Mutation	SNP	ENST00000335523.7	hg19	CCDS46034.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.545112	0.27652	.	.	ENSG00000187135	ENST00000335523	T	0.68903	-0.36	4.59	4.59	0.56863	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.084546	0.46442	D	0.000299	T	0.50633	0.1627	N	0.25380	0.74	0.36591	D	0.874093	B	0.30605	0.287	B	0.34138	0.176	T	0.51888	-0.8648	10	0.05721	T	0.95	-17.0186	13.3667	0.60689	0.0:0.0:0.0:1.0	.	39	A6NLU5	VTM2B_HUMAN	A	39	ENSP00000335038:V39A	ENSP00000335038:V39A	V	+	2	0	VSTM2B	34709991	0.958000	0.32768	0.995000	0.50966	0.994000	0.84299	1.650000	0.37292	1.938000	0.56188	0.444000	0.29173	GTA	.	.	.	none		0.617	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458601.1	NM_001146339	
ETHE1	23474	hgsc.bcm.edu	37	19	44030497	44030497	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:44030497A>T	ENST00000292147.2	-	3	297	c.231T>A	c.(229-231)aaT>aaA	p.N77K	ZNF575_ENST00000458714.2_Intron|ETHE1_ENST00000600651.1_Missense_Mutation_p.N77K	NM_014297.3	NP_055112.2	O95571	ETHE1_HUMAN	ethylmalonic encephalopathy 1	77					cellular nitrogen compound metabolic process (GO:0034641)|glutathione metabolic process (GO:0006749)|hydrogen sulfide metabolic process (GO:0070813)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|sulfur dioxygenase activity (GO:0050313)			central_nervous_system(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	5		Prostate(69;0.0153)				GGCAGTGGGTATTCACTGGGA	0.637																																					p.N77K		Atlas-SNP	.											.	ETHE1	7	.	0			c.T231A						PASS	.						50.0	50.0	50.0					19																	44030497		2203	4300	6503	SO:0001583	missense	23474	exon3			GTGGGTATTCACT		CCDS12622.1	19q13.32	2014-06-20				ENSG00000105755	1.13.11.18		23287	protein-coding gene	gene with protein product		608451				19136963	Standard	NM_014297		Approved	YF13H12, HSCO	uc002owp.3	O95571		ENST00000292147.2:c.231T>A	chr19.hg19:g.44030497A>T	ENSP00000292147:p.Asn77Lys	143.0	0.0	.		131.0	43.0	.	NM_014297	Q96HR0|Q9H001	Missense_Mutation	SNP	ENST00000292147.2	hg19	CCDS12622.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.574665	0.86542	.	.	ENSG00000105755	ENST00000292147	T	0.80393	-1.37	4.67	-5.32	0.02722	Beta-lactamase-like (2);	0.000000	0.85682	D	0.000000	D	0.91666	0.7366	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.99;1.0	D	0.91960	0.5578	10	0.62326	D	0.03	-16.786	17.6863	0.88257	0.168:0.0:0.832:0.0	.	50;77	B2RCZ7;O95571	.;ETHE1_HUMAN	K	77	ENSP00000292147:N77K	ENSP00000292147:N77K	N	-	3	2	ETHE1	48722337	0.995000	0.38212	0.901000	0.35422	0.992000	0.81027	0.170000	0.16663	-1.038000	0.03279	-0.375000	0.07067	AAT	.	.	.	none		0.637	ETHE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463184.1	NM_014297	
JAG1	182	hgsc.bcm.edu	37	20	10653490	10653490	+	Nonsense_Mutation	SNP	A	A	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:10653490A>C	ENST00000254958.5	-	2	761	c.246T>G	c.(244-246)taT>taG	p.Y82*	RP11-103J8.1_ENST00000605292.1_RNA	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	82					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						CGCGGGACTGATACTCCTTGA	0.662									Alagille Syndrome																												p.Y82X		Atlas-SNP	.											.	JAG1	213	.	0			c.T246G						PASS	.						51.0	50.0	51.0					20																	10653490		2203	4299	6502	SO:0001587	stop_gained	182	exon2	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGACTGATACTCC	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.246T>G	chr20.hg19:g.10653490A>C	ENSP00000254958:p.Tyr82*	49.0	0.0	.		94.0	25.0	.	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Nonsense_Mutation	SNP	ENST00000254958.5	hg19	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	A	41	8.923643	0.99004	.	.	ENSG00000101384	ENST00000254958	.	.	.	5.28	1.45	0.22620	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9719	0.41759	0.4136:0.0:0.5864:0.0	.	.	.	.	X	82	.	ENSP00000254958:Y82X	Y	-	3	2	JAG1	10601490	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.053000	0.41326	0.554000	0.29061	0.459000	0.35465	TAT	.	.	.	none		0.662	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
DZANK1	55184	hgsc.bcm.edu	37	20	18414380	18414380	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:18414380C>T	ENST00000358866.6	-	8	799	c.777G>A	c.(775-777)ttG>ttA	p.L259L	DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000329494.5_Silent_p.L261L|DZANK1_ENST00000262547.5_Silent_p.L259L|DZANK1_ENST00000357236.4_Silent_p.L145L|RNA5SP476_ENST00000516613.1_RNA			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	259							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						TCATGGGTACCAAGCTTCTGC	0.458																																					p.L259L		Atlas-SNP	.											.	DZANK1	65	.	0			c.G777A						PASS	.						112.0	109.0	110.0					20																	18414380		2000	4182	6182	SO:0001819	synonymous_variant	55184	exon9			GGGTACCAAGCTT	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.777G>A	chr20.hg19:g.18414380C>T		68.0	0.0	.		61.0	14.0	.	NM_001099407	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Silent	SNP	ENST00000358866.6	hg19	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	C	0.837	-0.743265	0.03088	.	.	ENSG00000089091	ENST00000358866	.	.	.	4.97	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.6738	10.7045	0.45948	0.0:0.9065:0.0:0.0935	.	.	.	.	X	58	.	.	W	-	2	0	C20orf12	18362380	1.000000	0.71417	0.803000	0.32268	0.023000	0.10783	1.732000	0.38146	2.448000	0.82819	0.655000	0.94253	TGG	.	.	.	none		0.458	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	
SS18L1	26039	hgsc.bcm.edu	37	20	60738629	60738629	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:60738629C>A	ENST00000331758.3	+	6	698	c.672C>A	c.(670-672)agC>agA	p.S224R	SS18L1_ENST00000421564.1_Missense_Mutation_p.S224R|SS18L1_ENST00000370848.4_Missense_Mutation_p.S227R	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	224	Gln-rich.|Methionine-rich intra-molecular domain. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)			SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			GCCAGGGGAGCAGCATGATGG	0.731			T	SSX1	synovial sarcoma																																p.S224R		Atlas-SNP	.		Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	.	SS18L1	37	.	0			c.C672A						PASS	.						23.0	25.0	25.0					20																	60738629		2195	4294	6489	SO:0001583	missense	26039	exon6			GGGGAGCAGCATG	AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.672C>A	chr20.hg19:g.60738629C>A	ENSP00000333012:p.Ser224Arg	2.0	0.0	.		98.0	43.0	.	NM_198935	A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Missense_Mutation	SNP	ENST00000331758.3	hg19	CCDS13491.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499248	0.64298	.	.	ENSG00000184402	ENST00000421564;ENST00000331758;ENST00000370848	T;T;T	0.32515	1.45;1.45;1.46	4.99	3.03	0.35002	.	0.269496	0.44483	D	0.000453	T	0.28499	0.0705	L	0.47716	1.5	0.25078	N	0.990947	P;P	0.45902	0.651;0.868	B;B	0.42319	0.198;0.383	T	0.11036	-1.0604	10	0.87932	D	0	-10.1574	11.0441	0.47849	0.0:0.8465:0.0:0.1535	.	224;224	B4DSR7;O75177	.;CREST_HUMAN	R	224;224;227	ENSP00000393999:S224R;ENSP00000333012:S224R;ENSP00000359885:S227R	ENSP00000333012:S224R	S	+	3	2	SS18L1	60172024	1.000000	0.71417	0.766000	0.31476	0.987000	0.75469	1.854000	0.39368	0.498000	0.27948	0.467000	0.42956	AGC	.	.	.	none		0.731	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080004.2		
PWP2	5822	hgsc.bcm.edu	37	21	45534138	45534138	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr21:45534138T>C	ENST00000291576.7	+	4	432	c.305T>C	c.(304-306)gTg>gCg	p.V102A		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	102					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GTGCACAGTGTGTCCTTCTCC	0.652											OREG0026247	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V102A		Atlas-SNP	.											.	PWP2	64	.	0			c.T305C						PASS	.						113.0	94.0	100.0					21																	45534138		2203	4300	6503	SO:0001583	missense	5822	exon4			ACAGTGTGTCCTT		CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.305T>C	chr21.hg19:g.45534138T>C	ENSP00000291576:p.Val102Ala	89.0	0.0	.	932	85.0	17.0	.	NM_005049	B2RAG8|Q96A77	Missense_Mutation	SNP	ENST00000291576.7	hg19	CCDS33579.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.498423	0.64298	.	.	ENSG00000241945	ENST00000291576	T	0.50001	0.76	4.8	4.8	0.61643	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.213399	0.38720	N	0.001592	T	0.35451	0.0932	L	0.33624	1.015	0.46131	D	0.998884	B	0.31383	0.321	B	0.25506	0.061	T	0.21999	-1.0229	10	0.42905	T	0.14	-8.6121	12.8724	0.57972	0.0:0.0:0.0:1.0	.	102	Q15269	PWP2_HUMAN	A	102	ENSP00000291576:V102A	ENSP00000291576:V102A	V	+	2	0	PWP2	44358566	0.995000	0.38212	0.948000	0.38648	0.736000	0.42039	5.690000	0.68241	1.929000	0.55896	0.402000	0.26972	GTG	.	.	.	none		0.652	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049	
C22orf15	150248	hgsc.bcm.edu	37	22	24106287	24106287	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr22:24106287G>A	ENST00000402217.3	+	2	292	c.39G>A	c.(37-39)gtG>gtA	p.V13V	C22orf15_ENST00000305199.5_Silent_p.V13V|C22orf15_ENST00000382821.3_Silent_p.V13V	NM_182520.2	NP_872326.2	Q8WYQ4	CV015_HUMAN	chromosome 22 open reading frame 15	13										breast(1)|pancreas(1)	2		Medulloblastoma(6;6.27e-05)|all_neural(6;0.00518)				GCTGCTCGGTGCTGGTGAACA	0.602																																					p.V13V		Atlas-SNP	.											.	C22orf15	5	.	0			c.G39A						PASS	.						86.0	90.0	89.0					22																	24106287		692	1591	2283	SO:0001819	synonymous_variant	150248	exon2			CTCGGTGCTGGTG	AB050773	CCDS13814.2	22q11.23	2012-11-13			ENSG00000169314	ENSG00000169314			15558	protein-coding gene	gene with protein product							Standard	NM_182520		Approved	FLJ36561, N27C7-3	uc011aja.2	Q8WYQ4	OTTHUMG00000150740	ENST00000402217.3:c.39G>A	chr22.hg19:g.24106287G>A		95.0	0.0	.		65.0	25.0	.	NM_182520	Q6ICJ7	Silent	SNP	ENST00000402217.3	hg19	CCDS13814.2																																																																																			.	.	.	none		0.602	C22orf15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319887.2	NM_182520	
GATSL3	652968	hgsc.bcm.edu	37	22	30685454	30685454	+	Silent	SNP	C	C	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr22:30685454C>T	ENST00000407689.3	-	1	162	c.33G>A	c.(31-33)cgG>cgA	p.R11R	GATSL3_ENST00000459785.1_5'Flank|RP1-130H16.18_ENST00000447976.1_Intron|GATSL3_ENST00000404953.3_Silent_p.R11R	NM_001037666.2	NP_001032755.1	Q8WTX7	GATL3_HUMAN	GATS protein-like 3	11										breast(1)|endometrium(1)|lung(1)	3						CGCTCAGCACCCGCACCCGGT	0.741																																					p.R11R		Atlas-SNP	.											.	GATSL3	14	.	0			c.G33A						PASS	.						11.0	18.0	16.0					22																	30685454		1870	4079	5949	SO:0001819	synonymous_variant	652968	exon1			CAGCACCCGCACC		CCDS43001.1	22q12	2010-06-23			ENSG00000239282	ENSG00000239282			34423	protein-coding gene	gene with protein product							Standard	NM_001037666		Approved			Q8WTX7	OTTHUMG00000150929	ENST00000407689.3:c.33G>A	chr22.hg19:g.30685454C>T		8.0	0.0	.		56.0	20.0	.	NM_001037666	O76052|Q96ND9|Q9UIE8	Silent	SNP	ENST00000407689.3	hg19	CCDS43001.1																																																																																			.	.	.	none		0.741	GATSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320581.2	NM_001037666	
CBY1	25776	hgsc.bcm.edu	37	22	39066951	39066951	+	Silent	SNP	G	G	A			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr22:39066951G>A	ENST00000216029.3	+	3	275	c.141G>A	c.(139-141)ctG>ctA	p.L47L	RP3-508I15.10_ENST00000423346.1_RNA|RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000422408.2_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	47					cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					CTATGAACCTGGCAGGGCAAA	0.527																																					p.L90L		Atlas-SNP	.											.	CBY1	10	.	0			c.G270A						PASS	.						144.0	143.0	143.0					22																	39066951		2203	4300	6503	SO:0001819	synonymous_variant	25776	exon4			GAACCTGGCAGGG	BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.141G>A	chr22.hg19:g.39066951G>A		64.0	0.0	.		67.0	14.0	.	NM_001002880	B2R4S2|Q66GT6|Q9UIK9	Silent	SNP	ENST00000216029.3	hg19	CCDS13974.1																																																																																			.	.	.	none		0.527	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320832.1	NM_015373	
MT-CYB	4519	hgsc.bcm.edu	37	M	14808	14808	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chrM:14808T>C	ENST00000361789.2	+	1	62	c.62T>C	c.(61-63)cTc>cCc	p.L21P	MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	21					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ATTCATCGACCTCCCCACCCC	0.443																																					p.L21P		Atlas-SNP	.											.	.	.	.	0			c.T62C						PASS	.																																			SO:0001583	missense	0	exon1			TCGACCTCCCCAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.62T>C	chrM.hg19:g.14808T>C	ENSP00000354554:p.Leu21Pro	188.0	0.0	.		21.0	11.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.443	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
HOOK2	29911	hgsc.bcm.edu	37	19	12874398	12874398	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:12874398delT	ENST00000397668.3	-	22	2027	c.1954delA	c.(1954-1956)agcfs	p.S652fs	HOOK2_ENST00000589965.1_5'Flank|HOOK2_ENST00000264827.5_Frame_Shift_Del_p.S650fs	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	652	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with CNTRL.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						TGACTTCGGCTTTTCTCAAAG	0.522																																					p.S652fs		Atlas-Indel,Pindel	.											.	HOOK2	73	.	0			c.1955delG						PASS	.						185.0	194.0	191.0					19																	12874398		2203	4300	6503	SO:0001589	frameshift_variant	29911	exon22			.	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1954delA	chr19.hg19:g.12874398delT	ENSP00000380785:p.Ser652fs	121.0	0.0	0		118.0	40.0	0.338983	NM_013312	O60562	Frame_Shift_Del	DEL	ENST00000397668.3	hg19	CCDS42508.1																																																																																			.	.	.	none		0.522	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451008.1	NM_013312	
TTLL5	23093	hgsc.bcm.edu	37	14	76243163	76243163	+	Frame_Shift_Del	DEL	A	A	-	rs372279209		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr14:76243163delA	ENST00000298832.9	+	23	2562	c.2357delA	c.(2356-2358)gaafs	p.E786fs	TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000556893.1_Frame_Shift_Del_p.E337fs|TTLL5_ENST00000554510.1_Frame_Shift_Del_p.E295fs|TTLL5_ENST00000557636.1_Frame_Shift_Del_p.E800fs	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	786					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTGAATATGGAAAACTTTCAG	0.403																																					p.E786fs		Atlas-Indel,Pindel	.											.	TTLL5	102	.	0			c.2356delG						PASS	.						130.0	127.0	128.0					14																	76243163		2203	4300	6503	SO:0001589	frameshift_variant	23093	exon23			.	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.2357delA	chr14.hg19:g.76243163delA	ENSP00000298832:p.Glu786fs	92.0	0.0	0		97.0	21.0	0.216495	NM_015072	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Frame_Shift_Del	DEL	ENST00000298832.9	hg19	CCDS32124.1																																																																																			.	.	.	none		0.403	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	NM_015072	
RSPH3	83861	hgsc.bcm.edu	37	6	159398820	159398821	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr6:159398820_159398821delTG	ENST00000252655.1	-	8	1621_1622	c.1432_1433delCA	c.(1432-1434)catfs	p.H478fs	RSPH3_ENST00000607398.1_5'Flank|RSPH3_ENST00000297262.3_Frame_Shift_Del_p.H382fs|RSPH3_ENST00000449822.1_Frame_Shift_Del_p.H240fs|RSPH3_ENST00000367069.2_Frame_Shift_Del_p.H336fs	NM_031924.4	NP_114130.3	Q86UC2	RSPH3_HUMAN	radial spoke 3 homolog (Chlamydomonas)	478										endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|skin(1)|stomach(7)	23		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)		TGGAGACTGATGTGTGTCTTCC	0.48																																					p.478_478del		Atlas-Indel,Pindel	.											.	RSPH3	48	.	0			c.1433_1434del						PASS	.																																			SO:0001589	frameshift_variant	83861	exon8			.	AF353618	CCDS5260.1	6q25.3	2014-05-16	2008-07-04	2007-06-26	ENSG00000130363	ENSG00000130363			21054	protein-coding gene	gene with protein product		615876	"""radial spokehead-like 2"""	RSHL2		12477932	Standard	NM_031924		Approved	dJ111C20.1, RSP3	uc003qrx.3	Q86UC2	OTTHUMG00000015924	ENST00000252655.1:c.1432_1433delCA	chr6.hg19:g.159398824_159398825delTG	ENSP00000252655:p.His478fs	72.0	0.0	0		77.0	23.0	0.298701	NM_031924	Q96LQ5|Q96LX2|Q9BX75	Frame_Shift_Del	DEL	ENST00000252655.1	hg19	CCDS5260.1																																																																																			.	.	.	none		0.480	RSPH3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_031924	
KLRC3	3823	hgsc.bcm.edu	37	12	10573086	10573086	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:10573086delT	ENST00000396439.2	-	1	108	c.64delA	c.(64-66)aggfs	p.R22fs	NKG2-E_ENST00000539033.1_Intron|KLRC3_ENST00000381904.2_Frame_Shift_Del_p.R22fs|KLRC3_ENST00000381903.2_Frame_Shift_Del_p.R22fs	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	22					cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						TTAGGTTTCCTTTGCTGCCAC	0.438																																					p.R22fs		Atlas-INDEL	.											.	KLRC3	25	.	0			c.65delG						PASS	.						98.0	96.0	97.0					12																	10573086		2203	4297	6500	SO:0001589	frameshift_variant	3823	exon1			.	L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.64delA	chr12.hg19:g.10573086delT	ENSP00000379716:p.Arg22fs	68.0	0.0	0		48.0	13.0	0.270833	NM_007333	Q8WXA4|Q96RL0|Q9UP04	Frame_Shift_Del	DEL	ENST00000396439.2	hg19	CCDS41755.1																																																																																			.	.	.	none		0.438	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393471.1	NM_002261	
LOC81691	81691	hgsc.bcm.edu	37	16	20851720	20851720	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr16:20851720delG	ENST00000261377.6	+	15	1765	c.1556delG	c.(1555-1557)aggfs	p.R519fs	ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000564274.1_Frame_Shift_Del_p.R519fs|AC004381.6_ENST00000348433.6_Frame_Shift_Del_p.R519fs	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					TGCAATCTCAGGGCTCTGAAG	0.408																																					p.R519fs		Atlas-Indel,Pindel	.											.	LOC81691	41	.	0			c.1555delA						PASS	.						113.0	115.0	115.0					16																	20851720		2201	4300	6501	SO:0001589	frameshift_variant	0	exon15			.																												ENST00000261377.6:c.1556delG	chr16.hg19:g.20851720delG	ENSP00000261377:p.Arg519fs	71.0	0.0	0		70.0	34.0	0.485714	NM_001144924		Frame_Shift_Del	DEL	ENST00000261377.6	hg19	CCDS10591.1																																																																																			.	.	.	none		0.408	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2		
KLRC3	3823	hgsc.bcm.edu	37	12	10588522	10588522	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr12:10588522delT	ENST00000539033.1	-	1	78	c.64delA	c.(64-66)aggfs	p.R22fs	KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381902.2_Frame_Shift_Del_p.R22fs|KLRC2_ENST00000381901.1_Frame_Shift_Del_p.R22fs																							TTAGGTTTCCTTTGCTGCCGC	0.438																																					p.R22fs		Atlas-INDEL	.											.	KLRC2	29	.	0			c.65delG						PASS	.						250.0	250.0	250.0					12																	10588522		2203	4300	6503	SO:0001589	frameshift_variant	3822	exon1			.																												ENST00000539033.1:c.64delA	chr12.hg19:g.10588522delT	ENSP00000437563:p.Arg22fs	146.0	0.0	0		154.0	34.0	0.220779	NM_002260		Frame_Shift_Del	DEL	ENST00000539033.1	hg19																																																																																				.	.	.	none		0.438	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1		
CCDC181	57821	hgsc.bcm.edu	37	1	169390718	169390718	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr1:169390718delA	ENST00000367806.3	-	3	1103	c.951delT	c.(949-951)tctfs	p.S317fs	CCDC181_ENST00000367805.3_Frame_Shift_Del_p.S317fs|CCDC181_ENST00000491570.1_5'UTR|CCDC181_ENST00000545005.1_Frame_Shift_Del_p.S317fs	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	317						nucleus (GO:0005634)											TCCTGTGATTAGATTTCCCAT	0.463																																					p.N318fs		Atlas-Indel,Pindel	.											.	C1orf114	67	.	0			c.952delA						PASS	.						159.0	145.0	150.0					1																	169390718		2203	4300	6503	SO:0001589	frameshift_variant	57821	exon3			.	AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.951delT	chr1.hg19:g.169390718delA	ENSP00000356780:p.Ser317fs	73.0	0.0	0		77.0	35.0	0.454545	NM_021179	O60780|Q53FD5|Q5TID9|Q8TC48	Frame_Shift_Del	DEL	ENST00000367806.3	hg19																																																																																				.	.	.	none		0.463	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086099.1	NM_021179	
GPATCH8	23131	hgsc.bcm.edu	37	17	42475173	42475176	+	Frame_Shift_Del	DEL	TGAG	TGAG	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	TGAG	TGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr17:42475173_42475176delTGAG	ENST00000591680.1	-	8	4299_4302	c.4269_4272delCTCA	c.(4267-4272)cactcafs	p.HS1423fs	GPATCH8_ENST00000434000.1_Frame_Shift_Del_p.HS1345fs	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1423							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CAGGGATGATTGAGTGAGTGAGGT	0.588																																					p.1424_1425del		Atlas-Indel,Pindel	.											.	GPATCH8	114	.	0			c.4270_4273del						PASS	.																																			SO:0001589	frameshift_variant	23131	exon8			.	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.4269_4272delCTCA	chr17.hg19:g.42475181_42475184delTGAG	ENSP00000467556:p.His1423fs	206.0	0.0	0		263.0	112.0	0.425856	NM_001002909	B9EGP9|O60300|Q8TB99	Frame_Shift_Del	DEL	ENST00000591680.1	hg19	CCDS32666.1																																																																																			.	.	.	none		0.588	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
SLC7A13	157724	hgsc.bcm.edu	37	8	87235298	87235298	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr8:87235298delT	ENST00000297524.3	-	2	823	c.720delA	c.(718-720)aaafs	p.K240fs	SLC7A13_ENST00000520624.1_5'UTR|SLC7A13_ENST00000419776.2_Frame_Shift_Del_p.K231fs	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	240						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						TAAATATGCATTTGGGAATTG	0.363																																					p.C241fs		Atlas-Indel,Pindel	.											.	SLC7A13	97	.	0			c.721delT						PASS	.						147.0	152.0	150.0					8																	87235298		2203	4300	6503	SO:0001589	frameshift_variant	157724	exon2			.	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.720delA	chr8.hg19:g.87235298delT	ENSP00000297524:p.Lys240fs	47.0	0.0	0		55.0	16.0	0.290909	NM_138817	Q05C37|Q08AH9|Q96N84	Frame_Shift_Del	DEL	ENST00000297524.3	hg19	CCDS34917.1																																																																																			.	.	.	none		0.363	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	
KMT2C	58508	hgsc.bcm.edu	37	7	151873882	151873883	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:151873882_151873883delTT	ENST00000262189.6	-	38	8873_8874	c.8655_8656delAA	c.(8653-8658)gaaactfs	p.ET2885fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.ET2885fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2885					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GGGCCAGCAGTTTCTCGATTGG	0.441																																					p.2886_2886del		Atlas-Indel,Pindel	.											.	MLL3	1564	.	0			c.8656_8657del						PASS	.																																			SO:0001589	frameshift_variant	58508	exon38			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8655_8656delAA	chr7.hg19:g.151873882_151873883delTT	ENSP00000262189:p.Glu2885fs	98.0	0.0	0		164.0	98.0	0.597561	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	hg19	CCDS5931.1																																																																																			.	.	.	none		0.441	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
THSD7A	221981	hgsc.bcm.edu	37	7	11486930	11486931	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr7:11486930_11486931insT	ENST00000423059.4	-	12	2977_2978	c.2726_2727insA	c.(2725-2727)ttgfs	p.L909fs	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	909	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ACCAGCTGGTCAATTGACAGTC	0.53										HNSCC(18;0.044)																											p.L909fs		Atlas-Indel,Pindel	.											.	THSD7A	219	.	0			c.2727_2728insA						PASS	.																																			SO:0001589	frameshift_variant	221981	exon12			.		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2726_2727insA	chr7.hg19:g.11486930_11486931insT	ENSP00000406482:p.Leu909fs	85.0	0.0	0		167.0	84.0	0.502994	NM_015204		Frame_Shift_Ins	INS	ENST00000423059.4	hg19	CCDS47543.1																																																																																			.	.	.	none		0.530	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
PIK3R1	5295	hgsc.bcm.edu	37	5	67588157	67588158	+	Frame_Shift_Ins	INS	-	-	G			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr5:67588157_67588158insG	ENST00000521381.1	+	8	1603_1604	c.987_988insG	c.(988-990)gatfs	p.D330fs	PIK3R1_ENST00000523872.1_5'Flank|PIK3R1_ENST00000336483.5_Frame_Shift_Ins_p.D60fs|PIK3R1_ENST00000396611.1_Frame_Shift_Ins_p.D330fs|PIK3R1_ENST00000521657.1_Frame_Shift_Ins_p.D330fs|PIK3R1_ENST00000320694.8_Frame_Shift_Ins_p.D30fs|PIK3R1_ENST00000274335.5_Frame_Shift_Ins_p.D330fs	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	330				D -> N (in Ref. 1; M61906). {ECO:0000305}.	B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TGTCCTTACAAGATGCTGAATG	0.396			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.Q329fs		Atlas-Indel,Pindel	.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1	869	.	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.987_988insG						PASS	.																																			SO:0001589	frameshift_variant	5295	exon8			.	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.988dupG	chr5.hg19:g.67588158_67588158dupG	ENSP00000428056:p.Asp330fs	51.0	0.0	0		55.0	24.0	0.436364	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Frame_Shift_Ins	INS	ENST00000521381.1	hg19	CCDS3993.1																																																																																			.	.	.	none		0.396	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
NUP62	23636	hgsc.bcm.edu	37	19	50411616	50411633	+	In_Frame_Del	DEL	GTCCATGTGCGCATTGAG	GTCCATGTGCGCATTGAG	-	rs139913264|rs61751953|rs151075180		TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	GTCCATGTGCGCATTGAG	GTCCATGTGCGCATTGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:50411616_50411633delGTCCATGTGCGCATTGAG	ENST00000596217.1	-	2	3319_3336	c.1432_1449delCTCAATGCGCACATGGAC	c.(1432-1449)ctcaatgcgcacatggacdel	p.LNAHMD478del	IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000597723.1_In_Frame_Del_p.LNAHMD402del|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000352066.3_In_Frame_Del_p.LNAHMD478del|NUP62_ENST00000422090.2_In_Frame_Del_p.LNAHMD478del|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000597029.1_In_Frame_Del_p.LNAHMD478del|NUP62_ENST00000413454.1_In_Frame_Del_p.LNAHMD478del			P37198	NUP62_HUMAN	nucleoporin 62kDa	478					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)	p.A480A(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ACTGCAGTGAGTCCATGTGCGCATTGAGGATCTTGCAG	0.628																																					p.478_484del		Atlas-INDEL	.											.	NUP62	50	.	1	Substitution - coding silent(1)	lung(1)	c.1433_1450del						PASS	.																																			SO:0001651	inframe_deletion	23636	exon3			.	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.1432_1449delCTCAATGCGCACATGGAC	chr19.hg19:g.50411616_50411633delGTCCATGTGCGCATTGAG	ENSP00000471191:p.Leu478_Asp483del	47.0	0.0	0		62.0	17.0	0.274194	NM_153719	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	In_Frame_Del	DEL	ENST00000596217.1	hg19	CCDS12788.1																																																																																			.	.	.	none		0.628	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
ROBO1	6091	hgsc.bcm.edu	37	3	79639003	79639003	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr3:79639003delT	ENST00000464233.1	-	2	172	c.59delA	c.(58-60)aatfs	p.N20fs		NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	20					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AAACAGGTGATTTGGGGATAA	0.393																																					p.N20fs		Atlas-INDEL	.											.	ROBO1	833	.	0			c.60delT						PASS	.						165.0	164.0	164.0					3																	79639003		1916	4117	6033	SO:0001589	frameshift_variant	6091	exon2			.	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.59delA	chr3.hg19:g.79639003delT	ENSP00000420321:p.Asn20fs	153.0	0.0	0		165.0	11.0	0.0666667	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Frame_Shift_Del	DEL	ENST00000464233.1	hg19	CCDS54611.1																																																																																			.	.	.	none		0.393	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
PRKCG	5582	hgsc.bcm.edu	37	19	54401854	54401854	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr19:54401854delC	ENST00000263431.3	+	11	1535	c.1253delC	c.(1252-1254)accfs	p.T418fs	PRKCG_ENST00000542049.1_Frame_Shift_Del_p.T305fs|PRKCG_ENST00000540413.1_Frame_Shift_Del_p.T418fs	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	418	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CACTTCCTCACCCAGCTCCAC	0.662																																					p.T418fs		Atlas-Indel,Pindel	.											.	PRKCG	246	.	0			c.1252delA						PASS	.						12.0	13.0	13.0					19																	54401854		2200	4285	6485	SO:0001589	frameshift_variant	5582	exon11			.	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1253delC	chr19.hg19:g.54401854delC	ENSP00000263431:p.Thr418fs	52.0	0.0	0		71.0	28.0	0.394366	NM_002739	B7Z8Q0	Frame_Shift_Del	DEL	ENST00000263431.3	hg19	CCDS12867.1																																																																																			.	.	.	none		0.662	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
BPIFA1	51297	hgsc.bcm.edu	37	20	31829269	31829269	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr20:31829269delG	ENST00000354297.4	+	6	731	c.660delG	c.(658-660)cagfs	p.Q220fs	BPIFA1_ENST00000375422.2_Frame_Shift_Del_p.Q220fs|BPIFA1_ENST00000375413.4_Frame_Shift_Del_p.Q220fs	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	220				Q -> K (in Ref. 1; AAF70860). {ECO:0000305}.	antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										AGTTGGTTCAGGGCAACGTAA	0.512																																					p.Q220fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.659delA						PASS	.						164.0	158.0	160.0					20																	31829269		2203	4300	6503	SO:0001589	frameshift_variant	51297	exon6			.	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.660delG	chr20.hg19:g.31829269delG	ENSP00000346251:p.Gln220fs	115.0	0.0	0		85.0	20.0	0.235294	NM_130852	A8K9R3|E1P5M9|Q9NZT0	Frame_Shift_Del	DEL	ENST00000354297.4	hg19	CCDS13217.1																																																																																			.	.	.	none		0.512	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852	
NAIP	4671	hgsc.bcm.edu	37	5	70279772	70279772	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E7-01A-31D-A28G-10	TCGA-P4-A5E7-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b75f116-8565-4b91-8bbe-c053a72fad8c	4106b575-287e-4493-8e74-2a72b1b94591	g.chr5:70279772delT	ENST00000517649.1	-	12	3394	c.3104delA	c.(3103-3105)aacfs	p.N1035fs	NAIP_ENST00000508426.2_Frame_Shift_Del_p.N1035fs|NAIP_ENST00000194097.4_Frame_Shift_Del_p.N1035fs|NAIP_ENST00000503719.2_Frame_Shift_Del_p.N873fs|NAIP_ENST00000523981.1_Frame_Shift_Del_p.N873fs	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein	1035					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)			central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TCTGCTGTGGTTTAAATGGAG	0.468																																					p.N1035fs		Atlas-INDEL	.											.	NAIP	38	.	0			c.3105delC						PASS	.																																			SO:0001589	frameshift_variant	4671	exon12			.	U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.3104delA	chr5.hg19:g.70279772delT	ENSP00000428657:p.Asn1035fs	221.0	0.0	0		221.0	17.0	0.0769231	NM_004536	B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Frame_Shift_Del	DEL	ENST00000517649.1	hg19	CCDS4009.1																																																																																			.	.	.	none		0.468	NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536	
