#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LYSMD1	388695	hgsc.bcm.edu	37	1	151134570	151134570	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr1:151134570G>T	ENST00000368908.5	-	2	847	c.187C>A	c.(187-189)Cag>Aag	p.Q63K	LYSMD1_ENST00000440902.2_Missense_Mutation_p.Q15K	NM_212551.4	NP_997716.1	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain containing 1	63										endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CGTTTAATCTGTTCCATCTTA	0.378																																					p.Q63K		Atlas-SNP	.											.	LYSMD1	23	.	0			c.C187A						PASS	.						50.0	51.0	51.0					1																	151134570		2203	4300	6503	SO:0001583	missense	388695	exon2			TAATCTGTTCCAT	BX647911	CCDS986.1, CCDS44218.1	1q21.2	2008-02-05			ENSG00000163155	ENSG00000163155			32070	protein-coding gene	gene with protein product						12477932	Standard	NM_212551		Approved	SB145, MGC35223, RP11-68I18.5	uc001ewy.3	Q96S90	OTTHUMG00000012260	ENST00000368908.5:c.187C>A	chr1.hg19:g.151134570G>T	ENSP00000357904:p.Gln63Lys	69.0	0.0	.		71.0	27.0	.	NM_212551	B4DQA1|Q69YX9	Missense_Mutation	SNP	ENST00000368908.5	hg19	CCDS986.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637942	0.67130	.	.	ENSG00000163155	ENST00000368908;ENST00000440902	T;T	0.40225	1.12;1.04	5.66	4.73	0.59995	Peptidoglycan-binding Lysin subgroup (1);Peptidoglycan-binding lysin domain (1);	0.000000	0.85682	D	0.000000	T	0.20210	0.0486	L	0.33189	0.99	0.49915	D	0.99983	P;B	0.41450	0.75;0.235	B;B	0.36766	0.232;0.103	T	0.07520	-1.0768	10	0.87932	D	0	-2.7477	14.7732	0.69696	0.0:0.0:0.8542:0.1457	.	15;63	Q96S90-2;Q96S90	.;LYSM1_HUMAN	K	63;15	ENSP00000357904:Q63K;ENSP00000404059:Q15K	ENSP00000357904:Q63K	Q	-	1	0	LYSMD1	149401194	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.056000	0.93881	1.345000	0.45676	0.467000	0.42956	CAG	.	.	.	none		0.378	LYSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034070.3	NM_212551	
TOR1AIP2	163590	hgsc.bcm.edu	37	1	179815212	179815212	+	Silent	SNP	A	A	C			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr1:179815212A>C	ENST00000367612.3	-	6	1794	c.1407T>G	c.(1405-1407)ctT>ctG	p.L469L	TOR1AIP2_ENST00000609928.1_Silent_p.L469L	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						AGCTTTAGAAAAGGCACCCCT	0.423																																					p.L469L		Atlas-SNP	.											.	TOR1AIP2	38	.	0			c.T1407G						PASS	.						90.0	88.0	89.0					1																	179815212		2203	4300	6503	SO:0001819	synonymous_variant	163590	exon7			TTAGAAAAGGCAC		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.1407T>G	chr1.hg19:g.179815212A>C		118.0	0.0	.		110.0	6.0	.	NM_001199260	Q05BU2	Silent	SNP	ENST00000367612.3	hg19	CCDS1334.1																																																																																			.	.	.	none		0.423	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034	
OR2T4	127074	hgsc.bcm.edu	37	1	248525639	248525639	+	Missense_Mutation	SNP	A	A	C	rs34079073|rs76878172	byFrequency	TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr1:248525639A>C	ENST00000366475.1	+	1	757	c.757A>C	c.(757-759)Atc>Ctc	p.I253L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTATTTACTCATCCTCCTCAC	0.522																																					p.I253L		Atlas-SNP	.											OR2T4,brain,glioma,0,1	OR2T4	126	.	0			c.A757C						PASS	.						94.0	74.0	81.0					1																	248525639		2024	3426	5450	SO:0001583	missense	127074	exon1			TTACTCATCCTCC	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.757A>C	chr1.hg19:g.248525639A>C	ENSP00000355431:p.Ile253Leu	668.0	1.0	.		562.0	23.0	.	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	hg19	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.326339	0.41197	.	.	ENSG00000196944	ENST00000366475	T	0.00392	7.58	3.09	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.01156	0.0038	H	0.94306	3.52	0.31855	N	0.621781	P	0.50156	0.932	P	0.59948	0.866	T	0.00865	-1.1535	10	0.72032	D	0.01	.	11.1471	0.48436	1.0:0.0:0.0:0.0	.	253	Q8NH00	OR2T4_HUMAN	L	253	ENSP00000355431:I253L	ENSP00000355431:I253L	I	+	1	0	OR2T4	246592262	1.000000	0.71417	0.050000	0.19076	0.010000	0.07245	7.329000	0.79170	1.264000	0.44198	0.477000	0.44152	ATC	.	.	.	alt		0.522	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
THUMPD2	80745	hgsc.bcm.edu	37	2	39964200	39964200	+	Splice_Site	SNP	C	C	G			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr2:39964200C>G	ENST00000505747.1	-	10	1215		c.e10-1		THUMPD2_ENST00000260619.6_Splice_Site	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2								methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				ATGAAGCACTCTGTGACAAAA	0.353																																					.		Atlas-SNP	.											.	THUMPD2	35	.	0			c.1188-1G>C						PASS	.						66.0	62.0	63.0					2																	39964200		2203	4300	6503	SO:0001630	splice_region_variant	80745	exon11			AGCACTCTGTGAC	AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.1188-1G>C	chr2.hg19:g.39964200C>G		92.0	0.0	.		94.0	8.0	.	NM_025264	A8K7I7|Q53TT8|Q53TV0	Splice_Site	SNP	ENST00000505747.1	hg19	CCDS1805.2	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726690	0.48833	.	.	ENSG00000138050	ENST00000505747;ENST00000260619	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2156	0.73264	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	THUMPD2	39817704	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	4.572000	0.60886	2.664000	0.90586	0.655000	0.94253	.	.	.	.	none		0.353	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219991.2	NM_025264	Intron
TSGA10	80705	hgsc.bcm.edu	37	2	99634687	99634687	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr2:99634687C>T	ENST00000393483.3	-	20	2892	c.2048G>A	c.(2047-2049)cGa>cAa	p.R683Q	TSGA10_ENST00000539964.1_Missense_Mutation_p.R683Q|TSGA10_ENST00000355053.4_Missense_Mutation_p.R683Q|TSGA10_ENST00000410001.1_Missense_Mutation_p.R683Q	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	683	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						ATCTAGGCCTCGGTCAGGAGA	0.383																																					p.R683Q		Atlas-SNP	.											.	TSGA10	81	.	0			c.G2048A						PASS	.						115.0	109.0	111.0					2																	99634687		2203	4300	6503	SO:0001583	missense	80705	exon19			AGGCCTCGGTCAG	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.2048G>A	chr2.hg19:g.99634687C>T	ENSP00000377123:p.Arg683Gln	80.0	0.0	.		87.0	30.0	.	NM_182911	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	hg19	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604396	0.87157	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.54071	0.66;0.66;0.66;0.66;0.59;0.72	5.04	4.16	0.48862	.	0.368291	0.23162	N	0.051240	T	0.39384	0.1076	L	0.27053	0.805	0.80722	D	1	B	0.18461	0.028	B	0.10450	0.005	T	0.21827	-1.0234	10	0.39692	T	0.17	-2.5563	12.49	0.55895	0.0:0.9177:0.0:0.0823	.	683	Q9BZW7	TSG10_HUMAN	Q	683;683;683;683;613;683	ENSP00000377123:R683Q;ENSP00000386956:R683Q;ENSP00000347161:R683Q;ENSP00000444419:R683Q;ENSP00000386508:R613Q;ENSP00000377122:R683Q	ENSP00000347161:R683Q	R	-	2	0	TSGA10	99001119	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.166000	0.64965	1.472000	0.48140	0.655000	0.94253	CGA	.	.	.	none		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
TMEM184C	55751	hgsc.bcm.edu	37	4	148545023	148545023	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr4:148545023C>G	ENST00000296582.3	+	2	736	c.162C>G	c.(160-162)atC>atG	p.I54M	TMEM184C_ENST00000508208.1_Missense_Mutation_p.I54M	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	54						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						TTGCTGGAATCTTTTTGCTGT	0.333																																					p.I54M		Atlas-SNP	.											.	TMEM184C	25	.	0			c.C162G						PASS	.						137.0	135.0	135.0					4																	148545023		2202	4299	6501	SO:0001583	missense	55751	exon2			TGGAATCTTTTTG	AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.162C>G	chr4.hg19:g.148545023C>G	ENSP00000296582:p.Ile54Met	114.0	0.0	.		65.0	37.0	.	NM_018241	D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	ENST00000296582.3	hg19	CCDS3770.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130269	0.37630	.	.	ENSG00000164168	ENST00000296582;ENST00000508208	T;T	0.45668	0.89;0.89	5.28	3.47	0.39725	.	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	L	0.60904	1.88	0.50171	D	0.999858	P	0.42456	0.78	P	0.45138	0.471	T	0.45425	-0.9262	10	0.54805	T	0.06	-23.423	13.982	0.64310	0.54:0.46:0.0:0.0	.	54	Q9NVA4	T184C_HUMAN	M	54	ENSP00000296582:I54M;ENSP00000425940:I54M	ENSP00000296582:I54M	I	+	3	3	TMEM184C	148764473	0.945000	0.32115	1.000000	0.80357	0.993000	0.82548	0.073000	0.14640	0.644000	0.30656	0.455000	0.32223	ATC	.	.	.	none		0.333	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364644.1	NM_018241	
MAST4	375449	hgsc.bcm.edu	37	5	66456396	66456396	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr5:66456396C>A	ENST00000403625.2	+	27	4056	c.3761C>A	c.(3760-3762)tCc>tAc	p.S1254Y	MAST4_ENST00000261569.7_Missense_Mutation_p.S1060Y|MAST4_ENST00000405643.1_Missense_Mutation_p.S1075Y|MAST4_ENST00000403666.1_Missense_Mutation_p.S1065Y|MAST4_ENST00000404260.3_Missense_Mutation_p.S1257Y	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1257						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AGCAAGAAATCCAAGAAGAAA	0.393																																					p.S1254Y		Atlas-SNP	.											.	MAST4	218	.	0			c.C3761A						PASS	.						104.0	106.0	106.0					5																	66456396		1862	4094	5956	SO:0001583	missense	375449	exon27			AGAAATCCAAGAA	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.3761C>A	chr5.hg19:g.66456396C>A	ENSP00000385727:p.Ser1254Tyr	89.0	0.0	.		76.0	25.0	.	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031570	0.75504	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T	0.68331	-0.28;-0.28;-0.32;-0.32;-0.28	5.81	4.93	0.64822	.	0.234815	0.43260	D	0.000587	T	0.79106	0.4390	M	0.73217	2.22	0.34416	D	0.696926	D;D	0.69078	0.99;0.997	P;D	0.65443	0.862;0.935	D	0.85389	0.1124	10	0.72032	D	0.01	-19.186	14.3064	0.66386	0.0:0.9294:0.0:0.0706	.	1257;1065	O15021;O15021-3	MAST4_HUMAN;.	Y	1257;1254;1065;1075;1075;1060;993	ENSP00000385048:S1257Y;ENSP00000385727:S1254Y;ENSP00000384313:S1065Y;ENSP00000384099:S1075Y;ENSP00000261569:S1060Y	ENSP00000261569:S1060Y	S	+	2	0	MAST4	66492152	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.264000	0.51553	2.736000	0.93811	0.655000	0.94253	TCC	.	.	.	none		0.393	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
EPB41L4A	64097	hgsc.bcm.edu	37	5	111506049	111506049	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr5:111506049G>A	ENST00000261486.5	-	20	1964	c.1688C>T	c.(1687-1689)cCa>cTa	p.P563L	EPB41L4A_ENST00000507810.1_5'UTR	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	563						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CAATCCGGATGGATCCACAAG	0.378																																					p.P563L		Atlas-SNP	.											.	EPB41L4A	130	.	0			c.C1688T						PASS	.						118.0	111.0	113.0					5																	111506049		1832	4086	5918	SO:0001583	missense	64097	exon20			CCGGATGGATCCA	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.1688C>T	chr5.hg19:g.111506049G>A	ENSP00000261486:p.Pro563Leu	71.0	0.0	.		68.0	22.0	.	NM_022140	A4FUI6	Missense_Mutation	SNP	ENST00000261486.5	hg19	CCDS43350.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543095	0.86022	.	.	ENSG00000129595	ENST00000261486	D	0.84070	-1.8	5.21	5.21	0.72293	.	0.131978	0.51477	D	0.000100	D	0.86703	0.5996	L	0.32530	0.975	0.58432	D	0.999998	D;D	0.89917	0.986;1.0	P;D	0.87578	0.655;0.998	D	0.85851	0.1404	10	0.36615	T	0.2	.	17.5611	0.87908	0.0:0.0:1.0:0.0	.	563;190	Q9HCS5;Q8N8X1	E41LA_HUMAN;.	L	563	ENSP00000261486:P563L	ENSP00000261486:P563L	P	-	2	0	EPB41L4A	111533948	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	7.409000	0.80053	2.415000	0.81967	0.563000	0.77884	CCA	.	.	.	none		0.378	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		
NMBR	4829	hgsc.bcm.edu	37	6	142396953	142396953	+	Silent	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr6:142396953G>A	ENST00000258042.1	-	3	1145	c.1005C>T	c.(1003-1005)ttC>ttT	p.F335F	NMBR_ENST00000480652.1_5'UTR	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	335					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		GTTGGCTGTTGAAATGCCTCC	0.473																																					p.F335F		Atlas-SNP	.											.	NMBR	62	.	0			c.C1005T						PASS	.						109.0	104.0	106.0					6																	142396953		2203	4300	6503	SO:0001819	synonymous_variant	4829	exon3			GCTGTTGAAATGC		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.1005C>T	chr6.hg19:g.142396953G>A		149.0	0.0	.		138.0	8.0	.	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	hg19	CCDS5196.1																																																																																			.	.	.	none		0.473	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
MEOX2	4223	hgsc.bcm.edu	37	7	15725797	15725797	+	Silent	SNP	A	A	G	rs113582077	byFrequency	TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr7:15725797A>G	ENST00000262041.5	-	1	640	c.231T>C	c.(229-231)caT>caC	p.H77H	AC005550.4_ENST00000442176.1_lincRNA|AC005550.5_ENST00000438923.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	77	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		gatggtggtgatggtggtggt	0.617																																					p.H77H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											MEOX2,rectum,carcinoma,0,2	MEOX2	68	.	0			c.T231C						PASS	.						21.0	22.0	22.0					7																	15725797		2203	4300	6503	SO:0001819	synonymous_variant	4223	exon1			GTGGTGATGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.231T>C	chr7.hg19:g.15725797A>G		84.0	2.0	.		63.0	7.0	.	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.	.	none		0.617	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
MEOX2	4223	hgsc.bcm.edu	37	7	15725800	15725800	+	Silent	SNP	G	G	A	rs113582077	byFrequency	TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr7:15725800G>A	ENST00000262041.5	-	1	637	c.228C>T	c.(226-228)caC>caT	p.H76H	AC005550.4_ENST00000442176.1_lincRNA|AC005550.5_ENST00000438923.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	76	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)	p.H80delH(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtggtgatggtggtggtggt	0.612																																					p.H76H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											.	MEOX2	68	.	1	Deletion - In frame(1)	stomach(1)	c.C228T						PASS	.						11.0	13.0	13.0					7																	15725800		2192	4293	6485	SO:0001819	synonymous_variant	4223	exon1			GTGATGGTGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.228C>T	chr7.hg19:g.15725800G>A		30.0	0.0	.		32.0	7.0	.	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.	.	none		0.612	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
HOXA7	3204	hgsc.bcm.edu	37	7	27194707	27194707	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr7:27194707G>A	ENST00000242159.3	-	2	647	c.514C>T	c.(514-516)Cgc>Tgc	p.R172C	RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000524304.1_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA7_ENST00000523796.2_5'UTR|HOXA-AS3_ENST00000518848.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7	172					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						TTAATCTGGCGCTCGGTGAGG	0.632																																					p.R172C		Atlas-SNP	.											.	HOXA7	34	.	0			c.C514T						PASS	.						87.0	99.0	95.0					7																	27194707		2203	4300	6503	SO:0001583	missense	3204	exon2			TCTGGCGCTCGGT		CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217	ENST00000242159.3:c.514C>T	chr7.hg19:g.27194707G>A	ENSP00000242159:p.Arg172Cys	111.0	0.0	.		119.0	32.0	.	NM_006896	A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	Missense_Mutation	SNP	ENST00000242159.3	hg19	CCDS5408.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349382	0.61183	.	.	ENSG00000122592	ENST00000242159	D	0.96774	-4.12	4.96	3.98	0.46160	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98365	0.9457	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98696	1.0698	10	0.87932	D	0	.	12.334	0.55056	0.0:0.0:0.6713:0.3287	.	172	P31268	HXA7_HUMAN	C	172	ENSP00000242159:R172C	ENSP00000242159:R172C	R	-	1	0	HOXA7	27161232	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.882000	0.39648	2.324000	0.78689	0.456000	0.33151	CGC	.	.	.	none		0.632	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358695.1		
PILRA	29992	hgsc.bcm.edu	37	7	99972037	99972037	+	Silent	SNP	C	C	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr7:99972037C>T	ENST00000198536.2	+	2	647	c.435C>T	c.(433-435)acC>acT	p.T145T	PILRA_ENST00000350573.2_Silent_p.T145T|PILRA_ENST00000453419.1_Silent_p.T145T|PILRA_ENST00000394000.2_Silent_p.T145T|PILRA_ENST00000474013.1_3'UTR	NM_013439.2	NP_038467.2	Q9UKJ1	PILRA_HUMAN	paired immunoglobin-like type 2 receptor alpha	145	Ig-like V-type.				signal transduction (GO:0007165)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	15	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCGAGGGGACCAAACTCTCCA	0.592																																					p.T145T		Atlas-SNP	.											.	PILRA	28	.	0			c.C435T						PASS	.						76.0	73.0	74.0					7																	99972037		2203	4300	6503	SO:0001819	synonymous_variant	29992	exon2			GGGGACCAAACTC	AF161080	CCDS5691.1, CCDS5692.1, CCDS47660.1	7q22.1	2013-01-11			ENSG00000085514	ENSG00000085514		"""Immunoglobulin superfamily / V-set domain containing"""	20396	protein-coding gene	gene with protein product		605341				10660620	Standard	NM_178272		Approved	FDF03	uc003uuo.1	Q9UKJ1	OTTHUMG00000155248	ENST00000198536.2:c.435C>T	chr7.hg19:g.99972037C>T		85.0	0.0	.		79.0	21.0	.	NM_013439	Q8NHI1	Silent	SNP	ENST00000198536.2	hg19	CCDS5691.1																																																																																			.	.	.	none		0.592	PILRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339016.1	NM_013439	
KIF13B	23303	hgsc.bcm.edu	37	8	28984749	28984749	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr8:28984749C>G	ENST00000524189.1	-	25	3150	c.3112G>C	c.(3112-3114)Gtg>Ctg	p.V1038L	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1038					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GATTCCTGCACTGACTTCACT	0.443																																					p.V1038L		Atlas-SNP	.											.	KIF13B	192	.	0			c.G3112C						PASS	.						149.0	147.0	148.0					8																	28984749		1920	4132	6052	SO:0001583	missense	23303	exon25			CCTGCACTGACTT	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3112G>C	chr8.hg19:g.28984749C>G	ENSP00000427900:p.Val1038Leu	121.0	0.0	.		132.0	9.0	.	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	hg19	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812352	0.70912	.	.	ENSG00000197892	ENST00000524189	T	0.77620	-1.11	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.77665	0.4164	M	0.66939	2.045	0.80722	D	1	B	0.32620	0.378	B	0.38378	0.272	T	0.78155	-0.2314	10	0.54805	T	0.06	.	12.1601	0.54099	0.0:0.9224:0.0:0.0776	.	1038	F8VPJ2	.	L	1038	ENSP00000427900:V1038L	ENSP00000427900:V1038L	V	-	1	0	KIF13B	29040668	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.510000	0.60455	2.649000	0.89929	0.655000	0.94253	GTG	.	.	.	none		0.443	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
DCAF13	25879	hgsc.bcm.edu	37	8	104432551	104432551	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr8:104432551G>T	ENST00000297579.5	+	2	863	c.586G>T	c.(586-588)Gct>Tct	p.A196S	DCAF13_ENST00000521999.1_Intron|DCAF13_ENST00000519682.1_Missense_Mutation_p.A40S|DCAF13_ENST00000521971.1_Missense_Mutation_p.A40S|DCAF13_ENST00000521716.1_Missense_Mutation_p.A40S	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	44					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						ATATATAAGAGCTTTAAATGC	0.388																																					p.A196S		Atlas-SNP	.											.	DCAF13	66	.	0			c.G586T						PASS	.						102.0	96.0	98.0					8																	104432551		2203	4300	6503	SO:0001583	missense	25879	exon2			ATAAGAGCTTTAA	AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.586G>T	chr8.hg19:g.104432551G>T	ENSP00000297579:p.Ala196Ser	165.0	0.0	.		135.0	48.0	.	NM_015420	Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	ENST00000297579.5	hg19	CCDS34934.1	.	.	.	.	.	.	.	.	.	.	G	33	5.265050	0.95399	.	.	ENSG00000164934	ENST00000297579;ENST00000521716;ENST00000521971;ENST00000388778;ENST00000519682	T;T;T;T	0.01313	5.02;5.02;5.02;5.02	5.2	5.2	0.72013	.	0.050275	0.85682	N	0.000000	T	0.16128	0.0388	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.13818	-1.0495	10	0.87932	D	0	-21.6277	18.7279	0.91722	0.0:0.0:1.0:0.0	.	44	B3KME9	.	S	196;40;40;44;40	ENSP00000297579:A196S;ENSP00000430645:A40S;ENSP00000430883:A40S;ENSP00000430411:A40S	ENSP00000297579:A196S	A	+	1	0	DCAF13	104501727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.260000	0.95568	2.420000	0.82092	0.655000	0.94253	GCT	.	.	.	none		0.388	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380797.2	NM_015420	
CCDC171	203238	hgsc.bcm.edu	37	9	15745613	15745613	+	Silent	SNP	C	C	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr9:15745613C>T	ENST00000380701.3	+	18	2983	c.2655C>T	c.(2653-2655)gaC>gaT	p.D885D	CCDC171_ENST00000297641.3_Silent_p.D885D	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	885								p.D152D(1)|p.D885D(1)									AATTACAAGACGTCATTGGTA	0.363																																					p.D885D		Atlas-SNP	.											C9orf93_ENST00000380689,colon,carcinoma,0,4	.	.	.	2	Substitution - coding silent(2)	lung(2)	c.C2655T						PASS	.						222.0	221.0	221.0					9																	15745613		2203	4300	6503	SO:0001819	synonymous_variant	203238	exon18			ACAAGACGTCATT	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2655C>T	chr9.hg19:g.15745613C>T		43.0	0.0	.		44.0	16.0	.	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Silent	SNP	ENST00000380701.3	hg19	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	C	0.248	-1.008817	0.02112	.	.	ENSG00000164989	ENST00000449575	.	.	.	5.03	-4.4	0.03600	.	.	.	.	.	T	0.40297	0.1111	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37641	-0.9697	4	.	.	.	-0.9084	3.9218	0.09247	0.3234:0.4014:0.0625:0.2128	.	.	.	.	M	125	.	.	T	+	2	0	C9orf93	15735613	0.998000	0.40836	0.941000	0.38009	0.154000	0.21943	0.535000	0.23114	-0.699000	0.05077	-1.604000	0.00809	ACG	.	.	.	none		0.363	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
ITIH5	80760	hgsc.bcm.edu	37	10	7621949	7621949	+	Missense_Mutation	SNP	C	C	T	rs368004189		TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr10:7621949C>T	ENST00000256861.6	-	9	1265	c.1187G>A	c.(1186-1188)cGg>cAg	p.R396Q	ITIH5_ENST00000397145.2_Missense_Mutation_p.R396Q|ITIH5_ENST00000397146.2_Missense_Mutation_p.R396Q|ITIH5_ENST00000446830.2_Missense_Mutation_p.R178Q|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000298441.6_Missense_Mutation_p.R182Q	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	396	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GGACACGCTCCGGTCTCCAAT	0.632																																					p.R396Q		Atlas-SNP	.											.	ITIH5	343	.	0			c.G1187A						PASS	.	C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	79.0	69.0	72.0		1187,1187,545	4.4	1.0	10		72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ITIH5	NM_001001851.2,NM_030569.6,NM_032817.5	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	396/703,396/943,182/729	7621949	1,13005	2203	4300	6503	SO:0001583	missense	80760	exon9			ACGCTCCGGTCTC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1187G>A	chr10.hg19:g.7621949C>T	ENSP00000256861:p.Arg396Gln	75.0	0.0	.		60.0	33.0	.	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	hg19		.	.	.	.	.	.	.	.	.	.	C	14.84	2.656967	0.47467	0.0	1.16E-4	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	5.33	4.41	0.53225	von Willebrand factor, type A (3);	0.152288	0.64402	D	0.000015	D	0.83792	0.5331	.	.	.	0.31433	N	0.672876	P;D;D	0.69078	0.948;0.997;0.997	P;P;P	0.60886	0.745;0.88;0.809	D	0.84790	0.0778	9	0.72032	D	0.01	-30.2968	10.6617	0.45706	0.0:0.8514:0.0:0.1486	.	396;396;182	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	Q	396;396;182;178;396	ENSP00000256861:R396Q;ENSP00000380333:R396Q;ENSP00000298441:R182Q;ENSP00000387969:R178Q;ENSP00000380332:R396Q	ENSP00000256861:R396Q	R	-	2	0	ITIH5	7661955	1.000000	0.71417	0.994000	0.49952	0.106000	0.19336	2.775000	0.47702	2.491000	0.84063	0.561000	0.74099	CGG	.	.	.	none		0.632	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
CREB3L1	90993	hgsc.bcm.edu	37	11	46342259	46342259	+	Splice_Site	SNP	A	A	G	rs79068197|rs386373762|rs386373761		TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr11:46342259A>G	ENST00000529193.1	+	12	1974		c.e12-1		CREB3L1_ENST00000288400.3_Splice_Site			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1						regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		TTCTCTCTCCAGGATCTGGGC	0.577			T	FUS	myxofibrosarcoma																																.	Pancreas(3;159 194 19597 26278 47995)	Atlas-SNP	.		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	CREB3L1,caecum,carcinoma,0,1	CREB3L1	30	.	0			c.1524-1A>G						PASS	.						89.0	92.0	91.0					11																	46342259		1996	4166	6162	SO:0001630	splice_region_variant	90993	exon12			CTCTCCAGGATCT		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.1524-1A>G	chr11.hg19:g.46342259A>G		149.0	1.0	.		156.0	8.0	.	NM_052854	Q8N2D5|Q96CP0	Splice_Site	SNP	ENST00000529193.1	hg19	CCDS53620.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.131944	0.56828	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415	.	.	.	4.08	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5834	0.39501	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CREB3L1	46298835	1.000000	0.71417	0.998000	0.56505	0.830000	0.47004	3.943000	0.56621	1.837000	0.53436	0.352000	0.21897	.	.	.	.	none		0.577	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	Intron
ACY3	91703	hgsc.bcm.edu	37	11	67413212	67413212	+	Missense_Mutation	SNP	G	G	A	rs368150084		TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr11:67413212G>A	ENST00000255082.3	-	4	553	c.383C>T	c.(382-384)gCg>gTg	p.A128V	ACY3_ENST00000529256.1_Missense_Mutation_p.A7V	NM_080658.1	NP_542389.1	Q96HD9	ACY3_HUMAN	aspartoacylase (aminocyclase) 3	128	Hydrolytic domain. {ECO:0000250}.				viral process (GO:0016032)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			endometrium(1)|lung(5)|prostate(2)	8					L-Aspartic Acid(DB00128)	GGAGGACTTCGCGATTAAGCA	0.642																																					p.A128V	GBM(56;346 1011 27014 29495 46841)	Atlas-SNP	.											.	ACY3	27	.	0			c.C383T						PASS	.	G	VAL/ALA	2,4398	4.2+/-10.8	0,2,2198	170.0	152.0	158.0		383	0.6	0.0	11		158	0,8588		0,0,4294	no	missense	ACY3	NM_080658.1	64	0,2,6492	AA,AG,GG		0.0,0.0455,0.0154	benign	128/320	67413212	2,12986	2200	4294	6494	SO:0001583	missense	91703	exon4			GACTTCGCGATTA	BC008689	CCDS8175.1	11q13.2	2014-08-08			ENSG00000132744	ENSG00000132744			24104	protein-coding gene	gene with protein product		614413				14656720	Standard	NM_080658		Approved	HCBP1, MGC9740, ACY-3	uc001omq.3	Q96HD9	OTTHUMG00000167283	ENST00000255082.3:c.383C>T	chr11.hg19:g.67413212G>A	ENSP00000255082:p.Ala128Val	195.0	0.0	.		203.0	12.0	.	NM_080658		Missense_Mutation	SNP	ENST00000255082.3	hg19	CCDS8175.1	.	.	.	.	.	.	.	.	.	.	G	1.017	-0.686076	0.03328	4.55E-4	0.0	ENSG00000132744	ENST00000255082;ENST00000529256	D;D	0.97505	-4.41;-4.41	3.79	0.623	0.17654	.	2.785610	0.01103	N	0.005413	D	0.86049	0.5840	N	0.00347	-1.61	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.82808	-0.0274	10	0.22109	T	0.4	.	4.3548	0.11172	0.2931:0.3178:0.3891:0.0	.	128	Q96HD9	ACY3_HUMAN	V	128;7	ENSP00000255082:A128V;ENSP00000434270:A7V	ENSP00000255082:A128V	A	-	2	0	ACY3	67169788	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.470000	0.06639	-0.081000	0.12662	-0.258000	0.10820	GCG	.	.	.	weak		0.642	ACY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394002.1	NM_080658	
POU2AF1	5450	hgsc.bcm.edu	37	11	111228192	111228192	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr11:111228192G>A	ENST00000393067.3	-	4	948	c.434C>T	c.(433-435)cCg>cTg	p.P145L		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	145					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		GATGAGTGGCGGAGAGGCATA	0.572			T	BCL6	NHL																																p.P145L		Atlas-SNP	.		Dom	yes		11	11q23.1	5450	"""POU domain, class 2, associating factor 1 (OBF1)"""		L	.	POU2AF1	23	.	0			c.C434T						PASS	.						81.0	70.0	73.0					11																	111228192		2201	4297	6498	SO:0001583	missense	5450	exon4			AGTGGCGGAGAGG		CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.434C>T	chr11.hg19:g.111228192G>A	ENSP00000376786:p.Pro145Leu	370.0	1.0	.		338.0	131.0	.	NM_006235	B2R8Z9|Q14983	Missense_Mutation	SNP	ENST00000393067.3	hg19	CCDS31675.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610386	0.28712	.	.	ENSG00000110777	ENST00000393067	T	0.28255	1.62	4.95	3.9	0.45041	.	0.326590	0.29376	N	0.012335	T	0.18718	0.0449	N	0.22421	0.69	0.44937	D	0.997956	B	0.28820	0.224	B	0.22601	0.04	T	0.05007	-1.0912	10	0.27082	T	0.32	-8.7718	10.5839	0.45271	0.0:0.0:0.2373:0.7627	.	145	Q16633	OBF1_HUMAN	L	145	ENSP00000376786:P145L	ENSP00000376786:P145L	P	-	2	0	POU2AF1	110733402	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	3.360000	0.52299	0.893000	0.36288	0.492000	0.49549	CCG	.	.	.	none		0.572	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391002.1	NM_006235	
HTR3A	3359	hgsc.bcm.edu	37	11	113846045	113846045	+	5'UTR	SNP	G	G	A	rs200513646		TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr11:113846045G>A	ENST00000504030.2	+	0	443				HTR3A_ENST00000375498.2_Missense_Mutation_p.A6T|HTR3A_ENST00000299961.5_5'Flank|HTR3A_ENST00000355556.2_Missense_Mutation_p.A6T|HTR3A_ENST00000535865.1_5'UTR|HTR3A_ENST00000506841.2_5'UTR			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	TGGAAAGCTCGCTATGCTGCT	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19934	0.0		0.0	False		,,,				2504	0.0				p.A6T		Atlas-SNP	.											.	HTR3A	93	.	0			c.G16A						PASS	.	G	THR/ALA,THR/ALA	4,4398	8.1+/-20.4	0,4,2197	62.0	55.0	58.0		16,16	-5.2	0.0	11		58	0,8592		0,0,4296	yes	missense,missense	HTR3A	NM_213621.3,NM_000869.5	58,58	0,4,6493	AA,AG,GG		0.0,0.0909,0.0308	benign,benign	6/517,6/485	113846045	4,12990	2201	4296	6497	SO:0001623	5_prime_UTR_variant	3359	exon1			AAGCTCGCTATGC	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.-3G>A	chr11.hg19:g.113846045G>A		53.0	0.0	.		26.0	8.0	.	NM_000869	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	ENST00000504030.2	hg19		.	.	.	.	.	.	.	.	.	.	G	9.618	1.133138	0.21041	9.09E-4	0.0	ENSG00000166736	ENST00000355556;ENST00000375498	T;T	0.77098	-0.99;-1.07	4.94	-5.23	0.02798	.	.	.	.	.	T	0.54615	0.1869	N	0.08118	0	0.29946	N	0.820675	B;B	0.10296	0.003;0.001	B;B	0.06405	0.002;0.001	T	0.33033	-0.9884	9	0.29301	T	0.29	.	12.1527	0.54059	0.5992:0.0:0.4008:0.0	.	6;6	G5E986;Q7KZM7	.;.	T	6	ENSP00000347754:A6T;ENSP00000364648:A6T	ENSP00000347754:A6T	A	+	1	0	HTR3A	113351255	0.000000	0.05858	0.000000	0.03702	0.240000	0.25518	-1.991000	0.01478	-1.239000	0.02532	-0.119000	0.15052	GCT	.	.	.	weak		0.632	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869	
TP53BP1	7158	hgsc.bcm.edu	37	15	43748237	43748237	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr15:43748237G>A	ENST00000263801.3	-	12	2806	c.2554C>T	c.(2554-2556)Cag>Tag	p.Q852*	TP53BP1_ENST00000605155.1_5'UTR|TP53BP1_ENST00000382044.4_Nonsense_Mutation_p.Q857*|TP53BP1_ENST00000450115.2_Nonsense_Mutation_p.Q857*|TP53BP1_ENST00000382039.3_Nonsense_Mutation_p.Q857*	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	852					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GTTTGGGGCTGCTGCAACTCC	0.458								Other conserved DNA damage response genes																													p.Q857X		Atlas-SNP	.											.	TP53BP1	157	.	0			c.C2569T						PASS	.						181.0	178.0	179.0					15																	43748237		2201	4298	6499	SO:0001587	stop_gained	7158	exon12			GGGGCTGCTGCAA	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.2554C>T	chr15.hg19:g.43748237G>A	ENSP00000263801:p.Gln852*	74.0	0.0	.		70.0	26.0	.	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Nonsense_Mutation	SNP	ENST00000263801.3	hg19	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	G	37	6.362726	0.97507	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	.	.	.	5.37	4.44	0.53790	.	0.405695	0.25091	N	0.033212	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-1.0009	12.5477	0.56210	0.0:0.1669:0.833:0.0	.	.	.	.	X	852;857;857;857;857	.	ENSP00000263801:Q852X	Q	-	1	0	TP53BP1	41535529	0.317000	0.24589	0.067000	0.19924	0.006000	0.05464	1.799000	0.38824	1.364000	0.46038	0.650000	0.86243	CAG	.	.	.	none		0.458	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
ABCC1	4363	hgsc.bcm.edu	37	16	16177358	16177358	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr16:16177358G>A	ENST00000399410.3	+	17	2426	c.2251G>A	c.(2251-2253)Gaa>Aaa	p.E751K	ABCC1_ENST00000345148.5_Missense_Mutation_p.E751K|ABCC1_ENST00000346370.5_Missense_Mutation_p.E751K|ABCC1_ENST00000349029.5_Intron|ABCC1_ENST00000399408.2_Missense_Mutation_p.E751K|ABCC1_ENST00000351154.5_Intron	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	751	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CCCAGACCTGGAAATCCTGCC	0.517																																					p.E751K		Atlas-SNP	.											.	ABCC1	156	.	0			c.G2251A						PASS	.						82.0	84.0	83.0					16																	16177358		2014	4202	6216	SO:0001583	missense	4363	exon17			GACCTGGAAATCC	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2251G>A	chr16.hg19:g.16177358G>A	ENSP00000382342:p.Glu751Lys	209.0	0.0	.		253.0	52.0	.	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	hg19	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334110	0.81801	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000345148;ENST00000536381	D;D;D;D	0.93906	-3.31;-3.31;-2.69;-3.31	5.29	5.29	0.74685	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.045819	0.85682	D	0.000000	D	0.94122	0.8115	N	0.25890	0.77	0.80722	D	1	P;D;P;P	0.71674	0.877;0.998;0.583;0.877	P;D;P;B	0.80764	0.538;0.994;0.455;0.438	D	0.94049	0.7316	10	0.41790	T	0.15	-18.2126	17.9191	0.88961	0.0:0.0:1.0:0.0	.	751;751;751;751	P33527-4;P33527-3;P33527;P33527-9	.;.;MRP1_HUMAN;.	K	751;751;751;751;425	ENSP00000382342:E751K;ENSP00000382340:E751K;ENSP00000263019:E751K;ENSP00000263014:E751K	ENSP00000263014:E751K	E	+	1	0	ABCC1	16084859	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.549000	0.73900	2.484000	0.83849	0.563000	0.77884	GAA	.	.	.	none		0.517	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
RLTPR	146206	hgsc.bcm.edu	37	16	67683208	67683208	+	Silent	SNP	C	C	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr16:67683208C>T	ENST00000334583.6	+	19	2068	c.1740C>T	c.(1738-1740)gaC>gaT	p.D580D	RLTPR_ENST00000545661.1_Silent_p.D544D	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	580	Tropomodulin-like.				cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGCAGGACGACGATTGTGTGA	0.612																																					p.D580D		Atlas-SNP	.											.	RLTPR	124	.	0			c.C1740T						PASS	.						64.0	71.0	69.0					16																	67683208		2055	4210	6265	SO:0001819	synonymous_variant	146206	exon19			GGACGACGATTGT	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1740C>T	chr16.hg19:g.67683208C>T		40.0	0.0	.		48.0	20.0	.	NM_001013838	B8X2Z3	Silent	SNP	ENST00000334583.6	hg19	CCDS45513.1																																																																																			.	.	.	none		0.612	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305775	+	Missense_Mutation	DNP	CT	CT	GC	rs137947981|rs535144703|rs141265645|rs58117746	byFrequency	TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr17:39305774_39305775CT>GC	ENST00000343246.4	-	1	279_280	c.245_246AG>GC	c.(244-246)cAG>cGC	p.Q82R		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	82	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagca	0.653																																					p.Q82H|p.Q82R		Atlas-SNP	.											KRTAP4-5,NS,carcinoma,0,1|KRTAP4-5,NS,carcinoma,+1,1	KRTAP4-5	34	.	1	Substitution - Missense(1)	lung(1)	c.G246C|c.A245G						PASS	.																																			SO:0001583	missense	85289	exon1			GGTGGTCTGGCAG|GTGGTCTGGCAGC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245_246delinsGC	chr17.hg19:g.39305774_39305775delinsGC	ENSP00000340546:p.Gln82Arg	75.0|74.0	0.0	.		83.0|86.0	23.0|26.0	.	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.	.	weak		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
SP6	80320	hgsc.bcm.edu	37	17	45925061	45925061	+	Silent	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr17:45925061G>A	ENST00000536300.1	-	2	1066	c.735C>T	c.(733-735)ccC>ccT	p.P245P	SP6_ENST00000342234.2_Silent_p.P245P	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	245					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						TGCCCCCATCGGGCCCACATG	0.672																																					p.P245P		Atlas-SNP	.											.	SP6	26	.	0			c.C735T						PASS	.						21.0	23.0	22.0					17																	45925061		2182	4251	6433	SO:0001819	synonymous_variant	80320	exon2			CCCATCGGGCCCA		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.735C>T	chr17.hg19:g.45925061G>A		101.0	0.0	.		83.0	31.0	.	NM_001258248	B3KXS4	Silent	SNP	ENST00000536300.1	hg19	CCDS11520.1																																																																																			.	.	.	none		0.672	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441395.1	NM_199262	
DNAI2	64446	hgsc.bcm.edu	37	17	72306227	72306227	+	Silent	SNP	G	G	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr17:72306227G>T	ENST00000311014.6	+	11	1486	c.1419G>T	c.(1417-1419)ctG>ctT	p.L473L	RP11-647F2.2_ENST00000585167.1_RNA|AC103809.1_ENST00000516976.1_RNA|DNAI2_ENST00000307504.5_Silent_p.L330L|DNAI2_ENST00000579490.1_Silent_p.L530L|DNAI2_ENST00000582036.1_Silent_p.L461L|DNAI2_ENST00000446837.2_Silent_p.L473L			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	473					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GCTCCCAGCTGGGGACAACCA	0.622									Kartagener syndrome																												p.L473L		Atlas-SNP	.											.	DNAI2	102	.	0			c.G1419T						PASS	.						55.0	51.0	52.0					17																	72306227		2203	4300	6503	SO:0001819	synonymous_variant	64446	exon11	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CCAGCTGGGGACA	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1419G>T	chr17.hg19:g.72306227G>T		96.0	0.0	.		93.0	32.0	.	NM_023036	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Silent	SNP	ENST00000311014.6	hg19	CCDS11697.1																																																																																			.	.	.	none		0.622	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036	
RAB40B	10966	hgsc.bcm.edu	37	17	80617514	80617514	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr17:80617514T>A	ENST00000571995.1	-	4	415	c.284A>T	c.(283-285)gAc>gTc	p.D95V	RAB40B_ENST00000538809.2_Missense_Mutation_p.D95V|RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000269347.6_5'UTR	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	95					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GTTCGCAATGTCATAGACCAG	0.517																																					p.D95V		Atlas-SNP	.											.	RAB40B	24	.	0			c.A284T						PASS	.						149.0	114.0	126.0					17																	80617514		2203	4300	6503	SO:0001583	missense	10966	exon4			GCAATGTCATAGA	U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.284A>T	chr17.hg19:g.80617514T>A	ENSP00000461785:p.Asp95Val	138.0	0.0	.		128.0	51.0	.	NM_006822	Q8WVG3	Missense_Mutation	SNP	ENST00000571995.1	hg19	CCDS11816.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259217	0.80246	.	.	ENSG00000141542	ENST00000269347;ENST00000538809	.	.	.	4.56	4.56	0.56223	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	D	0.88093	0.6344	H	0.98155	4.16	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92358	0.5895	9	0.87932	D	0	.	14.2775	0.66189	0.0:0.0:0.0:1.0	.	95	Q12829	RB40B_HUMAN	V	95;129	.	ENSP00000269347:D95V	D	-	2	0	RAB40B	78210803	1.000000	0.71417	0.997000	0.53966	0.803000	0.45373	7.768000	0.85345	1.992000	0.58205	0.533000	0.62120	GAC	.	.	.	none		0.517	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1		
MBD1	4152	hgsc.bcm.edu	37	18	47802004	47802004	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr18:47802004C>T	ENST00000591416.1	-	8	1189	c.758G>A	c.(757-759)cGc>cAc	p.R253H	MBD1_ENST00000588937.1_Missense_Mutation_p.R253H|MBD1_ENST00000590208.1_Missense_Mutation_p.R253H|MBD1_ENST00000585672.1_Missense_Mutation_p.R204H|MBD1_ENST00000349085.2_Missense_Mutation_p.R253H|MBD1_ENST00000591535.1_Missense_Mutation_p.R253H|MBD1_ENST00000382948.5_Missense_Mutation_p.R253H|MBD1_ENST00000424334.2_Missense_Mutation_p.R279H|MBD1_ENST00000398493.1_Missense_Mutation_p.R253H|MBD1_ENST00000339998.6_Missense_Mutation_p.R253H|MBD1_ENST00000587605.1_Missense_Mutation_p.R253H|MBD1_ENST00000353909.3_Missense_Mutation_p.R204H|MBD1_ENST00000585595.1_Missense_Mutation_p.R253H|MBD1_ENST00000347968.3_Missense_Mutation_p.R253H|MBD1_ENST00000457839.2_Missense_Mutation_p.R253H|MBD1_ENST00000398488.1_Missense_Mutation_p.R253H|MBD1_ENST00000398495.2_Missense_Mutation_p.R253H|MBD1_ENST00000269471.5_Missense_Mutation_p.R253H|MBD1_ENST00000436910.1_Missense_Mutation_p.R253H|MBD1_ENST00000269468.5_Missense_Mutation_p.R253H			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	253					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R253L(4)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						TTTCCACTGGCGCCTGAGACC	0.602																																					p.R253H		Atlas-SNP	.											.	MBD1	228	.	4	Substitution - Missense(4)	lung(4)	c.G758A						PASS	.						47.0	47.0	47.0					18																	47802004		2203	4300	6503	SO:0001583	missense	4152	exon8			CACTGGCGCCTGA	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.758G>A	chr18.hg19:g.47802004C>T	ENSP00000467017:p.Arg253His	239.0	0.0	.		224.0	74.0	.	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	hg19	CCDS11943.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144536	0.77888	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97232	-4.22;-3.92;-4.04;-4.22;-4.05;-4.18;-4.16;-4.3;-4.17;-4.06;-4.29;-4.05;-4.04	5.29	5.29	0.74685	Zinc finger, CXXC-type (2);	0.000000	0.56097	D	0.000023	D	0.97508	0.9184	L	0.56769	1.78	0.32700	N	0.513027	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.998;0.999;1.0;0.999;0.997;0.999;0.996;1.0;0.998;1.0;0.998	D	0.97757	1.0218	10	0.52906	T	0.07	-14.4062	10.2988	0.43639	0.0:0.9098:0.0:0.0902	.	253;279;253;253;253;253;204;253;253;253;253;253	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5;Q9UIS9-3	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.;.	H	253;204;253;253;253;253;253;279;253;253;253;253;253	ENSP00000372407:R253H;ENSP00000269469:R204H;ENSP00000342531:R253H;ENSP00000269468:R253H;ENSP00000285102:R253H;ENSP00000409561:R253H;ENSP00000269471:R253H;ENSP00000408846:R279H;ENSP00000339546:R253H;ENSP00000381508:R253H;ENSP00000405268:R253H;ENSP00000381506:R253H;ENSP00000381502:R253H	ENSP00000269468:R253H	R	-	2	0	MBD1	46056002	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.576000	0.46033	2.653000	0.90120	0.655000	0.94253	CGC	.	.	.	none		0.602	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
SPTBN4	57731	hgsc.bcm.edu	37	19	41076606	41076606	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr19:41076606C>T	ENST00000352632.3	+	33	7377	c.7291C>T	c.(7291-7293)Ctc>Ttc	p.L2431F	SPTBN4_ENST00000598249.1_Missense_Mutation_p.L2431F|SPTBN4_ENST00000392025.1_Missense_Mutation_p.L1174F			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2431	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAAGCGCGAGCTCGACGCTAA	0.711																																					p.L2431F		Atlas-SNP	.											.	SPTBN4	213	.	0			c.C7291T						PASS	.						13.0	13.0	13.0					19																	41076606		2130	4092	6222	SO:0001583	missense	57731	exon33			CGCGAGCTCGACG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7291C>T	chr19.hg19:g.41076606C>T	ENSP00000263373:p.Leu2431Phe	68.0	0.0	.		74.0	27.0	.	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496244	0.44352	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.31769	1.48;1.48	4.64	3.59	0.41128	Pleckstrin homology-type (1);Pleckstrin homology domain, spectrin-type (1);Pleckstrin homology domain (3);	0.111049	0.37623	U	0.002018	T	0.36441	0.0967	L	0.42245	1.32	0.80722	D	1	P;P	0.50943	0.94;0.94	P;P	0.51833	0.681;0.681	T	0.08973	-1.0696	10	0.39692	T	0.17	.	13.6768	0.62458	0.0:0.8434:0.1566:0.0	.	1174;2431	C9JY79;Q9H254	.;SPTN4_HUMAN	F	2431;2431;1174	ENSP00000263373:L2431F;ENSP00000375879:L1174F	ENSP00000263373:L2431F	L	+	1	0	SPTBN4	45768446	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	2.096000	0.41738	1.145000	0.42336	0.491000	0.48974	CTC	.	.	.	none		0.711	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
ZNF577	84765	hgsc.bcm.edu	37	19	52376124	52376124	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr19:52376124C>A	ENST00000301399.5	-	7	1484	c.1119G>T	c.(1117-1119)gaG>gaT	p.E373D	ZNF577_ENST00000451628.2_Missense_Mutation_p.E314D|ZNF577_ENST00000420592.1_Missense_Mutation_p.E314D|ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000485702.1_Intron	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	373			E -> K (in dbSNP:rs10407547).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TGTGAGTTTTCTCATGTTTAA	0.448																																					p.E373D		Atlas-SNP	.											ZNF577,NS,carcinoma,0,1	ZNF577	63	.	0			c.G1119T						PASS	.						89.0	94.0	92.0					19																	52376124		2203	4300	6503	SO:0001583	missense	84765	exon7			AGTTTTCTCATGT	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.1119G>T	chr19.hg19:g.52376124C>A	ENSP00000301399:p.Glu373Asp	67.0	0.0	.		84.0	40.0	.	NM_032679	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	hg19	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	7.724	0.697762	0.15106	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	3.06	2.02	0.26589	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25419	0.0618	N	0.08118	0	0.09310	N	0.999994	B;B	0.25007	0.016;0.116	B;B	0.25884	0.007;0.064	T	0.20840	-1.0263	9	0.87932	D	0	.	4.8679	0.13618	0.0:0.6085:0.0:0.3915	.	373;314	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	D	373;314;314;373	ENSP00000301399:E373D;ENSP00000413476:E314D;ENSP00000389652:E314D;ENSP00000404509:E373D	ENSP00000301399:E373D	E	-	3	2	ZNF577	57067936	0.000000	0.05858	0.007000	0.13788	0.327000	0.28475	0.103000	0.15292	0.592000	0.29728	0.655000	0.94253	GAG	.	.	.	none		0.448	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679	
EPB41L1	2036	hgsc.bcm.edu	37	20	34778710	34778710	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr20:34778710C>G	ENST00000338074.2	+	11	1452	c.1291C>G	c.(1291-1293)Ctt>Gtt	p.L431V	EPB41L1_ENST00000373946.3_Missense_Mutation_p.L400V|EPB41L1_ENST00000373950.2_Missense_Mutation_p.L334V|EPB41L1_ENST00000373941.1_Missense_Mutation_p.L431V|EPB41L1_ENST00000441639.1_Missense_Mutation_p.L369V|EPB41L1_ENST00000202028.5_Missense_Mutation_p.L369V	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	431					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					GTCCCGCAGCCTTGATGGAGG	0.602																																					p.L431V		Atlas-SNP	.											.	EPB41L1	111	.	0			c.C1291G						PASS	.						47.0	42.0	43.0					20																	34778710		2203	4300	6503	SO:0001583	missense	2036	exon12			CGCAGCCTTGATG	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1291C>G	chr20.hg19:g.34778710C>G	ENSP00000337168:p.Leu431Val	45.0	0.0	.		38.0	12.0	.	NM_001258329	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	hg19	CCDS13271.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499624	0.64298	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000344237;ENST00000338074;ENST00000373941	D;D;D;D;D;D	0.86297	-1.95;-1.92;-1.95;-1.94;-2.1;-2.1	5.48	5.48	0.80851	.	0.292495	0.38005	N	0.001858	D	0.84844	0.5562	N	0.24115	0.695	0.39057	D	0.960441	B;P;P;P;B;P	0.45569	0.249;0.861;0.539;0.794;0.3;0.783	B;P;B;P;B;P	0.47891	0.186;0.471;0.439;0.487;0.13;0.56	D	0.87969	0.2735	10	0.87932	D	0	-4.2264	17.9268	0.88986	0.0:1.0:0.0:0.0	.	431;431;400;334;334;369	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	V	369;334;431;334;369;400;5;431;431	ENSP00000202028:L369V;ENSP00000363061:L334V;ENSP00000399214:L369V;ENSP00000363057:L400V;ENSP00000337168:L431V;ENSP00000363052:L431V	ENSP00000202028:L369V	L	+	1	0	EPB41L1	34242124	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.048000	0.30379	2.556000	0.86216	0.561000	0.74099	CTT	.	.	.	none		0.602	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
FAM83D	81610	hgsc.bcm.edu	37	20	37570604	37570604	+	Silent	SNP	G	G	A			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr20:37570604G>A	ENST00000217429.4	+	2	617	c.576G>A	c.(574-576)gtG>gtA	p.V192V		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	162					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				ACCTGTAGGTGATTGCAGTGG	0.483																																					p.V192V		Atlas-SNP	.											.	FAM83D	60	.	0			c.G576A						PASS	.						149.0	152.0	151.0					20																	37570604		2058	4205	6263	SO:0001819	synonymous_variant	81610	exon2			GTAGGTGATTGCA	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.576G>A	chr20.hg19:g.37570604G>A		155.0	0.0	.		151.0	53.0	.	NM_030919	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Silent	SNP	ENST00000217429.4	hg19	CCDS42872.1																																																																																			.	.	.	none		0.483	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
PLXNB2	23654	hgsc.bcm.edu	37	22	50728592	50728593	+	Missense_Mutation	DNP	TT	TT	AC			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr22:50728592_50728593TT>AC	ENST00000449103.1	-	3	561_562	c.421_422AA>GT	c.(421-423)AAg>GTg	p.K141V	PLXNB2_ENST00000359337.4_Missense_Mutation_p.K141V			O15031	PLXB2_HUMAN	plexin B2	141	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CACGAAAGACTTCTCCCCGCTG	0.644																																					p.K141M|p.K141E		Atlas-SNP	.											.	PLXNB2	172	.	0			c.A422T|c.A421G						PASS	.																																			SO:0001583	missense	23654	exon3			AAAGACTTCTCCC|AAGACTTCTCCCC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.421_422delinsAC	chr22.hg19:g.50728592_50728593delinsAC	ENSP00000409171:p.Lys141Val	115.0|110.0	0.0	.		113.0	39.0|41.0	.	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	hg19	CCDS43035.1																																																																																			.	.	.	none		0.644	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
ARSE	415	hgsc.bcm.edu	37	X	2861169	2861169	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chrX:2861169C>T	ENST00000381134.3	-	8	1129	c.1063G>A	c.(1063-1065)Ggc>Agc	p.G355S	ARSE_ENST00000540563.1_Missense_Mutation_p.G310S|ARSE_ENST00000545496.1_Missense_Mutation_p.G380S	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	355					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGGGAACCGCCGTGATCCGAC	0.473																																					p.G355S		Atlas-SNP	.											.	ARSE	43	.	0			c.G1063A						PASS	.						89.0	83.0	85.0					X																	2861169		2203	4300	6503	SO:0001583	missense	415	exon8			AACCGCCGTGATC	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.1063G>A	chrX.hg19:g.2861169C>T	ENSP00000370526:p.Gly355Ser	87.0	0.0	.		91.0	62.0	.	NM_000047	Q53FT2|Q53FU8	Missense_Mutation	SNP	ENST00000381134.3	hg19	CCDS14122.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.687965	0.68271	.	.	ENSG00000157399	ENST00000540563;ENST00000545496;ENST00000381134	D;D;D	0.99809	-6.86;-6.86;-6.86	3.66	2.8	0.32819	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.109135	0.64402	D	0.000009	D	0.99887	0.9946	H	0.99929	4.97	0.51482	D	0.999923	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96969	0.9707	10	0.87932	D	0	.	9.8836	0.41249	0.0:0.8911:0.0:0.1089	.	310;380;355	F5H324;F5GYY5;P51690	.;.;ARSE_HUMAN	S	310;380;355	ENSP00000438198:G310S;ENSP00000441417:G380S;ENSP00000370526:G355S	ENSP00000370526:G355S	G	-	1	0	ARSE	2871169	0.999000	0.42202	0.003000	0.11579	0.000000	0.00434	6.039000	0.70972	0.545000	0.28902	-0.191000	0.12829	GGC	.	.	.	none		0.473	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
FAT1	2195	hgsc.bcm.edu	37	4	187629210	187629211	+	Frame_Shift_Del	DEL	AC	AC	-	rs572691033	byFrequency	TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr4:187629210_187629211delAC	ENST00000441802.2	-	2	1980_1981	c.1771_1772delGT	c.(1771-1773)gttfs	p.V591fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	591	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AATAGCAGAAACAGTGGTTATT	0.396										HNSCC(5;0.00058)																											p.591_591del	Colon(197;1040 2055 4143 4984 49344)	Atlas-Indel,Pindel	.											.	FAT1	500	.	0			c.1772_1773del						PASS	.																																			SO:0001589	frameshift_variant	2195	exon2			.	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1771_1772delGT	chr4.hg19:g.187629210_187629211delAC	ENSP00000406229:p.Val591fs	84.0	0.0	0		53.0	25.0	0.471698	NM_005245		Frame_Shift_Del	DEL	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.	.	none		0.396	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
DMXL1	1657	hgsc.bcm.edu	37	5	118556763	118556765	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr5:118556763_118556765delGAG	ENST00000311085.8	+	36	8281_8283	c.8201_8203delGAG	c.(8200-8205)agagga>aga	p.G2735del	DMXL1_ENST00000505312.1_3'UTR|DMXL1_ENST00000539542.1_In_Frame_Del_p.G2756del	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2735										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		CAGACTGGCAGAGGAGCATCTGT	0.35																																					p.2734_2734del		Atlas-Indel,Pindel	.											.	DMXL1	268	.	0			c.8200_8202del						PASS	.																																			SO:0001651	inframe_deletion	1657	exon36			.	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8201_8203delGAG	chr5.hg19:g.118556766_118556768delGAG	ENSP00000309690:p.Gly2735del	385.0	0.0	0		313.0	96.0	0.306709	NM_005509		In_Frame_Del	DEL	ENST00000311085.8	hg19	CCDS4125.1																																																																																			.	.	.	none		0.350	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
KIAA1217	56243	hgsc.bcm.edu	37	10	24832228	24832229	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr10:24832228_24832229delAG	ENST00000376454.3	+	19	4059_4060	c.4029_4030delAG	c.(4027-4032)acagatfs	p.D1344fs	KIAA1217_ENST00000376451.2_Frame_Shift_Del_p.D1027fs|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000307544.6_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1344					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						TTATCACGACAGATTTTGGCCA	0.411																																					p.1343_1343del		Atlas-Indel,Pindel	.											.	KIAA1217	235	.	0			c.4028_4029del						PASS	.																																			SO:0001589	frameshift_variant	56243	exon19			.	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4029_4030delAG	chr10.hg19:g.24832228_24832229delAG	ENSP00000365637:p.Asp1344fs	304.0	0.0	0		309.0	132.0	0.427184	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Frame_Shift_Del	DEL	ENST00000376454.3	hg19	CCDS31165.1																																																																																			.	.	.	none		0.411	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
EIF4G3	8672	hgsc.bcm.edu	37	1	21133827	21133829	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr1:21133827_21133829delCTC	ENST00000264211.8	-	31	4935_4937	c.4741_4743delGAG	c.(4741-4743)gagdel	p.E1581del	EIF4G3_ENST00000400422.1_In_Frame_Del_p.E1581del|EIF4G3_ENST00000374937.3_In_Frame_Del_p.E1587del|EIF4G3_ENST00000374935.3_In_Frame_Del_p.E1301del|EIF4G3_ENST00000536266.1_In_Frame_Del_p.E1185del|EIF4G3_ENST00000537738.1_In_Frame_Del_p.E1071del|EIF4G3_ENST00000602326.1_In_Frame_Del_p.E1587del	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1581	EIF4A-binding. {ECO:0000250}.|Necessary but not sufficient for MKNK1- binding. {ECO:0000250}.|W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TATCCTCAGACTCCTCTTCTGCT	0.438																																					p.1617_1618del		Atlas-Indel,Pindel	.											.	EIF4G3	300	.	0			c.4850_4852del						PASS	.																																			SO:0001651	inframe_deletion	8672	exon35			.	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.4741_4743delGAG	chr1.hg19:g.21133830_21133832delCTC	ENSP00000264211:p.Glu1581del	108.0	0.0	0		99.0	33.0	0.333333	NM_001198801	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	In_Frame_Del	DEL	ENST00000264211.8	hg19	CCDS214.1																																																																																			.	.	.	none		0.438	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
THUMPD2	80745	hgsc.bcm.edu	37	2	39964198	39964199	+	Splice_Site	DEL	CT	CT	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr2:39964198_39964199delCT	ENST00000505747.1	-	10	1215_1216	c.1188_1189delAG	c.(1186-1191)agagtg>agtg	p.RV396fs	THUMPD2_ENST00000260619.6_Splice_Site_p.RV366fs	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	396							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				ACATGAAGCACTCTGTGACAAA	0.356																																					p.397_397del		Atlas-Indel,Pindel	.											.	THUMPD2	35	.	0			c.1189_1190del						PASS	.																																			SO:0001630	splice_region_variant	80745	exon10			.	AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.1188-1AG>-	chr2.hg19:g.39964200_39964201delCT		94.0	0.0	0		124.0	23.0	0.185484	NM_025264	A8K7I7|Q53TT8|Q53TV0	Frame_Shift_Del	DEL	ENST00000505747.1	hg19	CCDS1805.2																																																																																			.	.	.	none		0.356	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219991.2	NM_025264	Frame_Shift_Del
HIF1A	3091	hgsc.bcm.edu	37	14	62194216	62194223	+	Frame_Shift_Del	DEL	AACCAACC	AACCAACC	-	rs369217648		TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	AACCAACC	AACCAACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr14:62194216_62194223delAACCAACC	ENST00000337138.4	+	6	881_888	c.616_623delAACCAACC	c.(616-624)aaccaacctfs	p.NQP206fs	HIF1A_ENST00000557538.1_Frame_Shift_Del_p.NQP147fs|HIF1A_ENST00000539097.1_Frame_Shift_Del_p.NQP230fs|HIF1A_ENST00000557206.1_3'UTR|HIF1A_ENST00000394997.1_Frame_Shift_Del_p.NQP207fs|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000323441.6_Frame_Shift_Del_p.NQP206fs	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	206	Interaction with TSGA10. {ECO:0000250}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TACCAACAGTAACCAACCTCAGTGTGGG	0.385																																					p.229_232del		Atlas-INDEL	.											.	HIF1A	120	.	0			c.687_694del						PASS	.																																			SO:0001589	frameshift_variant	3091	exon6			.	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.616_623delAACCAACC	chr14.hg19:g.62194216_62194223delAACCAACC	ENSP00000338018:p.Asn206fs	146.0	0.0	0		93.0	15.0	0.16129	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Frame_Shift_Del	DEL	ENST00000337138.4	hg19	CCDS9753.1																																																																																			.	.	.	none		0.385	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
NIPBL	25836	hgsc.bcm.edu	37	5	36986201	36986204	+	Frame_Shift_Del	DEL	AAAG	AAAG	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	AAAG	AAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr5:36986201_36986204delAAAG	ENST00000282516.8	+	10	3418_3421	c.2919_2922delAAAG	c.(2917-2922)acaaagfs	p.TK973fs	NIPBL_ENST00000448238.2_Frame_Shift_Del_p.TK973fs|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	973					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CTCAGGAGACAAAGAAAATGGAAA	0.373																																					p.973_974del		Atlas-Indel,Pindel	.											.	NIPBL	513	.	0			c.2918_2921del	GRCh37	CD063575	NIPBL	D		PASS	.																																			SO:0001589	frameshift_variant	25836	exon10			.	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.2919_2922delAAAG	chr5.hg19:g.36986201_36986204delAAAG	ENSP00000282516:p.Thr973fs	92.0	0.0	0		80.0	17.0	0.2125	NM_133433	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Del	DEL	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.	.	none		0.373	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
SETD9	133383	hgsc.bcm.edu	37	5	56210690	56210691	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr5:56210690_56210691delAG	ENST00000285947.2	+	5	1095_1096	c.709_710delAG	c.(709-711)agafs	p.R237fs	SETD9_ENST00000475908.1_3'UTR|SETD9_ENST00000541720.1_Frame_Shift_Del_p.R237fs	NM_153706.3	NP_714917.2	Q8NE22	SETD9_HUMAN	SET domain containing 9	237	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)										GTTCCTAGACAGAGCAGCTAAT	0.356																																					p.236_237del		Atlas-INDEL	.											.	.	.	.	0			c.708_709del						PASS	.																																			SO:0001589	frameshift_variant	133383	exon5			.	BC036528	CCDS3972.1	5q11.2	2012-02-23	2012-02-23	2012-02-23	ENSG00000155542	ENSG00000155542			28508	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 35"""	C5orf35		20930037	Standard	NM_153706		Approved	MGC33648	uc003jqx.3	Q8NE22	OTTHUMG00000059485	ENST00000285947.2:c.709_710delAG	chr5.hg19:g.56210692_56210693delAG	ENSP00000285947:p.Arg237fs	86.0	0.0	0		96.0	11.0	0.114583	NM_001171990	F5H713	Frame_Shift_Del	DEL	ENST00000285947.2	hg19	CCDS3972.1																																																																																			.	.	.	none		0.356	SETD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132304.2	NM_153706	
HIF1A	3091	hgsc.bcm.edu	37	14	62194225	62194225	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr14:62194225delC	ENST00000337138.4	+	6	890	c.625delC	c.(625-627)cagfs	p.Q209fs	HIF1A_ENST00000557538.1_Frame_Shift_Del_p.Q150fs|HIF1A_ENST00000539097.1_Frame_Shift_Del_p.Q233fs|HIF1A_ENST00000557206.1_3'UTR|HIF1A_ENST00000394997.1_Frame_Shift_Del_p.Q210fs|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000323441.6_Frame_Shift_Del_p.Q209fs	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	209	Interaction with TSGA10. {ECO:0000250}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TAACCAACCTCAGTGTGGGTA	0.383																																					p.P232fs		Atlas-INDEL	.											.	HIF1A	120	.	0			c.696delT						PASS	.						166.0	142.0	150.0					14																	62194225		2203	4300	6503	SO:0001589	frameshift_variant	3091	exon6			.	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.625delC	chr14.hg19:g.62194225delC	ENSP00000338018:p.Gln209fs	156.0	0.0	0		98.0	15.0	0.153061	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Frame_Shift_Del	DEL	ENST00000337138.4	hg19	CCDS9753.1																																																																																			.	.	.	none		0.383	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
IGFBP6	3489	hgsc.bcm.edu	37	12	53494509	53494509	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr12:53494509delT	ENST00000301464.3	+	2	621	c.348delT	c.(346-348)aatfs	p.N116fs	SOAT2_ENST00000301466.3_5'Flank|IGFBP6_ENST00000549628.1_3'UTR|IGFBP6_ENST00000548547.1_Frame_Shift_Del_p.N114fs	NM_002178.2	NP_002169.1	P24592	IBP6_HUMAN	insulin-like growth factor binding protein 6	116					cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)|ovary(1)|pancreas(1)	6						CAGAGGAGAATCCTAAGGAGA	0.567																																					p.N116fs	Esophageal Squamous(83;1656 1718 30141 34380)	Atlas-Indel,Pindel	.											.	IGFBP6	16	.	0			c.347delA						PASS	.						95.0	93.0	94.0					12																	53494509		2203	4300	6503	SO:0001589	frameshift_variant	3489	exon2			.		CCDS8846.1	12q13	2008-07-28				ENSG00000167779			5475	protein-coding gene	gene with protein product		146735				1850258, 10087296	Standard	NM_002178		Approved		uc001sbu.1	P24592	OTTHUMG00000169773	ENST00000301464.3:c.348delT	chr12.hg19:g.53494509delT	ENSP00000301464:p.Asn116fs	62.0	0.0	0		71.0	30.0	0.422535	NM_002178	Q14492	Frame_Shift_Del	DEL	ENST00000301464.3	hg19	CCDS8846.1																																																																																			.	.	.	none		0.567	IGFBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405813.1		
SAMD9	54809	hgsc.bcm.edu	37	7	92731495	92731495	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr7:92731495delT	ENST00000379958.2	-	3	4185	c.3916delA	c.(3916-3918)atafs	p.I1306fs		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1306						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			AGACAAAATATATCTACATAT	0.373																																					p.I1306fs		Atlas-Indel,Pindel	.											.	SAMD9	239	.	0			c.3917delT						PASS	.						73.0	81.0	78.0					7																	92731495		2197	4295	6492	SO:0001589	frameshift_variant	54809	exon2			.	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3916delA	chr7.hg19:g.92731495delT	ENSP00000369292:p.Ile1306fs	28.0	0.0	0		32.0	12.0	0.375	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Frame_Shift_Del	DEL	ENST00000379958.2	hg19	CCDS34680.1																																																																																			.	.	.	none		0.373	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
GPR37L1	9283	hgsc.bcm.edu	37	1	202097307	202097311	+	Frame_Shift_Del	DEL	CTCAA	CTCAA	-	rs76841249	byFrequency	TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	CTCAA	CTCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr1:202097307_202097311delCTCAA	ENST00000367282.5	+	2	1175_1179	c.1069_1073delCTCAA	c.(1069-1074)ctcaacfs	p.LN357fs		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	357					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						TGAGAGCCAGCTCAACAGCACCGTG	0.639																																					p.356_358del		Atlas-Indel,Pindel	.											.	GPR37L1	33	.	0			c.1068_1072del						PASS	.																																			SO:0001589	frameshift_variant	9283	exon2			.	AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.1069_1073delCTCAA	chr1.hg19:g.202097307_202097311delCTCAA	ENSP00000356251:p.Leu357fs	83.0	0.0	0		86.0	37.0	0.430233	NM_004767	B2R7M9|Q5SXP7|Q86VP7	Frame_Shift_Del	DEL	ENST00000367282.5	hg19	CCDS1420.1																																																																																			.	.	.	none		0.639	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2	NM_004767	
GLS	2744	hgsc.bcm.edu	37	2	191788697	191788701	+	Frame_Shift_Del	DEL	AAAAG	AAAAG	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	AAAAG	AAAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr2:191788697_191788701delAAAAG	ENST00000320717.3	+	10	1443_1447	c.1185_1189delAAAAG	c.(1183-1191)ttaaaagaafs	p.KE396fs	GLS_ENST00000338435.4_Frame_Shift_Del_p.KE396fs	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	396					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	GATATTACTTAAAAGAAAAGAAGGT	0.259																																					p.395_396del		Atlas-Indel,Pindel	.											.	GLS	47	.	0			c.1184_1188del						PASS	.																																			SO:0001589	frameshift_variant	2744	exon10			.	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1185_1189delAAAAG	chr2.hg19:g.191788702_191788706delAAAAG	ENSP00000317379:p.Lys396fs	132.0	0.0	0		120.0	34.0	0.283333	NM_001256310	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Frame_Shift_Del	DEL	ENST00000320717.3	hg19	CCDS2308.1																																																																																			.	.	.	none		0.259	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
HOXD10	3236	hgsc.bcm.edu	37	2	176981597	176981599	+	In_Frame_Del	DEL	TTT	TTT	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	TTT	TTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr2:176981597_176981599delTTT	ENST00000249501.4	+	1	291_293	c.36_38delTTT	c.(34-39)actttt>act	p.F13del	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	13					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		CTGCTAATACTTTTTTAGTAGAT	0.453																																					p.12_13del		Atlas-Indel,Pindel	.											.	HOXD10	65	.	0			c.35_37del						PASS	.																																			SO:0001651	inframe_deletion	3236	exon1			.		CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.36_38delTTT	chr2.hg19:g.176981600_176981602delTTT	ENSP00000249501:p.Phe13del	80.0	0.0	0		80.0	33.0	0.4125	NM_002148	Q6NT10	In_Frame_Del	DEL	ENST00000249501.4	hg19	CCDS2266.1																																																																																			.	.	.	none		0.453	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2		
TRIM39	56658	hgsc.bcm.edu	37	6	30303731	30303752	+	Splice_Site	DEL	GTCAGGCTTCGAGATGCTTAAG	GTCAGGCTTCGAGATGCTTAAG	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	GTCAGGCTTCGAGATGCTTAAG	GTCAGGCTTCGAGATGCTTAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr6:30303731_30303752delGTCAGGCTTCGAGATGCTTAAG	ENST00000396547.1	+	4	919_940	c.759_780delGTCAGGCTTCGAGATGCTTAAG	c.(757-780)cagtcaggcttcgagatgcttaag>ca	p.QSGFEMLK253fs	TRIM39_ENST00000396551.3_Splice_Site_p.QSGFEMLK253fs|TRIM39_ENST00000376656.4_Splice_Site_p.QSGFEMLK253fs|TRIM39-RPP21_ENST00000513556.1_Splice_Site_p.QSGFEMLK165fs|TRIM39_ENST00000540416.1_Splice_Site_p.QSGFEMLK253fs|TRIM39_ENST00000376659.5_Splice_Site_p.QSGFEMLK253fs|TRIM39_ENST00000396548.1_Splice_Site_p.QSGFEMLK253fs			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	253					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.K260Q(1)		ovary(3)	3						AGTGCTTACAGTCAGGCTTCGAGATGCTTAAGGTTCGACCTT	0.577																																					p.253_260del		Pindel	.											.	TRIM39	56	.	1	Substitution - Missense(1)	lung(1)	c.758_779del						PASS	.																																			SO:0001630	splice_region_variant	56658	exon5			.	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.780+1GTCAGGCTTCGAGATGCTTAAG>-	chr6.hg19:g.30303731_30303752delGTCAGGCTTCGAGATGCTTAAG		91.0	0.0	.		40.0	13.0	0.325	NM_172016	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Frame_Shift_Del	DEL	ENST00000396547.1	hg19	CCDS34377.1																																																																																			.	.	.	none		0.577	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016	Frame_Shift_Del
HIF1A	3091	hgsc.bcm.edu	37	14	62194216	62194225	+	Frame_Shift_Del	DEL	AACCAACCTC	AACCAACCTC	-	rs369217648		TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	AACCAACCTC	AACCAACCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr14:62194216_62194225delAACCAACCTC	ENST00000337138.4	+	6	881_890	c.616_625delAACCAACCTC	c.(616-627)aaccaacctcagfs	p.NQPQ206fs	HIF1A_ENST00000557538.1_Frame_Shift_Del_p.NQPQ147fs|HIF1A_ENST00000539097.1_Frame_Shift_Del_p.NQPQ230fs|HIF1A_ENST00000557206.1_3'UTR|HIF1A_ENST00000394997.1_Frame_Shift_Del_p.NQPQ207fs|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000323441.6_Frame_Shift_Del_p.NQPQ206fs	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	206	Interaction with TSGA10. {ECO:0000250}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TACCAACAGTAACCAACCTCAGTGTGGGTA	0.381																																					p.229_232del		Pindel	.											.	HIF1A	120	.	0			c.687_696del						PASS	.																																			SO:0001589	frameshift_variant	3091	exon6			.	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.616_625delAACCAACCTC	chr14.hg19:g.62194216_62194225delAACCAACCTC	ENSP00000338018:p.Asn206fs	152.0	0.0	.		100.0	15.0	0.150	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Frame_Shift_Del	DEL	ENST00000337138.4	hg19	CCDS9753.1																																																																																			.	.	.	none		0.381	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
MSH4	4438	hgsc.bcm.edu	37	1	76346929	76346934	+	Splice_Site	DEL	TTTCAG	TTTCAG	-			TCGA-P4-A5E8-01A-11D-A28G-10	TCGA-P4-A5E8-11A-12D-A28G-10	TTTCAG	TTTCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ca2f452-c444-436c-a256-a2e6c6d596d6	98665cdb-4732-42e2-9034-a7b233b8abb2	g.chr1:76346929_76346934delTTTCAG	ENST00000263187.3	+	14	1885_1889	c.1781_1785delTTTCAG	c.(1780-1785)atttca>a	p.IS594del		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	594					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						ACGTGTTTTCAGGATAGTGTGCAAAC	0.306								Mismatch excision repair (MMR)																													.		Pindel	.											.	MSH4	147	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	4438	.			.	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.1782-1TTTCAG>-	chr1.hg19:g.76346929_76346934delTTTCAG		82.0	0.0	.		59.0	11.0	0.186	.	Q5T4U6|Q8NEB3|Q9UNP8	Splice_Site	DEL	ENST00000263187.3	hg19	CCDS670.1																																																																																			.	.	.	none		0.306	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	In_Frame_Del
