#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MAP3K6	9064	hgsc.bcm.edu	37	1	27687435	27687435	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:27687435C>T	ENST00000493901.1	-	15	2136	c.1897G>A	c.(1897-1899)Gag>Aag	p.E633K	MAP3K6_ENST00000357582.2_Missense_Mutation_p.E633K|MAP3K6_ENST00000374040.3_Missense_Mutation_p.E625K	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	633					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CCCGCGCCCTCCGCCTCCTCC	0.736																																					p.E633K		Atlas-SNP	.											.	MAP3K6	134	.	0			c.G1897A						PASS	.						10.0	14.0	13.0					1																	27687435		2139	4246	6385	SO:0001583	missense	9064	exon14			CGCCCTCCGCCTC	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.1897G>A	chr1.hg19:g.27687435C>T	ENSP00000419591:p.Glu633Lys	71.0	0.0	.		102.0	35.0	.	NM_004672	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	ENST00000493901.1	hg19	CCDS299.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.901459	0.33535	.	.	ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582	T;T;T	0.68025	-0.3;-0.3;-0.3	4.67	3.73	0.42828	.	.	.	.	.	T	0.61999	0.2392	M	0.62723	1.935	0.09310	N	1	B;B	0.25609	0.13;0.079	B;B	0.24701	0.055;0.025	T	0.54860	-0.8230	9	0.48119	T	0.1	.	8.9619	0.35851	0.0:0.8957:0.0:0.1043	.	625;633	O95382-3;O95382	.;M3K6_HUMAN	K	625;633;356;633	ENSP00000363152:E625K;ENSP00000419591:E633K;ENSP00000350195:E633K	ENSP00000350195:E633K	E	-	1	0	MAP3K6	27560022	0.005000	0.15991	0.073000	0.20177	0.013000	0.08279	1.483000	0.35497	2.433000	0.82419	0.655000	0.94253	GAG	.	.	.	none		0.736	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672	
TUFT1	7286	hgsc.bcm.edu	37	1	151552139	151552139	+	Silent	SNP	A	A	G	rs201062061		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:151552139A>G	ENST00000368849.3	+	11	1001	c.939A>G	c.(937-939)aaA>aaG	p.K313K	TUFT1_ENST00000368848.2_Silent_p.K288K|TUFT1_ENST00000392712.3_Silent_p.K258K|TUFT1_ENST00000538902.1_Silent_p.K332K|TUFT1_ENST00000353024.3_Silent_p.K254K	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	313					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGAATTCAAAAGCTGTGATCC	0.547																																					p.K313K		Atlas-SNP	.											.	TUFT1	32	.	0			c.A939G						PASS	.						58.0	53.0	55.0					1																	151552139		2203	4300	6503	SO:0001819	synonymous_variant	7286	exon11			TTCAAAAGCTGTG	AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.939A>G	chr1.hg19:g.151552139A>G		170.0	0.0	.		138.0	17.0	.	NM_020127	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Silent	SNP	ENST00000368849.3	hg19	CCDS1000.1																																																																																			.	.	.	alt		0.547	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	NM_020127	
GATAD2B	57459	hgsc.bcm.edu	37	1	153792180	153792180	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:153792180G>C	ENST00000368655.4	-	3	610	c.367C>G	c.(367-369)Cca>Gca	p.P123A		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	123					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATGATGTCTGGTGAGGGAGTT	0.408																																					p.P123A		Atlas-SNP	.											.	GATAD2B	62	.	0			c.C367G						PASS	.						111.0	112.0	112.0					1																	153792180		2203	4300	6503	SO:0001583	missense	57459	exon3			TGTCTGGTGAGGG	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.367C>G	chr1.hg19:g.153792180G>C	ENSP00000357644:p.Pro123Ala	241.0	0.0	.		193.0	17.0	.	NM_020699	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	hg19	CCDS1054.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821458	0.90873	.	.	ENSG00000143614	ENST00000368655	T	0.41400	1.0	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.53029	0.1771	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.42982	-0.9419	10	0.35671	T	0.21	-15.871	17.5737	0.87942	0.0:0.0:1.0:0.0	.	123	Q8WXI9	P66B_HUMAN	A	123	ENSP00000357644:P123A	ENSP00000357644:P123A	P	-	1	0	GATAD2B	152058804	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.086000	0.94088	2.682000	0.91365	0.557000	0.71058	CCA	.	.	.	none		0.408	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	NM_020699	
SEMA4C	54910	hgsc.bcm.edu	37	2	97526794	97526794	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:97526794G>A	ENST00000305476.5	-	15	2203	c.2071C>T	c.(2071-2073)Cgg>Tgg	p.R691W	ANKRD39_ENST00000393537.4_5'Flank	NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	691					cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						AGCTCTTCCCGCAGCCGCCGG	0.687																																					p.R691W		Atlas-SNP	.											.	SEMA4C	56	.	0			c.C2071T						PASS	.						22.0	27.0	25.0					2																	97526794		2200	4287	6487	SO:0001583	missense	54910	exon15			CTTCCCGCAGCCG	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.2071C>T	chr2.hg19:g.97526794G>A	ENSP00000306844:p.Arg691Trp	70.0	0.0	.		100.0	4.0	.	NM_017789	Q32MJ3|Q7Z5X0	Missense_Mutation	SNP	ENST00000305476.5	hg19	CCDS2029.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.697364	0.68386	.	.	ENSG00000168758	ENST00000305476	T	0.78126	-1.15	4.89	4.89	0.63831	.	0.414868	0.24111	N	0.041444	T	0.73923	0.3649	N	0.08118	0	0.45097	D	0.998111	D;D;D	0.89917	0.997;0.999;1.0	P;P;D	0.67548	0.798;0.874;0.952	T	0.77851	-0.2434	10	0.87932	D	0	.	10.5898	0.45304	0.0:0.0:0.699:0.301	.	691;401;232	Q9C0C4;Q6P5A5;Q71RG3	SEM4C_HUMAN;.;.	W	691	ENSP00000306844:R691W	ENSP00000306844:R691W	R	-	1	2	SEMA4C	96890521	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.946000	0.56644	2.531000	0.85337	0.561000	0.74099	CGG	.	.	.	none		0.687	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	NM_017789	
CD96	10225	hgsc.bcm.edu	37	3	111297955	111297955	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:111297955C>T	ENST00000283285.5	+	5	804	c.673C>T	c.(673-675)Ctt>Ttt	p.L225F	CD96_ENST00000438817.2_Missense_Mutation_p.L209F|CD96_ENST00000352690.4_Missense_Mutation_p.L209F	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	225	Ig-like V-type 2.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						TAGAGTCAAGCTTGGTACAGA	0.423									Opitz Trigonocephaly syndrome																												p.L225F		Atlas-SNP	.											.	CD96	75	.	0			c.C673T						PASS	.						120.0	108.0	112.0					3																	111297955		2203	4300	6503	SO:0001583	missense	10225	exon5	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	GTCAAGCTTGGTA	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.673C>T	chr3.hg19:g.111297955C>T	ENSP00000283285:p.Leu225Phe	178.0	0.0	.		178.0	14.0	.	NM_198196	Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	hg19	CCDS2959.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.734|5.734	0.319968|0.319968	0.10845|0.10845	.|.	.|.	ENSG00000153283|ENSG00000153283	ENST00000465428|ENST00000352690;ENST00000283285;ENST00000438817	.|T;T;T	.|0.73258	.|1.54;-0.73;1.54	5.18|5.18	1.28|1.28	0.21552|0.21552	.|Immunoglobulin subtype (1);	.|0.567715	.|0.14720	.|N	.|0.302408	T|T	0.59702|0.59702	0.2213|0.2213	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|P;P;P;P	.|0.44946	.|0.761;0.846;0.761;0.761	.|B;P;B;B	.|0.46585	.|0.322;0.521;0.443;0.322	T|T	0.50800|0.50800	-0.8785|-0.8785	5|10	.|0.51188	.|T	.|0.08	-0.8167|-0.8167	5.5178|5.5178	0.16916|0.16916	0.2453:0.5587:0.1213:0.0747|0.2453:0.5587:0.1213:0.0747	.|.	.|209;209;225;209	.|E9PEJ1;P40200-2;P40200;Q8WUE2	.|.;.;TACT_HUMAN;.	V|F	50|209;225;209	.|ENSP00000342040:L209F;ENSP00000283285:L225F;ENSP00000389801:L209F	.|ENSP00000283285:L225F	A|L	+|+	2|1	0|0	CD96|CD96	112780645|112780645	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.017000|0.017000	0.09413|0.09413	0.121000|0.121000	0.15667|0.15667	-0.203000|-0.203000	0.10251|0.10251	-1.886000|-1.886000	0.00541|0.00541	GCT|CTT	.	.	.	none		0.423	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2		
ZIC1	7545	hgsc.bcm.edu	37	3	147128794	147128794	+	Nonsense_Mutation	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:147128794G>T	ENST00000282928.4	+	1	1624	c.895G>T	c.(895-897)Gag>Tag	p.E299*		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	299					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GCACACGGGCGAGAAGCCCTT	0.562																																					p.E299X		Atlas-SNP	.											.	ZIC1	141	.	0			c.G895T						PASS	.						91.0	94.0	93.0					3																	147128794		2203	4300	6503	SO:0001587	stop_gained	7545	exon1			ACGGGCGAGAAGC	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.895G>T	chr3.hg19:g.147128794G>T	ENSP00000282928:p.Glu299*	169.0	0.0	.		160.0	36.0	.	NM_003412	Q2M3N1	Nonsense_Mutation	SNP	ENST00000282928.4	hg19	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	G	43	9.911065	0.99294	.	.	ENSG00000152977	ENST00000282928	.	.	.	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.2006	0.82071	0.0:0.0:1.0:0.0	.	.	.	.	X	299	.	ENSP00000282928:E299X	E	+	1	0	ZIC1	148611484	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	7.528000	0.81941	1.862000	0.54008	0.561000	0.74099	GAG	.	.	.	none		0.562	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
MAEA	10296	hgsc.bcm.edu	37	4	1332242	1332242	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr4:1332242G>A	ENST00000303400.4	+	8	995	c.932G>A	c.(931-933)aGc>aAc	p.S311N	MAEA_ENST00000510794.1_Missense_Mutation_p.S310N|MAEA_ENST00000512289.1_3'UTR|MAEA_ENST00000505177.2_Missense_Mutation_p.S349N|MAEA_ENST00000452175.2_Missense_Mutation_p.S232N|MAEA_ENST00000264750.6_Missense_Mutation_p.S270N|MAEA_ENST00000514708.1_Missense_Mutation_p.S243N|MAEA_ENST00000505839.1_Missense_Mutation_p.S263N	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	311					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	AGCTCCAAGAGCCCTGACTGC	0.662																																					p.S311N		Atlas-SNP	.											.	MAEA	39	.	0			c.G932A						PASS	.						61.0	61.0	61.0					4																	1332242		2203	4300	6503	SO:0001583	missense	10296	exon8			CCAAGAGCCCTGA	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.932G>A	chr4.hg19:g.1332242G>A	ENSP00000302830:p.Ser311Asn	76.0	0.0	.		68.0	18.0	.	NM_001017405	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	hg19	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	G	7.811	0.715683	0.15306	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000264750;ENST00000382947;ENST00000539495;ENST00000452175;ENST00000514708;ENST00000510794;ENST00000505839	T;T;T;T;T;T;T	0.10763	2.84;2.84;2.84;2.84;2.84;2.84;2.84	5.41	4.44	0.53790	.	0.178095	0.64402	D	0.000005	T	0.04770	0.0129	N	0.20328	0.56	0.46260	D	0.998958	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.0;0.0	T	0.34254	-0.9836	10	0.05959	T	0.93	-33.7543	3.5266	0.07761	0.3654:0.0:0.6346:0.0	.	310;349;97;243;270;311	B4DVN3;E7ESC7;B3KRN7;D6RIB6;Q7L5Y9-3;Q7L5Y9	.;.;.;.;.;MAEA_HUMAN	N	311;349;270;243;290;232;243;310;263	ENSP00000302830:S311N;ENSP00000422215:S349N;ENSP00000264750:S270N;ENSP00000411415:S232N;ENSP00000427512:S243N;ENSP00000426807:S310N;ENSP00000424436:S263N	ENSP00000264750:S270N	S	+	2	0	MAEA	1322242	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.331000	0.79192	2.531000	0.85337	0.655000	0.94253	AGC	.	.	.	none		0.662	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
TLL1	7092	hgsc.bcm.edu	37	4	166996130	166996130	+	Silent	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr4:166996130T>C	ENST00000061240.2	+	17	2936	c.2289T>C	c.(2287-2289)caT>caC	p.H763H	TLL1_ENST00000507499.1_Silent_p.H786H	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	763	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTGTGCTACATGACAATAAAC	0.403																																					p.H763H		Atlas-SNP	.											.	TLL1	194	.	0			c.T2289C						PASS	.						296.0	244.0	262.0					4																	166996130		2203	4300	6503	SO:0001819	synonymous_variant	7092	exon17			GCTACATGACAAT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2289T>C	chr4.hg19:g.166996130T>C		223.0	0.0	.		161.0	18.0	.	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	hg19	CCDS3811.1																																																																																			.	.	.	none		0.403	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
FCHO2	115548	hgsc.bcm.edu	37	5	72359736	72359736	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:72359736C>A	ENST00000430046.2	+	18	1530	c.1414C>A	c.(1414-1416)Ctt>Att	p.L472I	FCHO2_ENST00000341845.6_Missense_Mutation_p.L472I|FCHO2_ENST00000512348.1_Missense_Mutation_p.L439I	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	472	Ser-rich.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		CAGACCAAAGCTTACTTCAGG	0.403																																					p.L472I		Atlas-SNP	.											.	FCHO2	96	.	0			c.C1414A						PASS	.						65.0	61.0	62.0					5																	72359736		1850	4087	5937	SO:0001583	missense	115548	exon18			CCAAAGCTTACTT	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.1414C>A	chr5.hg19:g.72359736C>A	ENSP00000393776:p.Leu472Ile	193.0	0.0	.		139.0	43.0	.	NM_138782	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	hg19	CCDS47230.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967806	0.74131	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348	T;T;T	0.39056	1.1;1.11;3.55	5.62	5.62	0.85841	.	0.164332	0.40728	N	0.001021	T	0.52933	0.1765	L	0.56769	1.78	0.41260	D	0.986778	D;D	0.67145	0.99;0.996	P;P	0.60415	0.76;0.874	T	0.43956	-0.9359	10	0.18710	T	0.47	-12.133	12.5234	0.56073	0.0:0.8806:0.0:0.1194	.	439;472	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	I	472;472;439	ENSP00000393776:L472I;ENSP00000344034:L472I;ENSP00000427296:L439I	ENSP00000344034:L472I	L	+	1	0	FCHO2	72395492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.706000	0.47135	2.637000	0.89404	0.650000	0.86243	CTT	.	.	.	none		0.403	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
MTRF1L	54516	hgsc.bcm.edu	37	6	153315714	153315714	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr6:153315714C>G	ENST00000367233.5	-	4	620	c.621G>C	c.(619-621)aaG>aaC	p.K207N	MTRF1L_ENST00000464135.1_5'UTR|MTRF1L_ENST00000367231.5_Missense_Mutation_p.K207N|MTRF1L_ENST00000367230.1_Missense_Mutation_p.K171N	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	207						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		GCTTTTCTGTCTTTGGCACTC	0.502																																					p.K207N		Atlas-SNP	.											.	MTRF1L	21	.	0			c.G621C						PASS	.						164.0	143.0	150.0					6																	153315714		2203	4300	6503	SO:0001583	missense	54516	exon4			TTCTGTCTTTGGC	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.621G>C	chr6.hg19:g.153315714C>G	ENSP00000356202:p.Lys207Asn	113.0	0.0	.		112.0	14.0	.	NM_019041	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	ENST00000367233.5	hg19	CCDS5243.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560810	0.65538	.	.	ENSG00000112031	ENST00000367233;ENST00000367231;ENST00000367230;ENST00000414771;ENST00000448966	T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76	4.97	3.11	0.35812	.	0.096199	0.64402	D	0.000001	T	0.18718	0.0449	M	0.78801	2.425	0.40959	D	0.984603	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.76071	0.964;0.973;0.987;0.974	T	0.01102	-1.1451	10	0.56958	D	0.05	-12.0679	8.928	0.35652	0.0:0.7454:0.0:0.2546	.	171;207;171;207	B4DMX1;Q9UGC7-2;Q9UGC7-4;Q9UGC7	.;.;.;RF1ML_HUMAN	N	207;207;171;58;71	ENSP00000356202:K207N;ENSP00000356200:K207N;ENSP00000356199:K171N;ENSP00000414383:K58N;ENSP00000415113:K71N	ENSP00000356199:K171N	K	-	3	2	MTRF1L	153357407	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.344000	0.33941	0.558000	0.29135	0.585000	0.79938	AAG	.	.	.	none		0.502	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
AUTS2	26053	hgsc.bcm.edu	37	7	70231266	70231266	+	Silent	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr7:70231266G>A	ENST00000342771.4	+	9	1956	c.1635G>A	c.(1633-1635)ccG>ccA	p.P545P	AUTS2_ENST00000406775.2_Silent_p.P545P	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	545	His-rich.									breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		cCTTCACGCCGTTCCCCCACG	0.642																																					p.P545P		Atlas-SNP	.											.	AUTS2	173	.	0			c.G1635A						PASS	.						278.0	255.0	263.0					7																	70231266		2203	4300	6503	SO:0001819	synonymous_variant	26053	exon9			CACGCCGTTCCCC	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1635G>A	chr7.hg19:g.70231266G>A		63.0	0.0	.		90.0	31.0	.	NM_001127231	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	hg19	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455200	0.26161	.	.	ENSG00000158321	ENST00000443672	.	.	.	5.56	-2.87	0.05700	.	.	.	.	.	T	0.50343	0.1610	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45131	-0.9282	4	.	.	.	-11.6373	6.7468	0.23466	0.1273:0.5083:0.2255:0.1389	.	.	.	.	H	87	.	.	R	+	2	0	AUTS2	69869202	0.862000	0.29867	0.976000	0.42696	0.997000	0.91878	-0.056000	0.11787	-0.475000	0.06852	0.561000	0.74099	CGT	.	.	.	none		0.642	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
CAMK1D	57118	hgsc.bcm.edu	37	10	12856228	12856228	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr10:12856228G>A	ENST00000378847.3	+	7	1013	c.676G>A	c.(676-678)Gac>Aac	p.D226N	CAMK1D_ENST00000378845.1_Missense_Mutation_p.D226N	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		TGATGAAAATGACTCCAAGCT	0.483																																					p.D226N		Atlas-SNP	.											.	CAMK1D	99	.	0			c.G676A						PASS	.						101.0	90.0	94.0					10																	12856228		2203	4300	6503	SO:0001583	missense	57118	exon7			GAAAATGACTCCA	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.676G>A	chr10.hg19:g.12856228G>A	ENSP00000368124:p.Asp226Asn	73.0	0.0	.		99.0	10.0	.	NM_153498	B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	hg19	CCDS7091.1	.	.	.	.	.	.	.	.	.	.	G	31	5.064215	0.93898	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.65364	-0.15;-0.15	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70011	0.3175	L	0.35723	1.085	0.80722	D	1	D;B	0.54047	0.964;0.267	D;B	0.63703	0.917;0.344	T	0.68907	-0.5285	10	0.42905	T	0.14	-37.1453	16.7965	0.85603	0.0:0.0:1.0:0.0	.	226;226	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	N	226	ENSP00000368124:D226N;ENSP00000368122:D226N	ENSP00000368122:D226N	D	+	1	0	CAMK1D	12896234	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.517000	0.98020	2.556000	0.86216	0.555000	0.69702	GAC	.	.	.	none		0.483	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397	
KCNQ1	3784	hgsc.bcm.edu	37	11	2466535	2466535	+	Silent	SNP	G	G	T	rs587781009		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:2466535G>T	ENST00000155840.5	+	1	315	c.207G>T	c.(205-207)gcG>gcT	p.A69A		NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	69					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	ccccggccgcgcccgccgcgc	0.811																																					p.A69A		Atlas-SNP	.											.	KCNQ1	60	.	0			c.G207T						PASS	.						3.0	4.0	3.0					11																	2466535		1287	2827	4114	SO:0001819	synonymous_variant	3784	exon1			GGCCGCGCCCGCC	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.207G>T	chr11.hg19:g.2466535G>T		0.0	0.0	.		4.0	4.0	.	NM_000218	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Silent	SNP	ENST00000155840.5	hg19	CCDS7736.1																																																																																			.	.	.	none		0.811	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	
TRIM68	55128	hgsc.bcm.edu	37	11	4621750	4621750	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:4621750C>T	ENST00000300747.5	-	7	1503	c.1214G>A	c.(1213-1215)cGa>cAa	p.R405Q		NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68	405	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGTGCCTGCTCGGTACTCATT	0.517																																					p.R405Q		Atlas-SNP	.											.	TRIM68	53	.	0			c.G1214A						PASS	.						100.0	84.0	89.0					11																	4621750		2201	4298	6499	SO:0001583	missense	55128	exon7			CCTGCTCGGTACT	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1		ENST00000300747.5:c.1214G>A	chr11.hg19:g.4621750C>T	ENSP00000300747:p.Arg405Gln	196.0	0.0	.		164.0	35.0	.	NM_018073	A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Missense_Mutation	SNP	ENST00000300747.5	hg19	CCDS31356.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473848	0.63737	.	.	ENSG00000167333	ENST00000300747;ENST00000544055	T	0.68181	-0.31	4.99	0.918	0.19386	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.160187	0.29932	N	0.010838	T	0.44582	0.1300	L	0.33753	1.03	0.28223	N	0.926426	P	0.34837	0.472	B	0.34824	0.19	T	0.23762	-1.0179	10	0.12766	T	0.61	.	3.2819	0.06918	0.1772:0.4704:0.0:0.3524	.	405	Q6AZZ1	TRI68_HUMAN	Q	405;126	ENSP00000300747:R405Q	ENSP00000300747:R405Q	R	-	2	0	TRIM68	4578326	0.000000	0.05858	0.996000	0.52242	0.995000	0.86356	-0.456000	0.06754	0.351000	0.24027	0.561000	0.74099	CGA	.	.	.	none		0.517	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073	
ZNHIT2	741	hgsc.bcm.edu	37	11	64884755	64884755	+	Missense_Mutation	SNP	G	G	A	rs200126440		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:64884755G>A	ENST00000310597.4	-	1	415	c.371C>T	c.(370-372)cCt>cTt	p.P124L	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	124							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						CCGCCATGGAGGCAGCAGCCG	0.731													G|||	1	0.000199681	0.0	0.0	5008	,	,		11861	0.0		0.001	False		,,,				2504	0.0				p.P124L		Atlas-SNP	.											.	ZNHIT2	12	.	0			c.C371T						PASS	.	G	LEU/PRO	0,3516		0,0,1758	6.0	8.0	7.0		371	4.6	1.0	11		7	3,7301		0,3,3649	no	missense	ZNHIT2	NM_014205.2	98	0,3,5407	AA,AG,GG		0.0411,0.0,0.0277	probably-damaging	124/404	64884755	3,10817	1758	3652	5410	SO:0001583	missense	741	exon1			CATGGAGGCAGCA		CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.371C>T	chr11.hg19:g.64884755G>A	ENSP00000308548:p.Pro124Leu	1.0	0.0	.		13.0	8.0	.	NM_014205	Q3SY14|Q8IUV0	Missense_Mutation	SNP	ENST00000310597.4	hg19	CCDS8094.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129799	0.77549	0.0	4.11E-4	ENSG00000174276	ENST00000310597	T	0.34472	1.36	4.55	4.55	0.56014	.	0.142165	0.47455	U	0.000232	T	0.59959	0.2232	M	0.74881	2.28	0.53005	D	0.999966	D	0.89917	1.0	D	0.83275	0.996	T	0.64757	-0.6332	10	0.72032	D	0.01	-12.5655	14.8345	0.70172	0.0:0.0:1.0:0.0	.	124	Q9UHR6	ZNHI2_HUMAN	L	124	ENSP00000308548:P124L	ENSP00000308548:P124L	P	-	2	0	ZNHIT2	64641331	0.995000	0.38212	0.958000	0.39756	0.786000	0.44442	2.667000	0.46808	2.366000	0.80165	0.561000	0.74099	CCT	.	.	.	weak		0.731	ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385260.1	NM_014205	
DSCAML1	57453	hgsc.bcm.edu	37	11	117352683	117352683	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:117352683G>C	ENST00000321322.6	-	12	2735	c.2734C>G	c.(2734-2736)Ctg>Gtg	p.L912V	DSCAML1_ENST00000527706.1_Missense_Mutation_p.L642V	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	852	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CTCACCTTCAGTGTGGAGACG	0.622																																					p.L912V		Atlas-SNP	.											.	DSCAML1	286	.	0			c.C2734G						PASS	.						104.0	73.0	84.0					11																	117352683		2201	4296	6497	SO:0001583	missense	57453	exon12			CCTTCAGTGTGGA		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2734C>G	chr11.hg19:g.117352683G>C	ENSP00000315465:p.Leu912Val	110.0	0.0	.		97.0	33.0	.	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397882	0.42512	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.73681	-0.77;-0.77	3.89	2.97	0.34412	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85111	0.5622	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.85651	0.1282	9	0.62326	D	0.03	.	11.2591	0.49071	0.09:0.0:0.91:0.0	.	852	Q8TD84	DSCL1_HUMAN	V	642;912;619	ENSP00000434335:L642V;ENSP00000315465:L912V	ENSP00000315465:L912V	L	-	1	2	DSCAML1	116857893	1.000000	0.71417	0.934000	0.37439	0.083000	0.17756	4.754000	0.62191	0.844000	0.35094	0.485000	0.47835	CTG	.	.	.	none		0.622	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
IL10RA	3587	hgsc.bcm.edu	37	11	117869470	117869470	+	Missense_Mutation	SNP	G	G	T	rs576666901	byFrequency	TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:117869470G>T	ENST00000227752.3	+	7	971	c.851G>T	c.(850-852)cGt>cTt	p.R284L	IL10RA_ENST00000545409.1_Missense_Mutation_p.R135L|IL10RA_ENST00000541785.1_Missense_Mutation_p.R264L|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	284					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		ATCAGCCAGCGTCCCTCCCCA	0.582																																					p.R284L		Atlas-SNP	.											.	IL10RA	46	.	0			c.G851T						PASS	.						90.0	73.0	79.0					11																	117869470		2200	4296	6496	SO:0001583	missense	3587	exon7			GCCAGCGTCCCTC	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.851G>T	chr11.hg19:g.117869470G>T	ENSP00000227752:p.Arg284Leu	122.0	0.0	.		115.0	18.0	.	NM_001558	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	hg19	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	G	8.140	0.784909	0.16189	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.23950	1.88;1.88;1.88	5.26	-3.16	0.05217	.	4.015810	0.00166	N	0.000015	T	0.07052	0.0179	N	0.01267	-0.92	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20505	-1.0273	10	0.10377	T	0.69	-0.0195	1.5109	0.02496	0.1162:0.2378:0.2516:0.3945	.	264;284	F5GYV8;Q13651	.;I10R1_HUMAN	L	284;264;135;264	ENSP00000227752:R284L;ENSP00000441397:R264L;ENSP00000443019:R135L	ENSP00000227752:R284L	R	+	2	0	IL10RA	117374680	0.000000	0.05858	0.000000	0.03702	0.289000	0.27227	-1.174000	0.03105	-0.149000	0.11215	-0.457000	0.05445	CGT	.	.	.	none		0.582	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
UTP20	27340	hgsc.bcm.edu	37	12	101720912	101720912	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:101720912C>A	ENST00000261637.4	+	26	3269	c.3095C>A	c.(3094-3096)tCt>tAt	p.S1032Y		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1032					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CAGGGGAAATCTGCTTCAGGC	0.453																																					p.S1032Y		Atlas-SNP	.											.	UTP20	222	.	0			c.C3095A						PASS	.						103.0	103.0	103.0					12																	101720912		2203	4300	6503	SO:0001583	missense	27340	exon26			GGAAATCTGCTTC	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3095C>A	chr12.hg19:g.101720912C>A	ENSP00000261637:p.Ser1032Tyr	90.0	0.0	.		82.0	13.0	.	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	hg19	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501228	0.85176	.	.	ENSG00000120800	ENST00000261637	T	0.20881	2.04	5.02	5.02	0.67125	Down-regulated-in-metastasis protein (1);Armadillo-type fold (1);	0.112147	0.64402	D	0.000007	T	0.45637	0.1352	M	0.63843	1.955	0.58432	D	0.999997	D	0.89917	1.0	D	0.77557	0.99	T	0.33624	-0.9861	10	0.49607	T	0.09	-16.674	18.7119	0.91661	0.0:1.0:0.0:0.0	.	1032	O75691	UTP20_HUMAN	Y	1032	ENSP00000261637:S1032Y	ENSP00000261637:S1032Y	S	+	2	0	UTP20	100245043	0.999000	0.42202	0.997000	0.53966	0.758000	0.43043	7.357000	0.79456	2.491000	0.84063	0.305000	0.20034	TCT	.	.	.	none		0.453	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
KIAA0226L	80183	hgsc.bcm.edu	37	13	46946278	46946278	+	Silent	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:46946278G>A	ENST00000429979.1	-	3	937	c.333C>T	c.(331-333)tcC>tcT	p.S111S	KIAA0226L_ENST00000409879.2_Intron|KIAA0226L_ENST00000378781.3_Silent_p.S111S|KIAA0226L_ENST00000480935.1_5'UTR|KIAA0226L_ENST00000389908.3_Silent_p.S111S|KIAA0226L_ENST00000378797.2_Silent_p.S111S|KIAA0226L_ENST00000378787.3_Silent_p.S111S|KIAA0226L_ENST00000534925.1_5'UTR|RNU2-6P_ENST00000411404.1_RNA|KIAA0226L_ENST00000378784.4_Silent_p.S44S|KIAA0226L_ENST00000322896.6_Intron	NM_025113.2	NP_079389.2	Q9H714	K226L_HUMAN	KIAA0226-like	111	Ser-rich.									NS(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|pancreas(1)	26						CGCTGCCAACGGAGTCTGTGG	0.572																																					p.S111S		Atlas-SNP	.											.	KIAA0226L	63	.	0			c.C333T						PASS	.						92.0	88.0	89.0					13																	46946278		2203	4300	6503	SO:0001819	synonymous_variant	80183	exon3			GCCAACGGAGTCT	AK025215	CCDS31970.2, CCDS66543.1, CCDS66544.1, CCDS66545.1, CCDS73569.1	13q14.11	2011-08-09	2011-08-09	2011-08-09	ENSG00000102445	ENSG00000102445			20420	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 18"""	C13orf18			Standard	NM_001286766		Approved	FLJ21562	uc010acl.3	Q9H714	OTTHUMG00000016868	ENST00000429979.1:c.333C>T	chr13.hg19:g.46946278G>A		123.0	0.0	.		122.0	6.0	.	NM_025113	A8KAG9|A8XR19|B3KS87|Q5W051|Q5W053|Q6PJ74|Q6PK94|Q86XH7|Q8N5J6	Silent	SNP	ENST00000429979.1	hg19	CCDS31970.2																																																																																			.	.	.	none		0.572	KIAA0226L-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044809.2	NM_025113	
TPP2	7174	hgsc.bcm.edu	37	13	103328750	103328750	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:103328750G>T	ENST00000376065.4	+	28	3681	c.3645G>T	c.(3643-3645)tgG>tgT	p.W1215C	TPP2_ENST00000466153.1_3'UTR|TPP2_ENST00000376052.3_Missense_Mutation_p.W1228C	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1215					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AAGAAAACTGGAAAAATTGTA	0.303																																					p.W1215C		Atlas-SNP	.											.	TPP2	124	.	0			c.G3645T						PASS	.						56.0	60.0	58.0					13																	103328750		2201	4290	6491	SO:0001583	missense	7174	exon28			AAACTGGAAAAAT	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.3645G>T	chr13.hg19:g.103328750G>T	ENSP00000365233:p.Trp1215Cys	137.0	0.0	.		117.0	11.0	.	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	hg19	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891078	0.33348	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.8	5.8	0.92144	.	0.162876	0.56097	D	0.000022	T	0.39733	0.1089	N	0.22421	0.69	0.80722	D	1	P	0.41748	0.761	B	0.37780	0.258	T	0.28073	-1.0055	9	0.38643	T	0.18	.	15.1747	0.72901	0.0692:0.0:0.9308:0.0	.	1215	P29144	TPP2_HUMAN	C	1215;1228	.	ENSP00000365220:W1228C	W	+	3	0	TPP2	102126751	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.923000	0.70045	2.746000	0.94184	0.563000	0.77884	TGG	.	.	.	none		0.303	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
IRS2	8660	hgsc.bcm.edu	37	13	110435073	110435073	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr13:110435073G>A	ENST00000375856.3	-	1	3842	c.3328C>T	c.(3328-3330)Ctc>Ttc	p.L1110F		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1110					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TGCTCCATGAGGCTCAGCCTC	0.731																																					p.L1110F	Melanoma(100;613 2409 40847)	Atlas-SNP	.											.	IRS2	44	.	0			c.C3328T						PASS	.						5.0	6.0	6.0					13																	110435073		2027	4070	6097	SO:0001583	missense	8660	exon1			CCATGAGGCTCAG	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3328C>T	chr13.hg19:g.110435073G>A	ENSP00000365016:p.Leu1110Phe	8.0	0.0	.		54.0	21.0	.	NM_003749	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	hg19	CCDS9510.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514438	0.27123	.	.	ENSG00000185950	ENST00000375856	T	0.46063	0.88	3.92	2.96	0.34315	.	0.608901	0.14485	U	0.316713	T	0.58323	0.2114	M	0.64404	1.975	0.36281	D	0.855788	D	0.76494	0.999	D	0.75484	0.986	T	0.62324	-0.6878	10	0.35671	T	0.21	-24.5425	12.0667	0.53592	0.1011:0.0:0.8989:0.0	.	1110	Q9Y4H2	IRS2_HUMAN	F	1110	ENSP00000365016:L1110F	ENSP00000365016:L1110F	L	-	1	0	IRS2	109233074	1.000000	0.71417	0.997000	0.53966	0.010000	0.07245	3.062000	0.49971	2.039000	0.60335	0.644000	0.83932	CTC	.	.	.	none		0.731	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
UNC79	57578	hgsc.bcm.edu	37	14	94052953	94052953	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr14:94052953G>C	ENST00000393151.2	+	21	2815	c.2815G>C	c.(2815-2817)Gat>Cat	p.D939H	UNC79_ENST00000553484.1_Missense_Mutation_p.D939H|UNC79_ENST00000256339.4_Missense_Mutation_p.D762H|UNC79_ENST00000555664.1_Missense_Mutation_p.D939H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	939					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGTAAAGAATGATACCGAAAG	0.333																																					p.D762H		Atlas-SNP	.											.	UNC79	366	.	0			c.G2284C						PASS	.						51.0	51.0	51.0					14																	94052953		2202	4299	6501	SO:0001583	missense	57578	exon21			AAGAATGATACCG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2815G>C	chr14.hg19:g.94052953G>C	ENSP00000376858:p.Asp939His	24.0	0.0	.		30.0	7.0	.	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	G	19.14	3.769262	0.69992	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18810	2.2;2.2;2.19;2.2	5.94	5.94	0.96194	.	0.110277	0.64402	D	0.000009	T	0.33235	0.0856	L	0.34521	1.04	0.42647	D	0.99343	D	0.57571	0.98	P	0.55965	0.788	T	0.00860	-1.1537	10	0.51188	T	0.08	-21.7402	20.3736	0.98901	0.0:0.0:1.0:0.0	.	939	C9JQL1	.	H	762;939;939;939;939	ENSP00000256339:D762H;ENSP00000450868:D939H;ENSP00000451360:D939H;ENSP00000376858:D939H	ENSP00000256339:D762H	D	+	1	0	KIAA1409	93122706	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.130000	0.77235	2.820000	0.97059	0.650000	0.86243	GAT	.	.	.	none		0.333	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
C15orf39	56905	hgsc.bcm.edu	37	15	75500838	75500838	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr15:75500838A>G	ENST00000360639.2	+	2	2769	c.2449A>G	c.(2449-2451)Aag>Gag	p.K817E	C15orf39_ENST00000394987.4_Missense_Mutation_p.K817E|RP11-69H7.3_ENST00000563568.1_RNA|C15orf39_ENST00000567617.1_Missense_Mutation_p.K817E			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	817						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						GCTGCTGGCCAAGCTGCTGTC	0.667																																					p.K817E		Atlas-SNP	.											.	C15orf39	64	.	0			c.A2449G						PASS	.						22.0	18.0	19.0					15																	75500838		2188	4288	6476	SO:0001583	missense	56905	exon2			CTGGCCAAGCTGC	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.2449A>G	chr15.hg19:g.75500838A>G	ENSP00000353854:p.Lys817Glu	22.0	0.0	.		42.0	7.0	.	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	ENST00000360639.2	hg19	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	A	7.085	0.571051	0.13623	.	.	ENSG00000167173	ENST00000360639;ENST00000394987;ENST00000446981	T;T	0.16324	2.35;2.35	5.07	1.05	0.20165	.	0.591269	0.18433	N	0.141368	T	0.12178	0.0296	L	0.45581	1.43	0.09310	N	0.999999	B;P	0.37370	0.234;0.592	B;B	0.34652	0.14;0.187	T	0.14062	-1.0486	10	0.46703	T	0.11	-8.4875	4.778	0.13189	0.5116:0.3589:0.1295:0.0	.	379;817	Q2VPA3;Q6ZRI6	.;CO039_HUMAN	E	817;817;215	ENSP00000353854:K817E;ENSP00000378438:K817E	ENSP00000353854:K817E	K	+	1	0	C15orf39	73287891	0.993000	0.37304	0.863000	0.33907	0.025000	0.11179	2.862000	0.48388	0.735000	0.32537	0.459000	0.35465	AAG	.	.	.	none		0.667	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
UBE2I	7329	hgsc.bcm.edu	37	16	1370453	1370453	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:1370453A>G	ENST00000355803.4	+	6	899	c.348A>G	c.(346-348)atA>atG	p.I116M	UBE2I_ENST00000325437.5_Missense_Mutation_p.I116M|UBE2I_ENST00000402301.1_Missense_Mutation_p.I116M|UBE2I_ENST00000406620.1_Missense_Mutation_p.I116M|UBE2I_ENST00000397515.2_Missense_Mutation_p.I116M|LA16c-358B7.3_ENST00000567829.1_RNA|UBE2I_ENST00000397514.3_Missense_Mutation_p.I116M|UBE2I_ENST00000403747.2_Missense_Mutation_p.I116M|LA16c-358B7.3_ENST00000568106.1_RNA|UBE2I_ENST00000566587.1_Missense_Mutation_p.I116M	NM_194260.2	NP_919236.1	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I	116					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intracellular steroid hormone receptor signaling pathway (GO:0033145)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein sumoylation (GO:0016925)|regulation of receptor activity (GO:0010469)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|fibrillar center (GO:0001650)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RING-like zinc finger domain binding (GO:0071535)|SUMO ligase activity (GO:0019789)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	5		Hepatocellular(780;0.00369)				TATTAGGAATACAGGAACTTC	0.512																																					p.I116M		Atlas-SNP	.											.	UBE2I	15	.	0			c.A348G						PASS	.						96.0	95.0	95.0					16																	1370453		2199	4300	6499	SO:0001583	missense	7329	exon6			AGGAATACAGGAA	D45050	CCDS10433.1	16p13.3	2011-05-19	2011-05-19		ENSG00000103275	ENSG00000103275	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12485	protein-coding gene	gene with protein product		601661	"""ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)"", ""ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)"""			8565643	Standard	NM_003345		Approved	UBC9	uc002cld.2	P63279	OTTHUMG00000047845	ENST00000355803.4:c.348A>G	chr16.hg19:g.1370453A>G	ENSP00000348056:p.Ile116Met	25.0	0.0	.		36.0	5.0	.	NM_003345	D3DU69|P50550|Q15698|Q59GX1|Q86VB3	Missense_Mutation	SNP	ENST00000355803.4	hg19	CCDS10433.1	.	.	.	.	.	.	.	.	.	.	A	16.92	3.254235	0.59212	.	.	ENSG00000103275	ENST00000325437;ENST00000355803;ENST00000397514;ENST00000397515;ENST00000406620;ENST00000403747;ENST00000402301	T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.13	2.85	0.33270	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.64427	0.2597	H	0.96805	3.885	0.80722	D	1	P;B	0.49961	0.93;0.326	P;B	0.47827	0.558;0.342	T	0.67856	-0.5562	10	0.87932	D	0	.	6.5449	0.22400	0.686:0.1604:0.0:0.1536	.	116;116	B0QYN7;P63279	.;UBC9_HUMAN	M	116	ENSP00000324897:I116M;ENSP00000348056:I116M;ENSP00000380649:I116M;ENSP00000380650:I116M;ENSP00000384568:I116M;ENSP00000385009:I116M;ENSP00000384361:I116M	ENSP00000324897:I116M	I	+	3	3	UBE2I	1310454	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.052000	0.30429	0.406000	0.25560	0.459000	0.35465	ATA	.	.	.	none		0.512	UBE2I-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250317.2	NM_003345	
CREBBP	1387	hgsc.bcm.edu	37	16	3817823	3817823	+	Nonsense_Mutation	SNP	C	C	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:3817823C>A	ENST00000262367.5	-	16	3957	c.3148G>T	c.(3148-3150)Gaa>Taa	p.E1050*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.E1012*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1050					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGTTTCTTTTCATCCACTTCC	0.433			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.E1050X		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.G3148T						PASS	.						250.0	223.0	232.0					16																	3817823		2197	4300	6497	SO:0001587	stop_gained	1387	exon16			TCTTTTCATCCAC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3148G>T	chr16.hg19:g.3817823C>A	ENSP00000262367:p.Glu1050*	102.0	0.0	.		110.0	30.0	.	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	ENST00000262367.5	hg19	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	C	49	15.549454	0.99837	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	.	.	.	5.61	5.61	0.85477	.	0.069937	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-12.7639	20.0086	0.97443	0.0:1.0:0.0:0.0	.	.	.	.	X	1050;1080;1012	.	ENSP00000262367:E1050X	E	-	1	0	CREBBP	3757824	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.451000	0.66632	2.808000	0.96608	0.655000	0.94253	GAA	.	.	.	none		0.433	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
SRCAP	10847	hgsc.bcm.edu	37	16	30744761	30744761	+	Silent	SNP	A	A	G			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:30744761A>G	ENST00000262518.4	+	28	6673	c.6288A>G	c.(6286-6288)gaA>gaG	p.E2096E	SRCAP_ENST00000395059.2_Silent_p.E2034E|SRCAP_ENST00000344771.4_Silent_p.E1938E	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2096	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTAGAGTTGAACAGAGACAGG	0.527																																					p.E2096E		Atlas-SNP	.											.	SRCAP	298	.	0			c.A6288G						PASS	.						82.0	72.0	75.0					16																	30744761		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon28			AGTTGAACAGAGA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6288A>G	chr16.hg19:g.30744761A>G		105.0	0.0	.		100.0	25.0	.	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	hg19	CCDS10689.2																																																																																			.	.	.	none		0.527	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
CDH8	1006	hgsc.bcm.edu	37	16	61823266	61823266	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:61823266G>C	ENST00000577390.1	-	8	2352	c.1398C>G	c.(1396-1398)atC>atG	p.I466M	CDH8_ENST00000577730.1_Missense_Mutation_p.I466M|CDH8_ENST00000299345.6_Missense_Mutation_p.I466M|CDH8_ENST00000584337.1_Missense_Mutation_p.I466M	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	466	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CAGTAGCAATGATTGTTATGT	0.403																																					p.I466M		Atlas-SNP	.											.	CDH8	273	.	0			c.C1398G						PASS	.						234.0	196.0	209.0					16																	61823266		2203	4300	6503	SO:0001583	missense	1006	exon8			AGCAATGATTGTT	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1398C>G	chr16.hg19:g.61823266G>C	ENSP00000462701:p.Ile466Met	154.0	0.0	.		157.0	11.0	.	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	hg19	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012887	0.35511	.	.	ENSG00000150394	ENST00000299345	T	0.68025	-0.3	5.44	5.44	0.79542	Cadherin (4);Cadherin-like (1);	0.056358	0.64402	D	0.000001	T	0.70404	0.3220	M	0.77486	2.375	0.36180	D	0.849374	B;B	0.26845	0.001;0.161	B;B	0.39152	0.01;0.292	T	0.76454	-0.2953	10	0.87932	D	0	.	7.413	0.27027	0.2018:0.0:0.7982:0.0	.	282;466	Q3LID3;P55286	.;CADH8_HUMAN	M	466	ENSP00000299345:I466M	ENSP00000299345:I466M	I	-	3	3	CDH8	60380767	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.084000	0.41625	2.716000	0.92895	0.491000	0.48974	ATC	.	.	.	none		0.403	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
RPH3AL	9501	hgsc.bcm.edu	37	17	131631	131631	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:131631T>A	ENST00000331302.7	-	6	673	c.366A>T	c.(364-366)aaA>aaT	p.K122N	RPH3AL_ENST00000323434.8_Intron|RPH3AL_ENST00000576001.1_5'UTR|RPH3AL_ENST00000536489.2_Intron	NM_001190411.1|NM_006987.3	NP_001177340.1|NP_008918.1	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)	122	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of protein secretion (GO:0050714)|regulation of calcium ion-dependent exocytosis (GO:0017158)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|secretory granule membrane (GO:0030667)	cytoskeletal protein binding (GO:0008092)|metal ion binding (GO:0046872)			NS(2)|breast(1)|kidney(1)|large_intestine(1)|skin(1)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		CGATCCCACATTTGGTGCAGA	0.587																																					p.K122N		Atlas-SNP	.											.	RPH3AL	18	.	0			c.A366T						PASS	.						81.0	81.0	81.0					17																	131631		2203	4300	6503	SO:0001583	missense	9501	exon6			CCCACATTTGGTG		CCDS10994.1, CCDS54059.1	17p13.3	2014-07-02			ENSG00000181031	ENSG00000181031		"""Synaptotagmins"""	10296	protein-coding gene	gene with protein product		604881				10395805	Standard	NM_006987		Approved	Noc2	uc021tmx.1	Q9UNE2	OTTHUMG00000090273	ENST00000331302.7:c.366A>T	chr17.hg19:g.131631T>A	ENSP00000328977:p.Lys122Asn	211.0	0.0	.		231.0	46.0	.	NM_006987	D3DTG7|Q9BSB3	Missense_Mutation	SNP	ENST00000331302.7	hg19	CCDS10994.1	.	.	.	.	.	.	.	.	.	.	T	15.21	2.767130	0.49574	.	.	ENSG00000181031	ENST00000323434	.	.	.	5.02	-8.63	0.00878	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000008	T	0.71426	0.3338	M	0.70903	2.155	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.82818	-0.0269	9	0.87932	D	0	-14.7906	16.2241	0.82283	0.0:0.5791:0.0:0.4208	.	122	Q9UNE2	RPH3L_HUMAN	N	122	.	ENSP00000319210:K122N	K	-	3	2	RPH3AL	131631	0.328000	0.24687	0.618000	0.29105	0.943000	0.58893	-0.811000	0.04500	-2.189000	0.00758	-1.660000	0.00751	AAA	.	.	.	none		0.587	RPH3AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206597.2	NM_006987	
RPL26	6154	hgsc.bcm.edu	37	17	8283223	8283223	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:8283223A>C	ENST00000584164.1	-	3	591	c.200T>G	c.(199-201)aTt>aGt	p.I67S	RPL26_ENST00000583011.1_Missense_Mutation_p.I67S|RPL26_ENST00000578812.1_Missense_Mutation_p.I67S|RPL26_ENST00000585176.1_5'UTR|RPL26_ENST00000293842.5_Missense_Mutation_p.I67S|RP11-849F2.5_ENST00000585181.1_RNA|RPL26_ENST00000582556.1_Missense_Mutation_p.I67S|RP11-849F2.7_ENST00000582471.1_Missense_Mutation_p.I67S|RP11-849F2.5_ENST00000579904.1_RNA			P61254	RL26_HUMAN	ribosomal protein L26	67					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			skin(1)|urinary_tract(1)	2						TACTTTGCCAATTTGCTGACC	0.373																																					p.I67S		Atlas-SNP	.											.	RPL26	7	.	0			c.T200G						PASS	.						51.0	51.0	51.0					17																	8283223		2203	4300	6503	SO:0001583	missense	6154	exon3			TTGCCAATTTGCT		CCDS11142.1	17p13	2011-04-06			ENSG00000161970	ENSG00000161970		"""L ribosomal proteins"""	10327	protein-coding gene	gene with protein product		603704				8479925	Standard	XM_005256749		Approved	L26	uc002glh.1	P61254	OTTHUMG00000108191	ENST00000584164.1:c.200T>G	chr17.hg19:g.8283223A>C	ENSP00000463784:p.Ile67Ser	101.0	0.0	.		117.0	14.0	.	NM_000987	B2R4F0|D3DTR8|Q02877|Q6IPY2	Missense_Mutation	SNP	ENST00000584164.1	hg19	CCDS11142.1	.	.	.	.	.	.	.	.	.	.	A	13.87	2.367500	0.42003	.	.	ENSG00000161970	ENST00000293842	.	.	.	4.7	4.7	0.59300	KOW (2);Translation protein SH3-like (1);Ribosomal protein L24/L26, conserved site (1);Ribosomal protein L24, SH3-like (1);	0.000000	0.85682	D	0.000000	T	0.44582	0.1300	N	0.22421	0.69	0.58432	D	0.999995	B	0.13145	0.007	B	0.25506	0.061	T	0.36016	-0.9765	9	0.37606	T	0.19	-1.2756	12.4268	0.55551	1.0:0.0:0.0:0.0	.	67	P61254	RL26_HUMAN	S	67	.	ENSP00000293842:I67S	I	-	2	0	RPL26	8223948	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.239000	0.95389	1.871000	0.54225	0.523000	0.50628	ATT	.	.	.	none		0.373	RPL26-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442322.1	NM_000987	
GGA3	23163	hgsc.bcm.edu	37	17	73239164	73239164	+	Missense_Mutation	SNP	C	C	G	rs35542883		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:73239164C>G	ENST00000245541.6	-	6	724	c.508G>C	c.(508-510)Gat>Cat	p.D170H	GGA3_ENST00000582717.1_Missense_Mutation_p.D98H|GGA3_ENST00000537686.1_Intron|GGA3_ENST00000538886.1_Missense_Mutation_p.D48H|GGA3_ENST00000578348.1_Missense_Mutation_p.D48H|GGA3_ENST00000351904.7_Missense_Mutation_p.D137H|GGA3_ENST00000579743.1_5'Flank|GGA3_ENST00000582486.1_Missense_Mutation_p.D98H	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	170	Binds to ARF1 (in long isoform).				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			TCCTCATCATCAAAAACAGGG	0.547																																					p.D170H		Atlas-SNP	.											.	GGA3	54	.	0			c.G508C						PASS	.						161.0	149.0	153.0					17																	73239164		2203	4300	6503	SO:0001583	missense	23163	exon6			CATCATCAAAAAC	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.508G>C	chr17.hg19:g.73239164C>G	ENSP00000245541:p.Asp170His	240.0	0.0	.		284.0	77.0	.	NM_138619	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	ENST00000245541.6	hg19	CCDS11717.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879725	0.51801	.	.	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537584;ENST00000538886	T;T	0.52983	2.01;0.64	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.67449	0.2894	M	0.67397	2.05	0.80722	D	1	D;P;D	0.89917	1.0;0.522;1.0	D;P;D	0.72982	0.972;0.729;0.979	T	0.69465	-0.5138	10	0.54805	T	0.06	-21.0362	18.153	0.89682	0.0:1.0:0.0:0.0	.	48;137;170	B7Z7E2;Q9NZ52-2;Q9NZ52	.;.;GGA3_HUMAN	H	170;137;98;48	ENSP00000245541:D170H;ENSP00000326575:D137H	ENSP00000245541:D170H	D	-	1	0	GGA3	70750759	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.646000	0.83445	2.505000	0.84491	0.563000	0.77884	GAT	.	.	.	none		0.547	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619	
MUC16	94025	hgsc.bcm.edu	37	19	9058716	9058716	+	Nonsense_Mutation	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr19:9058716G>C	ENST00000397910.4	-	3	28933	c.28730C>G	c.(28729-28731)tCa>tGa	p.S9577*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9579	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGATGACATTGACTCTATCTC	0.488																																					p.S9577X		Atlas-SNP	.											.	MUC16	4315	.	0			c.C28730G						PASS	.						90.0	84.0	86.0					19																	9058716		2003	4163	6166	SO:0001587	stop_gained	94025	exon3			GACATTGACTCTA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28730C>G	chr19.hg19:g.9058716G>C	ENSP00000381008:p.Ser9577*	154.0	0.0	.		155.0	31.0	.	NM_024690	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	60	44.522612	0.99986	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.5	1.41	0.22369	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.6673	0.23047	0.0:0.0:0.7208:0.2792	.	.	.	.	X	9577	.	ENSP00000381008:S9577X	S	-	2	0	MUC16	8919716	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.009000	0.12765	0.597000	0.29811	0.305000	0.20034	TCA	.	.	.	none		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NF2	4771	hgsc.bcm.edu	37	22	30057329	30057329	+	Splice_Site	SNP	G	G	A			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:30057329G>A	ENST00000338641.4	+	8	1251		c.e8+1		NF2_ENST00000334961.7_Splice_Site|NF2_ENST00000347330.5_Splice_Site|NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000413209.2_Intron|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000403435.1_Splice_Site|NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000403999.3_Splice_Site|NF2_ENST00000361676.4_Splice_Site	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(5)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						TGACAAGGAGGTAGGACATGT	0.532			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												.		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	NF2_ENST00000403999,spinal_cord,glioma,0,4	NF2	1312	.	5	Unknown(5)	meninges(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)	c.810+1G>A						PASS	.						117.0	108.0	111.0					22																	30057329		2203	4300	6503	SO:0001630	splice_region_variant	4771	exon8	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	AAGGAGGTAGGAC	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.810+1G>A	chr22.hg19:g.30057329G>A		68.0	0.0	.		42.0	14.0	.	NM_016418	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	ENST00000338641.4	hg19	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	G	33	5.287845	0.95517	.	.	ENSG00000186575	ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0795	0.97766	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28387329	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.864000	0.99589	2.747000	0.94245	0.650000	0.86243	.	.	.	.	none		0.532	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Intron
TOM1	10043	hgsc.bcm.edu	37	22	35723290	35723290	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:35723290G>T	ENST00000449058.2	+	7	800	c.675G>T	c.(673-675)gaG>gaT	p.E225D	TOM1_ENST00000436462.2_Missense_Mutation_p.E187D|TOM1_ENST00000425375.1_Missense_Mutation_p.E180D|TOM1_ENST00000411850.1_Missense_Mutation_p.E225D|TOM1_ENST00000382034.5_Missense_Mutation_p.E158D|TOM1_ENST00000447733.1_Missense_Mutation_p.E192D	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	225	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						GTGAGCTGGAGATGGTGAGTG	0.602																																					p.E225D		Atlas-SNP	.											.	TOM1	43	.	0			c.G675T						PASS	.						187.0	142.0	157.0					22																	35723290		2203	4300	6503	SO:0001583	missense	10043	exon7			GCTGGAGATGGTG	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.675G>T	chr22.hg19:g.35723290G>T	ENSP00000394466:p.Glu225Asp	100.0	0.0	.		73.0	10.0	.	NM_001135732	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	hg19	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	G	4.588	0.109203	0.08780	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000451197;ENST00000436462;ENST00000382034	T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.39	4.38	0.52667	GAT (2);	0.094349	0.64402	D	0.000001	T	0.12987	0.0315	N	0.01679	-0.765	0.49582	D	0.999809	B;P;B;B;B	0.38827	0.095;0.649;0.002;0.257;0.102	B;B;B;B;B	0.37692	0.023;0.256;0.023;0.103;0.07	T	0.30446	-0.9978	10	0.02654	T	1	-7.1743	6.6853	0.23142	0.3042:0.0:0.6958:0.0	.	180;187;234;225;225	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	D	192;219;225;225;180;234;187;158	ENSP00000398876:E192D;ENSP00000393714:E219D;ENSP00000394466:E225D;ENSP00000413697:E225D;ENSP00000394924:E180D;ENSP00000402556:E187D;ENSP00000371465:E158D	ENSP00000371465:E158D	E	+	3	2	TOM1	34053290	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.774000	0.26675	1.268000	0.44264	0.655000	0.94253	GAG	.	.	.	none		0.602	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
ZXDB	158586	hgsc.bcm.edu	37	X	57619114	57619114	+	Silent	SNP	G	G	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:57619114G>C	ENST00000374888.1	+	1	846	c.633G>C	c.(631-633)ccG>ccC	p.P211P		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						TGATCGCCCCGCAAGCTGGGT	0.736																																					p.P211P		Atlas-SNP	.											.	ZXDB	51	.	0			c.G633C						PASS	.						9.0	11.0	11.0					X																	57619114		2174	4231	6405	SO:0001819	synonymous_variant	158586	exon1			CGCCCCGCAAGCT	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.633G>C	chrX.hg19:g.57619114G>C		20.0	0.0	.		117.0	5.0	.	NM_007157	A8K151|Q9UBB3	Silent	SNP	ENST00000374888.1	hg19	CCDS35313.1																																																																																			.	.	.	none		0.736	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
THOC2	57187	hgsc.bcm.edu	37	X	122757675	122757675	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:122757675T>C	ENST00000245838.8	-	28	3497	c.3466A>G	c.(3466-3468)Aaa>Gaa	p.K1156E	THOC2_ENST00000491737.1_Missense_Mutation_p.K1041E|THOC2_ENST00000355725.4_Missense_Mutation_p.K1156E	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1156					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						CTCTTCTCTTTTTCTTCTTGG	0.348																																					p.K1156E		Atlas-SNP	.											.	THOC2	310	.	0			c.A3466G						PASS	.						150.0	119.0	128.0					X																	122757675		1809	4080	5889	SO:0001583	missense	57187	exon28			TCTCTTTTTCTTC	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.3466A>G	chrX.hg19:g.122757675T>C	ENSP00000245838:p.Lys1156Glu	67.0	0.0	.		42.0	7.0	.	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	hg19	CCDS43988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.88|19.88	3.909495|3.909495	0.72868|0.72868	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737|ENST00000438358	.|.	.|.	.|.	5.9|5.9	5.9|5.9	0.94986|0.94986	THO complex, subunitTHOC2, C-terminal (1);|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000001|0.000001	T|T	0.72661|0.72661	0.3488|0.3488	M|M	0.67625|0.67625	2.065|2.065	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.72293|0.72293	-0.4336|-0.4336	9|6	0.13470|.	T|.	0.59|.	-17.2559|-17.2559	15.2657|15.2657	0.73660|0.73660	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1156|.	Q8NI27|.	THOC2_HUMAN|.	E|R	1156;1156;1041|228	.|.	ENSP00000245838:K1156E|.	K|K	-|-	1|2	0|0	THOC2|THOC2	122585356|122585356	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.040000|8.040000	0.89188|0.89188	1.988000|1.988000	0.58038|0.58038	0.481000|0.481000	0.45027|0.45027	AAA|AAA	.	.	.	none		0.348	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
MAP3K1	4214	hgsc.bcm.edu	37	5	56183244	56183245	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:56183244_56183245insTA	ENST00000399503.3	+	18	4154_4155	c.4154_4155insTA	c.(4153-4158)agaattfs	p.RI1385fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1385	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAGAGACTAAGAATTGCAGATT	0.421																																					p.R1385fs		Atlas-Indel,Pindel	.											.	MAP3K1	355	.	0			c.4154_4155insTA						PASS	.																																			SO:0001589	frameshift_variant	4214	exon18			.	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	Exception_encountered	chr5.hg19:g.56183244_56183245insTA	ENSP00000382423:p.Arg1385fs	130.0	0.0	0		116.0	15.0	0.12931	NM_005921		Frame_Shift_Ins	INS	ENST00000399503.3	hg19	CCDS43318.1																																																																																			.	.	.	none		0.421	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
EIF4EBP3	8637	hgsc.bcm.edu	37	5	139928645	139928646	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:139928645_139928646delAG	ENST00000310331.2	+	2	330_331	c.258_259delAG	c.(256-261)acagagfs	p.E89fs	ANKHD1_ENST00000297183.6_Frame_Shift_Del_p.R2612fs|SRA1_ENST00000520427.1_5'Flank|ANKHD1-EIF4EBP3_ENST00000532219.1_Frame_Shift_Del_p.R2612fs	NM_003732.2	NP_003723.1	O60516	4EBP3_HUMAN	eukaryotic translation initiation factor 4E binding protein 3	89					negative regulation of translational initiation (GO:0045947)	eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	translation repressor activity (GO:0030371)			endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCAGGAGACAGAGGAAGAGAT	0.564																																					p.2611_2612del		Atlas-Indel,Pindel	.											.	ANKHD1-EIF4EBP3	179	.	0			c.7833_7834del						PASS	.																																			SO:0001589	frameshift_variant	404734	exon35			.	AF038869	CCDS4226.1	5q31.3	2007-07-18			ENSG00000243056	ENSG00000243056			3290	protein-coding gene	gene with protein product		603483				9593750	Standard	NM_003732		Approved	4E-BP3	uc003lfy.1	O60516	OTTHUMG00000129498	ENST00000310331.2:c.258_259delAG	chr5.hg19:g.139928647_139928648delAG	ENSP00000308472:p.Glu89fs	124.0	0.0	0		87.0	12.0	0.137931	NM_020690		Frame_Shift_Del	DEL	ENST00000310331.2	hg19	CCDS4226.1																																																																																			.	.	.	none		0.564	EIF4EBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251668.2	NM_003732	
NFKBIZ	64332	hgsc.bcm.edu	37	3	101572345	101572345	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:101572345delC	ENST00000326172.5	+	5	1090	c.975delC	c.(973-975)aacfs	p.N325fs	NFKBIZ_ENST00000394054.2_Frame_Shift_Del_p.N225fs|NFKBIZ_ENST00000326151.5_Intron	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	325	Required for transcriptional activity. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						ATGAACCAAACCTCTTTGATG	0.468																																					p.N325fs		Atlas-Indel,Pindel	.											.	NFKBIZ	55	.	0			c.974delA						PASS	.						128.0	124.0	125.0					3																	101572345		2203	4300	6503	SO:0001589	frameshift_variant	64332	exon5			.	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.975delC	chr3.hg19:g.101572345delC	ENSP00000325663:p.Asn325fs	93.0	0.0	0		91.0	17.0	0.186813	NM_031419	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Frame_Shift_Del	DEL	ENST00000326172.5	hg19	CCDS2946.1																																																																																			.	.	.	none		0.468	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353793.1	NM_031419	
ZNF7	7553	hgsc.bcm.edu	37	8	146066868	146066869	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr8:146066868_146066869delTC	ENST00000528372.1	+	5	616_617	c.376_377delTC	c.(376-378)tctfs	p.S126fs	ZNF7_ENST00000532393.1_3'UTR|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000325241.6_Frame_Shift_Del_p.S126fs|ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000544249.1_Frame_Shift_Del_p.S30fs|ZNF7_ENST00000446747.2_Frame_Shift_Del_p.S137fs|ZNF7_ENST00000529819.1_Intron			P17097	ZNF7_HUMAN	zinc finger protein 7	126					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		TGGAGACGTTTCTGATTCTGAG	0.485																																					p.125_126del		Atlas-INDEL	.											.	ZNF7	62	.	0			c.375_376del						PASS	.																																			SO:0001589	frameshift_variant	7553	exon5			.	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.376_377delTC	chr8.hg19:g.146066868_146066869delTC	ENSP00000432724:p.Ser126fs	88.0	0.0	0		86.0	10.0	0.116279	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Frame_Shift_Del	DEL	ENST00000528372.1	hg19	CCDS6435.1																																																																																			.	.	.	none		0.485	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
LCAT	3931	hgsc.bcm.edu	37	16	67974090	67974091	+	Frame_Shift_Ins	INS	-	-	GGGGG	rs202017590|rs368229427		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:67974090_67974091insGGGGG	ENST00000264005.5	-	6	1068_1069	c.1039_1040insCCCCC	c.(1039-1041)cgcfs	p.R347fs		NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	347			R -> C (in FED; results in reduced activity). {ECO:0000269|PubMed:21901787}.		cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		GATGTAGGTGCGGGGCGTGGGC	0.619																																					p.R347fs		Atlas-INDEL	.											.	LCAT	31	.	0			c.1040_1041insCCCCC						PASS	.																																			SO:0001589	frameshift_variant	3931	exon6			.		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.1039_1040insCCCCC	chr16.hg19:g.67974090_67974091insGGGGG	ENSP00000264005:p.Arg347fs	124.0	0.0	0		154.0	13.0	0.0844156	NM_000229	Q53XQ3	Frame_Shift_Ins	INS	ENST00000264005.5	hg19	CCDS10854.1																																																																																			.	.	.	none		0.619	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
ASPRV1	151516	hgsc.bcm.edu	37	2	70188625	70188626	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:70188625_70188626delAG	ENST00000320256.4	-	1	771_772	c.195_196delCT	c.(193-198)ctctgtfs	p.C66fs	PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						AGAAACCCACAGAGCAGTGTCG	0.653																																					p.66_66del		Atlas-Indel,Pindel	.											.	ASPRV1	41	.	0			c.196_197del						PASS	.																																			SO:0001589	frameshift_variant	151516	exon1			.	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.195_196delCT	chr2.hg19:g.70188627_70188628delAG	ENSP00000315383:p.Cys66fs	170.0	0.0	0		162.0	14.0	0.0864198	NM_152792		Frame_Shift_Del	DEL	ENST00000320256.4	hg19	CCDS1897.1																																																																																			.	.	.	none		0.653	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792	
RASA1	5921	hgsc.bcm.edu	37	5	86564698	86564699	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:86564698_86564699delCC	ENST00000274376.6	+	1	994_995	c.430_431delCC	c.(430-432)cccfs	p.P145fs	RASA1_ENST00000506290.1_5'Flank|RASA1_ENST00000456692.2_5'Flank|RASA1_ENST00000512763.1_5'Flank	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	145					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CCCTTACCTGCCCCCTTTGGGG	0.624																																					p.143_144del		Atlas-INDEL	.											.	RASA1	213	.	0			c.429_430del						PASS	.																																			SO:0001589	frameshift_variant	5921	exon1			.		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.430_431delCC	chr5.hg19:g.86564700_86564701delCC	ENSP00000274376:p.Pro145fs	38.0	0.0	0		35.0	12.0	0.342857	NM_002890	B2R6W3|Q9UDI1	Frame_Shift_Del	DEL	ENST00000274376.6	hg19	CCDS34200.1																																																																																			.	.	.	none		0.624	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
BCOR	54880	hgsc.bcm.edu	37	X	39913206	39913207	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:39913206_39913207delAC	ENST00000378444.4	-	14	5136_5137	c.4908_4909delGT	c.(4906-4911)gtgtttfs	p.F1637fs	BCOR_ENST00000378455.4_Frame_Shift_Del_p.F1585fs|BCOR_ENST00000342274.4_Frame_Shift_Del_p.F1603fs|BCOR_ENST00000397354.3_Frame_Shift_Del_p.F1603fs|BCOR_ENST00000378463.1_Frame_Shift_Del_p.F480fs	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1637	Necessary and sufficient for interaction with PCGF1.				heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TCAAATTCAAACACATCGCTAT	0.465			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.1637_1637del		Atlas-Indel,Pindel	.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	351	.	0			c.4909_4910del						PASS	.																																			SO:0001589	frameshift_variant	54880	exon14			.	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4908_4909delGT	chrX.hg19:g.39913208_39913209delAC	ENSP00000367705:p.Phe1637fs	260.0	0.0	0		234.0	19.0	0.0811966	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Frame_Shift_Del	DEL	ENST00000378444.4	hg19	CCDS48093.1																																																																																			.	.	.	none		0.465	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
SPIRE2	84501	hgsc.bcm.edu	37	16	89924825	89924826	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr16:89924825_89924826delAG	ENST00000378247.3	+	8	1225_1226	c.1182_1183delAG	c.(1180-1185)acagatfs	p.D395fs	SPIRE2_ENST00000393062.2_Frame_Shift_Del_p.D395fs	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	395					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TGTCAGTCACAGATGCTGGGGG	0.629																																					p.394_394del		Atlas-INDEL	.											.	SPIRE2	63	.	0			c.1181_1182del						PASS	.																																			SO:0001589	frameshift_variant	84501	exon8			.	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.1182_1183delAG	chr16.hg19:g.89924825_89924826delAG	ENSP00000367494:p.Asp395fs	89.0	0.0	0		101.0	12.0	0.118812	NM_032451	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Frame_Shift_Del	DEL	ENST00000378247.3	hg19	CCDS32516.1																																																																																			.	.	.	none		0.629	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
CEP128	145508	hgsc.bcm.edu	37	14	81251281	81251284	+	Frame_Shift_Del	DEL	CTTA	CTTA	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CTTA	CTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr14:81251281_81251284delCTTA	ENST00000555265.1	-	15	2541_2544	c.2166_2169delTAAG	c.(2164-2169)tttaagfs	p.FK722fs	CEP128_ENST00000281129.3_Frame_Shift_Del_p.FK722fs			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	722						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TCTTTTCTTTCTTAAAGTGCTTCA	0.412																																					p.723_724del		Atlas-Indel,Pindel	.											.	CEP128	146	.	0			c.2167_2170del						PASS	.																																			SO:0001589	frameshift_variant	145508	exon14			.	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2166_2169delTAAG	chr14.hg19:g.81251281_81251284delCTTA	ENSP00000451162:p.Phe722fs	92.0	0.0	0		75.0	25.0	0.333333	NM_152446	B9EK52|Q86X97|Q96ML4	Frame_Shift_Del	DEL	ENST00000555265.1	hg19	CCDS32130.1																																																																																			.	.	.	none		0.412	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
ZRSR2	8233	hgsc.bcm.edu	37	X	15841231	15841236	+	In_Frame_Del	DEL	AGCCGG	AGCCGG	-	rs199648317		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AGCCGG	AGCCGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chrX:15841231_15841236delAGCCGG	ENST00000307771.7	+	11	1339_1344	c.1315_1320delAGCCGG	c.(1315-1320)agccggdel	p.SR447del		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	447	Arg/Ser-rich (RS domain).				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					GGGCCGGGGCagccggagccggagcc	0.636			"""F, S, Mis"""		"""MDS, CLL"""																																p.438_440del	NSCLC(197;1631 3042 5741 31152)	Atlas-Indel,Pindel	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2	78	.	0			c.1314_1319del						PASS	.			17,138,2720		4,1,5,3,32,53,20,1147,368						3.0	0.1			9	24,75,5168		3,0,9,9,11,35,18,1934,1256	no	codingComplex	ZRSR2	NM_005089.3		7,1,14,12,43,88,38,3081,1624	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		1.8796,5.3913,3.1196				41,213,7888				SO:0001651	inframe_deletion	8233	exon11			.	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.1315_1320delAGCCGG	chrX.hg19:g.15841237_15841242delAGCCGG	ENSP00000303015:p.Ser447_Arg448del	23.0	0.0	0		62.0	19.0	0.306452	NM_005089	Q14D69	In_Frame_Del	DEL	ENST00000307771.7	hg19	CCDS14172.1																																																																																			.	.	.	none		0.636	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	
EPHA2	1969	hgsc.bcm.edu	37	1	16459720	16459721	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:16459720_16459721insTG	ENST00000358432.5	-	11	2161_2162	c.2007_2008insCA	c.(2005-2010)cagttcfs	p.F670fs		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	670	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	TGGTGGCTGAACTGGCCCATGA	0.629																																					p.F670fs		Atlas-Indel,Pindel	.											.	EPHA2	102	.	0			c.2008_2009insCA						PASS	.																																			SO:0001589	frameshift_variant	1969	exon11			.	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2007_2008insCA	chr1.hg19:g.16459720_16459721insTG	ENSP00000351209:p.Phe670fs	84.0	0.0	0		56.0	13.0	0.232143	NM_004431	B5A968|Q8N3Z2	Frame_Shift_Ins	INS	ENST00000358432.5	hg19	CCDS169.1																																																																																			.	.	.	none		0.629	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
AHNAK	79026	hgsc.bcm.edu	37	11	62285795	62285796	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:62285795_62285796delAG	ENST00000378024.4	-	5	16367_16368	c.16093_16094delCT	c.(16093-16095)ctgfs	p.L5365fs	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5365					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGTCCCCTCAGTGTCACATCT	0.545																																					p.5365_5365del		Atlas-INDEL	.											.	AHNAK	532	.	0			c.16094_16095del						PASS	.																																			SO:0001589	frameshift_variant	79026	exon5			.	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.16093_16094delCT	chr11.hg19:g.62285795_62285796delAG	ENSP00000367263:p.Leu5365fs	177.0	0.0	0		151.0	16.0	0.10596	NM_001620	A1A586	Frame_Shift_Del	DEL	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.	.	none		0.545	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
PHTF1	10745	hgsc.bcm.edu	37	1	114255942	114255943	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:114255942_114255943delTT	ENST00000369604.1	-	8	1224_1225	c.741_742delAA	c.(739-744)acaagafs	p.R248fs	PHTF1_ENST00000393357.2_Frame_Shift_Del_p.R248fs|PHTF1_ENST00000369596.2_Frame_Shift_Del_p.R195fs|PHTF1_ENST00000357783.2_Frame_Shift_Del_p.R248fs|PHTF1_ENST00000369600.1_Frame_Shift_Del_p.R195fs|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369598.1_Frame_Shift_Del_p.R203fs|PHTF1_ENST00000447664.2_Intron			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	248					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTTTCTCTCTTGTTTGCCACA	0.371																																					p.248_248del		Atlas-Indel,Pindel	.											.	PHTF1	69	.	0			c.742_743del						PASS	.																																			SO:0001589	frameshift_variant	10745	exon7			.	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.741_742delAA	chr1.hg19:g.114255942_114255943delTT	ENSP00000358617:p.Arg248fs	93.0	0.0	0		81.0	20.0	0.246914	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Frame_Shift_Del	DEL	ENST00000369604.1	hg19	CCDS861.1																																																																																			.	.	.	none		0.371	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
GOLGA4	2803	hgsc.bcm.edu	37	3	37365077	37365078	+	Splice_Site	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr3:37365077_37365078delAG	ENST00000361924.2	+	14	2075		c.e14-1		GOLGA4_ENST00000356847.4_Splice_Site|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4						Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTTAATTAACAGAGAATTCTTG	0.307																																					.		Atlas-Indel,Pindel	.											.	GOLGA4	173	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	2803	.			.	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1702-1AG>-	chr3.hg19:g.37365079_37365080delAG		141.0	0.0	0		128.0	33.0	0.257812	.	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Splice_Site	DEL	ENST00000361924.2	hg19	CCDS2666.1																																																																																			.	.	.	none		0.307	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Intron
TEX33	339669	hgsc.bcm.edu	37	22	37396006	37396008	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	TCA	TCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr22:37396006_37396008delTCA	ENST00000405091.2	-	5	758_760	c.507_509delTGA	c.(505-510)gatgaa>gaa	p.D169del	TEX33_ENST00000402860.3_In_Frame_Del_p.D84del|TEX33_ENST00000381821.1_In_Frame_Del_p.D169del			O43247	TEX33_HUMAN	testis expressed 33	169																	CTCGAAGACTTCATCAATAGCCT	0.542																																					p.170_170del		Atlas-Indel,Pindel	.											.	TEX33	25	.	0			c.508_510del						PASS	.																																			SO:0001651	inframe_deletion	339669	exon4			.	BC042635	CCDS13937.1, CCDS54524.1	22q12.3	2013-10-11	2012-02-16	2012-02-16	ENSG00000185264	ENSG00000185264			28568	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 33"""	C22orf33		22332119	Standard	NM_178552		Approved	MGC35206, EAN57	uc003aqf.3	O43247	OTTHUMG00000150531	ENST00000405091.2:c.507_509delTGA	chr22.hg19:g.37396009_37396011delTCA	ENSP00000386118:p.Asp169del	92.0	0.0	0		88.0	25.0	0.284091	NM_001163857	B1AH46|Q6ICF2|Q8IVQ2|Q9Y4V8	In_Frame_Del	DEL	ENST00000405091.2	hg19	CCDS54524.1																																																																																			.	.	.	none		0.542	TEX33-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318778.2	NM_178552	
MTA2	9219	hgsc.bcm.edu	37	11	62364175	62364176	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:62364175_62364176delCT	ENST00000278823.2	-	9	1204_1205	c.815_816delAG	c.(814-816)gagfs	p.E272fs	MTA2_ENST00000524902.1_Frame_Shift_Del_p.E99fs|MTA2_ENST00000527204.1_Frame_Shift_Del_p.E99fs	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	272	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						ATAGCATGGCCTCTGAGGCTGA	0.55																																					p.272_273del		Atlas-Indel,Pindel	.											.	MTA2	54	.	0			c.816_817del						PASS	.																																			SO:0001589	frameshift_variant	9219	exon9			.	AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.815_816delAG	chr11.hg19:g.62364177_62364178delCT	ENSP00000278823:p.Glu272fs	128.0	0.0	0		134.0	24.0	0.179104	NM_004739	Q68DB1|Q9UQB5	Frame_Shift_Del	DEL	ENST00000278823.2	hg19	CCDS8022.1																																																																																			.	.	.	none		0.550	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739	
GLCE	26035	hgsc.bcm.edu	37	15	69553563	69553564	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr15:69553563_69553564delAG	ENST00000261858.2	+	4	952_953	c.724_725delAG	c.(724-726)agafs	p.R242fs	GLCE_ENST00000559500.1_3'UTR|GLCE_ENST00000559420.2_Frame_Shift_Del_p.R178fs	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	242					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)	p.R242K(1)		NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AGCAGAAGACAGAGACAAAAAC	0.401																																					p.241_242del		Atlas-Indel,Pindel	.											.	GLCE	48	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.723_724del						PASS	.																																			SO:0001589	frameshift_variant	26035	exon4			.	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.724_725delAG	chr15.hg19:g.69553565_69553566delAG	ENSP00000261858:p.Arg242fs	157.0	0.0	0		105.0	22.0	0.209524	NM_015554	Q6GUQ2	Frame_Shift_Del	DEL	ENST00000261858.2	hg19	CCDS32277.1																																																																																			.	.	.	none		0.401	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
PCDHB5	26167	hgsc.bcm.edu	37	5	140515133	140515134	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr5:140515133_140515134delAG	ENST00000231134.5	+	1	334_335	c.117_118delAG	c.(115-120)acagaafs	p.E40fs		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	40	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGAAGAAACAGAAAGTGGCTA	0.49																																					p.39_39del		Atlas-INDEL	.											.	PCDHB5	184	.	0			c.116_117del						PASS	.																																			SO:0001589	frameshift_variant	26167	exon1			.	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.117_118delAG	chr5.hg19:g.140515133_140515134delAG	ENSP00000231134:p.Glu40fs	141.0	0.0	0		102.0	11.0	0.107843	NM_015669	Q549F4|Q9UFU9	Frame_Shift_Del	DEL	ENST00000231134.5	hg19	CCDS4247.1																																																																																			.	.	.	none		0.490	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
C17orf80	55028	hgsc.bcm.edu	37	17	71232036	71232037	+	Frame_Shift_Del	DEL	CA	CA	-	rs373362252|rs555089459		TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr17:71232036_71232037delCA	ENST00000535032.2	+	2	528_529	c.415_416delCA	c.(415-417)cagfs	p.Q139fs	FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000359042.2_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000426147.2_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000577615.1_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000268942.8_Frame_Shift_Del_p.Q139fs|C17orf80_ENST00000255557.4_Frame_Shift_Del_p.Q139fs			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	139						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			AACCAAGGCTCAGTTTTACGCA	0.381																																					p.138_139del		Atlas-INDEL	.											.	C17orf80	37	.	0			c.414_415del						PASS	.																																			SO:0001589	frameshift_variant	55028	exon3			.	AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.415_416delCA	chr17.hg19:g.71232036_71232037delCA	ENSP00000440551:p.Gln139fs	137.0	0.0	0		194.0	12.0	0.0618557	NM_001100621	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Frame_Shift_Del	DEL	ENST00000535032.2	hg19	CCDS11694.1																																																																																			.	.	.	none		0.381	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441893.1	NM_017941	
OR8D1	283159	hgsc.bcm.edu	37	11	124180084	124180085	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr11:124180084_124180085delGT	ENST00000357821.2	-	1	648_649	c.578_579delAC	c.(577-579)cacfs	p.H193fs		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H193Q(1)		kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GCTCATTGAGGTGTGTGTTGGA	0.46																																					p.193_194del		Atlas-Indel,Pindel	.											.	OR8D1	53	.	1	Substitution - Missense(1)	ovary(1)	c.579_580del						PASS	.																																			SO:0001589	frameshift_variant	283159	exon1			.	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.578_579delAC	chr11.hg19:g.124180090_124180091delGT	ENSP00000350474:p.His193fs	198.0	0.0	0		214.0	45.0	0.21028	NM_001002917	B2RNL4|Q6IEW1|Q8NGH0	Frame_Shift_Del	DEL	ENST00000357821.2	hg19	CCDS31706.1																																																																																			.	.	.	none		0.460	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387285.1	NM_001002917	
TTL	150465	hgsc.bcm.edu	37	2	113260608	113260609	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr2:113260608_113260609delAT	ENST00000233336.6	+	5	916_917	c.725_726delAT	c.(724-726)aatfs	p.N242fs		NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	242	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)			breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		CATTTGACCAATCACTGCATTC	0.376			T	ETV6	ALL																																p.242_242del		Atlas-Indel,Pindel	.		Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	.	TTL	27	.	0			c.724_725del						PASS	.																																			SO:0001589	frameshift_variant	150465	exon5			.		CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.725_726delAT	chr2.hg19:g.113260608_113260609delAT	ENSP00000233336:p.Asn242fs	130.0	0.0	0		123.0	33.0	0.268293	NM_153712	Q585T3|Q7Z302|Q8N426	Frame_Shift_Del	DEL	ENST00000233336.6	hg19	CCDS2096.1																																																																																			.	.	.	none		0.376	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254085.2	NM_153712	
NASP	4678	hgsc.bcm.edu	37	1	46073053	46073073	+	In_Frame_Del	DEL	CCAAAAAAACAGAAGACAAGT	CCAAAAAAACAGAAGACAAGT	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	CCAAAAAAACAGAAGACAAGT	CCAAAAAAACAGAAGACAAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr1:46073053_46073073delCCAAAAAAACAGAAGACAAGT	ENST00000350030.3	+	6	557_577	c.470_490delCCAAAAAAACAGAAGACAAGT	c.(469-492)gccaaaaaaacagaagacaagtct>gct	p.KKTEDKS158del	NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_In_Frame_Del_p.KKTEDKS160del|NASP_ENST00000372052.4_Intron|NASP_ENST00000537798.1_In_Frame_Del_p.KKTEDKS94del	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	158	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					AAAGAAGAAGCCAAAAAAACAGAAGACAAGTCTTTGGCAAA	0.412																																					p.157_163del		Atlas-INDEL	.											.	NASP	77	.	0			c.469_489del						PASS	.																																			SO:0001651	inframe_deletion	4678	exon6			.	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.470_490delCCAAAAAAACAGAAGACAAGT	chr1.hg19:g.46073053_46073073delCCAAAAAAACAGAAGACAAGT	ENSP00000255120:p.Lys158_Ser164del	222.0	0.0	0		174.0	13.0	0.0747126	NM_002482	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	In_Frame_Del	DEL	ENST00000350030.3	hg19	CCDS524.1																																																																																			.	.	.	none		0.412	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
LRRK2	120892	hgsc.bcm.edu	37	12	40742258	40742261	+	Frame_Shift_Del	DEL	TTAA	TTAA	-			TCGA-P4-A5EA-01A-11D-A28G-10	TCGA-P4-A5EA-11A-11D-A28G-10	TTAA	TTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0451b7be-d503-4cad-88a1-322496cffb25	5d70fe2b-81f9-4b9e-8410-3ccf2035292a	g.chr12:40742258_40742261delTTAA	ENST00000298910.7	+	43	6386_6389	c.6328_6331delTTAA	c.(6328-6333)ttaattfs	p.LI2110fs		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGTTGAGAAATTAATTAAACAGTG	0.314																																					p.2109_2110del		Pindel	.											.	LRRK2	763	.	0			c.6327_6330del						PASS	.																																			SO:0001589	frameshift_variant	120892	exon43			.	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6328_6331delTTAA	chr12.hg19:g.40742262_40742265delTTAA	ENSP00000298910:p.Leu2110fs	200.0	0.0	.		143.0	10.0	0.070	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Frame_Shift_Del	DEL	ENST00000298910.7	hg19	CCDS31774.1																																																																																			.	.	.	none		0.314	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
