#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DCLRE1B	64858	hgsc.bcm.edu	37	1	114454514	114454514	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr1:114454514C>T	ENST00000369563.3	+	4	1746	c.1300C>T	c.(1300-1302)Cac>Tac	p.H434Y	DCLRE1B_ENST00000466480.1_Intron	NM_022836.3	NP_073747.1	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B	434					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|protection from non-homologous end joining at telomere (GO:0031848)|telomere maintenance (GO:0000723)|telomeric 3' overhang formation (GO:0031860)|telomeric loop formation (GO:0031627)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(6)|stomach(1)	18	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTTTCAGTGCACTTAAGGTC	0.473								Other identified genes with known or suspected DNA repair function																													p.H434Y		Atlas-SNP	.											.	DCLRE1B	36	.	0			c.C1300T						PASS	.						168.0	186.0	180.0					1																	114454514		2203	4300	6503	SO:0001583	missense	64858	exon4			TCAGTGCACTTAA	BC029687	CCDS866.1	1p11.1	2010-06-24	2010-06-24		ENSG00000118655	ENSG00000118655			17641	protein-coding gene	gene with protein product	"""APOLLO"", ""PSO2 homolog (S. cerevisiae)"""	609683	"""DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)"""				Standard	NM_022836		Approved	SNM1B, FLJ12810, FLJ13998	uc001eeg.3	Q9H816	OTTHUMG00000011937	ENST00000369563.3:c.1300C>T	chr1.hg19:g.114454514C>T	ENSP00000358576:p.His434Tyr	135.0	0.0	.		134.0	18.0	.	NM_022836	Q9H9E5	Missense_Mutation	SNP	ENST00000369563.3	hg19	CCDS866.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.075166	0.55646	.	.	ENSG00000118655	ENST00000369563	T	0.75260	-0.92	5.75	2.18	0.27775	.	1.219440	0.05575	N	0.571775	T	0.42086	0.1187	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.42241	-0.9463	10	0.66056	D	0.02	-11.1736	5.1932	0.15220	0.2671:0.6065:0.0:0.1264	.	434	Q9H816	DCR1B_HUMAN	Y	434	ENSP00000358576:H434Y	ENSP00000358576:H434Y	H	+	1	0	DCLRE1B	114256037	0.002000	0.14202	0.004000	0.12327	0.624000	0.37722	0.606000	0.24194	1.186000	0.42985	0.655000	0.94253	CAC	.	.	.	none		0.473	DCLRE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033020.2	NM_022836	
MTA3	57504	hgsc.bcm.edu	37	2	42886918	42886918	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr2:42886918C>A	ENST00000405094.1	+	8	618	c.618C>A	c.(616-618)ttC>ttA	p.F206L	MTA3_ENST00000405592.1_Missense_Mutation_p.F150L|MTA3_ENST00000406652.1_Missense_Mutation_p.F150L|MTA3_ENST00000407270.3_Missense_Mutation_p.F206L|MTA3_ENST00000406911.1_Missense_Mutation_p.F206L			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	206	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.					intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						TTGGGACATTCGCCAGAGCCC	0.413																																					p.F206L		Atlas-SNP	.											.	MTA3	39	.	0			c.C618A						PASS	.						78.0	70.0	72.0					2																	42886918		1938	4145	6083	SO:0001583	missense	57504	exon8			GACATTCGCCAGA	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.618C>A	chr2.hg19:g.42886918C>A	ENSP00000385823:p.Phe206Leu	80.0	0.0	.		84.0	5.0	.	NM_020744	Q9NSP2|Q9ULF4	Missense_Mutation	SNP	ENST00000405094.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.73	3.205367	0.58234	.	.	ENSG00000057935	ENST00000405592;ENST00000406652;ENST00000407270;ENST00000282366;ENST00000406911;ENST00000405094	T;T;T;T;T	0.54866	0.55;0.55;0.61;0.59;0.57	4.96	-7.42	0.01388	.	0.000000	0.85682	D	0.000000	T	0.72645	0.3486	M	0.88105	2.93	0.50171	D	0.999857	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.988;0.994;0.999	T	0.80522	-0.1345	10	0.54805	T	0.06	-18.0256	20.3549	0.98835	0.0:0.0897:0.0:0.9103	.	206;206;150	E7EQY4;Q9BTC8-2;D6W5A2	.;.;.	L	150;150;206;206;206;206	ENSP00000383973:F150L;ENSP00000384249:F150L;ENSP00000385045:F206L;ENSP00000385241:F206L;ENSP00000385823:F206L	ENSP00000282366:F206L	F	+	3	2	MTA3	42740422	0.997000	0.39634	0.147000	0.22382	0.489000	0.33432	0.317000	0.19487	-1.514000	0.01786	-0.252000	0.11476	TTC	.	.	.	none		0.413	MTA3-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318159.1	NM_020744	
WDSUB1	151525	hgsc.bcm.edu	37	2	160139417	160139417	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr2:160139417T>C	ENST00000409990.3	-	2	420	c.164A>G	c.(163-165)tAt>tGt	p.Y55C	WDSUB1_ENST00000358147.4_Missense_Mutation_p.Y55C|WDSUB1_ENST00000392796.3_Missense_Mutation_p.Y55C|WDSUB1_ENST00000409124.1_Missense_Mutation_p.Y55C|WDSUB1_ENST00000359774.4_Missense_Mutation_p.Y55C	NM_001128213.1	NP_001121685	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain containing 1	55							ubiquitin-protein transferase activity (GO:0004842)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|stomach(3)	16						GTGGACAGCATAGGTATGAAA	0.443																																					p.Y55C		Atlas-SNP	.											.	WDSUB1	39	.	0			c.A164G						PASS	.						138.0	135.0	136.0					2																	160139417		2203	4300	6503	SO:0001583	missense	151525	exon2			ACAGCATAGGTAT	AK093494	CCDS2208.1	2q24.2	2013-01-28	2006-02-17	2005-03-25	ENSG00000196151	ENSG00000196151		"""WD repeat domain containing"", ""Sterile alpha motif (SAM) domain containing"", ""U-box domain containing"""	26697	protein-coding gene	gene with protein product			"""WD repeat and SAM domain containing 1"", ""WD repeat, SAM and U-box domain containing 1"""	WDSAM1		12477932	Standard	NM_152528		Approved	UBOX6, FLJ36175	uc002ual.4	Q8N9V3	OTTHUMG00000132028	ENST00000409990.3:c.164A>G	chr2.hg19:g.160139417T>C	ENSP00000387078:p.Tyr55Cys	243.0	0.0	.		261.0	27.0	.	NM_152528	Q53TI9|Q8N6N8	Missense_Mutation	SNP	ENST00000409990.3	hg19	CCDS2208.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360032	0.82353	.	.	ENSG00000196151	ENST00000359774;ENST00000358147;ENST00000392796;ENST00000409990;ENST00000409124	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74359	0.3706	M	0.69185	2.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.76353	-0.2990	10	0.56958	D	0.05	.	15.6902	0.77446	0.0:0.0:0.0:1.0	.	55;55;55	Q8N9V3-2;B8ZZF2;Q8N9V3	.;.;WSDU1_HUMAN	C	55	ENSP00000352820:Y55C;ENSP00000350866:Y55C;ENSP00000376545:Y55C;ENSP00000387078:Y55C;ENSP00000386891:Y55C	ENSP00000350866:Y55C	Y	-	2	0	WDSUB1	159847663	1.000000	0.71417	0.989000	0.46669	0.987000	0.75469	7.910000	0.87451	2.115000	0.64714	0.528000	0.53228	TAT	.	.	.	none		0.443	WDSUB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333339.1	NM_152528	
WDFY3	23001	hgsc.bcm.edu	37	4	85675021	85675021	+	Silent	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr4:85675021T>C	ENST00000295888.4	-	35	5975	c.5568A>G	c.(5566-5568)caA>caG	p.Q1856Q	WDFY3_ENST00000322366.6_Silent_p.Q1856Q	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1856					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTTCTTCTGATTGCCAAGGCT	0.403																																					p.Q1856Q		Atlas-SNP	.											.	WDFY3	314	.	0			c.A5568G						PASS	.						89.0	80.0	83.0					4																	85675021		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon35			TTCTGATTGCCAA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5568A>G	chr4.hg19:g.85675021T>C		127.0	0.0	.		145.0	39.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	hg19	CCDS3609.1																																																																																			.	.	.	none		0.403	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
SNX2	6643	hgsc.bcm.edu	37	5	122154607	122154607	+	Silent	SNP	T	T	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr5:122154607T>G	ENST00000379516.2	+	11	1209	c.1101T>G	c.(1099-1101)ctT>ctG	p.L367L	SNX2_ENST00000514949.1_Silent_p.L250L|SNX2_ENST00000510372.1_3'UTR	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	367					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		TGTCTCAGCTTGCAGAGGTTG	0.393																																					p.L367L		Atlas-SNP	.											.	SNX2	42	.	0			c.T1101G						PASS	.						124.0	117.0	119.0					5																	122154607		2203	4300	6503	SO:0001819	synonymous_variant	6643	exon11			TCAGCTTGCAGAG	AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.1101T>G	chr5.hg19:g.122154607T>G		100.0	0.0	.		123.0	7.0	.	NM_003100	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Silent	SNP	ENST00000379516.2	hg19	CCDS34217.1																																																																																			.	.	.	none		0.393	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371392.1	NM_003100	
SERPINB6	5269	hgsc.bcm.edu	37	6	2955761	2955761	+	Silent	SNP	G	G	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr6:2955761G>C	ENST00000380520.1	-	2	2303	c.309C>G	c.(307-309)ctC>ctG	p.L103L	SERPINB6_ENST00000335686.5_Silent_p.L103L|SERPINB6_ENST00000380539.1_Silent_p.L103L|SERPINB6_ENST00000380524.1_Silent_p.L103L|SERPINB6_ENST00000380529.1_Silent_p.L103L|SERPINB6_ENST00000380546.3_Silent_p.L103L			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	103					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	GACTTACTGAGAGGAAATCAC	0.493																																					p.L122L		Atlas-SNP	.											.	SERPINB6	31	.	0			c.C366G						PASS	.						78.0	78.0	78.0					6																	2955761		2203	4300	6503	SO:0001819	synonymous_variant	5269	exon3			TACTGAGAGGAAA	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.309C>G	chr6.hg19:g.2955761G>C		88.0	0.0	.		94.0	9.0	.	NM_001271823	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Silent	SNP	ENST00000380520.1	hg19	CCDS4479.1																																																																																			.	.	.	none		0.493	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043422.1		
NBN	4683	hgsc.bcm.edu	37	8	90967743	90967743	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr8:90967743T>C	ENST00000265433.3	-	10	1319	c.1165A>G	c.(1165-1167)Atg>Gtg	p.M389V	NBN_ENST00000409330.1_Missense_Mutation_p.M307V	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	389	Interaction with MTOR, MAPKAP1 and RICTOR.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTTTGTTCCATTTTGGAGACT	0.338								Homologous recombination																													p.M389V		Atlas-SNP	.											.	NBN	86	.	0			c.A1165G						PASS	.						104.0	98.0	100.0					8																	90967743		2203	4300	6503	SO:0001583	missense	4683	exon10			GTTCCATTTTGGA	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.1165A>G	chr8.hg19:g.90967743T>C	ENSP00000265433:p.Met389Val	35.0	0.0	.		42.0	14.0	.	NM_002485	B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	ENST00000265433.3	hg19	CCDS6249.1	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.453422	0.01071	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387	T;T	0.56941	2.1;0.43	5.45	-1.76	0.08006	.	0.952676	0.09006	N	0.862316	T	0.20659	0.0497	N	0.05383	-0.06	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24119	-1.0169	10	0.02654	T	1	3.3137	1.3277	0.02128	0.1323:0.1639:0.2892:0.4145	.	389;389	A6H8Y5;O60934	.;NBN_HUMAN	V	389;307;389	ENSP00000265433:M389V;ENSP00000386924:M307V	ENSP00000265433:M389V	M	-	1	0	NBN	91036919	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.078000	0.14761	-0.233000	0.09797	-0.321000	0.08615	ATG	.	.	.	none		0.338	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3	NM_001024688	
TAF1L	138474	hgsc.bcm.edu	37	9	32633310	32633310	+	Silent	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr9:32633310G>A	ENST00000242310.4	-	1	2357	c.2268C>T	c.(2266-2268)ggC>ggT	p.G756G	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	756					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GCAGTAATTGGCCAGGATGGA	0.443																																					p.G756G		Atlas-SNP	.											.	TAF1L	382	.	0			c.C2268T						PASS	.						184.0	180.0	182.0					9																	32633310		2203	4300	6503	SO:0001819	synonymous_variant	138474	exon1			TAATTGGCCAGGA	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2268C>T	chr9.hg19:g.32633310G>A		254.0	0.0	.		254.0	20.0	.	NM_153809	Q0VG57	Silent	SNP	ENST00000242310.4	hg19	CCDS35003.1																																																																																			.	.	.	none		0.443	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
DCAF10	79269	hgsc.bcm.edu	37	9	37800965	37800965	+	Silent	SNP	G	G	T	rs373032176		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr9:37800965G>T	ENST00000377724.3	+	1	467	c.102G>T	c.(100-102)ccG>ccT	p.P34P	DCAF10_ENST00000242323.7_Silent_p.P34P|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	34	Pro-rich.				protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						CCACCGGGCCGCCCTCGCCAC	0.761													G|||	1	0.000199681	0.0	0.0	5008	,	,		10350	0.0		0.001	False		,,,				2504	0.0				p.P34P		Atlas-SNP	.											.	DCAF10	31	.	0			c.G102T						PASS	.	G		2,2882		0,2,1440	3.0	4.0	3.0		102	-2.9	0.1	9		3	5,6809		0,5,3402	no	coding-synonymous	DCAF10	NM_024345.3		0,7,4842	TT,TG,GG		0.0734,0.0693,0.0722		34/560	37800965	7,9691	1442	3407	4849	SO:0001819	synonymous_variant	79269	exon1			CGGGCCGCCCTCG	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.102G>T	chr9.hg19:g.37800965G>T		0.0	0.0	.		12.0	8.0	.	NM_024345	A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Silent	SNP	ENST00000377724.3	hg19	CCDS6613.2																																																																																			.	.	.	weak		0.761	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052485.2	NM_024345	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751497	76751497	+	Missense_Mutation	SNP	A	A	G	rs559157215	byFrequency	TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr11:76751497A>G	ENST00000533140.1	+	2	1040	c.902A>G	c.(901-903)cAc>cGc	p.H301R	B3GNT6_ENST00000421061.1_Intron|B3GNT6_ENST00000354301.5_Missense_Mutation_p.H301R			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						gccgcccgccACACCCCGCTC	0.756													A|||	21	0.00419329	0.0008	0.0288	5008	,	,		10513	0.0		0.0	False		,,,				2504	0.0				p.H301R		Atlas-SNP	.											.	B3GNT6	27	.	0			c.A902G						PASS	.																																			SO:0001583	missense	192134	exon2			CCCGCCACACCCC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.902A>G	chr11.hg19:g.76751497A>G	ENSP00000435352:p.His301Arg	2.0	0.0	.		8.0	4.0	.	NM_138706	Q4TTN0	Missense_Mutation	SNP	ENST00000533140.1	hg19	CCDS53681.1	.	.	.	.	.	.	.	.	.	.	A	1.535	-0.543236	0.04053	.	.	ENSG00000198488	ENST00000533140;ENST00000354301	T;T	0.44083	0.93;0.93	2.89	0.53	0.17102	.	0.656353	0.15442	N	0.262162	T	0.21921	0.0528	N	0.21097	0.63	0.09310	N	0.999997	B	0.02656	0.0	B	0.09377	0.004	T	0.24368	-1.0162	10	0.11794	T	0.64	.	6.0489	0.19775	0.753:0.0:0.247:0.0	.	301	Q6ZMB0	B3GN6_HUMAN	R	301	ENSP00000435352:H301R;ENSP00000346256:H301R	ENSP00000346256:H301R	H	+	2	0	B3GNT6	76429145	0.000000	0.05858	0.007000	0.13788	0.109000	0.19521	-0.871000	0.04223	0.080000	0.16959	0.374000	0.22700	CAC	.	.	.	none		0.756	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123476178	123476178	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr11:123476178C>T	ENST00000529750.1	+	9	1213	c.886C>T	c.(886-888)Ccc>Tcc	p.P296S	GRAMD1B_ENST00000450171.2_5'Flank|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.P303S|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.P296S	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	296						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CAGTGAGGCCCCCGTCTCGGT	0.557																																					p.P296S		Atlas-SNP	.											.	GRAMD1B	122	.	0			c.C886T						PASS	.						142.0	149.0	147.0					11																	123476178		2083	4200	6283	SO:0001583	missense	57476	exon9			GAGGCCCCCGTCT	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.886C>T	chr11.hg19:g.123476178C>T	ENSP00000436500:p.Pro296Ser	121.0	0.0	.		147.0	45.0	.	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	hg19	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.911935	0.72983	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.30714	1.92;1.93;1.93;1.92;1.52	5.03	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	L	0.34521	1.04	0.58432	D	0.999998	P;P;D;B	0.57899	0.913;0.734;0.981;0.027	B;B;P;B	0.52109	0.424;0.356;0.69;0.065	T	0.02431	-1.1160	10	0.13470	T	0.59	.	13.3208	0.60432	0.0:0.9228:0.0:0.0772	.	256;303;296;303	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	S	303;303;296;296;256;292	ENSP00000402457:P303S;ENSP00000325628:P296S;ENSP00000436500:P296S;ENSP00000432987:P256S;ENSP00000434214:P292S	ENSP00000325628:P296S	P	+	1	0	GRAMD1B	122981388	0.994000	0.37717	0.842000	0.33263	0.898000	0.52572	3.919000	0.56439	1.112000	0.41740	0.305000	0.20034	CCC	.	.	.	none		0.557	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
BRAP	8315	hgsc.bcm.edu	37	12	112096635	112096635	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr12:112096635G>A	ENST00000327551.6	-	9	1176	c.1036C>T	c.(1036-1038)Cga>Tga	p.R346*	BRAP_ENST00000419234.4_Nonsense_Mutation_p.R376*|BRAP_ENST00000539060.1_Nonsense_Mutation_p.R197*			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						GCAACCAGTCGATGAACATAG	0.353																																					p.R376X	Pancreas(146;846 1904 7830 25130 26065)	Atlas-SNP	.											BRAP,NS,carcinoma,0,1	BRAP	42	.	0			c.C1126T						PASS	.						129.0	119.0	122.0					12																	112096635		2203	4300	6503	SO:0001587	stop_gained	8315	exon9			CCAGTCGATGAAC	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1036C>T	chr12.hg19:g.112096635G>A	ENSP00000330813:p.Arg346*	78.0	0.0	.		80.0	5.0	.	NM_006768	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Nonsense_Mutation	SNP	ENST00000327551.6	hg19		.	.	.	.	.	.	.	.	.	.	G	36	5.951877	0.97139	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1227	19.4174	0.94706	0.0:0.0:1.0:0.0	.	.	.	.	X	376;197;346;158	.	ENSP00000330813:R346X	R	-	1	2	BRAP	110581018	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.147000	0.94646	2.606000	0.88127	0.650000	0.86243	CGA	.	.	.	none		0.353	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
SEL1L	6400	hgsc.bcm.edu	37	14	81969202	81969202	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr14:81969202C>T	ENST00000336735.4	-	6	756	c.640G>A	c.(640-642)Gca>Aca	p.A214T	SEL1L_ENST00000555824.1_Missense_Mutation_p.A214T	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	214	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		TTCATGCTTGCTGCCTTTTGG	0.363																																					p.A214T		Atlas-SNP	.											.	SEL1L	67	.	0			c.G640A						PASS	.						146.0	139.0	142.0					14																	81969202		2203	4300	6503	SO:0001583	missense	6400	exon6			TGCTTGCTGCCTT		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.640G>A	chr14.hg19:g.81969202C>T	ENSP00000337053:p.Ala214Thr	61.0	0.0	.		79.0	22.0	.	NM_001244984	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	hg19	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191863	0.78902	.	.	ENSG00000071537	ENST00000336735;ENST00000555824	T;T	0.58940	0.35;0.3	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);	0.104952	0.64402	D	0.000004	T	0.71937	0.3399	M	0.66939	2.045	0.80722	D	1	D;D	0.67145	0.985;0.996	D;D	0.64042	0.92;0.921	T	0.74450	-0.3661	10	0.87932	D	0	.	14.4932	0.67665	0.1468:0.8532:0.0:0.0	.	214;214	Q9UBV2;Q9UBV2-2	SE1L1_HUMAN;.	T	214	ENSP00000337053:A214T;ENSP00000450709:A214T	ENSP00000337053:A214T	A	-	1	0	SEL1L	81038955	1.000000	0.71417	0.999000	0.59377	0.746000	0.42486	4.282000	0.58971	2.719000	0.93026	0.655000	0.94253	GCA	.	.	.	none		0.363	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
NLRP12	91662	hgsc.bcm.edu	37	19	54313633	54313633	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr19:54313633G>T	ENST00000324134.6	-	3	1448	c.1280C>A	c.(1279-1281)aCg>aAg	p.T427K	NLRP12_ENST00000535162.1_Missense_Mutation_p.T427K|NLRP12_ENST00000345770.5_Missense_Mutation_p.T427K|NLRP12_ENST00000391772.1_Missense_Mutation_p.T427K|NLRP12_ENST00000354278.3_Missense_Mutation_p.T427K|NLRP12_ENST00000351894.4_Missense_Mutation_p.T427K|NLRP12_ENST00000391773.1_Missense_Mutation_p.T427K|NLRP12_ENST00000391775.3_Missense_Mutation_p.T427K	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	427	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGTCCTGGACGTCTGTCTCAA	0.642																																					p.T427N		Atlas-SNP	.											NLRP12,colon,carcinoma,0,1	NLRP12	236	.	0			c.C1280A						PASS	.						92.0	91.0	92.0					19																	54313633		2203	4300	6503	SO:0001583	missense	91662	exon3			CTGGACGTCTGTC	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1280C>A	chr19.hg19:g.54313633G>T	ENSP00000319377:p.Thr427Lys	41.0	0.0	.		49.0	2.0	.	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	hg19	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253579	0.39797	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	4.77	1.33	0.21861	NACHT nucleoside triphosphatase (1);	0.322809	0.22246	N	0.062616	T	0.77691	0.4168	M	0.77616	2.38	0.09310	N	1	P;P;P;P	0.50443	0.935;0.835;0.835;0.752	B;B;B;B	0.38842	0.264;0.264;0.264;0.283	T	0.70831	-0.4765	10	0.66056	D	0.02	.	5.5314	0.16987	0.1844:0.1613:0.6542:0.0	.	427;427;427;427	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	K	427	ENSP00000319377:T427K;ENSP00000438030:T427K;ENSP00000340473:T427K;ENSP00000346231:T427K;ENSP00000375655:T427K;ENSP00000375653:T427K;ENSP00000375652:T427K	ENSP00000319377:T427K	T	-	2	0	NLRP12	59005445	0.000000	0.05858	0.002000	0.10522	0.515000	0.34225	0.072000	0.14617	0.174000	0.19809	-0.344000	0.07964	ACG	.	.	.	none		0.642	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
ZNF628	89887	hgsc.bcm.edu	37	19	55993264	55993264	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr19:55993264C>T	ENST00000598519.1	+	3	1257	c.704C>T	c.(703-705)gCc>gTc	p.A235V	ZNF628_ENST00000391718.2_Missense_Mutation_p.A231V			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	235	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		ccgggtaccgcctccgcggcc	0.766																																					p.A235V		Atlas-SNP	.											.	ZNF628	75	.	0			c.C704T						PASS	.						3.0	4.0	3.0					19																	55993264		1658	3351	5009	SO:0001583	missense	89887	exon3			GTACCGCCTCCGC	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.704C>T	chr19.hg19:g.55993264C>T	ENSP00000469591:p.Ala235Val	1.0	0.0	.		7.0	5.0	.	NM_033113	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	hg19	CCDS33116.3	.	.	.	.	.	.	.	.	.	.	.	7.048	0.563911	0.13498	.	.	ENSG00000197483	ENST00000391718	T	0.08807	3.05	3.0	1.93	0.25924	.	.	.	.	.	T	0.06325	0.0163	N	0.19112	0.55	0.09310	N	1	B	0.19445	0.036	B	0.24701	0.055	T	0.35919	-0.9769	9	0.54805	T	0.06	-3.6893	8.11	0.30909	0.0:0.7504:0.2496:0.0	.	231	Q5EBL2	ZN628_HUMAN	V	231	ENSP00000375598:A231V	ENSP00000375598:A231V	A	+	2	0	ZNF628	60685076	0.734000	0.28142	0.009000	0.14445	0.152000	0.21847	0.878000	0.28126	0.836000	0.34901	0.459000	0.35465	GCC	.	.	.	none		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
KIF4A	24137	hgsc.bcm.edu	37	X	69595071	69595071	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chrX:69595071G>A	ENST00000374403.3	+	17	1878	c.1796G>A	c.(1795-1797)cGc>cAc	p.R599H	KIF4A_ENST00000374388.3_Missense_Mutation_p.R599H	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	599					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GAGCGCCGCCGCAAACGTCTC	0.468																																					p.R599H		Atlas-SNP	.											.	KIF4A	118	.	0			c.G1796A						PASS	.						67.0	58.0	61.0					X																	69595071		2203	4300	6503	SO:0001583	missense	24137	exon17			GCCGCCGCAAACG	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1796G>A	chrX.hg19:g.69595071G>A	ENSP00000363524:p.Arg599His	102.0	0.0	.		120.0	5.0	.	NM_012310	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	hg19	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716466	0.68844	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.70869	2.3;-0.52	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000035	T	0.76292	0.3967	M	0.83483	2.645	0.80722	D	1	B;B	0.28713	0.143;0.22	B;B	0.33254	0.038;0.16	T	0.76394	-0.2975	10	0.52906	T	0.07	.	17.3242	0.87243	0.0:0.0:1.0:0.0	.	599;599	O95239;O95239-2	KIF4A_HUMAN;.	H	599	ENSP00000363509:R599H;ENSP00000363524:R599H	ENSP00000363509:R599H	R	+	2	0	KIF4A	69511796	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.912000	0.92726	2.562000	0.86427	0.600000	0.82982	CGC	.	.	.	none		0.468	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	
RNF128	79589	hgsc.bcm.edu	37	X	106034465	106034465	+	Splice_Site	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chrX:106034465G>A	ENST00000255499.2	+	6	1403		c.e6+1		RNF128_ENST00000324342.3_Splice_Site	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase						negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						CAGTCAACAAGTAAGCATCAT	0.453																																					.		Atlas-SNP	.											.	RNF128	74	.	0			c.1075+1G>A						PASS	.						172.0	148.0	156.0					X																	106034465		2203	4300	6503	SO:0001630	splice_region_variant	79589	exon6			CAACAAGTAAGCA	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.1153+1G>A	chrX.hg19:g.106034465G>A		141.0	0.0	.		136.0	33.0	.	NM_024539	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Splice_Site	SNP	ENST00000255499.2	hg19	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781964	0.70222	.	.	ENSG00000133135	ENST00000324342;ENST00000255499	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.497	0.67694	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF128	105921121	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	6.181000	0.71988	2.165000	0.68154	0.506000	0.49869	.	.	.	.	none		0.453	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	Intron
HS3ST4	9951	hgsc.bcm.edu	37	16	26147018	26147018	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr16:26147018delA	ENST00000331351.5	+	2	1212	c.820delA	c.(820-822)attfs	p.I274fs	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	274					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		TCCCAAGCGCATTCACTCCAT	0.498																																					p.R273fs		Atlas-INDEL	.											.	HS3ST4	120	.	0			c.819delC						PASS	.						122.0	111.0	115.0					16																	26147018		1568	3582	5150	SO:0001589	frameshift_variant	9951	exon2			.	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.820delA	chr16.hg19:g.26147018delA	ENSP00000330606:p.Ile274fs	78.0	0.0	0		112.0	12.0	0.107143	NM_006040	Q5QI42|Q8NDC2	Frame_Shift_Del	DEL	ENST00000331351.5	hg19	CCDS53995.1																																																																																			.	.	.	none		0.498	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040	
ZIC3	7547	hgsc.bcm.edu	37	X	136648984	136648985	+	In_Frame_Ins	INS	-	-	CGC			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chrX:136648984_136648985insCGC	ENST00000287538.5	+	1	684_685	c.134_135insCGC	c.(133-138)cacgcc>caCGCcgcc	p.55_56insA	RP1-137H15.2_ENST00000456631.1_RNA|RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_In_Frame_Ins_p.55_56insA	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	55	Poly-Ala.				anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					GACTCAACCCAcgccgccgccg	0.718																																					p.H45delinsHA		Atlas-INDEL	.											.	ZIC3	93	.	0			c.134_135insCGC						PASS	.																																			SO:0001652	inframe_insertion	7547	exon1			.	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.159_161dupCGC	chrX.hg19:g.136648991_136648993dupCGC	ENSP00000287538:p.Ala55_Ala55dup	6.0	1.0	0.166667		24.0	10.0	0.416667	NM_003413	B2CNW4|Q14DE5|Q5JY75	In_Frame_Ins	INS	ENST00000287538.5	hg19	CCDS14663.1																																																																																			.	.	.	none		0.718	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
HS3ST4	9951	hgsc.bcm.edu	37	16	26147021	26147023	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr16:26147021_26147023delCAC	ENST00000331351.5	+	2	1215_1217	c.823_825delCAC	c.(823-825)cacdel	p.H275del	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	275					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		CAAGCGCATTCACTCCATGGCCA	0.498																																					p.274_275del		Atlas-INDEL	.											.	HS3ST4	120	.	0			c.822_824del						PASS	.																																			SO:0001651	inframe_deletion	9951	exon2			.	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.823_825delCAC	chr16.hg19:g.26147021_26147023delCAC	ENSP00000330606:p.His275del	80.0	0.0	0		115.0	12.0	0.104348	NM_006040	Q5QI42|Q8NDC2	In_Frame_Del	DEL	ENST00000331351.5	hg19	CCDS53995.1																																																																																			.	.	.	none		0.498	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040	
HS3ST4	9951	hgsc.bcm.edu	37	16	26147022	26147025	+	Frame_Shift_Del	DEL	ACTC	ACTC	-			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	ACTC	ACTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr16:26147022_26147025delACTC	ENST00000331351.5	+	2	1216_1219	c.824_827delACTC	c.(823-828)cactccfs	p.HS275fs	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	275					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		AAGCGCATTCACTCCATGGCCAAG	0.505																																					p.275_276del		Pindel	.											.	HS3ST4	120	.	0			c.823_826del						PASS	.																																			SO:0001589	frameshift_variant	9951	exon2			.	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.824_827delACTC	chr16.hg19:g.26147022_26147025delACTC	ENSP00000330606:p.His275fs	82.0	0.0	.		117.0	10.0	0.085	NM_006040	Q5QI42|Q8NDC2	Frame_Shift_Del	DEL	ENST00000331351.5	hg19	CCDS53995.1																																																																																			.	.	.	none		0.505	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040	
