#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM201	199953	hgsc.bcm.edu	37	1	9658629	9658629	+	Silent	SNP	C	C	G			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:9658629C>G	ENST00000340381.6	+	4	561	c.552C>G	c.(550-552)gcC>gcG	p.A184A	TMEM201_ENST00000377376.4_Silent_p.A184A|TMEM201_ENST00000340305.5_Silent_p.A184A	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	184					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		AGCTGCGCGCCCTGTTGCTCA	0.642																																					p.A184A		Atlas-SNP	.											.	TMEM201	63	.	0			c.C552G						PASS	.						55.0	51.0	52.0					1																	9658629		2203	4300	6503	SO:0001819	synonymous_variant	199953	exon4			GCGCGCCCTGTTG		CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.552C>G	chr1.hg19:g.9658629C>G		241.0	0.0	.		241.0	82.0	.	NM_001010866	B9EH90|Q5SNT3	Silent	SNP	ENST00000340381.6	hg19	CCDS44055.2	.	.	.	.	.	.	.	.	.	.	C	11.02	1.516596	0.27123	.	.	ENSG00000188807	ENST00000416541	.	.	.	5.4	-0.367	0.12541	.	.	.	.	.	T	0.39172	0.1068	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29088	-1.0023	4	.	.	.	-28.101	0.3087	0.00285	0.2293:0.2578:0.2549:0.258	.	.	.	.	A	94	.	.	P	+	1	0	TMEM201	9581216	0.016000	0.18221	0.995000	0.50966	0.963000	0.63663	-1.022000	0.03611	0.267000	0.21916	-0.304000	0.09214	CCT	.	.	.	none		0.642	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127672.1	NM_001010866	
KIF1B	23095	hgsc.bcm.edu	37	1	10420986	10420986	+	Splice_Site	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:10420986G>A	ENST00000377086.1	+	39	4257		c.e39-1		KIF1B_ENST00000377081.1_Splice_Site|KIF1B_ENST00000263934.6_Splice_Site|KIF1B_ENST00000465635.1_Splice_Site			O60333	KIF1B_HUMAN	kinesin family member 1B						anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TCTGACCTTAGGACCTTCTAC	0.468																																					.		Atlas-SNP	.											.	KIF1B	242	.	0			c.3918-1G>A						PASS	.						186.0	151.0	163.0					1																	10420986		2203	4300	6503	SO:0001630	splice_region_variant	23095	exon37			ACCTTAGGACCTT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4056-1G>A	chr1.hg19:g.10420986G>A		104.0	0.0	.		126.0	7.0	.	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Splice_Site	SNP	ENST00000377086.1	hg19		.	.	.	.	.	.	.	.	.	.	G	25.9	4.683014	0.88542	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.355	0.90355	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIF1B	10343573	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.809000	0.99208	2.394000	0.81467	0.491000	0.48974	.	.	.	.	none		0.468	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		Intron
TMEM39B	55116	hgsc.bcm.edu	37	1	32560492	32560492	+	Silent	SNP	C	C	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:32560492C>T	ENST00000336294.5	+	7	1181	c.1035C>T	c.(1033-1035)gaC>gaT	p.D345D	TMEM39B_ENST00000373634.4_Silent_p.D146D|TMEM39B_ENST00000487305.1_3'UTR|TMEM39B_ENST00000456834.2_3'UTR|TMEM39B_ENST00000427288.1_Silent_p.D230D	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	345						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GCTACTGTGACCTGCTGCACA	0.607																																					p.D345D		Atlas-SNP	.											.	TMEM39B	66	.	0			c.C1035T						PASS	.						69.0	59.0	63.0					1																	32560492		2203	4300	6503	SO:0001819	synonymous_variant	55116	exon7			CTGTGACCTGCTG	AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.1035C>T	chr1.hg19:g.32560492C>T		46.0	0.0	.		46.0	17.0	.	NM_018056	B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Silent	SNP	ENST00000336294.5	hg19	CCDS351.2																																																																																			.	.	.	none		0.607	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011489.2	NM_018056	
ALX3	257	hgsc.bcm.edu	37	1	110607426	110607426	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:110607426C>A	ENST00000369792.4	-	2	464	c.377G>T	c.(376-378)gGc>gTc	p.G126V	RP4-773N10.4_ENST00000554749.1_RNA	NM_006492.2	NP_006483.2	O95076	ALX3_HUMAN	ALX homeobox 3	126					embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|pattern specification process (GO:0007389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.015)|all cancers(265;0.0706)|Epithelial(280;0.0758)|Colorectal(144;0.113)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAGGCAGGGGCCTGGGGAGCC	0.637																																					p.G126V		Atlas-SNP	.											.	ALX3	16	.	0			c.G377T						PASS	.						51.0	59.0	56.0					1																	110607426		2203	4300	6503	SO:0001583	missense	257	exon2			CAGGGGCCTGGGG	AF008203	CCDS819.1	1p13.3	2014-02-04	2008-11-04		ENSG00000156150	ENSG00000156150		"""Homeoboxes / PRD class"""	449	protein-coding gene	gene with protein product		606014	"""aristaless-like homeobox 3"", ""frontonasal dysplasia"""	FND		15226305, 11807986, 19409524	Standard	NM_006492		Approved		uc001dzb.3	O95076	OTTHUMG00000011650	ENST00000369792.4:c.377G>T	chr1.hg19:g.110607426C>A	ENSP00000358807:p.Gly126Val	165.0	0.0	.		135.0	49.0	.	NM_006492	O95075|Q5T8M4	Missense_Mutation	SNP	ENST00000369792.4	hg19	CCDS819.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773631	0.31411	.	.	ENSG00000156150	ENST00000369792	D	0.92199	-2.99	4.04	1.77	0.24775	.	0.699687	0.12287	N	0.482336	T	0.71324	0.3326	N	0.19112	0.55	0.47584	D	0.999467	B	0.34372	0.451	B	0.31686	0.134	T	0.66594	-0.5884	10	0.30854	T	0.27	.	4.1379	0.10179	0.0:0.502:0.2576:0.2404	.	126	O95076	ALX3_HUMAN	V	126	ENSP00000358807:G126V	ENSP00000358807:G126V	G	-	2	0	ALX3	110408949	0.002000	0.14202	0.996000	0.52242	0.915000	0.54546	1.144000	0.31565	0.767000	0.33267	0.462000	0.41574	GGC	.	.	.	none		0.637	ALX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032232.2	NM_006492	
ASH1L	55870	hgsc.bcm.edu	37	1	155308132	155308132	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:155308132G>A	ENST00000368346.3	-	27	9205	c.8566C>T	c.(8566-8568)Cag>Tag	p.Q2856*	ASH1L_ENST00000392403.3_Nonsense_Mutation_p.Q2851*			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2856					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TCATCCTCCTGGCCCAAGTCT	0.517																																					p.Q2851X		Atlas-SNP	.											.	ASH1L	279	.	0			c.C8551T						PASS	.						92.0	90.0	90.0					1																	155308132		2203	4300	6503	SO:0001587	stop_gained	55870	exon27			CCTCCTGGCCCAA	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8566C>T	chr1.hg19:g.155308132G>A	ENSP00000357330:p.Gln2856*	97.0	0.0	.		124.0	15.0	.	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Nonsense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	G	52	19.235170	0.99916	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	.	.	.	5.5	5.5	0.81552	.	0.135981	0.52532	D	0.000070	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	17.348	0.87315	0.0:0.0:1.0:0.0	.	.	.	.	X	2856;2851	.	ENSP00000357330:Q2856X	Q	-	1	0	ASH1L	153574756	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.039000	0.57325	2.861000	0.98227	0.655000	0.94253	CAG	.	.	.	none		0.517	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
CFHR2	3080	hgsc.bcm.edu	37	1	196879470	196879470	+	Intron	SNP	C	C	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:196879470C>T	ENST00000367421.3	+	2	135				CFHR4_ENST00000608469.1_Intron|CFHR4_ENST00000367418.2_Intron|CFHR4_ENST00000251424.4_Intron|CFHR4_ENST00000367416.2_Missense_Mutation_p.R286C			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TGAGAATACGCGTAGACCATA	0.343																																					p.R287C		Atlas-SNP	.											.	CFHR4	141	.	0			c.C859T						PASS	.																																			SO:0001627	intron_variant	10877	exon6			AATACGCGTAGAC	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-39115C>T	chr1.hg19:g.196879470C>T		227.0	0.0	.		220.0	90.0	.	NM_001201550	Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367421.3	hg19		.	.	.	.	.	.	.	.	.	.	.	5.563	0.288643	0.10513	.	.	ENSG00000134365	ENST00000367416;ENST00000367418	T;T	0.40756	1.21;1.02	2.42	-0.0299	0.13916	.	.	.	.	.	T	0.45756	0.1358	M	0.65975	2.015	0.09310	N	1	P;P	0.52577	0.492;0.954	B;P	0.51918	0.297;0.684	T	0.32666	-0.9898	9	0.51188	T	0.08	.	4.3475	0.11139	0.0:0.3933:0.0:0.6066	.	286;287	C9J7J7;Q5DVJ7	.;.	C	286;40	ENSP00000356386:R286C;ENSP00000356388:R40C	ENSP00000356386:R286C	R	+	1	0	CFHR4	195146093	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.205000	0.09411	-0.010000	0.14271	0.195000	0.17529	CGT	.	.	.	none		0.343	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005666	
CTSE	1510	hgsc.bcm.edu	37	1	206318340	206318340	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:206318340A>T	ENST00000358184.2	+	2	216	c.98A>T	c.(97-99)aAg>aTg	p.K33M	CTSE_ENST00000361052.3_Missense_Mutation_p.K33M|CTSE_ENST00000432969.2_Intron|CTSE_ENST00000360218.2_Missense_Mutation_p.K33M	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	33					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			CCGTCCCTCAAGAAGAAGCTG	0.557																																					p.K33M		Atlas-SNP	.											.	CTSE	72	.	0			c.A98T						PASS	.						56.0	58.0	57.0					1																	206318340		2203	4300	6503	SO:0001583	missense	1510	exon2			CCCTCAAGAAGAA	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.98A>T	chr1.hg19:g.206318340A>T	ENSP00000350911:p.Lys33Met	99.0	0.0	.		53.0	21.0	.	NM_001910	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	ENST00000358184.2	hg19	CCDS1462.1	.	.	.	.	.	.	.	.	.	.	A	18.69	3.678705	0.68042	.	.	ENSG00000196188	ENST00000358184;ENST00000361052;ENST00000360218	T;T;T	0.41758	0.99;0.99;0.99	4.57	3.64	0.41730	.	0.213055	0.32503	N	0.006003	T	0.36744	0.0978	L	0.47190	1.495	0.80722	D	1	P;B	0.37864	0.61;0.381	B;B	0.37198	0.243;0.163	T	0.37009	-0.9724	10	0.87932	D	0	.	11.9121	0.52745	0.0883:0.0:0.9117:0.0	.	33;33	P14091-2;P14091-1	.;.	M	33	ENSP00000350911:K33M;ENSP00000354337:K33M;ENSP00000353350:K33M	ENSP00000350911:K33M	K	+	2	0	CTSE	204484963	0.986000	0.35501	1.000000	0.80357	0.735000	0.41995	4.968000	0.63728	1.270000	0.44297	-0.242000	0.12053	AAG	.	.	.	none		0.557	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613037	+	Missense_Mutation	DNP	GA	GA	CT	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr2:73613036_73613037GA>CT	ENST00000264448.6	+	1	151_152	c.40_41GA>CT	c.(40-42)GAg>CTg	p.E14L	ALMS1_ENST00000377715.1_Missense_Mutation_p.E14L|ALMS1_ENST00000409009.1_Missense_Mutation_p.E14L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggaggag	0.693																																					p.E14Q|p.E14V		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C|c.A41T						PASS	.																																			SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG|TGGAGGAGGAGGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	Exception_encountered	chr2.hg19:g.73613036_73613037delinsCT	ENSP00000264448:p.Glu14Leu	202.0|200.0	0.0	.		237.0|239.0	13.0|19.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.	.	none		0.693	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
CCDC142	84865	hgsc.bcm.edu	37	2	74707970	74707970	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr2:74707970A>C	ENST00000393965.3	-	5	1825	c.1429T>G	c.(1429-1431)Tca>Gca	p.S477A	TTC31_ENST00000410003.1_5'Flank|TTC31_ENST00000233623.5_5'Flank|TTC31_ENST00000442235.2_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.S470A|CCDC142_ENST00000471713.1_5'UTR	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	477										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						CTTTCCTCTGAGGCCAGGCTA	0.582																																					p.S470A		Atlas-SNP	.											.	CCDC142	40	.	0			c.T1408G						PASS	.						72.0	69.0	70.0					2																	74707970		2203	4300	6503	SO:0001583	missense	84865	exon5			CCTCTGAGGCCAG	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.1429T>G	chr2.hg19:g.74707970A>C	ENSP00000377537:p.Ser477Ala	114.0	0.0	.		112.0	40.0	.	NM_032779	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	hg19		.	.	.	.	.	.	.	.	.	.	A	18.39	3.612677	0.66672	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.44482	0.92;0.92	4.17	4.17	0.49024	.	0.536281	0.15677	N	0.250095	T	0.55465	0.1922	M	0.72118	2.19	0.25148	N	0.990448	D;D;D	0.61697	0.99;0.975;0.99	P;P;P	0.58928	0.848;0.79;0.848	T	0.45381	-0.9265	10	0.37606	T	0.19	-2.1681	9.5608	0.39369	1.0:0.0:0.0:0.0	.	477;470;477	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	A	477;470	ENSP00000377537:S477A;ENSP00000290418:S470A	ENSP00000290418:S470A	S	-	1	0	CCDC142	74561478	0.997000	0.39634	0.989000	0.46669	0.966000	0.64601	2.551000	0.45820	1.756000	0.51951	0.459000	0.35465	TCA	.	.	.	none		0.582	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779	
TGOLN2	10618	hgsc.bcm.edu	37	2	85554322	85554322	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr2:85554322A>T	ENST00000409232.3	-	2	594	c.533T>A	c.(532-534)gTc>gAc	p.V178D	TGOLN2_ENST00000282120.2_Missense_Mutation_p.V80D|TGOLN2_ENST00000377386.3_Missense_Mutation_p.V178D|TGOLN2_ENST00000409015.1_Missense_Mutation_p.V178D|TGOLN2_ENST00000398263.2_Missense_Mutation_p.V178D|TGOLN2_ENST00000444342.2_Missense_Mutation_p.V178D			O43493	TGON2_HUMAN	trans-golgi network protein 2	178	14 X 14 AA tandem repeats.					Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)											CTTATTAGGGACATCTTTTGT	0.587																																					p.V178D		Atlas-SNP	.											.	TGOLN2	32	.	0			c.T533A						PASS	.						309.0	312.0	311.0					2																	85554322		1946	4141	6087	SO:0001583	missense	10618	exon2			TTAGGGACATCTT	AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.533T>A	chr2.hg19:g.85554322A>T	ENSP00000386443:p.Val178Asp	92.0	0.0	.		85.0	38.0	.	NM_001206841	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Missense_Mutation	SNP	ENST00000409232.3	hg19	CCDS56126.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.563265	0.00903	.	.	ENSG00000152291	ENST00000377386;ENST00000282120;ENST00000398263;ENST00000409232;ENST00000409015;ENST00000444342	T;T;T;T;T;T	0.11169	2.94;2.86;2.8;2.96;2.95;2.94	2.55	-5.11	0.02901	.	.	.	.	.	T	0.05456	0.0144	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.37619	-0.9698	9	0.12430	T	0.62	0.0827	0.495	0.00570	0.3025:0.2571:0.2813:0.1592	.	178;178;178;178	O43493;O43493-5;O43493-4;O43493-2	TGON2_HUMAN;.;.;.	D	178;80;178;178;178;178	ENSP00000366603:V178D;ENSP00000282120:V80D;ENSP00000381312:V178D;ENSP00000386443:V178D;ENSP00000387035:V178D;ENSP00000391190:V178D	ENSP00000282120:V80D	V	-	2	0	TGOLN2	85407833	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-6.946000	0.00048	-3.971000	0.00086	-1.466000	0.01016	GTC	.	.	.	none		0.587	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329045.2	NM_006464	
ACTR3	10096	hgsc.bcm.edu	37	2	114670788	114670788	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr2:114670788G>T	ENST00000263238.2	+	2	404	c.84G>T	c.(82-84)caG>caT	p.Q28H	ACTR3_ENST00000535589.2_5'UTR|ACTR3_ENST00000536059.1_Missense_Mutation_p.S8I	NM_001277140.1|NM_005721.3	NP_001264069.1|NP_005712.1	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog (yeast)	28					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron differentiation (GO:0045666)|regulation of myosin II filament organization (GO:0043519)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|spindle localization (GO:0051653)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|hemidesmosome (GO:0030056)|lamellipodium (GO:0030027)|membrane (GO:0016020)|podosome (GO:0002102)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(2)	15						CAGAACCACAGTTTATCATCC	0.289																																					p.Y28Y		Atlas-SNP	.											.	ACTR3	26	.	0			c.T84T						PASS	.						76.0	79.0	78.0					2																	114670788		2203	4296	6499	SO:0001583	missense	10096	exon2			ACCACAGTTTATC	AF006083	CCDS33277.1, CCDS63000.1	2q14.1	2010-07-20	2001-11-28		ENSG00000115091	ENSG00000115091			170	protein-coding gene	gene with protein product		604222	"""ARP3 (actin-related protein 3, yeast) homolog"""			9230079	Standard	NM_005721		Approved	ARP3	uc002tkx.2	P61158	OTTHUMG00000153497	ENST00000263238.2:c.84G>T	chr2.hg19:g.114670788G>T	ENSP00000263238:p.Gln28His	315.0	1.0	.		288.0	99.0	.	NM_005721	P32391|Q53QM2	Silent	SNP	ENST00000263238.2	hg19	CCDS33277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.37|13.37	2.217984|2.217984	0.39201|0.39201	.|.	.|.	ENSG00000115091|ENSG00000115091	ENST00000263238|ENST00000536059	D|D	0.94497|0.97575	-3.44|-4.44	4.42|4.42	3.52|3.52	0.40303|0.40303	.|.	0.064264|.	0.64402|.	D|.	0.000005|.	D|D	0.95947|0.95947	0.8680|0.8680	M|M	0.69523|0.69523	2.12|2.12	0.80722|0.80722	D|D	1|1	D|P	0.56521|0.34977	0.976|0.478	D|B	0.63877|0.40636	0.919|0.335	D|D	0.95526|0.95526	0.8599|0.8599	10|9	0.72032|0.72032	D|D	0.01|0.01	.|.	8.005|8.005	0.30319|0.30319	0.2466:0.0:0.7534:0.0|0.2466:0.0:0.7534:0.0	.|.	28|8	P61158|F5H3P5	ARP3_HUMAN|.	H|I	28|8	ENSP00000263238:Q28H|ENSP00000445257:S8I	ENSP00000263238:Q28H|ENSP00000445257:S8I	Q|S	+|+	3|2	2|0	ACTR3|ACTR3	114387258|114387258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	4.767000|4.767000	0.62286|0.62286	2.290000|2.290000	0.77057|0.77057	0.305000|0.305000	0.20034|0.20034	CAG|AGT	.	.	.	none		0.289	ACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331366.2	NM_005721	
OLA1	29789	hgsc.bcm.edu	37	2	174987981	174987981	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr2:174987981A>C	ENST00000409546.1	-	7	1345	c.715T>G	c.(715-717)Ttt>Gtt	p.F239V	OLA1_ENST00000284719.3_Missense_Mutation_p.F219V|OLA1_ENST00000428402.2_Missense_Mutation_p.F219V|OLA1_ENST00000392560.2_5'UTR|OLA1_ENST00000344357.5_Missense_Mutation_p.F61V					Obg-like ATPase 1											breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						GAAGTCAAAAATAAGTGTTTA	0.308																																					p.F219V		Atlas-SNP	.											.	OLA1	37	.	0			c.T655G						PASS	.						48.0	49.0	49.0					2																	174987981		2201	4296	6497	SO:0001583	missense	29789	exon7			TCAAAAATAAGTG		CCDS2255.1, CCDS42779.1	2q31.1	2014-06-24	2007-07-27	2007-07-27	ENSG00000138430	ENSG00000138430			28833	protein-coding gene	gene with protein product		611175	"""GTP-binding protein 9 (putative)"""	GTPBP9		17430889, 24486488	Standard	NM_013341		Approved	PTD004	uc002uih.3	Q9NTK5	OTTHUMG00000132335	ENST00000409546.1:c.715T>G	chr2.hg19:g.174987981A>C	ENSP00000386350:p.Phe239Val	46.0	0.0	.		33.0	8.0	.	NM_013341		Missense_Mutation	SNP	ENST00000409546.1	hg19		.	.	.	.	.	.	.	.	.	.	A	21.0	4.083112	0.76642	.	.	ENSG00000138430	ENST00000284719;ENST00000344357;ENST00000428402;ENST00000409546;ENST00000429575	T;T;T;T	0.45668	2.32;2.32;0.89;2.32	5.71	4.52	0.55395	.	0.047967	0.85682	D	0.000000	T	0.63058	0.2479	M	0.85373	2.75	0.80722	D	1	P;P;P;P	0.51791	0.948;0.854;0.885;0.854	P;P;P;P	0.59012	0.786;0.85;0.83;0.85	T	0.68032	-0.5516	10	0.87932	D	0	.	11.9033	0.52697	0.931:0.0:0.069:0.0	.	219;219;61;219	Q9NTK5-3;D7EHM2;Q9NTK5-2;Q9NTK5	.;.;.;OLA1_HUMAN	V	219;61;219;239;61	ENSP00000284719:F219V;ENSP00000340167:F61V;ENSP00000410385:F219V;ENSP00000386350:F239V	ENSP00000284719:F219V	F	-	1	0	OLA1	174696227	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.906000	0.63293	0.944000	0.37579	0.528000	0.53228	TTT	.	.	.	none		0.308	OLA1-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333877.1	NM_013341	
MYO1B	4430	hgsc.bcm.edu	37	2	192227007	192227007	+	Silent	SNP	T	T	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr2:192227007T>C	ENST00000392318.3	+	9	922	c.675T>C	c.(673-675)ctT>ctC	p.L225L	MYO1B_ENST00000304164.4_Silent_p.L225L|MYO1B_ENST00000392316.1_Silent_p.L225L|MYO1B_ENST00000339514.4_Silent_p.L225L	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	225	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			AACTTAAGCTTGAGAGGGATT	0.378																																					p.L225L		Atlas-SNP	.											.	MYO1B	160	.	0			c.T675C						PASS	.						112.0	111.0	111.0					2																	192227007		2203	4300	6503	SO:0001819	synonymous_variant	4430	exon9			TAAGCTTGAGAGG	L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.675T>C	chr2.hg19:g.192227007T>C		143.0	0.0	.		126.0	47.0	.	NM_012223	O43794|Q7Z6L5	Silent	SNP	ENST00000392318.3	hg19	CCDS46477.1																																																																																			.	.	.	none		0.378	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
WNT7A	7476	hgsc.bcm.edu	37	3	13860792	13860792	+	Silent	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr3:13860792G>A	ENST00000285018.4	-	4	1003	c.699C>T	c.(697-699)aaC>aaT	p.N233N		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	233					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						GAACGGCCTCGTTGTACTTGT	0.612																																					p.N233N		Atlas-SNP	.											.	WNT7A	70	.	0			c.C699T						PASS	.						108.0	100.0	103.0					3																	13860792		2203	4300	6503	SO:0001819	synonymous_variant	7476	exon4			GGCCTCGTTGTAC	D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.699C>T	chr3.hg19:g.13860792G>A		73.0	0.0	.		120.0	47.0	.	NM_004625	Q96H90|Q9Y560	Silent	SNP	ENST00000285018.4	hg19	CCDS2616.1																																																																																			.	.	.	none		0.612	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625	
ARGFX	503582	hgsc.bcm.edu	37	3	121289566	121289566	+	Silent	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr3:121289566G>A	ENST00000334384.3	+	1	16	c.6G>A	c.(4-6)agG>agA	p.R2R		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		AAACCATGAGGAACAGAATGG	0.473																																					p.R2R		Atlas-SNP	.											.	ARGFX	36	.	0			c.G6A						PASS	.						76.0	77.0	76.0					3																	121289566		2203	4300	6503	SO:0001819	synonymous_variant	503582	exon2			CATGAGGAACAGA		CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.6G>A	chr3.hg19:g.121289566G>A		302.0	1.0	.		404.0	240.0	.	NM_001012659		Silent	SNP	ENST00000334384.3	hg19	CCDS33834.1																																																																																			.	.	.	none		0.473	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659	
SI	6476	hgsc.bcm.edu	37	3	164783068	164783068	+	Missense_Mutation	SNP	C	C	T	rs143135955		TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr3:164783068C>T	ENST00000264382.3	-	7	850	c.788G>A	c.(787-789)cGa>cAa	p.R263Q		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	263	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAGTTGGTCTCGAGTAAAAAT	0.318										HNSCC(35;0.089)																											p.R263Q		Atlas-SNP	.											.	SI	500	.	0			c.G788A						PASS	.	C	GLN/ARG	0,4406		0,0,2203	68.0	67.0	67.0		788	5.9	1.0	3	dbSNP_134	67	1,8599	1.2+/-3.3	0,1,4299	no	missense	SI	NM_001041.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	263/1828	164783068	1,13005	2203	4300	6503	SO:0001583	missense	6476	exon7			TGGTCTCGAGTAA	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.788G>A	chr3.hg19:g.164783068C>T	ENSP00000264382:p.Arg263Gln	221.0	0.0	.		257.0	139.0	.	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	hg19	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	33	5.220283	0.95139	0.0	1.16E-4	ENSG00000090402	ENST00000264382	D	0.86164	-2.08	5.9	5.9	0.94986	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.95436	0.8518	M	0.92649	3.33	0.54753	D	0.999981	D	0.89917	1.0	D	0.81914	0.995	D	0.95695	0.8744	10	0.87932	D	0	.	20.2789	0.98501	0.0:1.0:0.0:0.0	.	263	P14410	SUIS_HUMAN	Q	263	ENSP00000264382:R263Q	ENSP00000264382:R263Q	R	-	2	0	SI	166265762	1.000000	0.71417	0.994000	0.49952	0.882000	0.50991	5.545000	0.67237	2.788000	0.95919	0.650000	0.86243	CGA	.	C|1.000;T|0.000	0.000	weak		0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SEC24D	9871	hgsc.bcm.edu	37	4	119674015	119674015	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr4:119674015G>C	ENST00000280551.6	-	12	1688	c.1450C>G	c.(1450-1452)Cga>Gga	p.R484G	SEC24D_ENST00000419654.2_Missense_Mutation_p.R40G|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000511481.1_Missense_Mutation_p.R115G|SEC24D_ENST00000429811.2_Missense_Mutation_p.R40G|SEC24D_ENST00000379735.5_Missense_Mutation_p.R485G			O94855	SC24D_HUMAN	SEC24 family member D	484					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						AAACCCACTCGAATTGCAGAC	0.373																																					p.R484G		Atlas-SNP	.											.	SEC24D	96	.	0			c.C1450G						PASS	.						73.0	75.0	74.0					4																	119674015		2203	4300	6503	SO:0001583	missense	9871	exon12			CCACTCGAATTGC	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1450C>G	chr4.hg19:g.119674015G>C	ENSP00000280551:p.Arg484Gly	117.0	0.0	.		119.0	49.0	.	NM_014822	Q8IYI7	Missense_Mutation	SNP	ENST00000280551.6	hg19	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683714	0.88639	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000429811;ENST00000511481;ENST00000419654	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	5.34	5.34	0.76211	Sec23/Sec24, trunk domain (1);	0.061247	0.64402	D	0.000007	T	0.76608	0.4011	M	0.93106	3.38	0.58432	D	0.99999	D;D	0.63880	0.989;0.993	D;D	0.68353	0.91;0.957	T	0.82948	-0.0204	10	0.87932	D	0	-15.9984	19.0321	0.92961	0.0:0.0:1.0:0.0	.	485;484	O94855-2;O94855	.;SC24D_HUMAN	G	484;485;40;115;40	ENSP00000280551:R484G;ENSP00000369059:R485G;ENSP00000409775:R40G;ENSP00000425491:R115G;ENSP00000388324:R40G	ENSP00000280551:R484G	R	-	1	2	SEC24D	119893463	1.000000	0.71417	0.950000	0.38849	0.959000	0.62525	5.727000	0.68523	2.494000	0.84150	0.467000	0.42956	CGA	.	.	.	none		0.373	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4		
UFSP2	55325	hgsc.bcm.edu	37	4	186324652	186324652	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr4:186324652T>C	ENST00000264689.6	-	11	1435	c.1319A>G	c.(1318-1320)gAa>gGa	p.E440G		NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	440						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		ACTTACCTTTTCCAAAATAAC	0.383																																					p.E440G		Atlas-SNP	.											.	UFSP2	33	.	0			c.A1319G						PASS	.						95.0	88.0	90.0					4																	186324652		2203	4300	6503	SO:0001583	missense	55325	exon11			ACCTTTTCCAAAA	AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.1319A>G	chr4.hg19:g.186324652T>C	ENSP00000264689:p.Glu440Gly	88.0	0.0	.		65.0	31.0	.	NM_018359	Q6IA77|Q96FS3	Missense_Mutation	SNP	ENST00000264689.6	hg19	CCDS3842.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.38|14.38	2.517213|2.517213	0.44763|0.44763	.|.	.|.	ENSG00000109775|ENSG00000109775	ENST00000264689|ENST00000509180	T|.	0.32988|.	1.43|.	5.92|5.92	4.75|4.75	0.60458|0.60458	.|.	0.190483|.	0.56097|.	N|.	0.000030|.	T|T	0.54695|0.54695	0.1874|0.1874	L|L	0.38953|0.38953	1.18|1.18	0.53688|0.53688	D|D	0.999975|0.999975	B;B|.	0.16396|.	0.003;0.017|.	B;B|.	0.16289|.	0.015;0.007|.	T|T	0.49634|0.49634	-0.8919|-0.8919	10|5	0.45353|.	T|.	0.12|.	-22.9056|-22.9056	11.7184|11.7184	0.51668|0.51668	0.0:0.0684:0.0:0.9316|0.0:0.0684:0.0:0.9316	.|.	440;340|.	Q9NUQ7;B3KRI4|.	UFSP2_HUMAN;.|.	G|E	440|169	ENSP00000264689:E440G|.	ENSP00000264689:E440G|.	E|K	-|-	2|1	0|0	UFSP2|UFSP2	186561646|186561646	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	7.688000|7.688000	0.84153|0.84153	1.073000|1.073000	0.40885|0.40885	0.533000|0.533000	0.62120|0.62120	GAA|AAA	.	.	.	none		0.383	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360589.2	NM_018359	
ANKRA2	57763	hgsc.bcm.edu	37	5	72857114	72857114	+	Splice_Site	SNP	C	C	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr5:72857114C>T	ENST00000296785.3	-	3	948		c.e3-1			NM_023039.4	NP_075526.1	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2							cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	low-density lipoprotein particle binding (GO:0030169)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		TTGCATTCAGCTAAGTGAAAA	0.358																																					.		Atlas-SNP	.											.	ANKRA2	23	.	0			c.290-1G>A						PASS	.						138.0	120.0	126.0					5																	72857114		2203	4300	6503	SO:0001630	splice_region_variant	57763	exon4			ATTCAGCTAAGTG	AA442702	CCDS4020.1	5q12-q13	2013-01-10			ENSG00000164331	ENSG00000164331		"""Ankyrin repeat domain containing"""	13208	protein-coding gene	gene with protein product		605787				10965114	Standard	NM_023039		Approved		uc003kcu.2	Q9H9E1	OTTHUMG00000102030	ENST00000296785.3:c.290-1G>A	chr5.hg19:g.72857114C>T		85.0	0.0	.		80.0	29.0	.	NM_023039		Splice_Site	SNP	ENST00000296785.3	hg19	CCDS4020.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843321	0.51057	.	.	ENSG00000164331	ENST00000296785	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0124	0.89227	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRA2	72892870	1.000000	0.71417	0.998000	0.56505	0.613000	0.37349	7.423000	0.80229	2.246000	0.74042	0.449000	0.29647	.	.	.	.	none		0.358	ANKRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219814.2	NM_023039	Intron
ANKRD34B	340120	hgsc.bcm.edu	37	5	79854309	79854309	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr5:79854309T>G	ENST00000338682.3	-	5	2202	c.1530A>C	c.(1528-1530)caA>caC	p.Q510H		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	510						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		AGTTTACTAATTGCTTAATTT	0.299																																					p.Q510H		Atlas-SNP	.											.	ANKRD34B	61	.	0			c.A1530C						PASS	.						50.0	52.0	51.0					5																	79854309		2203	4298	6501	SO:0001583	missense	340120	exon5			TACTAATTGCTTA		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.1530A>C	chr5.hg19:g.79854309T>G	ENSP00000339802:p.Gln510His	58.0	0.0	.		89.0	35.0	.	NM_001004441	B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	hg19	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	T	17.15	3.317196	0.60524	.	.	ENSG00000189127	ENST00000338682	T	0.21361	2.01	6.04	-2.62	0.06152	.	0.000000	0.64402	D	0.000004	T	0.42539	0.1207	M	0.77313	2.365	0.47037	D	0.999297	D	0.89917	1.0	D	0.87578	0.998	T	0.46190	-0.9209	10	0.56958	D	0.05	-16.413	14.2293	0.65879	0.0:0.5749:0.0:0.4251	.	510	A5PLL1	AN34B_HUMAN	H	510	ENSP00000339802:Q510H	ENSP00000339802:Q510H	Q	-	3	2	ANKRD34B	79890065	0.773000	0.28580	0.961000	0.40146	0.903000	0.53119	-0.065000	0.11617	-0.344000	0.08338	0.460000	0.39030	CAA	.	.	.	none		0.299	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	NM_001004441	
PARK2	5071	hgsc.bcm.edu	37	6	162864397	162864398	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr6:162864397_162864398TC>AT	ENST00000366898.1	-	2	217_218	c.115_116GA>AT	c.(115-117)GAc>ATc	p.D39I	PARK2_ENST00000366897.1_Missense_Mutation_p.D39I|PARK2_ENST00000366892.1_Missense_Mutation_p.D39I|PARK2_ENST00000366894.1_5'UTR|PARK2_ENST00000338468.3_5'UTR|PARK2_ENST00000366896.1_Missense_Mutation_p.D39I	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	39	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		ACGCAACTGGTCAGCCGGAACC	0.579																																					p.D39V|p.D39N		Atlas-SNP	.											.	PARK2	96	.	0			c.A116T|c.G115A						PASS	.																																			SO:0001583	missense	5071	exon2			AACTGGTCAGCCG|ACTGGTCAGCCGG		CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.115_116delinsAT	chr6.hg19:g.162864397_162864398delinsAT	ENSP00000355865:p.Asp39Ile	79.0	0.0	.		65.0|66.0	28.0|27.0	.	NM_004562	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	ENST00000366898.1	hg19	CCDS5281.1																																																																																			.	.	.	none		0.579	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1		
DBNL	28988	hgsc.bcm.edu	37	7	44091488	44091488	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr7:44091488T>A	ENST00000448521.1	+	3	297	c.199T>A	c.(199-201)Tgc>Agc	p.C67S	DBNL_ENST00000440166.1_Intron|DBNL_ENST00000494774.1_Missense_Mutation_p.C67S|DBNL_ENST00000468694.1_Missense_Mutation_p.C67S|DBNL_ENST00000497184.1_3'UTR|DBNL_ENST00000456905.1_Missense_Mutation_p.C67S|DBNL_ENST00000490734.2_Intron|DBNL_ENST00000452943.1_Missense_Mutation_p.C67S	NM_001014436.2	NP_001014436.1	Q9UJU6	DBNL_HUMAN	drebrin-like	67	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|endocytosis (GO:0006897)|immune system process (GO:0002376)|neuron projection morphogenesis (GO:0048812)|podosome assembly (GO:0071800)|Rac protein signal transduction (GO:0016601)|synapse assembly (GO:0007416)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|podosome (GO:0002102)|postsynaptic density (GO:0014069)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|enzyme activator activity (GO:0008047)			breast(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|stomach(1)	12						GTACGCCTTCTGCAGAGTGAA	0.562																																					p.C67S	NSCLC(68;573 1327 18604 34760 37992)	Atlas-SNP	.											.	DBNL	26	.	0			c.T199A						PASS	.						181.0	149.0	160.0					7																	44091488		2203	4300	6503	SO:0001583	missense	28988	exon3			GCCTTCTGCAGAG	AF151364	CCDS34622.1, CCDS34623.1, CCDS47579.1, CCDS64633.1, CCDS64634.1	7p13	2004-07-22			ENSG00000136279	ENSG00000136279			2696	protein-coding gene	gene with protein product		610106				10087302	Standard	NM_014063		Approved	SH3P7, HIP-55	uc003tjq.4	Q9UJU6	OTTHUMG00000155350	ENST00000448521.1:c.199T>A	chr7.hg19:g.44091488T>A	ENSP00000411701:p.Cys67Ser	95.0	0.0	.		80.0	47.0	.	NM_001122956	A4D2I9|B4DEM2|C9J7P1|P84070|Q6IAI8|Q96F30|Q96K74|Q9HBN8|Q9NR72	Missense_Mutation	SNP	ENST00000448521.1	hg19	CCDS34623.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.931604	0.92389	.	.	ENSG00000136279	ENST00000448521;ENST00000456905;ENST00000452943;ENST00000468694;ENST00000494774	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.15	5.15	0.70609	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	M	0.84846	2.72	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;1.0;0.999	T	0.71328	-0.4626	10	0.87932	D	0	-34.7951	14.6984	0.69139	0.0:0.0:0.0:1.0	.	15;67;67;67;67;67	B4DXL9;B4DDP6;B4DDD6;Q9UJU6-3;Q9UJU6;Q9UJU6-2	.;.;.;.;DBNL_HUMAN;.	S	67	ENSP00000411701:C67S;ENSP00000416421:C67S;ENSP00000405343:C67S;ENSP00000417653:C67S;ENSP00000419992:C67S	ENSP00000411701:C67S	C	+	1	0	DBNL	44058013	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.864000	0.87037	1.955000	0.56771	0.529000	0.55759	TGC	.	.	.	none		0.562	DBNL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339572.2	NM_014063	
TNS3	64759	hgsc.bcm.edu	37	7	47342974	47342974	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr7:47342974G>C	ENST00000398879.1	-	22	3397	c.3031C>G	c.(3031-3033)Ctg>Gtg	p.L1011V	TNS3_ENST00000311160.9_Missense_Mutation_p.L1011V|TNS3_ENST00000355730.3_Missense_Mutation_p.L771V			Q68CZ2	TENS3_HUMAN	tensin 3	1011					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GGAGGCGCCAGGGAGTCCGGT	0.672																																					p.L1011V		Atlas-SNP	.											.	TNS3	140	.	0			c.C3031G						PASS	.						20.0	24.0	23.0					7																	47342974		1966	4140	6106	SO:0001583	missense	64759	exon22			GCGCCAGGGAGTC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3031C>G	chr7.hg19:g.47342974G>C	ENSP00000381854:p.Leu1011Val	136.0	0.0	.		102.0	49.0	.	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	ENST00000398879.1	hg19	CCDS5506.2	.	.	.	.	.	.	.	.	.	.	G	1.723	-0.496178	0.04291	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	D;D;D;D	0.93811	-2.85;-2.85;-3.29;-3.0	5.44	1.6	0.23607	.	0.463335	0.18586	N	0.136878	D	0.84032	0.5383	L	0.34521	1.04	0.09310	N	0.999999	B	0.32573	0.376	B	0.27380	0.079	T	0.70730	-0.4792	10	0.18276	T	0.48	-13.2243	3.4749	0.07581	0.2793:0.0:0.5416:0.1791	.	1011	Q68CZ2	TENS3_HUMAN	V	1011;1121;1011;771;467;1114	ENSP00000312143:L1011V;ENSP00000381854:L1011V;ENSP00000347968:L771V;ENSP00000414358:L1114V	ENSP00000312143:L1011V	L	-	1	2	TNS3	47309499	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.334000	0.19787	0.263000	0.21812	0.555000	0.69702	CTG	.	.	.	none		0.672	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
ABCA13	154664	hgsc.bcm.edu	37	7	48390271	48390271	+	Silent	SNP	A	A	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr7:48390271A>T	ENST00000435803.1	+	30	10260	c.10236A>T	c.(10234-10236)gcA>gcT	p.A3412A		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3412					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTAACCATGCAGGCGCTGGAC	0.522																																					p.A3412A		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A10236T						PASS	.						154.0	155.0	154.0					7																	48390271		2051	4211	6262	SO:0001819	synonymous_variant	154664	exon30			CCATGCAGGCGCT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.10236A>T	chr7.hg19:g.48390271A>T		107.0	0.0	.		80.0	36.0	.	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	hg19	CCDS47584.1																																																																																			.	.	.	none		0.522	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
PPP2CB	5516	hgsc.bcm.edu	37	8	30651547	30651547	+	Silent	SNP	T	T	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr8:30651547T>A	ENST00000221138.4	-	5	1074	c.624A>T	c.(622-624)ggA>ggT	p.G208G	PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	208					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	AAATACCCCATCCACCACGAT	0.438																																					p.G208G		Atlas-SNP	.											.	PPP2CB	27	.	0			c.A624T						PASS	.						72.0	56.0	62.0					8																	30651547		2203	4300	6503	SO:0001819	synonymous_variant	5516	exon5			ACCCCATCCACCA		CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.624A>T	chr8.hg19:g.30651547T>A		323.0	0.0	.		333.0	32.0	.	NM_001009552	D3DSV4|P11082|Q6FHK5	Silent	SNP	ENST00000221138.4	hg19	CCDS6079.1																																																																																			.	.	.	none		0.438	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376527.2	NM_001009552	
PLEKHF2	79666	hgsc.bcm.edu	37	8	96167020	96167020	+	Nonstop_Mutation	SNP	T	T	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr8:96167020T>A	ENST00000315367.3	+	2	989	c.748T>A	c.(748-750)Taa>Aaa	p.*250K	PLEKHF2_ENST00000519516.1_Nonstop_Mutation_p.*250K	NM_024613.3	NP_078889.1	Q9H8W4	PKHF2_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 2	0					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)|transport vesicle (GO:0030133)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(1)|ovary(2)	5	Breast(36;3.18e-05)					TAGCAGTGACTAAGGACACAT	0.428																																					p.X250K		Atlas-SNP	.											.	PLEKHF2	32	.	0			c.T748A						PASS	.						63.0	61.0	62.0					8																	96167020		2203	4300	6503	SO:0001578	stop_lost	79666	exon2			AGTGACTAAGGAC	AF434819	CCDS6267.1	8q22.1	2013-01-10				ENSG00000175895		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20757	protein-coding gene	gene with protein product		615208					Standard	NM_024613		Approved	ZFYVE18, PHAFIN2, FLJ13187	uc003yhn.2	Q9H8W4		ENST00000315367.3:c.748T>A	chr8.hg19:g.96167020T>A	ENSP00000322373:p.*250Lysext*32	93.0	0.0	.		83.0	12.0	.	NM_024613		Missense_Mutation	SNP	ENST00000315367.3	hg19	CCDS6267.1	.	.	.	.	.	.	.	.	.	.	T	16.74	3.206693	0.58343	.	.	ENSG00000175895	ENST00000315367;ENST00000519516	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	.	.	.	K	250	.	.	X	+	1	0	PLEKHF2	96236196	1.000000	0.71417	0.999000	0.59377	0.770000	0.43624	7.385000	0.79763	2.367000	0.80283	0.528000	0.53228	TAA	.	.	.	none		0.428	PLEKHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379666.1	NM_024613	
PLEC	5339	hgsc.bcm.edu	37	8	144997632	144997632	+	Silent	SNP	C	C	G	rs376957701		TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr8:144997632C>G	ENST00000322810.4	-	31	7045	c.6876G>C	c.(6874-6876)gcG>gcC	p.A2292A	PLEC_ENST00000436759.2_Silent_p.A2182A|PLEC_ENST00000345136.3_Silent_p.A2155A|PLEC_ENST00000527096.1_Silent_p.A2178A|PLEC_ENST00000356346.3_Silent_p.A2141A|PLEC_ENST00000354958.2_Silent_p.A2133A|PLEC_ENST00000357649.2_Silent_p.A2159A|PLEC_ENST00000354589.3_Silent_p.A2155A|PLEC_ENST00000398774.2_Silent_p.A2123A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2292	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCCGCAGGGCCGCCTGCTCCG	0.687																																					p.A2292A		Atlas-SNP	.											.	PLEC	1144	.	0			c.G6876C						PASS	.						9.0	11.0	11.0					8																	144997632		2003	4078	6081	SO:0001819	synonymous_variant	5339	exon31			CAGGGCCGCCTGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6876G>C	chr8.hg19:g.144997632C>G		234.0	0.0	.		182.0	76.0	.	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	hg19	CCDS43772.1																																																																																			.	.	.	alt		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
FGD3	89846	hgsc.bcm.edu	37	9	95784642	95784642	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr9:95784642A>G	ENST00000375482.3	+	14	2024	c.1528A>G	c.(1528-1530)Acc>Gcc	p.T510A	FGD3_ENST00000538555.1_Missense_Mutation_p.T113A|FGD3_ENST00000337352.6_Missense_Mutation_p.T510A|FGD3_ENST00000416701.2_Missense_Mutation_p.T510A	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	510					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						GCCTGTGGTGACCACCGAAGG	0.632																																					p.T510A		Atlas-SNP	.											.	FGD3	116	.	0			c.A1528G						PASS	.						55.0	58.0	57.0					9																	95784642		2036	4171	6207	SO:0001583	missense	89846	exon14			GTGGTGACCACCG	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1528A>G	chr9.hg19:g.95784642A>G	ENSP00000364631:p.Thr510Ala	44.0	0.0	.		32.0	13.0	.	NM_001083536	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	ENST00000375482.3	hg19	CCDS43849.1	.	.	.	.	.	.	.	.	.	.	A	1.354	-0.590584	0.03799	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352;ENST00000538555	T;T;T;T	0.71817	-0.5;-0.5;-0.5;-0.6	4.27	2.16	0.27623	Zinc finger, FYVE/PHD-type (1);	1.877530	0.03443	N	0.209516	T	0.39172	0.1068	N	0.00926	-1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.41052	-0.9530	10	0.11182	T	0.66	.	5.0026	0.14271	0.1435:0.2066:0.6499:0.0	.	510;510	F8W7P2;Q5JSP0	.;FGD3_HUMAN	A	510;510;510;113	ENSP00000364631:T510A;ENSP00000413833:T510A;ENSP00000336914:T510A;ENSP00000442560:T113A	ENSP00000336914:T510A	T	+	1	0	FGD3	94824463	0.035000	0.19736	0.001000	0.08648	0.005000	0.04900	2.468000	0.45102	0.387000	0.25024	0.402000	0.26972	ACC	.	.	.	none		0.632	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086	
ANKS6	203286	hgsc.bcm.edu	37	9	101546300	101546300	+	Silent	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr9:101546300G>A	ENST00000353234.4	-	4	1094	c.1047C>T	c.(1045-1047)caC>caT	p.H349H	ANKS6_ENST00000540940.1_Silent_p.H154H|ANKS6_ENST00000375018.1_Silent_p.H349H|ANKS6_ENST00000375019.2_Silent_p.H48H			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	349						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				CAACATCCGCGTGCCTCTCCA	0.647																																					p.H349H		Atlas-SNP	.											.	ANKS6	59	.	0			c.C1047T						PASS	.						57.0	63.0	61.0					9																	101546300		2177	4270	6447	SO:0001819	synonymous_variant	203286	exon4			ATCCGCGTGCCTC	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1047C>T	chr9.hg19:g.101546300G>A		26.0	0.0	.		37.0	15.0	.	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Silent	SNP	ENST00000353234.4	hg19	CCDS43856.1																																																																																			.	.	.	none		0.647	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
ANKS6	203286	hgsc.bcm.edu	37	9	101552742	101552742	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr9:101552742A>G	ENST00000353234.4	-	2	553	c.506T>C	c.(505-507)tTt>tCt	p.F169S	ANKS6_ENST00000471846.1_5'UTR|ANKS6_ENST00000540940.1_5'UTR|ANKS6_ENST00000375018.1_Missense_Mutation_p.F169S|ANKS6_ENST00000375019.2_Intron			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	169						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				ATGGTCCACAAAGGCACCGGC	0.647																																					p.F169S		Atlas-SNP	.											.	ANKS6	59	.	0			c.T506C						PASS	.						26.0	33.0	31.0					9																	101552742		2057	4201	6258	SO:0001583	missense	203286	exon2			TCCACAAAGGCAC	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.506T>C	chr9.hg19:g.101552742A>G	ENSP00000297837:p.Phe169Ser	160.0	0.0	.		167.0	65.0	.	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	hg19	CCDS43856.1	.	.	.	.	.	.	.	.	.	.	A	1.456	-0.563751	0.03939	.	.	ENSG00000165138	ENST00000375018;ENST00000353234	T;T	0.62232	0.04;0.04	5.67	2.06	0.26882	Ankyrin repeat-containing domain (4);	0.555420	0.21506	N	0.073453	T	0.23688	0.0573	N	0.00456	-1.48	0.38197	D	0.940066	B	0.14012	0.009	B	0.21360	0.034	T	0.04454	-1.0950	10	0.17369	T	0.5	-1.109	7.859	0.29499	0.7534:0.0:0.2466:0.0	.	169	Q68DC2	ANKS6_HUMAN	S	169	ENSP00000364158:F169S;ENSP00000297837:F169S	ENSP00000297837:F169S	F	-	2	0	ANKS6	100592563	0.444000	0.25649	0.223000	0.23860	0.040000	0.13550	1.038000	0.30254	0.414000	0.25790	0.459000	0.35465	TTT	.	.	.	none		0.647	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
LRRC8A	56262	hgsc.bcm.edu	37	9	131669737	131669737	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr9:131669737G>C	ENST00000259324.5	+	3	817	c.294G>C	c.(292-294)aaG>aaC	p.K98N	LRRC8A_ENST00000372599.3_Missense_Mutation_p.K98N|LRRC8A_ENST00000372600.4_Missense_Mutation_p.K98N	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	98					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						CAGGCATCAAGTATGACCTGG	0.612																																					p.K98N		Atlas-SNP	.											.	LRRC8A	69	.	0			c.G294C						PASS	.						79.0	78.0	78.0					9																	131669737		2203	4300	6503	SO:0001583	missense	56262	exon3			CATCAAGTATGAC	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.294G>C	chr9.hg19:g.131669737G>C	ENSP00000259324:p.Lys98Asn	50.0	0.0	.		44.0	22.0	.	NM_001127244	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	ENST00000259324.5	hg19	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.203074	0.38905	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.34472	1.36;1.36;1.36	5.41	3.46	0.39613	Leucine-rich repeat-containing protein 8, N-terminal (1);	0.335130	0.36101	N	0.002800	T	0.25457	0.0619	L	0.38175	1.15	0.36156	D	0.847807	B	0.19706	0.038	B	0.23852	0.049	T	0.24657	-1.0154	10	0.72032	D	0.01	.	4.0417	0.09755	0.2627:0.1813:0.556:0.0	.	98	Q8IWT6	LRC8A_HUMAN	N	98	ENSP00000361682:K98N;ENSP00000361680:K98N;ENSP00000259324:K98N	ENSP00000259324:K98N	K	+	3	2	LRRC8A	130709558	0.997000	0.39634	1.000000	0.80357	0.956000	0.61745	0.459000	0.21908	1.281000	0.44480	0.563000	0.77884	AAG	.	.	.	none		0.612	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
LRRC8A	56262	hgsc.bcm.edu	37	9	131669746	131669746	+	Silent	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr9:131669746G>A	ENST00000259324.5	+	3	826	c.303G>A	c.(301-303)ctG>ctA	p.L101L	LRRC8A_ENST00000372599.3_Silent_p.L101L|LRRC8A_ENST00000372600.4_Silent_p.L101L	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	101					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						AGTATGACCTGGACCGGCACC	0.622																																					p.L101L		Atlas-SNP	.											.	LRRC8A	69	.	0			c.G303A						PASS	.						87.0	85.0	86.0					9																	131669746		2203	4300	6503	SO:0001819	synonymous_variant	56262	exon3			TGACCTGGACCGG	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.303G>A	chr9.hg19:g.131669746G>A		53.0	0.0	.		42.0	20.0	.	NM_001127244	Q6UXM2|Q8NCI0|Q9P2B1	Silent	SNP	ENST00000259324.5	hg19	CCDS35155.1																																																																																			.	.	.	none		0.622	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
LCN15	389812	hgsc.bcm.edu	37	9	139656704	139656705	+	Missense_Mutation	DNP	GG	GG	CC			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr9:139656704_139656705GG>CC	ENST00000316144.5	-	5	479_480	c.455_456CC>GG	c.(454-456)tCC>tGG	p.S152W	LCN15_ENST00000482511.1_5'UTR	NM_203347.1	NP_976222.1	Q6UWW0	LCN15_HUMAN	lipocalin 15	152			S -> A (in dbSNP:rs2297723).		lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)|transporter activity (GO:0005215)			endometrium(1)|lung(1)	2						AGTCCTGGAAGGACTTCAGAGC	0.649																																					p.S152S|p.S152C		Atlas-SNP	.											.	LCN15	11	.	0			c.C456G|c.C455G						PASS	.																																			SO:0001583	missense	389812	exon5			CTGGAAGGACTTC|TGGAAGGACTTCA		CCDS7006.1	9q34.3	2011-10-24			ENSG00000177984	ENSG00000177984		"""Lipocalins"""	33777	protein-coding gene	gene with protein product							Standard	NM_203347		Approved	UNQ2541, PRO6093	uc004cjd.3	Q6UWW0	OTTHUMG00000020943	ENST00000316144.5:c.455_456delinsCC	chr9.hg19:g.139656704_139656705delinsCC	ENSP00000313833:p.Ser152Trp	243.0|242.0	0.0	.		234.0|231.0	105.0|103.0	.	NM_203347		Silent|Missense_Mutation	SNP	ENST00000316144.5	hg19	CCDS7006.1																																																																																			.	.	.	none		0.649	LCN15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055114.2	NM_203347	
ZNF195	7748	hgsc.bcm.edu	37	11	3380399	3380399	+	Silent	SNP	T	T	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr11:3380399T>C	ENST00000399602.4	-	6	1965	c.1839A>G	c.(1837-1839)aaA>aaG	p.K613K	ZNF195_ENST00000429541.2_Silent_p.K545K|ZNF195_ENST00000354599.6_Silent_p.K541K|ZNF195_ENST00000343338.7_Silent_p.K545K|ZNF195_ENST00000526601.1_Silent_p.K594K|ZNF195_ENST00000005082.9_Silent_p.K590K|ZNF195_ENST00000528796.1_Intron	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	613					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGGTGAAGGCTTTGCCACACT	0.378																																					p.K613K		Atlas-SNP	.											.	ZNF195	77	.	0			c.A1839G						PASS	.						63.0	65.0	64.0					11																	3380399		2026	4209	6235	SO:0001819	synonymous_variant	7748	exon6			GAAGGCTTTGCCA		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1839A>G	chr11.hg19:g.3380399T>C		87.0	0.0	.		68.0	34.0	.	NM_001130520	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	hg19	CCDS44522.1																																																																																			.	.	.	none		0.378	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2		
SMPD1	6609	hgsc.bcm.edu	37	11	6411960	6411960	+	Silent	SNP	G	G	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr11:6411960G>T	ENST00000342245.4	+	1	300	c.132G>T	c.(130-132)gcG>gcT	p.A44A	SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000527275.1_Silent_p.A44A|SMPD1_ENST00000299397.3_Silent_p.A44A|SMPD1_ENST00000356761.2_Silent_p.A44A	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	44					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	tggcgctggcgctggcgctgg	0.692																																					p.A44A		Atlas-SNP	.											.	SMPD1	108	.	0			c.G132T						PASS	.						19.0	22.0	21.0					11																	6411960		2199	4295	6494	SO:0001819	synonymous_variant	6609	exon1			GCTGGCGCTGGCG	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.132G>T	chr11.hg19:g.6411960G>T		125.0	0.0	.		87.0	6.0	.	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Silent	SNP	ENST00000342245.4	hg19	CCDS44531.1																																																																																			.	.	.	none		0.692	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
NDUFS8	4728	hgsc.bcm.edu	37	11	67800585	67800585	+	Silent	SNP	C	C	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr11:67800585C>A	ENST00000313468.5	+	5	314	c.207C>A	c.(205-207)ggC>ggA	p.G69G	NDUFS8_ENST00000528492.1_Intron|MIR4691_ENST00000583764.1_RNA|RP5-901A4.1_ENST00000532296.1_RNA	NM_002496.3	NP_002487.1	O00217	NDUS8_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)	69					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|lung(5)|skin(1)	8						CAGGCCTGGGCATGACCCTGA	0.692																																					p.G69G	Colon(116;1205 2770 20054)	Atlas-SNP	.											.	NDUFS8	18	.	0			c.C207A						PASS	.						49.0	46.0	47.0					11																	67800585		2200	4294	6494	SO:0001819	synonymous_variant	4728	exon5			CCTGGGCATGACC	U65579	CCDS8176.1	11q13.2	2011-07-04	2002-08-29		ENSG00000110717	ENSG00000110717	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7715	protein-coding gene	gene with protein product	"""complex I 23kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial"""	602141	"""NADH dehydrogenase (ubiquinone) Fe-S protein 8 (23kD) (NADH-coenzyme Q reductase)"""			9666055, 9116042	Standard	NM_002496		Approved	TYKY, CI-23k	uc001onc.3	O00217	OTTHUMG00000167331	ENST00000313468.5:c.207C>A	chr11.hg19:g.67800585C>A		152.0	0.0	.		144.0	55.0	.	NM_002496	B2RB86|Q0VDA8	Silent	SNP	ENST00000313468.5	hg19	CCDS8176.1																																																																																			.	.	.	none		0.692	NDUFS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394193.1	NM_002496	
CCDC81	60494	hgsc.bcm.edu	37	11	86125892	86125892	+	Silent	SNP	A	A	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr11:86125892A>C	ENST00000445632.2	+	12	1725	c.1453A>C	c.(1453-1455)Aga>Cga	p.R485R	CCDC81_ENST00000278487.3_Silent_p.R220R|CCDC81_ENST00000528728.1_Silent_p.R220R|CCDC81_ENST00000354755.1_Silent_p.R395R	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	485										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				GTGTTACAAGAGAGCTTTGGA	0.348																																					p.R485R		Atlas-SNP	.											.	CCDC81	89	.	0			c.A1453C						PASS	.						62.0	60.0	61.0					11																	86125892		2202	4299	6501	SO:0001819	synonymous_variant	60494	exon12			TACAAGAGAGCTT	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1453A>C	chr11.hg19:g.86125892A>C		123.0	0.0	.		181.0	67.0	.	NM_001156474	A0AVL7|Q53FW3|Q9H5E5	Silent	SNP	ENST00000445632.2	hg19	CCDS53691.1																																																																																			.	.	.	none		0.348	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1	NM_021827	
PRICKLE1	144165	hgsc.bcm.edu	37	12	42854000	42854000	+	Silent	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr12:42854000G>A	ENST00000455697.1	-	8	2392	c.2107C>T	c.(2107-2109)Ctg>Ttg	p.L703L	PRICKLE1_ENST00000548696.1_Silent_p.L703L|PRICKLE1_ENST00000345127.3_Silent_p.L703L|PRICKLE1_ENST00000445766.2_Silent_p.L703L|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000552240.1_Silent_p.L703L	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	703					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		GGGGTGTACAGCCGCAGTCTG	0.493																																					p.L703L		Atlas-SNP	.											.	PRICKLE1	105	.	0			c.C2107T						PASS	.						72.0	73.0	73.0					12																	42854000		2203	4300	6503	SO:0001819	synonymous_variant	144165	exon8			TGTACAGCCGCAG	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.2107C>T	chr12.hg19:g.42854000G>A		113.0	0.0	.		111.0	49.0	.	NM_001144882	Q14C83|Q71QF8|Q96N00	Silent	SNP	ENST00000455697.1	hg19	CCDS8742.1																																																																																			.	.	.	none		0.493	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
HOXC8	3224	hgsc.bcm.edu	37	12	54403214	54403214	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr12:54403214T>A	ENST00000040584.4	+	1	383	c.146T>A	c.(145-147)tTc>tAc	p.F49Y	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	49					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						GCGCCCGGCTTCCAGCACGCT	0.662																																					p.F49Y	GBM(197;701 2226 7002 18822 41696)	Atlas-SNP	.											.	HOXC8	15	.	0			c.T146A						PASS	.						80.0	92.0	88.0					12																	54403214		2203	4300	6503	SO:0001583	missense	3224	exon1			CCGGCTTCCAGCA	X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.146T>A	chr12.hg19:g.54403214T>A	ENSP00000040584:p.Phe49Tyr	111.0	0.0	.		78.0	30.0	.	NM_022658	A8K4J4|O15221|O15362	Missense_Mutation	SNP	ENST00000040584.4	hg19	CCDS8870.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760497	0.89932	.	.	ENSG00000037965	ENST00000040584	T	0.46819	0.86	3.95	3.95	0.45737	.	0.000000	0.85682	D	0.000000	T	0.68375	0.2994	M	0.87456	2.885	0.53688	D	0.999973	D	0.63880	0.993	D	0.67548	0.952	T	0.70784	-0.4778	10	0.34782	T	0.22	.	12.0911	0.53726	0.0:0.0:0.0:1.0	.	49	P31273	HXC8_HUMAN	Y	49	ENSP00000040584:F49Y	ENSP00000040584:F49Y	F	+	2	0	HOXC8	52689481	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.152000	0.58111	1.551000	0.49450	0.379000	0.24179	TTC	.	.	.	none		0.662	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358957.2		
BRCA2	675	hgsc.bcm.edu	37	13	32907282	32907282	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr13:32907282A>G	ENST00000380152.3	+	10	1900	c.1667A>G	c.(1666-1668)aAt>aGt	p.N556S	BRCA2_ENST00000544455.1_Missense_Mutation_p.N556S			P51587	BRCA2_HUMAN	breast cancer 2, early onset	556					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTATGTCCAAATTTAATTGAT	0.373			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.N556S	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.A1667G						PASS	.						70.0	78.0	76.0					13																	32907282		2203	4300	6503	SO:0001583	missense	675	exon10	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	GTCCAAATTTAAT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.1667A>G	chr13.hg19:g.32907282A>G	ENSP00000369497:p.Asn556Ser	317.0	0.0	.		251.0	104.0	.	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	hg19	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.485706	0.00163	.	.	ENSG00000139618	ENST00000380152;ENST00000544455;ENST00000530893	T;T	0.00664	5.92;5.92	5.5	1.21	0.21127	.	0.434585	0.24740	N	0.035995	T	0.00271	0.0008	N	0.00621	-1.32	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45731	-0.9241	10	0.02654	T	1	.	6.3438	0.21337	0.5377:0.0:0.4623:0.0	.	556;556	P51587;A1YBP1	BRCA2_HUMAN;.	S	556;556;554	ENSP00000369497:N556S;ENSP00000439902:N556S	ENSP00000369497:N556S	N	+	2	0	BRCA2	31805282	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.070000	0.11523	0.362000	0.24319	-0.248000	0.11899	AAT	.	.	.	none		0.373	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
SNW1	22938	hgsc.bcm.edu	37	14	78184510	78184510	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr14:78184510T>C	ENST00000261531.7	-	14	1594	c.1532A>G	c.(1531-1533)cAt>cGt	p.H511R	SNW1_ENST00000555761.1_Missense_Mutation_p.M538V|SNW1_ENST00000554775.1_Missense_Mutation_p.H349R|SLIRP_ENST00000557431.1_Intron|SLIRP_ENST00000557623.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	511					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		AGAGCCACCATGCTGTTTGGC	0.498																																					p.H511R		Atlas-SNP	.											.	SNW1	44	.	0			c.A1532G						PASS	.						181.0	184.0	183.0					14																	78184510		2203	4300	6503	SO:0001583	missense	22938	exon14			CCACCATGCTGTT	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.1532A>G	chr14.hg19:g.78184510T>C	ENSP00000261531:p.His511Arg	113.0	0.0	.		88.0	34.0	.	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	hg19	CCDS9867.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.67|11.67	1.706995|1.706995	0.30232|0.30232	.|.	.|.	ENSG00000100603|ENSG00000100603	ENST00000261531;ENST00000554775|ENST00000555761	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33818|0.33818	0.0876|0.0876	N|N	0.08118|0.08118	0|0	0.33515|0.33515	D|D	0.591654|0.591654	P|B	0.50156|0.06786	0.932|0.001	P|B	0.58520|0.11329	0.84|0.006	T|T	0.37842|0.37842	-0.9688|-0.9688	9|7	0.40728|.	T|.	0.16|.	.|.	15.9314|15.9314	0.79663|0.79663	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	511|538	Q13573|G3V3A4	SNW1_HUMAN|.	R|V	511;349|538	.|.	ENSP00000261531:H511R|.	H|M	-|-	2|1	0|0	SNW1|SNW1	77254263|77254263	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.989000|0.989000	0.77384|0.77384	7.431000|7.431000	0.80335|0.80335	2.176000|2.176000	0.68965|0.68965	0.383000|0.383000	0.25322|0.25322	CAT|ATG	.	.	.	none		0.498	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
PML	5371	hgsc.bcm.edu	37	15	74315345	74315345	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr15:74315345A>C	ENST00000268058.3	+	3	875	c.779A>C	c.(778-780)cAg>cCg	p.Q260P	PML_ENST00000436891.3_Missense_Mutation_p.Q260P|PML_ENST00000359928.4_Missense_Mutation_p.Q260P|PML_ENST00000567543.1_Missense_Mutation_p.Q260P|PML_ENST00000395132.2_Missense_Mutation_p.Q260P|PML_ENST00000564428.1_Missense_Mutation_p.Q260P|PML_ENST00000569965.1_Missense_Mutation_p.Q260P|PML_ENST00000354026.6_Missense_Mutation_p.Q260P|PML_ENST00000563500.1_Missense_Mutation_p.Q260P|PML_ENST00000565898.1_Missense_Mutation_p.Q260P|PML_ENST00000395135.3_Missense_Mutation_p.Q260P|PML_ENST00000268059.6_Missense_Mutation_p.Q260P|PML_ENST00000435786.2_Missense_Mutation_p.Q260P|PML_ENST00000569161.1_3'UTR|PML_ENST00000569477.1_Missense_Mutation_p.Q260P	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	260					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GTTCACGCGCAGATGCACGCG	0.697			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.Q260P		Atlas-SNP	.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML	169	.	0			c.A779C						PASS	.						19.0	17.0	17.0					15																	74315345		2189	4289	6478	SO:0001583	missense	5371	exon3			ACGCGCAGATGCA	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.779A>C	chr15.hg19:g.74315345A>C	ENSP00000268058:p.Gln260Pro	37.0	0.0	.		48.0	14.0	.	NM_033250	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	hg19	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.861866	0.32884	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	T	0.50277	0.75	4.93	3.81	0.43845	.	0.993173	0.08176	N	0.986262	T	0.60340	0.2261	M	0.61703	1.905	0.09310	N	1	D;P;P;P;P;P;P;D;P;P;P;D;P	0.63880	0.993;0.915;0.91;0.666;0.938;0.727;0.784;0.985;0.89;0.89;0.61;0.993;0.769	P;P;P;B;P;B;P;P;P;P;B;P;P	0.61592	0.843;0.571;0.663;0.348;0.555;0.251;0.478;0.777;0.527;0.628;0.346;0.891;0.46	T	0.42965	-0.9420	10	0.72032	D	0.01	-14.2634	5.078	0.14642	0.7206:0.1838:0.0956:0.0	.	260;210;260;260;260;260;260;260;260;260;260;260;263	P29590-3;Q59GQ8;P29590;P29590-11;P29590-12;P29590-5;E9PBR7;P29590-13;P29590-4;P29590-2;P29590-14;P29590-8;Q59H09	.;.;PML_HUMAN;.;.;.;.;.;.;.;.;.;.	P	260	ENSP00000268058:Q260P	ENSP00000268058:Q260P	Q	+	2	0	PML	72102398	0.018000	0.18449	0.003000	0.11579	0.164000	0.22412	0.479000	0.22228	0.746000	0.32786	0.260000	0.18958	CAG	.	.	.	none		0.697	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
PDXDC1	23042	hgsc.bcm.edu	37	16	15110996	15110996	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr16:15110996G>A	ENST00000396410.4	+	10	929	c.832G>A	c.(832-834)Gct>Act	p.A278T	PDXDC1_ENST00000455313.2_Missense_Mutation_p.A255T|PDXDC1_ENST00000447912.2_Missense_Mutation_p.A187T|PDXDC1_ENST00000535621.2_Missense_Mutation_p.A278T|PDXDC1_ENST00000563679.1_Missense_Mutation_p.A296T|PDXDC1_ENST00000569715.1_Missense_Mutation_p.A251T|PDXDC1_ENST00000325823.7_Missense_Mutation_p.A263T|RP11-680G24.5_ENST00000565178.1_RNA|PDXDC1_ENST00000450288.2_Missense_Mutation_p.A250T	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	278					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGCAACATTGGCTCTGGGTTA	0.373																																					p.A278T		Atlas-SNP	.											.	PDXDC1	59	.	0			c.G832A						PASS	.						300.0	304.0	303.0					16																	15110996		2197	4300	6497	SO:0001583	missense	23042	exon10			ACATTGGCTCTGG	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.832G>A	chr16.hg19:g.15110996G>A	ENSP00000379691:p.Ala278Thr	111.0	0.0	.		142.0	40.0	.	NM_015027	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Missense_Mutation	SNP	ENST00000396410.4	hg19	CCDS32393.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.539966	0.85917	.	.	ENSG00000179889	ENST00000325823;ENST00000447912;ENST00000535621;ENST00000396410;ENST00000450288;ENST00000455313	T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74	5.45	5.45	0.79879	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.098174	0.64402	D	0.000001	T	0.44159	0.1280	L	0.45698	1.435	0.54753	D	0.999982	D;D;D;D;D;P	0.71674	0.998;0.997;0.986;0.998;0.998;0.55	D;D;P;D;D;B	0.70716	0.966;0.97;0.883;0.966;0.966;0.426	T	0.07177	-1.0786	10	0.27082	T	0.32	-14.2336	18.2726	0.90073	0.0:0.0:1.0:0.0	.	250;187;278;250;278;255	E7EPL4;E7EMH5;Q86XE2;B4DR55;Q6P996;Q6P996-2	.;.;.;.;PDXD1_HUMAN;.	T	263;187;278;278;250;255	ENSP00000322807:A263T;ENSP00000400310:A187T;ENSP00000437835:A278T;ENSP00000379691:A278T;ENSP00000391147:A250T;ENSP00000406703:A255T	ENSP00000322807:A263T	A	+	1	0	PDXDC1	15018497	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.905000	0.87416	2.546000	0.85860	0.542000	0.68232	GCT	.	.	.	none		0.373	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
GLG1	2734	hgsc.bcm.edu	37	16	74491772	74491772	+	Splice_Site	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr16:74491772G>A	ENST00000422840.2	-	24	3264	c.3265C>T	c.(3265-3267)Caa>Taa	p.Q1089*	RNU6-237P_ENST00000515985.1_RNA|GLG1_ENST00000447066.2_Splice_Site_p.Q1078*|GLG1_ENST00000205061.5_Splice_Site_p.Q1089*	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	1089					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						AGAGACTTACGACGCCCGCGG	0.517																																					p.Q1089X		Atlas-SNP	.											.	GLG1	106	.	0			c.C3265T						PASS	.						124.0	113.0	117.0					16																	74491772		2198	4300	6498	SO:0001630	splice_region_variant	2734	exon24			ACTTACGACGCCC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.3265+1C>T	chr16.hg19:g.74491772G>A		103.0	0.0	.		108.0	66.0	.	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Nonsense_Mutation	SNP	ENST00000422840.2	hg19	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	G	43	10.072459	0.99330	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.8	5.8	0.92144	.	0.051884	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.3892	20.051	0.97627	0.0:0.0:1.0:0.0	.	.	.	.	X	1089;1078;1089	.	.	Q	-	1	0	GLG1	73049273	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.476000	0.97823	2.740000	0.93945	0.650000	0.86243	CAA	.	.	.	none		0.517	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	Nonsense_Mutation
PLCG2	5336	hgsc.bcm.edu	37	16	81965133	81965133	+	Silent	SNP	C	C	G			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr16:81965133C>G	ENST00000359376.3	+	25	2827	c.2613C>G	c.(2611-2613)tcC>tcG	p.S871S		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	871					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						ACCAGAAGTCCTTTGTCTTCA	0.527																																					p.S871S		Atlas-SNP	.											.	PLCG2	276	.	0			c.C2613G						PASS	.						72.0	77.0	75.0					16																	81965133		1897	4116	6013	SO:0001819	synonymous_variant	5336	exon25			GAAGTCCTTTGTC		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.2613C>G	chr16.hg19:g.81965133C>G		100.0	0.0	.		118.0	8.0	.	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Silent	SNP	ENST00000359376.3	hg19	CCDS42204.1																																																																																			.	.	.	none		0.527	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
GPATCH8	23131	hgsc.bcm.edu	37	17	42476063	42476063	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr17:42476063G>A	ENST00000591680.1	-	8	3412	c.3382C>T	c.(3382-3384)Caa>Taa	p.Q1128*	GPATCH8_ENST00000434000.1_Nonsense_Mutation_p.Q1050*	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1128							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		AAGTAACCTTGTGGGGGGTCC	0.547																																					p.Q1128X		Atlas-SNP	.											.	GPATCH8	114	.	0			c.C3382T						PASS	.						109.0	109.0	109.0					17																	42476063		2203	4300	6503	SO:0001587	stop_gained	23131	exon8			AACCTTGTGGGGG	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.3382C>T	chr17.hg19:g.42476063G>A	ENSP00000467556:p.Gln1128*	67.0	0.0	.		59.0	28.0	.	NM_001002909	B9EGP9|O60300|Q8TB99	Nonsense_Mutation	SNP	ENST00000591680.1	hg19	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	G	38	7.074636	0.98044	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-16.8599	18.4809	0.90811	0.0:0.0:1.0:0.0	.	.	.	.	X	1128;1050	.	ENSP00000335486:Q1128X	Q	-	1	0	GPATCH8	39831589	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.263000	0.95617	2.602000	0.87976	0.650000	0.86243	CAA	.	.	.	none		0.547	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
MYL4	4635	hgsc.bcm.edu	37	17	45299172	45299172	+	Silent	SNP	C	C	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr17:45299172C>T	ENST00000354968.1	+	5	566	c.438C>T	c.(436-438)agC>agT	p.S146S	MYL4_ENST00000393450.1_Silent_p.S146S|snoU13_ENST00000516279.1_RNA|MYL4_ENST00000572316.1_Silent_p.S146S	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	146	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)			endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						ACAAGGAGAGCAATGGCACGG	0.587																																					p.S146S		Atlas-SNP	.											.	MYL4	27	.	0			c.C438T						PASS	.						131.0	101.0	111.0					17																	45299172		2203	4300	6503	SO:0001819	synonymous_variant	4635	exon5			GGAGAGCAATGGC		CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.438C>T	chr17.hg19:g.45299172C>T		62.0	0.0	.		58.0	18.0	.	NM_001002841	D3DXJ7|P11783	Silent	SNP	ENST00000354968.1	hg19	CCDS11510.1																																																																																			.	.	.	none		0.587	MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841	
BPTF	2186	hgsc.bcm.edu	37	17	65916183	65916183	+	Silent	SNP	T	T	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr17:65916183T>C	ENST00000321892.4	+	15	5920	c.5859T>C	c.(5857-5859)gtT>gtC	p.V1953V	BPTF_ENST00000424123.3_Silent_p.V1814V|BPTF_ENST00000335221.5_Silent_p.V1953V|BPTF_ENST00000306378.6_Silent_p.V1827V			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1953					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGAGAGATGTTGGTCCTTATG	0.323																																					p.V1953V		Atlas-SNP	.											.	BPTF	415	.	0			c.T5859C						PASS	.						138.0	142.0	141.0					17																	65916183		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon15			AGATGTTGGTCCT	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.5859T>C	chr17.hg19:g.65916183T>C		89.0	0.0	.		75.0	25.0	.	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	hg19																																																																																				.	.	.	none		0.323	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
UBE2O	63893	hgsc.bcm.edu	37	17	74449137	74449137	+	Silent	SNP	G	G	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr17:74449137G>A	ENST00000319380.7	-	1	151	c.87C>T	c.(85-87)gcC>gcT	p.A29A	AANAT_ENST00000250615.3_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	29	Ala-rich.				positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						cgggggctgcggctggggccg	0.781																																					p.A29A		Atlas-SNP	.											.	UBE2O	207	.	0			c.C87T						PASS	.						1.0	1.0	1.0					17																	74449137		533	1169	1702	SO:0001819	synonymous_variant	63893	exon1			GGCTGCGGCTGGG	AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.87C>T	chr17.hg19:g.74449137G>A		53.0	0.0	.		48.0	23.0	.	NM_022066	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Silent	SNP	ENST00000319380.7	hg19	CCDS32742.1																																																																																			.	.	.	none		0.781	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450123.1	NM_022066	
SH2D3A	10045	hgsc.bcm.edu	37	19	6760717	6760717	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr19:6760717C>A	ENST00000245908.6	-	3	620	c.351G>T	c.(349-351)caG>caT	p.Q117H	SH2D3A_ENST00000437152.3_Intron|SH2D3A_ENST00000599563.1_5'UTR	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	117					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						GCAGAGGCCCCTGCCAAGTCA	0.602																																					p.Q117H		Atlas-SNP	.											.	SH2D3A	53	.	0			c.G351T						PASS	.						44.0	43.0	43.0					19																	6760717		2203	4300	6503	SO:0001583	missense	10045	exon3			AGGCCCCTGCCAA	AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.351G>T	chr19.hg19:g.6760717C>A	ENSP00000245908:p.Gln117His	98.0	0.0	.		72.0	28.0	.	NM_005490	A8K9R6|B4DRS7|Q9Y2X4	Missense_Mutation	SNP	ENST00000245908.6	hg19	CCDS12173.1	.	.	.	.	.	.	.	.	.	.	C	7.064	0.566967	0.13560	.	.	ENSG00000125731	ENST00000245908	T	0.15256	2.44	4.97	1.25	0.21368	.	0.365819	0.20012	N	0.101107	T	0.10723	0.0262	L	0.39898	1.24	0.09310	N	1	B	0.11235	0.004	B	0.15052	0.012	T	0.23940	-1.0174	10	0.49607	T	0.09	-11.0037	0.6632	0.00846	0.1949:0.3795:0.1695:0.2561	.	117	Q9BRG2	SH23A_HUMAN	H	117	ENSP00000245908:Q117H	ENSP00000245908:Q117H	Q	-	3	2	SH2D3A	6711717	0.000000	0.05858	0.065000	0.19835	0.429000	0.31625	-0.503000	0.06383	0.533000	0.28675	-0.263000	0.10527	CAG	.	.	.	none		0.602	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458016.1	NM_005490	
HSD17B14	51171	hgsc.bcm.edu	37	19	49316726	49316726	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr19:49316726C>G	ENST00000263278.4	-	8	892	c.626G>C	c.(625-627)gGc>gCc	p.G209A	BCAT2_ENST00000598162.1_5'Flank|HSD17B14_ENST00000599157.1_Missense_Mutation_p.G185A|BCAT2_ENST00000316273.6_5'Flank|BCAT2_ENST00000545387.2_5'Flank|BCAT2_ENST00000402551.1_5'Flank|BCAT2_ENST00000601496.1_5'Flank|BCAT2_ENST00000599246.1_5'Flank|BCAT2_ENST00000597011.1_5'Flank	NM_016246.2	NP_057330.2	Q9BPX1	DHB14_HUMAN	hydroxysteroid (17-beta) dehydrogenase 14	209					steroid catabolic process (GO:0006706)	cytosol (GO:0005829)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			large_intestine(3)|lung(1)|skin(1)	5		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		GGCCAGCATGCCCTCTCGGAT	0.607																																					p.G209A		Atlas-SNP	.											.	HSD17B14	25	.	0			c.G626C						PASS	.						76.0	54.0	61.0					19																	49316726		2203	4299	6502	SO:0001583	missense	51171	exon8			AGCATGCCCTCTC	AF126781	CCDS12736.1	19q13.33	2011-09-14	2006-11-22	2006-11-22		ENSG00000087076		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	23238	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 3"", ""short chain dehydrogenase/reductase family 47C, member 1"""	612832	"""dehydrogenase/reductase (SDR family) member 10"""	DHRS10		10800688, 17067289, 19027726	Standard	XM_005258969		Approved	retSDR3, SDR47C1	uc002pkv.1	Q9BPX1		ENST00000263278.4:c.626G>C	chr19.hg19:g.49316726C>G	ENSP00000263278:p.Gly209Ala	64.0	0.0	.		67.0	20.0	.	NM_016246	Q9UKU3	Missense_Mutation	SNP	ENST00000263278.4	hg19	CCDS12736.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700653	0.48307	.	.	ENSG00000087076	ENST00000263278	T	0.20200	2.09	4.43	2.25	0.28309	NAD(P)-binding domain (1);	0.190085	0.43747	N	0.000525	T	0.11707	0.0285	N	0.01197	-0.965	0.47094	D	0.999316	D	0.71674	0.998	P	0.61003	0.882	T	0.18241	-1.0343	10	0.16420	T	0.52	.	7.2282	0.26028	0.0:0.7222:0.1783:0.0996	.	209	Q9BPX1	DHB14_HUMAN	A	209	ENSP00000263278:G209A	ENSP00000263278:G209A	G	-	2	0	HSD17B14	54008538	0.875000	0.30112	0.307000	0.25127	0.408000	0.30992	2.277000	0.43417	1.124000	0.41980	0.462000	0.41574	GGC	.	.	.	none		0.607	HSD17B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466212.1	NM_016246	
ZNF836	162962	hgsc.bcm.edu	37	19	52663822	52663822	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr19:52663822A>T	ENST00000322146.8	-	4	559	c.38T>A	c.(37-39)gTa>gAa	p.V13E	ZNF836_ENST00000597065.1_Missense_Mutation_p.V13E|CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Missense_Mutation_p.V13E	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	13	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TTCTATGGCTACATCCCTGAA	0.438																																					p.V13E		Atlas-SNP	.											.	ZNF836	158	.	0			c.T38A						PASS	.						89.0	95.0	93.0					19																	52663822		2202	4300	6502	SO:0001583	missense	162962	exon4			ATGGCTACATCCC	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.38T>A	chr19.hg19:g.52663822A>T	ENSP00000325038:p.Val13Glu	71.0	0.0	.		48.0	15.0	.	NM_001102657		Missense_Mutation	SNP	ENST00000322146.8	hg19	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.674755	0.29783	.	.	ENSG00000196267	ENST00000322146	T	0.10477	2.87	1.99	1.99	0.26369	Krueppel-associated box (4);	.	.	.	.	T	0.30510	0.0767	H	0.99090	4.425	0.18873	N	0.999988	B	0.30236	0.274	B	0.32805	0.153	T	0.37009	-0.9724	9	0.87932	D	0	.	7.554	0.27814	1.0:0.0:0.0:0.0	.	13	Q6ZNA1	ZN836_HUMAN	E	13	ENSP00000325038:V13E	ENSP00000325038:V13E	V	-	2	0	ZNF836	57355634	0.924000	0.31332	0.451000	0.26982	0.975000	0.68041	1.321000	0.33678	0.897000	0.36392	0.358000	0.22013	GTA	.	.	.	none		0.438	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
CFAP61	26074	hgsc.bcm.edu	37	20	20226857	20226857	+	Silent	SNP	C	C	T	rs114266049	byFrequency	TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr20:20226857C>T	ENST00000245957.5	+	19	2233	c.2157C>T	c.(2155-2157)agC>agT	p.S719S	C20orf26_ENST00000377293.1_Silent_p.S75S|C20orf26_ENST00000389656.3_Silent_p.S75S|C20orf26_ENST00000377309.2_Silent_p.S75S	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		719										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TTTTAGCCAGCGAGTATGAAT	0.358																																					p.S719S		Atlas-SNP	.											.	C20orf26	188	.	0			c.C2157T						PASS	.						75.0	83.0	80.0					20																	20226857		2203	4300	6503	SO:0001819	synonymous_variant	26074	exon19			AGCCAGCGAGTAT																												ENST00000245957.5:c.2157C>T	chr20.hg19:g.20226857C>T		205.0	0.0	.		215.0	66.0	.	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	ENST00000245957.5	hg19	CCDS33447.1																																																																																			.	C|0.994;A|0.006	.	alt		0.358	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
PPIL2	23759	hgsc.bcm.edu	37	22	22024222	22024222	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr22:22024222A>T	ENST00000335025.8	+	2	144	c.53A>T	c.(52-54)tAc>tTc	p.Y18F	PPIL2_ENST00000412327.1_Missense_Mutation_p.Y18F|PPIL2_ENST00000456792.2_Missense_Mutation_p.Y18F|PPIL2_ENST00000492445.2_Missense_Mutation_p.Y18F|PPIL2_ENST00000398831.3_Missense_Mutation_p.Y18F|PPIL2_ENST00000406385.1_Missense_Mutation_p.Y18F					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					TGTGCTGAATACACTCACTTT	0.448																																					p.Y18F		Atlas-SNP	.											.	PPIL2	38	.	0			c.A53T						PASS	.						199.0	161.0	174.0					22																	22024222		2203	4300	6503	SO:0001583	missense	23759	exon2			CTGAATACACTCA		CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.53A>T	chr22.hg19:g.22024222A>T	ENSP00000334553:p.Tyr18Phe	82.0	0.0	.		76.0	39.0	.	NM_014337		Missense_Mutation	SNP	ENST00000335025.8	hg19	CCDS13793.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.494928	0.64186	.	.	ENSG00000100023	ENST00000412327;ENST00000335025;ENST00000398831;ENST00000492445;ENST00000458567;ENST00000406385;ENST00000456792	T;T;T;T;T;T	0.28454	1.66;1.7;1.7;1.7;1.7;1.61	4.39	4.39	0.52855	.	0.071138	0.64402	D	0.000017	T	0.34890	0.0913	L	0.59436	1.845	0.50632	D	0.999883	P;P;P	0.47409	0.61;0.868;0.895	B;P;B	0.46299	0.219;0.511;0.313	T	0.22591	-1.0212	10	0.87932	D	0	.	10.2502	0.43364	1.0:0.0:0.0:0.0	.	18;18;18	E7EW80;Q13356-2;Q13356	.;.;PPIL2_HUMAN	F	18;18;18;18;49;18;18	ENSP00000390427:Y18F;ENSP00000334553:Y18F;ENSP00000381812:Y18F;ENSP00000445312:Y18F;ENSP00000384299:Y18F;ENSP00000396228:Y18F	ENSP00000334553:Y18F	Y	+	2	0	PPIL2	20354222	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	4.011000	0.57124	1.974000	0.57490	0.456000	0.33151	TAC	.	.	.	none		0.448	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075028.4		
DENND1C	79958	hgsc.bcm.edu	37	19	6468935	6468936	+	Frame_Shift_Ins	INS	-	-	C			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr19:6468935_6468936insC	ENST00000381480.2	-	20	1548_1549	c.1436_1437insG	c.(1435-1437)ggcfs	p.G479fs	DENND1C_ENST00000543576.1_Frame_Shift_Ins_p.G435fs	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	479					positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						CCCTCAGAGAGCCCCCCCTCTG	0.624																																					p.G479fs		Atlas-Indel,Pindel	.											.	DENND1C	93	.	0			c.1437_1438insG						PASS	.																																			SO:0001589	frameshift_variant	79958	exon20			.	AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.1437dupG	chr19.hg19:g.6468942_6468942dupC	ENSP00000370889:p.Gly479fs	47.0	0.0	0		56.0	20.0	0.357143	NM_024898	B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Frame_Shift_Ins	INS	ENST00000381480.2	hg19	CCDS45938.1																																																																																			.	.	.	none		0.624	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453332.2	NM_024898	
TCHH	7062	hgsc.bcm.edu	37	1	152084184	152084185	+	In_Frame_Ins	INS	-	-	CGCCTCTCCTGCTGCTCG			TCGA-P4-AAVM-01A-11D-A42J-10	TCGA-P4-AAVM-11A-11D-A42M-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c5d3340-513d-4576-8298-848fee2f3edc	2e812561-7f51-41c5-bdb3-4861f646b630	g.chr1:152084184_152084185insCGCCTCTCCTGCTGCTCG	ENST00000368804.1	-	2	1507_1508	c.1508_1509insCGAGCAGCAGGAGAGGCG	c.(1507-1509)cgc>cgCGAGCAGCAGGAGAGGCGc	p.503_503R>REQQERR		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	503	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGCTGCTCGCGCCTCTCCTG	0.663																																					p.R503delinsREQQERR		Atlas-INDEL	.											.	TCHH	275	.	0			c.1509_1510insCGAGCAGCAGGAGAGGCG						PASS	.																																			SO:0001652	inframe_insertion	7062	exon3			.	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1491_1508dupCGAGCAGCAGGAGAGGCG	chr1.hg19:g.152084184_152084185insCGCCTCTCCTGCTGCTCG	ENSP00000357794:p.GluGlnGlnGluArgArg503dup	27.0	0.0	0		25.0	10.0	0.4	NM_007113	Q5VUI3	In_Frame_Ins	INS	ENST00000368804.1	hg19	CCDS41396.1																																																																																			.	.	.	none		0.663	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
