#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2238153	2238153	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr1:2238153G>A	ENST00000378536.4	+	7	2208	c.2136G>A	c.(2134-2136)cgG>cgA	p.R712R		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	712					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		TGTGGCCGCGGGCCCGCCCCG	0.761																																					p.R712R	Ovarian(177;144 1678 13697 20086 27838 40755)	Atlas-SNP	.											.	SKI	33	.	0			c.G2136A						PASS	.						5.0	6.0	6.0					1																	2238153		1501	2825	4326	SO:0001819	synonymous_variant	6497	exon7			GCCGCGGGCCCGC	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.2136G>A	chr1.hg19:g.2238153G>A		0.0	0.0	.		26.0	21.0	.	NM_003036	Q5SYT7	Silent	SNP	ENST00000378536.4	hg19	CCDS39.1																																																																																			.	.	.	none		0.761	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
ARID1A	8289	hgsc.bcm.edu	37	1	27101241	27101241	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr1:27101241A>G	ENST00000324856.7	+	18	4894	c.4523A>G	c.(4522-4524)tAt>tGt	p.Y1508C	ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000374152.2_Missense_Mutation_p.Y1125C	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1508					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACCTATAATTATGCCAACAGG	0.572			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Y1508C		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.A4523G						PASS	.						68.0	72.0	71.0					1																	27101241		2203	4300	6503	SO:0001583	missense	8289	exon18			ATAATTATGCCAA	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4523A>G	chr1.hg19:g.27101241A>G	ENSP00000320485:p.Tyr1508Cys	92.0	0.0	.		70.0	20.0	.	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650090	0.67472	.	.	ENSG00000117713	ENST00000324856;ENST00000374152	T;T	0.05996	3.53;3.36	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.22666	0.0547	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.991;0.99;0.996	T	0.00175	-1.1954	10	0.44086	T	0.13	-5.0146	15.8453	0.78883	1.0:0.0:0.0:0.0	.	1125;1508;1161	O14497-3;O14497;Q4LE49	.;ARI1A_HUMAN;.	C	1508;1125	ENSP00000320485:Y1508C;ENSP00000363267:Y1125C	ENSP00000320485:Y1508C	Y	+	2	0	ARID1A	26973828	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.707000	0.74654	2.330000	0.79161	0.528000	0.53228	TAT	.	.	.	none		0.572	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
DLGAP3	58512	hgsc.bcm.edu	37	1	35331687	35331687	+	Silent	SNP	C	C	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr1:35331687C>T	ENST00000373347.1	-	12	3205	c.2937G>A	c.(2935-2937)ctG>ctA	p.L979L	DLGAP3_ENST00000235180.4_Silent_p.L979L			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	979					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				ggaccggtcacagcctggtct	0.731																																					p.L979L		Atlas-SNP	.											.	DLGAP3	107	.	0			c.G2937A						PASS	.						11.0	13.0	12.0					1																	35331687		2181	4267	6448	SO:0001819	synonymous_variant	58512	exon10			CGGTCACAGCCTG	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.2937G>A	chr1.hg19:g.35331687C>T		1.0	0.0	.		45.0	13.0	.	NM_001080418	Q5TDD5|Q9H3X7	Silent	SNP	ENST00000373347.1	hg19	CCDS30670.1																																																																																			.	.	.	none		0.731	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
ANKRD35	148741	hgsc.bcm.edu	37	1	145567075	145567075	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr1:145567075C>T	ENST00000355594.4	+	12	3010	c.2923C>T	c.(2923-2925)Cat>Tat	p.H975Y		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	975										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTACAGGAATCATCTACTGAA	0.473																																					p.H975Y	Melanoma(9;127 754 22988 51047)	Atlas-SNP	.											.	ANKRD35	96	.	0			c.C2923T						PASS	.						168.0	155.0	160.0					1																	145567075		2203	4300	6503	SO:0001583	missense	148741	exon12			AGGAATCATCTAC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2923C>T	chr1.hg19:g.145567075C>T	ENSP00000347802:p.His975Tyr	165.0	0.0	.		142.0	38.0	.	NM_144698	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	hg19	CCDS919.1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780583	0.49891	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.58652	0.32	5.12	5.12	0.69794	.	0.000000	0.47852	D	0.000209	T	0.69878	0.3160	M	0.74881	2.28	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.73266	-0.4037	10	0.87932	D	0	-3.866	13.9259	0.63961	0.0:1.0:0.0:0.0	.	975	Q8N283	ANR35_HUMAN	Y	884;975	ENSP00000347802:H975Y	ENSP00000347802:H975Y	H	+	1	0	ANKRD35	144278432	0.991000	0.36638	0.888000	0.34837	0.244000	0.25665	2.767000	0.47637	2.679000	0.91253	0.655000	0.94253	CAT	.	.	.	none		0.473	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
PKP1	5317	hgsc.bcm.edu	37	1	201285751	201285751	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr1:201285751G>A	ENST00000352845.3	+	4	772	c.772G>A	c.(772-774)Gat>Aat	p.D258N	PKP1_ENST00000367324.3_Missense_Mutation_p.D258N|PKP1_ENST00000475988.1_3'UTR|PKP1_ENST00000263946.3_Missense_Mutation_p.D258N			Q13835	PKP1_HUMAN	plakophilin 1	258					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						GAGCTCCCAGGATGAGAAATA	0.537																																					p.D258N		Atlas-SNP	.											PKP1,NS,carcinoma,0,1	PKP1	127	.	0			c.G772A						PASS	.						83.0	62.0	69.0					1																	201285751		2203	4300	6503	SO:0001583	missense	5317	exon4			TCCCAGGATGAGA	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.772G>A	chr1.hg19:g.201285751G>A	ENSP00000295597:p.Asp258Asn	250.0	1.0	.		207.0	54.0	.	NM_001005337	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	hg19	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.844590	0.51164	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.55588	0.51;0.51;0.51	4.91	3.96	0.45880	Armadillo-like helical (1);Armadillo-type fold (1);	0.200242	0.51477	D	0.000089	T	0.45397	0.1340	L	0.49778	1.585	0.53688	D	0.99997	P;P	0.49253	0.741;0.921	B;B	0.40940	0.344;0.33	T	0.34428	-0.9829	10	0.19147	T	0.46	-15.2438	14.2686	0.66138	0.0:0.0:0.8497:0.1502	.	258;258	Q13835-2;Q13835	.;PKP1_HUMAN	N	258	ENSP00000356293:D258N;ENSP00000263946:D258N;ENSP00000295597:D258N	ENSP00000263946:D258N	D	+	1	0	PKP1	199552374	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	7.782000	0.85680	1.008000	0.39264	0.591000	0.81541	GAT	.	.	.	none		0.537	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
TAF5L	27097	hgsc.bcm.edu	37	1	229730727	229730727	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr1:229730727C>T	ENST00000366676.1	-	4	1086	c.1087G>A	c.(1087-1089)Gac>Aac	p.D363N	TAF5L_ENST00000258281.2_Missense_Mutation_p.D363N			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	363					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				ATGGACATGTCTTCAGAACAA	0.527																																					p.D363N		Atlas-SNP	.											.	TAF5L	76	.	0			c.G1087A						PASS	.						121.0	102.0	108.0					1																	229730727		2203	4300	6503	SO:0001583	missense	27097	exon5			ACATGTCTTCAGA	AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.1087G>A	chr1.hg19:g.229730727C>T	ENSP00000355636:p.Asp363Asn	110.0	0.0	.		85.0	5.0	.	NM_014409	Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	ENST00000366676.1	hg19	CCDS1581.1	.	.	.	.	.	.	.	.	.	.	C	33	5.238803	0.95240	.	.	ENSG00000135801	ENST00000366676;ENST00000258281	D;D	0.88975	-2.45;-2.45	5.88	5.88	0.94601	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96027	0.8706	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96166	0.9119	10	0.87932	D	0	-34.0939	20.2422	0.98381	0.0:1.0:0.0:0.0	.	363	O75529	TAF5L_HUMAN	N	363	ENSP00000355636:D363N;ENSP00000258281:D363N	ENSP00000258281:D363N	D	-	1	0	TAF5L	227797350	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.811000	0.86092	2.782000	0.95742	0.655000	0.94253	GAC	.	.	.	none		0.527	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095229.1	NM_014409	
GKN1	56287	hgsc.bcm.edu	37	2	69207170	69207170	+	Silent	SNP	A	A	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:69207170A>G	ENST00000377938.2	+	5	546	c.483A>G	c.(481-483)acA>acG	p.T161T		NM_019617.3	NP_062563.3	Q9NS71	GKN1_HUMAN	gastrokine 1	161	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				digestion (GO:0007586)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)	extracellular region (GO:0005576)|secretory granule (GO:0030141)				breast(2)|large_intestine(4)|lung(5)	11						GGATTCCAACATACATGGCTG	0.507																																					p.T161T		Atlas-SNP	.											.	GKN1	24	.	0			c.A483G						PASS	.						156.0	111.0	126.0					2																	69207170		2203	4300	6503	SO:0001819	synonymous_variant	56287	exon5			TCCAACATACATG	AY139182	CCDS1891.2	2p13.3	2012-10-10			ENSG00000169605	ENSG00000169605		"""BRICHOS domain containing"""	23217	protein-coding gene	gene with protein product	"""BRICHOS domain containing 1"""	606402				12851218, 11562744	Standard	NM_019617		Approved	AMP18, CA11, BRICD1	uc002sfc.3	Q9NS71	OTTHUMG00000129574	ENST00000377938.2:c.483A>G	chr2.hg19:g.69207170A>G		248.0	0.0	.		207.0	41.0	.	NM_019617	Q8IUA9	Silent	SNP	ENST00000377938.2	hg19	CCDS1891.2																																																																																			.	.	.	none		0.507	GKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251769.2	NM_019617	
DCAF17	80067	hgsc.bcm.edu	37	2	172333421	172333421	+	Silent	SNP	T	T	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:172333421T>A	ENST00000375255.3	+	11	1470	c.1143T>A	c.(1141-1143)tcT>tcA	p.S381S	DCAF17_ENST00000468592.1_3'UTR|DCAF17_ENST00000539783.1_Intron	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17	381					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						ATCAGATCTCTGAAGATTTTG	0.323																																					p.S381S		Atlas-SNP	.											.	DCAF17	41	.	0			c.T1143A						PASS	.						70.0	72.0	71.0					2																	172333421		2203	4300	6503	SO:0001819	synonymous_variant	80067	exon11			GATCTCTGAAGAT	AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.1143T>A	chr2.hg19:g.172333421T>A		150.0	0.0	.		144.0	29.0	.	NM_025000	B2RTW5|Q53TN3|Q9H908	Silent	SNP	ENST00000375255.3	hg19	CCDS2243.2	.	.	.	.	.	.	.	.	.	.	T	10.52	1.373792	0.24857	.	.	ENSG00000115827	ENST00000339506;ENST00000431110	.	.	.	5.55	4.37	0.52481	.	.	.	.	.	T	0.46405	0.1391	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43015	-0.9417	4	.	.	.	-6.982	2.2645	0.04075	0.1969:0.0804:0.1334:0.5893	.	.	.	.	Q	132;83	.	.	L	+	2	0	DCAF17	172041667	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.499000	0.35671	0.913000	0.36797	0.472000	0.43445	CTG	.	.	.	none		0.323	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255342.2	NM_025000	
SLC40A1	30061	hgsc.bcm.edu	37	2	190437577	190437577	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:190437577C>A	ENST00000261024.2	-	4	808	c.382G>T	c.(382-384)Gtt>Ttt	p.V128F	SLC40A1_ENST00000418714.1_5'Flank	NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	128					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			CTTACGAGAACCCATCCATGG	0.393																																					p.V128F		Atlas-SNP	.											.	SLC40A1	51	.	0			c.G382T						PASS	.						83.0	78.0	80.0					2																	190437577		2203	4300	6503	SO:0001583	missense	30061	exon4			CGAGAACCCATCC	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.382G>T	chr2.hg19:g.190437577C>A	ENSP00000261024:p.Val128Phe	196.0	0.0	.		215.0	42.0	.	NM_014585	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	ENST00000261024.2	hg19	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.911373	0.33721	.	.	ENSG00000138449	ENST00000261024;ENST00000427241	D;D	0.94280	-3.39;-3.39	6.03	1.03	0.20045	Major facilitator superfamily domain, general substrate transporter (1);	0.604283	0.17891	N	0.158506	D	0.83848	0.5343	N	0.17474	0.49	0.42059	D	0.991157	B;B	0.09022	0.002;0.002	B;B	0.14578	0.011;0.011	T	0.70040	-0.4981	10	0.20519	T	0.43	-3.6976	7.1323	0.25508	0.0:0.3425:0.3929:0.2646	.	128;128	A8K7Y1;Q9NP59	.;S40A1_HUMAN	F	128	ENSP00000261024:V128F;ENSP00000390005:V128F	ENSP00000261024:V128F	V	-	1	0	SLC40A1	190145822	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	0.700000	0.25601	0.124000	0.18369	0.655000	0.94253	GTT	.	.	.	none		0.393	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		
GLS	2744	hgsc.bcm.edu	37	2	191795284	191795284	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:191795284A>G	ENST00000320717.3	+	13	1805	c.1547A>G	c.(1546-1548)cAc>cGc	p.H516R	GLS_ENST00000409215.1_Missense_Mutation_p.H21R|GLS_ENST00000409626.1_Missense_Mutation_p.H87R|GLS_ENST00000409428.1_Missense_Mutation_p.H21R|GLS_ENST00000338435.4_Missense_Mutation_p.H516R	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	516					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	AAGGGAATTCACTTTTGTCAC	0.383																																					p.H516R		Atlas-SNP	.											.	GLS	47	.	0			c.A1547G						PASS	.						128.0	119.0	122.0					2																	191795284		2203	4300	6503	SO:0001583	missense	2744	exon13			GAATTCACTTTTG	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1547A>G	chr2.hg19:g.191795284A>G	ENSP00000317379:p.His516Arg	120.0	0.0	.		119.0	31.0	.	NM_014905	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	hg19	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	A	13.95	2.388942	0.42308	.	.	ENSG00000115419	ENST00000320717;ENST00000338435;ENST00000409626;ENST00000457316;ENST00000409428;ENST00000409215;ENST00000412247	T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.84	5.84	0.93424	Beta-lactamase/transpeptidase-like (1);	0.049755	0.85682	D	0.000000	T	0.26195	0.0639	N	0.10664	0.02	0.54753	D	0.999986	B;B;B;B;B	0.12013	0.003;0.003;0.001;0.003;0.005	B;B;B;B;B	0.12156	0.004;0.006;0.003;0.006;0.007	T	0.06972	-1.0797	10	0.27082	T	0.32	-4.505	16.2233	0.82274	1.0:0.0:0.0:0.0	.	87;516;170;516;516	B7Z2P1;A8K132;Q68D38;O94925;O94925-3	.;.;.;GLSK_HUMAN;.	R	516;516;87;87;21;21;37	ENSP00000317379:H516R;ENSP00000340689:H516R;ENSP00000386417:H87R;ENSP00000395596:H87R;ENSP00000387177:H21R;ENSP00000387135:H21R;ENSP00000403329:H37R	ENSP00000317379:H516R	H	+	2	0	GLS	191503529	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.339000	0.96797	2.243000	0.73865	0.482000	0.46254	CAC	.	.	.	none		0.383	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
PGAP1	80055	hgsc.bcm.edu	37	2	197791195	197791195	+	Splice_Site	SNP	T	T	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:197791195T>A	ENST00000354764.4	-	1	260	c.146A>T	c.(145-147)cAg>cTg	p.Q49L	PGAP1_ENST00000485830.1_Intron|PGAP1_ENST00000409475.1_Splice_Site_p.Q49L|PGAP1_ENST00000409188.1_Intron	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	49					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GAACCTTACCTGATACTCCGG	0.562																																					p.Q49L		Atlas-SNP	.											.	PGAP1	84	.	0			c.A146T						PASS	.						184.0	203.0	197.0					2																	197791195		2203	4300	6503	SO:0001630	splice_region_variant	80055	exon1			CTTACCTGATACT		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.147+1A>T	chr2.hg19:g.197791195T>A		197.0	0.0	.		220.0	40.0	.	NM_024989	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	hg19	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.422748	0.43020	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475;ENST00000374738	D	0.83673	-1.75	4.16	4.16	0.48862	.	0.069665	0.64402	D	0.000011	T	0.70745	0.3259	N	0.15975	0.35	0.80722	D	1	B;P	0.48764	0.001;0.915	B;P	0.49361	0.001;0.608	T	0.66284	-0.5962	10	0.11485	T	0.65	-4.6463	6.88	0.24168	0.2059:0.0:0.0:0.7941	.	49;49	Q75T13-3;Q75T13	.;PGAP1_HUMAN	L	49	ENSP00000363870:Q49L	ENSP00000346809:Q49L	Q	-	2	0	PGAP1	197499440	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	2.730000	0.47335	1.752000	0.51891	0.260000	0.18958	CAG	.	.	.	none		0.562	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	Missense_Mutation
SGOL2	151246	hgsc.bcm.edu	37	2	201438489	201438489	+	Silent	SNP	T	T	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:201438489T>G	ENST00000357799.4	+	7	3518	c.3420T>G	c.(3418-3420)tcT>tcG	p.S1140S		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	1140					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						GATCTTTGTCTGAGATACATT	0.343																																					p.S1140S		Atlas-SNP	.											.	SGOL2	126	.	0			c.T3420G						PASS	.						109.0	101.0	103.0					2																	201438489		1844	4087	5931	SO:0001819	synonymous_variant	151246	exon7			TTTGTCTGAGATA	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.3420T>G	chr2.hg19:g.201438489T>G		80.0	0.0	.		74.0	13.0	.	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Silent	SNP	ENST00000357799.4	hg19	CCDS42796.1																																																																																			.	.	.	none		0.343	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
COPG1	22820	hgsc.bcm.edu	37	3	128993744	128993745	+	Nonsense_Mutation	DNP	GC	GC	TA			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr3:128993744_128993745GC>TA	ENST00000314797.6	+	22	2424_2425	c.2320_2321GC>TA	c.(2320-2322)GCa>TAa	p.A774*		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	774	Interaction with ZNF289/ARFGAP2.				COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										GAACTTCGAAGCAGCCTGGGAT	0.46																																					p.A774S|p.A774E		Atlas-SNP	.											.	.	.	.	0			c.G2320T|c.C2321A						PASS	.																																			SO:0001587	stop_gained	22820	exon22			TTCGAAGCAGCCT|TCGAAGCAGCCTG	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	Exception_encountered	chr3.hg19:g.128993744_128993745delinsTA	ENSP00000325002:p.Ala774*	279.0|283.0	0.0	.		313.0	63.0|64.0	.	NM_016128	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	ENST00000314797.6	hg19	CCDS33851.1																																																																																			.	.	.	none		0.460	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128	
NWD2	57495	hgsc.bcm.edu	37	4	37447184	37447184	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr4:37447184G>A	ENST00000309447.5	+	7	4422	c.3574G>A	c.(3574-3576)Gtg>Atg	p.V1192M		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1192										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						AGACAGTGAGGTGGTCAGCAT	0.468																																					p.V1192M		Atlas-SNP	.											.	KIAA1239	79	.	0			c.G3574A						PASS	.						36.0	30.0	32.0					4																	37447184		692	1591	2283	SO:0001583	missense	57495	exon7			AGTGAGGTGGTCA																												ENST00000309447.5:c.3574G>A	chr4.hg19:g.37447184G>A	ENSP00000309501:p.Val1192Met	77.0	0.0	.		88.0	25.0	.	NM_001144990	A8MRU1	Missense_Mutation	SNP	ENST00000309447.5	hg19	CCDS47040.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.737724	0.49045	.	.	ENSG00000174145	ENST00000309447	T	0.72942	-0.7	6.17	5.33	0.75918	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.60728	0.2291	L	0.29908	0.895	0.58432	D	0.999994	P	0.46706	0.883	B	0.39876	0.312	T	0.66011	-0.6029	10	0.62326	D	0.03	.	15.3226	0.74135	0.0:0.0:0.7453:0.2547	.	1192	Q9ULI1	K1239_HUMAN	M	1192	ENSP00000309501:V1192M	ENSP00000309501:V1192M	V	+	1	0	KIAA1239	37123579	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	6.316000	0.72857	1.610000	0.50200	0.655000	0.94253	GTG	.	.	.	none		0.468	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
HPSE	10855	hgsc.bcm.edu	37	4	84240579	84240579	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr4:84240579C>G	ENST00000405413.2	-	4	553	c.417G>C	c.(415-417)aaG>aaC	p.K139N	HPSE_ENST00000513463.1_Missense_Mutation_p.K139N|HPSE_ENST00000311412.5_Missense_Mutation_p.K139N|HPSE_ENST00000512196.1_Missense_Mutation_p.K139N	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	139					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	CCAACCGTAACTTCTCCTCCA	0.438																																					p.K139N		Atlas-SNP	.											.	HPSE	55	.	0			c.G417C						PASS	.						148.0	137.0	141.0					4																	84240579		2203	4300	6503	SO:0001583	missense	10855	exon3			CCGTAACTTCTCC	AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.417G>C	chr4.hg19:g.84240579C>G	ENSP00000384262:p.Lys139Asn	104.0	0.0	.		113.0	17.0	.	NM_001199830	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Missense_Mutation	SNP	ENST00000405413.2	hg19	CCDS3602.1	.	.	.	.	.	.	.	.	.	.	C	2.151	-0.394512	0.04899	.	.	ENSG00000173083	ENST00000311412;ENST00000405413;ENST00000512196;ENST00000513463	T;T;T;T	0.44482	0.94;0.94;0.92;2.02	5.14	0.358	0.16084	Glycoside hydrolase, superfamily (1);	0.691254	0.14121	N	0.340021	T	0.28863	0.0716	L	0.36672	1.1	0.09310	N	1	B;P;P	0.36465	0.0;0.551;0.554	B;B;B	0.40782	0.001;0.34;0.146	T	0.14531	-1.0469	10	0.27082	T	0.32	-4.5686	2.1168	0.03715	0.1217:0.3938:0.1188:0.3657	.	139;139;139	E9PCA9;E9PGR1;Q9Y251	.;.;HPSE_HUMAN	N	139	ENSP00000308107:K139N;ENSP00000384262:K139N;ENSP00000423265:K139N;ENSP00000421365:K139N	ENSP00000308107:K139N	K	-	3	2	HPSE	84459603	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-0.862000	0.04263	-0.150000	0.11195	-0.293000	0.09583	AAG	.	.	.	none		0.438	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252812.2	NM_006665	
GRID2	2895	hgsc.bcm.edu	37	4	94436380	94436380	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr4:94436380C>T	ENST00000282020.4	+	13	2269	c.2011C>T	c.(2011-2013)Ctt>Ttt	p.L671F	GRID2_ENST00000510992.1_Missense_Mutation_p.L576F	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	671					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.L671I(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TCTCCAGGACCTTTCCAAGCA	0.418																																					p.L671F		Atlas-SNP	.											GRID2,NS,carcinoma,0,1	GRID2	233	.	1	Substitution - Missense(1)	lung(1)	c.C2011T						PASS	.						45.0	44.0	44.0					4																	94436380		2203	4300	6503	SO:0001583	missense	2895	exon13			CAGGACCTTTCCA	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2011C>T	chr4.hg19:g.94436380C>T	ENSP00000282020:p.Leu671Phe	83.0	0.0	.		81.0	16.0	.	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	hg19	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826524	0.71143	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.52754	0.65;0.65	4.96	4.96	0.65561	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.062472	0.64402	D	0.000006	T	0.74038	0.3664	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.992;0.997	T	0.79757	-0.1669	10	0.87932	D	0	.	18.5496	0.91058	0.0:1.0:0.0:0.0	.	576;671	E9PH24;O43424	.;GRID2_HUMAN	F	671;576	ENSP00000282020:L671F;ENSP00000421257:L576F	ENSP00000282020:L671F	L	+	1	0	GRID2	94655403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.534000	0.45676	2.448000	0.82819	0.585000	0.79938	CTT	.	.	.	none		0.418	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
ADH6	130	hgsc.bcm.edu	37	4	100129912	100129912	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr4:100129912T>A	ENST00000237653.7	-	6	1125	c.741A>T	c.(739-741)ttA>ttT	p.L247F	RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394899.2_Missense_Mutation_p.L247F|RP11-696N14.1_ENST00000506454.1_RNA|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000504257.1_5'UTR|ADH6_ENST00000407820.2_Missense_Mutation_p.L38F|ADH6_ENST00000394897.1_Missense_Mutation_p.L247F	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	247					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	TGGGTTTCTTTAAGTCCTGAG	0.443																																					p.L247F		Atlas-SNP	.											.	ADH6	74	.	0			c.A741T						PASS	.						286.0	298.0	294.0					4																	100129912		2203	4300	6503	SO:0001583	missense	130	exon6			TTTCTTTAAGTCC	AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.741A>T	chr4.hg19:g.100129912T>A	ENSP00000237653:p.Leu247Phe	123.0	0.0	.		148.0	39.0	.	NM_000672	B3KS45|Q58F53	Missense_Mutation	SNP	ENST00000237653.7	hg19	CCDS3647.1	.	.	.	.	.	.	.	.	.	.	T	2.163	-0.391751	0.04932	.	.	ENSG00000172955	ENST00000394897;ENST00000394899;ENST00000407820;ENST00000237653;ENST00000508558	T;T;T;T;T	0.04156	3.69;3.69;3.69;3.69;3.69	4.56	-4.66	0.03329	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.483471	0.25219	N	0.032258	T	0.01523	0.0049	N	0.11651	0.15	0.22001	N	0.999427	B;B;B;B	0.14012	0.0;0.0;0.0;0.009	B;B;B;B	0.09377	0.004;0.002;0.002;0.004	T	0.42015	-0.9476	10	0.09338	T	0.73	-7.7887	1.7843	0.03038	0.3579:0.2092:0.3238:0.1091	.	124;247;247;247	B4DPD8;E9PBI1;P28332;P28332-2	.;.;ADH6_HUMAN;.	F	247;247;38;247;183	ENSP00000378358:L247F;ENSP00000378359:L247F;ENSP00000384997:L38F;ENSP00000237653:L247F;ENSP00000426187:L183F	ENSP00000237653:L247F	L	-	3	2	ADH6	100348935	0.000000	0.05858	0.004000	0.12327	0.597000	0.36814	0.028000	0.13644	-1.027000	0.03325	-0.294000	0.09567	TTA	.	.	.	none		0.443	ADH6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253665.1	NM_000672	
LARP7	51574	hgsc.bcm.edu	37	4	113568519	113568519	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr4:113568519C>A	ENST00000344442.5	+	7	1089	c.811C>A	c.(811-813)Cag>Aag	p.Q271K	MIR302D_ENST00000362275.1_RNA|MIR302B_ENST00000509938.1_RNA|MIR302C_ENST00000362232.1_RNA|MIR367_ENST00000362299.1_RNA|MIR302B_ENST00000505215.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302A_ENST00000385192.1_RNA|MIR302B_ENST00000362188.1_RNA|LARP7_ENST00000509061.1_Missense_Mutation_p.Q278K|LARP7_ENST00000324052.6_Missense_Mutation_p.Q271K	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	271	Lys-rich.				RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		ACCCCAAAAGCAGTGCTCAAA	0.448																																					p.Q278K		Atlas-SNP	.											.	LARP7	54	.	0			c.C832A						PASS	.						104.0	102.0	102.0					4																	113568519		1871	4114	5985	SO:0001583	missense	51574	exon9			CAAAAGCAGTGCT	AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.811C>A	chr4.hg19:g.113568519C>A	ENSP00000344950:p.Gln271Lys	126.0	0.0	.		147.0	16.0	.	NM_001267039	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	ENST00000344442.5	hg19	CCDS3701.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.204|0.204	-1.041899|-1.041899	0.01997|0.01997	.|.	.|.	ENSG00000174720|ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000505034;ENST00000324052|ENST00000511529	T;T;T;T|.	0.17528|.	2.27;2.27;2.27;2.27|.	5.86|5.86	5.01|5.01	0.66863|0.66863	.|.	0.366809|.	0.30126|.	N|.	0.010347|.	T|T	0.56485|0.56485	0.1988|0.1988	L|L	0.56769|0.56769	1.78|1.78	0.32446|0.32446	N|N	0.546025|0.546025	B;B|.	0.18013|.	0.025;0.025|.	B;B|.	0.18561|.	0.022;0.022|.	T|T	0.65162|0.65162	-0.6235|-0.6235	10|5	0.06236|.	T|.	0.91|.	-6.7457|-6.7457	10.0804|10.0804	0.42386|0.42386	0.0:0.7892:0.1388:0.072|0.0:0.7892:0.1388:0.072	.|.	271;271|.	D6RFF0;Q4G0J3|.	.;LARP7_HUMAN|.	K|R	271;278;271;271|51	ENSP00000344950:Q271K;ENSP00000422626:Q278K;ENSP00000421541:Q271K;ENSP00000314311:Q271K|.	ENSP00000314311:Q271K|.	Q|S	+|+	1|3	0|2	LARP7|LARP7	113787968|113787968	0.865000|0.865000	0.29922|0.29922	0.907000|0.907000	0.35723|0.35723	0.117000|0.117000	0.20001|0.20001	1.026000|1.026000	0.30103|0.30103	1.453000|1.453000	0.47775|0.47775	0.563000|0.563000	0.77884|0.77884	CAG|AGC	.	.	.	none		0.448	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	
IQGAP2	10788	hgsc.bcm.edu	37	5	75902074	75902074	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr5:75902074G>A	ENST00000274364.6	+	12	1600	c.1303G>A	c.(1303-1305)Gaa>Aaa	p.E435K	IQGAP2_ENST00000379730.3_5'UTR|CTD-2236F14.1_ENST00000511327.1_RNA|IQGAP2_ENST00000502745.1_5'Flank|IQGAP2_ENST00000396234.3_5'Flank	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	435					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAGCTGGAATGAAATTCAGAA	0.343																																					p.E435K		Atlas-SNP	.											.	IQGAP2	186	.	0			c.G1303A						PASS	.						100.0	99.0	100.0					5																	75902074		2203	4300	6503	SO:0001583	missense	10788	exon12			TGGAATGAAATTC	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1303G>A	chr5.hg19:g.75902074G>A	ENSP00000274364:p.Glu435Lys	109.0	0.0	.		122.0	27.0	.	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	hg19	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060330	0.76074	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.06849	3.25;3.25;3.25	5.63	4.76	0.60689	.	0.158913	0.56097	N	0.000036	T	0.11879	0.0289	M	0.68952	2.095	0.80722	D	1	P	0.39404	0.672	B	0.35607	0.206	T	0.02526	-1.1146	10	0.49607	T	0.09	-26.3168	14.1512	0.65387	0.0728:0.0:0.9272:0.0	.	435	Q13576	IQGA2_HUMAN	K	435;408;385	ENSP00000274364:E435K;ENSP00000423672:E408K;ENSP00000421097:E385K	ENSP00000274364:E435K	E	+	1	0	IQGAP2	75937830	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.250000	0.89835	1.370000	0.46153	0.650000	0.86243	GAA	.	.	.	none		0.343	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
DDX41	51428	hgsc.bcm.edu	37	5	176940458	176940458	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr5:176940458C>G	ENST00000507955.1	-	11	1649	c.1126G>C	c.(1126-1128)Gcc>Ccc	p.A376P	DDX41_ENST00000506965.1_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	376	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GGCATGGTGGCACTGAAGAGC	0.612																																					p.A376P		Atlas-SNP	.											.	DDX41	49	.	0			c.G1126C						PASS	.						129.0	139.0	136.0					5																	176940458		2203	4300	6503	SO:0001583	missense	51428	exon11			TGGTGGCACTGAA	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1126G>C	chr5.hg19:g.176940458C>G	ENSP00000422753:p.Ala376Pro	146.0	0.0	.		135.0	27.0	.	NM_016222	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	ENST00000507955.1	hg19	CCDS4427.1	.	.	.	.	.	.	.	.	.	.	C	34	5.359401	0.95854	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.59772	0.24;0.24	5.25	5.25	0.73442	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.055575	0.64402	D	0.000001	D	0.84705	0.5531	H	0.96777	3.88	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.988;0.992	D	0.89650	0.3869	10	0.87932	D	0	-29.9388	19.0273	0.92937	0.0:1.0:0.0:0.0	.	250;376	B3KRK2;Q9UJV9	.;DDX41_HUMAN	P	394;376	ENSP00000330349:A394P;ENSP00000422753:A376P	ENSP00000330349:A394P	A	-	1	0	DDX41	176873064	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.595000	0.82710	2.721000	0.93114	0.655000	0.94253	GCC	.	.	.	none		0.612	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	NM_016222	
HECW1	23072	hgsc.bcm.edu	37	7	43484075	43484075	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr7:43484075C>A	ENST00000395891.2	+	11	1909	c.1304C>A	c.(1303-1305)cCt>cAt	p.P435H	HECW1_ENST00000453890.1_Missense_Mutation_p.P435H	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	435					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TCTGTGGGACCTGAAGGGGCT	0.627																																					p.P435H		Atlas-SNP	.											.	HECW1	540	.	0			c.C1304A						PASS	.						22.0	25.0	24.0					7																	43484075		2079	4213	6292	SO:0001583	missense	23072	exon11			TGGGACCTGAAGG	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1304C>A	chr7.hg19:g.43484075C>A	ENSP00000379228:p.Pro435His	131.0	0.0	.		118.0	23.0	.	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	hg19	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102929	0.37145	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.33654	1.45;1.4	4.77	3.89	0.44902	.	15.800300	0.00906	N	0.002403	T	0.34221	0.0890	L	0.40543	1.245	0.09310	N	1	P;P	0.51791	0.612;0.948	B;B	0.39185	0.219;0.293	T	0.38564	-0.9655	10	0.52906	T	0.07	.	10.3123	0.43716	0.0:0.844:0.0:0.156	.	435;435	B4DH42;Q76N89	.;HECW1_HUMAN	H	435	ENSP00000379228:P435H;ENSP00000407774:P435H	ENSP00000265522:P435H	P	+	2	0	HECW1	43450600	0.000000	0.05858	0.008000	0.14137	0.181000	0.23173	0.250000	0.18235	1.311000	0.45024	0.591000	0.81541	CCT	.	.	.	none		0.627	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
ABCA13	154664	hgsc.bcm.edu	37	7	48563956	48563956	+	Missense_Mutation	SNP	A	A	C			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr7:48563956A>C	ENST00000435803.1	+	54	14188	c.14164A>C	c.(14164-14166)Aac>Cac	p.N4722H	ABCA13_ENST00000544596.1_Missense_Mutation_p.N452H	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4722	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGTGTTATACAACCTTAGTAA	0.363																																					p.N4722H		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A14164C						PASS	.						129.0	128.0	128.0					7																	48563956		1842	4094	5936	SO:0001583	missense	154664	exon54			TTATACAACCTTA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14164A>C	chr7.hg19:g.48563956A>C	ENSP00000411096:p.Asn4722His	167.0	0.0	.		138.0	30.0	.	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	7.655	0.683805	0.14907	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.47869	0.83;0.83;0.83	5.59	3.08	0.35506	ABC transporter-like (1);	0.227351	0.30850	N	0.008743	T	0.30448	0.0765	L	0.31526	0.94	0.22127	N	0.999341	B;B;B	0.28760	0.007;0.013;0.221	B;B;B	0.23716	0.017;0.009;0.048	T	0.16070	-1.0415	10	0.45353	T	0.12	.	6.4339	0.21813	0.7623:0.1574:0.0803:0.0	.	452;2424;4722	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	H	4722;495;452	ENSP00000411096:N4722H;ENSP00000391042:N495H;ENSP00000442634:N452H	ENSP00000391042:N495H	N	+	1	0	ABCA13	48534502	0.928000	0.31464	0.072000	0.20136	0.450000	0.32258	2.185000	0.42584	1.050000	0.40346	0.533000	0.62120	AAC	.	.	.	none		0.363	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
SSPO	23145	hgsc.bcm.edu	37	7	149518182	149518182	+	RNA	SNP	C	C	T	rs199773714	byFrequency	TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr7:149518182C>T	ENST00000378016.2	+	0	12525							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCACTCATGCGGGCCCAGAG	0.692													C|||	2	0.000399361	0.0	0.0	5008	,	,		17614	0.002		0.0	False		,,,				2504	0.0				p.C4175C		Atlas-SNP	.											.	.	.	.	0			c.C12525T						PASS	.																																					23145	exon87			CTCATGCGGGCCC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149518182C>T		13.0	0.0	.		37.0	6.0	.	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.	.	weak		0.692	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
EFR3A	23167	hgsc.bcm.edu	37	8	132996502	132996502	+	Missense_Mutation	SNP	T	T	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr8:132996502T>G	ENST00000254624.5	+	15	1917	c.1692T>G	c.(1690-1692)aaT>aaG	p.N564K	EFR3A_ENST00000519656.1_Missense_Mutation_p.N528K|EFR3A_ENST00000334503.4_Missense_Mutation_p.N564K	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	564						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			AACTGGCTAATGAAGAAGTAG	0.348																																					p.N564K		Atlas-SNP	.											.	EFR3A	96	.	0			c.T1692G						PASS	.						132.0	132.0	132.0					8																	132996502		2203	4300	6503	SO:0001583	missense	23167	exon15			GGCTAATGAAGAA	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.1692T>G	chr8.hg19:g.132996502T>G	ENSP00000254624:p.Asn564Lys	86.0	0.0	.		82.0	15.0	.	NM_015137	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	ENST00000254624.5	hg19	CCDS34942.2	.	.	.	.	.	.	.	.	.	.	T	19.05	3.752706	0.69533	.	.	ENSG00000132294	ENST00000254624;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T	0.30182	1.54;1.54;1.54	6.02	3.6	0.41247	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	M	0.70275	2.135	0.80722	D	1	P	0.45902	0.868	P	0.51415	0.669	T	0.23084	-1.0198	10	0.51188	T	0.08	-34.8449	10.0781	0.42373	0.0:0.1369:0.0:0.8631	.	564	Q14156	EFR3A_HUMAN	K	564;564;564;528	ENSP00000254624:N564K;ENSP00000334769:N564K;ENSP00000428086:N528K	ENSP00000254624:N564K	N	+	3	2	EFR3A	133065684	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.821000	0.27338	0.491000	0.27793	0.528000	0.53228	AAT	.	.	.	none		0.348	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137	
OC90	729330	hgsc.bcm.edu	37	8	133041425	133041426	+	Splice_Site	DNP	AC	AC	TT			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr8:133041425_133041426AC>TT	ENST00000443356.2	-	14	1166_1167	c.1080_1081GT>AA	c.(1078-1083)agGTgc>agAAgc	p.C361S	OC90_ENST00000603859.1_Splice_Site_p.C345S|OC90_ENST00000254627.3_Splice_Site_p.C345S|OC90_ENST00000262283.5_Splice_Site_p.C557S			Q02509	OC90_HUMAN	otoconin 90	361	Phospholipase A2-like 2.				lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GACAAGCAGCACCTAAGACCAA	0.554																																					p.C345S|p.R344R		Atlas-SNP	.											.	OC90	163	.	0			c.T1033A|c.G1032A						PASS	.																																			SO:0001630	splice_region_variant	729330	exon13			AGCAGCACCTAAG|GCAGCACCTAAGA	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.1080_1081delinsTT	chr8.hg19:g.133041425_133041426delinsTT		107.0|105.0	0.0	.		95.0|94.0	15.0|14.0	.	NM_001080399	B4DNG8	Missense_Mutation|Silent	SNP	ENST00000443356.2	hg19																																																																																				.	.	.	none		0.554	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399	Missense_Mutation
ABCA2	20	hgsc.bcm.edu	37	9	139907277	139907277	+	Silent	SNP	C	C	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr9:139907277C>G	ENST00000371605.3	-	30	5112	c.4965G>C	c.(4963-4965)gtG>gtC	p.V1655V	ABCA2_ENST00000265662.5_Silent_p.V1656V|ABCA2_ENST00000341511.6_Silent_p.V1656V			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1655					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGTGCCCGCCCACACTGCTGG	0.677																																					p.V1686V		Atlas-SNP	.											.	ABCA2	113	.	0			c.G5058C						PASS	.						10.0	14.0	13.0					9																	139907277		1886	3995	5881	SO:0001819	synonymous_variant	20	exon31			CCCGCCCACACTG	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4965G>C	chr9.hg19:g.139907277C>G		59.0	0.0	.		157.0	23.0	.	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	ENST00000371605.3	hg19		.	.	.	.	.	.	.	.	.	.	C	9.881	1.201473	0.22121	.	.	ENSG00000107331	ENST00000477420	.	.	.	4.15	3.22	0.36961	.	.	.	.	.	T	0.48150	0.1484	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43798	-0.9369	4	.	.	.	.	4.4915	0.11815	0.1537:0.609:0.1497:0.0876	.	.	.	.	R	68	.	.	G	-	1	0	ABCA2	139027098	0.859000	0.29813	1.000000	0.80357	0.989000	0.77384	-0.084000	0.11268	2.142000	0.66516	0.491000	0.48974	GGG	.	.	.	none		0.677	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
ANK3	288	hgsc.bcm.edu	37	10	61833342	61833342	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr10:61833342C>A	ENST00000280772.2	-	37	7488	c.7297G>T	c.(7297-7299)Gac>Tac	p.D2433Y	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2433					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTATAAGAGTCATCAGATATG	0.418																																					p.D2433Y		Atlas-SNP	.											.	ANK3	703	.	0			c.G7297T						PASS	.						79.0	80.0	80.0					10																	61833342		2203	4300	6503	SO:0001583	missense	288	exon37			AAGAGTCATCAGA	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7297G>T	chr10.hg19:g.61833342C>A	ENSP00000280772:p.Asp2433Tyr	102.0	0.0	.		111.0	18.0	.	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377882	0.61735	.	.	ENSG00000151150	ENST00000280772	T	0.70986	-0.53	5.8	5.8	0.92144	.	0.000000	0.44688	D	0.000436	T	0.81894	0.4919	L	0.53249	1.67	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.82252	-0.0549	10	0.72032	D	0.01	.	20.0591	0.97667	0.0:1.0:0.0:0.0	.	2433	Q12955	ANK3_HUMAN	Y	2433	ENSP00000280772:D2433Y	ENSP00000280772:D2433Y	D	-	1	0	ANK3	61503348	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.810000	0.86072	2.747000	0.94245	0.462000	0.41574	GAC	.	.	.	none		0.418	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ENTPD7	57089	hgsc.bcm.edu	37	10	101421214	101421214	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr10:101421214C>A	ENST00000370489.4	+	3	198	c.20C>A	c.(19-21)tCc>tAc	p.S7Y		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	7						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		ATCAGTTTTTCCTACCTCTGC	0.428																																					p.S7Y		Atlas-SNP	.											.	ENTPD7	44	.	0			c.C20A						PASS	.						133.0	125.0	128.0					10																	101421214		2203	4300	6503	SO:0001583	missense	57089	exon3			GTTTTTCCTACCT	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.20C>A	chr10.hg19:g.101421214C>A	ENSP00000359520:p.Ser7Tyr	71.0	0.0	.		61.0	16.0	.	NM_020354	B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	hg19	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.094777	0.76870	.	.	ENSG00000198018	ENST00000370489	T	0.17691	2.26	5.67	5.67	0.87782	.	0.127291	0.53938	D	0.000047	T	0.21631	0.0521	L	0.32530	0.975	0.48040	D	0.999575	P	0.49696	0.927	P	0.47251	0.542	T	0.00348	-1.1799	10	0.54805	T	0.06	-18.4355	18.5275	0.90978	0.0:1.0:0.0:0.0	.	7	Q9NQZ7	ENTP7_HUMAN	Y	7	ENSP00000359520:S7Y	ENSP00000359520:S7Y	S	+	2	0	ENTPD7	101411204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.312000	0.59154	2.664000	0.90586	0.555000	0.69702	TCC	.	.	.	none		0.428	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354	
DNMBP	23268	hgsc.bcm.edu	37	10	101715503	101715503	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr10:101715503G>T	ENST00000324109.4	-	4	1819	c.1728C>A	c.(1726-1728)caC>caA	p.H576Q	DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Missense_Mutation_p.H576Q	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	576					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		TGATTGAAAAGTGGCGTAAAA	0.507																																					p.H576Q		Atlas-SNP	.											.	DNMBP	173	.	0			c.C1728A						PASS	.						53.0	57.0	56.0					10																	101715503		2203	4300	6503	SO:0001583	missense	23268	exon4			TGAAAAGTGGCGT	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.1728C>A	chr10.hg19:g.101715503G>T	ENSP00000315659:p.His576Gln	67.0	0.0	.		55.0	8.0	.	NM_015221	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	hg19	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953459	0.53293	.	.	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.16897	2.35;2.31	6.04	1.56	0.23342	.	0.248667	0.28647	N	0.014613	T	0.14960	0.0361	M	0.71581	2.175	0.80722	D	1	P	0.43477	0.808	B	0.39419	0.299	T	0.16364	-1.0405	10	0.13108	T	0.6	-7.645	6.0919	0.19999	0.3777:0.1336:0.4887:0.0	.	576	Q6XZF7	DNMBP_HUMAN	Q	576	ENSP00000344914:H576Q;ENSP00000315659:H576Q	ENSP00000315659:H576Q	H	-	3	2	DNMBP	101705493	0.999000	0.42202	1.000000	0.80357	0.974000	0.67602	0.487000	0.22356	0.365000	0.24400	0.561000	0.74099	CAC	.	.	.	none		0.507	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
CYP17A1	1586	hgsc.bcm.edu	37	10	104590667	104590667	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr10:104590667C>T	ENST00000369887.3	-	8	1490	c.1319G>A	c.(1318-1320)cGc>cAc	p.R440H	CYP17A1-AS1_ENST00000369884.4_RNA|CYP17A1_ENST00000489268.1_5'Flank	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	440			R -> H (in AH5). {ECO:0000269|PubMed:8027220}.		adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	TATACAGGAGCGAGGTCCTGC	0.597																																					p.R440H		Atlas-SNP	.											.	CYP17A1	48	.	0			c.G1319A	GRCh37	CM940326	CYP17A1	M		PASS	.						34.0	28.0	30.0					10																	104590667		2203	4299	6502	SO:0001583	missense	1586	exon8			CAGGAGCGAGGTC	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.1319G>A	chr10.hg19:g.104590667C>T	ENSP00000358903:p.Arg440His	177.0	0.0	.		151.0	31.0	.	NM_000102	Q5TZV7	Missense_Mutation	SNP	ENST00000369887.3	hg19	CCDS7541.1	.	.	.	.	.	.	.	.	.	.	C	35	5.529855	0.96446	.	.	ENSG00000148795	ENST00000369887	D	0.92805	-3.11	5.62	5.62	0.85841	Cytochrome P450, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97195	0.9083	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97779	1.0231	10	0.87932	D	0	.	19.259	0.93959	0.0:1.0:0.0:0.0	.	440	P05093	CP17A_HUMAN	H	440	ENSP00000358903:R440H	ENSP00000358903:R440H	R	-	2	0	CYP17A1	104580657	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	7.281000	0.78621	2.650000	0.89964	0.555000	0.69702	CGC	.	.	.	none		0.597	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1	NM_000102	
NLRP6	171389	hgsc.bcm.edu	37	11	284253	284253	+	Missense_Mutation	SNP	A	A	G	rs150530901		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr11:284253A>G	ENST00000312165.5	+	6	2225	c.2225A>G	c.(2224-2226)gAc>gGc	p.D742G	NLRP6_ENST00000534750.1_Missense_Mutation_p.D741G	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	742					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		AAACTCCCTGACGCGGTCTGC	0.627																																					p.D742G		Atlas-SNP	.											.	NLRP6	4	.	0			c.A2225G						PASS	.	A	GLY/ASP	1,4405	2.1+/-5.4	0,1,2202	43.0	42.0	42.0		2225	1.4	0.0	11	dbSNP_134	42	0,8600		0,0,4300	no	missense	NLRP6	NM_138329.1	94	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	742/893	284253	1,13005	2203	4300	6503	SO:0001583	missense	171389	exon6			TCCCTGACGCGGT	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.2225A>G	chr11.hg19:g.284253A>G	ENSP00000309767:p.Asp742Gly	60.0	0.0	.		87.0	25.0	.	NM_138329	A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	hg19	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	A	3.343	-0.134159	0.06711	2.27E-4	0.0	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.57273	0.41;0.41	2.61	1.44	0.22558	.	0.174398	0.23650	U	0.045934	T	0.59018	0.2163	L	0.58354	1.805	0.09310	N	1	D;D	0.63880	0.972;0.993	P;D	0.72338	0.689;0.977	T	0.48222	-0.9054	10	0.19590	T	0.45	.	5.8126	0.18475	0.7241:0.2759:0.0:0.0	.	741;742	E9PJZ8;P59044	.;NALP6_HUMAN	G	741;742	ENSP00000433617:D741G;ENSP00000309767:D742G	ENSP00000309767:D742G	D	+	2	0	NLRP6	274253	0.000000	0.05858	0.013000	0.15412	0.149000	0.21700	0.094000	0.15107	0.419000	0.25927	0.374000	0.22700	GAC	.	A|1.000;G|0.000	0.000	weak		0.627	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
CTSD	1509	hgsc.bcm.edu	37	11	1785082	1785082	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr11:1785082G>A	ENST00000236671.2	-	1	140	c.8C>T	c.(7-9)cCc>cTc	p.P3L	AC068580.5_ENST00000446489.1_RNA|AC068580.1_ENST00000580120.1_RNA|AC068580.6_ENST00000449248.1_RNA	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	3					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAGGCTGGAGGGCTGCATGGC	0.736																																					p.P3L		Atlas-SNP	.											.	CTSD	26	.	0			c.C8T						PASS	.																																			SO:0001583	missense	1509	exon1			CTGGAGGGCTGCA	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.8C>T	chr11.hg19:g.1785082G>A	ENSP00000236671:p.Pro3Leu	0.0	0.0	.		23.0	13.0	.	NM_001909	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	hg19	CCDS7725.1	.	.	.	.	.	.	.	.	.	.	g	8.700	0.909609	0.17833	.	.	ENSG00000117984	ENST00000236671	T	0.52295	0.67	3.51	1.34	0.21922	.	3.791350	0.01307	N	0.010510	T	0.26231	0.0640	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.19289	-1.0310	10	0.12103	T	0.63	.	4.9541	0.14031	0.122:0.0:0.6694:0.2087	.	3	P07339	CATD_HUMAN	L	3	ENSP00000236671:P3L	ENSP00000236671:P3L	P	-	2	0	CTSD	1741658	0.001000	0.12720	0.258000	0.24420	0.029000	0.11900	0.135000	0.15952	0.769000	0.33313	0.549000	0.68633	CCC	.	.	.	none		0.736	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
MRGPRX4	117196	hgsc.bcm.edu	37	11	18195097	18195097	+	Silent	SNP	C	C	T	rs267602809		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr11:18195097C>T	ENST00000314254.3	+	1	714	c.294C>T	c.(292-294)ctC>ctT	p.L98L	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GCAAAATCCTCGTTTCTGTGA	0.527																																					p.L98L		Atlas-SNP	.											MRGPRX4,NS,carcinoma,0,1	MRGPRX4	68	.	0			c.C294T						PASS	.						129.0	103.0	112.0					11																	18195097		2199	4293	6492	SO:0001819	synonymous_variant	117196	exon1			AATCCTCGTTTCT	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.294C>T	chr11.hg19:g.18195097C>T		235.0	1.0	.		187.0	33.0	.	NM_054032	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Silent	SNP	ENST00000314254.3	hg19	CCDS7831.1																																																																																			.	.	.	none		0.527	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032	
LRP5	4041	hgsc.bcm.edu	37	11	68181318	68181318	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr11:68181318G>T	ENST00000294304.7	+	12	2771	c.2665G>T	c.(2665-2667)Gtg>Ttg	p.V889L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	889	Beta-propeller 3.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CCTGGACTTCGTGATGGACAT	0.592																																					p.V889L		Atlas-SNP	.											LRP5,NS,carcinoma,0,1	LRP5	136	.	0			c.G2665T						PASS	.						87.0	76.0	79.0					11																	68181318		2200	4294	6494	SO:0001583	missense	4041	exon12			GACTTCGTGATGG	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.2665G>T	chr11.hg19:g.68181318G>T	ENSP00000294304:p.Val889Leu	59.0	1.0	.		67.0	23.0	.	NM_002335	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	hg19	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708228	0.89018	.	.	ENSG00000162337	ENST00000294304	D	0.91407	-2.84	5.02	5.02	0.67125	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.43579	U	0.000546	D	0.88815	0.6539	N	0.25957	0.775	0.58432	D	0.999999	P;P	0.39759	0.687;0.687	P;P	0.48368	0.575;0.575	D	0.86093	0.1551	10	0.21540	T	0.41	.	18.5313	0.90993	0.0:0.0:1.0:0.0	.	889;889	Q9UES7;O75197	.;LRP5_HUMAN	L	889	ENSP00000294304:V889L	ENSP00000294304:V889L	V	+	1	0	LRP5	67937894	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.610000	0.54125	2.601000	0.87937	0.561000	0.74099	GTG	.	.	.	none		0.592	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
DNAJC14	85406	hgsc.bcm.edu	37	12	56217194	56217194	+	Missense_Mutation	SNP	C	C	G	rs541345798		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr12:56217194C>G	ENST00000357606.3	-	4	1795	c.1506G>C	c.(1504-1506)gaG>gaC	p.E502D	RP11-762I7.5_ENST00000546837.1_Missense_Mutation_p.V132L|RP11-762I7.5_ENST00000552719.1_5'Flank|DNAJC14_ENST00000317269.3_Missense_Mutation_p.E502D|DNAJC14_ENST00000317287.5_Missense_Mutation_p.E502D			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	502	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						ACATCTCATACTCCTTTCGCT	0.463																																					p.E502D		Atlas-SNP	.											.	DNAJC14	52	.	0			c.G1506C						PASS	.						95.0	84.0	87.0					12																	56217194		2203	4300	6503	SO:0001583	missense	85406	exon3			CTCATACTCCTTT	AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.1506G>C	chr12.hg19:g.56217194C>G	ENSP00000350223:p.Glu502Asp	76.0	0.0	.		86.0	15.0	.	NM_032364	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	hg19	CCDS8894.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.64|17.64	3.439259|3.439259	0.63067|0.63067	.|.	.|.	ENSG00000135392|ENSG00000257390	ENST00000357606;ENST00000317269;ENST00000537962;ENST00000317287|ENST00000546837	T;T;T|.	0.32023|.	1.47;1.47;1.47|.	5.85|5.85	4.7|4.7	0.59300|0.59300	Heat shock protein DnaJ, N-terminal (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.45657|0.45657	0.1353|0.1353	L|L	0.35542|0.35542	1.07|1.07	0.49483|0.49483	D|D	0.999795|0.999795	B;B|.	0.29766|.	0.256;0.256|.	P;P|.	0.50231|.	0.635;0.635|.	T|T	0.33240|0.33240	-0.9876|-0.9876	10|5	0.42905|.	T|.	0.14|.	-16.2803|-16.2803	7.9219|7.9219	0.29850|0.29850	0.0:0.1589:0.0:0.8411|0.0:0.1589:0.0:0.8411	.|.	502;502|.	Q6Y2X3;A8K5A7|.	DJC14_HUMAN;.|.	D|L	502;502;212;502|132	ENSP00000350223:E502D;ENSP00000316240:E502D;ENSP00000317500:E502D|.	ENSP00000316240:E502D|.	E|V	-|-	3|1	2|0	DNAJC14|RP11-762I7.5	54503461|54503461	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	2.807000|2.807000	0.47955|0.47955	1.141000|1.141000	0.42275|0.42275	-0.294000|-0.294000	0.09567|0.09567	GAG|GTA	.	.	.	none		0.463	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364	
DDX54	79039	hgsc.bcm.edu	37	12	113610195	113610195	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr12:113610195G>A	ENST00000306014.5	-	11	1269	c.1242C>T	c.(1240-1242)agC>agT	p.S414S	DDX54_ENST00000314045.7_Silent_p.S414S	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	414	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TGGCGGGGAAGCTGTAGTTGA	0.637																																					p.S414S		Atlas-SNP	.											.	DDX54	73	.	0			c.C1242T						PASS	.						82.0	67.0	72.0					12																	113610195		2203	4300	6503	SO:0001819	synonymous_variant	79039	exon11			GGGGAAGCTGTAG	AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.1242C>T	chr12.hg19:g.113610195G>A		175.0	0.0	.		215.0	72.0	.	NM_024072	Q86YT8|Q9BRZ1	Silent	SNP	ENST00000306014.5	hg19	CCDS31907.1																																																																																			.	.	.	none		0.637	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405435.1	NM_024072	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45693181	45693181	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr14:45693181C>T	ENST00000310806.4	-	11	3067	c.2609G>A	c.(2608-2610)tGc>tAc	p.C870Y		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	870					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						ACCAGGTAAGCATTCTAAGGG	0.388																																					p.C870Y		Atlas-SNP	.											.	MIS18BP1	92	.	0			c.G2609A						PASS	.						95.0	90.0	91.0					14																	45693181		2203	4300	6503	SO:0001583	missense	55320	exon11			GGTAAGCATTCTA	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2609G>A	chr14.hg19:g.45693181C>T	ENSP00000309790:p.Cys870Tyr	57.0	0.0	.		50.0	14.0	.	NM_018353	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	ENST00000310806.4	hg19	CCDS9684.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.229082	0.00280	.	.	ENSG00000129534	ENST00000310806	T	0.17691	2.26	5.72	2.87	0.33458	Homeodomain-like (1);	0.719999	0.14355	N	0.324833	T	0.12220	0.0297	L	0.57536	1.79	0.09310	N	1	P	0.51351	0.944	B	0.40165	0.321	T	0.10590	-1.0623	10	0.02654	T	1	0.5125	5.2769	0.15655	0.162:0.665:0.0:0.173	.	870	Q6P0N0	M18BP_HUMAN	Y	870	ENSP00000309790:C870Y	ENSP00000309790:C870Y	C	-	2	0	MIS18BP1	44762931	0.000000	0.05858	0.007000	0.13788	0.137000	0.21094	0.035000	0.13797	0.413000	0.25759	0.655000	0.94253	TGC	.	.	.	none		0.388	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
STOML1	9399	hgsc.bcm.edu	37	15	74281093	74281093	+	Silent	SNP	A	A	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr15:74281093A>G	ENST00000316900.5	-	4	565	c.441T>C	c.(439-441)ttT>ttC	p.F147F	STOML1_ENST00000316911.6_Silent_p.F97F|STOML1_ENST00000561656.1_Silent_p.F60F|STOML1_ENST00000564777.1_Silent_p.F97F|STOML1_ENST00000541638.1_Silent_p.F105F|STOML1_ENST00000359750.4_Silent_p.F147F	NM_001256672.1|NM_001256675.1|NM_001256677.1|NM_004809.4	NP_001243601.1|NP_001243604.1|NP_001243606.1|NP_004800.2	Q9UBI4	STML1_HUMAN	stomatin (EPB72)-like 1	147						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CCCAGATGCGAAACTGGACAT	0.612																																					p.F147F		Atlas-SNP	.											.	STOML1	22	.	0			c.T441C						PASS	.						108.0	100.0	103.0					15																	74281093		2198	4297	6495	SO:0001819	synonymous_variant	9399	exon4			GATGCGAAACTGG	Y16522	CCDS10254.1, CCDS58381.1, CCDS58382.1, CCDS58383.1, CCDS58384.1, CCDS58385.1	15q24-q25	2008-07-18			ENSG00000067221	ENSG00000067221			14560	protein-coding gene	gene with protein product	"""stomatin-like 1"", ""stomatin (EBP72)-like 1"""	608326				9931417	Standard	NM_004809		Approved	hUNC-24, SLP-1, STORP, FLJ36370	uc002awe.4	Q9UBI4	OTTHUMG00000137608	ENST00000316900.5:c.441T>C	chr15.hg19:g.74281093A>G		89.0	0.0	.		71.0	15.0	.	NM_001256672	B3KQN0|B4DUU5|B4DXM9|E7ESC0|H3BRP3|O95675|Q4PNR4|Q6FGL8|Q8WYI7|Q9UMB9|Q9UMC0|Q9Y6H9	Silent	SNP	ENST00000316900.5	hg19	CCDS10254.1																																																																																			.	.	.	none		0.612	STOML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269022.1	NM_004809	
LMAN1L	79748	hgsc.bcm.edu	37	15	75111060	75111060	+	Splice_Site	SNP	G	G	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr15:75111060G>T	ENST00000309664.5	+	5	638	c.499G>T	c.(499-501)Gat>Tat	p.D167Y	RP11-414J4.2_ENST00000564823.1_RNA|LMAN1L_ENST00000379709.3_Splice_Site_p.D167Y	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	167	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGCCCACAGGGATGGAGCTAG	0.577																																					p.D167Y		Atlas-SNP	.											.	LMAN1L	43	.	0			c.G499T						PASS	.						38.0	32.0	34.0					15																	75111060		2197	4295	6492	SO:0001630	splice_region_variant	79748	exon5			CACAGGGATGGAG	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.498-1G>T	chr15.hg19:g.75111060G>T		56.0	0.0	.		68.0	24.0	.	NM_021819	Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	hg19	CCDS10270.1	.	.	.	.	.	.	.	.	.	.	G	9.914	1.210396	0.22289	.	.	ENSG00000140506	ENST00000309664;ENST00000456603;ENST00000379709	T;T	0.69685	-0.42;-0.42	4.89	0.74	0.18330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.786555	0.11191	N	0.589939	T	0.75752	0.3892	M	0.87456	2.885	0.53005	D	0.999961	B;D;B;B	0.59767	0.009;0.986;0.009;0.271	B;P;B;B	0.54100	0.018;0.742;0.018;0.121	T	0.71790	-0.4486	10	0.87932	D	0	.	5.9881	0.19446	0.1621:0.0:0.5719:0.266	.	59;167;95;167	B4DGW5;Q9HAT1-3;B4DU67;Q9HAT1	.;.;.;LMA1L_HUMAN	Y	167;59;167	ENSP00000310431:D167Y;ENSP00000369031:D167Y	ENSP00000310431:D167Y	D	+	1	0	LMAN1L	72898113	1.000000	0.71417	0.051000	0.19133	0.011000	0.07611	1.479000	0.35453	-0.273000	0.09246	-2.281000	0.00270	GAT	.	.	.	none		0.577	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4		Missense_Mutation
ST8SIA2	8128	hgsc.bcm.edu	37	15	93007416	93007417	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr15:93007416_93007417TC>AT	ENST00000268164.3	+	6	1166_1167	c.929_930TC>AT	c.(928-930)aTC>aAT	p.I310N	ST8SIA2_ENST00000539113.1_Missense_Mutation_p.I289N	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	310					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGCAAACAAATCTACCTCTACG	0.49																																					p.I310N|p.I310I		Atlas-SNP	.											.	ST8SIA2	41	.	0			c.T929A|c.C930T						PASS	.																																			SO:0001583	missense	8128	exon6			AACAAATCTACCT|ACAAATCTACCTC	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	Exception_encountered	chr15.hg19:g.93007416_93007417delinsAT	ENSP00000268164:p.Ile310Asn	119.0	0.0	.		74.0|76.0	18.0|19.0	.	NM_006011	Q4VAZ0|Q92470|Q92746	Missense_Mutation|Silent	SNP	ENST00000268164.3	hg19	CCDS10372.1																																																																																			.	.	.	none		0.490	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
MMP15	4324	hgsc.bcm.edu	37	16	58079023	58079023	+	Missense_Mutation	SNP	G	G	C			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr16:58079023G>C	ENST00000219271.3	+	10	2468	c.1683G>C	c.(1681-1683)gaG>gaC	p.E561D		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	561					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	GCTGCCAGGAGCACGTGGAGC	0.682																																					p.E561D		Atlas-SNP	.											.	MMP15	58	.	0			c.G1683C						PASS	.						15.0	15.0	15.0					16																	58079023		2197	4298	6495	SO:0001583	missense	4324	exon10			CCAGGAGCACGTG	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.1683G>C	chr16.hg19:g.58079023G>C	ENSP00000219271:p.Glu561Asp	50.0	0.0	.		90.0	28.0	.	NM_002428	A0A2U6|Q14111	Missense_Mutation	SNP	ENST00000219271.3	hg19	CCDS10792.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.316412	0.23908	.	.	ENSG00000102996	ENST00000219271	T	0.15952	2.38	4.5	1.48	0.22813	Hemopexin/matrixin (1);	0.444889	0.25380	N	0.031083	T	0.07324	0.0185	N	0.08118	0	0.36663	D	0.878058	P	0.49185	0.92	P	0.45232	0.474	T	0.41662	-0.9496	10	0.15952	T	0.53	.	3.3205	0.07048	0.2891:0.0:0.5282:0.1827	.	561	P51511	MMP15_HUMAN	D	561	ENSP00000219271:E561D	ENSP00000219271:E561D	E	+	3	2	MMP15	56636524	1.000000	0.71417	0.967000	0.41034	0.905000	0.53344	1.330000	0.33781	0.167000	0.19631	-0.277000	0.10078	GAG	.	.	.	none		0.682	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428	
CLEC18B	497190	hgsc.bcm.edu	37	16	74447559	74447559	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr16:74447559A>T	ENST00000339953.5	-	4	593	c.472T>A	c.(472-474)Tca>Aca	p.S158T		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	158	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AGCTGGCTTGAGGTGGCCCAC	0.607																																					p.S158T		Atlas-SNP	.											.	CLEC18B	45	.	0			c.T472A						PASS	.						99.0	99.0	99.0					16																	74447559		2198	4298	6496	SO:0001583	missense	497190	exon4			GGCTTGAGGTGGC	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.472T>A	chr16.hg19:g.74447559A>T	ENSP00000341051:p.Ser158Thr	270.0	0.0	.		245.0	21.0	.	NM_001011880	B4DF90	Missense_Mutation	SNP	ENST00000339953.5	hg19	CCDS32484.1	.	.	.	.	.	.	.	.	.	.	a	14.17	2.454450	0.43634	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492;ENST00000425714	T	0.08807	3.05	3.1	3.1	0.35709	CAP domain (3);	0.000000	0.64402	D	0.000001	T	0.12390	0.0301	N	0.21545	0.675	0.42457	D	0.992777	D;P;D	0.63880	0.993;0.95;0.983	D;P;D	0.77557	0.99;0.871;0.928	T	0.22871	-1.0204	10	0.23891	T	0.37	.	7.6588	0.28392	1.0:0.0:0.0:0.0	.	78;158;158	Q6UXF7-2;C9JSV1;Q6UXF7	.;.;CL18B_HUMAN	T	158;158;158;78	ENSP00000341051:S158T	ENSP00000268492:S158T	S	-	1	0	CLEC18B	73005060	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	6.560000	0.73950	1.286000	0.44565	0.438000	0.28831	TCA	.	.	.	none		0.607	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	
CTDNEP1	23399	hgsc.bcm.edu	37	17	7147902	7147902	+	Silent	SNP	A	A	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:7147902A>G	ENST00000573600.1	-	8	1063	c.642T>C	c.(640-642)ctT>ctC	p.L214L	GABARAP_ENST00000573928.1_5'Flank|CTDNEP1_ENST00000572043.1_Silent_p.L81L|GABARAP_ENST00000571253.1_5'Flank|GABARAP_ENST00000571129.1_5'Flank|CTD-2545G14.7_ENST00000570760.2_Missense_Mutation_p.F18S|CTDNEP1_ENST00000318988.6_Silent_p.L214L|GABARAP_ENST00000302386.5_5'Flank|GABARAP_ENST00000577035.1_5'Flank|CTDNEP1_ENST00000574322.1_Silent_p.L214L			O95476	CNEP1_HUMAN	CTD nuclear envelope phosphatase 1	214	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				gamete generation (GO:0007276)|mesoderm development (GO:0007498)|nuclear envelope organization (GO:0006998)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of triglyceride biosynthetic process (GO:0010867)|protein dephosphorylation (GO:0006470)|protein localization to nucleus (GO:0034504)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|Nem1-Spo7 phosphatase complex (GO:0071595)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(9)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	15						GCAGGTTGAGAAGGGCTGTGT	0.522																																					p.L214L		Atlas-SNP	.											.	CTDNEP1	26	.	0			c.T642C						PASS	.						70.0	67.0	68.0					17																	7147902		2203	4300	6503	SO:0001819	synonymous_variant	23399	exon7			GTTGAGAAGGGCT	AJ011916	CCDS11093.1	17p13	2012-11-27	2010-10-27	2010-10-27	ENSG00000175826	ENSG00000175826		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	19085	protein-coding gene	gene with protein product	"""C-terminal domain nuclear envelope phosphatase 1"""	610684	"""dullard homolog (Xenopus laevis)"""	DULLARD		12083771, 17141153	Standard	NM_015343		Approved	HSA011916, NET56	uc002gfd.2	O95476	OTTHUMG00000102180	ENST00000573600.1:c.642T>C	chr17.hg19:g.7147902A>G		63.0	0.0	.		58.0	18.0	.	NM_001143775	D3DTN7|Q96GQ9	Silent	SNP	ENST00000573600.1	hg19	CCDS11093.1																																																																																			.	.	.	none		0.522	CTDNEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440215.1	NM_015343	
CHD3	1107	hgsc.bcm.edu	37	17	7794342	7794342	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:7794342C>G	ENST00000330494.7	+	4	619	c.469C>G	c.(469-471)Cac>Gac	p.H157D	CHD3_ENST00000380358.4_Missense_Mutation_p.H216D|CHD3_ENST00000358181.4_Missense_Mutation_p.H157D	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	157					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GGAGGATTACCACACGCTCAC	0.527																																					p.H216D		Atlas-SNP	.											.	CHD3	169	.	0			c.C646G						PASS	.						166.0	142.0	150.0					17																	7794342		2203	4300	6503	SO:0001583	missense	1107	exon4			GATTACCACACGC	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.469C>G	chr17.hg19:g.7794342C>G	ENSP00000332628:p.His157Asp	184.0	0.0	.		196.0	47.0	.	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	hg19	CCDS32554.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.56|15.56	2.869301|2.869301	0.51588|0.51588	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494|ENST00000452447	D;D;D|.	0.89746|.	-2.56;-2.49;-2.49|.	4.54|4.54	4.54|4.54	0.55810|0.55810	High mobility group, HMG1/HMG2 (1);CHD, N-terminal (1);|.	0.000000|.	0.48286|.	D|.	0.000185|.	T|T	0.46833|0.46833	0.1413|0.1413	N|N	0.11427|0.11427	0.14|0.14	0.46061|0.46061	D|D	0.998847|0.998847	P;P;P|.	0.42584|.	0.531;0.586;0.784|.	B;B;P|.	0.45753|.	0.275;0.396;0.492|.	T|T	0.43048|0.43048	-0.9415|-0.9415	10|5	0.33940|.	T|.	0.23|.	-20.7739|-20.7739	17.4864|17.4864	0.87689|0.87689	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	157;157;216|.	Q12873-2;Q12873;E9PG89|.	.;CHD3_HUMAN;.|.	D|R	216;157;157|31	ENSP00000369716:H216D;ENSP00000350907:H157D;ENSP00000332628:H157D|.	ENSP00000332628:H157D|.	H|P	+|+	1|2	0|0	CHD3|CHD3	7735067|7735067	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.592000|3.592000	0.53993|0.53993	2.349000|2.349000	0.79799|0.79799	0.557000|0.557000	0.71058|0.71058	CAC|CCA	.	.	.	none		0.527	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
SLC47A1	55244	hgsc.bcm.edu	37	17	19449787	19449787	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:19449787T>C	ENST00000270570.4	+	3	363	c.277T>C	c.(277-279)Tct>Cct	p.S93P	SLC47A1_ENST00000571335.1_5'UTR|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000575023.1_Missense_Mutation_p.S93P|SLC47A1_ENST00000436810.2_Intron|SLC47A1_ENST00000542886.1_Missense_Mutation_p.S93P|SLC47A1_ENST00000395585.1_Missense_Mutation_p.S93P|SLC47A1_ENST00000457293.1_Missense_Mutation_p.S93P	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	93					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	ATTCGGCTTATCTTCTGCCTG	0.453																																					p.S93P		Atlas-SNP	.											.	SLC47A1	55	.	0			c.T277C						PASS	.						201.0	160.0	174.0					17																	19449787		2203	4300	6503	SO:0001583	missense	55244	exon3			GGCTTATCTTCTG		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.277T>C	chr17.hg19:g.19449787T>C	ENSP00000270570:p.Ser93Pro	156.0	0.0	.		172.0	36.0	.	NM_018242	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	hg19	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	T	15.29	2.790304	0.50102	.	.	ENSG00000142494	ENST00000270570;ENST00000457293;ENST00000542886;ENST00000395585	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.32	4.17	0.49024	.	0.175212	0.49305	D	0.000151	T	0.65554	0.2702	M	0.91300	3.195	0.39743	D	0.971774	D;D;D	0.71674	0.998;0.984;0.957	D;D;P	0.76575	0.988;0.944;0.906	T	0.75167	-0.3413	10	0.72032	D	0.01	-17.7724	12.3905	0.55356	0.0:0.0:0.1831:0.8169	.	93;93;93	B4DYV3;Q96FL8;Q96FL8-3	.;S47A1_HUMAN;.	P	93	ENSP00000270570:S93P;ENSP00000415586:S93P;ENSP00000440435:S93P;ENSP00000378951:S93P	ENSP00000270570:S93P	S	+	1	0	SLC47A1	19390379	0.016000	0.18221	1.000000	0.80357	0.472000	0.32918	0.078000	0.14761	2.027000	0.59764	0.454000	0.30748	TCT	.	.	.	none		0.453	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
TLK2	11011	hgsc.bcm.edu	37	17	60679418	60679418	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:60679418T>A	ENST00000326270.9	+	20	2070	c.1802T>A	c.(1801-1803)gTa>gAa	p.V601E	TLK2_ENST00000343388.7_Missense_Mutation_p.V547E|TLK2_ENST00000542523.1_Missense_Mutation_p.V547E|TLK2_ENST00000346027.5_Missense_Mutation_p.V579E|TLK2_ENST00000582809.1_Missense_Mutation_p.V430E	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	601	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						ATTCTTTTAGTAAATGGTACA	0.343																																					p.V579E		Atlas-SNP	.											TLK2_ENST00000346027,NS,carcinoma,0,3	TLK2	223	.	0			c.T1736A						PASS	.						67.0	69.0	68.0					17																	60679418		2203	4300	6503	SO:0001583	missense	11011	exon19			TTTTAGTAAATGG	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1802T>A	chr17.hg19:g.60679418T>A	ENSP00000316512:p.Val601Glu	52.0	0.0	.		81.0	5.0	.	NM_006852	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	hg19		.	.	.	.	.	.	.	.	.	.	T	14.56	2.573086	0.45902	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	5.78	5.78	0.91487	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	N	0.13235	0.315	0.80722	D	1	D;B;B;B	0.89917	1.0;0.34;0.126;0.071	D;B;B;B	0.83275	0.996;0.07;0.112;0.115	T	0.05451	-1.0884	10	0.06891	T	0.86	.	15.2878	0.73843	0.0:0.0:0.0:1.0	.	601;547;579;579	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	E	579;547;601;547	ENSP00000275780:V579E;ENSP00000340800:V547E;ENSP00000316512:V601E;ENSP00000442311:V547E	ENSP00000316512:V601E	V	+	2	0	TLK2	58033150	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.201000	0.70794	0.459000	0.35465	GTA	.	.	.	none		0.343	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
LRRC37A3	374819	hgsc.bcm.edu	37	17	62855782	62855782	+	Silent	SNP	A	A	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:62855782A>T	ENST00000584306.1	-	11	5012	c.4482T>A	c.(4480-4482)atT>atA	p.I1494I	LRRC37A3_ENST00000334962.5_Silent_p.I471I|LRRC37A3_ENST00000319651.5_Silent_p.I1494I|LRRC37A3_ENST00000339474.5_Silent_p.I612I|LRRC37A3_ENST00000400877.3_Silent_p.I532I	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1494						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TAACATGAGCAATGAGCCTTC	0.522																																					p.I1494I		Atlas-SNP	.											.	LRRC37A3	75	.	0			c.T4482A						PASS	.						186.0	189.0	188.0					17																	62855782		2203	4300	6503	SO:0001819	synonymous_variant	374819	exon11			ATGAGCAATGAGC	AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.4482T>A	chr17.hg19:g.62855782A>T		440.0	0.0	.		433.0	90.0	.	NM_199340	Q49A01|Q49A80|Q8NB33	Silent	SNP	ENST00000584306.1	hg19	CCDS32708.1																																																																																			.	.	.	none		0.522	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445377.1	NM_199340	
CBX4	8535	hgsc.bcm.edu	37	17	77807927	77807927	+	Missense_Mutation	SNP	A	A	G	rs200965379		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:77807927A>G	ENST00000269397.4	-	5	1691	c.1514T>C	c.(1513-1515)gTg>gCg	p.V505A		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	505	Interaction with BMI1.|Poly-Ala.			V -> VAA (in Ref. 3; ACA49234). {ECO:0000305}.	chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			tgccgccgccaccgccaccgc	0.711																																					p.V505A		Atlas-SNP	.											CBX4,uveal_tract,malignant_melanoma,0,1	CBX4	40	.	0			c.T1514C						PASS	.						15.0	21.0	19.0					17																	77807927		1776	3704	5480	SO:0001583	missense	8535	exon5			GCCGCCACCGCCA	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1514T>C	chr17.hg19:g.77807927A>G	ENSP00000269397:p.Val505Ala	4.0	1.0	.		29.0	5.0	.	NM_003655	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	hg19	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	a	0.008	-1.872700	0.00542	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	.	.	.	0.575	0.575	0.17374	.	2.519730	0.02140	N	0.057046	T	0.20333	0.0489	N	0.08118	0	0.19775	N	0.999955	B	0.13594	0.008	B	0.04013	0.001	T	0.16217	-1.0410	8	0.32370	T	0.25	.	.	.	.	.	505	O00257	CBX4_HUMAN	A	505;235	.	ENSP00000269397:V505A	V	-	2	0	CBX4	75422522	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	0.179000	0.16840	0.475000	0.27415	0.158000	0.16466	GTG	.	.	.	weak		0.711	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
MC5R	4161	hgsc.bcm.edu	37	18	13826448	13826448	+	Silent	SNP	G	G	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr18:13826448G>A	ENST00000324750.3	+	1	906	c.684G>A	c.(682-684)gcG>gcA	p.A228A	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	228				ALPGASSARQRTSM -> LCPGPALRGRGPAW (in Ref. 1). {ECO:0000305}.	G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						CCAGCTCTGCGCGGCAGAGGA	0.617																																					p.A228A		Atlas-SNP	.											MC5R,NS,carcinoma,0,1	MC5R	83	.	0			c.G684A						PASS	.						210.0	180.0	190.0					18																	13826448		2203	4300	6503	SO:0001819	synonymous_variant	4161	exon1			CTCTGCGCGGCAG	AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.684G>A	chr18.hg19:g.13826448G>A		45.0	1.0	.		125.0	28.0	.	NM_005913	B0YJ34|Q502V1	Silent	SNP	ENST00000324750.3	hg19	CCDS11868.1																																																																																			.	.	.	none		0.617	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913	
ZNF780A	284323	hgsc.bcm.edu	37	19	40578806	40578806	+	IGR	SNP	A	A	T	rs528950544		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr19:40578806A>T	ENST00000595687.2	-	0	3472				ZNF780A_ENST00000414720.2_Missense_Mutation_p.F145L|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000450241.2_3'UTR	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					agagataaccaaatgcaatgc	0.353																																					p.F145L		Atlas-SNP	.											.	ZNF780A	156	.	0			c.T435A						PASS	.						112.0	98.0	103.0					19																	40578806		692	1591	2283	SO:0001628	intergenic_variant	284323	exon8			ATAACCAAATGCA	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119		chr19.hg19:g.40578806A>T		69.0	0.0	.		59.0	4.0	.	NM_001142579	E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	hg19	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	A	11.53	1.666731	0.29604	.	.	ENSG00000197782	ENST00000414720	T	0.00620	6.17	0.516	0.516	0.17019	.	.	.	.	.	T	0.00998	0.0033	.	.	.	0.21256	N	0.999747	P	0.46395	0.877	P	0.51866	0.682	T	0.55341	-0.8156	7	0.25751	T	0.34	.	.	.	.	.	145	O75290-2	.	L	145	ENSP00000416294:F145L	ENSP00000416294:F145L	F	-	3	2	ZNF780A	45270646	0.004000	0.15560	0.096000	0.21009	0.182000	0.23217	0.148000	0.16224	0.452000	0.26830	0.254000	0.18369	TTT	.	.	.	none		0.353	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880	
PRR19	284338	hgsc.bcm.edu	37	19	42814045	42814045	+	Silent	SNP	C	C	A	rs78424339		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr19:42814045C>A	ENST00000499536.2	+	1	1120	c.309C>A	c.(307-309)ccC>ccA	p.P103P	PRR19_ENST00000341747.3_Silent_p.P103P|PRR19_ENST00000598490.1_Silent_p.P103P			A6NJB7	PRR19_HUMAN	proline rich 19	103										NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				CCACACTCCCCGCCAAGCCCT	0.667																																					p.P103P		Atlas-SNP	.											PRR19,NS,carcinoma,0,1	PRR19	30	.	0			c.C309A						PASS	.						40.0	51.0	47.0					19																	42814045		2203	4300	6503	SO:0001819	synonymous_variant	284338	exon2			ACTCCCCGCCAAG	AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.309C>A	chr19.hg19:g.42814045C>A		40.0	1.0	.		61.0	3.0	.	NM_199285	A8K663|B3KW48|Q6P584	Silent	SNP	ENST00000499536.2	hg19	CCDS33036.1																																																																																			.	C|0.500;T|0.500	.	alt		0.667	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285	
DLGAP4	22839	hgsc.bcm.edu	37	20	35064566	35064566	+	Missense_Mutation	SNP	G	G	A	rs199988815		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr20:35064566G>A	ENST00000373907.2	+	3	1253	c.1054G>A	c.(1054-1056)Gat>Aat	p.D352N	DLGAP4_ENST00000401952.2_Missense_Mutation_p.D352N|DLGAP4_ENST00000339266.5_Missense_Mutation_p.D352N|DLGAP4_ENST00000373913.3_Missense_Mutation_p.D352N			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	352					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				ACGCGAGACGGATGCCGCGGC	0.721																																					p.D352N		Atlas-SNP	.											.	DLGAP4	111	.	0			c.G1054A						PASS	.	G	ASN/ASP	0,4334		0,0,2167	9.0	11.0	10.0		1054	4.2	0.2	20		10	2,8418		0,2,4208	no	missense	DLGAP4	NM_014902.4	23	0,2,6375	AA,AG,GG		0.0238,0.0,0.0157	benign	352/990	35064566	2,12752	2167	4210	6377	SO:0001583	missense	22839	exon3			GAGACGGATGCCG	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.1054G>A	chr20.hg19:g.35064566G>A	ENSP00000363014:p.Asp352Asn	1.0	0.0	.		34.0	21.0	.	NM_014902	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	ENST00000373907.2	hg19		.	.	.	.	.	.	.	.	.	.	G	15.46	2.840492	0.51057	0.0	2.38E-4	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	4.22	4.22	0.49857	.	1.057480	0.07332	N	0.879344	T	0.12178	0.0296	N	0.22421	0.69	0.09310	N	1	B	0.19200	0.034	B	0.18871	0.023	T	0.22591	-1.0212	10	0.27082	T	0.32	.	13.7551	0.62933	0.0:0.0:1.0:0.0	.	352	Q9Y2H0-1	.	N	352	ENSP00000363023:D352N;ENSP00000384954:D352N;ENSP00000363014:D352N;ENSP00000341633:D352N	ENSP00000341633:D352N	D	+	1	0	DLGAP4	34497980	0.998000	0.40836	0.243000	0.24186	0.629000	0.37895	3.978000	0.56881	1.913000	0.55393	0.555000	0.69702	GAT	.	.	.	weak		0.721	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902	
PRDM15	63977	hgsc.bcm.edu	37	21	43241557	43241557	+	Silent	SNP	C	C	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr21:43241557C>T	ENST00000269844.3	-	23	3134	c.3024G>A	c.(3022-3024)ctG>ctA	p.L1008L	PRDM15_ENST00000398548.1_Silent_p.L679L|PRDM15_ENST00000538201.1_Silent_p.L662L|PRDM15_ENST00000447207.2_Silent_p.L642L|PRDM15_ENST00000422911.1_Silent_p.L699L	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1008					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TGATGTGCTTCAGGTACTCCT	0.612																																					p.L1008L		Atlas-SNP	.											PRDM15,NS,carcinoma,0,1	PRDM15	110	.	0			c.G3024A						PASS	.						171.0	113.0	132.0					21																	43241557		2203	4300	6503	SO:0001819	synonymous_variant	63977	exon23			GTGCTTCAGGTAC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.3024G>A	chr21.hg19:g.43241557C>T		115.0	0.0	.		105.0	24.0	.	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	hg19	CCDS13676.1																																																																																			.	.	.	none		0.612	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
PLXNB2	23654	hgsc.bcm.edu	37	22	50716444	50716444	+	Splice_Site	SNP	T	T	C			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr22:50716444T>C	ENST00000449103.1	-	32	5028		c.e32-2		PLXNB2_ENST00000359337.4_Splice_Site			O15031	PLXB2_HUMAN	plexin B2						brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CAGTGTGCCCTGTGGGGGGGA	0.682																																					.		Atlas-SNP	.											.	PLXNB2	172	.	0			c.4888-2A>G						PASS	.						32.0	37.0	35.0					22																	50716444		2093	4223	6316	SO:0001630	splice_region_variant	23654	exon33			GTGCCCTGTGGGG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4888-2A>G	chr22.hg19:g.50716444T>C		97.0	0.0	.		124.0	17.0	.	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Splice_Site	SNP	ENST00000449103.1	hg19	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831563	0.50845	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399991;ENST00000399964;ENST00000411680	.	.	.	4.08	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4923	0.61402	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXNB2	49058571	1.000000	0.71417	0.983000	0.44433	0.517000	0.34286	7.524000	0.81866	1.827000	0.53221	0.402000	0.26972	.	.	.	.	none		0.682	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	Intron
KMT2C	58508	hgsc.bcm.edu	37	7	151919708	151919708	+	Frame_Shift_Del	DEL	T	T	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr7:151919708delT	ENST00000262189.6	-	21	3601	c.3383delA	c.(3382-3384)gacfs	p.D1128fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.D1128fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1128					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AAAACCAATGTCTGCTACATT	0.358																																					p.D1128fs		Atlas-Indel,Pindel	.											.	MLL3	1564	.	0			c.3384delC						PASS	.						62.0	50.0	54.0					7																	151919708		2203	4296	6499	SO:0001589	frameshift_variant	58508	exon21			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3383delA	chr7.hg19:g.151919708delT	ENSP00000262189:p.Asp1128fs	343.0	0.0	0		336.0	59.0	0.175595	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	hg19	CCDS5931.1																																																																																			.	.	.	none		0.358	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MON2	23041	hgsc.bcm.edu	37	12	62954348	62954349	+	Frame_Shift_Ins	INS	-	-	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr12:62954348_62954349insT	ENST00000393632.2	+	26	3878_3879	c.3487_3488insT	c.(3487-3489)ctgfs	p.L1163fs	MON2_ENST00000393629.2_Frame_Shift_Ins_p.L1163fs|MON2_ENST00000552738.1_Frame_Shift_Ins_p.L1140fs|MON2_ENST00000393630.3_Frame_Shift_Ins_p.L1164fs|MON2_ENST00000546600.1_Frame_Shift_Ins_p.L1163fs|MON2_ENST00000280379.6_Frame_Shift_Ins_p.L1164fs	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1163					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TGAAGTATCTCTGGCTGCTCTG	0.411																																					p.L1163fs		Atlas-INDEL	.											.	MON2	160	.	0			c.3487_3488insT						PASS	.																																			SO:0001589	frameshift_variant	23041	exon26			.		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3488dupT	chr12.hg19:g.62954349_62954349dupT	ENSP00000377252:p.Leu1163fs	30.0	0.0	0		43.0	11.0	0.255814	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Frame_Shift_Ins	INS	ENST00000393632.2	hg19	CCDS31849.1																																																																																			.	.	.	none		0.411	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
NUP98	4928	hgsc.bcm.edu	37	11	3789956	3789956	+	Frame_Shift_Del	DEL	G	G	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr11:3789956delG	ENST00000324932.7	-	8	1223	c.803delC	c.(802-804)acafs	p.T268fs	NUP98_ENST00000397007.4_Frame_Shift_Del_p.T268fs|NUP98_ENST00000397004.4_Frame_Shift_Del_p.T268fs|NUP98_ENST00000355260.3_Frame_Shift_Del_p.T268fs|NUP98_ENST00000359171.4_Frame_Shift_Del_p.T268fs	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	268	FG repeats 2.|Gly/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		ACCTGGATTTGTTCCAAATCC	0.378			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.T268fs		Atlas-INDEL	.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	149	.	0			c.804delA						PASS	.						121.0	116.0	118.0					11																	3789956		2201	4298	6499	SO:0001589	frameshift_variant	4928	exon8			.	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.803delC	chr11.hg19:g.3789956delG	ENSP00000316032:p.Thr268fs	49.0	0.0	0		52.0	12.0	0.230769	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Frame_Shift_Del	DEL	ENST00000324932.7	hg19	CCDS7746.1																																																																																			.	.	.	none		0.378	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
MYH3	4621	hgsc.bcm.edu	37	17	10558280	10558281	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:10558280_10558281delGG	ENST00000583535.1	-	3	188_189	c.101_102delCC	c.(100-102)gccfs	p.A34fs	MYH3_ENST00000226209.7_Frame_Shift_Del_p.A34fs	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	34					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						AATACGTCTTGGCATCAAAGGG	0.485																																					p.34_35del		Atlas-Indel,Pindel	.											.	MYH3	227	.	0			c.102_103del						PASS	.																																			SO:0001589	frameshift_variant	4621	exon3			.		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.101_102delCC	chr17.hg19:g.10558280_10558281delGG	ENSP00000464317:p.Ala34fs	150.0	0.0	0		164.0	38.0	0.231707	NM_002470	Q15492	Frame_Shift_Del	DEL	ENST00000583535.1	hg19	CCDS11157.1																																																																																			.	.	.	none		0.485	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
MTA1	9112	hgsc.bcm.edu	37	14	105936238	105936239	+	Frame_Shift_Ins	INS	-	-	G			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr14:105936238_105936239insG	ENST00000331320.7	+	20	2120_2121	c.1906_1907insG	c.(1906-1908)cggfs	p.R636fs	MTA1_ENST00000406191.1_Frame_Shift_Ins_p.R624fs|MTA1_ENST00000405646.1_Frame_Shift_Ins_p.R619fs|MTA1_ENST00000435036.2_Frame_Shift_Ins_p.R176fs|RP11-521B24.5_ENST00000552675.1_RNA	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	636					circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		GCGCCTGATCCGGGGGGGCTCC	0.663																																					p.R636fs		Atlas-Indel,Pindel	.											.	MTA1	61	.	0			c.1906_1907insG						PASS	.																																			SO:0001589	frameshift_variant	9112	exon20			.	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.1913dupG	chr14.hg19:g.105936245_105936245dupG	ENSP00000333633:p.Arg636fs	153.0	0.0	0		139.0	28.0	0.201439	NM_004689	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Frame_Shift_Ins	INS	ENST00000331320.7	hg19	CCDS32169.1																																																																																			.	.	.	none		0.663	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15		
LAMB1	3912	hgsc.bcm.edu	37	7	107592551	107592555	+	Frame_Shift_Del	DEL	TCACA	TCACA	-	rs376884310		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	TCACA	TCACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr7:107592551_107592555delTCACA	ENST00000222399.6	-	23	3423_3427	c.3193_3197delTGTGA	c.(3193-3198)tgtgacfs	p.CD1065fs	LAMB1_ENST00000393561.1_Frame_Shift_Del_p.CD1089fs	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1065	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CGCACAGCGGTCACAGTTCTGCCCG	0.571																																					p.1065_1066del		Atlas-INDEL	.											.	LAMB1	185	.	0			c.3194_3198del						PASS	.																																			SO:0001589	frameshift_variant	3912	exon23			.	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3193_3197delTGTGA	chr7.hg19:g.107592551_107592555delTCACA	ENSP00000222399:p.Cys1065fs	240.0	0.0	0		211.0	19.0	0.0900474	NM_002291	Q14D91	Frame_Shift_Del	DEL	ENST00000222399.6	hg19	CCDS5750.1																																																																																			.	.	.	none		0.571	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
LAMB1	3912	hgsc.bcm.edu	37	7	107592557	107592562	+	In_Frame_Del	DEL	TTCTGC	TTCTGC	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	TTCTGC	TTCTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr7:107592557_107592562delTTCTGC	ENST00000222399.6	-	23	3416_3421	c.3186_3191delGCAGAA	c.(3184-3192)gggcagaac>ggc	p.QN1063del	LAMB1_ENST00000393561.1_In_Frame_Del_p.QN1087del	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1063	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GCGGTCACAGTTCTGCCCGATCACAT	0.558																																					p.1063_1064del		Atlas-INDEL	.											.	LAMB1	185	.	0			c.3187_3192del						PASS	.																																			SO:0001651	inframe_deletion	3912	exon23			.	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3186_3191delGCAGAA	chr7.hg19:g.107592557_107592562delTTCTGC	ENSP00000222399:p.Gln1063_Asn1064del	219.0	0.0	0		200.0	19.0	0.095	NM_002291	Q14D91	In_Frame_Del	DEL	ENST00000222399.6	hg19	CCDS5750.1																																																																																			.	.	.	none		0.558	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
RDH16	8608	hgsc.bcm.edu	37	12	57346721	57346721	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr12:57346721delA	ENST00000398138.3	-	3	1482	c.626delT	c.(625-627)ttcfs	p.F209fs	RDH16_ENST00000360752.4_5'UTR	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)	209					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						AGCAGTCTTGAAATAGCCAGG	0.507																																					p.F209fs	GBM(179;741 2921 43105 45298)	Atlas-Indel,Pindel	.											.	RDH16	33	.	0			c.627delC						PASS	.						128.0	124.0	125.0					12																	57346721		1873	4112	5985	SO:0001589	frameshift_variant	8608	exon3			.		CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.626delT	chr12.hg19:g.57346721delA	ENSP00000381206:p.Phe209fs	55.0	0.0	0		90.0	31.0	0.344444	NM_003708	Q9UNV2	Frame_Shift_Del	DEL	ENST00000398138.3	hg19	CCDS41797.1																																																																																			.	.	.	none		0.507	RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410898.1	NM_003708	
OSGIN2	734	hgsc.bcm.edu	37	8	90936735	90936736	+	Frame_Shift_Ins	INS	-	-	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr8:90936735_90936736insT	ENST00000297438.2	+	6	848_849	c.493_494insT	c.(493-495)ctafs	p.L165fs	OSGIN2_ENST00000451899.2_Frame_Shift_Ins_p.L209fs	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	165					meiotic nuclear division (GO:0007126)					breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTTTAGGAGCCTAAAAGGGGAT	0.322																																					p.L209fs		Atlas-INDEL	.											.	OSGIN2	73	.	0			c.625_626insT						PASS	.																																			SO:0001589	frameshift_variant	734	exon6			.	AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.494dupT	chr8.hg19:g.90936736_90936736dupT	ENSP00000297438:p.Leu165fs	56.0	0.0	0		83.0	16.0	0.192771	NM_001126111		Frame_Shift_Ins	INS	ENST00000297438.2	hg19	CCDS6248.1																																																																																			.	.	.	none		0.322	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337	
KDM1B	221656	hgsc.bcm.edu	37	6	18218101	18218101	+	Frame_Shift_Del	DEL	C	C	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr6:18218101delC	ENST00000297792.5	+	17	1851	c.1674delC	c.(1672-1674)gtcfs	p.V558fs	KDM1B_ENST00000388870.2_Frame_Shift_Del_p.V791fs|KDM1B_ENST00000397244.1_Frame_Shift_Del_p.V559fs|KDM1B_ENST00000546309.2_Frame_Shift_Del_p.V81fs			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	790					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						AAGGAACCGTCTTTTTCGCTG	0.418																																					p.V558fs		Atlas-Indel,Pindel	.											.	KDM1B	58	.	0			c.1673delT						PASS	.						216.0	181.0	193.0					6																	18218101		2203	4300	6503	SO:0001589	frameshift_variant	221656	exon17			.	AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.1674delC	chr6.hg19:g.18218101delC	ENSP00000297792:p.Val558fs	95.0	0.0	0		97.0	22.0	0.226804	NM_153042	A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Frame_Shift_Del	DEL	ENST00000297792.5	hg19	CCDS34343.1																																																																																			.	.	.	none		0.418	KDM1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277080.1	NM_153042	
ZBTB1	22890	hgsc.bcm.edu	37	14	64989255	64989256	+	Frame_Shift_Ins	INS	-	-	T			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr14:64989255_64989256insT	ENST00000554015.1	+	4	1464_1465	c.1033_1034insT	c.(1033-1035)attfs	p.I345fs	ZBTB1_ENST00000358738.3_Frame_Shift_Ins_p.I345fs|ZBTB1_ENST00000394712.2_Frame_Shift_Ins_p.I345fs|RP11-973N13.4_ENST00000554918.1_RNA			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	345					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		CTTTAACATTATTAAAGTTACT	0.347																																					p.I345fs		Atlas-Indel,Pindel	.											.	ZBTB1	93	.	0			c.1033_1034insT						PASS	.																																			SO:0001589	frameshift_variant	22890	exon2			.	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1035dupT	chr14.hg19:g.64989257_64989257dupT	ENSP00000451000:p.Ile345fs	216.0	0.0	0		151.0	36.0	0.238411	NM_001123329	A8K6S8|Q86SW8	Frame_Shift_Ins	INS	ENST00000554015.1	hg19	CCDS45126.1																																																																																			.	.	.	none		0.347	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
HEATR5B	54497	hgsc.bcm.edu	37	2	37286106	37286107	+	Frame_Shift_Ins	INS	-	-	A			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:37286106_37286107insA	ENST00000233099.5	-	13	1968_1969	c.1873_1874insT	c.(1873-1875)tgtfs	p.C625fs	HEATR5B_ENST00000354531.2_Frame_Shift_Ins_p.C625fs	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	625						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TAGCTCAGGACAATGTGCAACG	0.347																																					p.C625fs		Atlas-Indel,Pindel	.											.	HEATR5B	185	.	0			c.1874_1875insT						PASS	.																																			SO:0001589	frameshift_variant	54497	exon13			.	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.1874dupT	chr2.hg19:g.37286108_37286108dupA	ENSP00000233099:p.Cys625fs	309.0	0.0	0		284.0	57.0	0.200704	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Frame_Shift_Ins	INS	ENST00000233099.5	hg19	CCDS33181.1																																																																																			.	.	.	none		0.347	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
TRPC4AP	26133	hgsc.bcm.edu	37	20	33603843	33603844	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr20:33603843_33603844insAA	ENST00000252015.2	-	10	1406_1407	c.1317_1318insTT	c.(1315-1320)ctccatfs	p.H440fs	TRPC4AP_ENST00000451813.2_Frame_Shift_Ins_p.H432fs|TRPC4AP_ENST00000432634.2_Frame_Shift_Ins_p.H401fs|TRPC4AP_ENST00000539834.1_Frame_Shift_Ins_p.H42fs			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	440					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TTGTGACCATGGAGGACAAGGG	0.5																																					p.H440fs		Atlas-Indel,Pindel	.											.	TRPC4AP	64	.	0			c.1318_1319insTT						PASS	.																																			SO:0001589	frameshift_variant	26133	exon10			.	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1317_1318insTT	chr20.hg19:g.33603843_33603844insAA	ENSP00000252015:p.His440fs	135.0	0.0	0		143.0	32.0	0.223776	NM_015638	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Frame_Shift_Ins	INS	ENST00000252015.2	hg19	CCDS13246.1																																																																																			.	.	.	none		0.500	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
FHL5	9457	hgsc.bcm.edu	37	6	97053903	97053904	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr6:97053903_97053904delTG	ENST00000326771.2	+	5	840_841	c.460_461delTG	c.(460-462)tgtfs	p.C154fs	FHL5_ENST00000541107.1_Frame_Shift_Del_p.C154fs	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	154	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		TTGTGTGCCATGTTTTGAGAAG	0.396																																					p.153_154del		Atlas-Indel,Pindel	.											.	FHL5	73	.	0			c.459_460del						PASS	.																																			SO:0001589	frameshift_variant	9457	exon5			.	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.460_461delTG	chr6.hg19:g.97053903_97053904delTG	ENSP00000326022:p.Cys154fs	146.0	0.0	0		139.0	35.0	0.251799	NM_020482	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Frame_Shift_Del	DEL	ENST00000326771.2	hg19	CCDS5035.1																																																																																			.	.	.	none		0.396	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
CDH12	1010	hgsc.bcm.edu	37	5	21751876	21751876	+	Frame_Shift_Del	DEL	T	T	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr5:21751876delT	ENST00000382254.1	-	15	3441	c.2355delA	c.(2353-2355)gaafs	p.E786fs	CDH12_ENST00000504376.2_Frame_Shift_Del_p.E786fs|CDH12_ENST00000522262.1_Frame_Shift_Del_p.E746fs|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	786					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TATAACTCTCTTCTTCGCCAA	0.428										HNSCC(59;0.17)																											p.E786fs		Atlas-Indel,Pindel	.											.	CDH12	238	.	0			c.2356delG						PASS	.						81.0	83.0	82.0					5																	21751876		2203	4300	6503	SO:0001589	frameshift_variant	1010	exon15			.	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2355delA	chr5.hg19:g.21751876delT	ENSP00000371689:p.Glu786fs	111.0	0.0	0		121.0	33.0	0.272727	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Frame_Shift_Del	DEL	ENST00000382254.1	hg19	CCDS3890.1																																																																																			.	.	.	none		0.428	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
ATPAF2	91647	hgsc.bcm.edu	37	17	17942265	17942266	+	Frame_Shift_Ins	INS	-	-	C			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr17:17942265_17942266insC	ENST00000474627.3	-	1	216_217	c.62_63insG	c.(61-63)ggtfs	p.G21fs	ATPAF2_ENST00000585101.1_Frame_Shift_Ins_p.G21fs|GID4_ENST00000268719.4_5'Flank|GID4_ENST00000376345.3_5'Flank	NM_145691.3	NP_663729.1	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 2	21					proton-transporting ATP synthase complex assembly (GO:0043461)	mitochondrion (GO:0005739)|nuclear speck (GO:0016607)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	8	all_neural(463;0.228)					CGCTGGGGCCACCCGCCGGCCG	0.668																																					p.G21fs		Atlas-INDEL	.											.	ATPAF2	15	.	0			c.63_64insG						PASS	.																																			SO:0001589	frameshift_variant	91647	exon1			.	AF052185	CCDS32585.1	17p11.2	2012-10-12			ENSG00000171953	ENSG00000171953		"""Mitochondrial respiratory chain complex assembly factors"""	18802	protein-coding gene	gene with protein product		608918				11410595, 11997338	Standard	NM_145691		Approved	Atp12p, ATP12, LP3663, MGC29736	uc002gse.1	Q8N5M1	OTTHUMG00000059354	ENST00000474627.3:c.63dupG	chr17.hg19:g.17942268_17942268dupC	ENSP00000417190:p.Gly21fs	44.0	0.0	0		145.0	11.0	0.0758621	NM_145691	A6NDE5|A8K2J2|Q6XYC7	Frame_Shift_Ins	INS	ENST00000474627.3	hg19	CCDS32585.1																																																																																			.	.	.	none		0.668	ATPAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131934.3	NM_145691	
LAMA3	3909	hgsc.bcm.edu	37	18	21508155	21508158	+	Frame_Shift_Del	DEL	GATT	GATT	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	GATT	GATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr18:21508155_21508158delGATT	ENST00000313654.9	+	63	8487_8490	c.8246_8249delGATT	c.(8245-8250)agattgfs	p.RL2749fs	LAMA3_ENST00000587184.1_Frame_Shift_Del_p.RL1084fs|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Frame_Shift_Del_p.RL1140fs|LAMA3_ENST00000399516.3_Frame_Shift_Del_p.RL2693fs	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2749	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GGTGTCGTTAGATTGAATGATACT	0.436																																					p.2749_2750del		Atlas-Indel,Pindel	.											.	LAMA3	397	.	0			c.8245_8248del						PASS	.																																			SO:0001589	frameshift_variant	3909	exon63			.	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8246_8249delGATT	chr18.hg19:g.21508155_21508158delGATT	ENSP00000324532:p.Arg2749fs	215.0	0.0	0		208.0	41.0	0.197115	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Frame_Shift_Del	DEL	ENST00000313654.9	hg19	CCDS42419.1																																																																																			.	.	.	none		0.436	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LAMB1	3912	hgsc.bcm.edu	37	7	107592551	107592562	+	In_Frame_Del	DEL	TCACAGTTCTGC	TCACAGTTCTGC	-	rs376884310		TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	TCACAGTTCTGC	TCACAGTTCTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr7:107592551_107592562delTCACAGTTCTGC	ENST00000222399.6	-	23	3416_3427	c.3186_3197delGCAGAACTGTGA	c.(3184-3198)gggcagaactgtgac>ggc	p.QNCD1063del	LAMB1_ENST00000393561.1_In_Frame_Del_p.QNCD1087del	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1063	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CGCACAGCGGTCACAGTTCTGCCCGATCACAT	0.561																																					p.1063_1066del		Pindel	.											.	LAMB1	185	.	0			c.3187_3198del						PASS	.																																			SO:0001651	inframe_deletion	3912	exon23			.	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3186_3197delGCAGAACTGTGA	chr7.hg19:g.107592551_107592562delTCACAGTTCTGC	ENSP00000222399:p.Gln1063_Asp1066del	228.0	0.0	.		210.0	23.0	0.110	NM_002291	Q14D91	In_Frame_Del	DEL	ENST00000222399.6	hg19	CCDS5750.1																																																																																			.	.	.	none		0.561	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
POLR1B	84172	hgsc.bcm.edu	37	2	113330280	113330285	+	In_Frame_Del	DEL	CCAATG	CCAATG	-			TCGA-PJ-A5Z8-01A-11D-A28G-10	TCGA-PJ-A5Z8-10A-01D-A28G-10	CCAATG	CCAATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8661bd12-fa20-4263-b1ab-034a4b225560	32a7ff68-4d91-4377-bc04-dd8688d15196	g.chr2:113330280_113330285delCCAATG	ENST00000263331.5	+	13	2796_2801	c.2216_2221delCCAATG	c.(2215-2223)accaatgcc>acc	p.NA740del	POLR1B_ENST00000537335.1_In_Frame_Del_p.NA529del|POLR1B_ENST00000417433.2_In_Frame_Del_p.NA684del|POLR1B_ENST00000541869.1_In_Frame_Del_p.NA778del|POLR1B_ENST00000409894.3_In_Frame_Del_p.NA557del	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	740					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CCAATTGGGACCAATGCCATCGTTGC	0.393																																					p.739_740del	Ovarian(16;256 576 9537 23969 41147)	Pindel	.											.	POLR1B	95	.	0			c.2215_2220del						PASS	.																																			SO:0001651	inframe_deletion	84172	exon13			.	AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.2216_2221delCCAATG	chr2.hg19:g.113330280_113330285delCCAATG	ENSP00000263331:p.Asn740_Ala741del	172.0	0.0	.		120.0	10.0	0.083	NM_019014	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	In_Frame_Del	DEL	ENST00000263331.5	hg19	CCDS2097.1																																																																																			.	.	.	none		0.393	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014	
