#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBIAD1	29914	hgsc.bcm.edu	37	1	11345827	11345827	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr1:11345827T>C	ENST00000376810.5	+	2	982	c.656T>C	c.(655-657)aTc>aCc	p.I219T	UBIAD1_ENST00000376804.2_Intron	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	219					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		GTCTATGCCATCCCCCTCGCC	0.607																																					p.I219T		Atlas-SNP	.											UBIAD1,caecum,carcinoma,0,1	UBIAD1	27	.	0			c.T656C						PASS	.						170.0	136.0	148.0					1																	11345827		2203	4300	6503	SO:0001583	missense	29914	exon2			ATGCCATCCCCCT		CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.656T>C	chr1.hg19:g.11345827T>C	ENSP00000366006:p.Ile219Thr	145.0	0.0	.		107.0	39.0	.	NM_013319	B3KQG3|Q53GX3|Q5THD4	Missense_Mutation	SNP	ENST00000376810.5	hg19	CCDS129.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.514621	0.64634	.	.	ENSG00000120942	ENST00000376810	D	0.92752	-3.1	5.94	5.94	0.96194	.	0.260438	0.37623	N	0.002007	D	0.90024	0.6885	L	0.52364	1.645	0.80722	D	1	P	0.45768	0.866	B	0.43194	0.411	D	0.89014	0.3430	10	0.33940	T	0.23	-5.3535	14.1354	0.65284	0.0:0.0:0.0:1.0	.	219	Q9Y5Z9	UBIA1_HUMAN	T	219	ENSP00000366006:I219T	ENSP00000366006:I219T	I	+	2	0	UBIAD1	11268414	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.665000	0.83852	2.265000	0.75225	0.482000	0.46254	ATC	.	.	.	none		0.607	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005773.1	NM_013319	
COL16A1	1307	hgsc.bcm.edu	37	1	32151315	32151315	+	Silent	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr1:32151315A>G	ENST00000373672.3	-	29	2457	c.1941T>C	c.(1939-1941)cgT>cgC	p.R647R	COL16A1_ENST00000373668.3_Silent_p.R647R|COL16A1_ENST00000271069.6_Silent_p.R646R	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	647	Nonhelical region 7 (NC7).				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		AGGCCACCACACGGACATCCC	0.642																																					p.R647R	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.T1941C						PASS	.						108.0	116.0	114.0					1																	32151315		1933	4136	6069	SO:0001819	synonymous_variant	1307	exon29			CACCACACGGACA	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1941T>C	chr1.hg19:g.32151315A>G		292.0	0.0	.		270.0	87.0	.	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	hg19	CCDS41297.1																																																																																			.	.	.	none		0.642	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
SH3D21	79729	hgsc.bcm.edu	37	1	36773209	36773209	+	Intron	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr1:36773209G>A	ENST00000426732.2	+	5	373				SH3D21_ENST00000453908.2_Splice_Site|SH3D21_ENST00000505871.1_Splice_Site|SH3D21_ENST00000312808.4_Splice_Site			A4FU49	SH321_HUMAN	SH3 domain containing 21							extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						GGGCCCCCAAGTGAGACCTCG	0.577																																					.		Atlas-SNP	.											.	SH3D21	73	.	0			c.436+1G>A						PASS	.						102.0	107.0	105.0					1																	36773209		692	1591	2283	SO:0001627	intron_variant	79729	exon5			CCCCAAGTGAGAC	AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.89-162G>A	chr1.hg19:g.36773209G>A		144.0	0.0	.		126.0	37.0	.	NM_001162530	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Splice_Site	SNP	ENST00000426732.2	hg19		.	.	.	.	.	.	.	.	.	.	G	23.1	4.379730	0.82682	.	.	ENSG00000214193	ENST00000373139;ENST00000453908;ENST00000505871	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4867	0.67622	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SH3D21	36545796	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.008000	0.63991	2.491000	0.84063	0.655000	0.94253	.	.	.	.	none		0.577	SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676	
BSND	7809	hgsc.bcm.edu	37	1	55472846	55472846	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr1:55472846G>T	ENST00000371265.4	+	3	703	c.449G>T	c.(448-450)gGc>gTc	p.G150V		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	150					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						GGAGAAGGTGGCCCTGGCGAC	0.612																																					p.G150V	Ovarian(191;1657 2078 22894 42033 48899)	Atlas-SNP	.											.	BSND	36	.	0			c.G449T						PASS	.						91.0	82.0	85.0					1																	55472846		2203	4300	6503	SO:0001583	missense	7809	exon3			AAGGTGGCCCTGG	AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.449G>T	chr1.hg19:g.55472846G>T	ENSP00000360312:p.Gly150Val	162.0	0.0	.		121.0	40.0	.	NM_057176	Q6NT28	Missense_Mutation	SNP	ENST00000371265.4	hg19	CCDS602.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315138	0.40996	.	.	ENSG00000162399	ENST00000371265	T	0.66280	-0.2	3.69	2.76	0.32466	.	0.936787	0.08850	N	0.884550	T	0.63200	0.2491	L	0.57536	1.79	0.19300	N	0.999979	P	0.48016	0.904	P	0.49887	0.625	T	0.53648	-0.8409	10	0.56958	D	0.05	-8.1298	4.0436	0.09763	0.1256:0.0:0.6418:0.2326	.	150	Q8WZ55	BSND_HUMAN	V	150	ENSP00000360312:G150V	ENSP00000360312:G150V	G	+	2	0	BSND	55245434	0.034000	0.19679	0.074000	0.20217	0.134000	0.20937	1.699000	0.37804	1.100000	0.41517	0.478000	0.44815	GGC	.	.	.	none		0.612	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022213.4	NM_057176	
PYGO2	90780	hgsc.bcm.edu	37	1	154931749	154931749	+	Missense_Mutation	SNP	G	G	A	rs267598059		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr1:154931749G>A	ENST00000368457.2	-	3	898	c.727C>T	c.(727-729)Ccc>Tcc	p.P243S	PYGO2_ENST00000368456.1_Missense_Mutation_p.P206S|PYGO2_ENST00000483463.1_5'Flank|RP11-307C12.12_ENST00000605085.1_RNA	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	243	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCAGGAAAGGGACTTGTGTTA	0.612																																					p.P243S	NSCLC(87;357 1460 1955 21029 23522)	Atlas-SNP	.											PYGO2,NS,carcinoma,0,1	PYGO2	32	.	0			c.C727T						PASS	.						22.0	23.0	23.0					1																	154931749		2203	4300	6503	SO:0001583	missense	90780	exon3			GAAAGGGACTTGT	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.727C>T	chr1.hg19:g.154931749G>A	ENSP00000357442:p.Pro243Ser	139.0	0.0	.		148.0	38.0	.	NM_138300	Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	hg19	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810294	0.32053	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.52754	0.65;0.71	4.72	4.72	0.59763	.	0.379769	0.24652	N	0.036709	T	0.35128	0.0921	N	0.24115	0.695	0.54753	D	0.999983	D	0.89917	1.0	D	0.79108	0.992	T	0.21348	-1.0248	10	0.02654	T	1	-4.499	14.7378	0.69430	0.0:0.0:1.0:0.0	.	243	Q9BRQ0	PYGO2_HUMAN	S	243;206	ENSP00000357442:P243S;ENSP00000357441:P206S	ENSP00000357441:P206S	P	-	1	0	PYGO2	153198373	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.079000	0.57613	2.454000	0.82982	0.462000	0.41574	CCC	.	.	.	none		0.612	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300	
ARHGAP30	257106	hgsc.bcm.edu	37	1	161018086	161018086	+	Missense_Mutation	SNP	A	A	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr1:161018086A>C	ENST00000368013.3	-	12	3045	c.2725T>G	c.(2725-2727)Tgt>Ggt	p.C909G	ARHGAP30_ENST00000368015.1_Missense_Mutation_p.C732G|USF1_ENST00000368021.3_5'Flank|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.C698G	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	909					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GGGCATAGACAGCCGTCTGGA	0.617																																					p.C909G		Atlas-SNP	.											.	ARHGAP30	105	.	0			c.T2725G						PASS	.						45.0	41.0	42.0					1																	161018086		2203	4300	6503	SO:0001583	missense	257106	exon12			ATAGACAGCCGTC	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2725T>G	chr1.hg19:g.161018086A>C	ENSP00000356992:p.Cys909Gly	65.0	0.0	.		47.0	17.0	.	NM_001025598	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	hg19	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	A	4.313	0.057320	0.08339	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368015	T;T;T	0.34859	2.79;2.87;1.34	4.61	3.47	0.39725	.	0.621137	0.14461	N	0.318218	T	0.12475	0.0303	L	0.56769	1.78	0.09310	N	1	B;B	0.30482	0.281;0.0	B;B	0.24701	0.055;0.001	T	0.24048	-1.0171	10	0.14656	T	0.56	.	8.9598	0.35840	0.5893:0.4107:0.0:0.0	.	909;698	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	G	698;909;732	ENSP00000356995:C698G;ENSP00000356992:C909G;ENSP00000356994:C732G	ENSP00000356992:C909G	C	-	1	0	ARHGAP30	159284710	0.016000	0.18221	0.054000	0.19295	0.338000	0.28826	1.132000	0.31418	0.613000	0.30089	0.374000	0.22700	TGT	.	.	.	none		0.617	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
MTR	4548	hgsc.bcm.edu	37	1	236979823	236979823	+	Silent	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr1:236979823G>A	ENST00000366577.5	+	8	1138	c.744G>A	c.(742-744)gtG>gtA	p.V248V	MTR_ENST00000418145.2_3'UTR|MTR_ENST00000535889.1_Silent_p.V248V	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	248	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TCATCAGCGTGTCTCATGGAG	0.463																																					p.V248V		Atlas-SNP	.											.	MTR	127	.	0			c.G744A						PASS	.						154.0	148.0	150.0					1																	236979823		2203	4299	6502	SO:0001819	synonymous_variant	4548	exon8			CAGCGTGTCTCAT	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.744G>A	chr1.hg19:g.236979823G>A		85.0	0.0	.		71.0	19.0	.	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Silent	SNP	ENST00000366577.5	hg19	CCDS1614.1																																																																																			.	.	.	none		0.463	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
SMC6	79677	hgsc.bcm.edu	37	2	17865003	17865003	+	Nonsense_Mutation	SNP	A	A	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:17865003A>C	ENST00000448223.2	-	24	2975	c.2706T>G	c.(2704-2706)taT>taG	p.Y902*	SMC6_ENST00000381272.4_Nonsense_Mutation_p.Y928*|SMC6_ENST00000402989.1_Nonsense_Mutation_p.Y902*|SMC6_ENST00000351948.4_Nonsense_Mutation_p.Y902*	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	902					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CCAGATCAAGATAGGTCTCTC	0.313																																					p.Y902X		Atlas-SNP	.											.	SMC6	102	.	0			c.T2706G						PASS	.						75.0	82.0	79.0					2																	17865003		2202	4298	6500	SO:0001587	stop_gained	79677	exon24			ATCAAGATAGGTC	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.2706T>G	chr2.hg19:g.17865003A>C	ENSP00000404092:p.Tyr902*	289.0	0.0	.		234.0	76.0	.	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Nonsense_Mutation	SNP	ENST00000448223.2	hg19	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	A	41	9.120162	0.99071	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989	.	.	.	6.02	-0.274	0.12910	.	0.057067	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	10.3803	0.44108	0.6665:0.0:0.3335:0.0	.	.	.	.	X	902;902;928;902	.	ENSP00000323439:Y902X	Y	-	3	2	SMC6	17728484	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.364000	0.20325	0.157000	0.19338	0.533000	0.62120	TAT	.	.	.	none		0.313	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
NCOA1	8648	hgsc.bcm.edu	37	2	24930361	24930361	+	Silent	SNP	T	T	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:24930361T>G	ENST00000406961.1	+	13	2674	c.2022T>G	c.(2020-2022)ggT>ggG	p.G674G	NCOA1_ENST00000288599.5_Silent_p.G674G|NCOA1_ENST00000348332.3_Silent_p.G674G|NCOA1_ENST00000407230.1_Silent_p.G523G|NCOA1_ENST00000405141.1_Silent_p.G674G|NCOA1_ENST00000395856.3_Silent_p.G674G|NCOA1_ENST00000538539.1_Silent_p.G674G			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	674	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTCAGGAGGTTCTTGTCCCT	0.493			T	PAX3	alveolar rhadomyosarcoma																																p.G674G		Atlas-SNP	.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1	210	.	0			c.T2022G						PASS	.						105.0	104.0	104.0					2																	24930361		2203	4300	6503	SO:0001819	synonymous_variant	8648	exon11			AGGAGGTTCTTGT	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2022T>G	chr2.hg19:g.24930361T>G		145.0	0.0	.		108.0	35.0	.	NM_147223	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	hg19	CCDS1712.1																																																																																			.	.	.	none		0.493	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
NAT8	9027	hgsc.bcm.edu	37	2	73868395	73868395	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:73868395T>C	ENST00000272425.3	-	2	510	c.361A>G	c.(361-363)Atg>Gtg	p.M121V		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)											breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						GCTCCTACCATGCCCACCACC	0.537																																					p.M121V		Atlas-SNP	.											.	NAT8	26	.	0			c.A361G						PASS	.						92.0	90.0	91.0					2																	73868395		2203	4300	6503	SO:0001583	missense	9027	exon2			CTACCATGCCCAC	AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.361A>G	chr2.hg19:g.73868395T>C	ENSP00000272425:p.Met121Val	101.0	0.0	.		105.0	38.0	.	NM_003960		Missense_Mutation	SNP	ENST00000272425.3	hg19	CCDS1926.1	.	.	.	.	.	.	.	.	.	.	T	4.168	0.029686	0.08101	.	.	ENSG00000144035	ENST00000272425	T	0.21191	2.02	3.86	3.86	0.44501	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.596637	0.18180	N	0.149173	T	0.15825	0.0381	L	0.33485	1.01	0.26806	N	0.969104	B	0.18610	0.029	B	0.23018	0.043	T	0.15867	-1.0422	10	0.19590	T	0.45	-0.2375	11.3146	0.49383	0.0:0.0:0.0:1.0	.	121	Q9UHE5	NAT8_HUMAN	V	121	ENSP00000272425:M121V	ENSP00000272425:M121V	M	-	1	0	NAT8	73721903	0.986000	0.35501	0.838000	0.33150	0.124000	0.20399	2.187000	0.42602	1.715000	0.51383	0.524000	0.50904	ATG	.	.	.	none		0.537	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1	NM_003960	
ACTG2	72	hgsc.bcm.edu	37	2	74129580	74129580	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:74129580C>T	ENST00000409624.1	+	4	863	c.220C>T	c.(220-222)Cac>Tac	p.H74Y	ACTG2_ENST00000409731.3_Intron|ACTG2_ENST00000409918.1_Missense_Mutation_p.H74Y|ACTG2_ENST00000345517.3_Missense_Mutation_p.H74Y			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	74					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			large_intestine(3)|lung(14)|skin(1)	18						CCCCATTGAACACGGCATCAT	0.493																																					p.H74Y		Atlas-SNP	.											.	ACTG2	37	.	0			c.C220T						PASS	.						145.0	118.0	127.0					2																	74129580		2203	4300	6503	SO:0001583	missense	72	exon3			ATTGAACACGGCA		CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	ENST00000409624.1:c.220C>T	chr2.hg19:g.74129580C>T	ENSP00000386857:p.His74Tyr	92.0	0.0	.		76.0	45.0	.	NM_001615	B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Missense_Mutation	SNP	ENST00000409624.1	hg19	CCDS1930.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995682	0.54147	.	.	ENSG00000163017	ENST00000345517;ENST00000409918;ENST00000442912;ENST00000409624	D;D;D;D	0.97404	-4.37;-3.46;-2.56;-4.37	3.84	3.84	0.44239	.	0.000000	0.85682	D	0.000000	D	0.98966	0.9648	H	0.97732	4.065	0.47547	D	0.999456	D;P	0.57571	0.98;0.85	D;D	0.75020	0.985;0.909	D	0.99053	1.0828	10	0.87932	D	0	.	15.0246	0.71659	0.0:1.0:0.0:0.0	.	74;74	B8ZZJ2;P63267	.;ACTH_HUMAN	Y	74	ENSP00000295137:H74Y;ENSP00000387182:H74Y;ENSP00000410020:H74Y;ENSP00000386857:H74Y	ENSP00000295137:H74Y	H	+	1	0	ACTG2	73983088	1.000000	0.71417	0.956000	0.39512	0.795000	0.44927	7.584000	0.82572	2.147000	0.66899	0.563000	0.77884	CAC	.	.	.	none		0.493	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328086.1	NM_001615	
RFX8	731220	hgsc.bcm.edu	37	2	102029382	102029382	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:102029382A>G	ENST00000376826.2	-	11	1051	c.1052T>C	c.(1051-1053)aTg>aCg	p.M351T	RFX8_ENST00000428343.1_Missense_Mutation_p.M238T			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						ATTACATTTCATCTCTGGGTT	0.468																																					p.M238T		Atlas-SNP	.											.	RFX8	16	.	0			c.T713C						PASS	.						157.0	127.0	136.0					2																	102029382		692	1591	2283	SO:0001583	missense	731220	exon8			CATTTCATCTCTG	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1052T>C	chr2.hg19:g.102029382A>G	ENSP00000366022:p.Met351Thr	62.0	0.0	.		62.0	23.0	.	NM_001145664	B4DQ32	Missense_Mutation	SNP	ENST00000376826.2	hg19		.	.	.	.	.	.	.	.	.	.	A	11.75	1.732784	0.30684	.	.	ENSG00000196460	ENST00000376826;ENST00000428343	T;T	0.76709	-1.04;0.94	5.51	4.35	0.52113	.	.	.	.	.	T	0.65595	0.2706	L	0.36672	1.1	0.26204	N	0.979403	B;B	0.15141	0.007;0.012	B;B	0.10450	0.005;0.004	T	0.50882	-0.8775	9	0.17832	T	0.49	.	7.9988	0.30284	0.9078:0.0:0.0922:0.0	.	238;351	Q6ZV50-3;Q6ZV50	.;RFX8_HUMAN	T	351;238	ENSP00000366022:M351T;ENSP00000401536:M238T	ENSP00000366022:M351T	M	-	2	0	RFX8	101395814	0.998000	0.40836	1.000000	0.80357	0.796000	0.44982	2.614000	0.46359	0.934000	0.37316	0.529000	0.55759	ATG	.	.	.	none		0.468	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
FMNL2	114793	hgsc.bcm.edu	37	2	153415322	153415322	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:153415322C>A	ENST00000288670.9	+	5	795	c.428C>A	c.(427-429)gCa>gAa	p.A143E		NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	143	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CTCTCATTTGCACAGTACGCG	0.368																																					p.A143E		Atlas-SNP	.											.	FMNL2	75	.	0			c.C428A						PASS	.						115.0	114.0	114.0					2																	153415322		1886	4117	6003	SO:0001583	missense	114793	exon5			CATTTGCACAGTA	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.428C>A	chr2.hg19:g.153415322C>A	ENSP00000288670:p.Ala143Glu	104.0	0.0	.		83.0	24.0	.	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	hg19	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.865789	0.91511	.	.	ENSG00000157827	ENST00000288670	D	0.89485	-2.52	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.94974	0.8374	M	0.84433	2.695	0.80722	D	1	D	0.67145	0.996	D	0.78314	0.991	D	0.95164	0.8284	10	0.52906	T	0.07	.	18.421	0.90590	0.0:1.0:0.0:0.0	.	143	Q96PY5-3	.	E	143	ENSP00000288670:A143E	ENSP00000288670:A143E	A	+	2	0	FMNL2	153123568	1.000000	0.71417	0.987000	0.45799	0.976000	0.68499	7.421000	0.80204	2.335000	0.79485	0.467000	0.42956	GCA	.	.	.	none		0.368	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
TTN	7273	hgsc.bcm.edu	37	2	179421832	179421832	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:179421832T>C	ENST00000591111.1	-	280	83350	c.83126A>G	c.(83125-83127)aAc>aGc	p.N27709S	TTN_ENST00000342992.6_Missense_Mutation_p.N26782S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N20477S|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.N20410S|TTN_ENST00000460472.2_Missense_Mutation_p.N20285S|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N29350S			Q8WZ42	TITIN_HUMAN	titin	27709	Fibronectin type-III 102. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTGACAGAGTTCTTTGAAAT	0.433																																					p.N29350S		Atlas-SNP	.											.	TTN	18412	.	0			c.A88049G						PASS	.						59.0	56.0	57.0					2																	179421832		1894	4122	6016	SO:0001583	missense	7273	exon330			ACAGAGTTCTTTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83126A>G	chr2.hg19:g.179421832T>C	ENSP00000465570:p.Asn27709Ser	99.0	0.0	.		47.0	18.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.28	2.488456	0.44249	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.81	4.59	0.56863	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38374	0.1038	N	0.17564	0.495	0.38032	D	0.935192	B;B;B;B	0.16603	0.006;0.006;0.006;0.018	B;B;B;B	0.15870	0.014;0.014;0.014;0.014	T	0.41179	-0.9523	9	0.87932	D	0	.	13.5686	0.61832	0.0:0.0:0.1846:0.8154	.	20285;20410;20477;27709	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	26782;20285;20477;20410;20282	ENSP00000343764:N26782S;ENSP00000434586:N20285S;ENSP00000340554:N20477S;ENSP00000352154:N20410S	ENSP00000340554:N20477S	N	-	2	0	TTN	179130078	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.375000	0.59549	2.343000	0.79666	0.533000	0.62120	AAC	.	.	.	none		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
GLS	2744	hgsc.bcm.edu	37	2	191795233	191795233	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:191795233T>C	ENST00000320717.3	+	13	1754	c.1496T>C	c.(1495-1497)aTg>aCg	p.M499T	GLS_ENST00000409215.1_Missense_Mutation_p.M4T|GLS_ENST00000409626.1_Missense_Mutation_p.M70T|GLS_ENST00000409428.1_Missense_Mutation_p.M4T|GLS_ENST00000338435.4_Missense_Mutation_p.M499T	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	499					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	ATGGGTATGATGTGCTGGTCT	0.388																																					p.M499T		Atlas-SNP	.											.	GLS	47	.	0			c.T1496C						PASS	.						153.0	143.0	146.0					2																	191795233		2203	4300	6503	SO:0001583	missense	2744	exon13			GTATGATGTGCTG	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1496T>C	chr2.hg19:g.191795233T>C	ENSP00000317379:p.Met499Thr	123.0	0.0	.		90.0	33.0	.	NM_014905	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	hg19	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.686240	0.47991	.	.	ENSG00000115419	ENST00000320717;ENST00000338435;ENST00000409626;ENST00000457316;ENST00000409428;ENST00000409215;ENST00000412247	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.84	5.84	0.93424	Beta-lactamase/transpeptidase-like (1);	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	L	0.51422	1.61	0.80722	D	1	B;B;B;B;B	0.33612	0.134;0.419;0.045;0.419;0.145	B;B;B;B;B	0.40101	0.137;0.319;0.097;0.319;0.139	T	0.39563	-0.9608	10	0.45353	T	0.12	-17.0749	16.2233	0.82274	0.0:0.0:0.0:1.0	.	70;499;153;499;499	B7Z2P1;A8K132;Q68D38;O94925;O94925-3	.;.;.;GLSK_HUMAN;.	T	499;499;70;70;4;4;20	ENSP00000317379:M499T;ENSP00000340689:M499T;ENSP00000386417:M70T;ENSP00000395596:M70T;ENSP00000387177:M4T;ENSP00000387135:M4T;ENSP00000403329:M20T	ENSP00000317379:M499T	M	+	2	0	GLS	191503478	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	8.040000	0.89188	2.243000	0.73865	0.482000	0.46254	ATG	.	.	.	none		0.388	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
PTPRN	5798	hgsc.bcm.edu	37	2	220173977	220173977	+	Silent	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:220173977G>A	ENST00000295718.2	-	1	318	c.78C>T	c.(76-78)agC>agT	p.S26S	PTPRN_ENST00000409251.3_Silent_p.S26S|PTPRN_ENST00000423636.2_5'Flank	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	26					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CCGGGCGGCTGCTCAGCAGCA	0.751																																					p.S26S		Atlas-SNP	.											.	PTPRN	138	.	0			c.C78T						PASS	.						3.0	4.0	3.0					2																	220173977		1857	3826	5683	SO:0001819	synonymous_variant	5798	exon1			GCGGCTGCTCAGC		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.78C>T	chr2.hg19:g.220173977G>A		94.0	0.0	.		95.0	42.0	.	NM_002846	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	hg19	CCDS2440.1																																																																																			.	.	.	none		0.751	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
SERPINE2	5270	hgsc.bcm.edu	37	2	224856616	224856616	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:224856616A>G	ENST00000258405.4	-	4	831	c.589T>C	c.(589-591)Ttc>Ctc	p.F197L	SERPINE2_ENST00000409304.1_Missense_Mutation_p.F197L|SERPINE2_ENST00000447280.2_Missense_Mutation_p.F209L|SERPINE2_ENST00000409840.3_Missense_Mutation_p.F197L	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	197					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TCGGGTTGGAACCGTGATTTC	0.517																																					p.F209L		Atlas-SNP	.											.	SERPINE2	103	.	0			c.T625C						PASS	.						160.0	122.0	135.0					2																	224856616		2203	4300	6503	SO:0001583	missense	5270	exon4			GTTGGAACCGTGA	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.589T>C	chr2.hg19:g.224856616A>G	ENSP00000258405:p.Phe197Leu	117.0	0.0	.		105.0	32.0	.	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	hg19	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.483952	0.84854	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738	T;D;T;T;T	0.94897	-0.02;-3.55;-0.02;-0.02;-0.02	5.8	5.8	0.92144	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.96679	0.8916	H	0.95780	3.72	0.80722	D	1	B;B	0.27229	0.172;0.172	B;B	0.35240	0.198;0.198	D	0.96028	0.9014	10	0.87932	D	0	.	16.1506	0.81618	1.0:0.0:0.0:0.0	.	209;197	B4DIF2;P07093	.;GDN_HUMAN	L	197;197;197;209;197	ENSP00000386412:F197L;ENSP00000258405:F197L;ENSP00000386969:F197L;ENSP00000415786:F209L;ENSP00000408452:F197L	ENSP00000258405:F197L	F	-	1	0	SERPINE2	224564860	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.890000	0.92477	2.206000	0.71126	0.528000	0.53228	TTC	.	.	.	none		0.517	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	chr2.hg19:g.241696843C>A		70.0	0.0	.		81.0	14.0	.	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	hg19	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
KLHL40	131377	hgsc.bcm.edu	37	3	42730387	42730387	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr3:42730387A>G	ENST00000287777.4	+	4	1548	c.1448A>G	c.(1447-1449)tAt>tGt	p.Y483C		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	483					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											ATGTGCGTCTATGACCCCAAG	0.612																																					p.Y483C		Atlas-SNP	.											.	.	.	.	0			c.A1448G						PASS	.						69.0	71.0	70.0					3																	42730387		2203	4300	6503	SO:0001583	missense	131377	exon4			GCGTCTATGACCC	AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.1448A>G	chr3.hg19:g.42730387A>G	ENSP00000287777:p.Tyr483Cys	135.0	0.0	.		129.0	25.0	.	NM_152393	Q86SI1|Q96MR2	Missense_Mutation	SNP	ENST00000287777.4	hg19	CCDS2703.1	.	.	.	.	.	.	.	.	.	.	a	19.17	3.775461	0.70107	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	D	0.87966	-2.32	3.81	3.81	0.43845	Kelch-type beta propeller (1);	0.261096	0.39475	N	0.001341	D	0.96012	0.8701	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97162	0.9838	10	0.87932	D	0	.	13.1169	0.59305	1.0:0.0:0.0:0.0	.	483	Q2TBA0	KBTB5_HUMAN	C	483;228	ENSP00000287777:Y483C	ENSP00000287777:Y483C	Y	+	2	0	KBTBD5	42705391	1.000000	0.71417	0.984000	0.44739	0.956000	0.61745	8.989000	0.93506	1.769000	0.52152	0.353000	0.21931	TAT	.	.	.	none		0.612	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393	
UBA7	7318	hgsc.bcm.edu	37	3	49841865	49841865	+	IGR	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr3:49841865C>T	ENST00000333486.3	-	0	3299				MIR5193_ENST00000584510.1_RNA|FAM212A_ENST00000333323.4_Silent_p.G103G	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AGGTGTCAGGCAGCACATGGC	0.632																																					p.G103G		Atlas-SNP	.											.	.	.	.	0			c.C309T						PASS	.						93.0	89.0	91.0					3																	49841865		2203	4300	6503	SO:0001628	intergenic_variant	389119	exon2			GTCAGGCAGCACA	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267		chr3.hg19:g.49841865C>T		61.0	0.0	.		79.0	17.0	.	NM_203370	Q9BRB2	Silent	SNP	ENST00000333486.3	hg19	CCDS2805.1																																																																																			.	.	.	none		0.632	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
TKT	7086	hgsc.bcm.edu	37	3	53264594	53264594	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr3:53264594C>T	ENST00000462138.1	-	8	1074	c.986G>A	c.(985-987)gGc>gAc	p.G329D	TKT_ENST00000423516.1_Missense_Mutation_p.G337D|TKT_ENST00000296289.6_Missense_Mutation_p.G282D|TKT_ENST00000461139.1_5'UTR|TKT_ENST00000423525.2_Missense_Mutation_p.G329D			P29401	TKT_HUMAN	transketolase	329					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)	p.K327fs*1(1)		endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		ACTGGCATGGCCCAGCTTGGC	0.602																																					p.G337D	Colon(133;1506 2347 35238 42177)	Atlas-SNP	.											.	TKT	38	.	1	Deletion - Frameshift(1)	lung(1)	c.G1010A						PASS	.						83.0	77.0	79.0					3																	53264594		2203	4300	6503	SO:0001583	missense	7086	exon9			GCATGGCCCAGCT		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.986G>A	chr3.hg19:g.53264594C>T	ENSP00000417773:p.Gly329Asp	98.0	0.0	.		118.0	67.0	.	NM_001258028	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	ENST00000462138.1	hg19	CCDS2871.1	.	.	.	.	.	.	.	.	.	.	C	35	5.464525	0.96257	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91	5.69	5.69	0.88448	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.97729	0.9255	H	0.96943	3.91	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98576	1.0648	10	0.87932	D	0	0.4241	19.8045	0.96525	0.0:1.0:0.0:0.0	.	337;246;329	E7EPA7;B3KSI4;P29401	.;.;TKT_HUMAN	D	329;329;337;282;163	ENSP00000417773:G329D;ENSP00000405455:G329D;ENSP00000391481:G337D;ENSP00000296289:G282D	ENSP00000296289:G282D	G	-	2	0	TKT	53239634	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.676000	0.91093	0.655000	0.94253	GGC	.	.	.	none		0.602	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1		
GOLGB1	2804	hgsc.bcm.edu	37	3	121417110	121417110	+	Missense_Mutation	SNP	G	G	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr3:121417110G>C	ENST00000340645.5	-	13	2370	c.2245C>G	c.(2245-2247)Ctt>Gtt	p.L749V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.L754V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	749					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TGAGAGAGAAGCTGGTCTCTT	0.418																																					p.L754V		Atlas-SNP	.											.	GOLGB1	319	.	0			c.C2260G						PASS	.						136.0	130.0	132.0					3																	121417110		2203	4299	6502	SO:0001583	missense	2804	exon13			AGAGAAGCTGGTC	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.2245C>G	chr3.hg19:g.121417110G>C	ENSP00000341848:p.Leu749Val	82.0	0.0	.		95.0	26.0	.	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.27|11.27	1.587926|1.587926	0.28268|0.28268	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235|ENST00000489400	T;T;T|.	0.35421|.	1.94;1.94;1.31|.	5.72|5.72	4.83|4.83	0.62350|0.62350	.|.	0.118223|.	0.38436|.	N|.	0.001690|.	T|T	0.57829|0.57829	0.2080|0.2080	M|M	0.69823|0.69823	2.125|2.125	0.21184|0.21184	N|N	0.999765|0.999765	D;B;D;D;D|.	0.76494|.	0.999;0.01;0.998;0.998;0.998|.	D;B;D;D;D|.	0.83275|.	0.991;0.022;0.996;0.99;0.941|.	T|T	0.51741|0.51741	-0.8667|-0.8667	10|5	0.41790|.	T|.	0.15|.	.|.	12.8931|12.8931	0.58082|0.58082	0.0:0.3132:0.6868:0.0|0.0:0.3132:0.6868:0.0	.|.	674;713;754;754;749|.	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789|.	.;.;.;.;GOGB1_HUMAN|.	V|R	749;754;713;561|619	ENSP00000341848:L749V;ENSP00000377275:L754V;ENSP00000418231:L713V|.	ENSP00000341848:L749V|.	L|S	-|-	1|3	0|2	GOLGB1|GOLGB1	122899800|122899800	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.805000|0.805000	0.45488|0.45488	3.253000|3.253000	0.51469|0.51469	1.381000|1.381000	0.46364|0.46364	0.655000|0.655000	0.94253|0.94253	CTT|AGC	.	.	.	none		0.418	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
STAG1	10274	hgsc.bcm.edu	37	3	136096520	136096520	+	Silent	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr3:136096520A>G	ENST00000383202.2	-	23	2608	c.2352T>C	c.(2350-2352)aaT>aaC	p.N784N	STAG1_ENST00000236698.5_Silent_p.N784N|STAG1_ENST00000536929.1_Silent_p.N368N|STAG1_ENST00000434713.2_Silent_p.N558N	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	784					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TCACTGGAGTATTAACATTAG	0.343																																					p.N784N		Atlas-SNP	.											.	STAG1	135	.	0			c.T2352C						PASS	.						70.0	69.0	69.0					3																	136096520		2203	4300	6503	SO:0001819	synonymous_variant	10274	exon23			TGGAGTATTAACA	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.2352T>C	chr3.hg19:g.136096520A>G		55.0	0.0	.		63.0	27.0	.	NM_005862	O00539|Q6P275	Silent	SNP	ENST00000383202.2	hg19	CCDS3090.1																																																																																			.	.	.	none		0.343	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
PARL	55486	hgsc.bcm.edu	37	3	183560125	183560125	+	Missense_Mutation	SNP	G	G	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr3:183560125G>C	ENST00000317096.4	-	6	778	c.718C>G	c.(718-720)Ctg>Gtg	p.L240V	PARL_ENST00000435888.1_Intron|PARL_ENST00000311101.5_Intron	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	240					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCTTGACCCAGAATGTTCACT	0.423																																					p.L240V		Atlas-SNP	.											.	PARL	32	.	0			c.C718G						PASS	.						166.0	159.0	162.0					3																	183560125		2203	4300	6503	SO:0001583	missense	55486	exon6			GACCCAGAATGTT	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.718C>G	chr3.hg19:g.183560125G>C	ENSP00000325421:p.Leu240Val	72.0	0.0	.		80.0	20.0	.	NM_018622	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	ENST00000317096.4	hg19	CCDS3248.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.77|17.77|17.77	3.470034|3.470034|3.470034	0.63625|0.63625|0.63625	.|.|.	.|.|.	ENSG00000175193|ENSG00000175193|ENSG00000175193	ENST00000418450|ENST00000317096;ENST00000450375|ENST00000417784	.|T;T|.	.|0.15718|.	.|2.4;2.4|.	5.32|5.32|5.32	4.43|4.43|4.43	0.53597|0.53597|0.53597	.|Peptidase S54, rhomboid domain (1);|.	.|0.080223|.	.|0.52532|.	.|D|.	.|0.000062|.	T|T|T	0.75583|0.75583|0.75583	0.3869|0.3869|0.3869	M|M|M	0.81802|0.81802|0.81802	2.56|2.56|2.56	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|P|.	.|0.36712|.	.|0.566|.	.|P|.	.|0.51055|.	.|0.657|.	T|T|T	0.76895|0.76895|0.76895	-0.2790|-0.2790|-0.2790	5|10|5	.|0.45353|.	.|T|.	.|0.12|.	-24.5427|-24.5427|-24.5427	13.7302|13.7302|13.7302	0.62783|0.62783|0.62783	0.0744:0.0:0.9256:0.0|0.0744:0.0:0.9256:0.0|0.0744:0.0:0.9256:0.0	.|.|.	.|240|.	.|Q9H300|.	.|PARL_HUMAN|.	L|V|C	6|240;20|31	.|ENSP00000325421:L240V;ENSP00000402689:L20V|.	.|ENSP00000325421:L240V|.	F|L|S	-|-|-	3|1|2	2|2|0	PARL|PARL|PARL	185042819|185042819|185042819	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.989000|0.989000|0.989000	0.77384|0.77384|0.77384	2.485000|2.485000|2.485000	0.45250|0.45250|0.45250	2.653000|2.653000|2.653000	0.90120|0.90120|0.90120	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TTC|CTG|TCT	.	.	.	none		0.423	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346465.1	NM_018622	
ATOH1	474	hgsc.bcm.edu	37	4	94750807	94750807	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr4:94750807T>C	ENST00000306011.3	+	1	766	c.730T>C	c.(730-732)Tat>Cat	p.Y244H		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	244					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		CGCGGCCTCCTATGAAGGGGG	0.706																																					p.Y244H		Atlas-SNP	.											.	ATOH1	40	.	0			c.T730C						PASS	.						16.0	19.0	18.0					4																	94750807		2192	4287	6479	SO:0001583	missense	474	exon1			GCCTCCTATGAAG	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.730T>C	chr4.hg19:g.94750807T>C	ENSP00000302216:p.Tyr244His	136.0	0.0	.		105.0	43.0	.	NM_005172	Q14CT9	Missense_Mutation	SNP	ENST00000306011.3	hg19	CCDS3638.1	.	.	.	.	.	.	.	.	.	.	T	12.29	1.894445	0.33442	.	.	ENSG00000172238	ENST00000306011	D	0.97378	-4.36	3.36	3.36	0.38483	.	0.158987	0.29964	N	0.010753	D	0.91150	0.7213	L	0.27053	0.805	0.25583	N	0.986778	B	0.31790	0.34	B	0.28011	0.085	T	0.82269	-0.0541	10	0.16896	T	0.51	-9.6261	6.9541	0.24562	0.0:0.1112:0.0:0.8888	.	244	Q92858	ATOH1_HUMAN	H	244	ENSP00000302216:Y244H	ENSP00000302216:Y244H	Y	+	1	0	ATOH1	94969830	0.585000	0.26774	0.999000	0.59377	0.311000	0.27955	0.000000	0.12993	1.788000	0.52465	0.386000	0.25728	TAT	.	.	.	none		0.706	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253585.1	NM_005172	
ANK2	287	hgsc.bcm.edu	37	4	114278777	114278777	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr4:114278777T>A	ENST00000357077.4	+	38	9056	c.9003T>A	c.(9001-9003)agT>agA	p.S3001R	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.S2968R	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3001					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AACAGGAAAGTACCTTGTGGG	0.413																																					p.S3001R		Atlas-SNP	.											.	ANK2	576	.	0			c.T9003A						PASS	.						118.0	116.0	117.0					4																	114278777		2203	4300	6503	SO:0001583	missense	287	exon38			GGAAAGTACCTTG	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.9003T>A	chr4.hg19:g.114278777T>A	ENSP00000349588:p.Ser3001Arg	222.0	0.0	.		144.0	42.0	.	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.988836	0.53934	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.96427	-0.27;-0.29;-4.01	5.72	-3.25	0.05079	.	0.634983	0.15548	N	0.256573	D	0.91506	0.7318	M	0.64997	1.995	0.22266	N	0.999245	B;P	0.42203	0.001;0.773	B;B	0.33521	0.001;0.165	D	0.84583	0.0662	10	0.15499	T	0.54	.	9.5599	0.39362	0.0:0.5174:0.1142:0.3683	.	2968;3001	Q01484;Q01484-4	ANK2_HUMAN;.	R	3001;2968;11	ENSP00000349588:S3001R;ENSP00000264366:S2968R;ENSP00000422498:S11R	ENSP00000264366:S2968R	S	+	3	2	ANK2	114498226	0.000000	0.05858	0.002000	0.10522	0.488000	0.33401	-0.524000	0.06222	-0.771000	0.04608	0.533000	0.62120	AGT	.	.	.	none		0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
GPR98	84059	hgsc.bcm.edu	37	5	90446037	90446037	+	Splice_Site	SNP	A	A	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr5:90446037A>T	ENST00000405460.2	+	88	18719	c.18623A>T	c.(18622-18624)gAg>gTg	p.E6208V	GPR98_ENST00000425867.2_Splice_Site_p.E1869V	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	6208					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GCTATGGAGGAGGTGTCTGCC	0.547																																					p.E6208V		Atlas-SNP	.											.	GPR98	605	.	0			c.A18623T						PASS	.						83.0	85.0	84.0					5																	90446037		2027	4182	6209	SO:0001630	splice_region_variant	84059	exon88			TGGAGGAGGTGTC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.18624+1A>T	chr5.hg19:g.90446037A>T		126.0	0.0	.		85.0	25.0	.	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825664	0.71143	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.35789	1.32;1.29	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.58509	0.2127	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	T	0.56129	-0.8030	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	1869;6208;1869	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	V	6208;6208;1869	ENSP00000384582:E6208V;ENSP00000392618:E1869V	.	E	+	2	0	GPR98	90481793	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	8.730000	0.91510	2.326000	0.78906	0.533000	0.62120	GAG	.	.	.	none		0.547	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	Missense_Mutation
FSTL4	23105	hgsc.bcm.edu	37	5	132534854	132534854	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr5:132534854T>A	ENST00000265342.7	-	16	2711	c.2462A>T	c.(2461-2463)aAc>aTc	p.N821I	CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	821						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCGCAGCGTGTTTTGTCTCCC	0.582																																					p.N821I		Atlas-SNP	.											.	FSTL4	74	.	0			c.A2462T						PASS	.						74.0	71.0	72.0					5																	132534854		2203	4300	6503	SO:0001583	missense	23105	exon16			AGCGTGTTTTGTC	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.2462A>T	chr5.hg19:g.132534854T>A	ENSP00000265342:p.Asn821Ile	70.0	0.0	.		70.0	26.0	.	NM_015082	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	hg19	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	T	11.27	1.587755	0.28268	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.60672	0.17	5.15	2.66	0.31614	Immunoglobulin-like (1);	0.265468	0.42548	D	0.000696	T	0.63283	0.2498	M	0.76574	2.34	0.30104	N	0.807186	P;D	0.54601	0.836;0.967	B;P	0.51229	0.366;0.663	T	0.64833	-0.6314	10	0.87932	D	0	-9.6102	8.8288	0.35072	0.0:0.1592:0.0:0.8408	.	821;470	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	I	821;652	ENSP00000265342:N821I	ENSP00000265342:N821I	N	-	2	0	FSTL4	132562753	0.994000	0.37717	0.030000	0.17652	0.231000	0.25187	2.497000	0.45354	0.269000	0.21961	0.477000	0.44152	AAC	.	.	.	none		0.582	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
PITX1	5307	hgsc.bcm.edu	37	5	134367076	134367076	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr5:134367076T>C	ENST00000265340.7	-	2	708	c.292A>G	c.(292-294)Agc>Ggc	p.S98G	PITX1_ENST00000506438.1_Missense_Mutation_p.S98G|CTC-349C3.1_ENST00000432382.3_5'Flank	NM_002653.4	NP_002644.4	P78337	PITX1_HUMAN	paired-like homeodomain 1	98					anatomical structure morphogenesis (GO:0009653)|branchiomeric skeletal muscle development (GO:0014707)|cartilage development (GO:0051216)|embryonic hindlimb morphogenesis (GO:0035116)|myoblast fate commitment (GO:0048625)|pituitary gland development (GO:0021983)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)			central_nervous_system(1)|cervix(3)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	READ - Rectum adenocarcinoma(2;0.0607)		AACTGCTGGCTTGTGAAGTGC	0.647																																					p.S98G		Atlas-SNP	.											.	PITX1	31	.	0			c.A292G						PASS	.						121.0	93.0	103.0					5																	134367076		2203	4300	6503	SO:0001583	missense	5307	exon2			GCTGGCTTGTGAA	AF009648	CCDS4182.1	5q31.1	2011-06-20	2007-07-12		ENSG00000069011	ENSG00000069011		"""Homeoboxes / PRD class"""	9004	protein-coding gene	gene with protein product		602149	"""paired-like homeodomain transcription factor 1"""	BFT		9337397, 9070926	Standard	NM_002653		Approved	PTX1, POTX	uc010jea.3	P78337	OTTHUMG00000149983	ENST00000265340.7:c.292A>G	chr5.hg19:g.134367076T>C	ENSP00000265340:p.Ser98Gly	127.0	0.0	.		91.0	25.0	.	NM_002653	A8K3M0|D3DQB0|O14677|O60425|Q9BTI5	Missense_Mutation	SNP	ENST00000265340.7	hg19	CCDS4182.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.559217	0.86335	.	.	ENSG00000069011	ENST00000265340;ENST00000506438;ENST00000507253;ENST00000502676	D;D;D;D	0.96300	-3.97;-3.97;-3.71;-3.71	4.39	4.39	0.52855	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96303	0.8794	L	0.31371	0.925	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	D	0.97051	0.9764	10	0.87932	D	0	.	13.9082	0.63850	0.0:0.0:0.0:1.0	.	98	P78337	PITX1_HUMAN	G	98	ENSP00000265340:S98G;ENSP00000427542:S98G;ENSP00000422908:S98G;ENSP00000423624:S98G	ENSP00000265340:S98G	S	-	1	0	PITX1	134394975	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.199000	0.72112	1.755000	0.51935	0.460000	0.39030	AGC	.	.	.	none		0.647	PITX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251195.3		
DPYSL3	1809	hgsc.bcm.edu	37	5	146833138	146833138	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr5:146833138C>A	ENST00000398514.3	-	1	384	c.13G>T	c.(13-15)Ggc>Tgc	p.G5C	DPYSL3_ENST00000343218.5_Intron|DPYSL3_ENST00000534907.1_Intron	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	5					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTTCTTGCCTTGGTAGGAC	0.716																																					p.G5C		Atlas-SNP	.											.	DPYSL3	58	.	0			c.G13T						PASS	.						39.0	52.0	48.0					5																	146833138		2088	4144	6232	SO:0001583	missense	1809	exon1			TCTTGCCTTGGTA	D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.13G>T	chr5.hg19:g.146833138C>A	ENSP00000381526:p.Gly5Cys	95.0	0.0	.		101.0	9.0	.	NM_001387	B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	hg19	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.889019	0.91814	.	.	ENSG00000113657	ENST00000398514;ENST00000512722	D;D	0.86694	-2.04;-2.16	5.22	5.22	0.72569	.	.	.	.	.	D	0.91147	0.7212	M	0.65975	2.015	0.80722	D	1	D	0.60160	0.987	P	0.58077	0.832	D	0.92147	0.5725	9	0.87932	D	0	.	15.7699	0.78162	0.0:1.0:0.0:0.0	.	5	Q14195	DPYL3_HUMAN	C	5	ENSP00000381526:G5C;ENSP00000426720:G5C	ENSP00000381526:G5C	G	-	1	0	DPYSL3	146813331	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.917000	0.56424	2.452000	0.82932	0.558000	0.71614	GGC	.	.	.	none		0.716	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387	
CLINT1	9685	hgsc.bcm.edu	37	5	157214655	157214655	+	Silent	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr5:157214655T>C	ENST00000411809.2	-	12	2081	c.1877A>G	c.(1876-1878)tAa>tGa	p.*626*	CLINT1_ENST00000296951.5_Silent_p.*626*|CLINT1_ENST00000523094.1_Silent_p.*626*|CLINT1_ENST00000530742.1_Silent_p.*626*|CLINT1_ENST00000523908.1_Silent_p.*644*	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	0					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TACAATCTCTTATTTGCTAAA	0.398																																					p.X644X	Colon(22;427 587 2170 6147 14291)	Atlas-SNP	.											.	CLINT1	86	.	0			c.A1931G						PASS	.						153.0	147.0	149.0					5																	157214655		1885	4101	5986	SO:0001819	synonymous_variant	9685	exon12			ATCTCTTATTTGC	AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.1877A>G	chr5.hg19:g.157214655T>C		67.0	0.0	.		65.0	7.0	.	NM_001195555	B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Silent	SNP	ENST00000411809.2	hg19	CCDS47330.1																																																																																			.	.	.	none		0.398	CLINT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374001.1	NM_014666	
PHIP	55023	hgsc.bcm.edu	37	6	79655791	79655791	+	Silent	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr6:79655791C>T	ENST00000275034.4	-	38	4724	c.4557G>A	c.(4555-4557)gaG>gaA	p.E1519E	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1519					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TAGATGGTTGCTCAGTGACAA	0.408																																					p.E1519E		Atlas-SNP	.											.	PHIP	177	.	0			c.G4557A						PASS	.						146.0	128.0	134.0					6																	79655791		2203	4300	6503	SO:0001819	synonymous_variant	55023	exon38			TGGTTGCTCAGTG	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4557G>A	chr6.hg19:g.79655791C>T		127.0	0.0	.		109.0	38.0	.	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	ENST00000275034.4	hg19	CCDS4987.1																																																																																			.	.	.	none		0.408	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
MUC17	140453	hgsc.bcm.edu	37	7	100679990	100679990	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr7:100679990G>A	ENST00000306151.4	+	3	5357	c.5293G>A	c.(5293-5295)Gag>Aag	p.E1765K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1765	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTCAGTTCTGAGGCTAGCAC	0.498																																					p.E1765K		Atlas-SNP	.											.	MUC17	804	.	0			c.G5293A						PASS	.						289.0	302.0	298.0					7																	100679990		2203	4300	6503	SO:0001583	missense	140453	exon3			AGTTCTGAGGCTA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5293G>A	chr7.hg19:g.100679990G>A	ENSP00000302716:p.Glu1765Lys	76.0	0.0	.		94.0	31.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	4.090	0.014651	0.07959	.	.	ENSG00000169876	ENST00000306151	T	0.01981	4.52	0.824	0.824	0.18818	.	.	.	.	.	T	0.01222	0.0040	L	0.27053	0.805	0.09310	N	1	P	0.48911	0.917	B	0.35899	0.213	T	0.29305	-1.0016	9	0.06891	T	0.86	.	5.0939	0.14723	0.0:0.0:1.0:0.0	.	1765	Q685J3	MUC17_HUMAN	K	1765	ENSP00000302716:E1765K	ENSP00000302716:E1765K	E	+	1	0	MUC17	100466710	0.000000	0.05858	0.006000	0.13384	0.022000	0.10575	-0.038000	0.12144	0.788000	0.33755	0.134000	0.15878	GAG	.	.	.	none		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CUX1	1523	hgsc.bcm.edu	37	7	101891788	101891788	+	Silent	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr7:101891788G>A	ENST00000292535.7	+	24	4022	c.3984G>A	c.(3982-3984)cgG>cgA	p.R1328R	CUX1_ENST00000546411.2_Silent_p.R1226R|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000556210.1_Silent_p.R1170R|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Silent_p.R1339R|CUX1_ENST00000549414.2_Silent_p.R1306R|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000550008.2_Silent_p.R1272R	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1328					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GCAGCGGCCGGGCGGCGCCCA	0.711																																					p.R1339R		Atlas-SNP	.											.	CUX1	253	.	0			c.G4017A						PASS	.						5.0	7.0	6.0					7																	101891788		2004	3805	5809	SO:0001819	synonymous_variant	1523	exon24			CGGCCGGGCGGCG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3984G>A	chr7.hg19:g.101891788G>A		41.0	0.0	.		36.0	18.0	.	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	ENST00000292535.7	hg19	CCDS5721.1																																																																																			.	.	.	none		0.711	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
ATP6V1B2	526	hgsc.bcm.edu	37	8	20069635	20069635	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr8:20069635T>A	ENST00000276390.2	+	8	768	c.728T>A	c.(727-729)tTc>tAc	p.F243Y		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	243					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	ACTGCCCGGTTCTTCAAATCT	0.373																																					p.F243Y	Pancreas(119;1230 1726 3901 4036 31644)	Atlas-SNP	.											.	ATP6V1B2	34	.	0			c.T728A						PASS	.						83.0	81.0	82.0					8																	20069635		2203	4300	6503	SO:0001583	missense	526	exon8			CCCGGTTCTTCAA	L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.728T>A	chr8.hg19:g.20069635T>A	ENSP00000276390:p.Phe243Tyr	97.0	0.0	.		88.0	36.0	.	NM_001693	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	ENST00000276390.2	hg19	CCDS6014.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632303	0.87660	.	.	ENSG00000147416	ENST00000276390;ENST00000542368	T	0.81415	-1.49	4.35	4.35	0.52113	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.097712	0.64402	D	0.000001	T	0.79627	0.4478	L	0.52126	1.63	0.80722	D	1	P	0.35872	0.525	B	0.43575	0.424	T	0.79988	-0.1571	10	0.46703	T	0.11	-15.7153	12.8046	0.57605	0.0:0.0:0.0:1.0	.	243	P21281	VATB2_HUMAN	Y	243;117	ENSP00000276390:F243Y	ENSP00000276390:F243Y	F	+	2	0	ATP6V1B2	20113915	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.790000	0.85794	1.947000	0.56498	0.533000	0.62120	TTC	.	.	.	none		0.373	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693	
MYBL1	4603	hgsc.bcm.edu	37	8	67514696	67514696	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr8:67514696C>T	ENST00000522677.3	-	2	493	c.83G>A	c.(82-84)gGa>gAa	p.G28E	MYBL1_ENST00000517885.1_Missense_Mutation_p.G28E|MYBL1_ENST00000524176.2_Missense_Mutation_p.G28E	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	28					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			TTTCTTCAGTCCTTTTTGTTG	0.343																																					p.G28E		Atlas-SNP	.											.	MYBL1	73	.	0			c.G83A						PASS	.						172.0	162.0	166.0					8																	67514696		1848	4099	5947	SO:0001583	missense	4603	exon2			TTCAGTCCTTTTT	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.83G>A	chr8.hg19:g.67514696C>T	ENSP00000429633:p.Gly28Glu	96.0	0.0	.		78.0	27.0	.	NM_001080416	E7EW29|Q495F9	Missense_Mutation	SNP	ENST00000522677.3	hg19	CCDS47867.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928320	0.34002	.	.	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	T;T;T	0.17054	2.81;2.33;2.3	5.55	4.67	0.58626	.	0.265955	0.41500	D	0.000876	T	0.18257	0.0438	L	0.43152	1.355	0.38359	D	0.944558	B;D;B	0.59767	0.049;0.986;0.126	B;P;B	0.48304	0.027;0.573;0.04	T	0.03673	-1.1014	10	0.02654	T	1	-9.9575	15.9114	0.79475	0.1363:0.8637:0.0:0.0	.	28;28;28	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	E	28	ENSP00000429633:G28E;ENSP00000428265:G28E;ENSP00000428011:G28E	ENSP00000428265:G28E	G	-	2	0	MYBL1	67677250	0.974000	0.33945	1.000000	0.80357	0.995000	0.86356	2.102000	0.41796	1.314000	0.45095	0.655000	0.94253	GGA	.	.	.	none		0.343	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274	
NCOA2	10499	hgsc.bcm.edu	37	8	71056986	71056986	+	Silent	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr8:71056986A>G	ENST00000452400.2	-	13	2884	c.2703T>C	c.(2701-2703)ccT>ccC	p.P901P	NCOA2_ENST00000267974.4_Intron	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	901					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TTGGTGGGAAAGGTCCAGCAC	0.458			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.P901P		Atlas-SNP	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.T2703C						PASS	.						204.0	190.0	195.0					8																	71056986		1925	4138	6063	SO:0001819	synonymous_variant	10499	exon13			TGGGAAAGGTCCA	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.2703T>C	chr8.hg19:g.71056986A>G		181.0	0.0	.		155.0	45.0	.	NM_006540	Q14CD2	Silent	SNP	ENST00000452400.2	hg19	CCDS47872.1																																																																																			.	.	.	none		0.458	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
TP53INP1	94241	hgsc.bcm.edu	37	8	95952262	95952262	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr8:95952262G>T	ENST00000342697.4	-	3	706	c.299C>A	c.(298-300)cCa>cAa	p.P100Q	NDUFAF6_ENST00000396113.1_Intron|TP53INP1_ENST00000378776.4_Missense_Mutation_p.P100Q|TP53INP1_ENST00000448464.2_Missense_Mutation_p.P100Q	NM_033285.3	NP_150601.1	Q96A56	T53I1_HUMAN	tumor protein p53 inducible nuclear protein 1	100					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to hydroperoxide (GO:0071447)|cellular response to methyl methanesulfonate (GO:0072703)|cellular response to UV (GO:0034644)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription, DNA-templated (GO:0045893)|response to heat (GO:0009408)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)			kidney(2)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	9	Breast(36;8.75e-07)					ACATGGGGGTGGGGTGATAAA	0.463																																					p.P100Q		Atlas-SNP	.											.	TP53INP1	22	.	0			c.C299A						PASS	.						123.0	115.0	118.0					8																	95952262		2203	4300	6503	SO:0001583	missense	94241	exon3			GGGGGTGGGGTGA	AF409115	CCDS6265.1, CCDS47899.1	8q22	2004-03-11				ENSG00000164938			18022	protein-coding gene	gene with protein product		606185				11511362, 12438758	Standard	NM_033285		Approved	DKFZp434M1317, FLJ22139, P53DINP1, SIP, TP53INP1A, TP53INP1B, Teap	uc003yhg.3	Q96A56		ENST00000342697.4:c.299C>A	chr8.hg19:g.95952262G>T	ENSP00000344215:p.Pro100Gln	153.0	0.0	.		133.0	51.0	.	NM_001135733	B2RCE5|Q969R9	Missense_Mutation	SNP	ENST00000342697.4	hg19	CCDS6265.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434936	0.83885	.	.	ENSG00000164938	ENST00000448464;ENST00000342697;ENST00000378776	T;T;T	0.79653	-1.29;-1.29;-1.29	6.17	5.3	0.74995	.	0.045488	0.85682	D	0.000000	D	0.89938	0.6860	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.983;0.999	D	0.91385	0.5130	10	0.87932	D	0	-22.1295	15.699	0.77528	0.0652:0.0:0.9348:0.0	.	100;100	Q96A56-2;Q96A56	.;T53I1_HUMAN	Q	100	ENSP00000390063:P100Q;ENSP00000344215:P100Q;ENSP00000368052:P100Q	ENSP00000344215:P100Q	P	-	2	0	TP53INP1	96021438	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.323000	0.96364	1.630000	0.50440	0.655000	0.94253	CCA	.	.	.	none		0.463	TP53INP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379818.1		
PABPC1	26986	hgsc.bcm.edu	37	8	101717893	101717893	+	Silent	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr8:101717893A>G	ENST00000318607.5	-	12	2739	c.1611T>C	c.(1609-1611)gtT>gtC	p.V537V	PABPC1_ENST00000519596.1_5'Flank|AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000519004.1_Silent_p.V492V|PABPC1_ENST00000522387.1_Silent_p.V505V	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	537					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CTTGTACATGAACAGCAGGCT	0.433																																					p.V537V		Atlas-SNP	.											.	PABPC1	76	.	0			c.T1611C						PASS	.						58.0	50.0	53.0					8																	101717893		2203	4300	6503	SO:0001819	synonymous_variant	26986	exon12			TACATGAACAGCA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1611T>C	chr8.hg19:g.101717893A>G		244.0	0.0	.		252.0	86.0	.	NM_002568	Q15097|Q93004	Silent	SNP	ENST00000318607.5	hg19	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	A	15.34	2.804600	0.50315	.	.	ENSG00000070756	ENST00000520868	.	.	.	5.75	3.37	0.38596	.	.	.	.	.	T	0.54565	0.1866	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50030	-0.8875	4	.	.	.	.	5.8593	0.18736	0.6593:0.0:0.3407:0.0	.	.	.	.	S	70	.	.	F	-	2	0	PABPC1	101787069	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.676000	0.25247	1.106000	0.41623	0.533000	0.62120	TTC	.	.	.	none		0.433	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						PASS	.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	34.0	1.0	.		59.0	3.0	.	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.	.	none		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
OR13C2	392376	hgsc.bcm.edu	37	9	107367111	107367111	+	Missense_Mutation	SNP	C	C	A	rs75116810		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr9:107367111C>A	ENST00000542196.1	-	1	840	c.798G>T	c.(796-798)gaG>gaT	p.E266D		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AATTAAGTGTCTCTTTAGACT	0.418																																					p.E266D		Atlas-SNP	.											.	OR13C2	46	.	0			c.G798T						PASS	.						148.0	132.0	137.0					9																	107367111		2201	4300	6501	SO:0001583	missense	392376	exon1			AAGTGTCTCTTTA		CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.798G>T	chr9.hg19:g.107367111C>A	ENSP00000438815:p.Glu266Asp	148.0	0.0	.		109.0	44.0	.	NM_001004481	B9EGV8|Q6IF54	Missense_Mutation	SNP	ENST00000542196.1	hg19	CCDS35092.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.250712	0.00022	.	.	ENSG00000257019	ENST00000542196	T	0.00164	8.64	3.08	-3.79	0.04320	GPCR, rhodopsin-like superfamily (1);	0.448415	0.16003	U	0.234188	T	0.00039	0.0001	N	0.01824	-0.7	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36792	-0.9733	10	0.02654	T	1	.	4.0407	0.09750	0.1362:0.2057:0.5389:0.1192	.	266	Q8NGS9	O13C2_HUMAN	D	266	ENSP00000438815:E266D	ENSP00000438815:E266D	E	-	3	2	OR13C2	106406932	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	-0.422000	0.07043	-0.512000	0.06505	-0.657000	0.03884	GAG	.	.	.	weak		0.418	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	NM_001004481	
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123287316	123287316	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr9:123287316G>A	ENST00000349780.4	-	11	1219	c.1040C>T	c.(1039-1041)gCc>gTc	p.A347V	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.A347V|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.A347V|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.A347V	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	347					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TTTAGCAAAGGCAGCACTGAG	0.468																																					p.A347V		Atlas-SNP	.											.	CDK5RAP2	157	.	0			c.C1040T						PASS	.						125.0	105.0	112.0					9																	123287316		2203	4300	6503	SO:0001583	missense	55755	exon11			GCAAAGGCAGCAC	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.1040C>T	chr9.hg19:g.123287316G>A	ENSP00000343818:p.Ala347Val	102.0	0.0	.		83.0	30.0	.	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	hg19	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617235	0.66672	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000345313;ENST00000482047	T;T;T;T;T	0.42900	3.84;3.75;3.84;3.75;0.96	5.51	4.59	0.56863	.	0.432373	0.21888	N	0.067631	T	0.46268	0.1384	L	0.56769	1.78	0.09310	N	0.999996	P;P;B;P	0.46142	0.86;0.873;0.078;0.799	P;B;B;B	0.47075	0.536;0.306;0.127;0.162	T	0.34725	-0.9817	10	0.29301	T	0.29	.	13.6699	0.62418	0.0:0.0:0.8403:0.1597	.	148;347;347;347	Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8	.;.;.;CK5P2_HUMAN	V	347;347;347;347;349;101	ENSP00000354065:A347V;ENSP00000352258:A347V;ENSP00000343818:A347V;ENSP00000353317:A347V;ENSP00000419640:A101V	ENSP00000341695:A349V	A	-	2	0	CDK5RAP2	122327137	1.000000	0.71417	0.019000	0.16419	0.844000	0.47949	5.391000	0.66266	1.290000	0.44636	0.555000	0.69702	GCC	.	.	.	none		0.468	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
STOX1	219736	hgsc.bcm.edu	37	10	70645490	70645490	+	Silent	SNP	C	C	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr10:70645490C>A	ENST00000298596.6	+	3	2021	c.1938C>A	c.(1936-1938)gcC>gcA	p.A646A	STOX1_ENST00000399165.4_Intron|STOX1_ENST00000421961.2_Silent_p.A536A|STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399169.4_Silent_p.A646A	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	646						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						CACGAGGTGCCTCCTTTTCAG	0.448																																					p.A646A		Atlas-SNP	.											.	STOX1	75	.	0			c.C1938A						PASS	.						128.0	121.0	123.0					10																	70645490		1926	4138	6064	SO:0001819	synonymous_variant	219736	exon3			AGGTGCCTCCTTT	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1938C>A	chr10.hg19:g.70645490C>A		78.0	0.0	.		64.0	46.0	.	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Silent	SNP	ENST00000298596.6	hg19	CCDS41535.1																																																																																			.	.	.	none		0.448	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
FUT11	170384	hgsc.bcm.edu	37	10	75535419	75535419	+	Silent	SNP	C	C	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr10:75535419C>A	ENST00000372841.3	+	3	1498	c.1455C>A	c.(1453-1455)atC>atA	p.I485I	RMRPP1_ENST00000517236.1_RNA	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	485					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					TACATGAAATCTTCATGAAGA	0.453																																					p.I485I		Atlas-SNP	.											.	FUT11	30	.	0			c.C1455A						PASS	.						110.0	99.0	103.0					10																	75535419		2203	4300	6503	SO:0001819	synonymous_variant	170384	exon3			TGAAATCTTCATG	BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.1455C>A	chr10.hg19:g.75535419C>A		116.0	0.0	.		80.0	51.0	.	NM_173540	Q495W7|Q8IYE4	Silent	SNP	ENST00000372841.3	hg19	CCDS7333.1																																																																																			.	.	.	none		0.453	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048689.1	NM_173540	
PTEN	5728	hgsc.bcm.edu	37	10	89720837	89720837	+	Nonsense_Mutation	SNP	A	A	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr10:89720837A>T	ENST00000371953.3	+	8	2345	c.988A>T	c.(988-990)Aaa>Taa	p.K330*	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	330	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N329fs*14(3)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.W274_F341del(1)|p.N329fs*12(1)|p.D326_K342del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAAAGCAAATAAAGACAAAGC	0.323		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.K330X		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN	3652	.	56	Whole gene deletion(37)|Deletion - Frameshift(13)|Deletion - In frame(4)|Unknown(2)	prostate(16)|central_nervous_system(13)|skin(6)|endometrium(4)|lung(4)|breast(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.A988T						PASS	.						71.0	73.0	72.0					10																	89720837		2203	4298	6501	SO:0001587	stop_gained	5728	exon8	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	GCAAATAAAGACA	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.988A>T	chr10.hg19:g.89720837A>T	ENSP00000361021:p.Lys330*	398.0	1.0	.		271.0	186.0	.	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	A	49	15.016191	0.99819	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.5629	15.3536	0.74409	1.0:0.0:0.0:0.0	.	.	.	.	X	330	.	.	K	+	1	0	PTEN	89710817	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.861000	0.92277	2.034000	0.60081	0.482000	0.46254	AAA	.	.	.	none		0.323	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
AMBRA1	55626	hgsc.bcm.edu	37	11	46563838	46563838	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr11:46563838A>G	ENST00000458649.2	-	7	2147	c.1729T>C	c.(1729-1731)Ttc>Ctc	p.F577L	AMBRA1_ENST00000533727.1_Missense_Mutation_p.F487L|AMBRA1_ENST00000298834.3_Missense_Mutation_p.F577L|AMBRA1_ENST00000528950.1_Missense_Mutation_p.F577L|AMBRA1_ENST00000534300.1_Missense_Mutation_p.F577L|AMBRA1_ENST00000314845.3_Missense_Mutation_p.F487L|AMBRA1_ENST00000426438.1_Missense_Mutation_p.F577L			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	577					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TCGTTGTTGAAGGTCAGGAGA	0.582																																					p.F487L		Atlas-SNP	.											.	AMBRA1	201	.	0			c.T1459C						PASS	.						121.0	99.0	106.0					11																	46563838		2201	4299	6500	SO:0001583	missense	55626	exon8			TGTTGAAGGTCAG	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1729T>C	chr11.hg19:g.46563838A>G	ENSP00000415327:p.Phe577Leu	54.0	0.0	.		40.0	15.0	.	NM_001267783	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.64	3.440069	0.63067	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.80824	-1.02;-1.42;-0.83;-0.96;-0.83;-0.84;-0.96	5.73	5.73	0.89815	.	0.044861	0.85682	D	0.000000	D	0.84097	0.5397	L	0.29908	0.895	0.80722	D	1	P;D;D;D;D;D	0.71674	0.953;0.998;0.998;0.974;0.99;0.974	B;D;D;D;D;D	0.76071	0.294;0.987;0.987;0.969;0.979;0.969	D	0.84535	0.0635	10	0.44086	T	0.13	.	16.0234	0.80516	1.0:0.0:0.0:0.0	.	577;577;577;487;487;487	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	L	487;487;577;577;577;487;577;577	ENSP00000318313:F487L;ENSP00000433372:F487L;ENSP00000431926:F577L;ENSP00000410899:F577L;ENSP00000298834:F577L;ENSP00000415327:F577L;ENSP00000433945:F577L	ENSP00000298834:F577L	F	-	1	0	AMBRA1	46520414	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.935000	0.92923	2.172000	0.68678	0.533000	0.62120	TTC	.	.	.	none		0.582	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
AMBRA1	55626	hgsc.bcm.edu	37	11	46569397	46569397	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr11:46569397G>T	ENST00000458649.2	-	3	582	c.164C>A	c.(163-165)tCt>tAt	p.S55Y	AMBRA1_ENST00000533727.1_Missense_Mutation_p.S55Y|AMBRA1_ENST00000298834.3_Missense_Mutation_p.S55Y|AMBRA1_ENST00000528950.1_Missense_Mutation_p.S55Y|AMBRA1_ENST00000534300.1_Missense_Mutation_p.S55Y|AMBRA1_ENST00000314845.3_Missense_Mutation_p.S55Y|AMBRA1_ENST00000426438.1_Missense_Mutation_p.S55Y			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	55					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TAAGAAGGTAGAGCGTGGACT	0.383																																					p.S55Y		Atlas-SNP	.											.	AMBRA1	201	.	0			c.C164A						PASS	.						53.0	54.0	54.0					11																	46569397		2201	4299	6500	SO:0001583	missense	55626	exon3			AAGGTAGAGCGTG	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.164C>A	chr11.hg19:g.46569397G>T	ENSP00000415327:p.Ser55Tyr	65.0	0.0	.		53.0	16.0	.	NM_001267783	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	hg19		.	.	.	.	.	.	.	.	.	.	G	19.58	3.853645	0.71719	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.72282	-0.48;-0.64;-0.34;-0.45;-0.34;-0.43;-0.45	6.04	6.04	0.98038	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84188	0.5417	M	0.67397	2.05	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;0.999;0.999	D;D;D;D;D;D	0.87578	0.991;0.998;0.998;0.996;0.996;0.996	T	0.83247	-0.0055	10	0.56958	D	0.05	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	55;55;55;55;55;55	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	Y	55	ENSP00000318313:S55Y;ENSP00000433372:S55Y;ENSP00000431926:S55Y;ENSP00000410899:S55Y;ENSP00000298834:S55Y;ENSP00000415327:S55Y;ENSP00000433945:S55Y	ENSP00000298834:S55Y	S	-	2	0	AMBRA1	46525973	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.659000	0.98597	2.873000	0.98535	0.561000	0.74099	TCT	.	.	.	none		0.383	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
NXF1	10482	hgsc.bcm.edu	37	11	62561809	62561809	+	Missense_Mutation	SNP	G	G	A	rs546919784		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr11:62561809G>A	ENST00000532297.1	-	20	2310	c.1681C>T	c.(1681-1683)Ccc>Tcc	p.P561S	NXF1_ENST00000294172.2_Missense_Mutation_p.P561S|TMEM223_ENST00000527073.1_5'Flank|TMEM223_ENST00000525631.1_5'Flank|NXF1_ENST00000533048.1_5'UTR|NXF1_ENST00000531709.2_3'UTR|TMEM223_ENST00000307366.7_5'Flank			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	561	Pro-rich.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGAGGGTGGGCACCGGGCTG	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		17580	0.0		0.0	False		,,,				2504	0.001				p.P561S		Atlas-SNP	.											.	NXF1	67	.	0			c.C1681T						PASS	.						103.0	95.0	98.0					11																	62561809		2201	4299	6500	SO:0001583	missense	10482	exon19			GGGTGGGCACCGG	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1681C>T	chr11.hg19:g.62561809G>A	ENSP00000436679:p.Pro561Ser	123.0	0.0	.		127.0	6.0	.	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	hg19	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745384	0.69418	.	.	ENSG00000162231	ENST00000294172;ENST00000532297	T;T	0.52295	0.67;0.67	5.38	4.43	0.53597	TAP, C-terminal (1);UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.44746	0.1308	M	0.70842	2.15	0.80722	D	1	P	0.44734	0.842	B	0.37601	0.254	T	0.46816	-0.9164	10	0.29301	T	0.29	-18.3515	13.9834	0.64319	0.0:0.1517:0.8483:0.0	.	561	Q9UBU9	NXF1_HUMAN	S	561	ENSP00000294172:P561S;ENSP00000436679:P561S	ENSP00000294172:P561S	P	-	1	0	NXF1	62318385	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.633000	0.83260	2.526000	0.85167	0.462000	0.41574	CCC	.	.	.	none		0.537	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
PCF11	51585	hgsc.bcm.edu	37	11	82877708	82877708	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr11:82877708G>A	ENST00000298281.4	+	5	2221	c.1769G>A	c.(1768-1770)aGt>aAt	p.S590N		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	590					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AACTGGCAAAGTTCCAAGTCT	0.368																																					p.S590N		Atlas-SNP	.											.	PCF11	220	.	0			c.G1769A						PASS	.						70.0	70.0	70.0					11																	82877708		1802	3980	5782	SO:0001583	missense	51585	exon5			GGCAAAGTTCCAA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1769G>A	chr11.hg19:g.82877708G>A	ENSP00000298281:p.Ser590Asn	291.0	0.0	.		277.0	83.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	G	7.024	0.559350	0.13436	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.45276	1.9;0.9;0.9	6.07	4.18	0.49190	.	0.165679	0.43747	D	0.000537	T	0.27278	0.0669	N	0.19112	0.55	0.24915	N	0.992017	B;B	0.19583	0.037;0.0	B;B	0.19391	0.025;0.003	T	0.14615	-1.0466	9	.	.	.	.	11.9702	0.53060	0.0652:0.1224:0.8124:0.0	.	590;590	E9PQ01;O94913	.;PCF11_HUMAN	N	590	ENSP00000298281:S590N;ENSP00000434540:S590N;ENSP00000431567:S590N	.	S	+	2	0	PCF11	82555356	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.554000	0.53720	0.869000	0.35703	0.655000	0.94253	AGT	.	.	.	none		0.368	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
CREBZF	58487	hgsc.bcm.edu	37	11	85375427	85375427	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr11:85375427T>C	ENST00000527447.1	-	1	719	c.493A>G	c.(493-495)Agg>Ggg	p.R165G	CREBZF_ENST00000398294.2_Missense_Mutation_p.R83G|CREBZF_ENST00000531515.1_Intron|CREBZF_ENST00000534224.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	165					negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				TTTAACAGCCTTTGCAGCAGG	0.647											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R165G	NSCLC(172;674 2044 9050 18334 41735)	Atlas-SNP	.											.	CREBZF	26	.	0			c.A493G						PASS	.						20.0	23.0	22.0					11																	85375427		2044	4204	6248	SO:0001583	missense	58487	exon1			ACAGCCTTTGCAG	AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.493A>G	chr11.hg19:g.85375427T>C	ENSP00000433459:p.Arg165Gly	89.0	0.0	.	1236	67.0	20.0	.	NM_001039618	B2R8Q9|Q0P5U9|Q52LT3	Missense_Mutation	SNP	ENST00000527447.1	hg19	CCDS41697.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279731	0.80692	.	.	ENSG00000137504	ENST00000398294;ENST00000527447	.	.	.	4.46	4.46	0.54185	.	0.219310	0.30879	N	0.008690	T	0.41026	0.1141	N	0.04508	-0.205	0.35343	D	0.78664	D	0.57899	0.981	D	0.67231	0.95	T	0.50955	-0.8766	8	.	.	.	-19.5129	10.3281	0.43805	0.0:0.0:0.0:1.0	.	165	Q9NS37	ZHANG_HUMAN	G	83;165	.	.	R	-	1	2	CREBZF	85053075	0.997000	0.39634	1.000000	0.80357	0.990000	0.78478	0.977000	0.29475	2.003000	0.58678	0.459000	0.35465	AGG	.	.	.	none		0.647	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390191.2	NM_001039618	
DDX10	1662	hgsc.bcm.edu	37	11	108562631	108562631	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr11:108562631G>A	ENST00000322536.3	+	8	1133	c.1004G>A	c.(1003-1005)cGg>cAg	p.R335Q	DDX10_ENST00000526794.1_Missense_Mutation_p.R335Q	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	335	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		GTGTTTTGCCGGCTACGTCCT	0.448			T	NUP98	AML*																																p.R335Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	.	DDX10	70	.	0			c.G1004A						PASS	.						159.0	132.0	141.0					11																	108562631		2201	4298	6499	SO:0001583	missense	1662	exon8			TTTGCCGGCTACG	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.1004G>A	chr11.hg19:g.108562631G>A	ENSP00000314348:p.Arg335Gln	104.0	0.0	.		100.0	29.0	.	NM_004398	B2RCQ3|Q5BJD8	Missense_Mutation	SNP	ENST00000322536.3	hg19	CCDS8342.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827186	0.71143	.	.	ENSG00000178105	ENST00000322536;ENST00000456020;ENST00000526794	T;T	0.04706	3.57;3.57	5.48	4.57	0.56435	Helicase, C-terminal (2);	0.051708	0.64402	D	0.000001	T	0.07413	0.0187	N	0.19112	0.55	0.46356	D	0.999001	D;D	0.60575	0.988;0.979	P;P	0.55112	0.74;0.769	T	0.39375	-0.9617	10	0.48119	T	0.1	-12.4144	11.2003	0.48736	0.1599:0.0:0.8401:0.0	.	335;335	Q13206;E9PIF2	DDX10_HUMAN;.	Q	335;241;335	ENSP00000314348:R335Q;ENSP00000432032:R335Q	ENSP00000314348:R335Q	R	+	2	0	DDX10	108067841	1.000000	0.71417	0.955000	0.39395	0.226000	0.24999	6.285000	0.72658	1.309000	0.44985	0.591000	0.81541	CGG	.	.	.	none		0.448	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390343.1	NM_004398	
ARHGAP9	64333	hgsc.bcm.edu	37	12	57872506	57872506	+	Missense_Mutation	SNP	C	C	G	rs368912616		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr12:57872506C>G	ENST00000356411.2	-	3	489	c.351G>C	c.(349-351)ttG>ttC	p.L117F	ARHGAP9_ENST00000430041.2_5'Flank|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.L196F|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.L117F|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.L188F|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.L117F			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	117					positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			GGGCCTGAGACAACTCCTCCA	0.577																																					p.L117F		Atlas-SNP	.											.	ARHGAP9	79	.	0			c.G351C						PASS	.						59.0	56.0	57.0					12																	57872506		2203	4300	6503	SO:0001583	missense	64333	exon2			CTGAGACAACTCC	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.351G>C	chr12.hg19:g.57872506C>G	ENSP00000348782:p.Leu117Phe	59.0	0.0	.		53.0	32.0	.	NM_001080157	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	hg19		.	.	.	.	.	.	.	.	.	.	c	2.790	-0.251593	0.05867	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000552249	T;T;T;T;T	0.61742	2.86;2.86;1.5;2.75;0.08	3.96	0.0109	0.14085	.	0.959081	0.08578	N	0.925035	T	0.53142	0.1778	L	0.48642	1.525	0.09310	N	1	D;P;B;P;B	0.61697	0.99;0.745;0.001;0.527;0.392	P;B;B;B;B	0.51806	0.68;0.161;0.001;0.158;0.076	T	0.43261	-0.9402	10	0.51188	T	0.08	.	1.2457	0.01972	0.1714:0.4464:0.1797:0.2026	.	117;196;117;117;117	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9	.;.;RHG09_HUMAN;.;.	F	117;117;117;188;166;35	ENSP00000377380:L117F;ENSP00000348782:L117F;ENSP00000394307:L117F;ENSP00000377386:L188F;ENSP00000448358:L35F	ENSP00000344852:L166F	L	-	3	2	ARHGAP9	56158773	0.000000	0.05858	0.003000	0.11579	0.020000	0.10135	-0.013000	0.12678	0.003000	0.14656	-1.776000	0.00657	TTG	.	.	.	alt		0.577	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496	
TRHDE	29953	hgsc.bcm.edu	37	12	72962372	72962372	+	Silent	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr12:72962372T>C	ENST00000261180.4	+	10	2028	c.1932T>C	c.(1930-1932)acT>acC	p.T644T	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	644					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TTCCATTAACTATTGTGGTAG	0.348																																					p.T644T		Atlas-SNP	.											.	TRHDE	194	.	0			c.T1932C						PASS	.						112.0	111.0	111.0					12																	72962372		2203	4300	6503	SO:0001819	synonymous_variant	29953	exon10			ATTAACTATTGTG	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1932T>C	chr12.hg19:g.72962372T>C		108.0	0.0	.		133.0	70.0	.	NM_013381	A5PL19|Q6UWJ4	Silent	SNP	ENST00000261180.4	hg19	CCDS9004.1																																																																																			.	.	.	none		0.348	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
CMA1	1215	hgsc.bcm.edu	37	14	24976587	24976588	+	Missense_Mutation	DNP	GC	GC	CA			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr14:24976587_24976588GC>CA	ENST00000250378.3	-	2	212_213	c.183_184GC>TG	c.(181-186)gtGCtg>gtTGtg	p.L62V	CMA1_ENST00000206446.4_Intron|RP11-80A15.1_ENST00000555109.1_Intron	NM_001836.3	NP_001827.1	P23946	CMA1_HUMAN	chymase 1, mast cell	62	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|cellular response to glucose stimulus (GO:0071333)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|interleukin-1 beta biosynthetic process (GO:0050720)|midbrain development (GO:0030901)|peptide metabolic process (GO:0006518)|positive regulation of angiogenesis (GO:0045766)|regulation of inflammatory response (GO:0050727)	extracellular region (GO:0005576)|intracellular (GO:0005622)	peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			kidney(1)|lung(8)|pancreas(1)|prostate(1)	11				GBM - Glioblastoma multiforme(265;0.0271)		GCAGCCGTCAGCACAAAGTTCC	0.48																																					p.L62V|p.V61V		Atlas-SNP	.											.	CMA1	21	.	0			c.C184G|c.G183T						PASS	.																																			SO:0001583	missense	1215	exon2			CCGTCAGCACAAA|CGTCAGCACAAAG		CCDS9630.1	14q12	2012-08-30			ENSG00000092009	ENSG00000092009	3.4.21.39		2097	protein-coding gene	gene with protein product		118938				8468056	Standard	NM_001836		Approved		uc001wpp.1	P23946	OTTHUMG00000140181	ENST00000250378.3:c.183_184delinsCA	chr14.hg19:g.24976587_24976588delinsCA	ENSP00000250378:p.Leu62Val	146.0|148.0	0.0	.		94.0|98.0	24.0|26.0	.	NM_001836	B5BUM8|Q16018|Q3SY36|Q3SY37|Q9UDH5	Missense_Mutation|Silent	SNP	ENST00000250378.3	hg19	CCDS9630.1																																																																																			.	.	.	none		0.480	CMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276535.2		
ARG2	384	hgsc.bcm.edu	37	14	68113700	68113700	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr14:68113700T>A	ENST00000261783.3	+	6	860	c.680T>A	c.(679-681)aTc>aAc	p.I227N		NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	227					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	CGACTTGGTATCCAGAAGGTC	0.378																																					p.I227N		Atlas-SNP	.											.	ARG2	20	.	0			c.T680A						PASS	.						108.0	104.0	105.0					14																	68113700		2203	4300	6503	SO:0001583	missense	384	exon6			TTGGTATCCAGAA	D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.680T>A	chr14.hg19:g.68113700T>A	ENSP00000261783:p.Ile227Asn	60.0	0.0	.		59.0	25.0	.	NM_001172	B2R690|Q6FHY8	Missense_Mutation	SNP	ENST00000261783.3	hg19	CCDS9785.1	.	.	.	.	.	.	.	.	.	.	T	31	5.095241	0.94197	.	.	ENSG00000081181	ENST00000261783	D	0.85955	-2.05	6.17	6.17	0.99709	Ureohydrolase domain (1);	0.044090	0.85682	D	0.000000	D	0.95446	0.8521	H	0.97365	3.99	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96930	0.9680	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	227	P78540	ARGI2_HUMAN	N	227	ENSP00000261783:I227N	ENSP00000261783:I227N	I	+	2	0	ARG2	67183453	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	ATC	.	.	.	none		0.378	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415190.2	NM_001172	
SNURF	8926	hgsc.bcm.edu	37	15	25207341	25207341	+	Nonsense_Mutation	SNP	C	C	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr15:25207341C>A	ENST00000577949.1	+	2	158	c.95C>A	c.(94-96)tCa>tAa	p.S32*	SNRPN_ENST00000400100.1_5'UTR|SNURF_ENST00000551312.2_Nonsense_Mutation_p.S32*|SNRPN_ENST00000400098.1_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNRPN_ENST00000390687.4_5'UTR|SNURF_ENST00000338094.6_Nonsense_Mutation_p.S32*|SNRPN_ENST00000346403.6_5'UTR|SNURF_ENST00000338327.4_Nonsense_Mutation_p.S32*|SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000554227.2_5'UTR			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	32						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		AGGACTGCCTCACTGAGCAAC	0.453																																					p.S32X		Atlas-SNP	.											.	SNURF	17	.	0			c.C95A						PASS	.						137.0	104.0	115.0					15																	25207341		2203	4300	6503	SO:0001587	stop_gained	8926	exon2			CTGCCTCACTGAG		CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.95C>A	chr15.hg19:g.25207341C>A	ENSP00000463201:p.Ser32*	131.0	0.0	.		94.0	36.0	.	NM_005678	A6NCW2	Nonsense_Mutation	SNP	ENST00000577949.1	hg19	CCDS10016.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359258	0.82353	.	.	ENSG00000214265	ENST00000338094;ENST00000338327	.	.	.	3.76	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.4824	11.3845	0.49776	0.0:1.0:0.0:0.0	.	.	.	.	X	32	.	ENSP00000336543:S32X	S	+	2	0	SNURF	22758434	0.993000	0.37304	0.937000	0.37676	0.838000	0.47535	2.269000	0.43346	2.412000	0.81896	0.655000	0.94253	TCA	.	.	.	none		0.453	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446300.1	NM_005678	
C15orf62	643338	hgsc.bcm.edu	37	15	41062848	41062848	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr15:41062848T>C	ENST00000344320.6	+	1	690	c.155T>C	c.(154-156)aTc>aCc	p.I52T	DNAJC17_ENST00000220496.4_Intron|DNAJC17_ENST00000558727.1_5'Flank	NM_001130448.2	NP_001123920.1	A8K5M9	CO062_HUMAN	chromosome 15 open reading frame 62	52						mitochondrion (GO:0005739)											CGAGAAGTCATCCGGGAGCTA	0.706																																					p.I52T		Atlas-SNP	.											.	C15orf62	3	.	0			c.T155C						PASS	.						42.0	56.0	52.0					15																	41062848		692	1591	2283	SO:0001583	missense	643338	exon1			AAGTCATCCGGGA		CCDS45229.1	15q15.1	2008-08-07			ENSG00000188277	ENSG00000188277			34489	protein-coding gene	gene with protein product							Standard	NM_001130448		Approved	LOC643338	uc010bby.3	A8K5M9		ENST00000344320.6:c.155T>C	chr15.hg19:g.41062848T>C	ENSP00000341178:p.Ile52Thr	57.0	0.0	.		45.0	15.0	.	NM_001130448	A6NK01	Missense_Mutation	SNP	ENST00000344320.6	hg19	CCDS45229.1	.	.	.	.	.	.	.	.	.	.	T	11.50	1.657219	0.29425	.	.	ENSG00000188277	ENST00000344320	.	.	.	5.48	4.37	0.52481	.	0.304354	0.26507	N	0.023994	T	0.26666	0.0652	N	0.19112	0.55	0.27401	N	0.954857	B	0.15930	0.015	B	0.10450	0.005	T	0.10823	-1.0613	9	0.40728	T	0.16	-12.0928	9.2131	0.37331	0.0:0.0827:0.0:0.9173	.	52	A8K5M9	CO062_HUMAN	T	52	.	ENSP00000341178:I52T	I	+	2	0	C15orf62	38850140	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.375000	0.44283	2.087000	0.62958	0.459000	0.35465	ATC	.	.	.	none		0.706	C15orf62-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418995.1	NM_001130448	
GLCE	26035	hgsc.bcm.edu	37	15	69548297	69548297	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr15:69548297G>A	ENST00000261858.2	+	3	380	c.152G>A	c.(151-153)gGg>gAg	p.G51E	GLCE_ENST00000559420.2_5'UTR	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	51					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AGAGTGGATGGGTTTGAAAAA	0.463																																					p.G51E		Atlas-SNP	.											.	GLCE	48	.	0			c.G152A						PASS	.						90.0	87.0	88.0					15																	69548297		2200	4298	6498	SO:0001583	missense	26035	exon3			TGGATGGGTTTGA	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.152G>A	chr15.hg19:g.69548297G>A	ENSP00000261858:p.Gly51Glu	178.0	0.0	.		155.0	49.0	.	NM_015554	Q6GUQ2	Missense_Mutation	SNP	ENST00000261858.2	hg19	CCDS32277.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034619	0.35893	.	.	ENSG00000138604	ENST00000261858	T	0.32753	1.44	5.3	3.42	0.39159	.	0.261099	0.38164	N	0.001783	T	0.21962	0.0529	L	0.36672	1.1	0.33073	D	0.535579	B	0.33694	0.421	B	0.27500	0.08	T	0.29088	-1.0023	10	0.62326	D	0.03	-2.6096	10.3667	0.44028	0.0:0.1541:0.699:0.1469	.	51	O94923	GLCE_HUMAN	E	51	ENSP00000261858:G51E	ENSP00000261858:G51E	G	+	2	0	GLCE	67335351	1.000000	0.71417	0.914000	0.36105	0.752000	0.42762	5.519000	0.67074	0.722000	0.32252	0.655000	0.94253	GGG	.	.	.	none		0.463	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
CYP1A2	1544	hgsc.bcm.edu	37	15	75042653	75042653	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr15:75042653G>A	ENST00000343932.4	+	2	637	c.574G>A	c.(574-576)Gtg>Atg	p.V192M		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	192					alkaloid metabolic process (GO:0009820)|arachidonic acid metabolic process (GO:0019369)|cellular respiration (GO:0045333)|cellular response to cadmium ion (GO:0071276)|dibenzo-p-dioxin metabolic process (GO:0018894)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|hydrogen peroxide biosynthetic process (GO:0050665)|lung development (GO:0030324)|methylation (GO:0032259)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative deethylation (GO:0071615)|oxidative demethylation (GO:0070989)|porphyrin-containing compound metabolic process (GO:0006778)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|toxin biosynthetic process (GO:0009403)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|demethylase activity (GO:0032451)|electron carrier activity (GO:0009055)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					"""""""Insulin(DB00071)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Agomelatine(DB06594)|Albendazole(DB00518)|Alitretinoin(DB00523)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Anagrelide(DB00261)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Asenapine(DB06216)|Atropine(DB00572)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzyl alcohol(DB06770)|Betaxolol(DB00195)|Bortezomib(DB00188)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Caffeine(DB00201)|Carbamazepine(DB00564)|Carmustine(DB00262)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clenbuterol(DB01407)|Clevidipine(DB04920)|Clobetasol propionate(DB01013)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Diazepam(DB00829)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Edetic Acid(DB00974)|Efavirenz(DB00625)|Eltrombopag(DB06210)|Enoxacin(DB00467)|Epinephrine(DB00668)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Ethanol(DB00898)|Etoposide(DB00773)|Etoricoxib(DB01628)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Gemfibrozil(DB01241)|Griseofulvin(DB00400)|Guanabenz(DB00629)|Haloperidol(DB00502)|Hesperetin(DB01094)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|inhaled insulin(DB05278)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Losartan(DB00678)|Lumiracoxib(DB01283)|Malathion(DB00772)|Maprotiline(DB00934)|Meclizine(DB00737)|Melatonin(DB01065)|Menadione(DB00170)|Methadone(DB00333)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Nabumetone(DB00461)|Nafcillin(DB00607)|Naproxen(DB00788)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitric Oxide(DB00435)|Nitroprusside(DB00325)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxaliplatin(DB00526)|Oxtriphylline(DB01303)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pefloxacin(DB00487)|Pentamidine(DB00738)|Pentoxifylline(DB00806)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pomalidomide(DB08910)|Praziquantel(DB01058)|Primaquine(DB01087)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|SIMEPREVIR(DB06290)|Sorafenib(DB00398)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Tenofovir(DB00300)|Terbinafine(DB00857)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiabendazole(DB00730)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tizanidine(DB00697)|Tocainide(DB01056)|Toremifene(DB00539)|Tranylcypromine(DB00752)|Triamterene(DB00384)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)|Vemurafenib(DB08881)|Verapamil(DB00661)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)|Zolpidem(DB00425)"""	TTACAATCAGGTGGTGGTGTC	0.567																																					p.V192M		Atlas-SNP	.											.	CYP1A2	70	.	0			c.G574A						PASS	.						244.0	192.0	210.0					15																	75042653		2197	4296	6493	SO:0001583	missense	1544	exon2			AATCAGGTGGTGG	AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1.14.14.1	"""Cytochrome P450s"""	2596	protein-coding gene	gene with protein product		124060	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2"""			15128046	Standard	NM_000761		Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	ENST00000343932.4:c.574G>A	chr15.hg19:g.75042653G>A	ENSP00000342007:p.Val192Met	68.0	0.0	.		51.0	24.0	.	NM_000761	Q16754|Q6NWU5|Q9BXX7|Q9UK49	Missense_Mutation	SNP	ENST00000343932.4	hg19	CCDS32293.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450299	0.26074	.	.	ENSG00000140505	ENST00000343932	T	0.70631	-0.5	4.98	-3.32	0.04973	.	0.338015	0.32593	N	0.005883	T	0.72946	0.3524	M	0.64080	1.96	0.26746	N	0.970298	D	0.62365	0.991	P	0.60286	0.872	T	0.67837	-0.5567	10	0.62326	D	0.03	.	8.2501	0.31712	0.3197:0.4156:0.2647:0.0	.	192	P05177-2	.	M	192	ENSP00000342007:V192M	ENSP00000342007:V192M	V	+	1	0	CYP1A2	72829706	0.028000	0.19301	0.002000	0.10522	0.002000	0.02628	0.368000	0.20399	-0.525000	0.06391	-0.254000	0.11334	GTG	.	.	.	none		0.567	CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421263.2	NM_000761	
GOLGA6C	653641	hgsc.bcm.edu	37	15	75562489	75562489	+	Silent	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr15:75562489C>T	ENST00000300576.5	+	18	2031	c.2031C>T	c.(2029-2031)aaC>aaT	p.N677N	RN7SL489P_ENST00000486185.2_RNA	NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C	677						Golgi apparatus (GO:0005794)				ovary(1)	1						CCCATGACAACCCCCCGGTAC	0.602																																					p.N677N		Atlas-SNP	.											.	GOLGA6C	12	.	0			c.C2031T						PASS	.						50.0	62.0	58.0					15																	75562489		665	1575	2240	SO:0001819	synonymous_variant	653641	exon18			TGACAACCCCCCG		CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.2031C>T	chr15.hg19:g.75562489C>T		542.0	0.0	.		441.0	55.0	.	NM_001164404		Silent	SNP	ENST00000300576.5	hg19	CCDS58388.1																																																																																			.	.	.	none		0.602	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419797.1	NM_001164404	
NR2F2	7026	hgsc.bcm.edu	37	15	96880778	96880778	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr15:96880778C>A	ENST00000394166.3	+	3	2561	c.1172C>A	c.(1171-1173)cCc>cAc	p.P391H	NR2F2_ENST00000453270.2_Missense_Mutation_p.P238H|NR2F2_ENST00000394171.2_Missense_Mutation_p.P238H|NR2F2_ENST00000421109.2_Missense_Mutation_p.P258H	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	391	Important for dimerization.|Interaction with ZFPM2. {ECO:0000250}.|Ligand-binding. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			GGTAAAACCCCCATCGAAACC	0.463																																					p.P391H		Atlas-SNP	.											.	NR2F2	35	.	0			c.C1172A						PASS	.						151.0	147.0	148.0					15																	96880778		2197	4298	6495	SO:0001583	missense	7026	exon3			AAACCCCCATCGA	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.1172C>A	chr15.hg19:g.96880778C>A	ENSP00000377721:p.Pro391His	155.0	0.0	.		129.0	45.0	.	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	hg19	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562655	0.65538	.	.	ENSG00000185551	ENST00000421109;ENST00000394166;ENST00000394171;ENST00000453270	T;T;D;D	0.95137	0.5;0.5;-3.62;-3.62	5.44	5.44	0.79542	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.97300	0.9117	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.987	D	0.97614	1.0131	10	0.87932	D	0	.	19.6189	0.95647	0.0:1.0:0.0:0.0	.	391;258	P24468;Q3KQR7	COT2_HUMAN;.	H	258;391;238;238	ENSP00000401674:P258H;ENSP00000377721:P391H;ENSP00000377726:P238H;ENSP00000389853:P238H	ENSP00000377721:P391H	P	+	2	0	NR2F2	94681782	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.698000	0.92095	0.650000	0.86243	CCC	.	.	.	none		0.463	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
ZG16B	124220	hgsc.bcm.edu	37	16	2880794	2880794	+	Missense_Mutation	SNP	A	A	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr16:2880794A>T	ENST00000382280.3	+	3	339	c.260A>T	c.(259-261)aAa>aTa	p.K87I	ZG16B_ENST00000572863.1_Missense_Mutation_p.K57I	NM_145252.2	NP_660295.2	Q96DA0	ZG16B_HUMAN	zymogen granule protein 16B	87					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5						CTCCTGGTGAAAAGGTGAGTA	0.562																																					p.K87I		Atlas-SNP	.											.	ZG16B	16	.	0			c.A260T						PASS	.						139.0	147.0	144.0					16																	2880794		2015	4157	6172	SO:0001583	missense	124220	exon3			TGGTGAAAAGGTG	BC009722	CCDS10479.2	16p13.3	2014-02-12	2012-12-07		ENSG00000162078	ENSG00000162078			30456	protein-coding gene	gene with protein product	"""jacalin-like lectin domain containing 2"""		"""zymogen granule protein 16 homolog B (rat)"""			12477932	Standard	NM_145252		Approved	HRPE773, PRO1567, JCLN2	uc002cru.3	Q96DA0	OTTHUMG00000128933	ENST00000382280.3:c.260A>T	chr16.hg19:g.2880794A>T	ENSP00000371715:p.Lys87Ile	97.0	0.0	.		140.0	76.0	.	NM_145252	A6NIY1|B2R4F6|Q6UW28	Missense_Mutation	SNP	ENST00000382280.3	hg19	CCDS10479.2	.	.	.	.	.	.	.	.	.	.	a	12.20	1.866528	0.32977	.	.	ENSG00000162078	ENST00000382280	T	0.30981	1.51	3.4	-1.96	0.07525	Mannose-binding lectin (3);	2.708630	0.01864	N	0.036792	T	0.30008	0.0751	N	0.14661	0.345	0.09310	N	0.999999	D	0.67145	0.996	D	0.66716	0.946	T	0.15983	-1.0418	10	0.33141	T	0.24	-8.9085	0.1357	0.00078	0.3502:0.1732:0.2343:0.2422	.	87	Q96DA0	ZG16B_HUMAN	I	87	ENSP00000371715:K87I	ENSP00000371715:K87I	K	+	2	0	ZG16B	2820795	0.002000	0.14202	0.006000	0.13384	0.005000	0.04900	0.180000	0.16860	-0.466000	0.06943	-0.295000	0.09555	AAA	.	.	.	none		0.562	ZG16B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250912.1	NM_145252	
CES4A	283848	hgsc.bcm.edu	37	16	67038021	67038021	+	Missense_Mutation	SNP	T	T	A	rs3859072		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr16:67038021T>A	ENST00000326686.5	+	9	974	c.974T>A	c.(973-975)gTg>gAg	p.V325E	CES4A_ENST00000540947.2_Missense_Mutation_p.V325E|CES4A_ENST00000535696.1_Missense_Mutation_p.V231E|CES4A_ENST00000398354.1_Missense_Mutation_p.V325E|CES4A_ENST00000541479.1_Missense_Mutation_p.V348E|CES4A_ENST00000338718.4_Missense_Mutation_p.V348E|CES4A_ENST00000540579.1_Missense_Mutation_p.V227E			Q5XG92	EST4A_HUMAN	carboxylesterase 4A	325						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			large_intestine(2)|liver(2)|lung(4)|ovary(1)	9						GTGGATGGTGTGGTGATCCCA	0.532																																					p.V325E		Atlas-SNP	.											.	CES4A	24	.	0			c.T974A						PASS	.						231.0	234.0	233.0					16																	67038021		2056	4189	6245	SO:0001583	missense	283848	exon9			ATGGTGTGGTGAT	AK094783	CCDS42174.1, CCDS42174.2, CCDS54024.1, CCDS54025.1, CCDS42174.3	16q22.1	2011-10-25	2010-10-12	2010-10-12	ENSG00000172824	ENSG00000172824		"""Carboxylesterases"""	26741	protein-coding gene	gene with protein product			"""carboxylesterase 8 (putative)"""	CES8		12975309, 17364878, 20931200	Standard	NM_001190201		Approved	FLJ37464	uc010vix.2	Q5XG92		ENST00000326686.5:c.974T>A	chr16.hg19:g.67038021T>A	ENSP00000314145:p.Val325Glu	139.0	0.0	.		142.0	30.0	.	NM_173815	A8KAJ6|B7Z349|B7Z3L2|B7Z6R3|Q6UX55|Q8N9F4	Missense_Mutation	SNP	ENST00000326686.5	hg19		.	.	.	.	.	.	.	.	.	.	t	8.048	0.765292	0.15914	.	.	ENSG00000172824	ENST00000540947;ENST00000541479;ENST00000338718;ENST00000398354;ENST00000326686;ENST00000538199;ENST00000540579;ENST00000535696	T;T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	4.63	3.51	0.40186	Carboxylesterase, type B (1);	0.321128	0.21974	N	0.066417	T	0.43144	0.1234	N	0.21324	0.655	0.37145	D	0.901879	P;P;B;B	0.38370	0.628;0.496;0.001;0.049	B;B;B;B	0.34489	0.137;0.184;0.029;0.029	T	0.43196	-0.9406	10	0.39692	T	0.17	.	8.757	0.34652	0.1697:0.0:0.0:0.8303	.	231;348;325;348	Q5XG92-7;F8WEE9;Q5XG92;F5H5S4	.;.;EST4A_HUMAN;.	E	325;348;348;325;325;288;227;231	ENSP00000444052:V325E;ENSP00000443175:V348E;ENSP00000340714:V348E;ENSP00000381397:V325E;ENSP00000314145:V325E;ENSP00000441103:V288E;ENSP00000441907:V227E;ENSP00000441644:V231E	ENSP00000314145:V325E	V	+	2	0	CES4A	65595522	0.833000	0.29383	0.102000	0.21198	0.070000	0.16714	1.730000	0.38125	0.612000	0.30071	0.398000	0.26397	GTG	.	T|1.000;|0.000	.	alt		0.532	CES4A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173815	
OR1A1	8383	hgsc.bcm.edu	37	17	3119721	3119721	+	Silent	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:3119721C>T	ENST00000304094.1	+	1	807	c.807C>T	c.(805-807)gaC>gaT	p.D269D		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GCCTAAAAGACGCAGTGATCA	0.478																																					p.D269D		Atlas-SNP	.											OR1A1,NS,carcinoma,0,1	OR1A1	54	.	0			c.C807T						PASS	.						153.0	135.0	141.0					17																	3119721		2203	4300	6503	SO:0001819	synonymous_variant	8383	exon1			AAAAGACGCAGTG	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.807C>T	chr17.hg19:g.3119721C>T		135.0	0.0	.		112.0	38.0	.	NM_014565	A5D914|Q6IFM1|Q6NTA9|Q96R87	Silent	SNP	ENST00000304094.1	hg19	CCDS11022.1																																																																																			.	.	.	none		0.478	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1	NM_014565	
MYH1	4619	hgsc.bcm.edu	37	17	10404016	10404016	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:10404016C>G	ENST00000226207.5	-	28	3886	c.3792G>C	c.(3790-3792)aaG>aaC	p.K1264N	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1264					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTTCCTTGGTCTTAATTTCAC	0.493																																					p.K1264N		Atlas-SNP	.											.	MYH1	403	.	0			c.G3792C						PASS	.						164.0	143.0	150.0					17																	10404016		2203	4300	6503	SO:0001583	missense	4619	exon28			CTTGGTCTTAATT		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3792G>C	chr17.hg19:g.10404016C>G	ENSP00000226207:p.Lys1264Asn	74.0	0.0	.		77.0	23.0	.	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	hg19	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144571	0.77888	.	.	ENSG00000109061	ENST00000226207	D	0.83673	-1.75	5.45	4.26	0.50523	Myosin tail (1);	0.000000	0.45126	U	0.000393	T	0.76248	0.3961	L	0.49513	1.565	0.42767	D	0.993824	B	0.12630	0.006	B	0.20577	0.03	T	0.68401	-0.5418	10	0.18710	T	0.47	.	10.9761	0.47467	0.0:0.8405:0.0:0.1595	.	1264	P12882	MYH1_HUMAN	N	1264	ENSP00000226207:K1264N	ENSP00000226207:K1264N	K	-	3	2	MYH1	10344741	0.916000	0.31088	1.000000	0.80357	0.996000	0.88848	0.626000	0.24492	2.716000	0.92895	0.650000	0.86243	AAG	.	.	.	none		0.493	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
GRB7	2886	hgsc.bcm.edu	37	17	37903002	37903002	+	Splice_Site	SNP	A	A	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:37903002A>C	ENST00000309156.4	+	15	1709		c.e15-1		GRB7_ENST00000394209.2_Splice_Site|GRB7_ENST00000394204.1_Splice_Site|GRB7_ENST00000394211.3_Splice_Site|GRB7_ENST00000445327.2_Splice_Site|GRB7_ENST00000309185.3_Splice_Site	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7						blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACTGTACCCCAGAGCGAGGAG	0.602																																					.		Atlas-SNP	.											.	GRB7	48	.	0			c.1453-2A>C						PASS	.						73.0	70.0	71.0					17																	37903002		2203	4300	6503	SO:0001630	splice_region_variant	2886	exon15			TACCCCAGAGCGA	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.1453-1A>C	chr17.hg19:g.37903002A>C		65.0	0.0	.		59.0	20.0	.	NM_005310	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Splice_Site	SNP	ENST00000309156.4	hg19	CCDS11345.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.106122	0.77096	.	.	ENSG00000141738	ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4461	0.61142	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRB7	35156528	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	8.595000	0.90840	2.017000	0.59298	0.482000	0.46254	.	.	.	.	none		0.602	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257024.2	NM_005310	Intron
KRT28	162605	hgsc.bcm.edu	37	17	38955927	38955927	+	Silent	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:38955927G>A	ENST00000306658.7	-	1	284	c.219C>T	c.(217-219)ggC>ggT	p.G73G		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				TTCCAGCAAAGCCAATACAAG	0.532																																					p.G73G	Melanoma(19;789 869 15380 26882 39836)	Atlas-SNP	.											.	KRT28	65	.	0			c.C219T						PASS	.						78.0	77.0	77.0					17																	38955927		2203	4300	6503	SO:0001819	synonymous_variant	162605	exon1			AGCAAAGCCAATA	AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.219C>T	chr17.hg19:g.38955927G>A		93.0	0.0	.		90.0	32.0	.	NM_181535		Silent	SNP	ENST00000306658.7	hg19	CCDS11376.1																																																																																			.	.	.	none		0.532	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535	
KRT33B	3884	hgsc.bcm.edu	37	17	39521769	39521769	+	Missense_Mutation	SNP	G	G	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:39521769G>T	ENST00000251646.3	-	4	674	c.625C>A	c.(625-627)Ctc>Atc	p.L209I		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	209	Linker 12.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				TCCACGTTGAGGCGGTCTCCA	0.527																																					p.L209I		Atlas-SNP	.											.	KRT33B	46	.	0			c.C625A						PASS	.						58.0	58.0	58.0					17																	39521769		2191	4300	6491	SO:0001583	missense	3884	exon4			CGTTGAGGCGGTC	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.625C>A	chr17.hg19:g.39521769G>T	ENSP00000251646:p.Leu209Ile	159.0	0.0	.		136.0	6.0	.	NM_002279	O76010	Missense_Mutation	SNP	ENST00000251646.3	hg19	CCDS11389.1	.	.	.	.	.	.	.	.	.	.	g	19.30	3.800219	0.70567	.	.	ENSG00000131738	ENST00000251646	D	0.88741	-2.42	4.51	4.51	0.55191	Filament (1);	0.000000	0.56097	D	0.000035	D	0.91061	0.7187	L	0.52126	1.63	0.34950	D	0.751156	P	0.49961	0.93	D	0.63877	0.919	D	0.92304	0.5852	10	0.38643	T	0.18	.	11.734	0.51755	0.0:0.2947:0.7053:0.0	.	209	Q14525	KT33B_HUMAN	I	209	ENSP00000251646:L209I	ENSP00000251646:L209I	L	-	1	0	KRT33B	36775295	0.942000	0.31987	1.000000	0.80357	0.961000	0.63080	2.329000	0.43876	2.474000	0.83562	0.650000	0.86243	CTC	.	.	.	none		0.527	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257292.1	NM_002279	
KPNB1	3837	hgsc.bcm.edu	37	17	45735997	45735997	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:45735997G>A	ENST00000290158.4	+	5	1014	c.607G>A	c.(607-609)Gag>Aag	p.E203K	KPNB1_ENST00000537679.1_Missense_Mutation_p.E58K|KPNB1_ENST00000540627.1_Missense_Mutation_p.E58K|KPNB1_ENST00000535458.2_Missense_Mutation_p.E58K|KPNB1_ENST00000577918.1_3'UTR	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	203					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|ovary(1)|pancreas(1)|skin(1)	4						GAACTCATTGGAGTTCACCAA	0.378																																					p.T203T		Atlas-SNP	.											.	KPNB1	58	.	0			c.A607A						PASS	.						80.0	77.0	78.0					17																	45735997		2203	4300	6503	SO:0001583	missense	3837	exon5			TCATTGGAGTTCA	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.607G>A	chr17.hg19:g.45735997G>A	ENSP00000290158:p.Glu203Lys	62.0	0.0	.		49.0	20.0	.	NM_002265	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Silent	SNP	ENST00000290158.4	hg19	CCDS11513.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097962	0.76870	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.86272	0.5893	M	0.91818	3.245	0.47037	D	0.999291	D;D	0.89917	0.969;1.0	P;D	0.87578	0.89;0.998	D	0.85203	0.1016	9	0.36615	T	0.2	-3.7334	20.5407	0.99260	0.0:0.0:1.0:0.0	.	58;203	F5H4R7;Q14974	.;IMB1_HUMAN	K	58;203;58;58	ENSP00000438253:E58K;ENSP00000290158:E203K;ENSP00000438964:E58K;ENSP00000445006:E58K	ENSP00000290158:E203K	E	+	1	0	KPNB1	43090996	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.866000	0.99616	2.865000	0.98341	0.655000	0.94253	GAG	.	.	.	none		0.378	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2	NM_002265	
HOXB13	10481	hgsc.bcm.edu	37	17	46805780	46805780	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:46805780G>A	ENST00000290295.7	-	1	760	c.176C>T	c.(175-177)cCg>cTg	p.P59L	PRAC2_ENST00000422730.2_RNA	NM_006361.5	NP_006352.2	Q92826	HXB13_HUMAN	homeobox B13	59					angiogenesis (GO:0001525)|epidermis development (GO:0008544)|epithelial cell maturation involved in prostate gland development (GO:0060743)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|response to wounding (GO:0009611)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|lung(6)|prostate(1)	11						TTGCTTTGGCGGCTCCGCCGA	0.652																																					p.P59L		Atlas-SNP	.											.	HOXB13	28	.	0			c.C176T						PASS	.						42.0	50.0	48.0					17																	46805780		2201	4296	6497	SO:0001583	missense	10481	exon1			TTTGGCGGCTCCG	U57052	CCDS11536.1	17q21.32	2014-09-17	2005-12-22		ENSG00000159184	ENSG00000159184		"""Homeoboxes / ANTP class : HOXL subclass"""	5112	protein-coding gene	gene with protein product		604607	"""homeo box B13"""			8756292, 9665387	Standard	NM_006361		Approved		uc002ioa.3	Q92826	OTTHUMG00000159900	ENST00000290295.7:c.176C>T	chr17.hg19:g.46805780G>A	ENSP00000290295:p.Pro59Leu	71.0	0.0	.		59.0	21.0	.	NM_006361	B2R878|Q96QM4|Q99810	Missense_Mutation	SNP	ENST00000290295.7	hg19	CCDS11536.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230315	0.79688	.	.	ENSG00000159184	ENST00000290295	T	0.52295	0.67	4.9	4.9	0.64082	.	0.191648	0.48286	D	0.000197	T	0.53302	0.1788	M	0.66939	2.045	0.54753	D	0.999989	D	0.54047	0.964	P	0.45712	0.491	T	0.62201	-0.6904	10	0.87932	D	0	.	16.7972	0.85605	0.0:0.0:1.0:0.0	.	59	Q92826	HXB13_HUMAN	L	59	ENSP00000290295:P59L	ENSP00000290295:P59L	P	-	2	0	HOXB13	44160779	0.923000	0.31300	0.854000	0.33618	0.824000	0.46624	4.091000	0.57700	2.544000	0.85801	0.462000	0.41574	CCG	.	.	.	none		0.652	HOXB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358087.3	NM_006361	
DLX3	1747	hgsc.bcm.edu	37	17	48072155	48072155	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:48072155T>C	ENST00000434704.2	-	1	433	c.208A>G	c.(208-210)Aat>Gat	p.N70D	DLX3_ENST00000512495.2_5'Flank|RP11-1094H24.3_ENST00000511867.1_lincRNA	NM_005220.2	NP_005211.1	O60479	DLX3_HUMAN	distal-less homeobox 3	70					blood vessel development (GO:0001568)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|placenta development (GO:0001890)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						CCATTGAGATTGAATTGGTGG	0.597																																					p.N70D		Atlas-SNP	.											.	DLX3	28	.	0			c.A208G						PASS	.						101.0	106.0	104.0					17																	48072155		2203	4300	6503	SO:0001583	missense	1747	exon1			TGAGATTGAATTG		CCDS11556.1	17q21.33	2011-06-20	2005-12-22			ENSG00000064195		"""Homeoboxes / ANTP class : NKL subclass"""	2916	protein-coding gene	gene with protein product		600525	"""distal-less homeo box 3"""			7613049	Standard	NM_005220		Approved		uc002ipy.3	O60479		ENST00000434704.2:c.208A>G	chr17.hg19:g.48072155T>C	ENSP00000389870:p.Asn70Asp	109.0	0.0	.		73.0	28.0	.	NM_005220	B3KQL6	Missense_Mutation	SNP	ENST00000434704.2	hg19	CCDS11556.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319787	0.81469	.	.	ENSG00000064195	ENST00000434704	D	0.90324	-2.65	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.92711	0.7683	M	0.77103	2.36	0.80722	D	1	D	0.57257	0.979	P	0.55508	0.777	D	0.90896	0.4765	10	0.19590	T	0.45	-21.8499	12.7113	0.57092	0.0:0.0:0.0:1.0	.	70	O60479	DLX3_HUMAN	D	70	ENSP00000389870:N70D	ENSP00000389870:N70D	N	-	1	0	DLX3	45427154	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.584000	0.67490	2.115000	0.64714	0.402000	0.26972	AAT	.	.	.	none		0.597	DLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366307.1		
USP32	84669	hgsc.bcm.edu	37	17	58262881	58262881	+	Missense_Mutation	SNP	C	C	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:58262881C>A	ENST00000300896.4	-	30	3968	c.3774G>T	c.(3772-3774)aaG>aaT	p.K1258N	USP32_ENST00000592339.1_Missense_Mutation_p.K928N	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1258	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			GGGTCTTACACTTGGAACAGT	0.537																																					p.K1258N		Atlas-SNP	.											.	USP32	128	.	0			c.G3774T						PASS	.						121.0	111.0	114.0					17																	58262881		2203	4298	6501	SO:0001583	missense	84669	exon30			CTTACACTTGGAA	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3774G>T	chr17.hg19:g.58262881C>A	ENSP00000300896:p.Lys1258Asn	203.0	0.0	.		180.0	65.0	.	NM_032582	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	hg19	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.662725	0.67700	.	.	ENSG00000170832	ENST00000300896	T	0.31510	1.49	5.6	2.37	0.29283	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.37073	0.0990	L	0.28556	0.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.03148	-1.1067	10	0.24483	T	0.36	.	9.4228	0.38561	0.0:0.6358:0.0:0.3642	.	1258	Q8NFA0	UBP32_HUMAN	N	1258	ENSP00000300896:K1258N	ENSP00000300896:K1258N	K	-	3	2	USP32	55617663	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.057000	0.30492	0.253000	0.21552	0.650000	0.86243	AAG	.	.	.	none		0.537	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	
MED13	9969	hgsc.bcm.edu	37	17	60039087	60039087	+	Silent	SNP	G	G	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:60039087G>T	ENST00000397786.2	-	22	5194	c.5118C>A	c.(5116-5118)atC>atA	p.I1706I		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1706					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.I1706I(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCTGGGGATAGATTTCTCTAT	0.403																																					p.I1706I		Atlas-SNP	.											MED13,colon,carcinoma,0,1	MED13	181	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5118A						PASS	.						138.0	138.0	138.0					17																	60039087		1824	4076	5900	SO:0001819	synonymous_variant	9969	exon22			GGGATAGATTTCT	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5118C>A	chr17.hg19:g.60039087G>T		109.0	0.0	.		82.0	19.0	.	NM_005121	B2RU05|O60334	Silent	SNP	ENST00000397786.2	hg19	CCDS42366.1																																																																																			.	.	.	none		0.403	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
ACE	1636	hgsc.bcm.edu	37	17	61558530	61558530	+	Missense_Mutation	SNP	C	C	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:61558530C>G	ENST00000290866.4	+	6	950	c.926C>G	c.(925-927)aCc>aGc	p.T309S	ACE_ENST00000428043.1_Missense_Mutation_p.T309S|ACE_ENST00000538928.1_Missense_Mutation_p.T309S|ACE_ENST00000584529.1_3'UTR	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	309	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CTCGATGTCACCAGTACTATG	0.587																																					p.T309S		Atlas-SNP	.											.	ACE	187	.	0			c.C926G						PASS	.						104.0	90.0	95.0					17																	61558530		2203	4300	6503	SO:0001583	missense	1636	exon6			ATGTCACCAGTAC	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.926C>G	chr17.hg19:g.61558530C>G	ENSP00000290866:p.Thr309Ser	148.0	0.0	.		128.0	42.0	.	NM_000789	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	hg19	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375723	0.61735	.	.	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	T;T;T	0.40476	1.03;1.03;1.03	4.21	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.62073	0.2398	M	0.65677	2.01	0.80722	D	1	D;D;B	0.71674	0.998;0.996;0.162	D;D;B	0.75020	0.985;0.977;0.245	T	0.64343	-0.6430	10	0.45353	T	0.12	-36.2495	16.7665	0.85525	0.0:1.0:0.0:0.0	.	309;309;309	F5H1K1;P12821-2;P12821	.;.;ACE_HUMAN	S	309	ENSP00000439591:T309S;ENSP00000290866:T309S;ENSP00000397593:T309S	ENSP00000290866:T309S	T	+	2	0	ACE	58912262	1.000000	0.71417	0.397000	0.26308	0.867000	0.49689	4.748000	0.62148	2.180000	0.69256	0.561000	0.74099	ACC	.	.	.	none		0.587	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
SOCS3	9021	hgsc.bcm.edu	37	17	76355088	76355088	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:76355088T>C	ENST00000330871.2	-	2	504	c.89A>G	c.(88-90)gAg>gGg	p.E30G	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	30	Kinase inhibitory region (KIR).				branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			CAGCTGGTACTCGCTCTTGGA	0.667																																					p.E30G		Atlas-SNP	.											.	SOCS3	16	.	0			c.A89G						PASS	.						13.0	12.0	12.0					17																	76355088		2183	4290	6473	SO:0001583	missense	9021	exon2			TGGTACTCGCTCT	AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.89A>G	chr17.hg19:g.76355088T>C	ENSP00000330341:p.Glu30Gly	129.0	0.0	.		90.0	32.0	.	NM_003955	O14509	Missense_Mutation	SNP	ENST00000330871.2	hg19	CCDS11756.1	.	.	.	.	.	.	.	.	.	.	T	13.69	2.311224	0.40895	.	.	ENSG00000184557	ENST00000330871	T	0.47869	0.83	4.16	4.16	0.48862	SH2 motif (1);	0.123969	0.53938	D	0.000044	T	0.37705	0.1013	L	0.44542	1.39	0.43808	D	0.996369	P	0.48764	0.915	B	0.36922	0.236	T	0.43294	-0.9400	10	0.72032	D	0.01	-18.8506	13.1915	0.59713	0.0:0.0:0.0:1.0	.	30	O14543	SOCS3_HUMAN	G	30	ENSP00000330341:E30G	ENSP00000330341:E30G	E	-	2	0	SOCS3	73866683	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	5.546000	0.67243	1.514000	0.48869	0.383000	0.25322	GAG	.	.	.	none		0.667	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437300.1		
PIEZO2	63895	hgsc.bcm.edu	37	18	10680336	10680336	+	Silent	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr18:10680336T>C	ENST00000503781.3	-	48	7472	c.7473A>G	c.(7471-7473)aaA>aaG	p.K2491K	PIEZO2_ENST00000580640.1_Silent_p.K2516K|PIEZO2_ENST00000302079.6_Silent_p.K2428K|PIEZO2_ENST00000581680.1_5'UTR|PIEZO2_ENST00000285141.4_Silent_p.K283K|PIEZO2_ENST00000538948.1_Silent_p.K448K	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2491					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TTATGTCTTCTTTTTCATAAT	0.398																																					p.K2491K		Atlas-SNP	.											.,2	.	.	.	0			c.A7473G						PASS	.						142.0	138.0	139.0					18																	10680336		2203	4300	6503	SO:0001819	synonymous_variant	63895	exon48			GTCTTCTTTTTCA	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7473A>G	chr18.hg19:g.10680336T>C		73.0	0.0	.		64.0	28.0	.	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	ENST00000503781.3	hg19																																																																																				.	.	.	none		0.398	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
PIEZO2	63895	hgsc.bcm.edu	37	18	10680342	10680342	+	Nonsense_Mutation	SNP	A	A	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr18:10680342A>T	ENST00000503781.3	-	48	7466	c.7467T>A	c.(7465-7467)taT>taA	p.Y2489*	PIEZO2_ENST00000580640.1_Nonsense_Mutation_p.Y2514*|PIEZO2_ENST00000302079.6_Nonsense_Mutation_p.Y2426*|PIEZO2_ENST00000581680.1_5'UTR|PIEZO2_ENST00000285141.4_Nonsense_Mutation_p.Y281*|PIEZO2_ENST00000538948.1_Nonsense_Mutation_p.Y446*	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2489					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										CTTCTTTTTCATAATTTTCCA	0.393																																					p.Y2489X		Atlas-SNP	.											.	.	.	.	0			c.T7467A						PASS	.						141.0	137.0	138.0					18																	10680342		2203	4300	6503	SO:0001587	stop_gained	63895	exon48			TTTTTCATAATTT	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7467T>A	chr18.hg19:g.10680342A>T	ENSP00000421377:p.Tyr2489*	63.0	0.0	.		60.0	27.0	.	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Nonsense_Mutation	SNP	ENST00000503781.3	hg19		.	.	.	.	.	.	.	.	.	.	A	43	10.389114	0.99396	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	.	.	.	5.92	4.77	0.60923	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7631	0.51914	0.9317:0.0:0.0683:0.0	.	.	.	.	X	383;2489;446;281	.	ENSP00000285141:Y281X	Y	-	3	2	FAM38B	10670342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.634000	0.54302	1.075000	0.40932	0.533000	0.62120	TAT	.	.	.	none		0.393	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
FUT5	2527	hgsc.bcm.edu	37	19	5867537	5867537	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:5867537C>T	ENST00000588525.1	-	2	287	c.200G>A	c.(199-201)aGc>aAc	p.S67N	FUT5_ENST00000252675.5_Missense_Mutation_p.S67N	NM_002034.2	NP_002025.2	Q11128	FUT5_HUMAN	fucosyltransferase 5 (alpha (1,3) fucosyltransferase)	67					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12						GGTCGCCATGCTGTCCTGGCA	0.657																																					p.S67N		Atlas-SNP	.											.	FUT5	29	.	0			c.G200A						PASS	.						38.0	39.0	38.0					19																	5867537		2203	4300	6503	SO:0001583	missense	2527	exon2			GCCATGCTGTCCT		CCDS12154.1	19p13.3	2013-02-26				ENSG00000130383	2.4.1.65	"""Fucosyltransferases"""	4016	protein-coding gene	gene with protein product		136835				1740457	Standard	NM_002034		Approved	FUC-TV	uc002mdo.4	Q11128	OTTHUMG00000180616	ENST00000588525.1:c.200G>A	chr19.hg19:g.5867537C>T	ENSP00000466880:p.Ser67Asn	93.0	0.0	.		80.0	33.0	.	NM_002034	A8K4X2	Missense_Mutation	SNP	ENST00000588525.1	hg19	CCDS12154.1	.	.	.	.	.	.	.	.	.	.	C	6.711	0.499852	0.12762	.	.	ENSG00000130383	ENST00000252675	T	0.28454	1.61	1.74	-3.05	0.05396	.	.	.	.	.	T	0.17874	0.0429	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.28808	-1.0032	9	0.22706	T	0.39	.	4.3455	0.11131	0.1716:0.4677:0.3607:0.0	.	67	Q11128	FUT5_HUMAN	N	67	ENSP00000252675:S67N	ENSP00000252675:S67N	S	-	2	0	FUT5	5818537	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.184000	0.16939	-0.600000	0.05790	-0.693000	0.03709	AGC	.	.	.	none		0.657	FUT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452213.1	NM_002034	
CRB3	92359	hgsc.bcm.edu	37	19	6466490	6466490	+	Missense_Mutation	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:6466490T>C	ENST00000598494.1	+	4	701	c.170T>C	c.(169-171)aTc>aCc	p.I57T	CRB3_ENST00000356762.3_Missense_Mutation_p.I57T|CRB3_ENST00000308243.7_Missense_Mutation_p.I57T|CRB3_ENST00000600229.1_Missense_Mutation_p.I57T			Q9BUF7	CRUM3_HUMAN	crumbs family member 3	57					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|protein localization to plasma membrane (GO:0072659)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)|SH3 domain binding (GO:0017124)			endometrium(1)|large_intestine(1)|lung(1)	3						CCAGAAGCCATCACTGCTATC	0.612																																					p.I57T		Atlas-SNP	.											.	CRB3	8	.	0			c.T170C						PASS	.						190.0	166.0	174.0					19																	6466490		2203	4300	6503	SO:0001583	missense	92359	exon4			AAGCCATCACTGC	AF503290	CCDS12166.1, CCDS12167.1	19p13.3	2014-02-06	2014-02-06		ENSG00000130545	ENSG00000130545			20237	protein-coding gene	gene with protein product		609737	"""crumbs homolog 3 (Drosophila)"""				Standard	XM_005259680		Approved	MGC17303	uc002mez.3	Q9BUF7	OTTHUMG00000181828	ENST00000598494.1:c.170T>C	chr19.hg19:g.6466490T>C	ENSP00000469707:p.Ile57Thr	39.0	0.0	.		34.0	7.0	.	NM_174881	A8KA91|D6W643|Q8N0V8|Q8WVA0	Missense_Mutation	SNP	ENST00000598494.1	hg19	CCDS12167.1	.	.	.	.	.	.	.	.	.	.	T	9.135	1.012505	0.19277	.	.	ENSG00000130545	ENST00000356762;ENST00000308243	.	.	.	4.72	1.11	0.20524	.	0.394099	0.19507	N	0.112599	T	0.36744	0.0978	L	0.46885	1.475	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.24190	-1.0167	9	0.42905	T	0.14	-6.2219	8.2264	0.31570	0.0:0.3766:0.0:0.6234	.	57;57	Q9BUF7-2;Q9BUF7	.;CRUM3_HUMAN	T	57	.	ENSP00000310123:I57T	I	+	2	0	CRB3	6417490	0.006000	0.16342	0.026000	0.17262	0.892000	0.51952	0.507000	0.22675	-0.059000	0.13154	0.477000	0.44152	ATC	.	.	.	none		0.612	CRB3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457837.1		
ZGLP1	100125288	hgsc.bcm.edu	37	19	10418909	10418909	+	Missense_Mutation	SNP	T	T	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:10418909T>A	ENST00000403903.3	-	1	1647	c.449A>T	c.(448-450)aAg>aTg	p.K150M	CTD-2369P2.10_ENST00000452032.2_3'UTR|ZGLP1_ENST00000403352.1_Missense_Mutation_p.K66M|FDX1L_ENST00000492239.1_5'Flank|FDX1L_ENST00000541276.1_3'UTR	NM_001103167.1	NP_001096637.1	P0C6A0	ZGLP1_HUMAN	zinc finger, GATA-like protein 1	150					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|ovary(1)	6						TATCTGAAACTTCAGAGTCAC	0.642																																					p.K150M		Atlas-SNP	.											.	ZGLP1	18	.	0			c.A449T						PASS	.						39.0	43.0	42.0					19																	10418909		1930	4133	6063	SO:0001583	missense	100125288	exon1			TGAAACTTCAGAG	AK096830	CCDS45959.1	19p13.2	2013-01-25			ENSG00000220201	ENSG00000220201		"""GATA zinc finger domain containing"""	37245	protein-coding gene	gene with protein product	"""GATA like protein 1"", ""GATA zinc finger domain containing 3"""	611639				16982049	Standard	NM_001103167		Approved	GLP1, GLP-1, GATAD3	uc002mnw.4	P0C6A0	OTTHUMG00000152114	ENST00000403903.3:c.449A>T	chr19.hg19:g.10418909T>A	ENSP00000384434:p.Lys150Met	29.0	0.0	.		30.0	12.0	.	NM_001103167		Missense_Mutation	SNP	ENST00000403903.3	hg19	CCDS45959.1	.	.	.	.	.	.	.	.	.	.	T	10.64	1.406851	0.25378	.	.	ENSG00000220201	ENST00000403903;ENST00000403352	D;D	0.98296	-4.85;-4.76	4.65	-1.45	0.08828	.	.	.	.	.	D	0.93684	0.7982	N	0.24115	0.695	0.20873	N	0.999839	B	0.32918	0.39	B	0.30179	0.112	D	0.87717	0.2570	9	0.66056	D	0.02	-7.2845	6.175	0.20439	0.0:0.1636:0.3897:0.4467	.	150	P0C6A0	ZGLP1_HUMAN	M	150;66	ENSP00000384434:K150M;ENSP00000385403:K66M	ENSP00000385403:K66M	K	-	2	0	ZGLP1	10279909	0.180000	0.23148	0.439000	0.26833	0.595000	0.36748	-0.563000	0.05943	-0.708000	0.05015	-2.944000	0.00085	AAG	.	.	.	none		0.642	ZGLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325278.1	NM_001103167	
GCDH	2639	hgsc.bcm.edu	37	19	13010540	13010540	+	3'UTR	SNP	A	A	G	rs376334735		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:13010540A>G	ENST00000222214.5	+	0	1713				SYCE2_ENST00000293695.7_Intron|GCDH_ENST00000457854.1_Missense_Mutation_p.R424G|GCDH_ENST00000588242.2_3'UTR|GCDH_ENST00000422947.2_3'UTR|GCDH_ENST00000591470.1_3'UTR			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase						cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	CTTAAAAAGAAGATGGAATTC	0.423																																					p.T424A	GBM(123;875 1636 7726 16444 26754)	Atlas-SNP	.											.	GCDH	76	.	0			c.A1270G						PASS	.						75.0	86.0	82.0					19																	13010540		2076	4215	6291	SO:0001624	3_prime_UTR_variant	2639	exon12			AAAAGAAGATGGA	AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.*185A>G	chr19.hg19:g.13010540A>G		174.0	0.0	.		136.0	36.0	.	NM_013976	A8K2Z2|O14719	Missense_Mutation	SNP	ENST00000222214.5	hg19	CCDS12286.1	.	.	.	.	.	.	.	.	.	.	A	16.79	3.220902	0.58560	.	.	ENSG00000105607	ENST00000457854	D	0.97505	-4.41	4.81	0.392	0.16288	.	.	.	.	.	D	0.87799	0.6268	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.78505	-0.2178	8	0.02654	T	1	.	3.8177	0.08822	0.5063:0.1922:0.3015:0.0	.	424	Q92947-2	.	G	424	ENSP00000394872:R424G	ENSP00000394872:R424G	R	+	1	2	GCDH	12871540	0.004000	0.15560	0.000000	0.03702	0.892000	0.51952	-0.302000	0.08221	0.093000	0.17368	0.460000	0.39030	AGA	.	.	.	weak		0.423	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451897.1		
CILP2	148113	hgsc.bcm.edu	37	19	19655554	19655554	+	Missense_Mutation	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:19655554C>T	ENST00000291495.5	+	8	2285	c.2200C>T	c.(2200-2202)Cgc>Tgc	p.R734C	CILP2_ENST00000586018.1_Missense_Mutation_p.R740C	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	734						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CGTGCCTGAGCGCCGCCGCTG	0.697																																					p.R734C		Atlas-SNP	.											CILP2,caecum,carcinoma,0,1	CILP2	84	.	0			c.C2200T						PASS	.						14.0	16.0	15.0					19																	19655554		2197	4288	6485	SO:0001583	missense	148113	exon8			CCTGAGCGCCGCC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2200C>T	chr19.hg19:g.19655554C>T	ENSP00000291495:p.Arg734Cys	80.0	0.0	.		70.0	27.0	.	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	hg19	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305389	0.60305	.	.	ENSG00000160161	ENST00000291495	T	0.51574	0.7	4.89	2.58	0.30949	.	0.477682	0.22795	N	0.055552	T	0.39733	0.1089	L	0.40543	1.245	0.43803	D	0.996357	D;D	0.65815	0.995;0.995	P;P	0.48677	0.586;0.586	T	0.29971	-0.9994	10	0.59425	D	0.04	-23.0496	3.694	0.08357	0.1728:0.568:0.1673:0.0919	.	734;734	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	C	734	ENSP00000291495:R734C	ENSP00000291495:R734C	R	+	1	0	CILP2	19516554	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	1.880000	0.39628	1.016000	0.39470	0.555000	0.69702	CGC	.	.	.	none		0.697	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
ZNF527	84503	hgsc.bcm.edu	37	19	37879856	37879856	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:37879856A>G	ENST00000436120.2	+	5	1012	c.905A>G	c.(904-906)tAt>tGt	p.Y302C	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	302					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y302>?(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAAAACCATATGCATGCAAT	0.393																																					p.Y302C		Atlas-SNP	.											.,1	ZNF527	78	.	1	Complex(1)	lung(1)	c.A905G						PASS	.						105.0	96.0	99.0					19																	37879856		2093	4241	6334	SO:0001583	missense	84503	exon5			AACCATATGCATG	AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.905A>G	chr19.hg19:g.37879856A>G	ENSP00000390179:p.Tyr302Cys	63.0	2.0	.		85.0	5.0	.	NM_032453	B4DVL5	Missense_Mutation	SNP	ENST00000436120.2	hg19	CCDS42559.1	.	.	.	.	.	.	.	.	.	.	A	2.120	-0.401673	0.04865	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	4.19	2.11	0.27256	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.557068	0.13635	N	0.373399	T	0.49983	0.1589	M	0.88704	2.975	0.09310	N	0.999999	B;B	0.17038	0.02;0.016	B;B	0.16722	0.016;0.009	T	0.53704	-0.8401	9	0.72032	D	0.01	.	3.9384	0.09316	0.6603:0.0:0.1838:0.1559	.	302;270	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	C	302;270;250	.	ENSP00000325231:Y270C	Y	+	2	0	ZNF527	42571696	0.000000	0.05858	0.042000	0.18584	0.284000	0.27059	-0.422000	0.07043	0.193000	0.20303	-0.274000	0.10170	TAT	.	.	.	none		0.393	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1	NM_032453	
PRKD2	25865	hgsc.bcm.edu	37	19	47181737	47181737	+	Missense_Mutation	SNP	T	T	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:47181737T>G	ENST00000291281.4	-	16	2479	c.2254A>C	c.(2254-2256)Aac>Cac	p.N752H	PRKD2_ENST00000433867.1_Missense_Mutation_p.N752H|PRKD2_ENST00000600194.1_Missense_Mutation_p.N595H|PRKD2_ENST00000593492.1_5'Flank|PRKD2_ENST00000595515.1_Missense_Mutation_p.N752H|PRKD2_ENST00000601806.1_Missense_Mutation_p.N595H|DACT3-AS1_ENST00000525008.1_RNA			Q9BZL6	KPCD2_HUMAN	protein kinase D2	752	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TCATCCTCGTTGAAAGGGAAG	0.627																																					p.N752H		Atlas-SNP	.											.	PRKD2	94	.	0			c.A2254C						PASS	.						163.0	123.0	136.0					19																	47181737		2203	4300	6503	SO:0001583	missense	25865	exon16			CCTCGTTGAAAGG	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.2254A>C	chr19.hg19:g.47181737T>G	ENSP00000291281:p.Asn752His	109.0	0.0	.		100.0	34.0	.	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	hg19	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.949602	0.92660	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.65732	-0.17;-0.17	4.65	4.65	0.58169	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000002	T	0.67748	0.2926	N	0.26092	0.79	0.58432	D	0.999999	P;D;D	0.89917	0.87;1.0;1.0	P;D;D	0.97110	0.867;0.999;1.0	T	0.71626	-0.4536	10	0.66056	D	0.02	-41.8641	13.3949	0.60846	0.0:0.0:0.0:1.0	.	752;237;752	E7ER94;A0JLT6;Q9BZL6	.;.;KPCD2_HUMAN	H	752	ENSP00000291281:N752H;ENSP00000393978:N752H	ENSP00000291281:N752H	N	-	1	0	PRKD2	51873577	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.956000	0.87863	1.872000	0.54250	0.460000	0.39030	AAC	.	.	.	none		0.627	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
CRX	1406	hgsc.bcm.edu	37	19	48342911	48342911	+	Missense_Mutation	SNP	C	C	T	rs61748454		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:48342911C>T	ENST00000221996.7	+	4	793	c.587C>T	c.(586-588)gCc>gTc	p.A196V	TPRX2P_ENST00000535362.1_Intron|CRX_ENST00000539067.1_Missense_Mutation_p.A196V	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	196					circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		ATGACCTACGCCCCGGCCTCC	0.662																																					p.A196V	Pancreas(57;461 1196 22201 40716 47188)	Atlas-SNP	.											.	CRX	52	.	0			c.C587T	GRCh37	CD972156	CRX	D	rs61748454	PASS	.						58.0	60.0	60.0					19																	48342911		2203	4300	6503	SO:0001583	missense	1406	exon4			CCTACGCCCCGGC	AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.587C>T	chr19.hg19:g.48342911C>T	ENSP00000221996:p.Ala196Val	50.0	0.0	.		66.0	29.0	.	NM_000554	Q0QD45	Missense_Mutation	SNP	ENST00000221996.7	hg19	CCDS12706.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029682	0.35797	.	.	ENSG00000105392	ENST00000221996;ENST00000539067	D;D	0.86366	-2.11;-2.11	4.36	3.24	0.37175	Transcription factor Otx, C-terminal (1);	0.215353	0.37669	N	0.001989	T	0.80204	0.4580	L	0.46157	1.445	0.25471	N	0.987827	P	0.43826	0.818	B	0.39562	0.303	T	0.70267	-0.4919	10	0.21540	T	0.41	-11.5606	10.1228	0.42632	0.0:0.6446:0.3554:0.0	.	196	O43186	CRX_HUMAN	V	196	ENSP00000221996:A196V;ENSP00000445565:A196V	ENSP00000221996:A196V	A	+	2	0	CRX	53034723	0.958000	0.32768	0.986000	0.45419	0.310000	0.27922	0.591000	0.23969	1.975000	0.57531	0.467000	0.42956	GCC	.	.	.	none		0.662	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409812.4	NM_000554	
HRC	3270	hgsc.bcm.edu	37	19	49656860	49656860	+	Silent	SNP	C	C	T			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:49656860C>T	ENST00000252825.4	-	1	1821	c.1635G>A	c.(1633-1635)gaG>gaA	p.E545E	HRC_ENST00000595625.1_Silent_p.E545E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	545					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cgtcttcttcctcctcctcct	0.622																																					p.E545E	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											HRC,NS,carcinoma,0,1	HRC	85	.	0			c.G1635A						PASS	.						58.0	29.0	39.0					19																	49656860		2202	4300	6502	SO:0001819	synonymous_variant	3270	exon1			TTCTTCCTCCTCC		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1635G>A	chr19.hg19:g.49656860C>T		38.0	1.0	.		25.0	3.0	.	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	hg19	CCDS12759.1																																																																																			.	.	.	none		0.622	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
ZNF71	58491	hgsc.bcm.edu	37	19	57133451	57133451	+	Missense_Mutation	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:57133451G>A	ENST00000328070.6	+	3	1030	c.796G>A	c.(796-798)Ggg>Agg	p.G266R		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CACGCACACCGGGGAGAAGCC	0.677																																					p.G266R		Atlas-SNP	.											.	ZNF71	69	.	0			c.G796A						PASS	.						50.0	53.0	52.0					19																	57133451		2203	4300	6503	SO:0001583	missense	58491	exon3			CACACCGGGGAGA	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.796G>A	chr19.hg19:g.57133451G>A	ENSP00000328245:p.Gly266Arg	180.0	0.0	.		186.0	66.0	.	NM_021216	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	hg19	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049854	0.75846	.	.	ENSG00000197951	ENST00000328070	T	0.26223	1.75	3.82	3.82	0.43975	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46425	0.1392	M	0.64997	1.995	0.37570	D	0.919396	D	0.89917	1.0	D	0.68765	0.96	T	0.56335	-0.7996	9	0.62326	D	0.03	.	14.6514	0.68800	0.0:0.0:1.0:0.0	.	266	Q9NQZ8	ZNF71_HUMAN	R	266	ENSP00000328245:G266R	ENSP00000328245:G266R	G	+	1	0	ZNF71	61825263	0.999000	0.42202	0.614000	0.29051	0.963000	0.63663	4.418000	0.59828	1.958000	0.56883	0.561000	0.74099	GGG	.	.	.	none		0.677	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
ZNF419	79744	hgsc.bcm.edu	37	19	58004676	58004676	+	Missense_Mutation	SNP	A	A	G			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:58004676A>G	ENST00000221735.7	+	5	937	c.751A>G	c.(751-753)Ata>Gta	p.I251V	ZNF419_ENST00000426954.2_Missense_Mutation_p.I239V|ZNF419_ENST00000347466.6_Missense_Mutation_p.I219V|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000415379.2_Missense_Mutation_p.I205V|ZNF419_ENST00000442920.2_Missense_Mutation_p.I238V|ZNF419_ENST00000424930.2_Missense_Mutation_p.I252V|ZNF419_ENST00000354197.4_Missense_Mutation_p.I239V			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		TATACACCAAATAGTTCACAC	0.423																																					p.I252V		Atlas-SNP	.											.	ZNF419	134	.	0			c.A754G						PASS	.						71.0	73.0	72.0					19																	58004676		2203	4300	6503	SO:0001583	missense	79744	exon5			CACCAAATAGTTC	AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.751A>G	chr19.hg19:g.58004676A>G	ENSP00000221735:p.Ile251Val	105.0	0.0	.		92.0	33.0	.	NM_001098491	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Missense_Mutation	SNP	ENST00000221735.7	hg19	CCDS54326.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046280	0.55110	.	.	ENSG00000105136	ENST00000424930;ENST00000426954;ENST00000354197;ENST00000427558;ENST00000442920;ENST00000517598;ENST00000347466;ENST00000415379;ENST00000221735	T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22	1.69	0.633	0.17712	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24509	0.0594	L	0.31845	0.965	0.09310	N	0.999999	P;P;D;P;P;D;P	0.56968	0.699;0.898;0.958;0.898;0.771;0.978;0.771	P;D;D;D;B;P;B	0.70716	0.768;0.956;0.97;0.956;0.276;0.608;0.276	T	0.10776	-1.0615	9	0.72032	D	0.01	.	5.1817	0.15163	0.6777:0.0:0.3223:0.0	.	205;205;238;239;252;219;251	E9PFX9;B4DXU7;E9PCP4;E9PET3;E9PED0;Q96HQ0-2;Q96HQ0	.;.;.;.;.;.;ZN419_HUMAN	V	252;239;239;122;238;252;219;205;251	ENSP00000388864:I252V;ENSP00000390916:I239V;ENSP00000346136:I239V;ENSP00000414709:I238V;ENSP00000299860:I219V;ENSP00000392129:I205V;ENSP00000221735:I251V	ENSP00000221735:I251V	I	+	1	0	ZNF419	62696488	0.000000	0.05858	0.008000	0.14137	0.589000	0.36550	-0.691000	0.05133	0.119000	0.18210	0.172000	0.16884	ATA	.	.	.	none		0.423	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691	
STAU1	6780	hgsc.bcm.edu	37	20	47732330	47732330	+	Silent	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr20:47732330T>C	ENST00000371856.2	-	13	2117	c.1707A>G	c.(1705-1707)ggA>ggG	p.G569G	STAU1_ENST00000347458.5_Silent_p.G488G|STAU1_ENST00000371792.1_Silent_p.G486G|STAU1_ENST00000371802.1_Silent_p.G494G|STAU1_ENST00000340954.7_Silent_p.G488G|STAU1_ENST00000371828.3_Silent_p.G494G|STAU1_ENST00000360426.4_Silent_p.G488G	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	569					intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			CAGACATTGGTCCGTTTCCTG	0.507																																					p.G569G		Atlas-SNP	.											.	STAU1	54	.	0			c.A1707G						PASS	.						263.0	209.0	227.0					20																	47732330		2203	4300	6503	SO:0001819	synonymous_variant	6780	exon13			CATTGGTCCGTTT		CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.1707A>G	chr20.hg19:g.47732330T>C		54.0	0.0	.		51.0	15.0	.	NM_017453	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Silent	SNP	ENST00000371856.2	hg19	CCDS13414.1																																																																																			.	.	.	none		0.507	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079633.1	NM_017453	
BRWD1	54014	hgsc.bcm.edu	37	21	40670471	40670471	+	Missense_Mutation	SNP	A	A	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr21:40670471A>C	ENST00000333229.2	-	5	563	c.236T>G	c.(235-237)tTg>tGg	p.L79W	BRWD1_ENST00000380800.3_Missense_Mutation_p.L79W|BRWD1_ENST00000342449.3_Missense_Mutation_p.L79W|BRWD1_ENST00000470108.1_5'UTR|BRWD1_ENST00000341322.4_Missense_Mutation_p.L79W	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	79					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GCAGATTTGCAAAAGATGATC	0.388																																					p.L79W	Melanoma(170;988 1986 4794 16843 39731)	Atlas-SNP	.											.	BRWD1	325	.	0			c.T236G						PASS	.						115.0	120.0	118.0					21																	40670471		2203	4300	6503	SO:0001583	missense	54014	exon5			ATTTGCAAAAGAT	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.236T>G	chr21.hg19:g.40670471A>C	ENSP00000330753:p.Leu79Trp	301.0	0.0	.		323.0	91.0	.	NM_001007246	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	hg19	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.796583	0.90453	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800;ENST00000341322	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.55	5.55	0.83447	.	0.000000	0.50627	D	0.000103	T	0.69611	0.3130	M	0.87682	2.9	0.50313	D	0.999863	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.76091	-0.3086	10	0.87932	D	0	-4.6002	15.6873	0.77421	1.0:0.0:0.0:0.0	.	79;79;79	Q6P2D1;Q9NSI6-2;Q9NSI6	.;.;BRWD1_HUMAN	W	79	ENSP00000330753:L79W;ENSP00000344333:L79W;ENSP00000370178:L79W;ENSP00000342106:L79W	ENSP00000330753:L79W	L	-	2	0	BRWD1	39592341	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.850000	0.92190	2.119000	0.64992	0.383000	0.25322	TTG	.	.	.	none		0.388	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
MN1	4330	hgsc.bcm.edu	37	22	28193970	28193970	+	Silent	SNP	T	T	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr22:28193970T>C	ENST00000302326.4	-	1	3516	c.2562A>G	c.(2560-2562)ccA>ccG	p.P854P		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	854					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						TCTTGCCCTCTGGCGGGTTCT	0.657			T	ETV6	"""AML, meningioma"""																																p.P854P		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	122	.	0			c.A2562G						PASS	.						71.0	78.0	76.0					22																	28193970		1886	4093	5979	SO:0001819	synonymous_variant	4330	exon1			GCCCTCTGGCGGG	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.2562A>G	chr22.hg19:g.28193970T>C		38.0	0.0	.		28.0	12.0	.	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	hg19	CCDS42998.1																																																																																			.	.	.	none		0.657	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
ATF4	468	hgsc.bcm.edu	37	22	39918544	39918544	+	Silent	SNP	C	C	A	rs189922789		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr22:39918544C>A	ENST00000337304.2	+	2	1875	c.993C>A	c.(991-993)atC>atA	p.I331I	ATF4_ENST00000396680.1_Silent_p.I331I|ATF4_ENST00000404241.2_Silent_p.I331I	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	331	Interaction with GABBR1. {ECO:0000250}.|Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.			KEI -> REK (in Ref. 5; no nucleotide entry). {ECO:0000305}.	activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	CCAAGGAGATCCAGTACCTGA	0.512																																					p.I331I		Atlas-SNP	.											.	ATF4	27	.	0			c.C993A						PASS	.						19.0	22.0	21.0					22																	39918544		2195	4289	6484	SO:0001819	synonymous_variant	468	exon2			GGAGATCCAGTAC	D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.993C>A	chr22.hg19:g.39918544C>A		210.0	0.0	.		122.0	64.0	.	NM_001675	Q9UH31	Silent	SNP	ENST00000337304.2	hg19	CCDS13996.1																																																																																			.	C|1.000;G|0.000	.	alt		0.512	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321305.1	NM_001675	
RGAG1	57529	hgsc.bcm.edu	37	X	109694814	109694814	+	Silent	SNP	G	G	A			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chrX:109694814G>A	ENST00000465301.2	+	3	1215	c.969G>A	c.(967-969)ccG>ccA	p.P323P	RGAG1_ENST00000540313.1_Silent_p.P323P	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	323										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TGTCCACACCGCTACTGTCAG	0.502													G|||	1	0.000264901	0.0	0.0	3775	,	,		16677	0.001		0.0	False		,,,				2504	0.0				p.P323P		Atlas-SNP	.											.	RGAG1	168	.	0			c.G969A						PASS	.						257.0	235.0	242.0					X																	109694814		2203	4300	6503	SO:0001819	synonymous_variant	57529	exon3			CACACCGCTACTG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.969G>A	chrX.hg19:g.109694814G>A		148.0	0.0	.		69.0	5.0	.	NM_020769	Q9P2M8	Silent	SNP	ENST00000465301.2	hg19	CCDS14552.1																																																																																			.	.	.	none		0.502	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
IL32	9235	hgsc.bcm.edu	37	16	3119166	3119166	+	Frame_Shift_Del	DEL	T	T	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr16:3119166delT	ENST00000534507.1	+	6	726	c.515delT	c.(514-516)gttfs	p.V172fs	IL32_ENST00000552356.1_Frame_Shift_Del_p.V106fs|IL32_ENST00000530890.1_Frame_Shift_Del_p.V106fs|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000552936.1_Frame_Shift_Del_p.V150fs|IL32_ENST00000325568.5_Frame_Shift_Del_p.V126fs|IL32_ENST00000529699.1_Frame_Shift_Del_p.V106fs|IL32_ENST00000008180.9_Frame_Shift_Del_p.V106fs|IL32_ENST00000552664.1_Frame_Shift_Del_p.V126fs|IL32_ENST00000551122.1_Intron|IL32_ENST00000440815.3_Frame_Shift_Del_p.V126fs|IL32_ENST00000533097.2_Frame_Shift_Del_p.V126fs|IL32_ENST00000549213.1_Intron|IL32_ENST00000548476.1_Frame_Shift_Del_p.V172fs|IL32_ENST00000396887.3_Intron|IL32_ENST00000444393.3_Frame_Shift_Del_p.V126fs|IL32_ENST00000382213.3_Frame_Shift_Del_p.V117fs|IL32_ENST00000530538.2_Frame_Shift_Del_p.V126fs|IL32_ENST00000548246.1_Frame_Shift_Del_p.V86fs|IL32_ENST00000548652.1_Frame_Shift_Del_p.V117fs|IL32_ENST00000396890.2_Frame_Shift_Del_p.V172fs|IL32_ENST00000526464.2_Frame_Shift_Del_p.V126fs|IL32_ENST00000529550.1_Frame_Shift_Del_p.V126fs|IL32_ENST00000531965.1_Frame_Shift_Del_p.V116fs|IL32_ENST00000551513.1_Frame_Shift_Del_p.V163fs|IL32_ENST00000525643.2_Frame_Shift_Del_p.V126fs|IL32_ENST00000528163.2_Frame_Shift_Del_p.V126fs			P24001	IL32_HUMAN	interleukin 32	172					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						TGGCACGGGGTTCTGGCCTGG	0.602																																					p.V126fs		Atlas-Indel,Pindel	.											.	IL32	32	.	0			c.376delG						PASS	.						21.0	25.0	24.0					16																	3119166		2192	4276	6468	SO:0001589	frameshift_variant	9235	exon7			.	M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.515delT	chr16.hg19:g.3119166delT	ENSP00000431775:p.Val172fs	267.0	0.0	0		317.0	117.0	0.369085	NM_004221	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Frame_Shift_Del	DEL	ENST00000534507.1	hg19																																																																																				.	.	.	none		0.602	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221	
HOXD4	3233	hgsc.bcm.edu	37	2	177016768	177016783	+	Frame_Shift_Del	DEL	GGATGAAGAAGGTGCA	GGATGAAGAAGGTGCA	-	rs547685014		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	GGATGAAGAAGGTGCA	GGATGAAGAAGGTGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr2:177016768_177016783delGGATGAAGAAGGTGCA	ENST00000306324.3	+	1	819_834	c.407_422delGGATGAAGAAGGTGCA	c.(406-423)tggatgaagaaggtgcacfs	p.WMKKVH136fs	HOXD3_ENST00000468418.3_5'UTR|MIR10B_ENST00000385011.1_RNA	NM_014621.2	NP_055436.2	P09016	HXD4_HUMAN	homeobox D4	136					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		GTCTACCCCTGGATGAAGAAGGTGCACGTGAATTCG	0.671																																					p.136_141del		Atlas-Indel,Pindel	.											.	HOXD4	32	.	0			c.406_421del						PASS	.																																			SO:0001589	frameshift_variant	3233	exon1			.		CCDS2269.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170166	ENSG00000170166		"""Homeoboxes / ANTP class : HOXL subclass"""	5138	protein-coding gene	gene with protein product		142981	"""homeo box D4"""	HOX4B, HOX4		1973146, 1358459	Standard	NM_014621		Approved		uc002uks.3	P09016	OTTHUMG00000132515	ENST00000306324.3:c.407_422delGGATGAAGAAGGTGCA	chr2.hg19:g.177016768_177016783delGGATGAAGAAGGTGCA	ENSP00000302548:p.Trp136fs	127.0	0.0	0		66.0	14.0	0.212121	NM_014621	B2R9R3|Q96AU0	Frame_Shift_Del	DEL	ENST00000306324.3	hg19	CCDS2269.1																																																																																			.	.	.	none		0.671	HOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255697.2		
TUBGCP3	10426	hgsc.bcm.edu	37	13	113212595	113212596	+	Frame_Shift_Ins	INS	-	-	G	rs9324311	byFrequency	TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr13:113212595_113212596insG	ENST00000261965.3	-	5	648_649	c.462_463insC	c.(460-465)tccggcfs	p.G155fs	TUBGCP3_ENST00000375669.3_Frame_Shift_Ins_p.G155fs	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	155					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CCCACGCTGCCGGAGCTCTGGG	0.624																																					p.G155fs		Atlas-Indel,Pindel	.											TUBGCP3,NS,carcinoma,0,1	TUBGCP3	74	.	0			c.463_464insC						PASS	.																																			SO:0001589	frameshift_variant	10426	exon5			.	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.463dupC	chr13.hg19:g.113212597_113212597dupG	ENSP00000261965:p.Gly155fs	97.0	0.0	0		79.0	30.0	0.379747	NM_006322	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Frame_Shift_Ins	INS	ENST00000261965.3	hg19	CCDS9525.1																																																																																			.	.	.	none		0.624	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2	NM_006322	
RNF185	91445	hgsc.bcm.edu	37	22	31583132	31583132	+	Frame_Shift_Del	DEL	G	G	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr22:31583132delG	ENST00000326132.6	+	2	211	c.52delG	c.(52-54)gggfs	p.G19fs	RNF185_ENST00000266252.7_Frame_Shift_Del_p.G19fs|RNF185_ENST00000426256.2_5'UTR	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185	19					autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(3)|skin(1)	6						CTCCAGTGCAGGGGGGCCCAG	0.607																																					p.A17fs		Atlas-Indel,Pindel	.											.	RNF185	14	.	0			c.51delA						PASS	.						71.0	73.0	72.0					22																	31583132		2203	4300	6503	SO:0001589	frameshift_variant	91445	exon2			.		CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.52delG	chr22.hg19:g.31583132delG	ENSP00000320508:p.Gly19fs	184.0	0.0	0		102.0	47.0	0.460784	NM_152267	A8K5C1|A9X3T8|Q8N900	Frame_Shift_Del	DEL	ENST00000326132.6	hg19	CCDS13890.1																																																																																			.	.	.	none		0.607	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321927.2	NM_152267	
SOX12	6666	hgsc.bcm.edu	37	20	306671	306679	+	In_Frame_Del	DEL	ACCCCGAGC	ACCCCGAGC	-	rs375905724|rs369922526		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	ACCCCGAGC	ACCCCGAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr20:306671_306679delACCCCGAGC	ENST00000342665.2	+	1	433_441	c.103_111delACCCCGAGC	c.(103-111)accccgagcdel	p.TPS35del	RP5-1103G7.4_ENST00000414676.1_RNA|SOX12_ENST00000544632.1_In_Frame_Del_p.TPS35del|RP5-1103G7.4_ENST00000442637.1_RNA	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12	35					cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			cTGGTGCAAGACCCCGAGCGGCCACATCA	0.722																																					p.34_37del		Atlas-Indel,Pindel	.											.	SOX12	8	.	0			c.102_110del						PASS	.																																			SO:0001651	inframe_deletion	6666	exon1			.	U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623	ENST00000342665.2:c.103_111delACCCCGAGC	chr20.hg19:g.306671_306679delACCCCGAGC	ENSP00000347646:p.Thr35_Ser37del	95.0	0.0	0		71.0	15.0	0.211268	NM_006943	Q5D038|Q9NUD4	In_Frame_Del	DEL	ENST00000342665.2	hg19	CCDS12995.1																																																																																			.	.	.	none		0.722	SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077435.2	NM_006943	
EFCAB13	124989	hgsc.bcm.edu	37	17	45452288	45452311	+	In_Frame_Del	DEL	AAAAACAGGTTTCGTCTACGGAAA	AAAAACAGGTTTCGTCTACGGAAA	-	rs370066816|rs377193277|rs377629904|rs554788706|rs144496511|rs536593341	byFrequency	TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	AAAAACAGGTTTCGTCTACGGAAA	AAAAACAGGTTTCGTCTACGGAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:45452288_45452311delAAAAACAGGTTTCGTCTACGGAAA	ENST00000331493.2	+	12	1739_1762	c.1328_1351delAAAAACAGGTTTCGTCTACGGAAA	c.(1327-1353)caaaaacaggtttcgtctacggaaaaa>caa	p.KQVSSTEK444del	EFCAB13_ENST00000517484.1_In_Frame_Del_p.KQVSSTEK348del	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	444						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.T449M(1)									TCCAGTCTCCAAAAACAGGTTTCGTCTACGGAAAAAACTGCAAT	0.357																																					p.443_450del		Atlas-Indel,Pindel	.											.	.	.	.	1	Substitution - Missense(1)	lung(1)	c.1327_1350del						PASS	.																																			SO:0001651	inframe_deletion	124989	exon12			.	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.1328_1351delAAAAACAGGTTTCGTCTACGGAAA	chr17.hg19:g.45452288_45452311delAAAAACAGGTTTCGTCTACGGAAA	ENSP00000332111:p.Lys444_Lys451del	248.0	0.0	0		168.0	23.0	0.136905	NM_152347	G3V128|Q49AG9	In_Frame_Del	DEL	ENST00000331493.2	hg19	CCDS11512.1																																																																																			.	.	.	none		0.357	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
KLK3	354	hgsc.bcm.edu	37	19	51361852	51361853	+	Splice_Site	INS	-	-	TTT			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:51361852_51361853insTTT	ENST00000326003.2	+	4	671		c.e4+1		KLK3_ENST00000595952.1_Splice_Site|KLK3_ENST00000593997.1_In_Frame_Ins_p.211_212insL|KLK3_ENST00000360617.3_Splice_Site|KLK3_ENST00000597483.1_Splice_Site	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3						cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		CACCTGCTCGGTGAGTCATCCC	0.554																																					.	Colon(185;1767 2023 13025 30120 37630)	Atlas-Indel,Pindel	.											.	KLK3	76	.	0			c.630+1->TTT						PASS	.																																			SO:0001630	splice_region_variant	354	exon4			.	X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.630+1->TTT	chr19.hg19:g.51361852_51361853insTTT		77.0	0.0	0		59.0	18.0	0.305085	NM_001030047	C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Splice_Site	INS	ENST00000326003.2	hg19	CCDS12807.1																																																																																			.	.	.	none		0.554	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464067.1	NM_145864	Intron
MUC16	94025	hgsc.bcm.edu	37	19	9074427	9074427	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:9074427delA	ENST00000397910.4	-	3	13222	c.13019delT	c.(13018-13020)gtcfs	p.V4340fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4342	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTCTTGGTGACATGAGTAGT	0.488																																					p.V4340fs		Atlas-Indel,Pindel	.											.	MUC16	4315	.	0			c.13020delC						PASS	.						109.0	114.0	112.0					19																	9074427		2096	4210	6306	SO:0001589	frameshift_variant	94025	exon3			.	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13019delT	chr19.hg19:g.9074427delA	ENSP00000381008:p.Val4340fs	78.0	0.0	0		78.0	36.0	0.461538	NM_024690	Q6ZQW5|Q96RK2	Frame_Shift_Del	DEL	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.	.	none		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MRC2	9902	hgsc.bcm.edu	37	17	60743875	60743875	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr17:60743875delA	ENST00000303375.5	+	4	1156	c.754delA	c.(754-756)aacfs	p.N252fs		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	252	C-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CTACCAGTTTAACTTCCAGTC	0.617																																					p.F251fs		Atlas-INDEL	.											.	MRC2	126	.	0			c.753delT						PASS	.						57.0	60.0	59.0					17																	60743875		2203	4300	6503	SO:0001589	frameshift_variant	9902	exon4			.	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.754delA	chr17.hg19:g.60743875delA	ENSP00000307513:p.Asn252fs	78.0	0.0	0		47.0	15.0	0.319149	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Frame_Shift_Del	DEL	ENST00000303375.5	hg19	CCDS11634.1																																																																																			.	.	.	none		0.617	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
GDF15	9518	hgsc.bcm.edu	37	19	18497000	18497001	+	Start_Codon_Del	DEL	AT	AT	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:18497000_18497001delAT	ENST00000252809.3	+	0	33_34				MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15						cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						CTGCACAGCCATGCCCGGGCAA	0.649																																					.		Atlas-INDEL	.											.	GDF15	31	.	0			.						PASS	.																																			SO:0001582	initiator_codon_variant	9518	wholegene			.	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988			chr19.hg19:g.18497000_18497001delAT		66.0	0.0	0		48.0	11.0	0.229167	NM_004864	O14629|P78360|Q9BWA0|Q9NRT0	Frame_Shift_Del	DEL	ENST00000252809.3	hg19	CCDS12376.1																																																																																			.	.	.	none		0.649	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
ANKRD50	57182	hgsc.bcm.edu	37	4	125590179	125590187	+	In_Frame_Del	DEL	TCAGAACCT	TCAGAACCT	-	rs551271977		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	TCAGAACCT	TCAGAACCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr4:125590179_125590187delTCAGAACCT	ENST00000504087.1	-	4	5282_5290	c.4245_4253delAGGTTCTGA	c.(4243-4254)gaaggttctgac>gac	p.EGS1415del	ANKRD50_ENST00000515641.1_In_Frame_Del_p.EGS1236del	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1415										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GAAGCTAGGGTCAGAACCTTCAATCTGAA	0.383																																					p.1416_1418del		Atlas-Indel,Pindel	.											.	ANKRD50	136	.	0			c.4246_4254del						PASS	.																																			SO:0001651	inframe_deletion	57182	exon4			.	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.4245_4253delAGGTTCTGA	chr4.hg19:g.125590179_125590187delTCAGAACCT	ENSP00000425658:p.Glu1415_Ser1417del	78.0	0.0	0		66.0	15.0	0.227273	NM_020337	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	In_Frame_Del	DEL	ENST00000504087.1	hg19	CCDS34060.1																																																																																			.	.	.	none		0.383	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
SETD1A	9739	hgsc.bcm.edu	37	16	30976438	30976439	+	Frame_Shift_Ins	INS	-	-	C			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr16:30976438_30976439insC	ENST00000262519.8	+	7	2061_2062	c.1375_1376insC	c.(1375-1377)tccfs	p.S459fs		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	459	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						AGTTCGGACTTCCCCCCGCCCA	0.698																																					p.S459fs		Atlas-Indel,Pindel	.											.	SETD1A	143	.	0			c.1375_1376insC						PASS	.																																			SO:0001589	frameshift_variant	9739	exon7			.	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1381dupC	chr16.hg19:g.30976444_30976444dupC	ENSP00000262519:p.Ser459fs	51.0	0.0	0		66.0	14.0	0.212121	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Frame_Shift_Ins	INS	ENST00000262519.8	hg19	CCDS32435.1																																																																																			.	.	.	none		0.698	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
HTR1B	3351	hgsc.bcm.edu	37	6	78172132	78172132	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr6:78172132delA	ENST00000369947.2	-	1	1358	c.989delT	c.(988-990)ttcfs	p.F331fs		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	331	Agonist binding.				adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GATGATGAAGAAGGGTAGCCA	0.512																																					p.F330fs		Atlas-Indel,Pindel	.											.	HTR1B	55	.	0			c.990delC						PASS	.						148.0	136.0	140.0					6																	78172132		2203	4300	6503	SO:0001589	frameshift_variant	3351	exon1			.	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.989delT	chr6.hg19:g.78172132delA	ENSP00000358963:p.Phe331fs	93.0	0.0	0		75.0	32.0	0.426667	NM_000863	Q4VAY7	Frame_Shift_Del	DEL	ENST00000369947.2	hg19	CCDS4986.1																																																																																			.	.	.	none		0.512	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863	
GOT2	2806	hgsc.bcm.edu	37	16	58742096	58742096	+	Frame_Shift_Del	DEL	G	G	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr16:58742096delG	ENST00000245206.5	-	10	1400	c.1272delC	c.(1270-1272)gccfs	p.A424fs	GOT2_ENST00000434819.2_Frame_Shift_Del_p.A381fs	NM_002080.2	NP_002071.2	P00505	AATM_HUMAN	glutamic-oxaloacetic transaminase 2, mitochondrial	424					2-oxoglutarate metabolic process (GO:0006103)|4-hydroxyproline catabolic process (GO:0019470)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid transport (GO:0015908)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|oxaloacetate metabolic process (GO:0006107)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|prostate(2)|skin(1)	22					L-Aspartic Acid(DB00128)	CCTGGTGAATGGCATGGGCAA	0.527																																					p.I425fs		Atlas-Indel,Pindel	.											.	GOT2	42	.	0			c.1273delA						PASS	.						74.0	67.0	70.0					16																	58742096		2198	4300	6498	SO:0001589	frameshift_variant	2806	exon10			.		CCDS10801.1, CCDS67045.1	16q21	2013-05-29	2013-05-29		ENSG00000125166	ENSG00000125166	2.6.1.1		4433	protein-coding gene	gene with protein product	"""kynurenine aminotransferase IV"", ""aspartate aminotransferase 2"", ""aspartate transaminase 2"""	138150	"""glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)"""			17442055	Standard	NM_002080		Approved	mitAAT, KATIV, KAT4	uc002eof.1	P00505	OTTHUMG00000133769	ENST00000245206.5:c.1272delC	chr16.hg19:g.58742096delG	ENSP00000245206:p.Ala424fs	47.0	0.0	0		53.0	28.0	0.528302	NM_002080	B4DJA6|E7ERW2|Q53FL3|Q9BWA3	Frame_Shift_Del	DEL	ENST00000245206.5	hg19	CCDS10801.1																																																																																			.	.	.	none		0.527	GOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258289.3		
GOLGA6B	55889	hgsc.bcm.edu	37	15	72947139	72947139	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr15:72947139delA	ENST00000421285.3	+	1	61	c.61delA	c.(61-63)aaafs	p.K21fs		NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	21						Golgi apparatus (GO:0005794)				NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						TCGACAGAATAAATTGGCAGC	0.522																																					p.N20fs		Pindel	.											.	GOLGA6B	30	.	0			c.60delT						PASS	.																																			SO:0001589	frameshift_variant	55889	exon1			.		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.61delA	chr15.hg19:g.72947139delA	ENSP00000408132:p.Lys21fs	703.0	0.0	.		621.0	33.0	0.053	NM_018652	A8MYY7	Frame_Shift_Del	DEL	ENST00000421285.3	hg19	CCDS10245.2																																																																																			.	.	.	none		0.522	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257474.4	NM_018652	
GDF15	9518	hgsc.bcm.edu	37	19	18496998	18497015	+	Start_Codon_Del	DEL	AACCTGCACAGCCATGCC	AACCTGCACAGCCATGCC	-	rs201445214|rs373073926|rs573590688		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	AACCTGCACAGCCATGCC	AACCTGCACAGCCATGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr19:18496998_18497015delAACCTGCACAGCCATGCC	ENST00000252809.3	+	0	31_48				MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15						cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)	p.P2H(1)		kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						ACCTGCACAGCCATGCCCGGGCAAGAACTCAGGACGGT	0.661																																					.		Pindel	.											.	GDF15	31	.	1	Substitution - Missense(1)	large_intestine(1)	.						PASS	.																																			SO:0001582	initiator_codon_variant	9518	wholegene			.	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988			chr19.hg19:g.18496998_18497015delAACCTGCACAGCCATGCC		62.0	0.0	.		48.0	11.0	0.229	NM_004864	O14629|P78360|Q9BWA0|Q9NRT0	Frame_Shift_Del	DEL	ENST00000252809.3	hg19	CCDS12376.1																																																																																			.	.	.	none		0.661	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
PTEN	5728	hgsc.bcm.edu	37	10	89720833	89720833	+	Frame_Shift_Del	DEL	A	A	-	rs587782304		TCGA-PJ-A8JU-01A-11D-A35Z-10	TCGA-PJ-A8JU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	13034367-8ee9-4a37-b910-2798632c44fe	d0b1cf4a-51b3-49a9-9a97-c719fa400826	g.chr10:89720833delA	ENST00000371953.3	+	8	2341	c.984delA	c.(982-984)gcafs	p.A328fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	328	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.A328fs*15(1)|p.W274_F341del(1)|p.A328fs*1(1)|p.D326_K342del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTGACAAAGCAAATAAAGACA	0.328		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.A328fs		Pindel	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN	3652	.	54	Whole gene deletion(37)|Deletion - Frameshift(11)|Deletion - In frame(4)|Unknown(2)	prostate(16)|central_nervous_system(13)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.983delC						PASS	.						73.0	76.0	75.0					10																	89720833		2203	4297	6500	SO:0001589	frameshift_variant	5728	exon8	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.984delA	chr10.hg19:g.89720833delA	ENSP00000361021:p.Ala328fs	416.0	0.0	.		270.0	97.0	0.359	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	hg19	CCDS31238.1																																																																																			.	.	.	none		0.328	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
