#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	hgsc.bcm.edu	37	1	8419867	8419868	+	Missense_Mutation	DNP	CG	CG	TT	rs538667090|rs147985313|rs557606465	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:8419867_8419868CG>TT	ENST00000337907.3	-	20	4208_4209	c.3574_3575CG>AA	c.(3574-3576)CGg>AAg	p.R1192K	RERE_ENST00000377464.1_Missense_Mutation_p.R924K|RERE_ENST00000400907.2_Intron|RERE_ENST00000476556.1_Missense_Mutation_p.R638K|RERE_ENST00000400908.2_Missense_Mutation_p.R1192K	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1192	Arg/Glu-rich (mixed charge).				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E1191_R1192insKE(1)		central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		ctcccgctcccgctccttctcc	0.683																																					p.R1192Q|p.R1192R		Atlas-SNP	.											RERE,NS,carcinoma,-1,1|RERE,NS,carcinoma,0,1	RERE	129	.	1	Insertion - In frame(1)	ovary(1)	c.G3575A|c.C3574A						PASS	.																																			SO:0001583	missense	473	exon20			CGCTCCCGCTCCT|GCTCCCGCTCCTT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.3574_3575delinsTT	chr1.hg19:g.8419867_8419868delinsTT	ENSP00000338629:p.Arg1192Lys	15.0	0.0	.		46.0|45.0	4.0	.	NM_012102	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation|Silent	SNP	ENST00000337907.3	hg19	CCDS95.1																																																																																			.	.	.	none		0.683	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
NSUN4	387338	hgsc.bcm.edu	37	1	46818626	46818626	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:46818626G>T	ENST00000474844.1	+	4	1329	c.679G>T	c.(679-681)Gat>Tat	p.D227Y	NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_Missense_Mutation_p.D178Y|NSUN4_ENST00000536062.1_Missense_Mutation_p.D178Y	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	227					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					AGAGATCAGGGATGGAAATCA	0.488																																					p.D227Y		Atlas-SNP	.											.	NSUN4	26	.	0			c.G679T						PASS	.						146.0	132.0	137.0					1																	46818626		2203	4300	6503	SO:0001583	missense	387338	exon4			ATCAGGGATGGAA	AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.679G>T	chr1.hg19:g.46818626G>T	ENSP00000419740:p.Asp227Tyr	53.0	0.0	.		95.0	4.0	.	NM_199044	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Missense_Mutation	SNP	ENST00000474844.1	hg19	CCDS534.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696993	0.68386	.	.	ENSG00000117481	ENST00000474844;ENST00000536062;ENST00000537428	T;T;T	0.22336	1.96;1.96;1.96	5.33	3.36	0.38483	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	0.525534	0.23606	N	0.046396	T	0.21674	0.0522	L	0.40543	1.245	0.35335	D	0.785985	P;B	0.49253	0.921;0.355	P;B	0.48368	0.575;0.393	T	0.25467	-1.0131	10	0.72032	D	0.01	-3.2295	7.9929	0.30250	0.1399:0.0:0.7295:0.1306	.	94;227	B3KUM0;Q96CB9	.;NSUN4_HUMAN	Y	227;178;178	ENSP00000419740:D227Y;ENSP00000438912:D178Y;ENSP00000437758:D178Y	ENSP00000419740:D227Y	D	+	1	0	NSUN4	46591213	0.997000	0.39634	0.990000	0.47175	0.980000	0.70556	1.385000	0.34408	1.458000	0.47871	0.591000	0.81541	GAT	.	.	.	none		0.488	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021427.1	NM_199044	
CLCA1	1179	hgsc.bcm.edu	37	1	86934706	86934706	+	Missense_Mutation	SNP	G	G	A	rs377703691		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:86934706G>A	ENST00000234701.3	+	2	403	c.52G>A	c.(52-54)Ggg>Agg	p.G18R	CLCA1_ENST00000394711.1_Missense_Mutation_p.G18R			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	18					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CCTTCTAGAAGGGGCCCTGAG	0.443																																					p.G18R		Atlas-SNP	.											.	CLCA1	109	.	0			c.G52A						PASS	.	G	ARG/GLY	0,4406		0,0,2203	139.0	134.0	136.0		52	6.0	0.8	1		136	1,8599	1.2+/-3.3	0,1,4299	no	missense	CLCA1	NM_001285.3	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	18/915	86934706	1,13005	2203	4300	6503	SO:0001583	missense	1179	exon1			CTAGAAGGGGCCC		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.52G>A	chr1.hg19:g.86934706G>A	ENSP00000234701:p.Gly18Arg	68.0	0.0	.		87.0	41.0	.	NM_001285	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	hg19	CCDS709.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577478	0.65878	0.0	1.16E-4	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.11821	2.74;2.74	5.96	5.96	0.96718	Chloride channel calcium-activated (1);	0.298342	0.31415	N	0.007685	T	0.28995	0.0720	M	0.77486	2.375	0.36444	D	0.865661	D	0.89917	1.0	D	0.81914	0.995	T	0.02307	-1.1179	10	0.25106	T	0.35	-15.6633	17.336	0.87281	0.0:0.0:1.0:0.0	.	18	A8K7I4	CLCA1_HUMAN	R	18	ENSP00000234701:G18R;ENSP00000378200:G18R	ENSP00000234701:G18R	G	+	1	0	CLCA1	86707294	0.978000	0.34361	0.836000	0.33094	0.545000	0.35147	2.435000	0.44811	2.831000	0.97527	0.650000	0.86243	GGG	.	.	.	none		0.443	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
LCE1C	353133	hgsc.bcm.edu	37	1	152777877	152777877	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:152777877G>A	ENST00000607093.1	-	1	77	c.78C>T	c.(76-78)acC>acT	p.T26T	LCE1C_ENST00000368768.1_Silent_p.T26T			Q5T751	LCE1C_HUMAN	late cornified envelope 1C	26	Pro-rich.				keratinization (GO:0031424)					NS(1)|lung(4)|prostate(1)|skin(2)|urinary_tract(1)	9	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gacactttggggTGgggcact	0.647																																					p.T26T		Atlas-SNP	.											.	LCE1C	40	.	0			c.C78T						PASS	.						45.0	46.0	46.0					1																	152777877		2203	4300	6503	SO:0001819	synonymous_variant	353133	exon2			CTTTGGGGTGGGG		CCDS1026.1	1q21.3	2008-02-05			ENSG00000197084	ENSG00000197084		"""Late cornified envelopes"""	29464	protein-coding gene	gene with protein product		612605				11698679	Standard	NM_001276331		Approved	LEP3	uc001fap.1	Q5T751	OTTHUMG00000012445	ENST00000607093.1:c.78C>T	chr1.hg19:g.152777877G>A		50.0	0.0	.		198.0	18.0	.	NM_178351		Silent	SNP	ENST00000607093.1	hg19	CCDS1026.1																																																																																			.	.	.	none		0.647	LCE1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034658.2	NM_178351	
SPRR2D	6703	hgsc.bcm.edu	37	1	153012642	153012642	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:153012642G>T	ENST00000368757.1	-	2	461	c.181C>A	c.(181-183)Cca>Aca	p.P61T	SPRR2D_ENST00000368756.1_Missense_Mutation_p.P61T|SPRR2D_ENST00000368758.3_Missense_Mutation_p.P61T|SPRR2D_ENST00000360379.3_Missense_Mutation_p.P61T			P22532	SPR2D_HUMAN	small proline-rich protein 2D	61					epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(1)|skin(1)	2	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGGCAGGGTGGGGAAGGTGTC	0.562																																					p.P61T		Atlas-SNP	.											.	SPRR2D	9	.	0			c.C181A						PASS	.						228.0	212.0	217.0					1																	153012642		2203	4298	6501	SO:0001583	missense	6703	exon2			AGGGTGGGGAAGG	AF333954	CCDS30864.1	1q21-q22	2008-02-05			ENSG00000163216	ENSG00000163216			11264	protein-coding gene	gene with protein product						8325635	Standard	NM_006945		Approved		uc001fbb.2	P22532	OTTHUMG00000014396	ENST00000368757.1:c.181C>A	chr1.hg19:g.153012642G>T	ENSP00000357746:p.Pro61Thr	93.0	0.0	.		342.0	16.0	.	NM_006945	A4QN03|A8K5K2|D3DV33|Q5T523|Q96RM3	Missense_Mutation	SNP	ENST00000368757.1	hg19	CCDS30864.1	.	.	.	.	.	.	.	.	.	.	G	0.024	-1.388841	0.01185	.	.	ENSG00000163216	ENST00000360379;ENST00000368758;ENST00000368757;ENST00000368756	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	3.62	0.403	0.16350	.	1.027660	0.07812	N	0.958367	T	0.09423	0.0232	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.37753	-0.9692	9	0.87932	D	0	.	2.2809	0.04114	0.1152:0.1919:0.4957:0.1972	.	61	P22532	SPR2D_HUMAN	T	61	ENSP00000353542:P61T;ENSP00000357747:P61T;ENSP00000357746:P61T;ENSP00000357745:P61T	ENSP00000353542:P61T	P	-	1	0	SPRR2D	151279266	0.003000	0.15002	0.000000	0.03702	0.016000	0.09150	0.726000	0.25984	-0.130000	0.11599	-0.535000	0.04281	CCA	.	.	.	none		0.562	SPRR2D-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040051.1		
DUSP23	54935	hgsc.bcm.edu	37	1	159751066	159751066	+	Missense_Mutation	SNP	A	A	T	rs141314838		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:159751066A>T	ENST00000368107.1	+	1	274	c.176A>T	c.(175-177)cAc>cTc	p.H59L	DUSP23_ENST00000368108.3_Missense_Mutation_p.H59L|DUSP23_ENST00000368109.1_Missense_Mutation_p.H59L			Q9BVJ7	DUS23_HUMAN	dual specificity phosphatase 23	59						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			lung(1)	1	all_hematologic(112;0.0537)					CTCACCCTGCACCGCCTGCGC	0.716																																					p.H59L		Atlas-SNP	.											.	DUSP23	9	.	0			c.A176T						PASS	.						4.0	4.0	4.0					1																	159751066		1795	3557	5352	SO:0001583	missense	54935	exon2			CCCTGCACCGCCT		CCDS1187.1	1q23.1	2011-06-09			ENSG00000158716	ENSG00000158716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	21480	protein-coding gene	gene with protein product						15147733	Standard	XM_005245289		Approved	FLJ20442, DUSP25	uc001ftz.1	Q9BVJ7	OTTHUMG00000022795	ENST00000368107.1:c.176A>T	chr1.hg19:g.159751066A>T	ENSP00000357087:p.His59Leu	3.0	0.0	.		183.0	78.0	.	NM_017823	Q9NX48	Missense_Mutation	SNP	ENST00000368107.1	hg19	CCDS1187.1	.	.	.	.	.	.	.	.	.	.	A	9.461	1.093071	0.20471	.	.	ENSG00000158716	ENST00000368109;ENST00000368108;ENST00000368107	D;D;D	0.82711	-1.64;-1.64;-1.64	4.89	3.76	0.43208	Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56062	0.1960	L	0.48935	1.535	0.58432	D	0.999997	B	0.24186	0.099	B	0.17433	0.018	T	0.53521	-0.8427	10	0.07644	T	0.81	-38.779	8.8034	0.34923	0.9101:0.0:0.0899:0.0	.	59	Q9BVJ7	DUS23_HUMAN	L	59	ENSP00000357089:H59L;ENSP00000357088:H59L;ENSP00000357087:H59L	ENSP00000357087:H59L	H	+	2	0	DUSP23	158017690	1.000000	0.71417	0.997000	0.53966	0.010000	0.07245	8.405000	0.90213	0.877000	0.35895	-0.441000	0.05720	CAC	.	.	.	none		0.716	DUSP23-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085552.1	NM_017823	
NFASC	23114	hgsc.bcm.edu	37	1	204985554	204985554	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:204985554G>T	ENST00000401399.1	+	29	3809	c.3610G>T	c.(3610-3612)Gaa>Taa	p.E1204*	NFASC_ENST00000360049.4_Nonsense_Mutation_p.E1133*|NFASC_ENST00000404076.1_Nonsense_Mutation_p.E1121*|NFASC_ENST00000367172.4_Nonsense_Mutation_p.E1311*|NFASC_ENST00000539706.1_Nonsense_Mutation_p.E1138*|NFASC_ENST00000513543.1_Nonsense_Mutation_p.E1133*|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000404907.1_Nonsense_Mutation_p.E1138*|NFASC_ENST00000339876.6_Nonsense_Mutation_p.E1204*|NFASC_ENST00000367171.4_Nonsense_Mutation_p.E1296*|NFASC_ENST00000367170.4_Nonsense_Mutation_p.E1232*|NFASC_ENST00000338515.6_Nonsense_Mutation_p.E1221*|NFASC_ENST00000338586.6_Nonsense_Mutation_p.E1188*|NFASC_ENST00000367169.4_Nonsense_Mutation_p.E1035*			O94856	NFASC_HUMAN	neurofascin	1311	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCAGTTCAATGAAGACGGCTC	0.562																																					p.E1204X		Atlas-SNP	.											.	NFASC	396	.	0			c.G3610T						PASS	.						197.0	175.0	182.0					1																	204985554		2203	4300	6503	SO:0001587	stop_gained	23114	exon30			TTCAATGAAGACG	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3610G>T	chr1.hg19:g.204985554G>T	ENSP00000385637:p.Glu1204*	89.0	0.0	.		310.0	34.0	.	NM_001005388	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Nonsense_Mutation	SNP	ENST00000401399.1	hg19	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	45|45	11.626230|11.626230	0.99583|0.99583	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393;ENST00000447819|ENST00000367173;ENST00000425360	.|.	.|.	.|.	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	0.000000|.	0.51477|.	D|.	0.000096|.	.|T	.|0.74718	.|0.3753	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73553	.|-0.3946	.|4	0.87932|.	D|.	0|.	.|.	18.6493|18.6493	0.91425|0.91425	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1311;1296;1232;1221;1204;1188;1153;1138;1133;1035;1121;1204;1138;1133;1129;182|1004;261	.|.	ENSP00000295776:E1153X|.	E|M	+|+	1|3	0|0	NFASC|NFASC	203252177|203252177	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.941000|0.941000	0.58515|0.58515	9.835000|9.835000	0.99442|0.99442	2.484000|2.484000	0.83849|0.83849	0.563000|0.563000	0.77884|0.77884	GAA|ATG	.	.	.	none		0.562	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
NRXN1	9378	hgsc.bcm.edu	37	2	50850682	50850682	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:50850682G>T	ENST00000406316.2	-	6	2380	c.904C>A	c.(904-906)Caa>Aaa	p.Q302K	NRXN1_ENST00000405472.3_Missense_Mutation_p.Q302K|NRXN1_ENST00000404971.1_Missense_Mutation_p.Q335K|NRXN1_ENST00000406859.3_Missense_Mutation_p.Q302K|NRXN1_ENST00000402717.3_Missense_Mutation_p.Q302K|NRXN1_ENST00000401669.2_Missense_Mutation_p.Q302K|NRXN1_ENST00000331040.5_5'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	302	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGCTGCTTTGAATGGGGTTT	0.393																																					p.Q335K		Atlas-SNP	.											.	NRXN1	1118	.	0			c.C1003A						PASS	.						138.0	129.0	132.0					2																	50850682		1869	4095	5964	SO:0001583	missense	9378	exon7			TGCTTTGAATGGG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.904C>A	chr2.hg19:g.50850682G>T	ENSP00000384311:p.Gln302Lys	66.0	0.0	.		79.0	34.0	.	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	hg19	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378078	0.61735	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.19;-1.24;-1.19;-1.24	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	L	0.38175	1.15	0.49389	D	0.999783	D;P	0.56035	0.974;0.946	P;D	0.68353	0.793;0.957	T	0.73933	-0.3826	10	0.09084	T	0.74	.	19.2231	0.93806	0.0:0.0:1.0:0.0	.	335;302	Q9ULB1-3;F8WB18	.;.	K	335;302;302;302;336;302;302	ENSP00000385142:Q335K;ENSP00000384311:Q302K;ENSP00000434015:Q302K;ENSP00000385017:Q302K;ENSP00000385434:Q302K;ENSP00000385681:Q302K	ENSP00000385017:Q302K	Q	-	1	0	NRXN1	50704186	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.776000	0.95493	0.650000	0.86243	CAA	.	.	.	none		0.393	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
C2orf81	388963	hgsc.bcm.edu	37	2	74642235	74642235	+	Missense_Mutation	SNP	C	C	T	rs533816628	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:74642235C>T	ENST00000517883.1	-	1	1475	c.784G>A	c.(784-786)Gat>Aat	p.D262N	C2orf81_ENST00000290390.5_Missense_Mutation_p.D330N			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	323										endometrium(3)|kidney(1)	4						AGCCGCACATCCGAGTGCCCG	0.741													c|||	15	0.00299521	0.0098	0.0014	5008	,	,		12968	0.0		0.001	False		,,,				2504	0.0				p.D330N		Atlas-SNP	.											.	C2orf81	23	.	0			c.G988A						PASS	.						6.0	10.0	9.0					2																	74642235		686	1580	2266	SO:0001583	missense	388963	exon4			GCACATCCGAGTG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.784G>A	chr2.hg19:g.74642235C>T	ENSP00000431103:p.Asp262Asn	2.0	0.0	.		95.0	50.0	.	NM_001145054		Missense_Mutation	SNP	ENST00000517883.1	hg19		.	.	.	.	.	.	.	.	.	.	c	14.86	2.660528	0.47572	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.47	0.838	0.18902	.	2.319490	0.02081	N	0.052394	T	0.35828	0.0945	L	0.36672	1.1	0.09310	N	1	P	0.36535	0.557	B	0.36289	0.221	T	0.27536	-1.0071	9	0.25751	T	0.34	-1.2556	9.5353	0.39218	0.1338:0.4358:0.4304:0.0	.	330	G3XAA6	.	N	262;330	.	ENSP00000290390:D330N	D	-	1	0	C2orf81	74495743	0.001000	0.12720	0.000000	0.03702	0.080000	0.17528	1.156000	0.31712	0.211000	0.20683	0.506000	0.49869	GAT	.	.	.	none		0.741	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
SPOPL	339745	hgsc.bcm.edu	37	2	139322375	139322375	+	Missense_Mutation	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:139322375A>G	ENST00000280098.4	+	9	1314	c.935A>G	c.(934-936)cAc>cGc	p.H312R		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	312					negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GCAGATTTGCACAGTGCAGAA	0.413																																					p.H312R		Atlas-SNP	.											.	SPOPL	54	.	0			c.A935G						PASS	.						170.0	161.0	164.0					2																	139322375		2203	4300	6503	SO:0001583	missense	339745	exon9			ATTTGCACAGTGC		CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.935A>G	chr2.hg19:g.139322375A>G	ENSP00000280098:p.His312Arg	80.0	0.0	.		176.0	29.0	.	NM_001001664		Missense_Mutation	SNP	ENST00000280098.4	hg19	CCDS33298.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.545679	0.86022	.	.	ENSG00000144228	ENST00000280098	T	0.76316	-1.01	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.88749	0.6521	M	0.89353	3.025	0.80722	D	1	D	0.71674	0.998	P	0.62813	0.907	D	0.90622	0.4560	9	.	.	.	-9.3536	15.6521	0.77104	1.0:0.0:0.0:0.0	.	312	Q6IQ16	SPOPL_HUMAN	R	312	ENSP00000280098:H312R	.	H	+	2	0	SPOPL	139038845	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.287000	0.95975	2.161000	0.67846	0.533000	0.62120	CAC	.	.	.	none		0.413	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331897.1		
SCN9A	6335	hgsc.bcm.edu	37	2	167055820	167055820	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:167055820C>T	ENST00000409435.1	-	26	5328	c.5329G>A	c.(5329-5331)Gat>Aat	p.D1777N	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.D1778N|SCN9A_ENST00000409672.1_Missense_Mutation_p.D1766N|SCN9A_ENST00000375387.4_Missense_Mutation_p.D1778N			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1777					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCAAAGTCATCCTCACTCAGA	0.428																																					p.D1766N		Atlas-SNP	.											.	SCN9A	296	.	0			c.G5296A						PASS	.						121.0	125.0	123.0					2																	167055820		2203	4300	6503	SO:0001583	missense	6335	exon27			AGTCATCCTCACT	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5329G>A	chr2.hg19:g.167055820C>T	ENSP00000386330:p.Asp1777Asn	142.0	0.0	.		189.0	10.0	.	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	hg19	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837192	0.91117	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	T;T;T;T	0.10005	2.92;2.92;2.92;2.92	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000006	T	0.48169	0.1485	H	0.94847	3.59	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.61028	-0.7145	10	0.87932	D	0	.	20.1802	0.98196	0.0:1.0:0.0:0.0	.	1766	E7EUN6	.	N	1766;1778;1778;1777	ENSP00000386306:D1766N;ENSP00000364536:D1778N;ENSP00000304748:D1778N;ENSP00000386330:D1777N	ENSP00000304748:D1778N	D	-	1	0	SCN9A	166764066	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.689000	0.84165	2.777000	0.95525	0.655000	0.94253	GAT	.	.	.	none		0.428	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
GIGYF2	26058	hgsc.bcm.edu	37	2	233671361	233671361	+	Silent	SNP	T	T	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:233671361T>A	ENST00000409547.1	+	17	2111	c.1800T>A	c.(1798-1800)ccT>ccA	p.P600P	GIGYF2_ENST00000409196.3_Silent_p.P594P|GIGYF2_ENST00000409451.3_Silent_p.P621P|GIGYF2_ENST00000373563.4_Silent_p.P600P|GIGYF2_ENST00000373566.3_Silent_p.P622P|GIGYF2_ENST00000409480.1_Silent_p.P622P|GIGYF2_ENST00000452341.2_Silent_p.P431P	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	600					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CTCCCCCTCCTCATATGGTAA	0.433																																					p.P621P		Atlas-SNP	.											.	GIGYF2	288	.	0			c.T1863A						PASS	.						111.0	108.0	109.0					2																	233671361		2203	4300	6503	SO:0001819	synonymous_variant	26058	exon17			CCCTCCTCATATG	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1800T>A	chr2.hg19:g.233671361T>A		39.0	0.0	.		54.0	35.0	.	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Silent	SNP	ENST00000409547.1	hg19	CCDS33401.1																																																																																			.	.	.	none		0.433	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
IQCA1	79781	hgsc.bcm.edu	37	2	237272540	237272540	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:237272540C>T	ENST00000409907.3	-	15	2026	c.1752G>A	c.(1750-1752)ctG>ctA	p.L584L	IQCA1_ENST00000309507.5_Silent_p.L581L|IQCA1_ENST00000431676.2_Silent_p.L543L	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	584							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						TGGCATGGACCAGCATTTTCT	0.512																																					p.L592L		Atlas-SNP	.											IQCA1_ENST00000409907,NS,carcinoma,0,2	IQCA1	170	.	0			c.G1776A						PASS	.						167.0	165.0	166.0					2																	237272540		1994	4155	6149	SO:0001819	synonymous_variant	79781	exon15			ATGGACCAGCATT	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1752G>A	chr2.hg19:g.237272540C>T		94.0	1.0	.		187.0	100.0	.	NM_001270585	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Silent	SNP	ENST00000409907.3	hg19	CCDS46549.1																																																																																			.	.	.	none		0.512	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
PTPRG	5793	hgsc.bcm.edu	37	3	62189090	62189090	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:62189090G>C	ENST00000474889.1	+	12	1998	c.1621G>C	c.(1621-1623)Gcc>Ccc	p.A541P	PTPRG_ENST00000295874.10_Missense_Mutation_p.A541P	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	541					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCTCCCGACGGCCGCCTCAGC	0.687																																					p.A541P		Atlas-SNP	.											.	PTPRG	153	.	0			c.G1621C						PASS	.						17.0	15.0	16.0					3																	62189090		2203	4297	6500	SO:0001583	missense	5793	exon12			CCGACGGCCGCCT	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1621G>C	chr3.hg19:g.62189090G>C	ENSP00000418112:p.Ala541Pro	32.0	0.0	.		99.0	67.0	.	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	hg19	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	G	9.459	1.092688	0.20471	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.55760	0.57;0.5	4.39	3.51	0.40186	.	0.179080	0.48286	D	0.000192	T	0.58836	0.2150	L	0.57536	1.79	0.09310	N	1	D;P	0.61080	0.989;0.93	P;P	0.58266	0.836;0.462	T	0.50750	-0.8791	10	0.59425	D	0.04	.	6.385	0.21556	0.0862:0.0:0.5861:0.3277	.	541;541	P23470-2;P23470	.;PTPRG_HUMAN	P	541	ENSP00000418112:A541P;ENSP00000295874:A541P	ENSP00000295874:A541P	A	+	1	0	PTPRG	62164130	0.995000	0.38212	0.010000	0.14722	0.036000	0.12997	4.014000	0.57145	0.959000	0.37980	0.591000	0.81541	GCC	.	.	.	none		0.687	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376122	113376122	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:113376122C>T	ENST00000478658.1	-	5	4424	c.4407G>A	c.(4405-4407)caG>caA	p.Q1469Q	KIAA2018_ENST00000316407.4_Silent_p.Q1469Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1469	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gctgctgctgctgctgctgct	0.498																																					p.Q1469Q		Atlas-SNP	.											.	KIAA2018	180	.	0			c.G4407A						PASS	.						55.0	66.0	62.0					3																	113376122		2188	4278	6466	SO:0001819	synonymous_variant	205717	exon7			CTGCTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4407G>A	chr3.hg19:g.113376122C>T		24.0	0.0	.		98.0	17.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	none		0.498	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376128	113376128	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:113376128C>T	ENST00000478658.1	-	5	4418	c.4401G>A	c.(4399-4401)caG>caA	p.Q1467Q	KIAA2018_ENST00000316407.4_Silent_p.Q1467Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1467	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gctgctgctgctgctgctgct	0.493																																					p.Q1467Q		Atlas-SNP	.											.	KIAA2018	180	.	0			c.G4401A						PASS	.						52.0	61.0	58.0					3																	113376128		2177	4283	6460	SO:0001819	synonymous_variant	205717	exon7			CTGCTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4401G>A	chr3.hg19:g.113376128C>T		21.0	0.0	.		93.0	22.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	none		0.493	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ROPN1B	152015	hgsc.bcm.edu	37	3	125690910	125690910	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:125690910G>T	ENST00000514116.1	+	3	328	c.13G>T	c.(13-15)Gat>Tat	p.D5Y	ROPN1B_ENST00000251776.4_Missense_Mutation_p.D5Y|ROPN1B_ENST00000504401.1_Missense_Mutation_p.D5Y|ROPN1B_ENST00000511862.1_3'UTR			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	5					acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		GGCTCAGACAGATAAGCCAAC	0.517																																					p.D5Y		Atlas-SNP	.											.	ROPN1B	16	.	0			c.G13T						PASS	.						54.0	56.0	56.0					3																	125690910		2203	4300	6503	SO:0001583	missense	152015	exon2			CAGACAGATAAGC	AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.13G>T	chr3.hg19:g.125690910G>T	ENSP00000426271:p.Asp5Tyr	30.0	0.0	.		86.0	26.0	.	NM_001012337	D3DNA6|Q96BM7	Missense_Mutation	SNP	ENST00000514116.1	hg19	CCDS33841.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986274	0.35036	.	.	ENSG00000114547	ENST00000514116;ENST00000251776;ENST00000504401;ENST00000513830;ENST00000508088;ENST00000509879	T;T;T;T	0.50548	1.7;1.7;1.3;0.74	3.37	2.48	0.30137	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (1);	0.169791	0.40222	N	0.001160	T	0.59224	0.2178	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.995;0.998	T	0.57900	-0.7731	10	0.87932	D	0	-2.9193	7.0352	0.24989	0.1362:0.0:0.8638:0.0	.	5;5	B7Z7H1;Q9BZX4	.;ROP1B_HUMAN	Y	5	ENSP00000426271:D5Y;ENSP00000251776:D5Y;ENSP00000425548:D5Y;ENSP00000423058:D5Y	ENSP00000251776:D5Y	D	+	1	0	ROPN1B	127173600	0.992000	0.36948	0.966000	0.40874	0.278000	0.26855	2.272000	0.43373	0.510000	0.28216	0.305000	0.20034	GAT	.	.	.	none		0.517	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369931.1	NM_001012337	
PPP2R3A	5523	hgsc.bcm.edu	37	3	135825108	135825108	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:135825108T>C	ENST00000264977.3	+	13	3890	c.3273T>C	c.(3271-3273)gcT>gcC	p.A1091A	PPP2R3A_ENST00000334546.2_Silent_p.A470A|PPP2R3A_ENST00000490467.1_Silent_p.A355A|PPP2R3A_ENST00000469270.1_3'UTR	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	1091					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGTTTGCCGCTGAGGAGTATG	0.453																																					p.A1091A		Atlas-SNP	.											.	PPP2R3A	114	.	0			c.T3273C						PASS	.						74.0	76.0	75.0					3																	135825108		2203	4300	6503	SO:0001819	synonymous_variant	5523	exon13			TGCCGCTGAGGAG	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.3273T>C	chr3.hg19:g.135825108T>C		69.0	0.0	.		126.0	41.0	.	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	ENST00000264977.3	hg19	CCDS3087.1																																																																																			.	.	.	none		0.453	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
MFSD1	64747	hgsc.bcm.edu	37	3	158519842	158519842	+	5'Flank	SNP	G	G	A	rs569538342	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:158519842G>A	ENST00000264266.8	+	0	0				RP11-379F4.9_ENST00000607044.1_RNA|MFSD1_ENST00000415822.2_Silent_p.R16R|MFSD1_ENST00000392813.4_Silent_p.R16R			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGAGCTCCCGGAGTCATGTGA	0.677													G|||	3	0.000599042	0.0023	0.0	5008	,	,		14763	0.0		0.0	False		,,,				2504	0.0				p.R16R	Pancreas(62;1186 1654 36636 37908)	Atlas-SNP	.											.	MFSD1	88	.	0			c.G48A						PASS	.						29.0	32.0	31.0					3																	158519842		692	1591	2283	SO:0001631	upstream_gene_variant	64747	exon1			CTCCCGGAGTCAT	BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835		chr3.hg19:g.158519842G>A	Exception_encountered	0.0	0.0	.		15.0	9.0	.	NM_022736	B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Silent	SNP	ENST00000264266.8	hg19																																																																																				.	.	.	none		0.677	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470730.1	NM_022736	
YEATS2	55689	hgsc.bcm.edu	37	3	183525842	183525842	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:183525842G>T	ENST00000305135.5	+	29	4231	c.4036G>T	c.(4036-4038)Gca>Tca	p.A1346S	YEATS2-AS1_ENST00000425008.3_RNA|YEATS2-AS1_ENST00000609195.1_RNA|YEATS2-AS1_ENST00000609871.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1346					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GCAGCCCGTGGCACTCCACAG	0.572																																					p.A1346S		Atlas-SNP	.											.	YEATS2	111	.	0			c.G4036T						PASS	.						44.0	46.0	45.0					3																	183525842		2006	4162	6168	SO:0001583	missense	55689	exon29			CCCGTGGCACTCC	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.4036G>T	chr3.hg19:g.183525842G>T	ENSP00000306983:p.Ala1346Ser	42.0	0.0	.		140.0	6.0	.	NM_018023	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	hg19	CCDS43175.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732056	0.69189	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.22134	1.97	5.53	4.63	0.57726	.	0.290196	0.31347	N	0.007819	T	0.12817	0.0311	N	0.08118	0	0.32028	N	0.599863	B	0.20368	0.044	B	0.15870	0.014	T	0.04991	-1.0913	10	0.59425	D	0.04	-14.0042	15.0579	0.71930	0.0:0.1431:0.8569:0.0	.	1346	Q9ULM3	YETS2_HUMAN	S	1346	ENSP00000306983:A1346S	ENSP00000306983:A1346S	A	+	1	0	YEATS2	185008536	1.000000	0.71417	0.918000	0.36340	0.889000	0.51656	5.256000	0.65468	1.291000	0.44653	0.561000	0.74099	GCA	.	.	.	none		0.572	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
DGKG	1608	hgsc.bcm.edu	37	3	185960324	185960324	+	Nonsense_Mutation	SNP	T	T	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:185960324T>A	ENST00000265022.3	-	20	2334	c.1795A>T	c.(1795-1797)Aga>Tga	p.R599*	DGKG_ENST00000382164.4_Nonsense_Mutation_p.R560*|DGKG_ENST00000344484.4_Nonsense_Mutation_p.R574*|DGKG_ENST00000544847.1_Nonsense_Mutation_p.R540*	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	599					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGTTTCTCTCTCATCACATGG	0.547											OREG0015965	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R599X		Atlas-SNP	.											.	DGKG	98	.	0			c.A1795T						PASS	.						100.0	87.0	92.0					3																	185960324		2203	4300	6503	SO:0001587	stop_gained	1608	exon20			TCTCTCTCATCAC	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1795A>T	chr3.hg19:g.185960324T>A	ENSP00000265022:p.Arg599*	27.0	0.0	.	2003	111.0	31.0	.	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Nonsense_Mutation	SNP	ENST00000265022.3	hg19	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	T	46	12.295792	0.99654	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	.	.	.	5.38	-0.167	0.13347	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3395	0.66617	0.0:0.0:0.4781:0.5218	.	.	.	.	X	599;574;560;540;563	.	ENSP00000265022:R599X	R	-	1	2	DGKG	187443018	0.993000	0.37304	1.000000	0.80357	0.992000	0.81027	0.192000	0.17096	0.099000	0.17552	0.533000	0.62120	AGA	.	.	.	none		0.547	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
PPP2R2C	5522	hgsc.bcm.edu	37	4	6335365	6335365	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:6335365T>C	ENST00000382599.4	-	7	1100	c.884A>G	c.(883-885)tAc>tGc	p.Y295C	PPP2R2C_ENST00000335585.5_Missense_Mutation_p.Y295C|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.Y278C|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.Y288C|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.Y288C			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	295					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						GGTGAGCATGTAGCGGCCGCT	0.572											OREG0016071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y295C		Atlas-SNP	.											.	PPP2R2C	63	.	0			c.A884G						PASS	.						110.0	105.0	107.0					4																	6335365		2203	4300	6503	SO:0001583	missense	5522	exon7			AGCATGTAGCGGC	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.884A>G	chr4.hg19:g.6335365T>C	ENSP00000372042:p.Tyr295Cys	59.0	0.0	.	633	128.0	77.0	.	NM_181876	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	hg19		.	.	.	.	.	.	.	.	.	.	T	16.16	3.044169	0.55110	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	4.11	1.24	0.21308	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.286388	0.35320	N	0.003299	T	0.59636	0.2208	H	0.94222	3.51	0.80722	D	1	D;D;D;D	0.67145	0.994;0.987;0.996;0.977	D;D;D;P	0.67900	0.933;0.926;0.954;0.87	T	0.66228	-0.5976	10	0.87932	D	0	.	9.1465	0.36937	0.3036:0.0:0.0:0.6964	.	288;295;278;295	B7Z3Y1;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;2ABG_HUMAN;.;.	C	295;288;278;295;288	ENSP00000335083:Y295C;ENSP00000423649:Y288C;ENSP00000422374:Y278C;ENSP00000372042:Y295C;ENSP00000425247:Y288C	ENSP00000335083:Y295C	Y	-	2	0	PPP2R2C	6386266	1.000000	0.71417	0.995000	0.50966	0.715000	0.41141	5.431000	0.66507	0.586000	0.29626	0.402000	0.26972	TAC	.	.	.	none		0.572	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
ATP10D	57205	hgsc.bcm.edu	37	4	47593174	47593174	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:47593174G>T	ENST00000273859.3	+	23	4326	c.4057G>T	c.(4057-4059)Gct>Tct	p.A1353S		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1353					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GTGGAGAGGGGCTGGAAAGAT	0.468																																					p.A1353S		Atlas-SNP	.											.	ATP10D	168	.	0			c.G4057T						PASS	.						107.0	108.0	108.0					4																	47593174		2203	4300	6503	SO:0001583	missense	57205	exon23			AGAGGGGCTGGAA	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.4057G>T	chr4.hg19:g.47593174G>T	ENSP00000273859:p.Ala1353Ser	77.0	0.0	.		90.0	4.0	.	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	hg19	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305821	0.40795	.	.	ENSG00000145246	ENST00000273859	T	0.38401	1.14	4.62	-2.03	0.07365	.	0.657993	0.13943	N	0.352047	T	0.20981	0.0505	L	0.51422	1.61	0.19775	N	0.999953	B	0.13145	0.007	B	0.08055	0.003	T	0.34576	-0.9823	10	0.09590	T	0.72	-0.9921	1.5641	0.02601	0.337:0.1313:0.3977:0.1341	.	1353	Q9P241	AT10D_HUMAN	S	1353	ENSP00000273859:A1353S	ENSP00000273859:A1353S	A	+	1	0	ATP10D	47287931	0.000000	0.05858	0.000000	0.03702	0.410000	0.31052	-0.016000	0.12613	-0.789000	0.04498	0.460000	0.39030	GCT	.	.	.	none		0.468	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
DSPP	1834	hgsc.bcm.edu	37	4	88536436	88536436	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:88536436C>T	ENST00000282478.7	+	4	2655	c.2622C>T	c.(2620-2622)agC>agT	p.S874S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S874S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	874	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaacagcagtg	0.502																																					p.S874S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2622T						PASS	.						70.0	85.0	79.0					4																	88536436		1641	2936	4577	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2622C>T	chr4.hg19:g.88536436C>T		131.0	0.0	.		371.0	30.0	.	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.	.	none		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
TLX3	30012	hgsc.bcm.edu	37	5	170736390	170736390	+	Silent	SNP	G	G	A	rs537348276		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:170736390G>A	ENST00000296921.5	+	1	103	c.21G>A	c.(19-21)gcG>gcA	p.A7A		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	7					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCGCCAGCGCGCAGACCCCGC	0.771			T	BCL11B	T-ALL																																p.A7A	Esophageal Squamous(33;43 807 3116 3348 30094)	Atlas-SNP	.		Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	.	TLX3	23	.	0			c.G21A						PASS	.						11.0	13.0	12.0					5																	170736390		2176	4263	6439	SO:0001819	synonymous_variant	30012	exon1			CAGCGCGCAGACC	AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.21G>A	chr5.hg19:g.170736390G>A		0.0	0.0	.		45.0	21.0	.	NM_021025	Q96AD3	Silent	SNP	ENST00000296921.5	hg19	CCDS34288.1																																																																																			.	.	.	none		0.771	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372076.3		
OR10C1	442194	hgsc.bcm.edu	37	6	29408232	29408232	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:29408232C>T	ENST00000444197.2	+	1	1150	c.440C>T	c.(439-441)gCg>gTg	p.A147V	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCTGGGTCGGCGTGGGCCTGT	0.622																																					p.A147V		Atlas-SNP	.											.	OR10C1	58	.	0			c.C440T						PASS	.						80.0	91.0	87.0					6																	29408232		1509	2709	4218	SO:0001583	missense	442194	exon1			GGTCGGCGTGGGC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.440C>T	chr6.hg19:g.29408232C>T	ENSP00000419119:p.Ala147Val	26.0	0.0	.		61.0	4.0	.	NM_013941	Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	hg19	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434952	0.43224	.	.	ENSG00000206474	ENST00000444197	T	0.34859	1.34	3.53	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38897	N	0.001526	T	0.29028	0.0721	N	0.16708	0.43	0.09310	N	1	D	0.67145	0.996	D	0.67725	0.953	T	0.18650	-1.0330	10	0.87932	D	0	.	14.9009	0.70678	0.0:1.0:0.0:0.0	.	147	Q96KK4	O10C1_HUMAN	V	147	ENSP00000419119:A147V	ENSP00000419119:A147V	A	+	2	0	OR10C1	29516211	0.000000	0.05858	0.027000	0.17364	0.033000	0.12548	-1.281000	0.02802	1.805000	0.52779	0.508000	0.49915	GCG	.	.	.	none		0.622	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
HLA-C	3107	hgsc.bcm.edu	37	6	31239552	31239552	+	Missense_Mutation	SNP	T	T	A	rs41545521		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:31239552T>A	ENST00000376228.5	-	2	181	c.167A>T	c.(166-168)cAg>cTg	p.Q56L	HLA-C_ENST00000383329.3_Missense_Mutation_p.Q56L	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	56	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CCGCACGAACTGCGTGTCGTC	0.701																																					p.Q56L		Atlas-SNP	.											HLA-C_ENST00000383329,colon,carcinoma,0,2	HLA-C	92	.	0			c.A167T						PASS	.						40.0	38.0	38.0					6																	31239552		1511	2707	4218	SO:0001583	missense	3107	exon2			ACGAACTGCGTGT	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.167A>T	chr6.hg19:g.31239552T>A	ENSP00000365402:p.Gln56Leu	14.0	1.0	.		174.0	11.0	.	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	hg19	CCDS34393.1	.	.	.	.	.	.	.	.	.	.	-	12.33	1.906500	0.33628	.	.	ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	T;T	0.00014	9.2;9.2	2.81	2.81	0.32909	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.195700	0.06728	N	0.776207	T	0.00178	0.0005	M	0.90542	3.125	0.26353	N	0.977175	D;D;D;D	0.67145	0.978;0.978;0.978;0.996	D;D;D;D	0.79108	0.98;0.98;0.98;0.992	T	0.41592	-0.9500	10	0.66056	D	0.02	.	7.4347	0.27148	0.0:0.0:0.0:1.0	.	56;56;56;56	A2AEA4;A6H578;A2AEA2;P10321	.;.;.;1C07_HUMAN	L	56;56;56;93	ENSP00000365402:Q56L;ENSP00000372819:Q56L	ENSP00000365402:Q56L	Q	-	2	0	HLA-C	31347531	0.000000	0.05858	1.000000	0.80357	0.175000	0.22909	-0.001000	0.12947	1.536000	0.49237	0.254000	0.18369	CAG	.	.	.	alt		0.701	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
CD2AP	23607	hgsc.bcm.edu	37	6	47471115	47471115	+	Missense_Mutation	SNP	A	A	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:47471115A>T	ENST00000359314.5	+	2	560	c.104A>T	c.(103-105)gAa>gTa	p.E35V		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	35	Interaction with ANLN and localization to the midbody.|SH3 1; truncated. {ECO:0000255|PROSITE- ProRule:PRU00192}.				mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			CTACAGGAGGAAGGGTGGCTG	0.378																																					p.E35V		Atlas-SNP	.											CD2AP,NS,carcinoma,0,1	CD2AP	43	.	0			c.A104T						PASS	.						139.0	134.0	135.0					6																	47471115		2203	4300	6503	SO:0001583	missense	23607	exon2			AGGAGGAAGGGTG	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.104A>T	chr6.hg19:g.47471115A>T	ENSP00000352264:p.Glu35Val	51.0	0.0	.		384.0	30.0	.	NM_012120	A6NL34|Q5VYA3|Q9UG97	Missense_Mutation	SNP	ENST00000359314.5	hg19	CCDS34472.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024553	0.75390	.	.	ENSG00000198087	ENST00000359314	T	0.54071	0.59	4.68	4.68	0.58851	Src homology-3 domain (4);	0.560263	0.21123	N	0.079786	T	0.63698	0.2533	M	0.75264	2.295	0.48452	D	0.999652	D	0.89917	1.0	D	0.83275	0.996	T	0.64935	-0.6290	10	0.38643	T	0.18	-17.8438	14.1476	0.65360	1.0:0.0:0.0:0.0	.	35	Q9Y5K6	CD2AP_HUMAN	V	35	ENSP00000352264:E35V	ENSP00000352264:E35V	E	+	2	0	CD2AP	47579074	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.530000	0.73816	1.735000	0.51646	0.533000	0.62120	GAA	.	.	.	none		0.378	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2		
PTCHD4	442213	hgsc.bcm.edu	37	6	48036108	48036108	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:48036108T>C	ENST00000339488.4	-	1	317	c.284A>G	c.(283-285)gAc>gGc	p.D95G	PTCHD4_ENST00000543600.1_Missense_Mutation_p.D78G	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	95						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TTTGGACTGGTCCAGGGGGAA	0.627																																					p.D95G		Atlas-SNP	.											.	.	.	.	0			c.A284G						PASS	.						72.0	79.0	77.0					6																	48036108		1946	4139	6085	SO:0001583	missense	442213	exon1			GACTGGTCCAGGG		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.284A>G	chr6.hg19:g.48036108T>C	ENSP00000341914:p.Asp95Gly	41.0	0.0	.		377.0	19.0	.	NM_001013732	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	hg19	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	T	18.19	3.569479	0.65765	.	.	ENSG00000244694	ENST00000339488;ENST00000543600	D;T	0.92397	-3.03;0.62	4.88	4.88	0.63580	.	0.103230	0.64402	D	0.000006	D	0.91088	0.7195	L	0.51422	1.61	0.80722	D	1	P;D	0.67145	0.826;0.996	B;P	0.57620	0.438;0.824	D	0.90227	0.4276	10	0.34782	T	0.22	.	14.4665	0.67488	0.0:0.0:0.0:1.0	.	95;78	Q6ZW05;B0QZ29	CF138_HUMAN;.	G	95;78	ENSP00000341914:D95G;ENSP00000439864:D78G	ENSP00000341914:D95G	D	-	2	0	C6orf138	48144067	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.602000	0.82796	1.813000	0.52934	0.460000	0.39030	GAC	.	.	.	none		0.627	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
ZNF451	26036	hgsc.bcm.edu	37	6	56989656	56989656	+	Splice_Site	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:56989656G>A	ENST00000370706.4	+	4	555	c.311G>A	c.(310-312)aGa>aAa	p.R104K	RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|ZNF451_ENST00000491832.2_Splice_Site_p.R104K|ZNF451_ENST00000357489.3_Splice_Site_p.R104K|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AGAGCATTCAGAGTATGTGCT	0.289																																					p.R104K		Atlas-SNP	.											.	ZNF451	181	.	0			c.G311A						PASS	.						35.0	33.0	34.0					6																	56989656		2203	4298	6501	SO:0001630	splice_region_variant	26036	exon4			CATTCAGAGTATG	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.312+1G>A	chr6.hg19:g.56989656G>A		102.0	0.0	.		253.0	16.0	.	NM_001031623	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	hg19	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456326	0.26161	.	.	ENSG00000112200	ENST00000510483;ENST00000370706;ENST00000357489;ENST00000491832	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	5.37	5.37	0.77165	.	0.061002	0.64402	D	0.000003	T	0.01156	0.0038	N	0.17082	0.46	0.80722	D	1	B;B;B;B	0.20887	0.049;0.037;0.027;0.037	B;B;B;B	0.15484	0.013;0.008;0.008;0.008	T	0.43360	-0.9396	10	0.06625	T	0.88	-16.7164	7.7021	0.28630	0.2013:0.0:0.7987:0.0	.	104;104;104;104	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	K	76;104;104;104	ENSP00000427558:R76K;ENSP00000359740:R104K;ENSP00000350083:R104K;ENSP00000421645:R104K	ENSP00000350083:R104K	R	+	2	0	ZNF451	57097615	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	4.870000	0.63035	2.665000	0.90641	0.655000	0.94253	AGA	.	.	.	none		0.289	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	Missense_Mutation
PHF3	23469	hgsc.bcm.edu	37	6	64394128	64394128	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:64394128G>A	ENST00000262043.3	+	4	845	c.505G>A	c.(505-507)Gct>Act	p.A169T	PHF3_ENST00000509330.1_Missense_Mutation_p.A169T|PHF3_ENST00000393387.1_Missense_Mutation_p.A169T			Q92576	PHF3_HUMAN	PHD finger protein 3	169					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TGTATCTACTGCTAAAGCAGG	0.418																																					p.A169T	GBM(135;136 1820 29512 34071 46235)	Atlas-SNP	.											.	PHF3	191	.	0			c.G505A						PASS	.						176.0	182.0	180.0					6																	64394128		2203	4300	6503	SO:0001583	missense	23469	exon3			TCTACTGCTAAAG	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.505G>A	chr6.hg19:g.64394128G>A	ENSP00000262043:p.Ala169Thr	139.0	0.0	.		233.0	92.0	.	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	hg19	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	G	7.135	0.580718	0.13686	.	.	ENSG00000118482	ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387;ENST00000514822	T;T;T;T;T	0.41758	2.0;2.31;1.99;0.99;2.31	5.92	2.2	0.27929	.	1.243890	0.06006	N	0.648726	T	0.05686	0.0149	N	0.03608	-0.345	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29941	-0.9995	10	0.21540	T	0.41	-2.6584	2.9393	0.05825	0.1274:0.5534:0.1251:0.1941	.	169;169	Q92576;D6R9X2	PHF3_HUMAN;.	T	81;169;122;169;169;99	ENSP00000425227:A81T;ENSP00000262043:A169T;ENSP00000424078:A122T;ENSP00000422841:A169T;ENSP00000377048:A169T	ENSP00000262043:A169T	A	+	1	0	PHF3	64452087	0.066000	0.20996	0.643000	0.29450	0.707000	0.40811	0.935000	0.28924	0.120000	0.18254	-0.139000	0.14373	GCT	.	.	.	none		0.418	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
UNC93A	54346	hgsc.bcm.edu	37	6	167709627	167709627	+	Missense_Mutation	SNP	C	C	T	rs538293568		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:167709627C>T	ENST00000230256.3	+	3	552	c.377C>T	c.(376-378)gCg>gTg	p.A126V	UNC93A_ENST00000366830.2_3'UTR|UNC93A_ENST00000366829.2_Missense_Mutation_p.A126V	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GCAGAGAAGGCGGGAAAGCGT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		22340	0.001		0.0	False		,,,				2504	0.0				p.A126V		Atlas-SNP	.											.	UNC93A	66	.	0			c.C377T						PASS	.						224.0	203.0	210.0					6																	167709627		2203	4300	6503	SO:0001583	missense	54346	exon3			AGAAGGCGGGAAA	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.377C>T	chr6.hg19:g.167709627C>T	ENSP00000230256:p.Ala126Val	105.0	0.0	.		270.0	109.0	.	NM_018974	B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	ENST00000230256.3	hg19	CCDS5300.1	.	.	.	.	.	.	.	.	.	.	C	5.524	0.281564	0.10458	.	.	ENSG00000112494	ENST00000503433;ENST00000230256;ENST00000366829	T;T;T	0.30981	1.51;3.54;3.52	5.53	-3.43	0.04810	Major facilitator superfamily domain, general substrate transporter (1);	1.006790	0.07968	N	0.983528	T	0.04634	0.0126	N	0.17723	0.515	0.09310	N	1	B;B	0.16166	0.016;0.006	B;B	0.13407	0.009;0.009	T	0.37244	-0.9714	10	0.25106	T	0.35	-1.2474	4.3328	0.11071	0.3325:0.2722:0.0:0.3953	.	126;126	Q4QQJ4;Q86WB7	.;UN93A_HUMAN	V	126	ENSP00000421484:A126V;ENSP00000230256:A126V;ENSP00000355794:A126V	ENSP00000230256:A126V	A	+	2	0	UNC93A	167629617	0.020000	0.18652	0.000000	0.03702	0.018000	0.09664	1.103000	0.31062	-1.274000	0.02421	-0.890000	0.02929	GCG	.	.	.	none		0.547	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
TRA2A	29896	hgsc.bcm.edu	37	7	23547073	23547073	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:23547073G>A	ENST00000297071.4	-	5	823	c.607C>T	c.(607-609)Cca>Tca	p.P203S	TRA2A_ENST00000474586.1_5'UTR|TRA2A_ENST00000538367.1_Missense_Mutation_p.P102S|TRA2A_ENST00000392502.4_Missense_Mutation_p.P102S	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	203	Linker.				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						CCTGGTGTTGGTGTGTGCGCT	0.413																																					p.P203S	Pancreas(121;2137 2973 46590)	Atlas-SNP	.											.	TRA2A	29	.	0			c.C607T						PASS	.						249.0	237.0	241.0					7																	23547073		2203	4300	6503	SO:0001583	missense	29896	exon5			GTGTTGGTGTGTG	U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.607C>T	chr7.hg19:g.23547073G>A	ENSP00000297071:p.Pro203Ser	40.0	0.0	.		102.0	37.0	.	NM_013293	B4DUA9	Missense_Mutation	SNP	ENST00000297071.4	hg19	CCDS5383.1	.	.	.	.	.	.	.	.	.	.	G	34	5.300909	0.95601	.	.	ENSG00000164548	ENST00000297071;ENST00000392502;ENST00000538367	T;T;T	0.74106	-0.81;-0.81;-0.81	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.87293	0.6141	M	0.88906	2.99	0.80722	D	1	D	0.55800	0.973	P	0.58577	0.841	D	0.88826	0.3302	10	0.59425	D	0.04	-12.1484	19.5178	0.95171	0.0:0.0:1.0:0.0	.	203	Q13595	TRA2A_HUMAN	S	203;102;102	ENSP00000297071:P203S;ENSP00000376290:P102S;ENSP00000441116:P102S	ENSP00000297071:P203S	P	-	1	0	TRA2A	23513598	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.831000	0.99420	2.615000	0.88500	0.650000	0.86243	CCA	.	.	.	none		0.413	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250257.1	NM_013293	
ARPC1B	10095	hgsc.bcm.edu	37	7	98990335	98990335	+	Silent	SNP	C	C	T	rs530272604	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:98990335C>T	ENST00000451682.1	+	10	1134	c.825C>T	c.(823-825)gcC>gcT	p.A275A	ARPC1B_ENST00000252725.5_Silent_p.A275A|PDAP1_ENST00000496335.1_5'UTR			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	275					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			ATGACGCCGCCGCGGGGATGC	0.697													C|||	4	0.000798722	0.003	0.0	5008	,	,		13061	0.0		0.0	False		,,,				2504	0.0				p.A275A		Atlas-SNP	.											.	ARPC1B	41	.	0			c.C825T						PASS	.						4.0	5.0	4.0					7																	98990335		1777	3378	5155	SO:0001819	synonymous_variant	10095	exon8			CGCCGCCGCGGGG	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.825C>T	chr7.hg19:g.98990335C>T		5.0	0.0	.		147.0	84.0	.	NM_005720	Q9BU00	Silent	SNP	ENST00000451682.1	hg19	CCDS5661.1																																																																																			.	.	.	none		0.697	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
OPN1SW	611	hgsc.bcm.edu	37	7	128415147	128415147	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:128415147C>T	ENST00000249389.2	-	2	413	c.414G>A	c.(412-414)aaG>aaA	p.K138K		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	138					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						TGCCGAAGGGCTTACAGATGA	0.547																																					p.K138K		Atlas-SNP	.											.	OPN1SW	52	.	0			c.G414A						PASS	.						96.0	75.0	82.0					7																	128415147		2203	4300	6503	SO:0001819	synonymous_variant	611	exon2			GAAGGGCTTACAG	U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.414G>A	chr7.hg19:g.128415147C>T		62.0	0.0	.		197.0	54.0	.	NM_001708	Q13877	Silent	SNP	ENST00000249389.2	hg19	CCDS5806.1																																																																																			.	.	.	none		0.547	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350655.1	NM_001708	
AGAP3	116988	hgsc.bcm.edu	37	7	150839014	150839014	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:150839014G>A	ENST00000463381.1	+	12	1337	c.841G>A	c.(841-843)Gtg>Atg	p.V281M	AGAP3_ENST00000397238.2_Missense_Mutation_p.V612M	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	576	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						ATTTGTGGTGGTGTCCCTCAC	0.612																																					p.V612M		Atlas-SNP	.											.	AGAP3	121	.	0			c.G1834A						PASS	.						94.0	112.0	106.0					7																	150839014		2150	4240	6390	SO:0001583	missense	116988	exon14			GTGGTGGTGTCCC	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.841G>A	chr7.hg19:g.150839014G>A	ENSP00000418016:p.Val281Met	88.0	0.0	.		327.0	124.0	.	NM_031946	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000463381.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.553104|4.553104	0.86127|0.86127	.|.	.|.	ENSG00000133612|ENSG00000133612	ENST00000463381;ENST00000397232;ENST00000397238;ENST00000335355|ENST00000461065	T;T|.	0.19394|.	2.15;2.15|.	4.24|4.24	4.24|4.24	0.50183|0.50183	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.64402|.	D|.	0.000008|.	T|.	0.74558|.	0.3732|.	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	D;D;D;P|.	0.89917|.	1.0;0.999;0.999;0.95|.	D;D;D;P|.	0.97110|.	1.0;0.981;0.964;0.755|.	T|.	0.75977|.	-0.3127|.	10|.	0.72032|.	D|.	0.01|.	.|.	16.1835|16.1835	0.81929|0.81929	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	576;111;612;281|.	Q96P47;E7ETI2;Q96P47-4;B3KNZ8|.	AGAP3_HUMAN;.;.;.|.	M|X	281;111;612;576|104	ENSP00000418016:V281M;ENSP00000380413:V612M|.	ENSP00000334157:V576M|.	V|W	+|+	1|3	0|0	AGAP3|AGAP3	150469947|150469947	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.458000|7.458000	0.80787|0.80787	2.346000|2.346000	0.79739|0.79739	0.655000|0.655000	0.94253|0.94253	GTG|TGG	.	.	.	none		0.612	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946	
RHEB	6009	hgsc.bcm.edu	37	7	151188050	151188050	+	Missense_Mutation	SNP	A	A	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:151188050A>T	ENST00000262187.5	-	2	515	c.103T>A	c.(103-105)Tac>Aac	p.Y35N	RHEB_ENST00000496004.1_5'UTR|RHEB_ENST00000472642.1_5'UTR	NM_005614.3	NP_005605.1	Q15382	RHEB_HUMAN	Ras homolog enriched in brain	35					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|positive regulation of TOR signaling (GO:0032008)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.Y35N(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)	14			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		GTTGGATCGTAGGAGTCCACA	0.358																																					p.Y35N	Pancreas(98;671 892 8111 15140 36556 39178 39939 44184)	Atlas-SNP	.											RHEB,NS,carcinoma,0,3	RHEB	30	.	1	Substitution - Missense(1)	kidney(1)	c.T103A						PASS	.						103.0	100.0	101.0					7																	151188050		2203	4300	6503	SO:0001583	missense	6009	exon2			GATCGTAGGAGTC	D78132	CCDS5927.1	7q36	2014-05-09	2003-07-14	2003-07-14	ENSG00000106615	ENSG00000106615			10011	protein-coding gene	gene with protein product		601293	"""Ras homolog enriched in brain 2"""	RHEB2		8661031	Standard	NM_005614		Approved		uc003wkh.1	Q15382	OTTHUMG00000157330	ENST00000262187.5:c.103T>A	chr7.hg19:g.151188050A>T	ENSP00000262187:p.Tyr35Asn	48.0	0.0	.		87.0	5.0	.	NM_005614	B3KWN6|D3DX13|Q53Y56|Q99444	Missense_Mutation	SNP	ENST00000262187.5	hg19	CCDS5927.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.708820	0.89018	.	.	ENSG00000106615	ENST00000262187	T	0.81247	-1.47	5.42	5.42	0.78866	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91841	0.7418	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93659	0.6980	10	0.87932	D	0	.	13.3975	0.60863	1.0:0.0:0.0:0.0	.	35	Q15382	RHEB_HUMAN	N	35	ENSP00000262187:Y35N	ENSP00000262187:Y35N	Y	-	1	0	RHEB	150818983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.143000	0.89621	2.051000	0.60960	0.533000	0.62120	TAC	.	.	.	none		0.358	RHEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348468.2	NM_005614	
TRAPPC9	83696	hgsc.bcm.edu	37	8	140744445	140744445	+	Splice_Site	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr8:140744445T>G	ENST00000438773.2	-	22	3189	c.3056A>C	c.(3055-3057)gAt>gCt	p.D1019A	TRAPPC9_ENST00000389328.4_Splice_Site_p.D1117A|TRAPPC9_ENST00000389327.3_Splice_Site_p.D1010A|TRAPPC9_ENST00000522504.1_5'UTR	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	1019					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CACCAGCACATCTGTAAGGGA	0.677																																					p.D1117A		Atlas-SNP	.											.	TRAPPC9	114	.	0			c.A3350C						PASS	.						13.0	15.0	14.0					8																	140744445		2197	4283	6480	SO:0001630	splice_region_variant	83696	exon22			AGCACATCTGTAA	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.3056-1A>C	chr8.hg19:g.140744445T>G		0.0	0.0	.		27.0	12.0	.	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	hg19	CCDS55278.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.420212	0.62622	.	.	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.995;0.996	T	0.64241	-0.6454	9	0.39692	T	0.17	.	13.8481	0.63479	0.0:0.0:0.0:1.0	.	1019;1117	Q96Q05;Q96Q05-2	TPPC9_HUMAN;.	A	1117;1010;1019	.	ENSP00000373978:D1010A	D	-	2	0	TRAPPC9	140813627	1.000000	0.71417	0.999000	0.59377	0.853000	0.48598	7.220000	0.78008	1.911000	0.55334	0.533000	0.62120	GAT	.	.	.	none		0.677	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	Missense_Mutation
FRMPD1	22844	hgsc.bcm.edu	37	9	37745145	37745145	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:37745145G>A	ENST00000539465.1	+	16	3709	c.3116G>A	c.(3115-3117)gGa>gAa	p.G1039E	FRMPD1_ENST00000377765.3_Missense_Mutation_p.G1039E|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1039						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GTCTCTCAAGGAGACACACTA	0.488																																					p.G1039E		Atlas-SNP	.											.	FRMPD1	237	.	0			c.G3116A						PASS	.						75.0	81.0	79.0					9																	37745145		2202	4299	6501	SO:0001583	missense	22844	exon16			CTCAAGGAGACAC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3116G>A	chr9.hg19:g.37745145G>A	ENSP00000444411:p.Gly1039Glu	33.0	0.0	.		47.0	18.0	.	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	hg19	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702580	0.68501	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.07908	3.15;3.15	5.17	3.32	0.38043	.	3.748350	0.00496	N	0.000156	T	0.08358	0.0208	N	0.24115	0.695	0.80722	D	1	B	0.12630	0.006	B	0.15052	0.012	T	0.17592	-1.0364	10	0.46703	T	0.11	-5.6669	7.1991	0.25871	0.0943:0.1842:0.7215:0.0	.	1039	Q5SYB0	FRPD1_HUMAN	E	1039	ENSP00000366995:G1039E;ENSP00000444411:G1039E	ENSP00000366995:G1039E	G	+	2	0	FRMPD1	37735145	0.009000	0.17119	0.861000	0.33841	0.973000	0.67179	0.191000	0.17076	0.557000	0.29117	0.462000	0.41574	GGA	.	.	.	none		0.488	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
PRKACG	5568	hgsc.bcm.edu	37	9	71628295	71628295	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:71628295G>A	ENST00000377276.2	-	1	744	c.714C>T	c.(712-714)ccC>ccT	p.P238P		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						CGGCGTAGAAGGGTGGGAAGC	0.597																																					p.P238P	Esophageal Squamous(110;2236 2623 32146)	Atlas-SNP	.											.	PRKACG	65	.	0			c.C714T						PASS	.						70.0	68.0	69.0					9																	71628295		2203	4300	6503	SO:0001819	synonymous_variant	5568	exon1			GTAGAAGGGTGGG	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.714C>T	chr9.hg19:g.71628295G>A		35.0	0.0	.		96.0	34.0	.	NM_002732	O60850|Q5VZ02|Q86YI1	Silent	SNP	ENST00000377276.2	hg19	CCDS6625.1																																																																																			.	.	.	none		0.597	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1		
NIPSNAP3A	25934	hgsc.bcm.edu	37	9	107521616	107521616	+	Missense_Mutation	SNP	A	A	C	rs546236502	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:107521616A>C	ENST00000374767.4	+	6	846	c.741A>C	c.(739-741)aaA>aaC	p.K247N		NM_015469.1	NP_056284.1	Q9UFN0	NPS3A_HUMAN	nipsnap homolog 3A (C. elegans)	247						cytoplasm (GO:0005737)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	8						CACCACTGAAATAGTTTTCTA	0.358																																					p.K247N		Atlas-SNP	.											.	NIPSNAP3A	18	.	0			c.A741C						PASS	.						105.0	97.0	100.0					9																	107521616		2203	4300	6503	SO:0001583	missense	25934	exon6			ACTGAAATAGTTT	BC005935	CCDS6760.1	9q31.3	2003-11-27			ENSG00000136783	ENSG00000136783			23619	protein-coding gene	gene with protein product		608871				12477932	Standard	NM_015469		Approved	DKFZp564D177, FLJ13953, HSPC299, MGC14553		Q9UFN0	OTTHUMG00000020413	ENST00000374767.4:c.741A>C	chr9.hg19:g.107521616A>C	ENSP00000363899:p.Lys247Asn	63.0	0.0	.		85.0	24.0	.	NM_015469	A6NM55|Q5VX32|Q9BRV7|Q9H843|Q9P083	Missense_Mutation	SNP	ENST00000374767.4	hg19	CCDS6760.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.325054	0.60634	.	.	ENSG00000136783	ENST00000374767	T	0.73047	-0.71	3.97	2.82	0.32997	Dimeric alpha-beta barrel (1);	0.047557	0.85682	D	0.000000	T	0.80166	0.4573	M	0.81239	2.535	0.37125	D	0.901004	D	0.76494	0.999	D	0.71656	0.974	T	0.80739	-0.1248	10	0.87932	D	0	.	4.8972	0.13757	0.6882:0.0:0.3118:0.0	.	247	Q9UFN0	NPS3A_HUMAN	N	247	ENSP00000363899:K247N	ENSP00000363899:K247N	K	+	3	2	NIPSNAP3A	106561437	0.997000	0.39634	1.000000	0.80357	0.978000	0.69477	0.441000	0.21611	0.697000	0.31718	0.482000	0.46254	AAA	.	.	.	none		0.358	NIPSNAP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053484.1	NM_015469	
SVEP1	79987	hgsc.bcm.edu	37	9	113233740	113233740	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:113233740C>A	ENST00000401783.2	-	16	3238	c.2902G>T	c.(2902-2904)Gca>Tca	p.A968S	SVEP1_ENST00000374469.1_Missense_Mutation_p.A945S|SVEP1_ENST00000302728.8_Missense_Mutation_p.A968S|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	968					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ATTTCTGATGCAAGCTGAAAG	0.428																																					p.A968S		Atlas-SNP	.											.	SVEP1	326	.	0			c.G2902T						PASS	.						122.0	112.0	115.0					9																	113233740		1855	4107	5962	SO:0001583	missense	79987	exon16			CTGATGCAAGCTG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2902G>T	chr9.hg19:g.113233740C>A	ENSP00000384917:p.Ala968Ser	88.0	0.0	.		152.0	16.0	.	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	7.630	0.678635	0.14841	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	T;T;T	0.78246	-1.01;-1.02;-1.16	5.49	5.49	0.81192	.	0.158375	0.56097	D	0.000024	T	0.56834	0.2012	N	0.08118	0	0.27524	N	0.951309	B;B	0.17268	0.021;0.012	B;B	0.15052	0.012;0.012	T	0.37033	-0.9723	10	0.10902	T	0.67	.	12.9639	0.58473	0.283:0.717:0.0:0.0	.	968;968	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	S	968;945;968	ENSP00000384917:A968S;ENSP00000363593:A945S;ENSP00000304118:A968S	ENSP00000304118:A968S	A	-	1	0	SVEP1	112273561	1.000000	0.71417	0.854000	0.33618	0.607000	0.37147	2.741000	0.47426	2.583000	0.87209	0.650000	0.86243	GCA	.	.	.	none		0.428	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SDCCAG3	10807	hgsc.bcm.edu	37	9	139302279	139302279	+	Splice_Site	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:139302279T>G	ENST00000357365.3	-	4	530	c.401A>C	c.(400-402)aAg>aCg	p.K134T	SDCCAG3_ENST00000298537.7_Splice_Site_p.K111T|PMPCA_ENST00000371720.1_5'Flank|SDCCAG3_ENST00000371725.3_Splice_Site_p.K61T|PMPCA_ENST00000399219.3_5'Flank|SDCCAG3_ENST00000461693.1_5'Flank|PMPCA_ENST00000371717.3_5'Flank	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	134						cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		TGGATTTACCTTTGCATAAAT	0.522																																					p.K134T		Atlas-SNP	.											.	SDCCAG3	41	.	0			c.A401C						PASS	.						117.0	127.0	124.0					9																	139302279		1996	4158	6154	SO:0001630	splice_region_variant	10807	exon4			TTTACCTTTGCAT	AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.402+1A>C	chr9.hg19:g.139302279T>G		28.0	0.0	.		43.0	11.0	.	NM_001039707	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Missense_Mutation	SNP	ENST00000357365.3	hg19	CCDS43904.1	.	.	.	.	.	.	.	.	.	.	T	14.76	2.632253	0.46944	.	.	ENSG00000165689	ENST00000357365;ENST00000298537;ENST00000371725;ENST00000371723	T;T;T;T	0.39406	2.24;2.31;2.29;1.08	5.34	5.34	0.76211	.	0.221148	0.38837	N	0.001555	T	0.58366	0.2117	M	0.63843	1.955	0.42845	D	0.994066	D;D;D	0.76494	0.99;0.997;0.999	P;D;D	0.68353	0.864;0.928;0.957	T	0.59627	-0.7419	10	0.45353	T	0.12	-23.4229	11.7031	0.51581	0.0:0.0:0.0:1.0	.	61;111;134	Q96C92-4;Q96C92-2;Q96C92	.;.;SDCG3_HUMAN	T	134;111;61;84	ENSP00000349929:K134T;ENSP00000298537:K111T;ENSP00000360790:K61T;ENSP00000360788:K84T	ENSP00000298537:K111T	K	-	2	0	SDCCAG3	138422100	1.000000	0.71417	0.628000	0.29241	0.117000	0.20001	4.054000	0.57434	2.012000	0.59069	0.528000	0.53228	AAG	.	.	.	none		0.522	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055060.2	NM_006643	Missense_Mutation
CUL2	8453	hgsc.bcm.edu	37	10	35360197	35360197	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:35360197G>C	ENST00000374748.1	-	3	362	c.49C>G	c.(49-51)Ctt>Gtt	p.L17V	CUL2_ENST00000602371.1_5'UTR|CUL2_ENST00000374742.1_Missense_Mutation_p.L17V|CUL2_ENST00000478044.1_5'UTR|CUL2_ENST00000374749.3_Missense_Mutation_p.L17V|CUL2_ENST00000374751.3_Missense_Mutation_p.L17V|CUL2_ENST00000537177.1_Missense_Mutation_p.L36V|CUL2_ENST00000374746.1_Missense_Mutation_p.L17V			Q13617	CUL2_HUMAN	cullin 2	17					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						GTCGTCAAAAGTTTGTTCCAT	0.358																																					p.L36V		Atlas-SNP	.											.	CUL2	63	.	0			c.C106G						PASS	.						148.0	122.0	131.0					10																	35360197		2203	4300	6503	SO:0001583	missense	8453	exon2			TCAAAAGTTTGTT	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.49C>G	chr10.hg19:g.35360197G>C	ENSP00000363880:p.Leu17Val	116.0	0.0	.		173.0	41.0	.	NM_001198778	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	hg19	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585575	0.66105	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374742;ENST00000537177;ENST00000421317	T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.92	4.06	0.47325	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.058793	0.64402	N	0.000001	T	0.65491	0.2696	L	0.58101	1.795	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;P;D	0.66497	0.944;0.875;0.923	T	0.67150	-0.5743	10	0.87932	D	0	-7.8946	11.7589	0.51890	0.0663:0.1241:0.8097:0.0	.	17;36;17	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	V	17;17;17;17;17;36;17	ENSP00000363883:L17V;ENSP00000363880:L17V;ENSP00000363878:L17V;ENSP00000363881:L17V;ENSP00000363874:L17V;ENSP00000444856:L36V;ENSP00000414095:L17V	ENSP00000363874:L17V	L	-	1	0	CUL2	35400203	1.000000	0.71417	0.282000	0.24776	0.833000	0.47200	6.391000	0.73208	0.824000	0.34613	0.655000	0.94253	CTT	.	.	.	none		0.358	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
TET1	80312	hgsc.bcm.edu	37	10	70404893	70404893	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:70404893G>T	ENST00000373644.4	+	4	2616	c.2407G>T	c.(2407-2409)Gct>Tct	p.A803S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	803					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.A803T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CCATAAAAACGCTATGAGCTC	0.353																																					p.A803S		Atlas-SNP	.											TET1_ENST00000373644,NS,carcinoma,0,1	TET1	255	.	1	Substitution - Missense(1)	endometrium(1)	c.G2407T						PASS	.						100.0	100.0	100.0					10																	70404893		2203	4300	6503	SO:0001583	missense	80312	exon4			AAAAACGCTATGA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2407G>T	chr10.hg19:g.70404893G>T	ENSP00000362748:p.Ala803Ser	102.0	0.0	.		84.0	10.0	.	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609899	0.46527	.	.	ENSG00000138336	ENST00000373644	T	0.08458	3.09	5.92	4.93	0.64822	.	0.759080	0.12137	N	0.496237	T	0.05318	0.0141	L	0.27053	0.805	0.27338	N	0.956599	P	0.44429	0.835	B	0.38056	0.264	T	0.21449	-1.0245	10	0.24483	T	0.36	.	4.6605	0.12639	0.2192:0.0:0.7808:0.0	.	803	Q8NFU7	TET1_HUMAN	S	803	ENSP00000362748:A803S	ENSP00000362748:A803S	A	+	1	0	TET1	70074899	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	1.045000	0.30341	2.822000	0.97130	0.650000	0.86243	GCT	.	.	.	none		0.353	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
ACSM6	142827	hgsc.bcm.edu	37	10	96967018	96967018	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:96967018C>A	ENST00000394005.3	+	3	466	c.457C>A	c.(457-459)Caa>Aaa	p.Q153K	C10orf129_ENST00000341686.3_Missense_Mutation_p.Q153K|C10orf129_ENST00000430183.1_5'UTR			Q6P461	ACSM6_HUMAN		153					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		AATTCGCTATCAATTACGCAT	0.468																																					p.Q153K		Atlas-SNP	.											C10orf129_ENST00000341686,NS,carcinoma,0,1	C10orf129	52	.	0			c.C457A						PASS	.						82.0	76.0	78.0					10																	96967018		2203	4300	6503	SO:0001583	missense	142827	exon4			CGCTATCAATTAC																												ENST00000394005.3:c.457C>A	chr10.hg19:g.96967018C>A	ENSP00000377573:p.Gln153Lys	53.0	0.0	.		94.0	20.0	.	NM_207321	A4FU95|A4IF38|Q5VZX2|Q6ZTX1	Missense_Mutation	SNP	ENST00000394005.3	hg19	CCDS7440.2	.	.	.	.	.	.	.	.	.	.	C	6.282	0.420077	0.11928	.	.	ENSG00000173124	ENST00000539707;ENST00000341686;ENST00000394005	T;T	0.41065	1.01;1.01	1.2	0.259	0.15583	AMP-dependent synthetase/ligase (1);	.	.	.	.	T	0.23249	0.0562	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.09377	0.004	T	0.21586	-1.0241	9	0.87932	D	0	.	5.4913	0.16777	0.0:0.7911:0.0:0.2089	.	153	Q6P461	ACSM6_HUMAN	K	179;153;153	ENSP00000340296:Q153K;ENSP00000377573:Q153K	ENSP00000340296:Q153K	Q	+	1	0	C10orf129	96957008	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	-1.319000	0.02702	0.134000	0.18681	0.579000	0.79373	CAA	.	.	.	none		0.468	C10orf129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049506.2		
PDZD7	79955	hgsc.bcm.edu	37	10	102783355	102783355	+	Missense_Mutation	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:102783355A>G	ENST00000370215.3	-	4	605	c.380T>C	c.(379-381)cTg>cCg	p.L127P	PDZD7_ENST00000470414.1_Missense_Mutation_p.L127P	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	127	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCCCACGCACAGGCCAGCCCG	0.657																																					p.L127P		Atlas-SNP	.											.	PDZD7	101	.	0			c.T380C						PASS	.						62.0	54.0	57.0					10																	102783355		2203	4300	6503	SO:0001583	missense	79955	exon4			ACGCACAGGCCAG	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.380T>C	chr10.hg19:g.102783355A>G	ENSP00000359234:p.Leu127Pro	13.0	0.0	.		31.0	13.0	.	NM_001195263	D5FJ77|Q8N321	Missense_Mutation	SNP	ENST00000370215.3	hg19	CCDS31269.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403886	0.83230	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.50548	0.74	5.05	5.05	0.67936	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000001	T	0.79581	0.4470	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.961	D	0.87162	0.2215	10	0.87932	D	0	.	14.7786	0.69749	1.0:0.0:0.0:0.0	.	127;127	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	P	127	ENSP00000359234:L127P	ENSP00000359234:L127P	L	-	2	0	PDZD7	102773345	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.224000	0.95209	1.893000	0.54813	0.459000	0.35465	CTG	.	.	.	none		0.657	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
MUC2	4583	hgsc.bcm.edu	37	11	1078339	1078339	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:1078339C>T	ENST00000441003.2	+	5	653	c.626C>T	c.(625-627)cCc>cTc	p.P209L	MUC2_ENST00000359061.5_Missense_Mutation_p.P209L	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	209	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGTGAGGATCCCGAGGAGGAG	0.642																																					p.P209L		Atlas-SNP	.											.	MUC2	614	.	0			c.C626T						PASS	.						76.0	90.0	86.0					11																	1078339		2086	4194	6280	SO:0001583	missense	4583	exon5			AGGATCCCGAGGA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.626C>T	chr11.hg19:g.1078339C>T	ENSP00000415183:p.Pro209Leu	73.0	0.0	.		224.0	60.0	.	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	C	12.34	1.909914	0.33721	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14766	2.54;2.48	4.08	4.08	0.47627	.	0.567974	0.14666	U	0.305646	T	0.21881	0.0527	L	0.53729	1.69	0.45554	D	0.998508	P	0.37525	0.598	B	0.43386	0.418	T	0.04454	-1.0950	10	0.48119	T	0.1	.	16.2743	0.82636	0.0:1.0:0.0:0.0	.	209	E7EUV1	.	L	209	ENSP00000415183:P209L;ENSP00000351956:P209L	ENSP00000351956:P209L	P	+	2	0	MUC2	1068339	0.995000	0.38212	0.394000	0.26270	0.046000	0.14306	2.838000	0.48199	1.818000	0.53035	0.561000	0.74099	CCC	.	.	.	none		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR10A2	341276	hgsc.bcm.edu	37	11	6891503	6891503	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:6891503G>A	ENST00000307322.4	+	1	580	c.518G>A	c.(517-519)aGg>aAg	p.R173K		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	173				R -> K (in Ref. 4; AAK95109). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CCTGTGCTGAGGCTGGTCTGT	0.507																																					p.R173K		Atlas-SNP	.											OR10A2,right_upper_lobe,carcinoma,0,1	OR10A2	55	.	0			c.G518A						PASS	.						191.0	158.0	169.0					11																	6891503		2201	4296	6497	SO:0001583	missense	341276	exon1			TGCTGAGGCTGGT	BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.518G>A	chr11.hg19:g.6891503G>A	ENSP00000303862:p.Arg173Lys	87.0	1.0	.		248.0	12.0	.	NM_001004460	B2RNL9|Q6IFG9	Missense_Mutation	SNP	ENST00000307322.4	hg19	CCDS31415.1	.	.	.	.	.	.	.	.	.	.	g	0.888	-0.726545	0.03158	.	.	ENSG00000170790	ENST00000307322	T	0.00016	9.13	4.14	-2.4	0.06583	GPCR, rhodopsin-like superfamily (1);	0.386873	0.25280	N	0.031805	T	0.00039	0.0001	N	0.00815	-1.16	0.22620	N	0.998928	B	0.02656	0.0	B	0.04013	0.001	T	0.40040	-0.9584	10	0.02654	T	1	.	9.7558	0.40502	0.6387:0.0:0.3613:0.0	.	173	Q9H208	O10A2_HUMAN	K	173	ENSP00000303862:R173K	ENSP00000303862:R173K	R	+	2	0	OR10A2	6848079	0.000000	0.05858	0.986000	0.45419	0.922000	0.55478	-0.974000	0.03794	-0.362000	0.08113	-0.201000	0.12746	AGG	.	.	.	none		0.507	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385984.1	NM_001004460	
PDE3B	5140	hgsc.bcm.edu	37	11	14666027	14666027	+	Missense_Mutation	SNP	C	C	G	rs373522381	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:14666027C>G	ENST00000282096.4	+	1	759	c.406C>G	c.(406-408)Ctc>Gtc	p.L136V	PSMA1_ENST00000418988.2_5'Flank|PDE3B_ENST00000534317.1_3'UTR|PDE3B_ENST00000455098.2_Missense_Mutation_p.L136V	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	136					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CACCTGCTTCCTCACCCGGAC	0.692													C|||	2	0.000399361	0.0015	0.0	5008	,	,		14055	0.0		0.0	False		,,,				2504	0.0				p.L136V		Atlas-SNP	.											.	PDE3B	98	.	0			c.C406G						PASS	.						29.0	32.0	31.0					11																	14666027		2199	4294	6493	SO:0001583	missense	5140	exon1			TGCTTCCTCACCC	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.406C>G	chr11.hg19:g.14666027C>G	ENSP00000282096:p.Leu136Val	10.0	0.0	.		146.0	52.0	.	NM_000922	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	ENST00000282096.4	hg19	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170982	0.57584	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.74842	-0.72;-0.88	3.78	0.801	0.18679	.	8.111930	0.00166	N	0.000000	T	0.73953	0.3653	L	0.40543	1.245	0.31630	N	0.649153	P;P;P	0.52842	0.884;0.884;0.956	B;B;P	0.50659	0.358;0.358;0.647	T	0.62058	-0.6934	10	0.45353	T	0.12	.	6.7026	0.23232	0.0:0.5775:0.0:0.4225	.	136;136;136	B7ZM37;Q13370;A7E2E5	.;PDE3B_HUMAN;.	V	136	ENSP00000282096:L136V;ENSP00000388644:L136V	ENSP00000282096:L136V	L	+	1	0	PDE3B	14622603	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	1.686000	0.37669	0.130000	0.18549	0.313000	0.20887	CTC	.	.	.	alt		0.692	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386974.1	NM_000922	
OR4X1	390113	hgsc.bcm.edu	37	11	48285602	48285602	+	Missense_Mutation	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:48285602T>G	ENST00000320048.1	+	1	190	c.190T>G	c.(190-192)Tta>Gta	p.L64V		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						TCTCAGCTACTTATCCTTTGT	0.493																																					p.L64V		Atlas-SNP	.											.	OR4X1	75	.	0			c.T190G						PASS	.						148.0	135.0	139.0					11																	48285602		2201	4298	6499	SO:0001583	missense	390113	exon1			AGCTACTTATCCT	AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.190T>G	chr11.hg19:g.48285602T>G	ENSP00000321506:p.Leu64Val	66.0	0.0	.		156.0	18.0	.	NM_001004726	Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	hg19	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	T	10.30	1.313474	0.23908	.	.	ENSG00000176567	ENST00000320048	T	0.00507	6.92	4.29	-3.51	0.04696	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01976	0.0062	H	0.97540	4.025	0.20403	N	0.999903	D	0.57571	0.98	P	0.56960	0.81	T	0.01084	-1.1457	9	0.87932	D	0	.	8.1735	0.31268	0.0:0.4875:0.1294:0.3831	.	64	Q8NH49	OR4X1_HUMAN	V	64	ENSP00000321506:L64V	ENSP00000321506:L64V	L	+	1	2	OR4X1	48242178	0.000000	0.05858	0.901000	0.35422	0.022000	0.10575	-2.554000	0.00926	-1.009000	0.03400	-2.821000	0.00108	TTA	.	.	.	none		0.493	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
KMT2A	4297	hgsc.bcm.edu	37	11	118373932	118373932	+	Missense_Mutation	SNP	A	A	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:118373932A>C	ENST00000389506.5	+	27	7316	c.7316A>C	c.(7315-7317)gAa>gCa	p.E2439A	KMT2A_ENST00000534358.1_Missense_Mutation_p.E2442A|KMT2A_ENST00000354520.4_Missense_Mutation_p.E2401A			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2439					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ACTTTCAAAGAAAAGCATTCC	0.403																																					p.E2442A		Atlas-SNP	.											.	MLL	548	.	0			c.A7325C						PASS	.						62.0	65.0	64.0					11																	118373932		2199	4296	6495	SO:0001583	missense	4297	exon27			TCAAAGAAAAGCA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.7316A>C	chr11.hg19:g.118373932A>C	ENSP00000374157:p.Glu2439Ala	96.0	0.0	.		87.0	34.0	.	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.794138	0.31777	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.83591	-1.74;-1.74;-1.71	5.85	5.85	0.93711	.	0.109676	0.64402	D	0.000008	T	0.70064	0.3181	N	0.19112	0.55	0.49915	D	0.999833	P;P	0.49090	0.919;0.919	B;B	0.33339	0.162;0.162	T	0.76889	-0.2792	10	0.72032	D	0.01	.	16.2303	0.82332	1.0:0.0:0.0:0.0	.	2442;2439	E9PQG7;Q03164	.;MLL1_HUMAN	A	2442;2439;2401;1349	ENSP00000436786:E2442A;ENSP00000374157:E2439A;ENSP00000346516:E2401A	ENSP00000346516:E2401A	E	+	2	0	MLL	117879142	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.414000	0.73318	2.233000	0.73108	0.533000	0.62120	GAA	.	.	.	none		0.403	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
SCNN1A	6337	hgsc.bcm.edu	37	12	6457064	6457064	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:6457064G>A	ENST00000228916.2	-	13	2083	c.1985C>T	c.(1984-1986)tCc>tTc	p.S662F	SCNN1A_ENST00000543768.1_Missense_Mutation_p.S685F|SCNN1A_ENST00000360168.3_Missense_Mutation_p.S721F|SCNN1A_ENST00000540037.1_Missense_Mutation_p.S362F|SCNN1A_ENST00000396966.2_3'UTR|SCNN1A_ENST00000358945.3_Missense_Mutation_p.S684F	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	662					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	AGGACAGGTGGAGGAACTGGC	0.672																																					p.S721F		Atlas-SNP	.											.	SCNN1A	54	.	0			c.C2162T						PASS	.						7.0	8.0	7.0					12																	6457064		2098	4115	6213	SO:0001583	missense	6337	exon12			CAGGTGGAGGAAC	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1985C>T	chr12.hg19:g.6457064G>A	ENSP00000228916:p.Ser662Phe	34.0	0.0	.		95.0	31.0	.	NM_001159576	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	ENST00000228916.2	hg19	CCDS8543.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383587	0.42207	.	.	ENSG00000111319	ENST00000360168;ENST00000358945;ENST00000540037;ENST00000228916;ENST00000543768	T;T;T;T;T	0.73258	-0.73;-0.69;-0.44;-0.63;-0.67	3.95	1.82	0.25136	.	1.972990	0.02819	N	0.125281	T	0.70090	0.3184	M	0.63428	1.95	0.09310	N	1	B;B;B	0.32693	0.38;0.38;0.226	B;B;B	0.29267	0.085;0.085;0.1	T	0.60627	-0.7226	10	0.72032	D	0.01	-0.3348	11.2996	0.49298	0.0:0.3534:0.6466:0.0	.	685;662;721	B4E2Q5;P37088;P37088-2	.;SCNNA_HUMAN;.	F	721;684;362;662;685	ENSP00000353292:S721F;ENSP00000351825:S684F;ENSP00000440876:S362F;ENSP00000228916:S662F;ENSP00000438739:S685F	ENSP00000228916:S662F	S	-	2	0	SCNN1A	6327325	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.471000	0.22100	0.933000	0.37291	0.555000	0.69702	TCC	.	.	.	none		0.672	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
KLRK1	22914	hgsc.bcm.edu	37	12	10539523	10539523	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:10539523T>C	ENST00000240618.6	-	3	267	c.127A>G	c.(127-129)Aaa>Gaa	p.K43E	KLRC4-KLRK1_ENST00000539300.1_3'UTR|RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Missense_Mutation_p.K43E	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	43					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CATTTGCTTTTGACTACTGGA	0.323																																					p.K43E		Atlas-SNP	.											.	.	.	.	0			c.A127G						PASS	.						207.0	186.0	193.0					12																	10539523		2203	4298	6501	SO:0001583	missense	0	exon8			TGCTTTTGACTAC	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.127A>G	chr12.hg19:g.10539523T>C	ENSP00000240618:p.Lys43Glu	47.0	0.0	.		85.0	32.0	.	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	hg19	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.445773	0.25987	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01474	4.85;4.85	4.24	1.81	0.25067	.	0.304503	0.23859	N	0.043877	T	0.01661	0.0053	L	0.36672	1.1	0.09310	N	1	B;B;B	0.26775	0.056;0.159;0.081	B;B;B	0.29524	0.029;0.103;0.028	T	0.46527	-0.9185	10	0.34782	T	0.22	.	4.666	0.12666	0.1788:0.0:0.2431:0.5781	.	43;24;43	Q8WZ67;Q1HEA1;P26718	.;.;NKG2D_HUMAN	E	43	ENSP00000240618:K43E;ENSP00000446003:K43E	ENSP00000240618:K43E	K	-	1	0	KLRK1	10430790	0.005000	0.15991	0.001000	0.08648	0.025000	0.11179	0.895000	0.28363	0.250000	0.21479	0.455000	0.32223	AAA	.	.	.	none		0.323	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
PTPRO	5800	hgsc.bcm.edu	37	12	15673198	15673198	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:15673198G>A	ENST00000281171.4	+	10	2173	c.1843G>A	c.(1843-1845)Gat>Aat	p.D615N	PTPRO_ENST00000348962.2_Missense_Mutation_p.D615N	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	615	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GACGTGGGGAGATCCAGAATT	0.478																																					p.D615N		Atlas-SNP	.											.	PTPRO	148	.	0			c.G1843A						PASS	.						138.0	124.0	129.0					12																	15673198		2203	4300	6503	SO:0001583	missense	5800	exon10			TGGGGAGATCCAG	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1843G>A	chr12.hg19:g.15673198G>A	ENSP00000281171:p.Asp615Asn	96.0	0.0	.		262.0	78.0	.	NM_002848	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	hg19	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956744	0.92726	.	.	ENSG00000151490	ENST00000281171;ENST00000348962	T;T	0.53640	3.8;0.61	5.2	5.2	0.72013	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.249218	0.27922	N	0.017316	T	0.41558	0.1164	N	0.19112	0.55	0.80722	D	1	P;P	0.41188	0.741;0.624	B;B	0.43658	0.426;0.245	T	0.44952	-0.9294	10	0.72032	D	0.01	.	17.0929	0.86627	0.0:0.0:1.0:0.0	.	615;615	Q16827-2;Q16827	.;PTPRO_HUMAN	N	615	ENSP00000281171:D615N;ENSP00000343434:D615N	ENSP00000281171:D615N	D	+	1	0	PTPRO	15564465	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.851000	0.92205	2.689000	0.91719	0.655000	0.94253	GAT	.	.	.	none		0.478	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
DDN	23109	hgsc.bcm.edu	37	12	49391677	49391677	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:49391677C>T	ENST00000421952.2	-	2	1003	c.982G>A	c.(982-984)Ggt>Agt	p.G328S	RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	328						cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						CTGTCGCTACCACTGTTCAGG	0.677																																					p.G328S		Atlas-SNP	.											.	DDN	54	.	0			c.G982A						PASS	.						46.0	53.0	51.0					12																	49391677		2203	4299	6502	SO:0001583	missense	23109	exon2			CGCTACCACTGTT	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.982G>A	chr12.hg19:g.49391677C>T	ENSP00000390590:p.Gly328Ser	20.0	0.0	.		53.0	11.0	.	NM_015086		Missense_Mutation	SNP	ENST00000421952.2	hg19	CCDS31791.2	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658359	0.67586	.	.	ENSG00000181418	ENST00000421952	T	0.44881	0.91	3.88	2.05	0.26809	.	0.148751	0.31601	N	0.007378	T	0.21387	0.0515	N	0.24115	0.695	0.09310	N	1	P	0.40909	0.732	B	0.31191	0.125	T	0.10776	-1.0615	10	0.42905	T	0.14	-3.234	7.9639	0.30087	0.0:0.798:0.0:0.202	.	328	O94850	DEND_HUMAN	S	328	ENSP00000390590:G328S	ENSP00000390590:G328S	G	-	1	0	DDN	47677944	0.000000	0.05858	0.001000	0.08648	0.743000	0.42351	0.617000	0.24359	0.617000	0.30160	0.561000	0.74099	GGT	.	.	.	none		0.677	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1		
FAM216A	29902	hgsc.bcm.edu	37	12	110906786	110906786	+	Missense_Mutation	SNP	C	C	T	rs202079205	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:110906786C>T	ENST00000377673.5	+	1	618	c.106C>T	c.(106-108)Ccg>Tcg	p.P36S	GPN3_ENST00000537466.2_5'Flank|GPN3_ENST00000228827.3_5'Flank|GPN3_ENST00000552180.1_5'UTR|GPN3_ENST00000543199.1_5'Flank	NM_013300.2	NP_037432.2	Q8WUB2	F216A_HUMAN	family with sequence similarity 216, member A	36																	TTCTGCAGAGCCGCCCGCTGT	0.771													C|||	12	0.00239617	0.0091	0.0	5008	,	,		13111	0.0		0.0	False		,,,				2504	0.0				p.P36S		Atlas-SNP	.											.	.	.	.	0			c.C106T						PASS	.	C	SER/PRO	24,3054		0,24,1515	2.0	2.0	2.0		106	3.3	0.1	12		2	0,6186		0,0,3093	yes	missense	C12orf24	NM_013300.2	74	0,24,4608	TT,TC,CC		0.0,0.7797,0.2591	probably-damaging	36/274	110906786	24,9240	1539	3093	4632	SO:0001583	missense	29902	exon1			GCAGAGCCGCCCG	U79274	CCDS31899.1	12q24.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000204856	ENSG00000204856			30180	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 24"""	C12orf24			Standard	NM_013300		Approved	HSU79274	uc001tqu.4	Q8WUB2	OTTHUMG00000169526	ENST00000377673.5:c.106C>T	chr12.hg19:g.110906786C>T	ENSP00000366901:p.Pro36Ser	1.0	0.0	.		25.0	12.0	.	NM_013300	A6NH30|Q99776	Missense_Mutation	SNP	ENST00000377673.5	hg19	CCDS31899.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171608	0.78452	0.007797	0.0	ENSG00000204856	ENST00000377673;ENST00000538285	T	0.51071	0.72	4.16	3.27	0.37495	.	0.000000	0.39544	N	0.001336	T	0.32645	0.0836	L	0.56769	1.78	0.27811	N	0.942126	B;B	0.30709	0.291;0.129	B;B	0.26693	0.072;0.031	T	0.41645	-0.9497	10	0.87932	D	0	-0.6948	9.2806	0.37727	0.0:0.8974:0.0:0.1026	.	36;36	F5GZE4;Q8WUB2	.;CL024_HUMAN	S	36	ENSP00000366901:P36S	ENSP00000366901:P36S	P	+	1	0	C12orf24	109391169	0.943000	0.32029	0.132000	0.22025	0.895000	0.52256	2.944000	0.49034	1.096000	0.41439	0.462000	0.41574	CCG	.	.	.	weak		0.771	FAM216A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404616.1	NM_013300	
PPTC7	160760	hgsc.bcm.edu	37	12	110969392	110969392	+	3'UTR	SNP	A	A	G	rs139110749	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:110969392A>G	ENST00000354300.3	-	0	6653				RAD9B_ENST00000409778.3_Missense_Mutation_p.K311R|RAD9B_ENST00000409300.1_3'UTR|RAD9B_ENST00000409425.1_3'UTR|RAD9B_ENST00000409246.1_3'UTR|RAD9B_ENST00000392672.4_Silent_p.K416K	NM_139283.1	NP_644812.1	Q8NI37	PPTC7_HUMAN	PTC7 protein phosphatase homolog (S. cerevisiae)							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|large_intestine(2)|lung(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	9						GCTGCAGGAAAGAATTTAATG	0.353																																					p.K416K		Atlas-SNP	.											.	RAD9B	50	.	0			c.A1248G						PASS	.						94.0	83.0	87.0					12																	110969392		1566	3582	5148	SO:0001624	3_prime_UTR_variant	144715	exon12			CAGGAAAGAATTT	AF385435	CCDS9149.1	12q24.11	2009-11-05				ENSG00000196850			30695	protein-coding gene	gene with protein product	"""T cell activation protein phosphatase 2C"""	609668				15177553	Standard	NM_139283		Approved	TA-PP2C	uc001trh.1	Q8NI37	OTTHUMG00000169529	ENST00000354300.3:c.*5450T>C	chr12.hg19:g.110969392A>G		12.0	0.0	.		27.0	9.0	.	NM_152442	B3KWC5|Q68DZ7|Q6UY82	Silent	SNP	ENST00000354300.3	hg19	CCDS9149.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.352501	0.41700	.	.	ENSG00000151164	ENST00000409778	T	0.19250	2.16	4.49	2.08	0.27032	.	155.184000	0.02530	U	0.093532	T	0.15609	0.0376	.	.	.	0.09310	N	1	B	0.26635	0.155	B	0.23574	0.047	T	0.21211	-1.0252	9	0.40728	T	0.16	14.2473	4.9792	0.14157	0.6246:0.1916:0.0:0.1837	.	311	B4DYM6	.	R	311	ENSP00000386697:K311R	ENSP00000386697:K311R	K	+	2	0	RAD9B	109453775	0.009000	0.17119	0.001000	0.08648	0.372000	0.29890	1.856000	0.39389	0.343000	0.23821	0.397000	0.26171	AAG	.	.	.	none		0.353	PPTC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404635.1	NM_139283	
RBM19	9904	hgsc.bcm.edu	37	12	114385205	114385205	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:114385205G>A	ENST00000545145.2	-	11	1419	c.1341C>T	c.(1339-1341)ttC>ttT	p.F447F	RBM19_ENST00000392561.3_Silent_p.F447F|RBM19_ENST00000261741.5_Silent_p.F447F	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	447	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TGAAGGTGATGAATGCAAAAC	0.602																																					p.F447F		Atlas-SNP	.											.	RBM19	117	.	0			c.C1341T						PASS	.						144.0	122.0	130.0					12																	114385205		2203	4300	6503	SO:0001819	synonymous_variant	9904	exon11			GGTGATGAATGCA	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1341C>T	chr12.hg19:g.114385205G>A		73.0	0.0	.		278.0	64.0	.	NM_001146699	A8K5X9|Q9BPY6|Q9UFN5	Silent	SNP	ENST00000545145.2	hg19	CCDS9172.1																																																																																			.	.	.	none		0.602	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
BRI3BP	140707	hgsc.bcm.edu	37	12	125509640	125509640	+	Silent	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:125509640C>A	ENST00000341446.8	+	3	511	c.420C>A	c.(418-420)tcC>tcA	p.S140S		NM_080626.5	NP_542193.3			BRI3 binding protein											large_intestine(1)|lung(8)|ovary(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)		GGTTCTTGTCCCTGACCCTGG	0.632																																					p.S140S		Atlas-SNP	.											.	BRI3BP	18	.	0			c.C420A						PASS	.						100.0	83.0	89.0					12																	125509640		2203	4300	6503	SO:0001819	synonymous_variant	140707	exon3			CTTGTCCCTGACC	AF284094	CCDS9262.1	12q24.1	2008-08-04			ENSG00000184992	ENSG00000184992			14251	protein-coding gene	gene with protein product		615627				11860200, 17765869	Standard	NM_080626		Approved	BNAS1, KG19, HCCR-2	uc001uha.1	Q8WY22	OTTHUMG00000168548	ENST00000341446.8:c.420C>A	chr12.hg19:g.125509640C>A		25.0	0.0	.		85.0	32.0	.	NM_080626		Silent	SNP	ENST00000341446.8	hg19	CCDS9262.1																																																																																			.	.	.	none		0.632	BRI3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400200.2	NM_080626	
N6AMT2	221143	hgsc.bcm.edu	37	13	21306119	21306119	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr13:21306119T>C	ENST00000382758.1	-	4	416	c.369A>G	c.(367-369)ccA>ccG	p.P123P	N6AMT2_ENST00000382754.4_Silent_p.P123P			Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2 (putative)	123						extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(3)|lung(3)	7		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GTAAGTCCAATGGATTATTGT	0.378																																					p.P123P		Atlas-SNP	.											.	N6AMT2	26	.	0			c.A369G						PASS	.						121.0	116.0	118.0					13																	21306119		2203	4300	6503	SO:0001819	synonymous_variant	221143	exon4			GTCCAATGGATTA	AK055408	CCDS9293.1	13q12.11	2006-12-14			ENSG00000150456	ENSG00000150456			27351	protein-coding gene	gene with protein product						12477932	Standard	NM_174928		Approved		uc001uno.1	Q8WVE0	OTTHUMG00000016519	ENST00000382758.1:c.369A>G	chr13.hg19:g.21306119T>C		83.0	0.0	.		82.0	37.0	.	NM_174928	B5G4V1	Silent	SNP	ENST00000382758.1	hg19	CCDS9293.1																																																																																			.	.	.	none		0.378	N6AMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044083.1	NM_174928	
FARP1	10160	hgsc.bcm.edu	37	13	99092299	99092299	+	Splice_Site	SNP	T	T	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr13:99092299T>A	ENST00000319562.6	+	22	2781		c.e22+2		FARP1_ENST00000595437.1_Splice_Site|FARP1_ENST00000376586.2_Splice_Site	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)						dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGCCGCCAGGTAACTCGGGAG	0.627																																					.		Atlas-SNP	.											.	FARP1	207	.	0			c.2516+2T>A						PASS	.						103.0	116.0	112.0					13																	99092299		2203	4300	6503	SO:0001630	splice_region_variant	10160	exon22			GCCAGGTAACTCG	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2516+2T>A	chr13.hg19:g.99092299T>A		27.0	0.0	.		70.0	13.0	.	NM_005766	Q5JVI9|Q6IQ29	Splice_Site	SNP	ENST00000319562.6	hg19	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843475	0.91197	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0308	0.64615	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	FARP1	97890300	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	5.986000	0.70563	1.917000	0.55516	0.533000	0.62120	.	.	.	.	none		0.627	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	Intron
ARHGEF40	55701	hgsc.bcm.edu	37	14	21543565	21543565	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr14:21543565G>C	ENST00000298694.4	+	4	1652	c.1525G>C	c.(1525-1527)Gac>Cac	p.D509H	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.D509H			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	509						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						AGGAAAAGGGGACAACATTCC	0.557																																					p.D509H		Atlas-SNP	.											.	ARHGEF40	84	.	0			c.G1525C						PASS	.						131.0	127.0	128.0					14																	21543565		2203	4300	6503	SO:0001583	missense	55701	exon4			AAAGGGGACAACA		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1525G>C	chr14.hg19:g.21543565G>C	ENSP00000298694:p.Asp509His	108.0	0.0	.		227.0	62.0	.	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	hg19	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	G	0.307	-0.970175	0.02232	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.02472	4.34;4.28	5.12	2.29	0.28610	.	0.113584	0.39210	N	0.001427	T	0.02230	0.0069	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.44329	-0.9335	10	0.40728	T	0.16	.	7.8371	0.29376	0.0851:0.308:0.6069:0.0	.	509;509	Q8TER5;G3V3N2	ARH40_HUMAN;.	H	509	ENSP00000298694:D509H;ENSP00000298693:D509H	ENSP00000298693:D509H	D	+	1	0	ARHGEF40	20613405	0.142000	0.22610	0.001000	0.08648	0.002000	0.02628	1.389000	0.34453	0.272000	0.22027	-0.225000	0.12378	GAC	.	.	.	none		0.557	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
CIPC	85457	hgsc.bcm.edu	37	14	77580238	77580238	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr14:77580238C>T	ENST00000361786.2	+	4	1094	c.777C>T	c.(775-777)ttC>ttT	p.F259F	RP11-463C8.4_ENST00000557752.1_Intron	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		259					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		GTCTGACCTTCGCTTCCCCCG	0.572																																					p.F259F		Atlas-SNP	.											KIAA1737,NS,carcinoma,0,1	KIAA1737	26	.	0			c.C777T						PASS	.						84.0	68.0	74.0					14																	77580238		2203	4300	6503	SO:0001819	synonymous_variant	85457	exon4			GACCTTCGCTTCC																												ENST00000361786.2:c.777C>T	chr14.hg19:g.77580238C>T		26.0	0.0	.		48.0	24.0	.	NM_033426	B2RCI1|Q8N389|Q8NDZ1	Silent	SNP	ENST00000361786.2	hg19	CCDS9855.1																																																																																			.	.	.	none		0.572	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414278.1		
ITPK1	3705	hgsc.bcm.edu	37	14	93408017	93408017	+	Silent	SNP	C	C	T	rs563090061	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr14:93408017C>T	ENST00000267615.6	-	11	1307	c.1134G>A	c.(1132-1134)gcG>gcA	p.A378A	ITPK1_ENST00000556603.2_Silent_p.A378A|ITPK1_ENST00000555495.1_Silent_p.A259A|ITPK1_ENST00000354313.3_Intron			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	378					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		CGGTGCCGCCCGCGTCGGCCT	0.736													C|||	4	0.000798722	0.0008	0.0014	5008	,	,		13386	0.001		0.0	False		,,,				2504	0.001				p.A378A		Atlas-SNP	.											.	ITPK1	53	.	0			c.G1134A						PASS	.						3.0	3.0	3.0					14																	93408017		1665	3314	4979	SO:0001819	synonymous_variant	3705	exon11			GCCGCCCGCGTCG	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.1134G>A	chr14.hg19:g.93408017C>T		0.0	0.0	.		14.0	12.0	.	NM_001142593	Q9BTL6|Q9H2E7	Silent	SNP	ENST00000267615.6	hg19	CCDS9907.1																																																																																			.	.	.	none		0.736	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
CASC5	57082	hgsc.bcm.edu	37	15	40915310	40915310	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:40915310G>T	ENST00000346991.5	+	11	3316	c.2926G>T	c.(2926-2928)Gtt>Ttt	p.V976F	CASC5_ENST00000527044.1_3'UTR|CASC5_ENST00000399668.2_Missense_Mutation_p.V950F			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	976	2 X 104 AA approximate repeats.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGATAATCATGTTGAACTAGA	0.378																																					p.V976F		Atlas-SNP	.											.	CASC5	269	.	0			c.G2926T						PASS	.						92.0	86.0	88.0					15																	40915310		1860	4104	5964	SO:0001583	missense	57082	exon11			AATCATGTTGAAC	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.2926G>T	chr15.hg19:g.40915310G>T	ENSP00000335463:p.Val976Phe	58.0	0.0	.		88.0	21.0	.	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	hg19	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757693	0.31137	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.16897	2.31;2.31	4.64	0.322	0.15888	.	0.547984	0.17535	N	0.170730	T	0.07503	0.0189	N	0.08118	0	0.09310	N	1	B;B;P	0.39352	0.101;0.009;0.669	B;B;B	0.34652	0.053;0.001;0.187	T	0.24621	-1.0155	10	0.62326	D	0.03	.	9.0014	0.36083	0.436:0.0:0.564:0.0	.	950;976;950	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	F	976;950;950	ENSP00000335463:V976F;ENSP00000382576:V950F	ENSP00000260369:V950F	V	+	1	0	CASC5	38702602	0.000000	0.05858	0.020000	0.16555	0.900000	0.52787	-0.061000	0.11693	0.051000	0.15978	0.557000	0.71058	GTT	.	.	.	none		0.378	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
TGM7	116179	hgsc.bcm.edu	37	15	43585144	43585145	+	Missense_Mutation	DNP	GC	GC	TT	rs267604217		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:43585144_43585145GC>TT	ENST00000452443.2	-	3	205_206	c.201_202GC>AA	c.(199-204)aaGCcg>aaAAcg	p.P68T		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	68					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	AGCTCTGACGGCTTGGGTCCTG	0.559																																					p.P68T|p.K67K		Atlas-SNP	.											.	TGM7	86	.	0			c.C202A|c.G201A						PASS	.																																			SO:0001583	missense	116179	exon3			CTGACGGCTTGGG|TGACGGCTTGGGT	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.201_202delinsTT	chr15.hg19:g.43585144_43585145delinsTT	ENSP00000389466:p.Pro68Thr	44.0	0.0	.		65.0|62.0	14.0	.	NM_052955		Missense_Mutation|Silent	SNP	ENST00000452443.2	hg19	CCDS32213.1																																																																																			.	.	.	none		0.559	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
HDC	3067	hgsc.bcm.edu	37	15	50535435	50535435	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:50535435C>T	ENST00000267845.3	-	11	1549	c.1147G>A	c.(1147-1149)Gaa>Aaa	p.E383K	HDC_ENST00000543581.1_Missense_Mutation_p.E350K|RN7SL494P_ENST00000461517.2_RNA	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		TTAGCCATTTCAGTACCCTGG	0.403																																					p.E383K	GBM(95;1627 1936 6910 9570)	Atlas-SNP	.											.	HDC	86	.	0			c.G1147A						PASS	.						65.0	65.0	65.0					15																	50535435		2196	4295	6491	SO:0001583	missense	3067	exon11			CCATTTCAGTACC		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1147G>A	chr15.hg19:g.50535435C>T	ENSP00000267845:p.Glu383Lys	106.0	0.0	.		155.0	62.0	.	NM_002112		Missense_Mutation	SNP	ENST00000267845.3	hg19	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043666	0.55003	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.39592	1.07;1.07	5.82	4.9	0.64082	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.280579	0.41605	N	0.000857	T	0.37972	0.1023	L	0.28694	0.88	0.58432	D	0.999998	P;P	0.35894	0.526;0.526	B;B	0.43508	0.422;0.307	T	0.10200	-1.0640	10	0.18276	T	0.48	-10.5182	14.7799	0.69756	0.0:0.9307:0.0:0.0693	.	350;383	B7ZM01;P19113	.;DCHS_HUMAN	K	383;350	ENSP00000267845:E383K;ENSP00000440252:E350K	ENSP00000267845:E383K	E	-	1	0	HDC	48322727	0.999000	0.42202	0.897000	0.35233	0.970000	0.65996	3.899000	0.56288	1.462000	0.47948	0.467000	0.42956	GAA	.	.	.	none		0.403	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
MYO5C	55930	hgsc.bcm.edu	37	15	52500781	52500781	+	Silent	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:52500781G>T	ENST00000261839.7	-	36	4517	c.4356C>A	c.(4354-4356)ctC>ctA	p.L1452L	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1452	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TCAGGCAATTGAGAAAATGAC	0.438											OREG0023129	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1452L		Atlas-SNP	.											.	MYO5C	162	.	0			c.C4356A						PASS	.						105.0	107.0	106.0					15																	52500781		1889	4099	5988	SO:0001819	synonymous_variant	55930	exon36			GCAATTGAGAAAA	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4356C>A	chr15.hg19:g.52500781G>T		58.0	0.0	.	985	108.0	9.0	.	NM_018728	Q6P1W8	Silent	SNP	ENST00000261839.7	hg19	CCDS42036.1																																																																																			.	.	.	none		0.438	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
CSPG4	1464	hgsc.bcm.edu	37	15	75982866	75982866	+	Silent	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:75982866G>C	ENST00000308508.5	-	3	632	c.540C>G	c.(538-540)ctC>ctG	p.L180L		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	180	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GAGGCCGGAGGAGGCTGCGGC	0.647																																					p.L180L		Atlas-SNP	.											.	CSPG4	175	.	0			c.C540G						PASS	.						35.0	40.0	38.0					15																	75982866		2147	4173	6320	SO:0001819	synonymous_variant	1464	exon3			CCGGAGGAGGCTG	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.540C>G	chr15.hg19:g.75982866G>C		43.0	0.0	.		62.0	20.0	.	NM_001897	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	hg19	CCDS10284.1																																																																																			.	.	.	none		0.647	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
HMOX2	3163	hgsc.bcm.edu	37	16	4557977	4557977	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:4557977C>T	ENST00000570646.1	+	4	1073	c.468C>T	c.(466-468)cgC>cgT	p.R156R	HMOX2_ENST00000575120.1_Silent_p.R127R|HMOX2_ENST00000414777.1_Silent_p.R156R|HMOX2_ENST00000406590.2_Silent_p.R156R|HMOX2_ENST00000458134.3_Silent_p.R156R|HMOX2_ENST00000219700.6_Silent_p.R156R|HMOX2_ENST00000398595.3_Silent_p.R156R	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	156					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						CATACACCCGCTACATGGGGG	0.617																																					p.R156R		Atlas-SNP	.											.	HMOX2	22	.	0			c.C468T						PASS	.						39.0	43.0	41.0					16																	4557977		2197	4300	6497	SO:0001819	synonymous_variant	3163	exon4			CACCCGCTACATG		CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.468C>T	chr16.hg19:g.4557977C>T		80.0	0.0	.		216.0	85.0	.	NM_001127205	A8MT35|D3DUD5|I3L430|O60605	Silent	SNP	ENST00000570646.1	hg19	CCDS10517.1																																																																																			.	.	.	none		0.617	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251636.2		
LAT	27040	hgsc.bcm.edu	37	16	28996234	28996234	+	5'Flank	SNP	G	G	A	rs572112079	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:28996234G>A	ENST00000360872.5	+	0	0				LAT_ENST00000454369.2_5'Flank|LAT_ENST00000354453.4_5'Flank|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000395461.3_Missense_Mutation_p.A18T|LAT_ENST00000395456.2_5'Flank|LAT_ENST00000564277.1_5'Flank|LAT_ENST00000566177.1_5'Flank			O43561	LAT_HUMAN	linker for activation of T cells						blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CTTGGGGGGGGCCAGCAGACC	0.731																																					p.A18T		Atlas-SNP	.											.	LAT	22	.	0			c.G52A						PASS	.						7.0	8.0	8.0					16																	28996234		690	1584	2274	SO:0001631	upstream_gene_variant	27040	exon1			GGGGGGGCCAGCA	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761		chr16.hg19:g.28996234G>A	Exception_encountered	16.0	0.0	.		91.0	29.0	.	NM_001014989	B7WPI0|C7C5T6|G5E9K3|O43919	Missense_Mutation	SNP	ENST00000360872.5	hg19	CCDS10647.1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.247385	0.22880	.	.	ENSG00000213658	ENST00000395461	.	.	.	2.5	-1.56	0.08532	.	.	.	.	.	T	0.16128	0.0388	N	0.08118	0	0.19300	N	0.999973	B	0.02656	0.0	B	0.01281	0.0	T	0.21655	-1.0239	8	0.87932	D	0	-0.7971	3.9972	0.09564	0.1852:0.4888:0.326:0.0	.	18	B7WPI0	.	T	18	.	ENSP00000378845:A18T	A	+	1	0	LAT	28903735	0.000000	0.05858	0.002000	0.10522	0.036000	0.12997	-0.751000	0.04803	-0.063000	0.13065	-0.264000	0.10439	GCC	.	.	.	none		0.731	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
PRRT2	112476	hgsc.bcm.edu	37	16	29825753	29825753	+	Missense_Mutation	SNP	A	A	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:29825753A>C	ENST00000358758.7	+	3	1262	c.979A>C	c.(979-981)Atc>Ctc	p.I327L	AC009133.20_ENST00000569039.1_RNA|PAGR1_ENST00000609618.1_5'Flank|PRRT2_ENST00000567659.1_Missense_Mutation_p.I327L|PAGR1_ENST00000320330.6_5'Flank|AC009133.14_ENST00000569981.1_RNA|PRRT2_ENST00000300797.6_3'UTR	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	327					neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						GGGAGTCCTCATCATCATCGC	0.642																																					p.I327L		Atlas-SNP	.											.	PRRT2	28	.	0			c.A979C						PASS	.						73.0	81.0	78.0					16																	29825753		2197	4300	6497	SO:0001583	missense	112476	exon3			GTCCTCATCATCA	BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.979A>C	chr16.hg19:g.29825753A>C	ENSP00000351608:p.Ile327Leu	18.0	0.0	.		59.0	18.0	.	NM_001256442	A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Missense_Mutation	SNP	ENST00000358758.7	hg19	CCDS10654.1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.815687	0.70912	.	.	ENSG00000167371	ENST00000358758	D	0.85339	-1.97	3.71	3.71	0.42584	.	0.745808	0.12408	N	0.471504	D	0.86410	0.5926	N	0.25380	0.74	0.80722	D	1	D;D	0.63046	0.992;0.99	D;D	0.76071	0.987;0.978	T	0.82796	-0.0280	10	0.40728	T	0.16	-8.8013	10.7234	0.46052	1.0:0.0:0.0:0.0	.	327;327	Q7Z6L0;Q7Z6L0-2	PRRT2_HUMAN;.	L	327	ENSP00000351608:I327L	ENSP00000351608:I327L	I	+	1	0	PRRT2	29733254	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.922000	0.48860	1.481000	0.48307	0.372000	0.22366	ATC	.	.	.	none		0.642	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255161.3	NM_145239	
DHX38	9785	hgsc.bcm.edu	37	16	72141342	72141342	+	Missense_Mutation	SNP	G	G	A	rs374391366		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:72141342G>A	ENST00000268482.3	+	20	3213	c.2704G>A	c.(2704-2706)Ggg>Agg	p.G902R	DHX38_ENST00000536867.1_Missense_Mutation_p.G214R	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	902	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				CAAGTCCCTCGGGGTGCAGGA	0.597																																					p.G902R	Melanoma(97;711 1442 7855 13832 28836)	Atlas-SNP	.											.	DHX38	91	.	0			c.G2704A						PASS	.	G	ARG/GLY	2,4394	4.2+/-10.8	0,2,2196	42.0	37.0	38.0		2704	5.3	1.0	16		38	0,8600		0,0,4300	no	missense	DHX38	NM_014003.3	125	0,2,6496	AA,AG,GG		0.0,0.0455,0.0154	possibly-damaging	902/1228	72141342	2,12994	2198	4300	6498	SO:0001583	missense	9785	exon20			TCCCTCGGGGTGC	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2704G>A	chr16.hg19:g.72141342G>A	ENSP00000268482:p.Gly902Arg	25.0	0.0	.		118.0	5.0	.	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	hg19	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651253	0.88056	4.55E-4	0.0	ENSG00000140829	ENST00000268482;ENST00000536867	T;T	0.04156	3.69;3.69	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.125696	0.52532	D	0.000067	T	0.14743	0.0356	M	0.85462	2.755	0.80722	D	1	D;P	0.53885	0.963;0.936	B;P	0.45449	0.429;0.481	T	0.01604	-1.1314	10	0.72032	D	0.01	.	18.7055	0.91637	0.0:0.0:1.0:0.0	.	214;902	B4DVG8;Q92620	.;PRP16_HUMAN	R	902;214	ENSP00000268482:G902R;ENSP00000437898:G214R	ENSP00000268482:G902R	G	+	1	0	DHX38	70698843	1.000000	0.71417	0.966000	0.40874	0.973000	0.67179	9.190000	0.94934	2.745000	0.94114	0.655000	0.94253	GGG	.	.	.	weak		0.597	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
MYO1D	4642	hgsc.bcm.edu	37	17	31098169	31098169	+	Missense_Mutation	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:31098169A>G	ENST00000318217.5	-	6	992	c.688T>C	c.(688-690)Tat>Cat	p.Y230H	MYO1D_ENST00000579584.1_Missense_Mutation_p.Y230H|MYO1D_ENST00000583621.1_Missense_Mutation_p.Y230H|MYO1D_ENST00000394649.4_Missense_Mutation_p.Y142H	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	230	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			ACATGAATATAGTTGTAGGAT	0.348																																					p.Y230H		Atlas-SNP	.											.	MYO1D	93	.	0			c.T688C						PASS	.						104.0	105.0	105.0					17																	31098169		2203	4300	6503	SO:0001583	missense	4642	exon6			GAATATAGTTGTA	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.688T>C	chr17.hg19:g.31098169A>G	ENSP00000324527:p.Tyr230His	64.0	0.0	.		87.0	4.0	.	NM_015194	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	hg19	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.637013	0.87760	.	.	ENSG00000176658	ENST00000318217	D	0.91124	-2.79	5.82	5.82	0.92795	Myosin head, motor domain (2);	0.000000	0.36134	U	0.002776	D	0.96941	0.9001	H	0.97265	3.97	0.58432	D	0.999999	D;D	0.67145	0.996;0.993	D;D	0.71870	0.966;0.975	D	0.98122	1.0426	10	0.87932	D	0	.	14.1486	0.65367	1.0:0.0:0.0:0.0	.	141;230	Q7Z3N6;O94832	.;MYO1D_HUMAN	H	230	ENSP00000324527:Y230H	ENSP00000324527:Y230H	Y	-	1	0	MYO1D	28122282	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	8.730000	0.91510	2.232000	0.73038	0.528000	0.53228	TAT	.	.	.	none		0.348	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
LYZL6	57151	hgsc.bcm.edu	37	17	34263772	34263772	+	Missense_Mutation	SNP	C	C	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:34263772C>G	ENST00000585556.1	-	4	698	c.364G>C	c.(364-366)Ggg>Cgg	p.G122R	LYZL6_ENST00000492340.2_5'UTR|LYZL6_ENST00000394523.3_Missense_Mutation_p.G122R|LYZL6_ENST00000293274.4_Missense_Mutation_p.G122R			O75951	LYZL6_HUMAN	lysozyme-like 6	122					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTGTTCATCCCCCGTGCTCCG	0.572																																					p.G122R		Atlas-SNP	.											.	LYZL6	18	.	0			c.G364C						PASS	.						114.0	103.0	107.0					17																	34263772		2203	4300	6503	SO:0001583	missense	57151	exon3			TCATCCCCCGTGC	AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.364G>C	chr17.hg19:g.34263772C>G	ENSP00000468094:p.Gly122Arg	20.0	0.0	.		115.0	61.0	.	NM_020426	Q6UW30	Missense_Mutation	SNP	ENST00000585556.1	hg19	CCDS11302.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733915	0.30684	.	.	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.75589	-0.95;-0.95	4.89	3.9	0.45041	Lysozyme-like domain (1);	0.000000	0.64402	D	0.000001	D	0.88273	0.6392	M	0.93462	3.42	0.09310	N	0.999991	D	0.89917	1.0	D	0.97110	1.0	T	0.81048	-0.1109	10	0.87932	D	0	-6.5656	10.8134	0.46559	0.1893:0.8107:0.0:0.0	.	122	O75951	LYZL6_HUMAN	R	122	ENSP00000293274:G122R;ENSP00000378031:G122R	ENSP00000293274:G122R	G	-	1	0	LYZL6	31287885	0.102000	0.21896	0.008000	0.14137	0.071000	0.16799	1.597000	0.36729	1.168000	0.42723	0.561000	0.74099	GGG	.	.	.	none		0.572	LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256578.2	NM_020426	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274238	39274238	+	Silent	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:39274238A>G	ENST00000391413.2	-	1	368	c.330T>C	c.(328-330)tgT>tgC	p.C110C		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	110	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agctggggcgacagcagctgg	0.652																																					p.C110C		Atlas-SNP	.											.	KRTAP4-11	94	.	0			c.T330C						PASS	.						5.0	9.0	8.0					17																	39274238		657	1550	2207	SO:0001819	synonymous_variant	653240	exon1			GGGGCGACAGCAG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.330T>C	chr17.hg19:g.39274238A>G		27.0	0.0	.		116.0	14.0	.	NM_033059	A0AUY2	Silent	SNP	ENST00000391413.2	hg19	CCDS45675.1																																																																																			.	.	.	none		0.652	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-12	83755	hgsc.bcm.edu	37	17	39280069	39280069	+	Silent	SNP	G	G	A	rs374262239		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:39280069G>A	ENST00000394014.1	-	1	350	c.306C>T	c.(304-306)cgC>cgT	p.R102R		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	102	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCAGCTGGGGCGGCAGCAGG	0.667																																					p.R102R		Atlas-SNP	.											.	KRTAP4-12	32	.	0			c.C306T						PASS	.	G		44,4314		0,44,2135	38.0	44.0	42.0		306	-2.5	0.0	17		42	0,8532		0,0,4266	no	coding-synonymous	KRTAP4-12	NM_031854.2		0,44,6401	AA,AG,GG		0.0,1.0096,0.3413		102/202	39280069	44,12846	2179	4266	6445	SO:0001819	synonymous_variant	83755	exon1			GCTGGGGCGGCAG	AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.306C>T	chr17.hg19:g.39280069G>A		13.0	0.0	.		197.0	20.0	.	NM_031854	A3KMC5|Q495I0	Silent	SNP	ENST00000394014.1	hg19	CCDS32649.1																																																																																			.	.	.	weak		0.667	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257777.1		
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296467	39296467	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:39296467T>C	ENST00000345847.4	-	1	272	c.273A>G	c.(271-273)agA>agG	p.R91R		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	91	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						AGCACTGGGGTCTGCAGCAGC	0.657																																					p.R91R		Atlas-SNP	.											.	KRTAP4-6	46	.	0			c.A273G						PASS	.																																			SO:0001819	synonymous_variant	81871	exon1			CTGGGGTCTGCAG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.273A>G	chr17.hg19:g.39296467T>C		15.0	0.0	.		131.0	9.0	.	NM_030976	Q9BYR1	Silent	SNP	ENST00000345847.4	hg19	CCDS54125.1																																																																																			.	.	.	none		0.657	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
TUBG1	7283	hgsc.bcm.edu	37	17	40765685	40765685	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:40765685C>T	ENST00000251413.3	+	7	689	c.627C>T	c.(625-627)gcC>gcT	p.A209A		NM_001070.4	NP_001061.2	P23258	TBG1_HUMAN	tubulin, gamma 1	209					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic spindle organization (GO:0000212)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	apical part of cell (GO:0045177)|cell leading edge (GO:0031252)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)|polar microtubule (GO:0005827)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A209A(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Vinblastine(DB00570)	ACAACACAGCCCTGAACCGGA	0.562																																					p.A209A	Colon(20;114 698 11420 22864)	Atlas-SNP	.											TUBG1,colon,carcinoma,0,1	TUBG1	25	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C627T						PASS	.						176.0	166.0	169.0					17																	40765685		2203	4300	6503	SO:0001819	synonymous_variant	7283	exon7			CACAGCCCTGAAC	BC000619	CCDS11433.1	17q21.31	2010-03-15	2000-01-20		ENSG00000131462	ENSG00000131462		"""Tubulins"""	12417	protein-coding gene	gene with protein product		191135	"""tubulin, gamma polypeptide"""	TUBG		1904010	Standard	NM_001070		Approved	TUBGCP1	uc002ian.3	P23258		ENST00000251413.3:c.627C>T	chr17.hg19:g.40765685C>T		65.0	0.0	.		200.0	8.0	.	NM_001070	Q53X79|Q9BW59	Silent	SNP	ENST00000251413.3	hg19	CCDS11433.1																																																																																			.	.	.	none		0.562	TUBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450548.1	NM_001070	
SOST	50964	hgsc.bcm.edu	37	17	41835944	41835944	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:41835944T>C	ENST00000301691.2	-	1	212	c.166A>G	c.(166-168)Atg>Gtg	p.M56V		NM_025237.2	NP_079513.1	Q9BQB4	SOST_HUMAN	sclerostin	56					cellular response to parathyroid hormone stimulus (GO:0071374)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|response to mechanical stimulus (GO:0009612)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(3)|prostate(1)	6		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		GCCCGGTTCATGGTCTTGTTG	0.597																																					p.M56V		Atlas-SNP	.											.	SOST	19	.	0			c.A166G						PASS	.						57.0	54.0	55.0					17																	41835944		2203	4300	6503	SO:0001583	missense	50964	exon1			GGTTCATGGTCTT	AF326736	CCDS11468.1	17q12-q21	2014-06-28	2010-04-28			ENSG00000167941			13771	protein-coding gene	gene with protein product		605740	"""sclerosteosis"""			11179006, 11181578	Standard	NM_025237		Approved	VBCH	uc002iec.1	Q9BQB4		ENST00000301691.2:c.166A>G	chr17.hg19:g.41835944T>C	ENSP00000301691:p.Met56Val	22.0	0.0	.		87.0	26.0	.	NM_025237	Q495N9	Missense_Mutation	SNP	ENST00000301691.2	hg19	CCDS11468.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.155167	0.57259	.	.	ENSG00000167941	ENST00000301691	T	0.76578	-1.03	4.26	3.15	0.36227	.	0.404445	0.25642	N	0.029277	T	0.67702	0.2921	L	0.55481	1.735	0.35701	D	0.815622	B	0.33171	0.4	B	0.24394	0.053	T	0.69756	-0.5059	10	0.48119	T	0.1	-0.6649	8.7222	0.34447	0.1693:0.0:0.0:0.8307	.	56	Q9BQB4	SOST_HUMAN	V	56	ENSP00000301691:M56V	ENSP00000301691:M56V	M	-	1	0	SOST	39191470	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.993000	0.49425	0.648000	0.30732	0.454000	0.30748	ATG	.	.	.	none		0.597	SOST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453502.1	NM_025237	
HDAC5	10014	hgsc.bcm.edu	37	17	42171119	42171119	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:42171119G>A	ENST00000393622.2	-	4	509	c.178C>T	c.(178-180)Cgg>Tgg	p.R60W	HDAC5_ENST00000586802.1_Missense_Mutation_p.R60W|HDAC5_ENST00000336057.5_Missense_Mutation_p.R60W|HDAC5_ENST00000225983.6_Missense_Mutation_p.R61W	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	60					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		AGAGCCCCCCGTAGCTCCACA	0.667																																					p.R61W		Atlas-SNP	.											HDAC5,NS,carcinoma,0,1	HDAC5	67	.	0			c.C181T						PASS	.						13.0	15.0	15.0					17																	42171119		2197	4295	6492	SO:0001583	missense	10014	exon4			CCCCCCGTAGCTC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.178C>T	chr17.hg19:g.42171119G>A	ENSP00000377244:p.Arg60Trp	26.0	0.0	.		156.0	73.0	.	NM_001015053	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	ENST00000393622.2	hg19	CCDS45696.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604577	0.66445	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.50001	0.78;0.78;0.76	4.14	4.14	0.48551	.	0.240511	0.26859	N	0.022121	T	0.56891	0.2016	L	0.32530	0.975	0.42561	D	0.993142	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.69654	0.965;0.924;0.965;0.924	T	0.63189	-0.6693	10	0.87932	D	0	-23.2017	15.156	0.72743	0.0:0.0:1.0:0.0	.	60;60;61;60	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	W	61;60;60	ENSP00000225983:R61W;ENSP00000377244:R60W;ENSP00000337290:R60W	ENSP00000225983:R61W	R	-	1	2	HDAC5	39526645	0.996000	0.38824	0.992000	0.48379	0.875000	0.50365	3.362000	0.52314	1.858000	0.53909	0.462000	0.41574	CGG	.	.	.	none		0.667	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053	
RALBP1	10928	hgsc.bcm.edu	37	18	9524725	9524725	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr18:9524725C>T	ENST00000019317.4	+	5	1410	c.1187C>T	c.(1186-1188)gCg>gTg	p.A396V	RALBP1_ENST00000383432.3_Missense_Mutation_p.A396V			Q15311	RBP1_HUMAN	ralA binding protein 1	396					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	GAGACCCAGGCGGGCATCAAG	0.557																																					p.A396V		Atlas-SNP	.											RALBP1,NS,neuroblastoma,0,1	RALBP1	48	.	0			c.C1187T						PASS	.						42.0	36.0	38.0					18																	9524725		2203	4300	6503	SO:0001583	missense	10928	exon5			CCCAGGCGGGCAT	L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1187C>T	chr18.hg19:g.9524725C>T	ENSP00000019317:p.Ala396Val	64.0	1.0	.		73.0	6.0	.	NM_006788	D3DUI0	Missense_Mutation	SNP	ENST00000019317.4	hg19	CCDS11845.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.472202	0.43942	.	.	ENSG00000017797	ENST00000019317;ENST00000383432	T;T	0.10763	2.84;2.84	5.51	3.42	0.39159	.	0.141251	0.64402	D	0.000006	T	0.06142	0.0159	N	0.14661	0.345	0.41488	D	0.988201	B	0.23650	0.089	B	0.18871	0.023	T	0.32079	-0.9920	10	0.51188	T	0.08	0.7672	7.3696	0.26794	0.6491:0.2443:0.0:0.1066	.	396	Q15311	RBP1_HUMAN	V	396	ENSP00000019317:A396V;ENSP00000372924:A396V	ENSP00000019317:A396V	A	+	2	0	RALBP1	9514725	1.000000	0.71417	0.749000	0.31150	0.410000	0.31052	6.100000	0.71473	0.640000	0.30582	-0.140000	0.14226	GCG	.	.	.	none		0.557	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254479.1	NM_006788	
OR7E24	26648	hgsc.bcm.edu	37	19	9362181	9362181	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:9362181G>C	ENST00000456448.1	+	1	576	c.462G>C	c.(460-462)atG>atC	p.M154I		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						GAATCATCATGAACCCACGCC	0.443																																					p.M154I		Atlas-SNP	.											.	OR7E24	48	.	0			c.G462C						PASS	.						130.0	144.0	139.0					19																	9362181		2193	4296	6489	SO:0001583	missense	26648	exon1			CATCATGAACCCA	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.462G>C	chr19.hg19:g.9362181G>C	ENSP00000387523:p.Met154Ile	51.0	0.0	.		124.0	36.0	.	NM_001079935	B9EJD9|Q9UPJ1	Missense_Mutation	SNP	ENST00000456448.1	hg19	CCDS45955.1	.	.	.	.	.	.	.	.	.	.	g	10.46	1.356506	0.24598	.	.	ENSG00000237521	ENST00000456448	T	0.00551	6.65	2.39	2.39	0.29439	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00906	0.0030	M	0.80847	2.515	0.28275	N	0.924234	B	0.19706	0.038	B	0.16289	0.015	T	0.12293	-1.0553	9	0.66056	D	0.02	.	11.6917	0.51519	0.0:0.0:1.0:0.0	.	154	Q6IFN5	O7E24_HUMAN	I	154	ENSP00000387523:M154I	ENSP00000387523:M154I	M	+	3	0	OR7E24	9223181	0.999000	0.42202	0.492000	0.27490	0.028000	0.11728	2.571000	0.45990	1.353000	0.45828	0.436000	0.28706	ATG	.	.	.	none		0.443	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1		
MAN2B1	4125	hgsc.bcm.edu	37	19	12760979	12760979	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:12760979G>A	ENST00000456935.2	-	17	2144	c.2104C>T	c.(2104-2106)Cgc>Tgc	p.R702C	CTD-2192J16.22_ENST00000597692.1_5'Flank|MAN2B1_ENST00000221363.4_Missense_Mutation_p.R701C	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	702					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGGTACAGGCGAACCACCTGG	0.627																																					p.R702C		Atlas-SNP	.											.	MAN2B1	91	.	0			c.C2104T						PASS	.						132.0	111.0	118.0					19																	12760979		2203	4300	6503	SO:0001583	missense	4125	exon17			ACAGGCGAACCAC		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2104C>T	chr19.hg19:g.12760979G>A	ENSP00000395473:p.Arg702Cys	43.0	0.0	.		166.0	8.0	.	NM_000528	G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	ENST00000456935.2	hg19	CCDS32919.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667589	0.88348	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.86097	-2.07;-2.07	4.91	4.91	0.64330	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.45126	D	0.000392	D	0.94565	0.8249	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95872	0.8892	10	0.87932	D	0	-28.1246	15.638	0.76970	0.0:0.0:1.0:0.0	.	701;702	G5E928;O00754	.;MA2B1_HUMAN	C	702;641;701	ENSP00000395473:R702C;ENSP00000221363:R701C	ENSP00000221363:R701C	R	-	1	0	MAN2B1	12621979	1.000000	0.71417	0.999000	0.59377	0.834000	0.47266	7.042000	0.76565	2.564000	0.86499	0.555000	0.69702	CGC	.	.	.	none		0.627	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		
ZNF571	51276	hgsc.bcm.edu	37	19	38056037	38056037	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:38056037G>A	ENST00000328550.2	-	4	1392	c.1293C>T	c.(1291-1293)ggC>ggT	p.G431G	ZNF571-AS1_ENST00000589802.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF540_ENST00000592533.1_Intron|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571_ENST00000590751.1_Intron|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571_ENST00000451802.2_Silent_p.G431G|ZNF571_ENST00000593133.1_Silent_p.G431G|ZNF571_ENST00000358744.3_Silent_p.G431G|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA			Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	25			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAAGTTGTTTGCCACAAATAA	0.363																																					p.G431G		Atlas-SNP	.											.	ZNF571	54	.	0			c.C1293T						PASS	.						48.0	52.0	51.0					19																	38056037		2203	4299	6502	SO:0001819	synonymous_variant	51276	exon4			TTGTTTGCCACAA	AF161544	CCDS12505.1	19q13.12	2013-09-20			ENSG00000180479	ENSG00000180479		"""Zinc fingers, C2H2-type"", ""-"""	25000	protein-coding gene	gene with protein product						11042152	Standard	XM_005258977		Approved	HSPC059	uc002ogt.3	Q7Z3V5	OTTHUMG00000182016	ENST00000328550.2:c.1293C>T	chr19.hg19:g.38056037G>A		66.0	0.0	.		34.0	20.0	.	NM_016536	Q2HIY0|Q3ZCU3|Q9NZX7	Silent	SNP	ENST00000328550.2	hg19	CCDS12505.1																																																																																			.	.	.	none		0.363	ZNF571-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458669.1	NM_016536	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48183862	48183862	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:48183862G>C	ENST00000396720.3	+	6	1629	c.1435G>C	c.(1435-1437)Gcg>Ccg	p.A479P	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	479										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		TGGCGCCCCGGCGGTCCAGCT	0.692																																					p.A479P		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.G1435C						PASS	.						16.0	21.0	19.0					19																	48183862		2061	4175	6236	SO:0001583	missense	29998	exon6			GCCCCGGCGGTCC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.1435G>C	chr19.hg19:g.48183862G>C	ENSP00000379946:p.Ala479Pro	1.0	0.0	.		44.0	12.0	.	NM_015711	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	hg19	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	G	2.717	-0.267452	0.05754	.	.	ENSG00000063169	ENST00000396720	T	0.38722	1.12	4.7	-0.598	0.11649	.	.	.	.	.	T	0.40862	0.1134	L	0.38531	1.155	0.27198	N	0.960237	D	0.53885	0.963	P	0.56042	0.79	T	0.32295	-0.9912	9	0.31617	T	0.26	.	6.572	0.22543	0.2611:0.0:0.6073:0.1316	.	479	Q9NZM4	GSCR1_HUMAN	P	479	ENSP00000379946:A479P	ENSP00000379946:A479P	A	+	1	0	GLTSCR1	52875674	0.160000	0.22878	0.002000	0.10522	0.054000	0.15201	0.417000	0.21214	0.077000	0.16863	0.491000	0.48974	GCG	.	.	.	none		0.692	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
PRR12	57479	hgsc.bcm.edu	37	19	50100554	50100554	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:50100554G>A	ENST00000418929.2	+	4	2974	c.2962G>A	c.(2962-2964)Gat>Aat	p.D988N		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCCTGCTTATGATCCCTATGG	0.736																																					p.D988N		Atlas-SNP	.											.	PRR12	157	.	0			c.G2962A						PASS	.						3.0	4.0	4.0					19																	50100554		1585	3699	5284	SO:0001583	missense	57479	exon4			GCTTATGATCCCT	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2962G>A	chr19.hg19:g.50100554G>A	ENSP00000394510:p.Asp988Asn	0.0	0.0	.		36.0	26.0	.	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	hg19	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231566	0.39399	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	T	0.24350	1.86	4.79	4.79	0.61399	.	0.000000	0.45126	D	0.000382	T	0.37571	0.1008	L	0.38175	1.15	0.45690	D	0.998604	D	0.89917	1.0	D	0.87578	0.998	T	0.03473	-1.1033	10	0.13108	T	0.6	-21.245	14.8476	0.70272	0.0:0.0:1.0:0.0	.	988	Q9ULL5-3	.	N	988;168;168	ENSP00000394510:D988N	ENSP00000246798:D168N	D	+	1	0	PRR12	54792366	0.986000	0.35501	0.979000	0.43373	0.599000	0.36880	2.157000	0.42320	2.476000	0.83614	0.491000	0.48974	GAT	.	.	.	none		0.736	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
GPR32	2854	hgsc.bcm.edu	37	19	51274070	51274070	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:51274070T>C	ENST00000270590.4	+	1	350	c.213T>C	c.(211-213)cgT>cgC	p.R71R		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	71					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CTGTCTTCCGTATGGCACGCA	0.572																																					p.R71R	Esophageal Squamous(113;152 1581 5732 15840 44398)	Atlas-SNP	.											.	GPR32	68	.	0			c.T213C						PASS	.						225.0	169.0	188.0					19																	51274070		2203	4300	6503	SO:0001819	synonymous_variant	2854	exon1			CTTCCGTATGGCA	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.213T>C	chr19.hg19:g.51274070T>C		57.0	0.0	.		158.0	8.0	.	NM_001506	Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	hg19	CCDS12801.1																																																																																			.	.	.	none		0.572	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
GPR32	2854	hgsc.bcm.edu	37	19	51274076	51274076	+	Silent	SNP	A	A	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:51274076A>C	ENST00000270590.4	+	1	356	c.219A>C	c.(217-219)gcA>gcC	p.A73A		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	73					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TCCGTATGGCACGCACGGTCT	0.572																																					p.A73A	Esophageal Squamous(113;152 1581 5732 15840 44398)	Atlas-SNP	.											.	GPR32	68	.	0			c.A219C						PASS	.						215.0	162.0	180.0					19																	51274076		2203	4300	6503	SO:0001819	synonymous_variant	2854	exon1			TATGGCACGCACG	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.219A>C	chr19.hg19:g.51274076A>C		55.0	0.0	.		164.0	10.0	.	NM_001506	Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	hg19	CCDS12801.1																																																																																			.	.	.	none		0.572	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
GPR32	2854	hgsc.bcm.edu	37	19	51274184	51274184	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:51274184C>T	ENST00000270590.4	+	1	464	c.327C>T	c.(325-327)ctC>ctT	p.L109L		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	109					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		AGTGGCTCCTCGGAGAGTGGG	0.527																																					p.L109L	Esophageal Squamous(113;152 1581 5732 15840 44398)	Atlas-SNP	.											.	GPR32	68	.	0			c.C327T						PASS	.						135.0	123.0	127.0					19																	51274184		2203	4300	6503	SO:0001819	synonymous_variant	2854	exon1			GCTCCTCGGAGAG	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.327C>T	chr19.hg19:g.51274184C>T		44.0	0.0	.		129.0	6.0	.	NM_001506	Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	hg19	CCDS12801.1																																																																																			.	.	.	none		0.527	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
LRRN4	164312	hgsc.bcm.edu	37	20	6033147	6033147	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:6033147T>C	ENST00000378858.4	-	2	523	c.299A>G	c.(298-300)cAg>cGg	p.Q100R		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	100					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						CACCTGCAGCTGCTCCAGGTG	0.731																																					p.Q100R		Atlas-SNP	.											.	LRRN4	54	.	0			c.A299G						PASS	.						6.0	8.0	7.0					20																	6033147		2113	4185	6298	SO:0001583	missense	164312	exon2			TGCAGCTGCTCCA	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.299A>G	chr20.hg19:g.6033147T>C	ENSP00000368135:p.Gln100Arg	0.0	0.0	.		31.0	13.0	.	NM_152611	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	hg19	CCDS13097.1	.	.	.	.	.	.	.	.	.	.	T	1.702	-0.501239	0.04261	.	.	ENSG00000125872	ENST00000378858	T	0.04406	3.63	5.37	0.364	0.16124	.	0.918843	0.09178	N	0.837822	T	0.02970	0.0088	N	0.16233	0.39	0.18873	N	0.999982	B;B	0.06786	0.001;0.001	B;B	0.04013	0.0;0.001	T	0.48399	-0.9039	10	0.25751	T	0.34	-6.0721	4.5538	0.12126	0.2133:0.256:0.0:0.5307	.	100;100	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	R	100	ENSP00000368135:Q100R	ENSP00000368135:Q100R	Q	-	2	0	LRRN4	5981147	0.002000	0.14202	0.402000	0.26371	0.002000	0.02628	-0.227000	0.09126	-0.136000	0.11475	-0.516000	0.04426	CAG	.	.	.	none		0.731	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
ARFGAP1	55738	hgsc.bcm.edu	37	20	61918934	61918934	+	Missense_Mutation	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:61918934T>G	ENST00000370283.4	+	13	1070	c.930T>G	c.(928-930)agT>agG	p.S310R	ARFGAP1_ENST00000353546.3_Missense_Mutation_p.S318R|ARFGAP1_ENST00000519604.1_Missense_Mutation_p.S265R|ARFGAP1_ENST00000519273.2_Missense_Mutation_p.S197R|ARFGAP1_ENST00000370275.4_Missense_Mutation_p.V390G|ARFGAP1_ENST00000547204.1_Missense_Mutation_p.S244R|MIR4326_ENST00000582203.1_RNA|ARFGAP1_ENST00000518794.2_3'UTR	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	310					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AGGGCCACAGTTATCAGAACA	0.542																																					p.S318R		Atlas-SNP	.											.	ARFGAP1	38	.	0			c.T954G						PASS	.						44.0	45.0	44.0					20																	61918934		2201	4299	6500	SO:0001583	missense	55738	exon14			CCACAGTTATCAG	AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.930T>G	chr20.hg19:g.61918934T>G	ENSP00000359306:p.Ser310Arg	35.0	0.0	.		76.0	26.0	.	NM_175609	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Missense_Mutation	SNP	ENST00000370283.4	hg19	CCDS13515.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.23|13.23	2.173905|2.173905	0.38413|0.38413	.|.	.|.	ENSG00000101199|ENSG00000101199	ENST00000370283;ENST00000547204;ENST00000549047;ENST00000523460;ENST00000519604;ENST00000519273;ENST00000353546|ENST00000370275	T;T;T;T;T;T|T	0.50001|0.38560	1.39;0.77;0.85;0.78;0.76;1.41|1.13	4.81|4.81	-0.361|-0.361	0.12564|0.12564	.|.	0.782541|.	0.12772|.	N|.	0.440467|.	T|T	0.36663|0.36663	0.0975|0.0975	L|L	0.60455|0.60455	1.87|1.87	0.49798|0.49798	D|D	0.999824|0.999824	D;D;P;P|B	0.60160|0.26318	0.958;0.987;0.859;0.913|0.146	P;P;P;P|B	0.57960|0.24974	0.663;0.83;0.556;0.742|0.057	T|T	0.33548|0.33548	-0.9864|-0.9864	10|9	0.32370|0.87932	T|D	0.25|0	-9.8078|-9.8078	9.7438|9.7438	0.40435|0.40435	0.0:0.6144:0.0:0.3856|0.0:0.6144:0.0:0.3856	.|.	197;265;310;318|390	B7Z8H8;E7EV62;Q8N6T3;Q8N6T3-2|B7ZBI2	.;.;ARFG1_HUMAN;.|.	R|G	310;244;236;66;265;197;318|390	ENSP00000359306:S310R;ENSP00000449800:S244R;ENSP00000447037:S236R;ENSP00000430500:S265R;ENSP00000443716:S197R;ENSP00000314615:S318R|ENSP00000359298:V390G	ENSP00000314615:S318R|ENSP00000359298:V390G	S|V	+|+	3|2	2|0	ARFGAP1|ARFGAP1	61389379|61389379	1.000000|1.000000	0.71417|0.71417	0.316000|0.316000	0.25252|0.25252	0.180000|0.180000	0.23129|0.23129	1.634000|1.634000	0.37123|0.37123	0.106000|0.106000	0.17784|0.17784	0.379000|0.379000	0.24179|0.24179	AGT|GTT	.	.	.	none		0.542	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080134.3	NM_018209	
HELZ2	85441	hgsc.bcm.edu	37	20	62197379	62197379	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:62197379G>A	ENST00000467148.1	-	8	2865	c.2796C>T	c.(2794-2796)atC>atT	p.I932I	HELZ2_ENST00000427522.2_Silent_p.I363I	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	932	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CGCACTCACGGATGAAGCTCT	0.701																																					p.I932I		Atlas-SNP	.											.	.	.	.	0			c.C2796T						PASS	.						16.0	16.0	16.0					20																	62197379		2174	4285	6459	SO:0001819	synonymous_variant	85441	exon9			CTCACGGATGAAG	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.2796C>T	chr20.hg19:g.62197379G>A		5.0	0.0	.		78.0	32.0	.	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	hg19	CCDS33508.1																																																																																			.	.	.	none		0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
ADAMTS5	11096	hgsc.bcm.edu	37	21	28338045	28338045	+	Silent	SNP	A	A	T	rs369445782	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:28338045A>T	ENST00000284987.5	-	1	787	c.666T>A	c.(664-666)gcT>gcA	p.A222A		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	222					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						TGTGCGCCGGAGCATGCTCGT	0.716													A|||	4	0.000798722	0.0023	0.0	5008	,	,		14660	0.0		0.001	False		,,,				2504	0.0				p.A222A	Esophageal Squamous(53;683 1080 10100 14424 45938)	Atlas-SNP	.											.	ADAMTS5	184	.	0			c.T666A						PASS	.	A		15,4337		0,15,2161	9.0	12.0	11.0		666	-4.4	0.0	21		11	2,8476		0,2,4237	no	coding-synonymous	ADAMTS5	NM_007038.3		0,17,6398	TT,TA,AA		0.0236,0.3447,0.1325		222/931	28338045	17,12813	2176	4239	6415	SO:0001819	synonymous_variant	11096	exon1			CGCCGGAGCATGC	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.666T>A	chr21.hg19:g.28338045A>T		0.0	0.0	.		73.0	33.0	.	NM_007038	Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	hg19	CCDS13579.1																																																																																			.	.	.	weak		0.716	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
TTC3	7267	hgsc.bcm.edu	37	21	38519809	38519809	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:38519809G>A	ENST00000399017.2	+	22	4669	c.1922G>A	c.(1921-1923)tGc>tAc	p.C641Y	TTC3_ENST00000540756.1_Missense_Mutation_p.C331Y|TTC3_ENST00000355666.1_Missense_Mutation_p.C641Y|TTC3_ENST00000354749.2_Missense_Mutation_p.C641Y|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	641					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GTTGAAGAATGCAAGTTCCCT	0.323																																					p.C641Y	Ovarian(38;194 1649 35661)	Atlas-SNP	.											.	TTC3	182	.	0			c.G1922A						PASS	.						111.0	108.0	109.0					21																	38519809		2203	4300	6503	SO:0001583	missense	7267	exon22			AAGAATGCAAGTT	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.1922G>A	chr21.hg19:g.38519809G>A	ENSP00000381981:p.Cys641Tyr	38.0	0.0	.		56.0	4.0	.	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	hg19	CCDS13651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.0|20.0	3.930568|3.930568	0.73327|0.73327	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000414818|ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000540756;ENST00000399017;ENST00000354749	.|T;T;T;T;T;T;T	.|0.53640	.|2.42;0.66;2.43;2.72;0.61;2.72;2.72	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	.|0.294582	.|0.30020	.|N	.|0.010617	T|T	0.57227|0.57227	0.2039|0.2039	N|N	0.20986|0.20986	0.625|0.625	0.58432|0.58432	D|D	0.999993|0.999993	.|D;D	.|0.76494	.|0.998;0.999	.|D;D	.|0.83275	.|0.994;0.996	T|T	0.63589|0.63589	-0.6603|-0.6603	5|10	.|0.87932	.|D	.|0	-11.1008|-11.1008	17.997|17.997	0.89187|0.89187	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|331;641	.|B4DSZ9;P53804	.|.;TTC3_HUMAN	T|Y	39|641;641;623;641;331;641;641	.|ENSP00000403943:C641Y;ENSP00000408456:C641Y;ENSP00000391891:C623Y;ENSP00000347889:C641Y;ENSP00000442875:C331Y;ENSP00000381981:C641Y;ENSP00000346791:C641Y	.|ENSP00000346791:C641Y	A|C	+|+	1|2	0|0	TTC3|TTC3	37441679|37441679	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	7.912000|7.912000	0.87465|0.87465	2.409000|2.409000	0.81822|0.81822	0.650000|0.650000	0.86243|0.86243	GCA|TGC	.	.	.	none		0.323	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
PRDM15	63977	hgsc.bcm.edu	37	21	43221434	43221434	+	Missense_Mutation	SNP	G	G	A	rs147616045		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:43221434G>A	ENST00000269844.3	-	31	4600	c.4490C>T	c.(4489-4491)gCg>gTg	p.A1497V	PRDM15_ENST00000398548.1_Missense_Mutation_p.A1168V|PRDM15_ENST00000447207.2_Missense_Mutation_p.A1131V|PRDM15_ENST00000538201.1_Missense_Mutation_p.A1151V|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000422911.1_Missense_Mutation_p.A1188V	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CTGCTGCTCCGCCTGCACCTG	0.637													g|||	1	0.000199681	0.0008	0.0	5008	,	,		15122	0.0		0.0	False		,,,				2504	0.0				p.A1497V		Atlas-SNP	.											.	PRDM15	110	.	0			c.C4490T						PASS	.		VAL/ALA,VAL/ALA	5,4369		0,5,2182	33.0	38.0	36.0		3503,4490	3.7	0.0	21	dbSNP_134	36	2,8498		0,2,4248	yes	missense,missense	PRDM15	NM_001040424.1,NM_022115.3	64,64	0,7,6430	AA,AG,GG		0.0235,0.1143,0.0544	possibly-damaging,possibly-damaging	1168/1179,1497/1508	43221434	7,12867	2187	4250	6437	SO:0001583	missense	63977	exon31			TGCTCCGCCTGCA	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4490C>T	chr21.hg19:g.43221434G>A	ENSP00000269844:p.Ala1497Val	0.0	0.0	.		24.0	10.0	.	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	hg19	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	g	13.53	2.264687	0.40095	0.001143	2.35E-4	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.08546	3.16;3.17;3.17;3.16;3.08	4.56	3.65	0.41850	.	.	.	.	.	T	0.04952	0.0133	N	0.14661	0.345	0.09310	N	1	P;B;B	0.35226	0.491;0.043;0.043	B;B;B	0.22753	0.041;0.012;0.007	T	0.33420	-0.9869	9	0.72032	D	0.01	-4.2914	10.8161	0.46575	0.0:0.0:0.6437:0.3563	.	1497;1188;1168	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	V	1188;1168;1151;1131;1497	ENSP00000408592:A1188V;ENSP00000381556:A1168V;ENSP00000444044:A1151V;ENSP00000390245:A1131V;ENSP00000269844:A1497V	ENSP00000269844:A1497V	A	-	2	0	PRDM15	42094503	0.050000	0.20438	0.003000	0.11579	0.735000	0.41995	2.502000	0.45398	0.847000	0.35167	0.558000	0.71614	GCG	.	G|1.000;A|0.000	0.000	weak		0.637	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
PRPS2	5634	hgsc.bcm.edu	37	X	12840843	12840843	+	Missense_Mutation	SNP	C	C	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:12840843C>G	ENST00000380668.5	+	7	1013	c.885C>G	c.(883-885)atC>atG	p.I295M	PRPS2_ENST00000398491.2_Missense_Mutation_p.I298M	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	295					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						TTTCCATGATCTTGGCCGAAG	0.453																																					p.I298M		Atlas-SNP	.											.	PRPS2	41	.	0			c.C894G						PASS	.						174.0	117.0	136.0					X																	12840843		2203	4300	6503	SO:0001583	missense	5634	exon7			CATGATCTTGGCC	Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.885C>G	chrX.hg19:g.12840843C>G	ENSP00000370043:p.Ile295Met	90.0	0.0	.		232.0	69.0	.	NM_001039091	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	ENST00000380668.5	hg19	CCDS14150.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.559940	0.27827	.	.	ENSG00000101911	ENST00000380668;ENST00000398491;ENST00000461630;ENST00000460220	T;T;T	0.73363	-0.74;-0.74;-0.74	5.12	-0.0434	0.13859	.	0.000000	0.85682	D	0.000000	T	0.58018	0.2093	N	0.25485	0.75	0.80722	D	1	B;B	0.20164	0.042;0.012	B;B	0.37451	0.25;0.238	T	0.21586	-1.0241	10	0.12103	T	0.63	-23.1539	4.2961	0.10902	0.2341:0.3845:0.0:0.3814	.	295;298	P11908;P11908-2	PRPS2_HUMAN;.	M	295;298;150;127	ENSP00000370043:I295M;ENSP00000381504:I298M;ENSP00000418911:I150M	ENSP00000370043:I295M	I	+	3	3	PRPS2	12750764	0.945000	0.32115	0.987000	0.45799	0.993000	0.82548	0.139000	0.16036	0.131000	0.18576	0.513000	0.50165	ATC	.	.	.	none		0.453	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
PHKA2	5256	hgsc.bcm.edu	37	X	18919658	18919658	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:18919658C>A	ENST00000379942.4	-	27	3637	c.2972G>T	c.(2971-2973)gGa>gTa	p.G991V		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	991					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TTTGGTGACTCCGGTATGGCC	0.547																																					p.G991V		Atlas-SNP	.											.	PHKA2	122	.	0			c.G2972T						PASS	.						180.0	139.0	153.0					X																	18919658		2203	4300	6503	SO:0001583	missense	5256	exon27			GTGACTCCGGTAT		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2972G>T	chrX.hg19:g.18919658C>A	ENSP00000369274:p.Gly991Val	53.0	0.0	.		186.0	65.0	.	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	hg19	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573963	0.86542	.	.	ENSG00000044446	ENST00000379942	D	0.90955	-2.76	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.94798	0.8320	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.93740	0.7049	10	0.41790	T	0.15	-16.0545	19.5104	0.95139	0.0:1.0:0.0:0.0	.	991	P46019	KPB2_HUMAN	V	991	ENSP00000369274:G991V	ENSP00000369274:G991V	G	-	2	0	PHKA2	18829579	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	7.400000	0.79949	2.562000	0.86427	0.600000	0.82982	GGA	.	.	.	none		0.547	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
BRWD3	254065	hgsc.bcm.edu	37	X	80001213	80001213	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:80001213G>A	ENST00000373275.4	-	7	662	c.446C>T	c.(445-447)gCc>gTc	p.A149V		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	149					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TAATTGCCTGGCAGAGGTGAT	0.343																																					p.A149V		Atlas-SNP	.											.	BRWD3	251	.	0			c.C446T						PASS	.						36.0	33.0	34.0					X																	80001213		2203	4298	6501	SO:0001583	missense	254065	exon7			TGCCTGGCAGAGG		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.446C>T	chrX.hg19:g.80001213G>A	ENSP00000362372:p.Ala149Val	204.0	0.0	.		303.0	98.0	.	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	hg19	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873392	0.91664	.	.	ENSG00000165288	ENST00000373275	T	0.29397	1.57	4.96	4.08	0.47627	.	0.065291	0.64402	D	0.000010	T	0.46580	0.1400	M	0.64997	1.995	0.49798	D	0.999826	D	0.67145	0.996	P	0.57911	0.829	T	0.42832	-0.9428	9	.	.	.	-1.3369	14.4752	0.67541	0.0:0.144:0.856:0.0	.	149	Q6RI45	BRWD3_HUMAN	V	149	ENSP00000362372:A149V	.	A	-	2	0	BRWD3	79887869	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.170000	0.64990	1.065000	0.40693	0.544000	0.68410	GCC	.	.	.	none		0.343	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
MT-CO2	4513	hgsc.bcm.edu	37	M	7925	7925	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrM:7925G>A	ENST00000361739.1	+	1	340	c.340G>A	c.(340-342)Ggc>Agc	p.G114S	MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	114					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						ACACCGACTACGGCGGACTAA	0.493																																					p.G114S		Atlas-SNP	.											.	.	.	.	0			c.G340A						PASS	.																																			SO:0001583	missense	5743	exon1			GACTACGGCGGAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.340G>A	chrM.hg19:g.7925G>A	ENSP00000354876:p.Gly114Ser	8.0	0.0	.		67.0	7.0	.	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.	.	none		0.493	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
MT-CO3	4514	hgsc.bcm.edu	37	M	9930	9930	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrM:9930T>C	ENST00000362079.2	+	1	724	c.724T>C	c.(724-726)Tgg>Cgg	p.W242R	MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	242					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						CCGCCTGATACTGGCATTTTG	0.383																																					p.W242R		Atlas-SNP	.											.	.	.	.	0			c.T724C						PASS	.																																			SO:0001583	missense	5742	exon1			TGATACTGGCATT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.724T>C	chrM.hg19:g.9930T>C	ENSP00000354982:p.Trp242Arg	12.0	0.0	.		29.0	29.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.383	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
BRINP2	57795	hgsc.bcm.edu	37	1	177242681	177242690	+	Frame_Shift_Del	DEL	GTCAGTTCTG	GTCAGTTCTG	-	rs138487282		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	GTCAGTTCTG	GTCAGTTCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:177242681_177242690delGTCAGTTCTG	ENST00000361539.4	+	5	1039_1048	c.727_736delGTCAGTTCTG	c.(727-738)gtcagttctgtcfs	p.VSSV243fs	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	243	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											TCTGGACTCAGTCAGTTCTGTCTTGGTACA	0.443																																					p.242_245del		Atlas-Indel,Pindel	.											.	FAM5B	191	.	0			c.726_735del						PASS	.																																			SO:0001589	frameshift_variant	57795	exon5			.		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.727_736delGTCAGTTCTG	chr1.hg19:g.177242681_177242690delGTCAGTTCTG	ENSP00000354481:p.Val243fs	126.0	0.0	0		181.0	18.0	0.0994475	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Frame_Shift_Del	DEL	ENST00000361539.4	hg19	CCDS1320.1																																																																																			.	.	.	none		0.443	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
GABRQ	55879	hgsc.bcm.edu	37	X	151808889	151808890	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:151808889_151808890delTG	ENST00000370306.2	+	2	220_221	c.200_201delTG	c.(199-201)ctgfs	p.L67fs		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	67					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GACAGGGTGCTGTCAAGATACG	0.47																																					p.67_67del		Atlas-Indel,Pindel	.											.	GABRQ	131	.	0			c.199_200del						PASS	.																																			SO:0001589	frameshift_variant	55879	exon2			.	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.200_201delTG	chrX.hg19:g.151808889_151808890delTG	ENSP00000359329:p.Leu67fs	70.0	0.0	0		159.0	56.0	0.352201	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Frame_Shift_Del	DEL	ENST00000370306.2	hg19	CCDS14707.1																																																																																			.	.	.	none		0.470	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
CUX2	23316	hgsc.bcm.edu	37	12	111785758	111785759	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:111785758_111785759insA	ENST00000261726.6	+	22	4244_4245	c.4090_4091insA	c.(4090-4092)caafs	p.Q1364fs		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1364	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						ACTTCATCCCCAACAGGAGAGT	0.604																																					p.Q1364fs		Atlas-Indel,Pindel	.											.	CUX2	145	.	0			c.4090_4091insA						PASS	.																																			SO:0001589	frameshift_variant	23316	exon22			.	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.4092dupA	chr12.hg19:g.111785760_111785760dupA	ENSP00000261726:p.Gln1364fs	40.0	0.0	0		69.0	24.0	0.347826	NM_015267	A7E2Y4	Frame_Shift_Ins	INS	ENST00000261726.6	hg19	CCDS41837.1																																																																																			.	.	.	none		0.604	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
PKHD1	5314	hgsc.bcm.edu	37	6	51890186	51890186	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:51890186delC	ENST00000371117.3	-	32	4697	c.4422delG	c.(4420-4422)gggfs	p.G1474fs	PKHD1_ENST00000340994.4_Frame_Shift_Del_p.G1474fs	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1474	IPT/TIG 9.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAGTGCAATTCCCCTGACACT	0.542																																					p.N1475fs		Atlas-Indel,Pindel	.											.	PKHD1	927	.	0			c.4423delA						PASS	.						57.0	52.0	54.0					6																	51890186		2203	4300	6503	SO:0001589	frameshift_variant	5314	exon32			.	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4422delG	chr6.hg19:g.51890186delC	ENSP00000360158:p.Gly1474fs	40.0	0.0	0		239.0	53.0	0.221757	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Frame_Shift_Del	DEL	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	.	.	none		0.542	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
CIZ1	25792	hgsc.bcm.edu	37	9	130947865	130947865	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:130947865delT	ENST00000393608.1	-	5	751	c.549delA	c.(547-549)aaafs	p.K183fs	CIZ1_ENST00000538431.1_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000372938.5_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000325721.8_Frame_Shift_Del_p.K159fs|CIZ1_ENST00000357558.5_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000372948.3_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000372954.1_Frame_Shift_Del_p.K159fs|CIZ1_ENST00000277465.4_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000541172.1_Frame_Shift_Del_p.K82fs|CIZ1_ENST00000476727.2_5'UTR	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	183					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						TCCGGGCCTGTTTCTGGGGGT	0.637																																					p.Q214fs		Atlas-Indel,Pindel	.											.	CIZ1	75	.	0			c.640delC						PASS	.						67.0	68.0	68.0					9																	130947865		2203	4300	6503	SO:0001589	frameshift_variant	25792	exon5			.	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.549delA	chr9.hg19:g.130947865delT	ENSP00000377232:p.Lys183fs	45.0	0.0	0		118.0	36.0	0.305085	NM_001257975	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Frame_Shift_Del	DEL	ENST00000393608.1	hg19	CCDS6894.1																																																																																			.	.	.	none		0.637	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
GPR112	139378	hgsc.bcm.edu	37	X	135475736	135475737	+	Frame_Shift_Ins	INS	-	-	AAAAT			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:135475736_135475737insAAAAT	ENST00000394143.1	+	18	8368_8369	c.8077_8078insAAAAT	c.(8077-8079)aatfs	p.-2692fs	GPR112_ENST00000370652.1_Frame_Shift_Ins_p.-2692fs|GPR112_ENST00000412101.1_Frame_Shift_Ins_p.-2487fs|GPR112_ENST00000287534.4_Frame_Shift_Ins_p.-2445fs|GPR112_ENST00000394141.1_Frame_Shift_Ins_p.-2487fs	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTTTGAGAATAATAGTAAGTAT	0.371																																					p.N2693fs		Atlas-Indel,Pindel	.											.	GPR112	459	.	0			c.8077_8078insAAAAT						PASS	.																																			SO:0001589	frameshift_variant	139378	exon18			.	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	Exception_encountered	chrX.hg19:g.135475736_135475737insAAAAT	ENSP00000377699:p.Asn2692fs	52.0	0.0	0		58.0	16.0	0.275862	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Frame_Shift_Ins	INS	ENST00000394143.1	hg19	CCDS35409.1																																																																																			.	.	.	none		0.371	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
ZFHX3	463	hgsc.bcm.edu	37	16	72923790	72923790	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:72923790delG	ENST00000268489.5	-	4	3960	c.3288delC	c.(3286-3288)tccfs	p.S1096fs	ZFHX3_ENST00000397992.5_Frame_Shift_Del_p.S182fs	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1096					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGGCCTTGGTGGAGTAGTTGC	0.557																																					p.T1097fs		Atlas-Indel,Pindel	.											.	ZFHX3	404	.	0			c.3289delA						PASS	.						107.0	75.0	86.0					16																	72923790		2198	4300	6498	SO:0001589	frameshift_variant	463	exon4			.	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.3288delC	chr16.hg19:g.72923790delG	ENSP00000268489:p.Ser1096fs	16.0	0.0	0		42.0	14.0	0.333333	NM_006885	D3DWS8|O15101|Q13719	Frame_Shift_Del	DEL	ENST00000268489.5	hg19	CCDS10908.1																																																																																			.	.	.	none		0.557	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388661	1388665	+	Frame_Shift_Del	DEL	CGATG	CGATG	-	rs199774688|rs150559021|rs9762106	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	CGATG	CGATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:1388661_1388665delCGATG	ENST00000324803.4	+	1	3322_3326	c.362_366delCGATG	c.(361-366)ccgatgfs	p.PM121fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	121					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TCACACGTGCCGATGCGGAGTGCCC	0.678																																					p.121_122del		Atlas-INDEL	.											.	CRIPAK	185	.	0			c.361_365del						PASS	.																																			SO:0001589	frameshift_variant	285464	exon1			.	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.362_366delCGATG	chr4.hg19:g.1388661_1388665delCGATG	ENSP00000323978:p.Pro121fs	11.0	0.0	0		98.0	11.0	0.112245	NM_175918	Q8NB03	Frame_Shift_Del	DEL	ENST00000324803.4	hg19	CCDS3349.1																																																																																			.	.	.	none		0.678	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
KMT2C	58508	hgsc.bcm.edu	37	7	152012386	152012386	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:152012386delT	ENST00000262189.6	-	4	645	c.427delA	c.(427-429)agtfs	p.S144fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.S144fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	144					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTAAGGAACTTTTTTCCCCA	0.378																																					p.S143fs		Atlas-Indel,Pindel	.											.	MLL3	1564	.	0			c.428delG						PASS	.						136.0	126.0	129.0					7																	152012386		2203	4300	6503	SO:0001589	frameshift_variant	58508	exon4			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.427delA	chr7.hg19:g.152012386delT	ENSP00000262189:p.Ser144fs	87.0	0.0	0		144.0	52.0	0.361111	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	hg19	CCDS5931.1																																																																																			.	.	.	none		0.378	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
B9D2	80776	hgsc.bcm.edu	37	19	41869392	41869392	+	Frame_Shift_Del	DEL	T	T	-	rs2241714	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:41869392delT	ENST00000243578.3	-	2	252	c.33delA	c.(31-33)atafs	p.I11fs	TMEM91_ENST00000604123.1_Intron|TMEM91_ENST00000539627.1_Intron|B9D2_ENST00000601597.1_5'UTR|TMEM91_ENST00000413014.2_5'Flank|CTC-435M10.3_ENST00000604424.1_Intron	NM_030578.3	NP_085055.2	Q9BPU9	B9D2_HUMAN	B9 protein domain 2	11	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.		I -> M (in dbSNP:rs2241714). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.2}.		cilium assembly (GO:0042384)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)	gamma-tubulin binding (GO:0043015)			large_intestine(1)|ovary(1)	2						CGCTGGCCCCTATGATCTGCC	0.537																																					p.G12fs		Atlas-Indel,Pindel	.											.	B9D2	9	.	0			c.34delG						PASS	.						69.0	58.0	62.0					19																	41869392		2203	4300	6503	SO:0001589	frameshift_variant	80776	exon2			.	BC004157	CCDS12579.1	19q13.2	2014-01-28				ENSG00000123810			28636	protein-coding gene	gene with protein product		611951				21763481	Standard	NM_030578		Approved	MGC4093, MKS10	uc002oqj.2	Q9BPU9		ENST00000243578.3:c.33delA	chr19.hg19:g.41869392delT	ENSP00000243578:p.Ile11fs	72.0	0.0	0		124.0	67.0	0.540323	NM_030578		Frame_Shift_Del	DEL	ENST00000243578.3	hg19	CCDS12579.1																																																																																			.	.	.	none		0.537	B9D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463489.1	NM_030578	
PPP4R1L	55370	hgsc.bcm.edu	37	20	56813334	56813337	+	3'UTR	DEL	AAAG	AAAG	-	rs530133150		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	AAAG	AAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:56813334_56813337delAAAG	ENST00000334187.8	-	0	2105_2108							Q9P1A2	PP4RL_HUMAN	protein phosphatase 4, regulatory subunit 1-like																		TGAAGCTGATAAAGATAGTCTCTC	0.333																																					.		Atlas-Indel,Pindel	.											.	PPP4R1L	1	.	0			.						PASS	.																																			SO:0001624	3_prime_UTR_variant	55370	.			.	AF119843		20q13.32	2013-03-28			ENSG00000124224	ENSG00000124224			15755	other	unknown				C20orf192		14702039, 11780052	Standard	NR_003505		Approved	bA196N14.4, bA196N14.5	uc002xyy.1	Q9P1A2	OTTHUMG00000032838	ENST00000334187.8:c.*847CTTT>-	chr20.hg19:g.56813334_56813337delAAAG		28.0	0.0	0		46.0	22.0	0.478261	.	B4DRM4|Q96LY6|Q9BZ17|Q9BZ18	RNA	DEL	ENST00000334187.8	hg19																																																																																				.	.	.	none		0.333	PPP4R1L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_003505	
KIAA1324L	222223	hgsc.bcm.edu	37	7	86577110	86577110	+	Frame_Shift_Del	DEL	A	A	-	rs536741266		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:86577110delA	ENST00000450689.2	-	3	624	c.439delT	c.(439-441)tctfs	p.S147fs	KIAA1324L_ENST00000444627.1_Frame_Shift_Del_p.S147fs|KIAA1324L_ENST00000416314.1_Intron	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	147						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GCGATGTTAGAAAATCCTGCC	0.473																																					p.S147fs		Atlas-Indel,Pindel	.											.	KIAA1324L	225	.	0			c.440delC						PASS	.						124.0	101.0	108.0					7																	86577110		692	1591	2283	SO:0001589	frameshift_variant	222223	exon3			.	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.439delT	chr7.hg19:g.86577110delA	ENSP00000413445:p.Ser147fs	73.0	0.0	0		178.0	64.0	0.359551	NM_001142749	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Frame_Shift_Del	DEL	ENST00000450689.2	hg19	CCDS47632.1																																																																																			.	.	.	none		0.473	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
LRRC1	55227	hgsc.bcm.edu	37	6	53764574	53764575	+	Frame_Shift_Del	DEL	TT	TT	-	rs550591899		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:53764574_53764575delTT	ENST00000370888.1	+	8	949_950	c.672_673delTT	c.(670-675)tgtttafs	p.L225fs		NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	225						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		ACCTGCTGTGTTTAGATGTCTC	0.391																																					p.224_224del		Atlas-Indel,Pindel	.											.	LRRC1	59	.	0			c.671_672del						PASS	.																																			SO:0001589	frameshift_variant	55227	exon8			.	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.672_673delTT	chr6.hg19:g.53764574_53764575delTT	ENSP00000359925:p.Leu225fs	83.0	0.0	0		409.0	32.0	0.0782396	NM_018214	Q5TGN3|Q9HAC0|Q9NVF1	Frame_Shift_Del	DEL	ENST00000370888.1	hg19	CCDS4953.2																																																																																			.	.	.	none		0.391	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168	
