#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF8	943	hgsc.bcm.edu	37	1	12170173	12170173	+	Silent	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:12170173G>T	ENST00000263932.2	+	6	810	c.588G>T	c.(586-588)ggG>ggT	p.G196G	TNFRSF8_ENST00000417814.2_Silent_p.G85G	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	196					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CTGTAAGAGGGGGCACCCGCC	0.627																																					p.G196G		Atlas-SNP	.											.	TNFRSF8	70	.	0			c.G588T						PASS	.						50.0	48.0	49.0					1																	12170173		2203	4300	6503	SO:0001819	synonymous_variant	943	exon6			AAGAGGGGGCACC	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.588G>T	chr1.hg19:g.12170173G>T		110.0	0.0	.		135.0	69.0	.	NM_001243	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Silent	SNP	ENST00000263932.2	hg19	CCDS144.1																																																																																			.	.	.	none		0.627	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
PAX7	5081	hgsc.bcm.edu	37	1	18961677	18961677	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:18961677G>A	ENST00000375375.3	+	3	992	c.394G>A	c.(394-396)Gag>Aag	p.E132K	PAX7_ENST00000400661.3_Missense_Mutation_p.E132K|PAX7_ENST00000420770.2_Missense_Mutation_p.E132K	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	132	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.|Sufficient to mediate interaction with PAXBP1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GTTCAGCTGGGAGATCCGGGA	0.587			T	FOXO1A	alveolar rhabdomyosarcoma																																p.E132K		Atlas-SNP	.		Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	.	PAX7	127	.	0			c.G394A						PASS	.						81.0	75.0	77.0					1																	18961677		2203	4300	6503	SO:0001583	missense	5081	exon3			AGCTGGGAGATCC	X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.394G>A	chr1.hg19:g.18961677G>A	ENSP00000364524:p.Glu132Lys	224.0	0.0	.		193.0	85.0	.	NM_002584	E9PFV9|Q0VA99|Q2PJS5	Missense_Mutation	SNP	ENST00000375375.3	hg19	CCDS186.1	.	.	.	.	.	.	.	.	.	.	G	34	5.375541	0.95923	.	.	ENSG00000009709	ENST00000375375;ENST00000420770;ENST00000400661	D;D;D	0.99598	-6.26;-6.26;-6.26	5.14	5.14	0.70334	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99796	0.9913	H	0.97540	4.025	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.983	D;D;D	0.85130	0.997;0.995;0.94	D	0.96972	0.9709	10	0.87932	D	0	.	17.337	0.87285	0.0:0.0:1.0:0.0	.	132;132;132	E9PFV9;P23759-2;P23759	.;.;PAX7_HUMAN	K	132	ENSP00000364524:E132K;ENSP00000403389:E132K;ENSP00000383502:E132K	ENSP00000364524:E132K	E	+	1	0	PAX7	18834264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.558000	0.98132	2.686000	0.91538	0.561000	0.74099	GAG	.	.	.	none		0.587	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584	
GPATCH3	63906	hgsc.bcm.edu	37	1	27216294	27216294	+	IGR	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:27216294C>T	ENST00000361720.5	-	0	2123				GPN2_ENST00000374135.4_Silent_p.K98K|GPN2_ENST00000461282.1_5'Flank	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3								nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		GGGGGTCGAGCTTGGCACGCA	0.667																																					p.K98K		Atlas-SNP	.											.	GPN2	18	.	0			c.G294A						PASS	.						59.0	55.0	56.0					1																	27216294		2203	4300	6503	SO:0001628	intergenic_variant	54707	exon1			GTCGAGCTTGGCA	BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229		chr1.hg19:g.27216294C>T		80.0	0.0	.		100.0	50.0	.	NM_018066	Q5JYH2|Q8NDJ2|Q9H9Z3	Silent	SNP	ENST00000361720.5	hg19	CCDS290.1																																																																																			.	.	.	none		0.667	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012181.1	NM_022078	
MACF1	23499	hgsc.bcm.edu	37	1	39824842	39824842	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:39824842A>T	ENST00000372915.3	+	46	12252	c.12165A>T	c.(12163-12165)caA>caT	p.Q4055H	MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000539005.1_Missense_Mutation_p.Q1988H|MACF1_ENST00000567887.1_Missense_Mutation_p.Q4087H|MACF1_ENST00000564288.1_Missense_Mutation_p.Q4050H|MACF1_ENST00000317713.7_Missense_Mutation_p.Q1988H|MACF1_ENST00000545844.1_Missense_Mutation_p.Q1988H|MACF1_ENST00000289893.4_Missense_Mutation_p.Q2490H|MACF1_ENST00000361689.2_Missense_Mutation_p.Q1988H			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4055					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTGAGCACCAAGTACCTGTGG	0.423																																					p.Q1988H		Atlas-SNP	.											.	MACF1	909	.	0			c.A5964T						PASS	.						71.0	70.0	70.0					1																	39824842		2203	4300	6503	SO:0001583	missense	23499	exon43			GCACCAAGTACCT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.12165A>T	chr1.hg19:g.39824842A>T	ENSP00000362006:p.Gln4055His	272.0	1.0	.		308.0	146.0	.	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.8|22.8	4.339791|4.339791	0.81911|0.81911	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.55760|.	0.5;0.5;0.5;0.5;0.5;0.5|.	5.35|5.35	4.21|4.21	0.49690|0.49690	.|.	0.000000|.	0.64402|.	D|.	0.000012|.	T|T	0.63355|0.63355	0.2504|0.2504	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	P;B;D;D|.	0.63880|.	0.86;0.067;0.993;0.975|.	P;B;D;P|.	0.65443|.	0.797;0.103;0.935;0.796|.	T|T	0.64689|0.64689	-0.6348|-0.6348	10|5	0.72032|.	D|.	0.01|.	.|.	5.0785|5.0785	0.14644|0.14644	0.8019:0.0:0.1981:0.0|0.8019:0.0:0.1981:0.0	.|.	4055;1988;1988;1953|.	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	MACF1_HUMAN;.;.;.|.	H|C	1988;4055;1988;1988;1988;2490|1122	ENSP00000439537:Q1988H;ENSP00000362006:Q4055H;ENSP00000354573:Q1988H;ENSP00000313438:Q1988H;ENSP00000444364:Q1988H;ENSP00000289893:Q2490H|.	ENSP00000289893:Q2490H|.	Q|S	+|+	3|1	2|0	MACF1|MACF1	39597429|39597429	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.308000|2.308000	0.43690|0.43690	2.149000|2.149000	0.67028|0.67028	0.460000|0.460000	0.39030|0.39030	CAA|AGT	.	.	.	none		0.423	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
RLF	6018	hgsc.bcm.edu	37	1	40704556	40704556	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:40704556G>C	ENST00000372771.4	+	8	4209	c.4182G>C	c.(4180-4182)gaG>gaC	p.E1394D		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1394					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			ATATTGAAGAGCCTAAAGTAC	0.403																																					p.E1394D		Atlas-SNP	.											.	RLF	152	.	0			c.G4182C						PASS	.						80.0	79.0	79.0					1																	40704556		2203	4300	6503	SO:0001583	missense	6018	exon8			TGAAGAGCCTAAA		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.4182G>C	chr1.hg19:g.40704556G>C	ENSP00000361857:p.Glu1394Asp	127.0	0.0	.		159.0	75.0	.	NM_012421	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	hg19	CCDS448.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.379214	0.24944	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.15139	2.45	5.91	4.92	0.64577	.	0.305702	0.34507	N	0.003918	T	0.04272	0.0118	N	0.00707	-1.245	0.39572	D	0.969296	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.39643	-0.9604	10	0.23891	T	0.37	-13.2144	5.5377	0.17021	0.078:0.1073:0.6082:0.2065	.	1087;1394	F5H2M5;Q13129	.;RLF_HUMAN	D	1394;1087	ENSP00000361857:E1394D	ENSP00000361857:E1394D	E	+	3	2	RLF	40477143	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	1.454000	0.35178	2.793000	0.96121	0.655000	0.94253	GAG	.	.	.	none		0.403	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
TTC39A	22996	hgsc.bcm.edu	37	1	51777848	51777848	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:51777848C>A	ENST00000447632.2	-	4	349	c.301G>T	c.(301-303)Gta>Tta	p.V101L	TTC39A_ENST00000262675.7_Missense_Mutation_p.V73L|TTC39A_ENST00000371750.5_Missense_Mutation_p.V101L|TTC39A_ENST00000413473.2_Missense_Mutation_p.V104L|TTC39A_ENST00000451380.1_Missense_Mutation_p.V100L|TTC39A_ENST00000371747.3_Missense_Mutation_p.V100L|TTC39A_ENST00000262676.5_Missense_Mutation_p.V97L			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	101								p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						GAATCTGTTACAGAAGACTTC	0.552																																					p.V104L		Atlas-SNP	.											.	TTC39A	40	.	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)	c.G310T						PASS	.						43.0	45.0	44.0					1																	51777848		1893	4104	5997	SO:0001583	missense	22996	exon4			CTGTTACAGAAGA	AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.301G>T	chr1.hg19:g.51777848C>A	ENSP00000393952:p.Val101Leu	50.0	0.0	.		50.0	28.0	.	NM_001144832	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	ENST00000447632.2	hg19		.	.	.	.	.	.	.	.	.	.	C	6.034	0.374693	0.11409	.	.	ENSG00000085831	ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750;ENST00000371747;ENST00000262676;ENST00000411642;ENST00000439482;ENST00000422925;ENST00000380849;ENST00000401051;ENST00000532836;ENST00000527205	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	3.55	2.6	0.31112	.	0.459723	0.22016	N	0.065781	T	0.18718	0.0449	N	0.10685	0.025	0.31602	N	0.652598	B;B;B;B;B;B;B	0.13594	0.0;0.0;0.003;0.008;0.001;0.0;0.002	B;B;B;B;B;B;B	0.18871	0.001;0.002;0.02;0.023;0.012;0.004;0.011	T	0.25467	-1.0131	10	0.07325	T	0.83	-1.0752	9.2988	0.37833	0.0:0.8868:0.0:0.1132	.	104;100;73;97;100;101;101	Q5SRH9-4;E7EQY9;D3DQ30;Q5SRH9-3;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;.;TT39A_HUMAN;.	L	101;104;73;100;101;100;97;73;100;73;73;104;73;128	ENSP00000393952:V101L;ENSP00000406144:V104L;ENSP00000262675:V73L;ENSP00000397207:V100L;ENSP00000360815:V101L;ENSP00000360812:V100L;ENSP00000262676:V97L;ENSP00000408532:V73L;ENSP00000405803:V100L;ENSP00000388995:V73L;ENSP00000370230:V73L;ENSP00000383830:V104L;ENSP00000434483:V73L;ENSP00000432453:V128L	ENSP00000262675:V73L	V	-	1	0	TTC39A	51550436	0.436000	0.25586	0.967000	0.41034	0.601000	0.36947	1.159000	0.31749	0.798000	0.33994	0.313000	0.20887	GTA	.	.	.	none		0.552	TTC39A-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000022434.2		
TRIM33	51592	hgsc.bcm.edu	37	1	115006036	115006036	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:115006036G>T	ENST00000358465.2	-	3	871	c.788C>A	c.(787-789)tCa>tAa	p.S263*	TRIM33_ENST00000450349.2_5'UTR|TRIM33_ENST00000369543.2_Nonsense_Mutation_p.S263*	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	263					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TATCTTACCTGAGACATCTTC	0.333			T	RET	papillary thyroid																																p.S263X		Atlas-SNP	.		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	TRIM33	115	.	0			c.C788A						PASS	.						152.0	135.0	141.0					1																	115006036		2203	4299	6502	SO:0001587	stop_gained	51592	exon3			TTACCTGAGACAT	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.788C>A	chr1.hg19:g.115006036G>T	ENSP00000351250:p.Ser263*	137.0	0.0	.		123.0	45.0	.	NM_033020	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Nonsense_Mutation	SNP	ENST00000358465.2	hg19	CCDS872.1	.	.	.	.	.	.	.	.	.	.	G	39	7.889202	0.98545	.	.	ENSG00000197323	ENST00000358465;ENST00000369543	.	.	.	5.67	5.67	0.87782	.	0.174270	0.51477	D	0.000096	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.1834	19.7863	0.96440	0.0:0.0:1.0:0.0	.	.	.	.	X	263	.	ENSP00000351250:S263X	S	-	2	0	TRIM33	114807559	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	9.352000	0.97076	2.665000	0.90641	0.655000	0.94253	TCA	.	.	.	none		0.333	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
NRAS	4893	hgsc.bcm.edu	37	1	115251231	115251231	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:115251231C>A	ENST00000369535.4	-	5	748	c.495G>T	c.(493-495)caG>caT	p.Q165H		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	165					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)			NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCATTCGGTACTGGCGTATTT	0.413		50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q165H		Atlas-SNP	.		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	.	NRAS	3766	.	0			c.G495T						PASS	.						293.0	247.0	263.0					1																	115251231		2203	4300	6503	SO:0001583	missense	4893	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TCGGTACTGGCGT	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.495G>T	chr1.hg19:g.115251231C>A	ENSP00000358548:p.Gln165His	136.0	0.0	.		130.0	50.0	.	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	hg19	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053902	0.55218	.	.	ENSG00000213281	ENST00000369535	T	0.69040	-0.37	5.86	4.95	0.65309	.	0.125967	0.33040	U	0.005343	T	0.43743	0.1261	L	0.40543	1.245	0.51767	D	0.999937	B	0.02656	0.0	B	0.06405	0.002	T	0.51301	-0.8723	10	0.66056	D	0.02	.	12.4792	0.55831	0.0:0.8651:0.0:0.1349	.	165	P01111	RASN_HUMAN	H	165	ENSP00000358548:Q165H	ENSP00000358548:Q165H	Q	-	3	2	NRAS	115052754	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.426000	0.34870	1.623000	0.50342	0.650000	0.86243	CAG	.	.	.	none		0.413	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
ZNF687	57592	hgsc.bcm.edu	37	1	151260816	151260816	+	Silent	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:151260816G>T	ENST00000368879.2	+	2	2147	c.2049G>T	c.(2047-2049)cgG>cgT	p.R683R		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	683					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AACAGTGCCGGGACAAGGCTG	0.652																																					p.R683R		Atlas-SNP	.											.	ZNF687	94	.	0			c.G2049T						PASS	.						20.0	21.0	20.0					1																	151260816		2201	4297	6498	SO:0001819	synonymous_variant	57592	exon2			GTGCCGGGACAAG		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.2049G>T	chr1.hg19:g.151260816G>T		39.0	0.0	.		47.0	25.0	.	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Silent	SNP	ENST00000368879.2	hg19		.	.	.	.	.	.	.	.	.	.	G	10.30	1.313509	0.23908	.	.	ENSG00000143373	ENST00000426871	.	.	.	4.96	-0.935	0.10423	.	.	.	.	.	T	0.45074	0.1324	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49093	-0.8975	4	.	.	.	.	11.7294	0.51728	0.0763:0.4559:0.4678:0.0	.	.	.	.	V	286	.	.	G	+	2	0	ZNF687	149527440	0.982000	0.34865	0.998000	0.56505	0.998000	0.95712	0.117000	0.15583	-0.015000	0.14150	0.561000	0.74099	GGG	.	.	.	none		0.652	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
SNX27	81609	hgsc.bcm.edu	37	1	151665956	151665956	+	Silent	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:151665956A>G	ENST00000458013.2	+	11	1695	c.1575A>G	c.(1573-1575)aaA>aaG	p.K525K	SNX27_ENST00000368838.1_Silent_p.K432K|SNX27_ENST00000368843.3_Silent_p.K525K			Q96L92	SNX27_HUMAN	sorting nexin family member 27	525	FERM-like region F3.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGTGGAGAAAAGAGGTAATTC	0.423																																					p.K525K	Colon(46;291 966 40145 41237 41888)	Atlas-SNP	.											.	SNX27	44	.	0			c.A1575G						PASS	.						186.0	174.0	178.0					1																	151665956		2203	4300	6503	SO:0001819	synonymous_variant	81609	exon11			GAGAAAAGAGGTA	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1575A>G	chr1.hg19:g.151665956A>G		83.0	0.0	.		81.0	38.0	.	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Silent	SNP	ENST00000458013.2	hg19																																																																																				.	.	.	none		0.423	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
LCE6A	448835	hgsc.bcm.edu	37	1	152816237	152816237	+	Nonstop_Mutation	SNP	T	T	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:152816237T>A	ENST00000431011.2	+	2	406	c.241T>A	c.(241-243)Tga>Aga	p.*81R		NM_001128600.1	NP_001122072.1	A0A183	LCE6A_HUMAN	late cornified envelope 6A	0					keratinization (GO:0031424)												TGAAGGCGACTGAGCCCAGAA	0.552																																					p.X81R		Atlas-SNP	.											.	LCE6A	10	.	0			c.T241A						PASS	.						74.0	72.0	73.0					1																	152816237		692	1591	2283	SO:0001578	stop_lost	448835	exon2			GGCGACTGAGCCC	DQ991251	CCDS44227.1	1q21.3	2011-05-24	2006-09-18	2006-09-18	ENSG00000235942	ENSG00000235942		"""Late cornified envelopes"""	31824	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 44"""	C1orf44			Standard	NM_001128600		Approved		uc001fas.4	A0A183	OTTHUMG00000012448	ENST00000431011.2:c.241T>A	chr1.hg19:g.152816237T>A	ENSP00000411070:p.*81Argext*5	208.0	1.0	.		187.0	96.0	.	NM_001128600		Missense_Mutation	SNP	ENST00000431011.2	hg19	CCDS44227.1	.	.	.	.	.	.	.	.	.	.	T	1.289	-0.608089	0.03717	.	.	ENSG00000235942	ENST00000431011	.	.	.	4.01	-4.65	0.03339	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7181	0.23314	0.1432:0.1829:0.0:0.6739	.	.	.	.	R	81	.	.	X	+	1	0	LCE6A	151082861	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.253000	0.02877	-1.018000	0.03363	0.528000	0.53228	TGA	.	.	.	none		0.552	LCE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034661.2		
HDGF	3068	hgsc.bcm.edu	37	1	156713487	156713487	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:156713487T>A	ENST00000357325.5	-	5	987	c.673A>T	c.(673-675)Acc>Tcc	p.T225S	HDGF_ENST00000416666.2_Missense_Mutation_p.T193S|HDGF_ENST00000537739.1_Missense_Mutation_p.T225S|HDGF_ENST00000368206.5_Missense_Mutation_p.T241S|MRPL24_ENST00000361531.2_5'Flank|HDGF_ENST00000368209.5_Missense_Mutation_p.T218S|HDGF_ENST00000465180.1_5'UTR|MRPL24_ENST00000368211.4_5'Flank	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor	225	Glu-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		TCTTCCTTGGTAGcctcttcc	0.617																																					p.T241S		Atlas-SNP	.											.	HDGF	60	.	0			c.A721T						PASS	.						58.0	63.0	61.0					1																	156713487		2202	4300	6502	SO:0001583	missense	3068	exon5			CCTTGGTAGCCTC	D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.673A>T	chr1.hg19:g.156713487T>A	ENSP00000349878:p.Thr225Ser	49.0	0.0	.		45.0	15.0	.	NM_001126050	B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Missense_Mutation	SNP	ENST00000357325.5	hg19	CCDS1156.1	.	.	.	.	.	.	.	.	.	.	T	6.574	0.474156	0.12521	.	.	ENSG00000143321	ENST00000357325;ENST00000368209;ENST00000537739;ENST00000416666;ENST00000368206;ENST00000406805	T;T;T;T;T	0.30448	1.99;1.54;1.99;1.57;1.53	4.51	-1.35	0.09114	.	1.112620	0.07019	U	0.826534	T	0.03695	0.0105	N	0.08118	0	0.20873	N	0.99984	B;B;B;B	0.16603	0.018;0.018;0.018;0.001	B;B;B;B	0.14578	0.011;0.011;0.007;0.003	T	0.40534	-0.9558	10	0.19147	T	0.46	-1.4395	4.2504	0.10691	0.0:0.3977:0.1699:0.4324	.	200;241;218;225	B7Z958;Q5SZ07;Q5SZ08;P51858	.;.;.;HDGF_HUMAN	S	225;218;225;193;241;248	ENSP00000349878:T225S;ENSP00000357192:T218S;ENSP00000443120:T225S;ENSP00000416752:T193S;ENSP00000357189:T241S	ENSP00000349878:T225S	T	-	1	0	HDGF	154980111	0.103000	0.21917	0.809000	0.32408	0.771000	0.43674	-0.486000	0.06513	-0.407000	0.07576	-0.602000	0.04101	ACC	.	.	.	none		0.617	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098946.1	NM_004494	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204237388	204237388	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:204237388A>G	ENST00000272203.3	-	4	471	c.155T>C	c.(154-156)aTg>aCg	p.M52T	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.M52T	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	52										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GTTCCGCTTCATGGAGTGTGA	0.622																																					p.M52T		Atlas-SNP	.											.	PLEKHA6	115	.	0			c.T155C						PASS	.						117.0	98.0	104.0					1																	204237388		2203	4300	6503	SO:0001583	missense	22874	exon4			CGCTTCATGGAGT	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.155T>C	chr1.hg19:g.204237388A>G	ENSP00000272203:p.Met52Thr	54.0	0.0	.		56.0	23.0	.	NM_014935	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	hg19	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	A	17.34	3.364816	0.61513	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.11385	2.78;2.78	5.67	5.67	0.87782	.	0.042149	0.85682	D	0.000000	T	0.17874	0.0429	M	0.72479	2.2	0.54753	D	0.999986	B	0.14805	0.011	B	0.21708	0.036	T	0.01345	-1.1379	10	0.72032	D	0.01	-31.4344	15.5746	0.76365	1.0:0.0:0.0:0.0	.	52	Q9Y2H5	PKHA6_HUMAN	T	52	ENSP00000272203:M52T;ENSP00000402046:M52T	ENSP00000272203:M52T	M	-	2	0	PLEKHA6	202504011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.693000	0.84214	2.148000	0.66965	0.533000	0.62120	ATG	.	.	.	none		0.622	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
NENF	29937	hgsc.bcm.edu	37	1	212617777	212617777	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:212617777A>G	ENST00000366988.3	+	3	392	c.335A>G	c.(334-336)cAt>cGt	p.H112R	NENF_ENST00000473900.1_3'UTR	NM_013349.4	NP_037481.1	Q9UMX5	NENF_HUMAN	neudesin neurotrophic factor	112	Cytochrome b5 heme-binding.				positive regulation of MAPK cascade (GO:0043410)	extracellular space (GO:0005615)	heme binding (GO:0020037)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(2)	4				all cancers(67;0.00967)|OV - Ovarian serous cystadenocarcinoma(81;0.0108)|GBM - Glioblastoma multiforme(131;0.0325)|Epithelial(68;0.132)		GACCTCACCCATGACACTGTG	0.478																																					p.H112R		Atlas-SNP	.											.	NENF	11	.	0			c.A335G						PASS	.						85.0	76.0	79.0					1																	212617777		2203	4300	6503	SO:0001583	missense	29937	exon3			TCACCCATGACAC		CCDS1505.1	1q32.3	2011-07-05	2011-07-05		ENSG00000117691	ENSG00000117691			30384	protein-coding gene	gene with protein product	"""neudesin"""	611874	"""neuron derived neurotrophic factor"""			9771976, 15605373	Standard	NM_013349		Approved	CIR2, SCIRP10, SPUF	uc001hjd.3	Q9UMX5	OTTHUMG00000036744	ENST00000366988.3:c.335A>G	chr1.hg19:g.212617777A>G	ENSP00000355955:p.His112Arg	118.0	0.0	.		117.0	46.0	.	NM_013349	A1KYQ8|Q53FZ6|Q5TM90	Missense_Mutation	SNP	ENST00000366988.3	hg19	CCDS1505.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.874425	0.33069	.	.	ENSG00000117691	ENST00000366988	T	0.76060	-0.99	5.2	5.2	0.72013	Cytochrome b5 (3);	0.229621	0.45361	D	0.000377	T	0.71484	0.3345	M	0.64997	1.995	0.41696	D	0.989376	P	0.39601	0.68	B	0.36378	0.223	T	0.75614	-0.3257	10	0.54805	T	0.06	-17.1208	15.0799	0.72106	1.0:0.0:0.0:0.0	.	112	Q9UMX5	NENF_HUMAN	R	112	ENSP00000355955:H112R	ENSP00000355955:H112R	H	+	2	0	NENF	210684400	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.415000	0.66411	1.965000	0.57142	0.491000	0.48974	CAT	.	.	.	none		0.478	NENF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089291.1	NM_013349	
EPRS	2058	hgsc.bcm.edu	37	1	220160681	220160681	+	Silent	SNP	T	T	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:220160681T>A	ENST00000366923.3	-	20	3110	c.2841A>T	c.(2839-2841)ggA>ggT	p.G947G	snoU13_ENST00000459217.1_RNA	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	947	3 X 57 AA approximate repeats.|WHEP-TRS 3.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TATACTCTACTCCTATCAAAG	0.378																																					p.G947G		Atlas-SNP	.											.	EPRS	140	.	0			c.A2841T						PASS	.						82.0	81.0	82.0					1																	220160681		2203	4300	6503	SO:0001819	synonymous_variant	2058	exon20			CTCTACTCCTATC	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2841A>T	chr1.hg19:g.220160681T>A		84.0	0.0	.		123.0	53.0	.	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	ENST00000366923.3	hg19	CCDS31027.1																																																																																			.	.	.	none		0.378	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
IBA57	200205	hgsc.bcm.edu	37	1	228362451	228362451	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:228362451G>A	ENST00000366711.3	+	2	402	c.400G>A	c.(400-402)Ggc>Agc	p.G134S	IBA57_ENST00000546123.1_5'UTR|IBA57_ENST00000484749.1_3'UTR	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	134					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						CTCGGTGCAGGGCGCGCTGCA	0.662																																					p.G134S		Atlas-SNP	.											.	IBA57	22	.	0			c.G400A						PASS	.						24.0	24.0	24.0					1																	228362451		2200	4297	6497	SO:0001583	missense	200205	exon2			GTGCAGGGCGCGC	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.400G>A	chr1.hg19:g.228362451G>A	ENSP00000355672:p.Gly134Ser	32.0	0.0	.		25.0	11.0	.	NM_001010867		Missense_Mutation	SNP	ENST00000366711.3	hg19	CCDS31046.1	.	.	.	.	.	.	.	.	.	.	G	8.657	0.899594	0.17686	.	.	ENSG00000181873	ENST00000366711	T	0.41065	1.01	4.65	2.75	0.32379	Glycine cleavage T-protein, N-terminal (1);	0.474372	0.24368	N	0.039124	T	0.26376	0.0644	N	0.21373	0.66	0.80722	D	1	B	0.12013	0.005	B	0.20384	0.029	T	0.04565	-1.0942	10	0.18276	T	0.48	-1.4742	10.0048	0.41951	0.076:0.1384:0.7856:0.0	.	134	Q5T440	CAF17_HUMAN	S	134	ENSP00000355672:G134S	ENSP00000355672:G134S	G	+	1	0	IBA57	226429074	0.998000	0.40836	0.000000	0.03702	0.095000	0.18619	4.116000	0.57871	0.562000	0.29204	0.655000	0.94253	GGC	.	.	.	none		0.662	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095980.1	NM_001010867	
NCOA1	8648	hgsc.bcm.edu	37	2	24896243	24896243	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:24896243A>T	ENST00000406961.1	+	7	917	c.265A>T	c.(265-267)Aca>Tca	p.T89S	NCOA1_ENST00000405141.1_Missense_Mutation_p.T89S|NCOA1_ENST00000348332.3_Missense_Mutation_p.T89S|NCOA1_ENST00000288599.5_Missense_Mutation_p.T89S|NCOA1_ENST00000407230.1_5'UTR|NCOA1_ENST00000395856.3_Missense_Mutation_p.T89S|RNU6-936P_ENST00000384005.1_RNA|NCOA1_ENST00000538539.1_Missense_Mutation_p.T89S			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	89					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAGAAATCAACAACTGATGA	0.343			T	PAX3	alveolar rhadomyosarcoma																																p.T89S		Atlas-SNP	.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1	210	.	0			c.A265T						PASS	.						79.0	82.0	81.0					2																	24896243		2203	4300	6503	SO:0001583	missense	8648	exon5			AAATCAACAACTG	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.265A>T	chr2.hg19:g.24896243A>T	ENSP00000385216:p.Thr89Ser	160.0	0.0	.		172.0	67.0	.	NM_147223	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	hg19	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	A	7.169	0.587162	0.13812	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T	0.01629	4.72;4.72;4.72;4.72;4.72;4.72	4.84	3.68	0.42216	Helix-loop-helix DNA-binding (2);	0.320508	0.31612	N	0.007353	T	0.00580	0.0019	N	0.00446	-1.495	0.29426	N	0.860201	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.14023	0.01;0.005;0.004	T	0.42816	-0.9429	10	0.18276	T	0.48	.	5.8454	0.18663	0.7718:0.0:0.2282:0.0	.	89;89;89	Q15788-3;Q15788;Q15788-2	.;NCOA1_HUMAN;.	S	89	ENSP00000385216:T89S;ENSP00000385097:T89S;ENSP00000444039:T89S;ENSP00000320940:T89S;ENSP00000288599:T89S;ENSP00000379197:T89S	ENSP00000288599:T89S	T	+	1	0	NCOA1	24749747	0.998000	0.40836	1.000000	0.80357	0.977000	0.68977	1.262000	0.32992	2.022000	0.59522	0.459000	0.35465	ACA	.	.	.	none		0.343	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
C2orf71	388939	hgsc.bcm.edu	37	2	29295391	29295391	+	Silent	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:29295391G>A	ENST00000331664.5	-	1	1736	c.1737C>T	c.(1735-1737)agC>agT	p.S579S		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	579					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CACTTACCGTGCTAGGTCTTG	0.612																																					p.S579S		Atlas-SNP	.											.	C2orf71	146	.	0			c.C1737T						PASS	.						41.0	45.0	43.0					2																	29295391		2078	4215	6293	SO:0001819	synonymous_variant	388939	exon1			TACCGTGCTAGGT		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1737C>T	chr2.hg19:g.29295391G>A		63.0	0.0	.		67.0	30.0	.	NM_001029883		Silent	SNP	ENST00000331664.5	hg19	CCDS42669.1																																																																																			.	.	.	none		0.612	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
SP3	6670	hgsc.bcm.edu	37	2	174820133	174820133	+	Silent	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:174820133C>T	ENST00000310015.6	-	4	1637	c.1107G>A	c.(1105-1107)caG>caA	p.Q369Q	SP3_ENST00000483084.1_5'Flank|SP3_ENST00000455789.2_Silent_p.Q316Q|SP3_ENST00000418194.2_Silent_p.Q301Q	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	369	Transactivation domain (Gln-rich).				B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			TATAATTTCCCTGAAGATCTG	0.408																																					p.Q369Q		Atlas-SNP	.											.	SP3	82	.	0			c.G1107A						PASS	.						79.0	76.0	77.0					2																	174820133		2203	4300	6503	SO:0001819	synonymous_variant	6670	exon4			ATTTCCCTGAAGA	M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.1107G>A	chr2.hg19:g.174820133C>T		68.0	0.0	.		62.0	28.0	.	NM_003111	A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Silent	SNP	ENST00000310015.6	hg19	CCDS2254.1	.	.	.	.	.	.	.	.	.	.	C	2.337	-0.351976	0.05173	.	.	ENSG00000172845	ENST00000416195	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	T	0.70937	0.3281	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69072	-0.5242	4	.	.	.	.	14.6237	0.68605	0.1457:0.8543:0.0:0.0	.	.	.	.	K	326	.	.	R	-	2	0	SP3	174528379	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.488000	0.45276	2.670000	0.90874	0.563000	0.77884	AGG	.	.	.	none		0.408	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255452.1	NM_003111	
TTN	7273	hgsc.bcm.edu	37	2	179403955	179403955	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:179403955G>C	ENST00000591111.1	-	303	94008	c.93784C>G	c.(93784-93786)Cct>Gct	p.P31262A	TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P30335A|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P23963A|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P23838A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P32903A|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P24030A|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000588257.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31262	Fibronectin type-III 128. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTCTGGAGGATTGCTTGGA	0.423																																					p.P32903A		Atlas-SNP	.											.	TTN	18412	.	0			c.C98707G						PASS	.						97.0	88.0	91.0					2																	179403955		1895	4108	6003	SO:0001583	missense	7273	exon353			CTGGAGGATTGCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.93784C>G	chr2.hg19:g.179403955G>C	ENSP00000465570:p.Pro31262Ala	71.0	0.0	.		99.0	43.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.73	3.461654	0.63513	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	6.04	5.17	0.71159	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.63570	0.2522	L	0.56340	1.77	0.58432	D	0.999996	D;D;D;D	0.58970	0.984;0.984;0.984;0.984	P;P;P;P	0.56612	0.802;0.802;0.802;0.802	T	0.67699	-0.5603	9	0.87932	D	0	.	15.4494	0.75262	0.0663:0.0:0.9337:0.0	.	23838;23963;24030;31262	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	30335;23838;24030;23963;23835	ENSP00000343764:P30335A;ENSP00000434586:P23838A;ENSP00000340554:P24030A;ENSP00000352154:P23963A	ENSP00000340554:P24030A	P	-	1	0	TTN	179112201	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	1.571000	0.49722	0.563000	0.77884	CCT	.	.	.	none		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PARD3B	117583	hgsc.bcm.edu	37	2	206058030	206058030	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:206058030A>G	ENST00000406610.2	+	15	2333	c.2126A>G	c.(2125-2127)aAg>aGg	p.K709R	PARD3B_ENST00000351153.1_Missense_Mutation_p.K709R|PARD3B_ENST00000358768.2_Missense_Mutation_p.K647R|PARD3B_ENST00000349953.3_Missense_Mutation_p.K709R|PARD3B_ENST00000462231.1_Missense_Mutation_p.K709R	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	709					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		AAAGCCTCGAAGAGCATGGAC	0.478																																					p.K709R		Atlas-SNP	.											.	PARD3B	314	.	0			c.A2126G						PASS	.						63.0	62.0	62.0					2																	206058030		1957	4155	6112	SO:0001583	missense	117583	exon15			CCTCGAAGAGCAT	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.2126A>G	chr2.hg19:g.206058030A>G	ENSP00000385848:p.Lys709Arg	274.0	0.0	.		257.0	126.0	.	NM_205863	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	hg19		.	.	.	.	.	.	.	.	.	.	A	20.4	3.982851	0.74474	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.17370	2.54;2.28;2.71;2.61	5.54	5.54	0.83059	.	0.129926	0.51477	D	0.000098	T	0.32255	0.0823	L	0.58428	1.81	0.43841	D	0.996422	P;D;P;D;P	0.54964	0.669;0.969;0.897;0.958;0.864	B;P;P;P;P	0.56163	0.19;0.585;0.574;0.793;0.523	T	0.01810	-1.1269	10	0.52906	T	0.07	.	14.5322	0.67934	1.0:0.0:0.0:0.0	.	709;709;709;647;709	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	R	709;647;709;709	ENSP00000385848:K709R;ENSP00000351618:K647R;ENSP00000317261:K709R;ENSP00000340280:K709R	ENSP00000340280:K709R	K	+	2	0	PARD3B	205766275	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.958000	0.70330	2.231000	0.72958	0.397000	0.26171	AAG	.	.	.	none		0.478	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	
UGT1A5	54579	hgsc.bcm.edu	37	2	234622434	234622434	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:234622434C>G	ENST00000373414.3	+	1	797	c.797C>G	c.(796-798)cCc>cGc	p.P266R	UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000608381.1_Missense_Mutation_p.P266R|UGT1A6_ENST00000373424.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	266						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		ATGGATTACCCCAGGCCGATC	0.517																																					p.P266R		Atlas-SNP	.											.	UGT1A5	66	.	0			c.C797G						PASS	.						109.0	124.0	119.0					2																	234622434		2201	4295	6496	SO:0001583	missense	54579	exon1			ATTACCCCAGGCC	M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.797C>G	chr2.hg19:g.234622434C>G	ENSP00000362513:p.Pro266Arg	103.0	0.0	.		73.0	38.0	.	NM_019078	B8K294	Missense_Mutation	SNP	ENST00000373414.3	hg19	CCDS33404.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028709	0.75504	.	.	ENSG00000240224	ENST00000373414	T	0.80994	-1.44	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	D	0.93884	0.8043	H	0.98559	4.265	0.58432	D	0.999999	D;D	0.67145	0.996;0.996	D;D	0.72625	0.978;0.978	D	0.96616	0.9456	10	0.87932	D	0	.	17.7257	0.88364	0.0:1.0:0.0:0.0	.	266;266	Q5DSZ9;P35504	.;UD15_HUMAN	R	266	ENSP00000362513:P266R	ENSP00000362513:P266R	P	+	2	0	UGT1A5	234287173	1.000000	0.71417	0.987000	0.45799	0.594000	0.36715	7.529000	0.81952	2.189000	0.69895	0.561000	0.74099	CCC	.	.	.	none		0.517	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130985.1	NM_019078	
MYEOV2	150678	hgsc.bcm.edu	37	2	241073396	241073396	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:241073396C>A	ENST00000607357.1	-	2	108	c.90G>T	c.(88-90)atG>atT	p.M30I	MYEOV2_ENST00000307266.3_Missense_Mutation_p.M61I|MYEOV2_ENST00000489698.1_5'UTR	NM_001163424.1	NP_001156896.1	Q8WXC6	MYOV2_HUMAN	myeloma overexpressed 2	30										breast(1)|lung(5)|pancreas(1)	7		all_epithelial(40;1.56e-11)|Breast(86;0.0002)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.81e-30)|all cancers(36;1.1e-27)|OV - Ovarian serous cystadenocarcinoma(60;2.74e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.54e-06)|Lung(119;0.00361)|LUSC - Lung squamous cell carcinoma(224;0.0153)|Colorectal(34;0.0202)|COAD - Colon adenocarcinoma(134;0.143)		CTGCCAAGTCCATCAAGAGCC	0.488																																					p.M61I		Atlas-SNP	.											.	MYEOV2	20	.	0			c.G183T						PASS	.						106.0	112.0	110.0					2																	241073396		2203	4300	6503	SO:0001583	missense	150678	exon2			CAAGTCCATCAAG	AF453951	CCDS2532.1, CCDS63183.1	2q37.3	2008-02-05			ENSG00000172428	ENSG00000172428			21314	protein-coding gene	gene with protein product							Standard	NM_138336		Approved		uc002vyu.1	Q8WXC6	OTTHUMG00000133352	ENST00000607357.1:c.90G>T	chr2.hg19:g.241073396C>A	ENSP00000475979:p.Met30Ile	88.0	0.0	.		70.0	31.0	.	NM_138336	Q8N110	Missense_Mutation	SNP	ENST00000607357.1	hg19		.	.	.	.	.	.	.	.	.	.	C	18.15	3.558987	0.65538	.	.	ENSG00000172428	ENST00000307266;ENST00000403160	.	.	.	4.55	4.55	0.56014	.	0.000000	0.85682	U	0.000000	T	0.73705	0.3621	.	.	.	0.80722	D	1	B;P	0.44281	0.393;0.831	P;P	0.54664	0.584;0.758	T	0.77120	-0.2705	8	0.62326	D	0.03	-13.8025	15.1841	0.72986	0.0:1.0:0.0:0.0	.	30;61	Q8WXC6;Q8WXC6-1	MYOV2_HUMAN;.	I	61;51	.	ENSP00000304147:M61I	M	-	3	0	MYEOV2	240722069	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.087000	0.71362	2.240000	0.73641	0.650000	0.86243	ATG	.	.	.	none		0.488	MYEOV2-005	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470698.1	NM_138336	
GOLGA4	2803	hgsc.bcm.edu	37	3	37366995	37366995	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:37366995T>A	ENST00000361924.2	+	14	3992	c.3618T>A	c.(3616-3618)ttT>ttA	p.F1206L	GOLGA4_ENST00000356847.4_Missense_Mutation_p.F1228L|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1206	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GCTTGGAATTTAAAAAACTGT	0.348																																					p.F1228L		Atlas-SNP	.											.	GOLGA4	173	.	0			c.T3684A						PASS	.						40.0	42.0	41.0					3																	37366995		2203	4299	6502	SO:0001583	missense	2803	exon15			GGAATTTAAAAAA	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.3618T>A	chr3.hg19:g.37366995T>A	ENSP00000354486:p.Phe1206Leu	243.0	1.0	.		222.0	92.0	.	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	hg19	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	T	3.525	-0.096941	0.07010	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.22134	1.98;1.97;1.97	5.53	2.29	0.28610	.	0.211412	0.24120	N	0.041370	T	0.12646	0.0307	L	0.47190	1.495	0.09310	N	1	B;B;B;B	0.15141	0.012;0.002;0.002;0.007	B;B;B;B	0.14578	0.011;0.003;0.006;0.01	T	0.37979	-0.9682	10	0.02654	T	1	.	4.6894	0.12772	0.0:0.4299:0.161:0.4091	.	1206;1206;1228;1206	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	L	1206;1228;1077	ENSP00000354486:F1206L;ENSP00000349305:F1228L;ENSP00000405842:F1077L	ENSP00000349305:F1228L	F	+	3	2	GOLGA4	37341999	0.022000	0.18835	0.785000	0.31869	0.667000	0.39255	0.082000	0.14847	0.686000	0.31488	-0.468000	0.05107	TTT	.	.	.	none		0.348	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
CCR9	10803	hgsc.bcm.edu	37	3	45942619	45942619	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:45942619G>T	ENST00000357632.2	+	3	519	c.339G>T	c.(337-339)aaG>aaT	p.K113N	CCR9_ENST00000355983.2_Missense_Mutation_p.K101N|LZTFL1_ENST00000536047.1_Intron|Y_RNA_ENST00000364765.1_RNA|CCR9_ENST00000395963.2_Missense_Mutation_p.K101N|LZTFL1_ENST00000539217.1_Intron|CCR9_ENST00000422395.1_3'UTR	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	113					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		ACCAGTGGAAGTTCCAGACCT	0.483																																					p.K113N		Atlas-SNP	.											.	CCR9	45	.	0			c.G339T						PASS	.						200.0	188.0	192.0					3																	45942619		2203	4300	6503	SO:0001583	missense	10803	exon3			GTGGAAGTTCCAG	AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.339G>T	chr3.hg19:g.45942619G>T	ENSP00000350256:p.Lys113Asn	89.0	0.0	.		82.0	34.0	.	NM_031200	Q4VBM3|Q549E0|Q9UQQ6	Missense_Mutation	SNP	ENST00000357632.2	hg19	CCDS2732.1	.	.	.	.	.	.	.	.	.	.	G	4.329	0.060379	0.08339	.	.	ENSG00000173585	ENST00000357632;ENST00000395963;ENST00000355983	T;T;T	0.37058	1.22;1.22;1.22	4.96	-3.74	0.04385	GPCR, rhodopsin-like superfamily (1);	0.949681	0.08862	N	0.882804	T	0.18299	0.0439	N	0.20685	0.6	0.09310	N	0.999997	B	0.14438	0.01	B	0.16722	0.016	T	0.28459	-1.0043	10	0.21014	T	0.42	.	5.4602	0.16612	0.1717:0.1145:0.5256:0.1882	.	113	P51686	CCR9_HUMAN	N	113;101;101	ENSP00000350256:K113N;ENSP00000379292:K101N;ENSP00000348260:K101N	ENSP00000348260:K101N	K	+	3	2	CCR9	45917623	0.000000	0.05858	0.343000	0.25615	0.801000	0.45260	-0.482000	0.06544	-0.736000	0.04831	-1.166000	0.01754	AAG	.	.	.	none		0.483	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257323.2		
LSMEM2	132228	hgsc.bcm.edu	37	3	50324199	50324199	+	Silent	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:50324199C>T	ENST00000316436.3	+	3	354	c.267C>T	c.(265-267)tgC>tgT	p.C89C		NM_153215.1	NP_694947.1	Q8N112	LSME2_HUMAN	leucine-rich single-pass membrane protein 2	89						integral component of membrane (GO:0016021)											AGGCTGGCTGCAGCCCTGTGT	0.632																																					p.C89C		Atlas-SNP	.											.	.	.	.	0			c.C267T						PASS	.						78.0	76.0	76.0					3																	50324199		2203	4300	6503	SO:0001819	synonymous_variant	0	exon3			TGGCTGCAGCCCT	AK095927	CCDS2814.1	3p21.31	2013-03-08	2013-03-08	2013-03-08	ENSG00000179564	ENSG00000179564			26781	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 45"""	C3orf45			Standard	NM_153215		Approved	FLJ38608	uc003cyz.3	Q8N112	OTTHUMG00000156938	ENST00000316436.3:c.267C>T	chr3.hg19:g.50324199C>T		67.0	0.0	.		38.0	19.0	.	NM_153215		Silent	SNP	ENST00000316436.3	hg19	CCDS2814.1																																																																																			.	.	.	none		0.632	LSMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346671.1	NM_153215	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376476	113376476	+	Silent	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:113376476G>A	ENST00000478658.1	-	5	4070	c.4053C>T	c.(4051-4053)ccC>ccT	p.P1351P	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.P1351P			Q68DE3	K2018_HUMAN	KIAA2018	1351						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CAAGCCTGAGGGGGGCTGGCT	0.473																																					p.P1351P		Atlas-SNP	.											.	KIAA2018	180	.	0			c.C4053T						PASS	.						99.0	97.0	98.0					3																	113376476		1966	4162	6128	SO:0001819	synonymous_variant	205717	exon7			CCTGAGGGGGGCT	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4053C>T	chr3.hg19:g.113376476G>A		60.0	0.0	.		50.0	27.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	none		0.473	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
GOLGB1	2804	hgsc.bcm.edu	37	3	121413729	121413729	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:121413729G>T	ENST00000340645.5	-	13	5751	c.5626C>A	c.(5626-5628)Cag>Aag	p.Q1876K	GOLGB1_ENST00000393667.3_Missense_Mutation_p.Q1881K	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1876					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		GTTGATATCTGACTCAGTAAG	0.368																																					p.Q1881K		Atlas-SNP	.											.	GOLGB1	319	.	0			c.C5641A						PASS	.						133.0	150.0	144.0					3																	121413729		2203	4300	6503	SO:0001583	missense	2804	exon13			ATATCTGACTCAG	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5626C>A	chr3.hg19:g.121413729G>T	ENSP00000341848:p.Gln1876Lys	98.0	0.0	.		102.0	38.0	.	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	6.523	0.464725	0.12402	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.15952	2.38;2.38	5.92	5.04	0.67666	.	0.129584	0.35407	N	0.003230	T	0.33411	0.0862	M	0.65975	2.015	0.35168	D	0.771267	D;B;B;D	0.67145	0.996;0.112;0.112;0.988	D;B;B;P	0.72982	0.979;0.032;0.032;0.794	T	0.44421	-0.9329	10	0.19590	T	0.45	.	8.3617	0.32363	0.0812:0.1576:0.7612:0.0	.	1801;1881;1881;1876	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	K	1876;1881	ENSP00000341848:Q1876K;ENSP00000377275:Q1881K	ENSP00000341848:Q1876K	Q	-	1	0	GOLGB1	122896419	0.004000	0.15560	0.986000	0.45419	0.247000	0.25773	0.789000	0.26886	1.459000	0.47892	0.650000	0.86243	CAG	.	.	.	none		0.368	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
MAGEF1	64110	hgsc.bcm.edu	37	3	184428920	184428920	+	Silent	SNP	A	A	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:184428920A>C	ENST00000317897.3	-	1	916	c.690T>G	c.(688-690)ccT>ccG	p.P230P		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	230	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			GATTGGTGTGAGGCACCCGCC	0.488																																					p.P230P		Atlas-SNP	.											.	MAGEF1	27	.	0			c.T690G						PASS	.						53.0	60.0	58.0					3																	184428920		2203	4300	6503	SO:0001819	synonymous_variant	64110	exon1			GGTGTGAGGCACC	AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.690T>G	chr3.hg19:g.184428920A>C		104.0	0.0	.		91.0	46.0	.	NM_022149	Q9H215	Silent	SNP	ENST00000317897.3	hg19	CCDS3269.1																																																																																			.	.	.	none		0.488	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1	NM_022149	
DGKG	1608	hgsc.bcm.edu	37	3	185969621	185969621	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:185969621A>G	ENST00000265022.3	-	19	2227	c.1688T>C	c.(1687-1689)aTc>aCc	p.I563T	DGKG_ENST00000344484.4_Missense_Mutation_p.I538T|DGKG_ENST00000544847.1_Missense_Mutation_p.I504T|DGKG_ENST00000382164.4_Missense_Mutation_p.I524T	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	563	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CTCTCTGGGGATGACTTCCAG	0.507																																					p.I563T		Atlas-SNP	.											.	DGKG	98	.	0			c.T1688C						PASS	.						183.0	170.0	174.0					3																	185969621		2203	4300	6503	SO:0001583	missense	1608	exon19			CTGGGGATGACTT	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1688T>C	chr3.hg19:g.185969621A>G	ENSP00000265022:p.Ile563Thr	101.0	0.0	.		97.0	4.0	.	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	hg19	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	A	7.945	0.743641	0.15642	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	D;D;D;T	0.83075	-1.5;-1.51;-1.68;-1.35	5.06	-0.278	0.12894	Diacylglycerol kinase, catalytic domain (1);	0.549028	0.18794	N	0.130972	T	0.56702	0.2003	N	0.04335	-0.225	0.34056	D	0.656773	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.12837	0.004;0.008;0.004;0.002	T	0.47861	-0.9084	10	0.11485	T	0.65	.	5.7195	0.17978	0.5853:0.2645:0.1503:0.0	.	504;538;524;563	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	T	563;538;524;504;527	ENSP00000265022:I563T;ENSP00000339777:I538T;ENSP00000371599:I524T;ENSP00000440507:I504T	ENSP00000265022:I563T	I	-	2	0	DGKG	187452315	0.998000	0.40836	0.994000	0.49952	0.996000	0.88848	1.589000	0.36644	0.065000	0.16485	0.383000	0.25322	ATC	.	.	.	none		0.507	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
PCDH10	57575	hgsc.bcm.edu	37	4	134072496	134072496	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr4:134072496G>T	ENST00000264360.5	+	1	2027	c.1201G>T	c.(1201-1203)Gtg>Ttg	p.V401L	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	401	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		ACTGGGAGACGTGCCTTTCCG	0.607																																					p.V401L		Atlas-SNP	.											.	PCDH10	290	.	0			c.G1201T						PASS	.						139.0	140.0	140.0					4																	134072496		2203	4300	6503	SO:0001583	missense	57575	exon1			GGAGACGTGCCTT	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1201G>T	chr4.hg19:g.134072496G>T	ENSP00000264360:p.Val401Leu	72.0	0.0	.		66.0	29.0	.	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	hg19	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134716	0.21123	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.51071	0.72	4.68	4.68	0.58851	Cadherin (4);Cadherin-like (1);	0.000000	0.40818	N	0.001004	T	0.44685	0.1305	L	0.35487	1.065	0.52501	D	0.999955	P;B	0.36354	0.549;0.004	P;B	0.46659	0.523;0.018	T	0.18429	-1.0337	10	0.05721	T	0.95	.	17.3997	0.87456	0.0:0.0:1.0:0.0	.	401;401	Q9P2E7;Q96SF0	PCD10_HUMAN;.	L	401	ENSP00000264360:V401L	ENSP00000264360:V401L	V	+	1	0	PCDH10	134291946	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.674000	0.83992	2.423000	0.82170	0.561000	0.74099	GTG	.	.	.	none		0.607	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
GPM6A	2823	hgsc.bcm.edu	37	4	176556203	176556203	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr4:176556203G>T	ENST00000280187.7	-	8	735	c.690C>A	c.(688-690)caC>caA	p.H230Q	GPM6A_ENST00000393658.2_Missense_Mutation_p.H230Q|GPM6A_ENST00000515090.1_Missense_Mutation_p.H223Q|GPM6A_ENST00000506894.1_Missense_Mutation_p.H219Q|GPM6A_ENST00000506219.1_5'UTR	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	230					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CCATAAGGTAGTGAACCTAAT	0.403																																					p.H230Q		Atlas-SNP	.											.	GPM6A	70	.	0			c.C690A						PASS	.						61.0	59.0	59.0					4																	176556203		2203	4300	6503	SO:0001583	missense	2823	exon7			AAGGTAGTGAACC		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.690C>A	chr4.hg19:g.176556203G>T	ENSP00000280187:p.His230Gln	38.0	0.0	.		28.0	11.0	.	NM_201591	B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	ENST00000280187.7	hg19	CCDS3824.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714211	0.68730	.	.	ENSG00000150625	ENST00000280187;ENST00000393658;ENST00000506894;ENST00000515090	D;D;D;D	0.99176	-5.52;-5.52;-5.52;-5.52	5.77	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.98651	0.9548	L	0.55990	1.75	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.81914	0.995;0.995;0.995	D	0.96785	0.9578	10	0.26408	T	0.33	-20.0308	10.7457	0.46179	0.1426:0.0:0.8574:0.0	.	223;219;230	B7Z642;E9PHI5;P51674	.;.;GPM6A_HUMAN	Q	230;230;219;223	ENSP00000280187:H230Q;ENSP00000377268:H230Q;ENSP00000421578:H219Q;ENSP00000423984:H223Q	ENSP00000280187:H230Q	H	-	3	2	GPM6A	176793197	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.806000	0.38892	2.885000	0.99019	0.655000	0.94253	CAC	.	.	.	none		0.403	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1		
WDR17	116966	hgsc.bcm.edu	37	4	177098622	177098622	+	Splice_Site	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr4:177098622A>G	ENST00000280190.4	+	30	3822	c.3666A>G	c.(3664-3666)agA>agG	p.R1222R	WDR17_ENST00000393643.2_Splice_Site_p.R1198R|WDR17_ENST00000507824.2_Splice_Site_p.R1197R|WDR17_ENST00000508596.1_Splice_Site_p.R1183R			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1222										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GAAAATATAGATCATTAGAAG	0.299																																					p.R1222R		Atlas-SNP	.											.	WDR17	198	.	0			c.A3666G						PASS	.						60.0	69.0	66.0					4																	177098622		2201	4296	6497	SO:0001630	splice_region_variant	116966	exon30			ATATAGATCATTA	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3666-1A>G	chr4.hg19:g.177098622A>G		124.0	0.0	.		100.0	40.0	.	NM_170710	E7EQX0|Q0QD35	Silent	SNP	ENST00000280190.4	hg19	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	A	9.886	1.202950	0.22121	.	.	ENSG00000150627	ENST00000443118	.	.	.	5.6	0.312	0.15837	.	.	.	.	.	T	0.51483	0.1677	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36915	-0.9728	4	.	.	.	.	5.914	0.19045	0.5729:0.2349:0.1922:0.0	.	.	.	.	V	457	.	.	I	+	1	0	WDR17	177335616	0.984000	0.35163	0.979000	0.43373	0.803000	0.45373	0.955000	0.29188	-0.046000	0.13446	0.524000	0.50904	ATC	.	.	.	none		0.299	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		Silent
PLEKHG4B	153478	hgsc.bcm.edu	37	5	163420	163421	+	Missense_Mutation	DNP	AA	AA	TT			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:163420_163421AA>TT	ENST00000283426.6	+	11	2215_2216	c.2165_2166AA>TT	c.(2164-2166)aAA>aTT	p.K722I		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	722							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CCCCAGAAGAAAATGATAAAGA	0.609																																					p.K722I|p.K722N		Atlas-SNP	.											.	PLEKHG4B	167	.	0			c.A2165T|c.A2166T						PASS	.																																			SO:0001583	missense	153478	exon11			AGAAGAAAATGAT|GAAGAAAATGATA	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	Exception_encountered	chr5.hg19:g.163420_163421delinsTT	ENSP00000283426:p.Lys722Ile	133.0|132.0	0.0	.		86.0	38.0|39.0	.	NM_052909		Missense_Mutation	SNP	ENST00000283426.6	hg19	CCDS34124.1																																																																																			.	.	.	none		0.609	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
NIPBL	25836	hgsc.bcm.edu	37	5	37049326	37049326	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:37049326A>G	ENST00000282516.8	+	40	7376	c.6877A>G	c.(6877-6879)Acc>Gcc	p.T2293A	NIPBL_ENST00000448238.2_Missense_Mutation_p.T2293A	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2293					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			ATTTTTTCACACCCAGTCAAG	0.413																																					p.T2293A		Atlas-SNP	.											.	NIPBL	513	.	0			c.A6877G						PASS	.						224.0	213.0	216.0					5																	37049326		2203	4300	6503	SO:0001583	missense	25836	exon40			TTTCACACCCAGT	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6877A>G	chr5.hg19:g.37049326A>G	ENSP00000282516:p.Thr2293Ala	72.0	0.0	.		75.0	39.0	.	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	hg19	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	7.931	0.740748	0.15642	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.95307	-3.67;-3.67	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.052442	0.64402	D	0.000001	D	0.88194	0.6371	N	0.11560	0.145	0.40370	D	0.979331	B;B	0.25486	0.127;0.104	B;B	0.33960	0.173;0.084	D	0.84616	0.0681	10	0.07990	T	0.79	-4.9512	15.6935	0.77473	1.0:0.0:0.0:0.0	.	2293;2293	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	A	2293	ENSP00000282516:T2293A;ENSP00000406266:T2293A	ENSP00000282516:T2293A	T	+	1	0	NIPBL	37085083	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.929000	0.70096	2.109000	0.64355	0.477000	0.44152	ACC	.	.	.	none		0.413	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
MAST4	375449	hgsc.bcm.edu	37	5	66461904	66461904	+	Silent	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:66461904G>A	ENST00000403625.2	+	29	7192	c.6897G>A	c.(6895-6897)gaG>gaA	p.E2299E	MAST4_ENST00000405643.1_Silent_p.E2120E|MAST4_ENST00000261569.7_Silent_p.E2105E|MAST4_ENST00000403666.1_Silent_p.E2110E|MAST4_ENST00000404260.3_Silent_p.E2302E	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2302						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AGGTGCTGGAGAAGCCTGTGC	0.622											OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E2299E		Atlas-SNP	.											.	MAST4	218	.	0			c.G6897A						PASS	.						21.0	27.0	25.0					5																	66461904		1916	4110	6026	SO:0001819	synonymous_variant	375449	exon29			GCTGGAGAAGCCT	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.6897G>A	chr5.hg19:g.66461904G>A		92.0	0.0	.	1092	65.0	21.0	.	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	hg19	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	G	2.764	-0.257184	0.05791	.	.	ENSG00000069020	ENST00000443808	T	0.04862	3.54	4.27	1.4	0.22301	.	0.737317	0.12126	N	0.497250	T	0.08447	0.0210	.	.	.	0.19300	N	0.99998	.	.	.	.	.	.	T	0.30679	-0.9970	7	0.66056	D	0.02	-8.1738	6.124	0.20170	0.1728:0.293:0.5342:0.0	.	.	.	.	K	1356	ENSP00000400551:E1356K	ENSP00000400551:E1356K	E	+	1	0	MAST4	66497660	0.738000	0.28186	0.006000	0.13384	0.014000	0.08584	0.180000	0.16860	0.511000	0.28236	0.462000	0.41574	GAA	.	.	.	none		0.622	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
CD180	4064	hgsc.bcm.edu	37	5	66479076	66479076	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:66479076A>G	ENST00000256447.4	-	3	1752	c.1595T>C	c.(1594-1596)cTg>cCg	p.L532P	CTD-2306M10.1_ENST00000602471.1_lincRNA	NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	532					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		GTCGCATGTCAGGCTGTTGTG	0.473																																					p.L532P		Atlas-SNP	.											.	CD180	78	.	0			c.T1595C						PASS	.						87.0	59.0	68.0					5																	66479076		2203	4300	6503	SO:0001583	missense	4064	exon3			CATGTCAGGCTGT	D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.1595T>C	chr5.hg19:g.66479076A>G	ENSP00000256447:p.Leu532Pro	117.0	0.0	.		104.0	37.0	.	NM_005582	B2R7Z7|Q32MM5	Missense_Mutation	SNP	ENST00000256447.4	hg19	CCDS3992.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.962783	0.53507	.	.	ENSG00000134061	ENST00000256447	T	0.69435	-0.4	4.95	4.95	0.65309	.	0.117810	0.35378	N	0.003258	D	0.87148	0.6105	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91268	0.5042	10	0.87932	D	0	.	14.7906	0.69841	1.0:0.0:0.0:0.0	.	532	Q99467	CD180_HUMAN	P	532	ENSP00000256447:L532P	ENSP00000256447:L532P	L	-	2	0	CD180	66514832	0.728000	0.28080	0.946000	0.38457	0.663000	0.39108	6.357000	0.73051	2.076000	0.62316	0.460000	0.39030	CTG	.	.	.	none		0.473	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
NRG2	9542	hgsc.bcm.edu	37	5	139422438	139422438	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:139422438G>T	ENST00000361474.1	-	1	441	c.217C>A	c.(217-219)Ccc>Acc	p.P73T	NRG2_ENST00000541337.1_Missense_Mutation_p.P73T|NRG2_ENST00000289409.4_Missense_Mutation_p.P73T|NRG2_ENST00000394770.1_Missense_Mutation_p.P73T|NRG2_ENST00000545385.1_Missense_Mutation_p.P73T|NRG2_ENST00000289422.7_Missense_Mutation_p.P73T|NRG2_ENST00000358522.3_Missense_Mutation_p.P73T	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	73					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gggctgcggggctgcggCTGT	0.746																																					p.P73T		Atlas-SNP	.											.	NRG2	69	.	0			c.C217A						PASS	.						1.0	2.0	1.0					5																	139422438		838	1656	2494	SO:0001583	missense	9542	exon1			TGCGGGGCTGCGG		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.217C>A	chr5.hg19:g.139422438G>T	ENSP00000354910:p.Pro73Thr	3.0	0.0	.		6.0	4.0	.	NM_013982		Missense_Mutation	SNP	ENST00000361474.1	hg19	CCDS4217.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122733	0.37436	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000289409;ENST00000358522;ENST00000378238	T;T;T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	4.1	4.1	0.47936	.	1.266670	0.05928	N	0.634708	T	0.66025	0.2748	N	0.08118	0	0.38024	D	0.934932	B;B;B;B	0.33103	0.397;0.276;0.397;0.397	B;B;B;B	0.31614	0.133;0.037;0.133;0.08	T	0.51076	-0.8751	10	0.15066	T	0.55	-6.9595	14.2466	0.65993	0.0:0.0:1.0:0.0	.	73;73;73;73	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	T	73	ENSP00000444235:P73T;ENSP00000289422:P73T;ENSP00000354910:P73T;ENSP00000438753:P73T;ENSP00000378251:P73T;ENSP00000289409:P73T;ENSP00000351323:P73T;ENSP00000367483:P73T	ENSP00000289409:P73T	P	-	1	0	NRG2	139402622	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.579000	0.74036	2.133000	0.65898	0.491000	0.48974	CCC	.	.	.	none		0.746	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140857046	140857046	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:140857046C>T	ENST00000308177.3	+	1	1467	c.1363C>T	c.(1363-1365)Cca>Tca	p.P455S	PCDHGA12_ENST00000252085.3_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA11_ENST00000398587.2_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	455	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACAACCCTCCACAATCTTC	0.527																																					p.P455S		Atlas-SNP	.											.	PCDHGC3	173	.	0			c.C1363T						PASS	.						146.0	149.0	148.0					5																	140857046		2203	4300	6503	SO:0001583	missense	5098	exon1			AACCCTCCACAAT	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.1363C>T	chr5.hg19:g.140857046C>T	ENSP00000312070:p.Pro455Ser	243.0	0.0	.		211.0	14.0	.	NM_032402	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	hg19	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050852	0.75960	.	.	ENSG00000240184	ENST00000308177	D	0.84800	-1.9	5.19	5.19	0.71726	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.96821	0.8962	H	0.99948	5.02	0.46586	D	0.999111	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.98483	1.0606	9	0.87932	D	0	.	19.2755	0.94030	0.0:1.0:0.0:0.0	.	455;455	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	S	455	ENSP00000312070:P455S	ENSP00000312070:P455S	P	+	1	0	PCDHGC3	140837230	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.575000	0.82447	2.865000	0.98341	0.655000	0.94253	CCA	.	.	.	none		0.527	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
SLC36A2	153201	hgsc.bcm.edu	37	5	150726918	150726918	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:150726918G>C	ENST00000335244.4	-	1	233	c.104C>G	c.(103-105)tCt>tGt	p.S35C	SLC36A2_ENST00000521967.1_Missense_Mutation_p.S35C	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	35					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	CAAGAATGTAGAGTCCTTGTT	0.478																																					p.S35C		Atlas-SNP	.											.	SLC36A2	71	.	0			c.C104G						PASS	.						206.0	200.0	202.0					5																	150726918		2203	4300	6503	SO:0001583	missense	153201	exon1			AATGTAGAGTCCT	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.104C>G	chr5.hg19:g.150726918G>C	ENSP00000334223:p.Ser35Cys	164.0	0.0	.		141.0	61.0	.	NM_181776	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	ENST00000335244.4	hg19	CCDS4315.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432660	0.25813	.	.	ENSG00000186335	ENST00000335244;ENST00000521967	T;T	0.10960	3.63;2.82	4.87	2.96	0.34315	.	0.318730	0.31188	N	0.008086	T	0.11965	0.0291	N	0.24115	0.695	0.09310	N	0.999999	D;D;P	0.69078	0.997;0.969;0.829	P;P;P	0.56865	0.808;0.682;0.502	T	0.05550	-1.0878	10	0.52906	T	0.07	-9.6566	5.61	0.17400	0.0989:0.0:0.7072:0.1939	.	35;35;35	B4DMY0;E5RJJ5;Q495M3	.;.;S36A2_HUMAN	C	35	ENSP00000334223:S35C;ENSP00000430535:S35C	ENSP00000334223:S35C	S	-	2	0	SLC36A2	150707111	0.031000	0.19500	0.015000	0.15790	0.074000	0.17049	1.709000	0.37909	1.405000	0.46838	0.655000	0.94253	TCT	.	.	.	none		0.478	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1		
UIMC1	51720	hgsc.bcm.edu	37	5	176395811	176395811	+	Silent	SNP	A	A	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr5:176395811A>T	ENST00000377227.4	-	6	1077	c.945T>A	c.(943-945)ctT>ctA	p.L315L	UIMC1_ENST00000511320.1_Silent_p.L315L|UIMC1_ENST00000377219.2_Silent_p.L315L|UIMC1_ENST00000503273.1_5'UTR|UIMC1_ENST00000506128.1_Intron			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	315	AIR.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)			NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTTTTTATTAAGGAGCTGCC	0.458																																					p.L315L		Atlas-SNP	.											.	UIMC1	55	.	0			c.T945A						PASS	.						59.0	60.0	60.0					5																	176395811		2203	4300	6503	SO:0001819	synonymous_variant	51720	exon6			TTTATTAAGGAGC	AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.945T>A	chr5.hg19:g.176395811A>T		89.0	0.0	.		92.0	39.0	.	NM_016290	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Silent	SNP	ENST00000377227.4	hg19	CCDS4408.1																																																																																			.	.	.	none		0.458	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253422.1	NM_016290	
VWA7	80737	hgsc.bcm.edu	37	6	31744458	31744458	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr6:31744458G>C	ENST00000375688.4	-	2	299	c.99C>G	c.(97-99)atC>atG	p.I33M	VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Missense_Mutation_p.I33M|Y_RNA_ENST00000364685.1_RNA|VWA7_ENST00000447450.1_Missense_Mutation_p.I33M			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	33						extracellular region (GO:0005576)											GCAGGCTCCAGATGTTGGGGA	0.652																																					p.I33M		Atlas-SNP	.											.	.	.	.	0			c.C99G						PASS	.						11.0	6.0	8.0					6																	31744458		1433	2570	4003	SO:0001583	missense	80737	exon2			GCTCCAGATGTTG		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.99C>G	chr6.hg19:g.31744458G>C	ENSP00000364840:p.Ile33Met	120.0	0.0	.		80.0	45.0	.	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	hg19	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	G	17.62	3.433786	0.62955	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.14893	2.47;2.47;2.47	5.07	5.07	0.68467	.	0.189670	0.43747	D	0.000529	T	0.11452	0.0279	L	0.36672	1.1	0.31565	N	0.657011	P	0.41131	0.739	P	0.44518	0.452	T	0.01675	-1.1298	10	0.72032	D	0.01	-11.1767	15.9908	0.80202	0.0:0.0:1.0:0.0	.	33	Q9Y334	G7C_HUMAN	M	33	ENSP00000364840:I33M;ENSP00000364838:I33M;ENSP00000390554:I33M	ENSP00000364838:I33M	I	-	3	3	C6orf27	31852437	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.076000	0.41548	2.646000	0.89796	0.557000	0.71058	ATC	.	.	.	none		0.652	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
PPT2	9374	hgsc.bcm.edu	37	6	32122818	32122818	+	Silent	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr6:32122818G>T	ENST00000324816.6	+	3	763	c.195G>T	c.(193-195)ggG>ggT	p.G65G	PPT2-EGFL8_ENST00000453656.2_3'UTR|PRRT1_ENST00000375152.2_5'Flank|PPT2_ENST00000375137.2_Silent_p.G65G|PPT2_ENST00000375143.2_Silent_p.G65G|PRRT1_ENST00000375150.2_5'Flank|PPT2_ENST00000395523.1_Silent_p.G65G|PPT2_ENST00000493548.1_3'UTR|PPT2_ENST00000437001.2_Intron|PPT2_ENST00000361568.2_Silent_p.G71G|PPT2_ENST00000445576.2_Silent_p.G65G|PPT2-EGFL8_ENST00000422437.1_Silent_p.G65G			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	65					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						CACACCCCGGGACTGTGGTGA	0.622																																					p.G71G		Atlas-SNP	.											.	PPT2	19	.	0			c.G213T						PASS	.						75.0	72.0	73.0					6																	32122818		1509	2708	4217	SO:0001819	synonymous_variant	9374	exon3			CCCCGGGACTGTG	AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.195G>T	chr6.hg19:g.32122818G>T		96.0	0.0	.		93.0	48.0	.	NM_138717	A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Silent	SNP	ENST00000324816.6	hg19	CCDS4742.1																																																																																			.	.	.	none		0.622	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076552.4	NM_138717	
TRERF1	55809	hgsc.bcm.edu	37	6	42204006	42204006	+	Silent	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr6:42204006C>A	ENST00000372922.4	-	16	3565	c.3003G>T	c.(3001-3003)ccG>ccT	p.P1001P	TRERF1_ENST00000354325.2_Silent_p.P918P|TRERF1_ENST00000541110.1_Silent_p.P1021P|TRERF1_ENST00000340840.2_Silent_p.P918P|TRERF1_ENST00000372917.4_Silent_p.P918P	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1001	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCTGCAGGGGCGGCCCCTCCG	0.617																																					p.P1001P		Atlas-SNP	.											.	TRERF1	124	.	0			c.G3003T						PASS	.						44.0	50.0	48.0					6																	42204006		2203	4300	6503	SO:0001819	synonymous_variant	55809	exon16			CAGGGGCGGCCCC	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3003G>T	chr6.hg19:g.42204006C>A		107.0	0.0	.		82.0	33.0	.	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	ENST00000372922.4	hg19	CCDS4867.1																																																																																			.	.	.	none		0.617	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
EYS	346007	hgsc.bcm.edu	37	6	65301559	65301559	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr6:65301559C>A	ENST00000370621.3	-	26	4727	c.4201G>T	c.(4201-4203)Gat>Tat	p.D1401Y	EYS_ENST00000370616.2_Missense_Mutation_p.D1401Y|EYS_ENST00000503581.1_Missense_Mutation_p.D1401Y			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1401					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AAAATAAAATCTGACATTAAG	0.398																																					p.D1401Y		Atlas-SNP	.											.	EYS	527	.	0			c.G4201T						PASS	.						71.0	67.0	68.0					6																	65301559		692	1591	2283	SO:0001583	missense	346007	exon26			TAAAATCTGACAT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4201G>T	chr6.hg19:g.65301559C>A	ENSP00000359655:p.Asp1401Tyr	77.0	0.0	.		81.0	31.0	.	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	C	12.58	1.980085	0.34942	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.85258	-1.96;-1.94;-1.94	5.74	2.61	0.31194	.	.	.	.	.	T	0.70631	0.3246	N	0.08118	0	0.80722	D	1	D;D	0.65815	0.995;0.976	P;P	0.61201	0.885;0.556	T	0.73375	-0.4002	9	0.66056	D	0.02	.	5.5222	0.16939	0.0:0.6394:0.1555:0.2051	.	1401;1401	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	Y	1401	ENSP00000424243:D1401Y;ENSP00000359655:D1401Y;ENSP00000359650:D1401Y	ENSP00000359650:D1401Y	D	-	1	0	EYS	65358280	0.961000	0.32948	0.110000	0.21437	0.785000	0.44390	-0.091000	0.11146	0.206000	0.20587	0.591000	0.81541	GAT	.	.	.	none		0.398	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
KPNA5	3841	hgsc.bcm.edu	37	6	117043373	117043373	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr6:117043373T>G	ENST00000368564.1	+	9	989	c.841T>G	c.(841-843)Tat>Gat	p.Y281D	KPNA5_ENST00000356348.1_Missense_Mutation_p.Y281D			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	278					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		GGCCCTTTCTTATCTCTCCGA	0.413																																					p.Y281D		Atlas-SNP	.											.	KPNA5	57	.	0			c.T841G						PASS	.						151.0	132.0	138.0					6																	117043373		2203	4300	6503	SO:0001583	missense	3841	exon9			CTTTCTTATCTCT	AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.841T>G	chr6.hg19:g.117043373T>G	ENSP00000357552:p.Tyr281Asp	84.0	0.0	.		79.0	36.0	.	NM_002269	B2RAI5|Q86X23	Missense_Mutation	SNP	ENST00000368564.1	hg19	CCDS5111.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855264	0.91355	.	.	ENSG00000196911	ENST00000368564;ENST00000356348	T;T	0.70282	-0.47;-0.47	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.077905	0.52532	D	0.000062	D	0.85999	0.5828	M	0.92970	3.365	0.54753	D	0.999981	D	0.89917	1.0	D	0.91635	0.999	D	0.89578	0.3818	10	0.87932	D	0	.	16.1671	0.81777	0.0:0.0:0.0:1.0	.	278	O15131	IMA5_HUMAN	D	281	ENSP00000357552:Y281D;ENSP00000348704:Y281D	ENSP00000348704:Y281D	Y	+	1	0	KPNA5	117150066	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.414000	0.80117	2.224000	0.72417	0.528000	0.53228	TAT	.	.	.	none		0.413	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041967.1	NM_002269	
GPRC6A	222545	hgsc.bcm.edu	37	6	117127768	117127768	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr6:117127768A>T	ENST00000310357.3	-	3	1121	c.1100T>A	c.(1099-1101)gTc>gAc	p.V367D	GPRC6A_ENST00000368549.3_Missense_Mutation_p.V367D|GPRC6A_ENST00000530250.1_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	367					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		AGTGTCCTTGACATATGCGCA	0.403																																					p.V367D		Atlas-SNP	.											.	GPRC6A	152	.	0			c.T1100A						PASS	.						103.0	93.0	96.0					6																	117127768		2203	4299	6502	SO:0001583	missense	222545	exon3			TCCTTGACATATG	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1100T>A	chr6.hg19:g.117127768A>T	ENSP00000309493:p.Val367Asp	61.0	0.0	.		84.0	37.0	.	NM_148963	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	hg19	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417587	0.25552	.	.	ENSG00000173612	ENST00000310357;ENST00000368549	D;D	0.85556	-2.0;-2.0	5.18	0.0122	0.14090	Extracellular ligand-binding receptor (1);	0.459032	0.18165	N	0.149641	T	0.60444	0.2269	N	0.25647	0.755	0.09310	N	1	P;P	0.44946	0.846;0.794	P;P	0.46629	0.466;0.522	T	0.62969	-0.6741	10	0.12430	T	0.62	.	9.2807	0.37727	0.7229:0.0:0.2771:0.0	.	367;367	Q5T6X5-3;Q5T6X5	.;GPC6A_HUMAN	D	367	ENSP00000309493:V367D;ENSP00000357537:V367D	ENSP00000309493:V367D	V	-	2	0	GPRC6A	117234461	0.000000	0.05858	0.058000	0.19502	0.605000	0.37080	0.342000	0.19926	-0.057000	0.13199	0.528000	0.53228	GTC	.	.	.	none		0.403	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
GPR126	57211	hgsc.bcm.edu	37	6	142691326	142691326	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr6:142691326T>A	ENST00000230173.6	+	4	941	c.465T>A	c.(463-465)aaT>aaA	p.N155K	GPR126_ENST00000545477.1_3'UTR|GPR126_ENST00000367608.2_Missense_Mutation_p.N155K|GPR126_ENST00000367609.3_Missense_Mutation_p.N155K|GPR126_ENST00000296932.8_Missense_Mutation_p.N155K	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	155	Pentaxin.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CCTTAAGGAATCAAAAGGTCA	0.408																																					p.N155K		Atlas-SNP	.											.	GPR126	192	.	0			c.T465A						PASS	.						108.0	96.0	100.0					6																	142691326		1894	4119	6013	SO:0001583	missense	57211	exon4			AAGGAATCAAAAG	AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.465T>A	chr6.hg19:g.142691326T>A	ENSP00000230173:p.Asn155Lys	108.0	0.0	.		79.0	33.0	.	NM_198569	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	ENST00000230173.6	hg19	CCDS47490.1	.	.	.	.	.	.	.	.	.	.	T	19.73	3.882482	0.72294	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609;ENST00000541199	T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;1.96	5.66	4.49	0.54785	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.080775	0.52532	D	0.000061	T	0.65207	0.2669	M	0.71581	2.175	0.43372	D	0.995461	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.992	D;D;D;D;P	0.91635	0.999;0.999;0.999;0.998;0.856	T	0.70249	-0.4924	10	0.72032	D	0.01	.	10.8928	0.47004	0.0:0.0763:0.0:0.9237	.	155;155;155;155;154	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4;F5H2L1	.;.;.;GP126_HUMAN;.	K	155;155;155;155;154	ENSP00000230173:N155K;ENSP00000356580:N155K;ENSP00000296932:N155K;ENSP00000356581:N155K;ENSP00000446287:N154K	ENSP00000230173:N155K	N	+	3	2	GPR126	142733019	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.705000	0.47127	0.971000	0.38288	0.528000	0.53228	AAT	.	.	.	none		0.408	GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
WBSCR28	135886	hgsc.bcm.edu	37	7	73280192	73280192	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr7:73280192C>T	ENST00000320531.2	+	3	823	c.787C>T	c.(787-789)Ccc>Tcc	p.P263S		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	263						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				GCAAGAAACTCCCAGAGAATA	0.542																																					p.P263S		Atlas-SNP	.											.	WBSCR28	24	.	0			c.C787T						PASS	.						84.0	93.0	90.0					7																	73280192		1999	4170	6169	SO:0001583	missense	135886	exon3			GAAACTCCCAGAG	BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.787C>T	chr7.hg19:g.73280192C>T	ENSP00000316775:p.Pro263Ser	28.0	0.0	.		31.0	13.0	.	NM_182504	Q6UE04|Q8NHP4	Missense_Mutation	SNP	ENST00000320531.2	hg19	CCDS43597.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.824780	0.32237	.	.	ENSG00000175877	ENST00000320531	T	0.34072	1.38	3.55	3.55	0.40652	.	0.000000	0.40064	N	0.001182	T	0.45013	0.1321	L	0.34521	1.04	0.22975	N	0.998486	D	0.76494	0.999	D	0.71656	0.974	T	0.17018	-1.0383	10	0.87932	D	0	-3.4254	11.0008	0.47604	0.0:1.0:0.0:0.0	.	263	Q6UE05	WBS28_HUMAN	S	263	ENSP00000316775:P263S	ENSP00000316775:P263S	P	+	1	0	WBSCR28	72918128	0.004000	0.15560	0.662000	0.29724	0.009000	0.06853	0.329000	0.19698	2.302000	0.77476	0.644000	0.83932	CCC	.	.	.	none		0.542	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348130.1	NM_182504	
PCLO	27445	hgsc.bcm.edu	37	7	82582455	82582455	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr7:82582455G>A	ENST00000333891.9	-	5	8151	c.7814C>T	c.(7813-7815)cCc>cTc	p.P2605L	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.P2605L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGATCCCAAGGGCCAACTGGT	0.428																																					p.P2605L		Atlas-SNP	.											.	PCLO	1506	.	0			c.C7814T						PASS	.						144.0	136.0	138.0					7																	82582455		1852	4102	5954	SO:0001583	missense	27445	exon5			CCCAAGGGCCAAC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7814C>T	chr7.hg19:g.82582455G>A	ENSP00000334319:p.Pro2605Leu	112.0	0.0	.		164.0	108.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	6.685	0.495051	0.12762	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17528	2.27;2.28	5.04	4.16	0.48862	.	.	.	.	.	T	0.19485	0.0468	L	0.54323	1.7	0.80722	D	1	B;B	0.18461	0.028;0.028	B;B	0.19946	0.027;0.027	T	0.03000	-1.1084	9	0.87932	D	0	.	12.8617	0.57918	0.0805:0.0:0.9195:0.0	.	2605;2605	Q9Y6V0-5;Q9Y6V0-6	.;.	L	2536;2605;2605	ENSP00000334319:P2605L;ENSP00000388393:P2605L	ENSP00000334319:P2605L	P	-	2	0	PCLO	82420391	1.000000	0.71417	0.968000	0.41197	0.748000	0.42578	3.224000	0.51238	1.116000	0.41820	0.591000	0.81541	CCC	.	.	.	none		0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
MET	4233	hgsc.bcm.edu	37	7	116423414	116423414	+	Missense_Mutation	SNP	A	A	G	rs121913246		TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr7:116423414A>G	ENST00000318493.6	+	19	3930	c.3743A>G	c.(3742-3744)tAt>tGt	p.Y1248C	MET_ENST00000539704.1_Missense_Mutation_p.Y100C|MET_ENST00000397752.3_Missense_Mutation_p.Y1230C			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Y1248C(8)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AGAGACATGTATGATAAAGAA	0.393			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.Y1248C		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,rectum,carcinoma,-1,9	MET	412	.	8	Substitution - Missense(8)	upper_aerodigestive_tract(7)|kidney(1)	c.A3743G	GRCh37	CM970947	MET	M	rs121913246	PASS	.						105.0	99.0	101.0					7																	116423414		1843	4094	5937	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	ACATGTATGATAA	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3743A>G	chr7.hg19:g.116423414A>G	ENSP00000317272:p.Tyr1248Cys	119.0	0.0	.		133.0	87.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	A	17.26	3.345049	0.61073	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	D;D;D	0.83250	-1.7;-1.7;-1.7	5.46	5.46	0.80206	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91270	0.7248	M	0.82132	2.575	0.58432	A	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92475	0.5988	9	0.87932	D	0	.	15.824	0.78683	1.0:0.0:0.0:0.0	.	1248;1230	P08581-2;P08581	.;MET_HUMAN	C	1230;1248;100	ENSP00000380860:Y1230C;ENSP00000317272:Y1248C;ENSP00000445020:Y100C	ENSP00000317272:Y1248C	Y	+	2	0	MET	116210650	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.960000	0.70348	2.197000	0.70478	0.460000	0.39030	TAT	.	.	.	weak		0.393	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
CCDC136	64753	hgsc.bcm.edu	37	7	128441373	128441373	+	Silent	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr7:128441373C>T	ENST00000297788.4	+	4	847	c.480C>T	c.(478-480)tcC>tcT	p.S160S	CCDC136_ENST00000464832.1_Silent_p.S210S|CCDC136_ENST00000378685.4_Silent_p.S210S|CCDC136_ENST00000487361.1_Silent_p.S160S	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	160	Glu-rich.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						CAGAGGATTCCGCAACTGAAC	0.483																																					p.S210S		Atlas-SNP	.											.	CCDC136	170	.	0			c.C630T						PASS	.						63.0	66.0	65.0					7																	128441373		2037	4186	6223	SO:0001819	synonymous_variant	64753	exon5			GGATTCCGCAACT		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.480C>T	chr7.hg19:g.128441373C>T		68.0	0.0	.		115.0	41.0	.	NM_001201372	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Silent	SNP	ENST00000297788.4	hg19	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	T	2.942	-0.218780	0.06101	.	.	ENSG00000128596	ENST00000494552	.	.	.	5.65	-11.3	0.00108	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46527	-0.9185	4	.	.	.	-8.6599	4.439	0.11564	0.2265:0.4454:0.1525:0.1756	.	.	.	.	L	37	.	.	P	+	2	0	CCDC136	128228609	0.000000	0.05858	0.011000	0.14972	0.310000	0.27922	-4.697000	0.00197	-2.356000	0.00613	-1.213000	0.01624	CCG	.	.	.	none		0.483	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CPA1	1357	hgsc.bcm.edu	37	7	130022030	130022030	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr7:130022030C>T	ENST00000011292.3	+	4	613	c.463C>T	c.(463-465)Cgt>Tgt	p.R155C	CPA1_ENST00000484324.1_Missense_Mutation_p.R67C	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	155					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					CTATGAAGGGCGTCCCATTTA	0.557																																					p.R155C		Atlas-SNP	.											.	CPA1	73	.	0			c.C463T						PASS	.						130.0	101.0	111.0					7																	130022030		2203	4300	6503	SO:0001583	missense	1357	exon4			GAAGGGCGTCCCA		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.463C>T	chr7.hg19:g.130022030C>T	ENSP00000011292:p.Arg155Cys	77.0	0.0	.		108.0	6.0	.	NM_001868	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	ENST00000011292.3	hg19	CCDS5820.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048277	0.55110	.	.	ENSG00000091704	ENST00000481342;ENST00000011292;ENST00000476062;ENST00000484324	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.46	5.46	0.80206	Peptidase M14, carboxypeptidase A (3);	0.046442	0.85682	D	0.000000	T	0.75265	0.3826	H	0.99619	4.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.86816	0.2001	10	0.87932	D	0	.	16.4592	0.84031	0.0:1.0:0.0:0.0	.	67;155	B4DDW9;P15085	.;CBPA1_HUMAN	C	67;155;67;67	ENSP00000420218:R67C;ENSP00000011292:R155C;ENSP00000419408:R67C;ENSP00000419497:R67C	ENSP00000011292:R155C	R	+	1	0	CPA1	129809266	0.992000	0.36948	0.143000	0.22291	0.163000	0.22366	3.032000	0.49736	2.576000	0.86940	0.561000	0.74099	CGT	.	.	.	none		0.557	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
HEY1	23462	hgsc.bcm.edu	37	8	80677948	80677948	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr8:80677948G>C	ENST00000354724.3	-	5	589	c.390C>G	c.(388-390)tgC>tgG	p.C130W	RP11-27N21.3_ENST00000607172.1_lincRNA|HEY1_ENST00000523976.1_Missense_Mutation_p.C40W|HEY1_ENST00000337919.5_Missense_Mutation_p.C134W|HEY1_ENST00000435063.2_5'UTR	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	130	Orange. {ECO:0000255|PROSITE- ProRule:PRU00380}.				angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			CTTCTGCCAGGCATTCCCGAA	0.498			T	NCOA2	mesenchymal chondrosarcoma						OREG0018837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C134W		Atlas-SNP	.		Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	.	HEY1	51	.	0			c.C402G						PASS	.						61.0	64.0	63.0					8																	80677948		2203	4300	6503	SO:0001583	missense	23462	exon5			TGCCAGGCATTCC	AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.390C>G	chr8.hg19:g.80677948G>C	ENSP00000346761:p.Cys130Trp	144.0	0.0	.	1200	116.0	45.0	.	NM_001040708	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Missense_Mutation	SNP	ENST00000354724.3	hg19	CCDS6225.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104243	0.56291	.	.	ENSG00000164683	ENST00000354724;ENST00000542205;ENST00000337919;ENST00000523976;ENST00000518733	D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46	4.98	4.98	0.66077	Orange subgroup (1);Orange (2);	0.000000	0.85682	D	0.000000	D	0.96234	0.8772	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97377	0.9980	10	0.87932	D	0	-1.6691	18.6141	0.91296	0.0:0.0:1.0:0.0	.	130;134	Q9Y5J3;Q9Y5J3-2	HEY1_HUMAN;.	W	130;134;134;40;92	ENSP00000346761:C130W;ENSP00000338272:C134W;ENSP00000429792:C40W;ENSP00000429705:C92W	ENSP00000338272:C134W	C	-	3	2	HEY1	80840503	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.614000	0.46359	2.456000	0.83038	0.561000	0.74099	TGC	.	.	.	none		0.498	HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379516.1	NM_012258	
FAM135B	51059	hgsc.bcm.edu	37	8	139165353	139165353	+	Silent	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr8:139165353A>G	ENST00000395297.1	-	13	1535	c.1365T>C	c.(1363-1365)tcT>tcC	p.S455S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	455										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CTTCCCTAAAAGATAAATTGC	0.378										HNSCC(54;0.14)																											p.S455S		Atlas-SNP	.											.	FAM135B	423	.	0			c.T1365C						PASS	.						73.0	70.0	71.0					8																	139165353		1881	4106	5987	SO:0001819	synonymous_variant	51059	exon13			CCTAAAAGATAAA	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1365T>C	chr8.hg19:g.139165353A>G		203.0	0.0	.		191.0	76.0	.	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	hg19	CCDS6375.2																																																																																			.	.	.	none		0.378	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
ZNF16	7564	hgsc.bcm.edu	37	8	146156157	146156157	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr8:146156157C>A	ENST00000276816.4	-	4	2202	c.2016G>T	c.(2014-2016)ttG>ttT	p.L672F	ZNF16_ENST00000394909.2_Missense_Mutation_p.L672F	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	672					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GGTGTTTGATCAACTTTGATC	0.527																																					p.L672F		Atlas-SNP	.											.	ZNF16	80	.	0			c.G2016T						PASS	.						177.0	165.0	169.0					8																	146156157		2203	4300	6503	SO:0001583	missense	7564	exon3			TTTGATCAACTTT	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.2016G>T	chr8.hg19:g.146156157C>A	ENSP00000276816:p.Leu672Phe	48.0	0.0	.		37.0	15.0	.	NM_006958	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	ENST00000276816.4	hg19	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768564	0.31320	.	.	ENSG00000170631	ENST00000276816;ENST00000394909	T;T	0.68624	-0.34;-0.34	4.03	3.09	0.35607	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.76485	0.3994	M	0.69185	2.1	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62374	-0.6868	9	0.62326	D	0.03	.	6.346	0.21349	0.0:0.5505:0.3465:0.1029	.	672	P17020	ZNF16_HUMAN	F	672	ENSP00000276816:L672F;ENSP00000378369:L672F	ENSP00000276816:L672F	L	-	3	2	ZNF16	146126961	0.000000	0.05858	0.711000	0.30485	0.594000	0.36715	-1.750000	0.01822	2.081000	0.62600	0.462000	0.41574	TTG	.	.	.	none		0.527	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
HAUS6	54801	hgsc.bcm.edu	37	9	19080609	19080609	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr9:19080609A>T	ENST00000380502.3	-	9	1399	c.932T>A	c.(931-933)tTa>tAa	p.L311*	HAUS6_ENST00000380496.1_Nonsense_Mutation_p.L175*	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	311					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GACTTCATTTAATAACTGAAT	0.368																																					p.L311X		Atlas-SNP	.											.	HAUS6	66	.	0			c.T932A						PASS	.						56.0	53.0	54.0					9																	19080609		2201	4297	6498	SO:0001587	stop_gained	54801	exon9			TCATTTAATAACT	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.932T>A	chr9.hg19:g.19080609A>T	ENSP00000369871:p.Leu311*	228.0	0.0	.		194.0	70.0	.	NM_017645	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Nonsense_Mutation	SNP	ENST00000380502.3	hg19	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	A	36	5.706308	0.96821	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	.	.	.	5.49	5.49	0.81192	.	0.142736	0.46758	D	0.000268	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7991	13.5326	0.61631	1.0:0.0:0.0:0.0	.	.	.	.	X	311;175	.	ENSP00000369865:L175X	L	-	2	0	HAUS6	19070609	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.947000	0.70242	2.089000	0.63090	0.482000	0.46254	TTA	.	.	.	none		0.368	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
GBA2	57704	hgsc.bcm.edu	37	9	35741770	35741770	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr9:35741770G>A	ENST00000378103.3	-	4	1208	c.685C>T	c.(685-687)Cat>Tat	p.H229Y	GBA2_ENST00000378094.4_Missense_Mutation_p.H229Y|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Missense_Mutation_p.H235Y	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	229					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TAGAGGGCATGGTAGAAAGCA	0.587																																					p.H229Y		Atlas-SNP	.											.	GBA2	77	.	0			c.C685T						PASS	.						130.0	123.0	125.0					9																	35741770		2203	4300	6503	SO:0001583	missense	57704	exon4			GGGCATGGTAGAA	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.685C>T	chr9.hg19:g.35741770G>A	ENSP00000367343:p.His229Tyr	82.0	0.0	.		72.0	27.0	.	NM_020944	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	hg19	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017890	0.93404	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.37	5.37	0.77165	Beta-glucosidase, GBA2 type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77191	0.4094	M	0.71296	2.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.975;0.998	T	0.70757	-0.4785	9	0.11485	T	0.65	-22.5324	19.4817	0.95013	0.0:0.0:1.0:0.0	.	235;229;229	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	Y	229;229;235	.	ENSP00000367334:H229Y	H	-	1	0	GBA2	35731770	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.686000	0.98664	2.673000	0.90976	0.557000	0.71058	CAT	.	.	.	none		0.587	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
CNTNAP3	79937	hgsc.bcm.edu	37	9	39144299	39144299	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr9:39144299G>A	ENST00000297668.6	-	11	1767	c.1694C>T	c.(1693-1695)tCg>tTg	p.S565L	CNTNAP3_ENST00000377656.2_Missense_Mutation_p.S565L|CNTNAP3_ENST00000358144.2_Missense_Mutation_p.S477L|CNTNAP3_ENST00000323947.7_Intron|CNTNAP3_ENST00000377659.1_Missense_Mutation_p.S565L	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	565	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GGTGTCCCACGACTGGGAACA	0.502																																					p.S565L		Atlas-SNP	.											.	CNTNAP3	82	.	0			c.C1694T						PASS	.						9.0	6.0	7.0					9																	39144299		2038	3953	5991	SO:0001583	missense	79937	exon11			TCCCACGACTGGG	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1694C>T	chr9.hg19:g.39144299G>A	ENSP00000297668:p.Ser565Leu	630.0	0.0	.		632.0	235.0	.	NM_033655	B1AMA0|Q9C0E9	Missense_Mutation	SNP	ENST00000297668.6	hg19	CCDS6616.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186331	0.78789	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144;ENST00000377659	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	3.04	3.04	0.35103	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.23492	0.0568	L	0.47078	1.49	0.80722	D	1	D;P;P	0.62365	0.991;0.807;0.801	P;B;B	0.50590	0.645;0.266;0.14	T	0.05733	-1.0867	9	0.66056	D	0.02	.	13.1565	0.59520	0.0:0.0:1.0:0.0	.	565;565;565	Q9BZ76-2;A6NC89;Q9BZ76	.;.;CNTP3_HUMAN	L	565;565;477;565	ENSP00000297668:S565L;ENSP00000366884:S565L;ENSP00000350863:S477L;ENSP00000366887:S565L	ENSP00000297668:S565L	S	-	2	0	CNTNAP3	39134299	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	5.316000	0.65815	1.691000	0.51100	0.306000	0.20318	TCG	.	.	.	none		0.502	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
C9orf47	286223	hgsc.bcm.edu	37	9	91606554	91606554	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr9:91606554A>C	ENST00000334490.5	+	2	484	c.416A>C	c.(415-417)cAc>cCc	p.H139P	S1PR3_ENST00000358157.2_5'UTR|C9orf47_ENST00000375850.3_Missense_Mutation_p.H120P|C9orf47_ENST00000375851.2_Missense_Mutation_p.H120P			Q6ZRZ4	CI047_HUMAN	chromosome 9 open reading frame 47	139						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|liver(1)|lung(1)	4						GCGCCCCGGCACCGCCGCGCG	0.781																																					p.H139P		Atlas-SNP	.											.	C9orf47	9	.	0			c.A416C						PASS	.						2.0	2.0	2.0					9																	91606554		1448	2974	4422	SO:0001583	missense	286223	exon2			CCCGGCACCGCCG	AK094842	CCDS35062.1, CCDS47989.1	9q22.1	2008-02-05	2004-11-04		ENSG00000186354	ENSG00000186354			23669	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 108"""	C9orf108			Standard	NM_001001938		Approved	FLJ37523, bA791O21.3	uc004aqc.2	Q6ZRZ4	OTTHUMG00000020172	ENST00000334490.5:c.416A>C	chr9.hg19:g.91606554A>C	ENSP00000335616:p.His139Pro	18.0	0.0	.		19.0	12.0	.	NM_001001938	B7ZMC7|Q5SQD7|Q7Z568|Q8N1V4	Missense_Mutation	SNP	ENST00000334490.5	hg19	CCDS35062.1	.	.	.	.	.	.	.	.	.	.	A	10.64	1.407244	0.25378	.	.	ENSG00000186354	ENST00000375851;ENST00000375850;ENST00000334490	.	.	.	1.58	-1.41	0.08941	.	.	.	.	.	T	0.11707	0.0285	N	0.08118	0	0.09310	N	0.999995	D;D	0.58268	0.982;0.982	P;P	0.44422	0.449;0.449	T	0.13229	-1.0517	8	0.87932	D	0	.	2.3629	0.04312	0.3788:0.3701:0.0:0.2511	.	139;120	Q6ZRZ4;Q6ZRZ4-2	CI047_HUMAN;.	P	120;120;139	.	ENSP00000335616:H139P	H	+	2	0	C9orf47	90796374	0.002000	0.14202	0.000000	0.03702	0.044000	0.14063	-0.122000	0.10627	-0.403000	0.07622	0.454000	0.30748	CAC	.	.	.	none		0.781	C9orf47-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355972.1	NM_182599	
RNF20	56254	hgsc.bcm.edu	37	9	104302568	104302568	+	Silent	SNP	A	A	G	rs150763272		TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr9:104302568A>G	ENST00000389120.3	+	3	303	c.213A>G	c.(211-213)gaA>gaG	p.E71E		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	71					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TTGAAGATGAACTTCGTGAGC	0.453																																					p.E71E		Atlas-SNP	.											.	RNF20	110	.	0			c.A213G						PASS	.	A		4,4402	8.1+/-20.4	0,4,2199	134.0	119.0	124.0		213	-0.6	1.0	9	dbSNP_134	124	0,8600		0,0,4300	no	coding-synonymous	RNF20	NM_019592.5		0,4,6499	GG,GA,AA		0.0,0.0908,0.0308		71/976	104302568	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	56254	exon3			AGATGAACTTCGT	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.213A>G	chr9.hg19:g.104302568A>G		112.0	0.0	.		106.0	60.0	.	NM_019592	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Silent	SNP	ENST00000389120.3	hg19	CCDS35084.1																																																																																			.	A|1.000;G|0.000	0.000	weak		0.453	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
TSC1	7248	hgsc.bcm.edu	37	9	135787825	135787825	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr9:135787825G>T	ENST00000298552.3	-	9	978	c.757C>A	c.(757-759)Cat>Aat	p.H253N	TSC1_ENST00000403810.1_Missense_Mutation_p.H253N|TSC1_ENST00000440111.2_Missense_Mutation_p.H253N|TSC1_ENST00000545250.1_Missense_Mutation_p.H202N	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	253					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		ACAACATCATGAGTTTCTAAT	0.418			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.H253N		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	167	.	1	Unknown(1)	bone(1)	c.C757A						PASS	.						123.0	105.0	111.0					9																	135787825		2203	4300	6503	SO:0001583	missense	7248	exon9	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CATCATGAGTTTC	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.757C>A	chr9.hg19:g.135787825G>T	ENSP00000298552:p.His253Asn	50.0	0.0	.		40.0	15.0	.	NM_000368	B7Z897|Q5VVN5	Missense_Mutation	SNP	ENST00000298552.3	hg19	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.859483	0.91433	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000537172;ENST00000424271;ENST00000403810	D;D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44;-2.44	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.95046	0.8396	M	0.83603	2.65	0.80722	D	1	D;D;P;D;P;D	0.76494	0.999;0.989;0.852;0.981;0.956;0.976	D;D;P;P;D;D	0.87578	0.998;0.944;0.539;0.852;0.955;0.924	D	0.95026	0.8165	10	0.66056	D	0.02	-14.9842	18.9865	0.92773	0.0:0.0:1.0:0.0	.	132;202;253;253;253;253	B7Z604;B7Z897;Q86WV8;Q59IT9;Q32NF0;Q92574	.;.;.;.;.;TSC1_HUMAN	N	253;253;202;132;132;253	ENSP00000298552:H253N;ENSP00000394524:H253N;ENSP00000444017:H202N;ENSP00000438099:H132N;ENSP00000386093:H253N	ENSP00000298552:H253N	H	-	1	0	TSC1	134777646	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.724000	0.93272	0.561000	0.74099	CAT	.	.	.	none		0.418	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
PRPF18	8559	hgsc.bcm.edu	37	10	13658405	13658405	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr10:13658405A>G	ENST00000378572.3	+	9	960	c.800A>G	c.(799-801)gAt>gGt	p.D267G		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	267					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						CAGGCAAATGATGCTTATCTT	0.413																																					p.D267G		Atlas-SNP	.											.	PRPF18	32	.	0			c.A800G						PASS	.						143.0	134.0	137.0					10																	13658405		2203	4300	6503	SO:0001583	missense	8559	exon9			CAAATGATGCTTA	U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.800A>G	chr10.hg19:g.13658405A>G	ENSP00000367835:p.Asp267Gly	49.0	0.0	.		58.0	22.0	.	NM_003675	Q5T9P9|Q9BUI9	Missense_Mutation	SNP	ENST00000378572.3	hg19	CCDS7100.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.309778	0.81247	.	.	ENSG00000165630	ENST00000378572;ENST00000298451	.	.	.	5.3	5.3	0.74995	Prp18 (3);	0.000000	0.85682	D	0.000000	D	0.84460	0.5477	M	0.91768	3.24	0.80722	D	1	D	0.63046	0.992	D	0.65987	0.94	D	0.88339	0.2973	9	0.87932	D	0	-32.6043	15.2507	0.73542	1.0:0.0:0.0:0.0	.	267	Q99633	PRP18_HUMAN	G	267;29	.	ENSP00000298451:D29G	D	+	2	0	PRPF18	13698411	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	9.320000	0.96346	2.006000	0.58801	0.528000	0.53228	GAT	.	.	.	none		0.413	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046879.1		
SVIL	6840	hgsc.bcm.edu	37	10	29769500	29769500	+	Silent	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr10:29769500A>G	ENST00000355867.4	-	29	6095	c.5343T>C	c.(5341-5343)taT>taC	p.Y1781Y	SVIL_ENST00000375398.2_Silent_p.Y1781Y|PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000535393.1_Silent_p.Y695Y|PTCHD3P1_ENST00000446807.1_RNA|SVIL_ENST00000460007.1_5'UTR|SVIL_ENST00000538146.1_Silent_p.Y573Y|SVIL_ENST00000375400.3_Silent_p.Y1355Y|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000414457.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1781					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				ACTTGACCACATAGGCATCCC	0.567																																					p.Y1781Y		Atlas-SNP	.											.	SVIL	226	.	0			c.T5343C						PASS	.						104.0	95.0	98.0					10																	29769500		2203	4300	6503	SO:0001819	synonymous_variant	6840	exon29			GACCACATAGGCA	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.5343T>C	chr10.hg19:g.29769500A>G		106.0	0.0	.		96.0	44.0	.	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	hg19	CCDS7164.1																																																																																			.	.	.	none		0.567	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
SLC16A12	387700	hgsc.bcm.edu	37	10	91203518	91203518	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr10:91203518A>G	ENST00000341233.4	-	4	599	c.209T>C	c.(208-210)cTc>cCc	p.L70P	SLC16A12_ENST00000371790.4_Missense_Mutation_p.L100P	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						CTCACCACAGAGCATGGTCAC	0.393																																					p.L100P		Atlas-SNP	.											.	SLC16A12	40	.	0			c.T299C						PASS	.						107.0	93.0	98.0					10																	91203518		2203	4300	6503	SO:0001583	missense	387700	exon4			CCACAGAGCATGG		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.209T>C	chr10.hg19:g.91203518A>G	ENSP00000343022:p.Leu70Pro	77.0	0.0	.		80.0	31.0	.	NM_213606	Q5M9M9|Q5T7J2|Q6ZV76	Missense_Mutation	SNP	ENST00000341233.4	hg19		.	.	.	.	.	.	.	.	.	.	A	24.7	4.555001	0.86231	.	.	ENSG00000152779	ENST00000341233;ENST00000371790	T;T	0.60797	0.16;0.16	5.62	5.62	0.85841	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.118609	0.64402	D	0.000016	T	0.77572	0.4150	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.79215	-0.1895	10	0.41790	T	0.15	.	15.0059	0.71513	1.0:0.0:0.0:0.0	.	70	Q6ZSM3	MOT12_HUMAN	P	70;100	ENSP00000343022:L70P;ENSP00000360855:L100P	ENSP00000343022:L70P	L	-	2	0	SLC16A12	91193498	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.339000	0.96797	2.151000	0.67156	0.482000	0.46254	CTC	.	.	.	none		0.393	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606	
MGEA5	10724	hgsc.bcm.edu	37	10	103577714	103577714	+	Silent	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr10:103577714G>A	ENST00000361464.3	-	1	461	c.66C>T	c.(64-66)gcC>gcT	p.A22A	KCNIP2-AS1_ENST00000412353.1_RNA|MGEA5_ENST00000370094.3_Silent_p.A22A|MGEA5_ENST00000419011.2_Silent_p.A22A|MGEA5_ENST00000439817.1_Silent_p.A22A|MGEA5_ENST00000357797.5_Silent_p.A22A	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	22					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		CCGCAGAGGCGGCAGGGTTGG	0.736																																					p.A22A		Atlas-SNP	.											.	MGEA5	53	.	0			c.C66T						PASS	.						9.0	10.0	10.0					10																	103577714		2166	4258	6424	SO:0001819	synonymous_variant	10724	exon1			AGAGGCGGCAGGG	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.66C>T	chr10.hg19:g.103577714G>A		25.0	0.0	.		39.0	16.0	.	NM_001142434	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Silent	SNP	ENST00000361464.3	hg19	CCDS7520.1																																																																																			.	.	.	none		0.736	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
PHRF1	57661	hgsc.bcm.edu	37	11	598434	598434	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:598434G>A	ENST00000264555.5	+	9	1084	c.956G>A	c.(955-957)gGc>gAc	p.G319D	PHRF1_ENST00000533464.1_Missense_Mutation_p.G315D|PHRF1_ENST00000416188.2_Missense_Mutation_p.G319D|PHRF1_ENST00000413872.2_Missense_Mutation_p.G318D	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	319	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GTGGCGACTGGCCTGAGCACT	0.657																																					p.G319D		Atlas-SNP	.											.	PHRF1	188	.	0			c.G956A						PASS	.						29.0	37.0	34.0					11																	598434		2125	4237	6362	SO:0001583	missense	57661	exon9			CGACTGGCCTGAG	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.956G>A	chr11.hg19:g.598434G>A	ENSP00000264555:p.Gly319Asp	31.0	0.0	.		24.0	8.0	.	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	hg19		.	.	.	.	.	.	.	.	.	.	G	17.75	3.465596	0.63513	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	4.64	4.64	0.57946	.	0.000000	0.42420	D	0.000719	T	0.62368	0.2422	M	0.66939	2.045	0.51233	D	0.999914	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.998	T	0.66582	-0.5887	10	0.72032	D	0.01	-24.5391	14.6641	0.68893	0.0:0.0:1.0:0.0	.	315;318;319;319	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	D	319;318;319;315	ENSP00000264555:G319D;ENSP00000388589:G318D;ENSP00000410626:G319D;ENSP00000431870:G315D	ENSP00000264555:G319D	G	+	2	0	PHRF1	588434	1.000000	0.71417	0.651000	0.29564	0.079000	0.17450	7.543000	0.82106	2.134000	0.65973	0.491000	0.48974	GGC	.	.	.	none		0.657	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
EPS8L2	64787	hgsc.bcm.edu	37	11	721127	721127	+	Silent	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:721127C>A	ENST00000533256.1	+	9	996	c.621C>A	c.(619-621)ccC>ccA	p.P207P	AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Silent_p.P207P|EPS8L2_ENST00000526198.1_Silent_p.P223P|EPS8L2_ENST00000530636.1_Silent_p.P207P			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	207					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCCCGGCGCCCATCCCCTTCC	0.736																																					p.P207P		Atlas-SNP	.											.	EPS8L2	42	.	0			c.C621A						PASS	.						9.0	11.0	10.0					11																	721127		2060	4086	6146	SO:0001819	synonymous_variant	64787	exon8			GGCGCCCATCCCC	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.621C>A	chr11.hg19:g.721127C>A		16.0	0.0	.		13.0	6.0	.	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Silent	SNP	ENST00000533256.1	hg19	CCDS31328.1																																																																																			.	.	.	none		0.736	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
OR51D1	390038	hgsc.bcm.edu	37	11	4661416	4661416	+	Silent	SNP	T	T	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:4661416T>C	ENST00000357605.2	+	1	472	c.396T>C	c.(394-396)gcT>gcC	p.A132A		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCCATGGCTTTTGACCGCT	0.557																																					p.A132A		Atlas-SNP	.											.	OR51D1	49	.	0			c.T396C						PASS	.						135.0	111.0	119.0					11																	4661416		2201	4298	6499	SO:0001819	synonymous_variant	390038	exon1			CATGGCTTTTGAC	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.396T>C	chr11.hg19:g.4661416T>C		104.0	0.0	.		91.0	31.0	.	NM_001004751	B9EIK4	Silent	SNP	ENST00000357605.2	hg19	CCDS31357.1																																																																																			.	.	.	none		0.557	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751	
CSNK2A3	283106	hgsc.bcm.edu	37	11	11374645	11374645	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:11374645T>C	ENST00000528848.2	-	1	259	c.22A>G	c.(22-24)Agg>Ggg	p.R8G	GALNT18_ENST00000227756.4_Intron|RP11-567I13.1_ENST00000526867.1_RNA	NM_001256686.1	NP_001243615.1	Q8NEV1	CSK23_HUMAN	casein kinase 2, alpha 3 polypeptide	8					positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)										ACTCTGGCCCTGCTTGGCACG	0.507																																					p.R8G		Atlas-SNP	.											.	.	.	.	0			c.A22G						PASS	.																																			SO:0001583	missense	283106	exon1			TGGCCCTGCTTGG	X64692	CCDS59224.1	11p15.3	2013-01-18	2013-01-17	2013-01-17	ENSG00000254598	ENSG00000254598			2458	protein-coding gene	gene with protein product			"""casein kinase 2, alpha 1 polypeptide pseudogene"""	CSNK2A1P		12102635, 1610905, 20625391	Standard	NM_001256686		Approved		uc001mjp.4	Q8NEV1	OTTHUMG00000165708	ENST00000528848.2:c.22A>G	chr11.hg19:g.11374645T>C	ENSP00000473553:p.Arg8Gly	121.0	0.0	.		121.0	50.0	.	NM_001256686		Missense_Mutation	SNP	ENST00000528848.2	hg19	CCDS59224.1																																																																																			.	.	.	none		0.507	CSNK2A3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385850.3	NM_001256686	
FERMT3	83706	hgsc.bcm.edu	37	11	63978141	63978141	+	Silent	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:63978141G>A	ENST00000279227.5	+	3	314	c.219G>A	c.(217-219)ctG>ctA	p.L73L	FERMT3_ENST00000345728.5_Silent_p.L73L	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	73					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						GGCAGTGGCTGCTGCAGACCC	0.622																																					p.L73L		Atlas-SNP	.											.	FERMT3	51	.	0			c.G219A						PASS	.						127.0	117.0	120.0					11																	63978141		2201	4297	6498	SO:0001819	synonymous_variant	83706	exon3			GTGGCTGCTGCAG	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.219G>A	chr11.hg19:g.63978141G>A		144.0	0.0	.		138.0	55.0	.	NM_031471	Q8IUA1|Q8N207|Q9BT48	Silent	SNP	ENST00000279227.5	hg19	CCDS8060.1																																																																																			.	.	.	none		0.622	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471	
ANKRD13D	338692	hgsc.bcm.edu	37	11	67057877	67057877	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:67057877G>A	ENST00000447274.2	+	3	1225	c.50G>A	c.(49-51)aGg>aAg	p.R17K	ANKRD13D_ENST00000511455.2_Missense_Mutation_p.R104K|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.R17K|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.R17K			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	17						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GCCACGCAGAGGCTGGCGGGC	0.627																																					p.R104K		Atlas-SNP	.											.	ANKRD13D	71	.	0			c.G311A						PASS	.						76.0	47.0	57.0					11																	67057877		2193	4291	6484	SO:0001583	missense	338692	exon3			CGCAGAGGCTGGC	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.50G>A	chr11.hg19:g.67057877G>A	ENSP00000402616:p.Arg17Lys	93.0	0.0	.		96.0	27.0	.	NM_207354	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	hg19		.	.	.	.	.	.	.	.	.	.	G	34	5.342333	0.95783	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.31769	1.48;1.67;1.48;1.48	3.52	3.52	0.40303	.	0.058843	0.64402	D	0.000004	T	0.50240	0.1604	M	0.77103	2.36	0.58432	D	0.999996	D;P	0.76494	0.999;0.757	D;B	0.71656	0.974;0.397	T	0.52162	-0.8612	10	0.07990	T	0.79	-28.4454	15.0538	0.71897	0.0:0.0:1.0:0.0	.	104;17	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	K	17;104;17;17	ENSP00000402616:R17K;ENSP00000427130:R104K;ENSP00000310874:R17K;ENSP00000444404:R17K	ENSP00000310874:R17K	R	+	2	0	ANKRD13D	66814453	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.544000	0.73878	2.265000	0.75225	0.655000	0.94253	AGG	.	.	.	none		0.627	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354	
PAK1	5058	hgsc.bcm.edu	37	11	77103498	77103498	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:77103498A>G	ENST00000356341.3	-	2	599	c.68T>C	c.(67-69)aTg>aCg	p.M23T	PAK1_ENST00000528203.1_Intron|PAK1_ENST00000530617.1_Missense_Mutation_p.M23T|PAK1_ENST00000278568.4_Missense_Mutation_p.M23T	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	23					actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					GGCTCCAATCATAGTGCTGGT	0.483																																					p.M23T		Atlas-SNP	.											.	PAK1	89	.	0			c.T68C						PASS	.						110.0	103.0	105.0					11																	77103498		2200	4292	6492	SO:0001583	missense	5058	exon2			CCAATCATAGTGC	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.68T>C	chr11.hg19:g.77103498A>G	ENSP00000348696:p.Met23Thr	76.0	0.0	.		78.0	37.0	.	NM_001128620	O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	ENST00000356341.3	hg19	CCDS8250.1	.	.	.	.	.	.	.	.	.	.	A	15.36	2.809226	0.50421	.	.	ENSG00000149269	ENST00000356341;ENST00000530617;ENST00000278568;ENST00000529248;ENST00000524847;ENST00000528592;ENST00000528633;ENST00000526968	T;T;T	0.69806	-0.4;-0.43;-0.43	6.17	6.17	0.99709	.	0.034131	0.85682	D	0.000000	T	0.61837	0.2379	L	0.43152	1.355	0.80722	D	1	B;B;B	0.23185	0.025;0.081;0.034	B;B;B	0.31390	0.045;0.129;0.062	T	0.56511	-0.7967	10	0.19590	T	0.45	.	15.3933	0.74767	1.0:0.0:0.0:0.0	.	23;23;23	B3KNX7;Q13153;Q13153-2	.;PAK1_HUMAN;.	T	23	ENSP00000348696:M23T;ENSP00000433423:M23T;ENSP00000278568:M23T	ENSP00000278568:M23T	M	-	2	0	PAK1	76781146	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.074000	0.89500	2.371000	0.80710	0.533000	0.62120	ATG	.	.	.	none		0.483	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576	
KMT2A	4297	hgsc.bcm.edu	37	11	118366483	118366483	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:118366483G>A	ENST00000389506.5	+	19	5423	c.5423G>A	c.(5422-5424)cGa>cAa	p.R1808Q	KMT2A_ENST00000354520.4_Missense_Mutation_p.R1770Q|KMT2A_ENST00000534358.1_Missense_Mutation_p.R1811Q			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1808					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TGGCAGGAGCGAGAGGAAAAC	0.458																																					p.R1811Q		Atlas-SNP	.											.	MLL	548	.	0			c.G5432A						PASS	.						111.0	112.0	112.0					11																	118366483		2200	4296	6496	SO:0001583	missense	4297	exon19			AGGAGCGAGAGGA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5423G>A	chr11.hg19:g.118366483G>A	ENSP00000374157:p.Arg1808Gln	184.0	0.0	.		153.0	68.0	.	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941101	0.92526	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.84800	-1.89;-1.9;-1.81	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.88115	0.6350	L	0.31664	0.95	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.79108	0.919;0.992	D	0.86200	0.1618	10	0.33141	T	0.24	.	18.2774	0.90087	0.0:0.0:1.0:0.0	.	1811;1808	E9PQG7;Q03164	.;MLL1_HUMAN	Q	1811;1808;1770;718	ENSP00000436786:R1811Q;ENSP00000374157:R1808Q;ENSP00000346516:R1770Q	ENSP00000346516:R1770Q	R	+	2	0	MLL	117871693	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.411000	0.80078	2.830000	0.97506	0.585000	0.79938	CGA	.	.	.	none		0.458	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
VWF	7450	hgsc.bcm.edu	37	12	6120943	6120943	+	Silent	SNP	G	G	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr12:6120943G>C	ENST00000261405.5	-	34	5936	c.5682C>G	c.(5680-5682)acC>acG	p.T1894T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1894					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGTCTGGCAAGGTCCAGACGT	0.582																																					p.T1894T		Atlas-SNP	.											.	VWF	338	.	0			c.C5682G						PASS	.						11.0	13.0	13.0					12																	6120943		2190	4266	6456	SO:0001819	synonymous_variant	7450	exon34			TGGCAAGGTCCAG		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5682C>G	chr12.hg19:g.6120943G>C		245.0	0.0	.		249.0	110.0	.	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.	.	none		0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
CLEC4D	338339	hgsc.bcm.edu	37	12	8672900	8672900	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr12:8672900C>T	ENST00000299665.2	+	5	656	c.463C>T	c.(463-465)Cgt>Tgt	p.R155C		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	155	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R155C(1)		large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					AGGTCAGTGGCGTTGGGTGGA	0.403																																					p.R155C		Atlas-SNP	.											CLEC4D,NS,carcinoma,0,1	CLEC4D	46	.	1	Substitution - Missense(1)	lung(1)	c.C463T						PASS	.						97.0	98.0	98.0					12																	8672900		2203	4300	6503	SO:0001583	missense	338339	exon5			CAGTGGCGTTGGG	AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.463C>T	chr12.hg19:g.8672900C>T	ENSP00000299665:p.Arg155Cys	86.0	0.0	.		71.0	5.0	.	NM_080387	Q8N5J5	Missense_Mutation	SNP	ENST00000299665.2	hg19	CCDS8593.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983050	0.53827	.	.	ENSG00000166527	ENST00000299665	T	0.18502	2.21	4.67	1.48	0.22813	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.17238	0.0414	M	0.76727	2.345	0.27413	N	0.954503	B	0.10296	0.003	B	0.09377	0.004	T	0.23976	-1.0173	8	.	.	.	.	3.4237	0.07402	0.1972:0.5788:0.0:0.224	.	155	Q8WXI8	CLC4D_HUMAN	C	155	ENSP00000299665:R155C	.	R	+	1	0	CLEC4D	8564167	0.099000	0.21834	0.689000	0.30133	0.721000	0.41392	0.074000	0.14662	0.606000	0.29965	-0.135000	0.14842	CGT	.	.	.	none		0.403	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400565.1	NM_080387	
MAGOHB	55110	hgsc.bcm.edu	37	12	10762497	10762497	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr12:10762497A>C	ENST00000320756.2	-	3	287	c.197T>G	c.(196-198)aTt>aGt	p.I66S	MAGOHB_ENST00000381881.2_Intron|MAGOHB_ENST00000539554.1_Missense_Mutation_p.I20S	NM_018048.3	NP_060518.1	Q96A72	MGN2_HUMAN	mago-nashi homolog B (Drosophila)	66					mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|large_intestine(2)	4						ACTGTCATCAATAATTCTCTT	0.368																																					p.I66S		Atlas-SNP	.											.	MAGOHB	17	.	0			c.T197G						PASS	.						128.0	127.0	127.0					12																	10762497		2203	4300	6503	SO:0001583	missense	55110	exon3			TCATCAATAATTC		CCDS8628.1	12p13.2	2014-02-12	2008-01-24		ENSG00000111196	ENSG00000111196			25504	protein-coding gene	gene with protein product							Standard	NM_018048		Approved	FLJ10292, MGN2	uc001qyq.2	Q96A72	OTTHUMG00000168407	ENST00000320756.2:c.197T>G	chr12.hg19:g.10762497A>C	ENSP00000319240:p.Ile66Ser	57.0	0.0	.		60.0	32.0	.	NM_018048		Missense_Mutation	SNP	ENST00000320756.2	hg19	CCDS8628.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.153073	0.78001	.	.	ENSG00000111196	ENST00000539554;ENST00000320756	.	.	.	4.61	4.61	0.57282	.	0.000000	0.85682	U	0.000000	D	0.84982	0.5593	M	0.93420	3.415	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	D	0.88474	0.3064	9	0.87932	D	0	.	12.6083	0.56535	1.0:0.0:0.0:0.0	.	66	Q96A72	MGN2_HUMAN	S	20;66	.	ENSP00000319240:I66S	I	-	2	0	MAGOHB	10653764	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.162000	0.89657	2.293000	0.77203	0.482000	0.46254	ATT	.	.	.	none		0.368	MAGOHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399616.1	NM_018048	
PTPRR	5801	hgsc.bcm.edu	37	12	71155251	71155251	+	Splice_Site	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr12:71155251C>A	ENST00000283228.2	-	4	1079	c.627G>T	c.(625-627)gaG>gaT	p.E209D	PTPRR_ENST00000342084.4_Splice_Site_p.E97D	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	209					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AACAACATACCTCAGGAGAGA	0.373																																					p.E209D		Atlas-SNP	.											.	PTPRR	109	.	0			c.G627T						PASS	.						124.0	127.0	126.0					12																	71155251		2203	4300	6503	SO:0001630	splice_region_variant	5801	exon4			ACATACCTCAGGA	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.627+1G>T	chr12.hg19:g.71155251C>A		73.0	0.0	.		83.0	37.0	.	NM_002849	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	hg19	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839074	0.51057	.	.	ENSG00000153233	ENST00000283228;ENST00000342084	T;T	0.35421	1.31;1.31	5.68	5.68	0.88126	.	0.121494	0.36234	U	0.002712	T	0.52403	0.1732	L	0.57536	1.79	0.80722	D	1	D;D	0.55605	0.967;0.972	P;P	0.55391	0.775;0.675	T	0.41431	-0.9509	9	.	.	.	-17.9149	19.7965	0.96487	0.0:1.0:0.0:0.0	.	97;209	F5GXR7;Q15256	.;PTPRR_HUMAN	D	209;97	ENSP00000283228:E209D;ENSP00000339605:E97D	.	E	-	3	2	PTPRR	69441518	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	6.292000	0.72725	2.686000	0.91538	0.448000	0.29417	GAG	.	.	.	none		0.373	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	Missense_Mutation
DTX1	1840	hgsc.bcm.edu	37	12	113531444	113531444	+	Silent	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr12:113531444G>T	ENST00000257600.3	+	4	1607	c.1104G>T	c.(1102-1104)gtG>gtT	p.V368V	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	368	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						AGAGCGACGTGAAGCCCGTGC	0.677																																					p.V368V		Atlas-SNP	.											.	DTX1	83	.	0			c.G1104T						PASS	.						22.0	28.0	26.0					12																	113531444		2203	4299	6502	SO:0001819	synonymous_variant	1840	exon4			CGACGTGAAGCCC	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1104G>T	chr12.hg19:g.113531444G>T		56.0	0.0	.		42.0	21.0	.	NM_004416	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	hg19	CCDS9164.1																																																																																			.	.	.	none		0.677	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
KCTD12	115207	hgsc.bcm.edu	37	13	77459491	77459491	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr13:77459491G>C	ENST00000377474.2	-	1	1034	c.793C>G	c.(793-795)Cgc>Ggc	p.R265G	AC000403.1_ENST00000579275.1_RNA|KCTD12_ENST00000317765.2_Missense_Mutation_p.R265G	NM_138444.3	NP_612453.1	Q96CX2	KCD12_HUMAN	potassium channel tetramerization domain containing 12	265					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.0499)		GAGGTGTAGCGCTCCGGGGGA	0.637											OREG0022449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R265G		Atlas-SNP	.											.	KCTD12	11	.	0			c.C793G						PASS	.						38.0	33.0	35.0					13																	77459491		2203	4300	6503	SO:0001583	missense	115207	exon1			TGTAGCGCTCCGG	AF359381	CCDS9455.1	13q21	2013-06-20	2013-06-20	2003-11-26	ENSG00000178695	ENSG00000178695			14678	protein-coding gene	gene with protein product	"""predominantly fetal expressed T1 domain"""	610521	"""chromosome 13 open reading frame 2"", ""potassium channel tetramerisation domain containing 12"""	C13orf2		15357420	Standard	NM_138444		Approved	KIAA1778, PFET1	uc010aeu.1	Q96CX2	OTTHUMG00000017096	ENST00000377474.2:c.793C>G	chr13.hg19:g.77459491G>C	ENSP00000366694:p.Arg265Gly	48.0	0.0	.	1175	40.0	11.0	.	NM_138444		Missense_Mutation	SNP	ENST00000377474.2	hg19	CCDS9455.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.197163	0.58126	.	.	ENSG00000178695	ENST00000377474;ENST00000317765	T;T	0.55588	0.51;0.51	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.52240	0.1722	M	0.68952	2.095	0.80722	D	1	P	0.44578	0.838	B	0.41088	0.347	T	0.59343	-0.7472	10	0.56958	D	0.05	.	12.9674	0.58492	0.0:0.0:0.838:0.162	.	265	Q96CX2	KCD12_HUMAN	G	265	ENSP00000366694:R265G;ENSP00000317141:R265G	ENSP00000317141:R265G	R	-	1	0	KCTD12	76357492	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.246000	0.32803	2.399000	0.81585	0.462000	0.41574	CGC	.	.	.	none		0.637	KCTD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045309.2	NM_138444	
CPNE6	9362	hgsc.bcm.edu	37	14	24546923	24546923	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr14:24546923C>A	ENST00000397016.2	+	17	1969	c.1658C>A	c.(1657-1659)cCc>cAc	p.P553H	CPNE6_ENST00000216775.2_Missense_Mutation_p.P553H|CPNE6_ENST00000537691.1_Missense_Mutation_p.P608H	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	553					lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GCTACGACTCCCAGCCCTAGC	0.652																																					p.P553H		Atlas-SNP	.											.	CPNE6	40	.	0			c.C1658A						PASS	.						32.0	34.0	33.0					14																	24546923		2200	4300	6500	SO:0001583	missense	9362	exon16			CGACTCCCAGCCC	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1658C>A	chr14.hg19:g.24546923C>A	ENSP00000380211:p.Pro553His	51.0	0.0	.		45.0	18.0	.	NM_006032	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	hg19	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851144	0.51270	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.07567	3.18;3.22;3.22	5.3	5.3	0.74995	.	0.000000	0.47455	D	0.000232	T	0.11495	0.0280	L	0.53249	1.67	0.40964	D	0.98464	P;B	0.41569	0.755;0.036	B;B	0.42386	0.386;0.063	T	0.01136	-1.1440	10	0.66056	D	0.02	-1.2104	9.9851	0.41837	0.0:0.9081:0.0:0.0919	.	608;553	F5GXN1;O95741	.;CPNE6_HUMAN	H	608;553;553	ENSP00000440077:P608H;ENSP00000380211:P553H;ENSP00000216775:P553H	ENSP00000216775:P553H	P	+	2	0	CPNE6	23616763	0.873000	0.30073	0.996000	0.52242	0.727000	0.41649	1.078000	0.30754	2.467000	0.83353	0.561000	0.74099	CCC	.	.	.	none		0.652	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
TXNDC16	57544	hgsc.bcm.edu	37	14	52899033	52899033	+	Nonsense_Mutation	SNP	T	T	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr14:52899033T>A	ENST00000281741.4	-	21	2838	c.2467A>T	c.(2467-2469)Aaa>Taa	p.K823*		NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	823					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					TAGTTCACTTTTGAGCATCCT	0.289																																					p.K823X		Atlas-SNP	.											.	TXNDC16	59	.	0			c.A2467T						PASS	.						72.0	67.0	69.0					14																	52899033		2203	4299	6502	SO:0001587	stop_gained	57544	exon21			TCACTTTTGAGCA	AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.2467A>T	chr14.hg19:g.52899033T>A	ENSP00000281741:p.Lys823*	67.0	0.0	.		56.0	27.0	.	NM_020784	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Nonsense_Mutation	SNP	ENST00000281741.4	hg19	CCDS32083.1	.	.	.	.	.	.	.	.	.	.	T	38	6.750790	0.97813	.	.	ENSG00000087301	ENST00000281741	.	.	.	5.07	-0.183	0.13284	.	1.550970	0.04296	N	0.346487	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.9709	7.2863	0.26342	0.0:0.0915:0.5545:0.3539	.	.	.	.	X	823	.	ENSP00000281741:K823X	K	-	1	0	TXNDC16	51968783	0.041000	0.20044	0.012000	0.15200	0.006000	0.05464	0.206000	0.17375	0.019000	0.15079	-0.340000	0.08031	AAA	.	.	.	none		0.289	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411681.1	XM_051699	
YLPM1	56252	hgsc.bcm.edu	37	14	75265567	75265567	+	Silent	SNP	T	T	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr14:75265567T>C	ENST00000325680.7	+	5	3691	c.3567T>C	c.(3565-3567)ccT>ccC	p.P1189P	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Silent_p.P994P	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	994	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		ATGAGCCTCCTAGGGCTCCAT	0.483																																					p.P1189P		Atlas-SNP	.											.	YLPM1	298	.	0			c.T3567C						PASS	.						60.0	58.0	58.0					14																	75265567		1899	4114	6013	SO:0001819	synonymous_variant	56252	exon5			GCCTCCTAGGGCT	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3567T>C	chr14.hg19:g.75265567T>C		92.0	0.0	.		62.0	32.0	.	NM_019589	P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000325680.7	hg19	CCDS45135.1																																																																																			.	.	.	none		0.483	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589	
C14orf159	80017	hgsc.bcm.edu	37	14	91642285	91642285	+	Silent	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr14:91642285G>A	ENST00000523771.1	+	7	1203	c.600G>A	c.(598-600)ttG>ttA	p.L200L	C14orf159_ENST00000522322.1_Silent_p.L200L|C14orf159_ENST00000428926.2_Silent_p.L200L|C14orf159_ENST00000518868.1_Silent_p.L205L|C14orf159_ENST00000520328.1_Silent_p.L188L|C14orf159_ENST00000521077.2_Silent_p.L205L|C14orf159_ENST00000523816.1_Silent_p.L200L|C14orf159_ENST00000412671.2_Silent_p.L205L|C14orf159_ENST00000256324.10_Silent_p.L205L|C14orf159_ENST00000525393.2_Silent_p.L76L			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	200						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		CAGAACTGTTGGGAATCAAAG	0.483																																					p.L205L		Atlas-SNP	.											.	C14orf159	57	.	0			c.G615A						PASS	.						105.0	99.0	101.0					14																	91642285		2203	4300	6503	SO:0001819	synonymous_variant	80017	exon7			ACTGTTGGGAATC	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.600G>A	chr14.hg19:g.91642285G>A		107.0	0.0	.		81.0	34.0	.	NM_001102368	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Silent	SNP	ENST00000523771.1	hg19	CCDS32141.1																																																																																			.	.	.	none		0.483	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102514292	102514292	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr14:102514292C>G	ENST00000360184.4	+	73	13309	c.13145C>G	c.(13144-13146)aCc>aGc	p.T4382S	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4382					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ACACTGCACACCACCGCGTCC	0.642																																					p.T4382S		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.C13145G						PASS	.						118.0	73.0	88.0					14																	102514292		2203	4300	6503	SO:0001583	missense	1778	exon73			TGCACACCACCGC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.13145C>G	chr14.hg19:g.102514292C>G	ENSP00000348965:p.Thr4382Ser	22.0	0.0	.		29.0	14.0	.	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	hg19	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	C	11.14	1.550260	0.27652	.	.	ENSG00000197102	ENST00000360184	T	0.08193	3.12	5.37	5.37	0.77165	Dynein heavy chain (1);	0.160376	0.56097	D	0.000033	T	0.06005	0.0156	N	0.20766	0.605	0.49130	D	0.999759	B	0.02656	0.0	B	0.06405	0.002	T	0.41484	-0.9506	10	0.18710	T	0.47	.	12.4528	0.55686	0.0:0.9233:0.0:0.0767	.	4382	Q14204	DYHC1_HUMAN	S	4382	ENSP00000348965:T4382S	ENSP00000348965:T4382S	T	+	2	0	DYNC1H1	101584045	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.949000	0.56668	2.509000	0.84616	0.655000	0.94253	ACC	.	.	.	none		0.642	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
HERC2	8924	hgsc.bcm.edu	37	15	28457714	28457714	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr15:28457714A>G	ENST00000261609.7	-	43	6910	c.6802T>C	c.(6802-6804)Ttt>Ctt	p.F2268L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTCACATTAAAGGCCACGGCA	0.478																																					p.F2268L		Atlas-SNP	.											.	HERC2	501	.	0			c.T6802C						PASS	.						12.0	12.0	12.0					15																	28457714		2161	4231	6392	SO:0001583	missense	8924	exon43			CATTAAAGGCCAC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6802T>C	chr15.hg19:g.28457714A>G	ENSP00000261609:p.Phe2268Leu	219.0	0.0	.		178.0	70.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.900211	0.52227	.	.	ENSG00000128731	ENST00000261609	T	0.48522	0.81	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.67183	0.2866	M	0.80422	2.495	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.72766	-0.4194	10	0.72032	D	0.01	.	14.0923	0.65000	1.0:0.0:0.0:0.0	.	2268	O95714	HERC2_HUMAN	L	2268	ENSP00000261609:F2268L	ENSP00000261609:F2268L	F	-	1	0	HERC2	26131309	1.000000	0.71417	0.179000	0.23059	0.494000	0.33585	9.125000	0.94402	1.906000	0.55180	0.254000	0.18369	TTT	.	.	.	none		0.478	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
CALML4	91860	hgsc.bcm.edu	37	15	68489951	68489951	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr15:68489951A>C	ENST00000467889.1	-	4	504	c.320T>G	c.(319-321)cTg>cGg	p.L107R	CALML4_ENST00000448060.2_Missense_Mutation_p.L60R|RP11-315D16.2_ENST00000562767.1_Silent_p.A33A|CALML4_ENST00000395465.3_Intron|CALML4_ENST00000540479.1_Missense_Mutation_p.L31R	NM_033429.2	NP_219501.2	Q96GE6	CALL4_HUMAN	calmodulin-like 4	107	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						GGAGAAATCCAGCTCTCCATT	0.478																																					p.L107R		Atlas-SNP	.											.	CALML4	16	.	0			c.T320G						PASS	.						104.0	95.0	98.0					15																	68489951		1887	4129	6016	SO:0001583	missense	91860	exon4			AAATCCAGCTCTC	AF308287	CCDS10226.2, CCDS42052.1, CCDS66808.1	15q22.31	2013-01-10			ENSG00000129007	ENSG00000129007		"""EF-hand domain containing"""	18445	protein-coding gene	gene with protein product							Standard	NM_033429		Approved	MGC4809, NY-BR-20	uc002arb.3	Q96GE6	OTTHUMG00000133287	ENST00000467889.1:c.320T>G	chr15.hg19:g.68489951A>C	ENSP00000419081:p.Leu107Arg	40.0	0.0	.		52.0	15.0	.	NM_033429	B4DL15|F8W6Y4|Q6MZY3|Q6N048|Q9H286	Missense_Mutation	SNP	ENST00000467889.1	hg19	CCDS10226.2	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101169	0.76983	.	.	ENSG00000129007	ENST00000448060;ENST00000540479;ENST00000467889	T;T;T	0.80738	-1.41;0.68;-1.18	5.0	5.0	0.66597	EF-hand-like domain (1);	0.073080	0.56097	D	0.000024	D	0.91422	0.7293	M	0.91561	3.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.93345	0.6713	10	0.87932	D	0	-21.1778	14.6621	0.68879	1.0:0.0:0.0:0.0	.	60;107	F8W6Y4;Q96GE6	.;CALL4_HUMAN	R	60;31;107	ENSP00000400755:L60R;ENSP00000438177:L31R;ENSP00000419081:L107R	ENSP00000400755:L60R	L	-	2	0	CALML4	66277005	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	8.844000	0.92147	2.002000	0.58637	0.402000	0.26972	CTG	.	.	.	none		0.478	CALML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257067.3	NM_033429	
ANKRD34C	390616	hgsc.bcm.edu	37	15	79587013	79587013	+	Silent	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr15:79587013C>T	ENST00000558647.2	+	1	1387	c.1387C>T	c.(1387-1389)Ctg>Ttg	p.L463L	ANKRD34C_ENST00000421388.2_Silent_p.L463L			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	463										endometrium(3)|kidney(1)|skin(1)	5						GCCTGGCTTCCTGCCGCCTTT	0.507																																					p.L463L		Atlas-SNP	.											.	ANKRD34C	29	.	0			c.C1387T						PASS	.						109.0	98.0	101.0					15																	79587013		685	1584	2269	SO:0001819	synonymous_variant	390616	exon2			GGCTTCCTGCCGC		CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1387C>T	chr15.hg19:g.79587013C>T		96.0	0.0	.		69.0	32.0	.	NM_001146341	H3BNM1	Silent	SNP	ENST00000558647.2	hg19	CCDS53965.1																																																																																			.	.	.	none		0.507	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2	NM_001146341	
DNAJA3	9093	hgsc.bcm.edu	37	16	4504895	4504895	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr16:4504895A>T	ENST00000262375.6	+	11	1500	c.1423A>T	c.(1423-1425)Aag>Tag	p.K475*	DNAJA3_ENST00000355296.4_Intron|DNAJA3_ENST00000431375.2_Intron	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	475					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						TTCCAAACTTAAGAAAATGTT	0.502																																					p.K475X		Atlas-SNP	.											.	DNAJA3	52	.	0			c.A1423T						PASS	.						78.0	75.0	76.0					16																	4504895		2197	4300	6497	SO:0001587	stop_gained	9093	exon11			AAACTTAAGAAAA	AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.1423A>T	chr16.hg19:g.4504895A>T	ENSP00000262375:p.Lys475*	111.0	0.0	.		87.0	40.0	.	NM_005147	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Nonsense_Mutation	SNP	ENST00000262375.6	hg19	CCDS10515.1	.	.	.	.	.	.	.	.	.	.	A	38	7.066242	0.98040	.	.	ENSG00000103423	ENST00000262375	.	.	.	5.49	5.49	0.81192	.	0.152909	0.41938	D	0.000786	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.0755	14.7634	0.69621	1.0:0.0:0.0:0.0	.	.	.	.	X	475	.	ENSP00000262375:K475X	K	+	1	0	DNAJA3	4444896	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.482000	0.81143	2.085000	0.62840	0.482000	0.46254	AAG	.	.	.	none		0.502	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1		
NT5M	56953	hgsc.bcm.edu	37	17	17248204	17248204	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:17248204G>A	ENST00000389022.4	+	4	742	c.526G>A	c.(526-528)Gac>Aac	p.D176N	NT5M_ENST00000582909.1_3'UTR	NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	176					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						TCTCATAGACGACCGGCCGGA	0.602																																					p.D176N		Atlas-SNP	.											.	NT5M	17	.	0			c.G526A						PASS	.						122.0	102.0	109.0					17																	17248204		2203	4300	6503	SO:0001583	missense	56953	exon4			ATAGACGACCGGC	AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.526G>A	chr17.hg19:g.17248204G>A	ENSP00000373674:p.Asp176Asn	73.0	0.0	.		96.0	55.0	.	NM_020201		Missense_Mutation	SNP	ENST00000389022.4	hg19	CCDS32581.1	.	.	.	.	.	.	.	.	.	.	G	31	5.099176	0.94197	.	.	ENSG00000205309	ENST00000446264;ENST00000389022	D	0.82167	-1.58	5.78	4.81	0.61882	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.91402	0.7287	M	0.86268	2.805	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.92515	0.6020	10	0.72032	D	0.01	-42.4803	13.7786	0.63069	0.0746:0.0:0.9254:0.0	.	176;176;176	Q2I378;Q9NPB1;F6S3X3	.;NT5M_HUMAN;.	N	176	ENSP00000373674:D176N	ENSP00000373674:D176N	D	+	1	0	NT5M	17188929	1.000000	0.71417	0.958000	0.39756	0.960000	0.62799	8.533000	0.90617	1.434000	0.47414	0.655000	0.94253	GAC	.	.	.	none		0.602	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1		
FLII	2314	hgsc.bcm.edu	37	17	18160230	18160230	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:18160230T>C	ENST00000327031.4	-	2	392	c.167A>G	c.(166-168)cAg>cGg	p.Q56R	FLII_ENST00000545457.2_Missense_Mutation_p.Q56R|FLII_ENST00000584444.1_5'UTR|FLII_ENST00000579294.1_Missense_Mutation_p.Q45R|FLII_ENST00000578558.1_Missense_Mutation_p.Q56R|FLII_ENST00000379450.4_Missense_Mutation_p.Q25R	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	56	Interaction with LRRFIP1 and LRRFIP2.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					TACCAGCTTCTGCAGGGCGGC	0.637																																					p.Q56R		Atlas-SNP	.											.	FLII	79	.	0			c.A167G						PASS	.						18.0	19.0	19.0					17																	18160230		2200	4299	6499	SO:0001583	missense	2314	exon2			AGCTTCTGCAGGG	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.167A>G	chr17.hg19:g.18160230T>C	ENSP00000324573:p.Gln56Arg	34.0	0.0	.		57.0	18.0	.	NM_001256265	B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	ENST00000327031.4	hg19	CCDS11192.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.924494	0.52653	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T;T	0.36157	1.27;1.86;1.9	5.12	5.12	0.69794	.	0.054847	0.85682	D	0.000000	T	0.28134	0.0694	L	0.47716	1.5	0.58432	D	0.999999	B;B;P;B	0.42248	0.009;0.009;0.774;0.024	B;B;B;B	0.32928	0.013;0.013;0.155;0.042	T	0.07083	-1.0791	10	0.20519	T	0.43	-31.848	14.9182	0.70815	0.0:0.0:0.0:1.0	.	25;25;56;56	E7EPM0;B4DIL0;F5H407;Q13045	.;.;.;FLII_HUMAN	R	56;56;25	ENSP00000324573:Q56R;ENSP00000438536:Q56R;ENSP00000368763:Q25R	ENSP00000324573:Q56R	Q	-	2	0	FLII	18100955	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.887000	0.87295	1.924000	0.55735	0.418000	0.28097	CAG	.	.	.	none		0.637	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
SLFN5	162394	hgsc.bcm.edu	37	17	33588032	33588032	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:33588032C>A	ENST00000299977.4	+	3	1203	c.1055C>A	c.(1054-1056)tCa>tAa	p.S352*	SLFN5_ENST00000542451.1_Nonsense_Mutation_p.S352*	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	352					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		TTGAGTTTGTCATCTGCCACG	0.468																																					p.S352X		Atlas-SNP	.											.	SLFN5	92	.	0			c.C1055A						PASS	.						191.0	176.0	181.0					17																	33588032		2203	4300	6503	SO:0001587	stop_gained	162394	exon3			GTTTGTCATCTGC	BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.1055C>A	chr17.hg19:g.33588032C>A	ENSP00000299977:p.Ser352*	150.0	0.0	.		170.0	108.0	.	NM_144975	Q08AF2|Q8WU54|Q96A82	Nonsense_Mutation	SNP	ENST00000299977.4	hg19	CCDS32619.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898751	0.72639	.	.	ENSG00000166750	ENST00000299977;ENST00000542451	.	.	.	3.25	0.959	0.19624	.	1.010410	0.07984	N	0.986128	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.8337	0.05507	0.2761:0.563:0.0:0.1609	.	.	.	.	X	352	.	ENSP00000299977:S352X	S	+	2	0	SLFN5	30612145	0.000000	0.05858	0.087000	0.20705	0.209000	0.24338	-0.092000	0.11129	0.682000	0.31407	0.591000	0.81541	TCA	.	.	.	none		0.468	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2	NM_144975	
PGAP3	93210	hgsc.bcm.edu	37	17	37829901	37829901	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:37829901G>T	ENST00000300658.4	-	6	652	c.560C>A	c.(559-561)aCc>aAc	p.T187N	PGAP3_ENST00000579146.1_Intron|PGAP3_ENST00000429199.2_Missense_Mutation_p.T166N|PGAP3_ENST00000378011.4_Missense_Mutation_p.T136N	NM_033419.3	NP_219487.3	Q96FM1	PGAP3_HUMAN	post-GPI attachment to proteins 3	187					GPI anchor biosynthetic process (GO:0006506)|GPI anchor metabolic process (GO:0006505)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	hydrolase activity, acting on ester bonds (GO:0016788)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12						CAGCCCCACGGTCCTGCCCCA	0.652																																					p.T187N		Atlas-SNP	.											.	PGAP3	37	.	0			c.C560A						PASS	.						68.0	65.0	66.0					17																	37829901		2203	4300	6503	SO:0001583	missense	93210	exon6			CCCACGGTCCTGC	AB088396	CCDS32641.1	17q21.2	2009-06-02	2009-06-02	2009-06-02		ENSG00000161395			23719	protein-coding gene	gene with protein product	"""post-GPI attachment to proteins 3"""	611801	"""per1-like domain containing 1"""	PERLD1		15010812, 17021251, 17314402	Standard	NM_001291728		Approved	MGC9753, CAB2, PP1498, PER1	uc002hsj.3	Q96FM1		ENST00000300658.4:c.560C>A	chr17.hg19:g.37829901G>T	ENSP00000300658:p.Thr187Asn	52.0	0.0	.		64.0	39.0	.	NM_033419	B4DGK7|Q86Z03|Q8NBJ8	Missense_Mutation	SNP	ENST00000300658.4	hg19	CCDS32641.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389718	0.61956	.	.	ENSG00000161395	ENST00000300658;ENST00000378011;ENST00000309862;ENST00000429199	.	.	.	4.65	3.67	0.42095	.	0.224770	0.45126	D	0.000394	T	0.58206	0.2106	L	0.54323	1.7	0.80722	D	1	P;P;P	0.46706	0.841;0.883;0.841	P;P;P	0.50136	0.632;0.576;0.632	T	0.54682	-0.8257	9	0.27082	T	0.32	-14.3119	11.0755	0.48030	0.0932:0.0:0.9068:0.0	.	166;136;187	B4DGK7;Q96FM1-2;Q96FM1	.;.;PGAP3_HUMAN	N	187;136;131;166	.	ENSP00000300658:T187N	T	-	2	0	PGAP3	35083427	1.000000	0.71417	0.999000	0.59377	0.754000	0.42855	7.571000	0.82399	2.113000	0.64589	0.655000	0.94253	ACC	.	.	.	none		0.652	PGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444825.2	NM_033419	
GSDMA	284110	hgsc.bcm.edu	37	17	38122087	38122087	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:38122087G>T	ENST00000301659.4	+	2	265	c.147G>T	c.(145-147)tgG>tgT	p.W49C		NM_178171.4	NP_835465.2	Q96QA5	GSDMA_HUMAN	gasdermin A	49					apoptotic process (GO:0006915)	perinuclear region of cytoplasm (GO:0048471)				NS(1)|endometrium(2)|large_intestine(3)|lung(1)	7						CGCTCTTCTGGGGGGCCCGGT	0.622																																					p.W49C		Atlas-SNP	.											.	GSDMA	26	.	0			c.G147T						PASS	.						32.0	37.0	35.0					17																	38122087		1984	4138	6122	SO:0001583	missense	284110	exon2			CTTCTGGGGGGCC	AB093591	CCDS45669.1	17q21.2	2008-07-31	2008-07-31	2008-07-31		ENSG00000167914			13311	protein-coding gene	gene with protein product		611218	"""gasdermin"", ""gasdermin 1"""	GSDM, GSDM1		12883658, 15010812, 17350798	Standard	NM_178171		Approved	FLJ39120	uc002htl.1	Q96QA5		ENST00000301659.4:c.147G>T	chr17.hg19:g.38122087G>T	ENSP00000301659:p.Trp49Cys	73.0	0.0	.		101.0	68.0	.	NM_178171	Q32MC5|Q86VE7|Q8N1M6	Missense_Mutation	SNP	ENST00000301659.4	hg19	CCDS45669.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418683	0.25552	.	.	ENSG00000167914	ENST00000301659	T	0.41758	0.99	5.51	4.54	0.55810	.	0.338661	0.26176	N	0.025884	T	0.65668	0.2713	M	0.85630	2.765	0.52099	D	0.999946	D	0.89917	1.0	D	0.91635	0.999	T	0.70051	-0.4978	10	0.87932	D	0	-3.0E-4	10.2534	0.43383	0.0914:0.0:0.9086:0.0	.	49	Q96QA5	GSDMA_HUMAN	C	49	ENSP00000301659:W49C	ENSP00000301659:W49C	W	+	3	0	GSDMA	35375613	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	3.268000	0.51585	1.337000	0.45525	0.462000	0.41574	TGG	.	.	.	none		0.622	GSDMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446847.1	NM_178171	
ACLY	47	hgsc.bcm.edu	37	17	40049362	40049362	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:40049362C>T	ENST00000352035.2	-	15	1655	c.1525G>A	c.(1525-1527)Gtg>Atg	p.V509M	ACLY_ENST00000393896.2_Missense_Mutation_p.V499M|ACLY_ENST00000590151.1_Missense_Mutation_p.V509M|ACLY_ENST00000537919.1_Missense_Mutation_p.V238M|ACLY_ENST00000353196.1_Missense_Mutation_p.V499M	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	509					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				ATGCCTTGCACGGCCCGGGTC	0.592																																					p.V509M	Colon(64;807 1396 15971 30971)	Atlas-SNP	.											.	ACLY	85	.	0			c.G1525A						PASS	.						105.0	99.0	101.0					17																	40049362		2203	4300	6503	SO:0001583	missense	47	exon15			CTTGCACGGCCCG	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.1525G>A	chr17.hg19:g.40049362C>T	ENSP00000253792:p.Val509Met	87.0	0.0	.		100.0	4.0	.	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	hg19	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	C	34	5.389813	0.95988	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.88	5.88	0.94601	CoA-binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93726	0.7995	M	0.92367	3.3	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.995;0.994	D	0.94345	0.7574	10	0.87932	D	0	.	20.2228	0.98330	0.0:1.0:0.0:0.0	.	238;553;563;499;509	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	M	509;563;499;238;499	ENSP00000253792:V509M;ENSP00000345398:V499M;ENSP00000445349:V238M;ENSP00000377474:V499M	ENSP00000253792:V509M	V	-	1	0	ACLY	37302888	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	7.610000	0.82949	2.789000	0.95967	0.655000	0.94253	GTG	.	.	.	none		0.592	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
INTS2	57508	hgsc.bcm.edu	37	17	59952339	59952339	+	Silent	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:59952339C>T	ENST00000444766.3	-	19	2616	c.2541G>A	c.(2539-2541)aaG>aaA	p.K847K	INTS2_ENST00000251334.6_Silent_p.K839K|Y_RNA_ENST00000365491.1_RNA	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	847					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TCTGAGTATACTTTTGTTGTC	0.348																																					p.K847K		Atlas-SNP	.											INTS2,NS,carcinoma,0,1	INTS2	89	.	0			c.G2541A						PASS	.						57.0	55.0	56.0					17																	59952339		1869	4102	5971	SO:0001819	synonymous_variant	57508	exon19			AGTATACTTTTGT	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2541G>A	chr17.hg19:g.59952339C>T		107.0	0.0	.		124.0	38.0	.	NM_020748	Q9ULD3	Silent	SNP	ENST00000444766.3	hg19	CCDS45750.1																																																																																			.	.	.	none		0.348	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
TBC1D16	125058	hgsc.bcm.edu	37	17	77923648	77923648	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:77923648C>T	ENST00000310924.2	-	7	1389	c.1274G>A	c.(1273-1275)gGt>gAt	p.G425D	TBC1D16_ENST00000340848.7_Missense_Mutation_p.G63D|TBC1D16_ENST00000570373.1_Missense_Mutation_p.G64D|TBC1D16_ENST00000572862.1_Missense_Mutation_p.G63D|TBC1D16_ENST00000576768.1_Intron	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	425	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			CACATCAATACCGCCAAAGAA	0.577																																					p.G425D	Ovarian(14;397 562 4850 31922 49378)	Atlas-SNP	.											.	TBC1D16	48	.	0			c.G1274A						PASS	.						27.0	31.0	30.0					17																	77923648		2202	4300	6502	SO:0001583	missense	125058	exon7			TCAATACCGCCAA	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1274G>A	chr17.hg19:g.77923648C>T	ENSP00000309794:p.Gly425Asp	84.0	0.0	.		131.0	43.0	.	NM_019020	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	SNP	ENST00000310924.2	hg19	CCDS11766.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.767431	0.90020	.	.	ENSG00000167291	ENST00000340848;ENST00000310924	T;T	0.11385	2.78;2.78	4.79	4.79	0.61399	Rab-GAP/TBC domain (3);	0.231325	0.44688	D	0.000440	T	0.50034	0.1592	H	0.97564	4.03	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.77004	0.989;0.964;0.972	T	0.71441	-0.4592	10	0.87932	D	0	-39.6362	17.8354	0.88694	0.0:1.0:0.0:0.0	.	85;425;63	Q96DH7;Q8TBP0;Q8N3Z4	.;TBC16_HUMAN;.	D	63;425	ENSP00000341517:G63D;ENSP00000309794:G425D	ENSP00000309794:G425D	G	-	2	0	TBC1D16	75538243	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.649000	0.83500	2.192000	0.70111	0.585000	0.79938	GGT	.	.	.	none		0.577	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020	
TNFRSF11A	8792	hgsc.bcm.edu	37	18	60052147	60052147	+	Silent	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr18:60052147C>T	ENST00000586569.1	+	10	1769	c.1731C>T	c.(1729-1731)cgC>cgT	p.R577R	TNFRSF11A_ENST00000269485.7_Silent_p.R260R	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	577					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				CCCTGGCGCGCCGAGACTCCT	0.761																																					p.R577R		Atlas-SNP	.											.	TNFRSF11A	51	.	0			c.C1731T						PASS	.						7.0	8.0	8.0					18																	60052147		2099	3994	6093	SO:0001819	synonymous_variant	8792	exon10			GGCGCGCCGAGAC	AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.1731C>T	chr18.hg19:g.60052147C>T		17.0	0.0	.		27.0	12.0	.	NM_003839	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Silent	SNP	ENST00000586569.1	hg19	CCDS11980.1																																																																																			.	.	.	none		0.761	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2		
CHAF1A	10036	hgsc.bcm.edu	37	19	4433229	4433229	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr19:4433229A>T	ENST00000301280.5	+	13	2467	c.2366A>T	c.(2365-2367)gAt>gTt	p.D789V	CTB-50L17.5_ENST00000590159.1_RNA|CHAF1A_ENST00000587368.1_3'UTR	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	789	Binds to p60.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCAGCGAGGATGCCGCCATC	0.652								Chromatin Structure																													p.D789V		Atlas-SNP	.											.	CHAF1A	69	.	0			c.A2366T						PASS	.						69.0	71.0	70.0					19																	4433229		2203	4300	6503	SO:0001583	missense	10036	exon13			GCGAGGATGCCGC	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.2366A>T	chr19.hg19:g.4433229A>T	ENSP00000301280:p.Asp789Val	65.0	0.0	.		71.0	30.0	.	NM_005483	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	hg19	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	A	9.618	1.132969	0.21041	.	.	ENSG00000167670	ENST00000301280	T	0.26373	1.74	5.65	4.61	0.57282	.	.	.	.	.	T	0.21022	0.0506	L	0.47716	1.5	0.58432	D	0.99999	P	0.40398	0.716	B	0.34873	0.191	T	0.01925	-1.1246	8	.	.	.	-21.8765	11.8638	0.52482	0.8154:0.1846:0.0:0.0	.	789	Q13111	CAF1A_HUMAN	V	789	ENSP00000301280:D789V	.	D	+	2	0	CHAF1A	4384229	1.000000	0.71417	0.039000	0.18376	0.005000	0.04900	3.819000	0.55686	0.966000	0.38159	0.533000	0.62120	GAT	.	.	.	none		0.652	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483	
FARSA	2193	hgsc.bcm.edu	37	19	13035292	13035292	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr19:13035292G>A	ENST00000314606.4	-	11	1262	c.1244C>T	c.(1243-1245)cCc>cTc	p.P415L	FARSA_ENST00000588025.1_Missense_Mutation_p.P455L|FARSA_ENST00000423140.2_Missense_Mutation_p.P384L	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	415					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	CTCCATGCTGGGCTCTGTGTA	0.607																																					p.P415L		Atlas-SNP	.											.	FARSA	46	.	0			c.C1244T						PASS	.						105.0	86.0	93.0					19																	13035292		2203	4300	6503	SO:0001583	missense	2193	exon11			ATGCTGGGCTCTG	U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.1244C>T	chr19.hg19:g.13035292G>A	ENSP00000320309:p.Pro415Leu	25.0	0.0	.		30.0	13.0	.	NM_004461	B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	ENST00000314606.4	hg19	CCDS12287.1	.	.	.	.	.	.	.	.	.	.	G	31	5.075764	0.94000	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	D;D	0.81739	-1.53;-1.53	5.11	5.11	0.69529	Aminoacyl-tRNA synthetase, class II (1);Phenylalanyl-tRNA synthetase (1);	0.000000	0.85682	D	0.000000	D	0.92873	0.7733	H	0.95437	3.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94955	0.8103	10	0.87932	D	0	-16.8972	17.3314	0.87265	0.0:0.0:1.0:0.0	.	384;415;415	B4E363;Q6IBR2;Q9Y285	.;.;SYFA_HUMAN	L	415;384	ENSP00000320309:P415L;ENSP00000396548:P384L	ENSP00000320309:P415L	P	-	2	0	FARSA	12896292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.200000	0.95010	2.388000	0.81334	0.561000	0.74099	CCC	.	.	.	none		0.607	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461	
FARSA	2193	hgsc.bcm.edu	37	19	13035306	13035306	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr19:13035306G>T	ENST00000314606.4	-	11	1248	c.1230C>A	c.(1228-1230)aaC>aaA	p.N410K	FARSA_ENST00000588025.1_Missense_Mutation_p.N450K|FARSA_ENST00000423140.2_Missense_Mutation_p.N379K	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	410					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	CTGTGTATGGGTTGTAGGCTG	0.587																																					p.N410K		Atlas-SNP	.											.	FARSA	46	.	0			c.C1230A						PASS	.						109.0	89.0	96.0					19																	13035306		2203	4300	6503	SO:0001583	missense	2193	exon11			GTATGGGTTGTAG	U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.1230C>A	chr19.hg19:g.13035306G>T	ENSP00000320309:p.Asn410Lys	26.0	0.0	.		32.0	13.0	.	NM_004461	B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	ENST00000314606.4	hg19	CCDS12287.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750860	0.69533	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	T;T	0.63744	-0.06;-0.06	5.11	2.94	0.34122	Aminoacyl-tRNA synthetase, class II (1);Phenylalanyl-tRNA synthetase (1);	0.000000	0.85682	D	0.000000	D	0.83613	0.5292	H	0.97103	3.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86119	0.1567	10	0.87932	D	0	-22.818	9.606	0.39634	0.2346:0.0:0.7654:0.0	.	379;410;410	B4E363;Q6IBR2;Q9Y285	.;.;SYFA_HUMAN	K	410;379	ENSP00000320309:N410K;ENSP00000396548:N379K	ENSP00000320309:N410K	N	-	3	2	FARSA	12896306	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.984000	0.40658	1.162000	0.42619	0.561000	0.74099	AAC	.	.	.	none		0.587	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461	
ZNF552	79818	hgsc.bcm.edu	37	19	58319468	58319468	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr19:58319468T>A	ENST00000391701.1	-	3	1333	c.1164A>T	c.(1162-1164)aaA>aaT	p.K388N	ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		TTTGCCTAAATTTTTTTTCAC	0.413																																					p.K388N		Atlas-SNP	.											ZNF552,NS,carcinoma,0,1	ZNF552	32	.	0			c.A1164T						PASS	.						147.0	143.0	144.0					19																	58319468		2203	4300	6503	SO:0001583	missense	79818	exon3			CCTAAATTTTTTT	AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.1164A>T	chr19.hg19:g.58319468T>A	ENSP00000375582:p.Lys388Asn	127.0	0.0	.		115.0	54.0	.	NM_024762	B3KUE9|Q6P5A6	Missense_Mutation	SNP	ENST00000391701.1	hg19	CCDS12963.1	.	.	.	.	.	.	.	.	.	.	T	7.935	0.741520	0.15642	.	.	ENSG00000178935	ENST00000391701	T	0.20200	2.09	1.96	-3.92	0.04155	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08088	0.0202	N	0.11427	0.14	0.09310	N	1	B;B	0.28820	0.224;0.124	B;B	0.26094	0.066;0.026	T	0.16100	-1.0414	9	0.51188	T	0.08	.	0.9994	0.01474	0.473:0.1394:0.1527:0.2349	.	384;388	B7Z1H1;Q9H707	.;ZN552_HUMAN	N	388	ENSP00000375582:K388N	ENSP00000375582:K388N	K	-	3	2	ZNF552	63011280	0.000000	0.05858	0.000000	0.03702	0.322000	0.28314	-4.686000	0.00198	-2.729000	0.00385	-1.256000	0.01477	AAA	.	.	.	none		0.413	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466829.1	NM_024762	
LPIN3	64900	hgsc.bcm.edu	37	20	39978760	39978760	+	Silent	SNP	T	T	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr20:39978760T>C	ENST00000373257.3	+	7	916	c.825T>C	c.(823-825)ccT>ccC	p.P275P		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	275					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				CAACCTCTCCTCCTCGGGGAG	0.622																																					p.P275P		Atlas-SNP	.											.	LPIN3	69	.	0			c.T825C						PASS	.						29.0	22.0	24.0					20																	39978760		2202	4299	6501	SO:0001819	synonymous_variant	64900	exon7			CTCTCCTCCTCGG	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.825T>C	chr20.hg19:g.39978760T>C		94.0	0.0	.		91.0	51.0	.	NM_022896	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Silent	SNP	ENST00000373257.3	hg19	CCDS33469.1																																																																																			.	.	.	none		0.622	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896	
COL20A1	57642	hgsc.bcm.edu	37	20	61940011	61940011	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr20:61940011C>T	ENST00000358894.6	+	8	993	c.893C>T	c.(892-894)aCt>aTt	p.T298I	COL20A1_ENST00000422202.1_Missense_Mutation_p.T305I|COL20A1_ENST00000326996.6_Missense_Mutation_p.T298I|COL20A1_ENST00000435874.1_Missense_Mutation_p.T305I	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	298	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GATGTGCACACTGCTGCCCGT	0.667																																					p.T298I		Atlas-SNP	.											.	COL20A1	137	.	0			c.C893T						PASS	.						26.0	32.0	30.0					20																	61940011		2120	4220	6340	SO:0001583	missense	57642	exon8			TGCACACTGCTGC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.893C>T	chr20.hg19:g.61940011C>T	ENSP00000351767:p.Thr298Ile	90.0	0.0	.		67.0	37.0	.	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	hg19	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	C	8.261	0.811242	0.16537	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	4.07	3.1	0.35709	von Willebrand factor, type A (3);	0.727564	0.12360	N	0.475743	T	0.75975	0.3923	L	0.35793	1.09	0.09310	N	1	P;P	0.36027	0.478;0.533	B;B	0.37451	0.174;0.25	T	0.66862	-0.5816	10	0.42905	T	0.14	.	10.6662	0.45732	0.0:0.8393:0.0:0.1607	.	305;298	Q9P218-2;Q9P218	.;COKA1_HUMAN	I	298;298;305;305	ENSP00000351767:T298I;ENSP00000323077:T298I;ENSP00000408690:T305I;ENSP00000414753:T305I	ENSP00000323077:T298I	T	+	2	0	COL20A1	61410456	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.134000	0.15932	1.982000	0.57802	0.467000	0.42956	ACT	.	.	.	none		0.667	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
USP25	29761	hgsc.bcm.edu	37	21	17172133	17172133	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr21:17172133A>G	ENST00000285679.6	+	6	982	c.613A>G	c.(613-615)Aat>Gat	p.N205D	USP25_ENST00000285681.2_Missense_Mutation_p.N205D|USP25_ENST00000547201.1_3'UTR|USP25_ENST00000351097.5_Missense_Mutation_p.N205D|USP25_ENST00000400183.2_Missense_Mutation_p.N205D	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	205	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GCCTCCATCAAATGCTCAAGA	0.289																																					p.N205D		Atlas-SNP	.											.	USP25	156	.	0			c.A613G						PASS	.						80.0	80.0	80.0					21																	17172133		2203	4294	6497	SO:0001583	missense	29761	exon6			CCATCAAATGCTC	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.613A>G	chr21.hg19:g.17172133A>G	ENSP00000285679:p.Asn205Asp	184.0	0.0	.		171.0	67.0	.	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	ENST00000285679.6	hg19	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.999424	0.35320	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.03	2.6	0.31112	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.221075	0.44688	D	0.000432	T	0.14787	0.0357	N	0.10916	0.065	0.25753	N	0.985036	P;B;B;B	0.35139	0.486;0.08;0.222;0.009	B;B;B;B	0.32624	0.149;0.018;0.096;0.016	T	0.17592	-1.0364	10	0.18710	T	0.47	.	12.1748	0.54180	0.7294:0.2706:0.0:0.0	.	205;205;205;205	Q9UHP3-3;Q96B65;Q9UHP3-1;Q9UHP3	.;.;.;UBP25_HUMAN	D	205	ENSP00000285681:N205D;ENSP00000285679:N205D;ENSP00000299574:N205D;ENSP00000383044:N205D	ENSP00000285679:N205D	N	+	1	0	USP25	16094004	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.993000	0.40747	0.324000	0.23333	0.528000	0.53228	AAT	.	.	.	none		0.289	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
BACH1	571	hgsc.bcm.edu	37	21	30715024	30715024	+	Missense_Mutation	SNP	G	G	A	rs377002114		TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr21:30715024G>A	ENST00000399921.1	+	5	2324	c.2081G>A	c.(2080-2082)cGa>cAa	p.R694Q	BACH1_ENST00000286800.3_Missense_Mutation_p.R694Q	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						GGCTACGCGCGAGGGCAGGAG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18154	0.001		0.0	False		,,,				2504	0.0				p.R694Q		Atlas-SNP	.											BACH1,NS,carcinoma,0,1	BACH1	66	.	0			c.G2081A						PASS	.	G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	49.0	51.0	50.0		2081,2081	-10.2	0.0	21		50	1,8599		0,1,4299	no	missense,missense	BACH1	NM_001186.2,NM_206866.1	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	694/737,694/737	30715024	1,13005	2203	4300	6503	SO:0001583	missense	571	exon5			ACGCGCGAGGGCA	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.2081G>A	chr21.hg19:g.30715024G>A	ENSP00000382805:p.Arg694Gln	87.0	0.0	.		69.0	36.0	.	NM_206866	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000399921.1	hg19	CCDS13585.1	.	.	.	.	.	.	.	.	.	.	G	5.245	0.230686	0.09969	0.0	1.16E-4	ENSG00000156273	ENST00000286800;ENST00000399921	T;T	0.70399	-0.48;-0.48	5.18	-10.2	0.00374	.	1.645150	0.03069	N	0.156896	T	0.37812	0.1017	N	0.11427	0.14	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.37197	-0.9716	10	0.10902	T	0.67	5.0905	0.5012	0.00580	0.3585:0.218:0.1401:0.2834	.	694	O14867	BACH1_HUMAN	Q	694	ENSP00000286800:R694Q;ENSP00000382805:R694Q	ENSP00000286800:R694Q	R	+	2	0	BACH1	29636895	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.738000	0.01842	-2.180000	0.00766	-0.355000	0.07637	CGA	.	.	.	weak		0.577	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
SIM2	6493	hgsc.bcm.edu	37	21	38084911	38084911	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr21:38084911G>T	ENST00000290399.6	+	3	950	c.337G>T	c.(337-339)Ggc>Tgc	p.G113C	SIM2_ENST00000430056.3_Missense_Mutation_p.G113C	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	113	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						TGTCCATTTAGGCTTATCCCA	0.388																																					p.G113C		Atlas-SNP	.											.	SIM2	55	.	0			c.G337T						PASS	.						155.0	136.0	142.0					21																	38084911		2203	4300	6503	SO:0001583	missense	6493	exon3			CATTTAGGCTTAT		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.337G>T	chr21.hg19:g.38084911G>T	ENSP00000290399:p.Gly113Cys	45.0	0.0	.		59.0	26.0	.	NM_005069	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Missense_Mutation	SNP	ENST00000290399.6	hg19	CCDS13646.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.541391|4.541391	0.85917|0.85917	.|.	.|.	ENSG00000159263|ENSG00000159263	ENST00000290399;ENST00000430056|ENST00000431229	T;T|.	0.39056|.	1.1;1.1|.	5.42|5.42	5.42|5.42	0.78866|0.78866	PAS (2);PAS fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90717|0.90717	0.7087|0.7087	H|H	0.98199|0.98199	4.17|4.17	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.94002|0.94002	0.7276|0.7276	10|5	0.87932|.	D|.	0|.	.|.	19.2521|19.2521	0.93929|0.93929	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	113;113|.	Q14190;Q14190-2|.	SIM2_HUMAN;.|.	C|M	113|50	ENSP00000290399:G113C;ENSP00000404176:G113C|.	ENSP00000290399:G113C|.	G|R	+|+	1|2	0|0	SIM2|SIM2	37006781|37006781	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.904000|0.904000	0.53231|0.53231	9.287000|9.287000	0.95975|0.95975	2.542000|2.542000	0.85734|0.85734	0.655000|0.655000	0.94253|0.94253	GGC|AGG	.	.	.	none		0.388	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1	NM_009586	
DSCAM	1826	hgsc.bcm.edu	37	21	41559859	41559859	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr21:41559859G>A	ENST00000400454.1	-	13	3086	c.2609C>T	c.(2608-2610)tCt>tTt	p.S870F		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	870	Ig-like C2-type 9.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CTCCCCATAAGAATTAATAGC	0.403																																					p.S870F	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.C2609T						PASS	.						113.0	102.0	105.0					21																	41559859		1859	4104	5963	SO:0001583	missense	1826	exon13			CCATAAGAATTAA	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2609C>T	chr21.hg19:g.41559859G>A	ENSP00000383303:p.Ser870Phe	94.0	0.0	.		57.0	22.0	.	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580605	0.86645	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.70399	-0.48;-0.48	4.74	4.74	0.60224	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86678	0.5990	M	0.89287	3.02	0.58432	D	0.999996	D	0.76494	0.999	D	0.87578	0.998	D	0.88729	0.3235	10	0.52906	T	0.07	.	18.0962	0.89490	0.0:0.0:1.0:0.0	.	870	O60469	DSCAM_HUMAN	F	870;622	ENSP00000383303:S870F;ENSP00000385342:S622F	ENSP00000383303:S870F	S	-	2	0	DSCAM	40481729	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	9.679000	0.98649	2.309000	0.77851	0.561000	0.74099	TCT	.	.	.	none		0.403	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
COL18A1	80781	hgsc.bcm.edu	37	21	46875847	46875847	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr21:46875847G>A	ENST00000359759.4	+	1	424	c.403G>A	c.(403-405)Gag>Aag	p.E135K	COL18A1_ENST00000400337.2_Intron|COL18A1_ENST00000355480.5_Missense_Mutation_p.E135K			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	135					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TGTCCCCACTGAGAGCTTGGC	0.642																																					p.E135K		Atlas-SNP	.											.	COL18A1	129	.	0			c.G403A						PASS	.						34.0	40.0	38.0					21																	46875847		2089	4179	6268	SO:0001583	missense	80781	exon1			CCCACTGAGAGCT		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.403G>A	chr21.hg19:g.46875847G>A	ENSP00000352798:p.Glu135Lys	131.0	0.0	.		130.0	61.0	.	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	hg19		.	.	.	.	.	.	.	.	.	.	G	12.33	1.906637	0.33628	.	.	ENSG00000182871	ENST00000355480;ENST00000359759;ENST00000539645	T;T	0.31769	1.48;1.48	3.11	-0.0648	0.13771	Domain of unknown function DUF959, collagen XVIII, N-terminal (1);	0.988177	0.08216	N	0.979979	T	0.28764	0.0713	L	0.53249	1.67	0.09310	N	1	B;B	0.25441	0.126;0.103	B;B	0.28916	0.096;0.039	T	0.37888	-0.9686	10	0.52906	T	0.07	.	6.3553	0.21398	0.1093:0.3523:0.5383:0.0	.	135;135	P39060;P39060-1	COIA1_HUMAN;.	K	135	ENSP00000347665:E135K;ENSP00000352798:E135K	ENSP00000347665:E135K	E	+	1	0	COL18A1	45700275	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.939000	0.01545	-0.007000	0.14345	-0.479000	0.04858	GAG	.	.	.	none		0.642	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
SREBF2	6721	hgsc.bcm.edu	37	22	42281013	42281013	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr22:42281013G>T	ENST00000361204.4	+	11	2372	c.2206G>T	c.(2206-2208)Gcc>Tcc	p.A736S		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	736					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GGGCTTCCTGGCCGTGAGTAC	0.562																																					p.A736S		Atlas-SNP	.											.	SREBF2	99	.	0			c.G2206T						PASS	.						101.0	78.0	86.0					22																	42281013		2203	4300	6503	SO:0001583	missense	6721	exon11			TTCCTGGCCGTGA	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.2206G>T	chr22.hg19:g.42281013G>T	ENSP00000354476:p.Ala736Ser	104.0	0.0	.		79.0	41.0	.	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	hg19	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073508	0.36566	.	.	ENSG00000198911	ENST00000361204;ENST00000457567	T	0.08458	3.09	5.13	5.13	0.70059	.	0.101356	0.64402	D	0.000002	T	0.06325	0.0163	L	0.32530	0.975	0.51482	D	0.999926	B	0.31581	0.329	B	0.27170	0.077	T	0.36187	-0.9758	10	0.11485	T	0.65	-16.1308	11.9942	0.53191	0.0796:0.0:0.9204:0.0	.	736	Q12772	SRBP2_HUMAN	S	736	ENSP00000354476:A736S	ENSP00000354476:A736S	A	+	1	0	SREBF2	40610959	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	4.372000	0.59530	2.412000	0.81896	0.491000	0.48974	GCC	.	.	.	none		0.562	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
FMR1	2332	hgsc.bcm.edu	37	X	147014033	147014033	+	Silent	SNP	T	T	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chrX:147014033T>C	ENST00000370475.4	+	8	848	c.720T>C	c.(718-720)aaT>aaC	p.N240N	FMR1_ENST00000370470.1_Silent_p.N240N|FMR1_ENST00000370477.1_Silent_p.N240N|FMR1_ENST00000218200.8_Silent_p.N240N|FMR1_ENST00000370471.3_Silent_p.N240N|FMR1_ENST00000334557.6_Silent_p.N240N|FMR1_ENST00000440235.2_5'UTR|FMR1_ENST00000439526.2_Silent_p.N240N	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	240	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					ATGGTGCTAATATTCAGCAAG	0.388									Fragile X syndrome																												p.N240N		Atlas-SNP	.											.	FMR1	93	.	0			c.T720C						PASS	.						176.0	164.0	168.0					X																	147014033		2203	4300	6503	SO:0001819	synonymous_variant	2332	exon8	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	TGCTAATATTCAG	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.720T>C	chrX.hg19:g.147014033T>C		364.0	0.0	.		328.0	141.0	.	NM_002024	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Silent	SNP	ENST00000370475.4	hg19	CCDS14682.1																																																																																			.	.	.	none		0.388	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	
LIMA1	51474	hgsc.bcm.edu	37	12	50571335	50571336	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr12:50571335_50571336insA	ENST00000341247.4	-	11	1940_1941	c.1791_1792insT	c.(1789-1794)tttcaafs	p.Q598fs	LIMA1_ENST00000552909.1_Frame_Shift_Ins_p.Q437fs|LIMA1_ENST00000552783.1_Frame_Shift_Ins_p.Q439fs|LIMA1_ENST00000394943.3_Frame_Shift_Ins_p.Q599fs|LIMA1_ENST00000552823.1_Frame_Shift_Ins_p.Q438fs|LIMA1_ENST00000547825.1_Frame_Shift_Ins_p.Q296fs|LIMA1_ENST00000552491.1_Frame_Shift_Ins_p.Q295fs	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	598					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)	p.Q598E(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						GAGGTGCTTTGAAATGAAGCTG	0.495																																					p.Q599fs		Atlas-Indel,Pindel	.											LIMA1,NS,carcinoma,0,1	LIMA1	67	.	1	Substitution - Missense(1)	lung(1)	c.1795_1796insT						PASS	.																																			SO:0001589	frameshift_variant	51474	exon11			.	AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.1792dupT	chr12.hg19:g.50571338_50571338dupA	ENSP00000340184:p.Gln598fs	65.0	0.0	0		50.0	22.0	0.44	NM_001113546	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Frame_Shift_Ins	INS	ENST00000341247.4	hg19	CCDS8802.1																																																																																			.	.	.	none		0.495	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406235.2	NM_016357	
OR52M1	119772	hgsc.bcm.edu	37	11	4566635	4566636	+	Frame_Shift_Ins	INS	-	-	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:4566635_4566636insC	ENST00000360213.1	+	1	215_216	c.215_216insC	c.(214-219)gacctgfs	p.L73fs		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCTGCCATTGACCTGGTTCTGT	0.515																																					p.D72fs		Atlas-Indel,Pindel	.											.	OR52M1	53	.	0			c.215_216insC						PASS	.																																			SO:0001589	frameshift_variant	119772	exon1			.	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.217dupC	chr11.hg19:g.4566637_4566637dupC	ENSP00000353343:p.Leu73fs	95.0	0.0	0		98.0	40.0	0.408163	NM_001004137		Frame_Shift_Ins	INS	ENST00000360213.1	hg19	CCDS31353.1																																																																																			.	.	.	none		0.515	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137	
ITGAX	3687	hgsc.bcm.edu	37	16	31391906	31391908	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr16:31391906_31391908delCTC	ENST00000268296.4	+	28	3358_3360	c.3237_3239delCTC	c.(3235-3240)tactcc>tac	p.S1080del	ITGAX_ENST00000562522.1_In_Frame_Del_p.S1080del	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	1080					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CATCCGTGTACTCCCAGCTTCCA	0.547																																					p.1079_1080del		Atlas-Indel,Pindel	.											.	ITGAX	198	.	0			c.3236_3238del						PASS	.																																			SO:0001651	inframe_deletion	3687	exon28			.	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.3237_3239delCTC	chr16.hg19:g.31391906_31391908delCTC	ENSP00000268296:p.Ser1080del	95.0	0.0	0		95.0	36.0	0.378947	NM_000887	Q8IVA6	In_Frame_Del	DEL	ENST00000268296.4	hg19	CCDS10711.1																																																																																			.	.	.	none		0.547	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
ZNF491	126069	hgsc.bcm.edu	37	19	11917180	11917180	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr19:11917180delA	ENST00000323169.5	+	3	743	c.412delA	c.(412-414)aaafs	p.K138fs	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						GTTTTGTGGGAAAGCCTTGGA	0.388																																					p.G137fs		Atlas-Indel,Pindel	.											.	ZNF491	61	.	0			c.411delG						PASS	.						99.0	99.0	99.0					19																	11917180		2203	4300	6503	SO:0001589	frameshift_variant	126069	exon3			.	AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.412delA	chr19.hg19:g.11917180delA	ENSP00000313443:p.Lys138fs	76.0	0.0	0		88.0	35.0	0.397727	NM_152356	Q3MJ35|Q8NAT8	Frame_Shift_Del	DEL	ENST00000323169.5	hg19	CCDS12267.1																																																																																			.	.	.	none		0.388	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344518.1	NM_152356	
GLMN	11146	hgsc.bcm.edu	37	1	92731987	92731988	+	Frame_Shift_Ins	INS	-	-	T			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:92731987_92731988insT	ENST00000370360.3	-	13	1283_1284	c.1202_1203insA	c.(1201-1203)tatfs	p.Y401fs	GLMN_ENST00000534881.1_Frame_Shift_Ins_p.Y387fs	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	401					muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		TAAATAATGTATATTTGCCTTG	0.302									Multiple Glomus Tumors (of the Skin), Familial																												p.Y401_T402delinsX		Atlas-Indel,Pindel	.											GLMN,colon,carcinoma,0,1	GLMN	37	.	0			c.1203_1204insA						PASS	.																																			SO:0001589	frameshift_variant	11146	exon13	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	.	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.1203dupA	chr1.hg19:g.92731988_92731988dupT	ENSP00000359385:p.Tyr401fs	199.0	0.0	0		196.0	79.0	0.403061	NM_053274	Q5VVC3|Q9BVE8	Frame_Shift_Ins	INS	ENST00000370360.3	hg19	CCDS738.1																																																																																			.	.	.	none		0.302	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028358.1	NM_007070	
RABGGTB	5876	hgsc.bcm.edu	37	1	76257870	76257871	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:76257870_76257871insTT	ENST00000319942.3	+	7	655_656	c.584_585insTT	c.(583-588)tattgtfs	p.C196fs	SNORD45B_ENST00000364617.1_RNA|RABGGTB_ENST00000496055.1_3'UTR|RABGGTB_ENST00000535300.1_Frame_Shift_Ins_p.C22fs	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit	196					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						TTTTAGATCTATTGTTGCACAG	0.327																																					p.Y195fs		Atlas-Indel,Pindel	.											.	RABGGTB	37	.	0			c.584_585insTT						PASS	.																																			SO:0001589	frameshift_variant	5876	exon7			.	U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.585_586dupTT	chr1.hg19:g.76257871_76257872dupTT	ENSP00000317473:p.Cys196fs	52.0	0.0	0		55.0	16.0	0.290909	NM_004582	Q92697	Frame_Shift_Ins	INS	ENST00000319942.3	hg19	CCDS669.1																																																																																			.	.	.	none		0.327	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026972.1	NM_004582	
BRCA1	672	hgsc.bcm.edu	37	17	41243848	41243848	+	Frame_Shift_Del	DEL	C	C	-	rs80357873|rs80357609		TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:41243848delC	ENST00000357654.3	-	10	3818	c.3700delG	c.(3700-3702)gtafs	p.V1234fs	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000346315.3_Frame_Shift_Del_p.V1234fs|BRCA1_ENST00000309486.4_Frame_Shift_Del_p.V938fs|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Frame_Shift_Del_p.V1187fs|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000354071.3_Frame_Shift_Del_p.V1234fs|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Frame_Shift_Del_p.V1234fs|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000468300.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1234					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ATATTGTTTACTTTACCAAAT	0.413			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.V1234fs		Atlas-Indel,Pindel	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.3701delT						PASS	.						98.0	94.0	96.0					17																	41243848		2203	4300	6503	SO:0001589	frameshift_variant	672	exon10	Familial Cancer Database		.	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3700delG	chr17.hg19:g.41243848delC	ENSP00000350283:p.Val1234fs	132.0	0.0	0		139.0	78.0	0.561151	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Frame_Shift_Del	DEL	ENST00000357654.3	hg19	CCDS11453.1																																																																																			.	.	.	none		0.413	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
ADAMTS17	170691	hgsc.bcm.edu	37	15	100882071	100882071	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr15:100882071delG	ENST00000268070.4	-	1	139	c.34delC	c.(34-36)ctgfs	p.L12fs	SPATA41_ENST00000560282.1_lincRNA	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	12						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		AGCACGGGCAGGACGAGCGGA	0.741																																					p.L12fs		Atlas-Indel,Pindel	.											.	ADAMTS17	127	.	0			c.35delT						PASS	.						23.0	23.0	23.0					15																	100882071		2092	4138	6230	SO:0001589	frameshift_variant	170691	exon1			.	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.34delC	chr15.hg19:g.100882071delG	ENSP00000268070:p.Leu12fs	85.0	0.0	0		74.0	23.0	0.310811	NM_139057	Q2I7G4|Q6ZN75	Frame_Shift_Del	DEL	ENST00000268070.4	hg19	CCDS10383.1																																																																																			.	.	.	none		0.741	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
APAF1	317	hgsc.bcm.edu	37	12	99109218	99109218	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr12:99109218delT	ENST00000551964.1	+	22	3708	c.2972delT	c.(2971-2973)gtafs	p.V991fs	APAF1_ENST00000550527.1_Frame_Shift_Del_p.V980fs|APAF1_ENST00000547045.1_Frame_Shift_Del_p.V948fs|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000357310.1_Frame_Shift_Del_p.V948fs|APAF1_ENST00000339433.3_Frame_Shift_Del_p.V948fs|APAF1_ENST00000359972.2_Frame_Shift_Del_p.V937fs|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000549007.1_Frame_Shift_Del_p.V948fs	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	991					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TTAGAACTTGTAAACAATAGA	0.343																																					p.V991X		Atlas-Indel,Pindel	.											.	APAF1	111	.	0			c.2971delG						PASS	.						62.0	60.0	60.0					12																	99109218		2203	4300	6503	SO:0001589	frameshift_variant	317	exon22			.	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.2972delT	chr12.hg19:g.99109218delT	ENSP00000448165:p.Val991fs	44.0	0.0	0		40.0	16.0	0.4	NM_181861	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Frame_Shift_Del	DEL	ENST00000551964.1	hg19	CCDS9069.1																																																																																			.	.	.	none		0.343	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	
C11orf80	79703	hgsc.bcm.edu	37	11	66610424	66610425	+	Frame_Shift_Ins	INS	-	-	C			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr11:66610424_66610425insC	ENST00000360962.4	+	16	1859_1860	c.1852_1853insC	c.(1852-1854)gccfs	p.A618fs	C11orf80_ENST00000525449.2_Frame_Shift_Ins_p.A426fs|RCE1_ENST00000525356.1_5'Flank|RCE1_ENST00000524506.1_5'Flank|C11orf80_ENST00000532565.2_Frame_Shift_Ins_p.A400fs|C11orf80_ENST00000346672.4_Frame_Shift_Ins_p.A427fs|C11orf80_ENST00000527634.1_Frame_Shift_Ins_p.A401fs|C11orf80_ENST00000540737.1_Frame_Shift_Ins_p.A452fs|RCE1_ENST00000309657.3_5'Flank	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	618										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						GTCAGAGGCCGCCCCGCGCCGC	0.733																																					p.A618fs		Atlas-Indel,Pindel	.											.	C11orf80	31	.	0			c.1852_1853insC						PASS	.																																			SO:0001589	frameshift_variant	79703	exon16			.			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.1856dupC	chr11.hg19:g.66610428_66610428dupC	ENSP00000354227:p.Ala618fs	47.0	0.0	0		43.0	19.0	0.44186	NM_024650	Q9H677	Frame_Shift_Ins	INS	ENST00000360962.4	hg19	CCDS53664.1																																																																																			.	.	.	none		0.733	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
PREX1	57580	hgsc.bcm.edu	37	20	47261019	47261023	+	Frame_Shift_Del	DEL	GATTG	GATTG	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	GATTG	GATTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr20:47261019_47261023delGATTG	ENST00000371941.3	-	27	3547_3551	c.3525_3529delCAATC	c.(3523-3531)agcaatcgafs	p.SN1175fs	PREX1_ENST00000396220.1_Frame_Shift_Del_p.SN1175fs|PREX1_ENST00000496915.1_5'Flank	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1175					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ACCGAGTCTCGATTGCTGTTACACT	0.585																																					p.1176_1177del		Atlas-INDEL	.											.	PREX1	441	.	0			c.3526_3530del						PASS	.																																			SO:0001589	frameshift_variant	57580	exon27			.	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3525_3529delCAATC	chr20.hg19:g.47261019_47261023delGATTG	ENSP00000361009:p.Ser1175fs	94.0	0.0	0		61.0	14.0	0.229508	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Frame_Shift_Del	DEL	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.	.	none		0.585	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37508624	37508625	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr10:37508624_37508625insA	ENST00000602533.1	+	34	3915_3916	c.3816_3817insA	c.(3817-3819)aaafs	p.K1273fs	ANKRD30A_ENST00000361713.1_Frame_Shift_Ins_p.K1273fs|ANKRD30A_ENST00000374660.1_Frame_Shift_Ins_p.K1392fs			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1329					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AACTACAAAGCAAAAATATGTG	0.342																																					p.S1272fs		Atlas-Indel,Pindel	.											.	ANKRD30A	448	.	0			c.3816_3817insA						PASS	.																																			SO:0001589	frameshift_variant	91074	exon34			.	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3821dupA	chr10.hg19:g.37508629_37508629dupA	ENSP00000473551:p.Lys1273fs	186.0	0.0	0		203.0	92.0	0.453202	NM_052997	Q5W025	Frame_Shift_Ins	INS	ENST00000602533.1	hg19																																																																																				.	.	.	none		0.342	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
LINS	55180	hgsc.bcm.edu	37	15	101120996	101120997	+	Frame_Shift_Ins	INS	-	-	A	rs141782332	byFrequency	TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr15:101120996_101120997insA	ENST00000314742.8	-	2	273_274	c.51_52insT	c.(49-54)cttggafs	p.G18fs	LINS_ENST00000560133.1_Intron|LINS_ENST00000559149.1_5'UTR|LINS_ENST00000561308.1_Frame_Shift_Ins_p.G18fs	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	18										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						AGTGTGGCTCCAAGAAGTACCT	0.371																																					p.G18fs		Atlas-Indel,Pindel	.											.	LINS	62	.	0			c.52_53insT						PASS	.																																			SO:0001589	frameshift_variant	55180	exon2			.	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.52dupT	chr15.hg19:g.101120998_101120998dupA	ENSP00000318423:p.Gly18fs	93.0	0.0	0		80.0	42.0	0.525	NM_001040616	Q96FW2|Q9NVQ3	Frame_Shift_Ins	INS	ENST00000314742.8	hg19	CCDS10385.1																																																																																			.	.	.	none		0.371	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
PREX1	57580	hgsc.bcm.edu	37	20	47261025	47261033	+	In_Frame_Del	DEL	TGTTACACT	TGTTACACT	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	TGTTACACT	TGTTACACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr20:47261025_47261033delTGTTACACT	ENST00000371941.3	-	27	3537_3545	c.3515_3523delAGTGTAACA	c.(3514-3525)gagtgtaacagc>ggc	p.1172_1175ECNS>G	PREX1_ENST00000396220.1_In_Frame_Del_p.1172_1175ECNS>G|PREX1_ENST00000496915.1_5'Flank	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1172					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TCTCGATTGCTGTTACACTCGCTGCAAAG	0.579																																					p.1172_1175del		Atlas-INDEL	.											.	PREX1	441	.	0			c.3516_3524del						PASS	.																																			SO:0001651	inframe_deletion	57580	exon27			.	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3515_3523delAGTGTAACA	chr20.hg19:g.47261025_47261033delTGTTACACT	ENSP00000361009:p.Glu1172_Ser1175delinsGly	94.0	0.0	0		57.0	14.0	0.245614	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	In_Frame_Del	DEL	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.	.	none		0.579	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
MASP2	10747	hgsc.bcm.edu	37	1	11105002	11105002	+	Intron	DEL	G	G	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr1:11105002delG	ENST00000400897.3	-	4	560				MASP2_ENST00000400898.3_Frame_Shift_Del_p.L185fs	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		GGAGGCTAGAGGCTCTGCTCT	0.667																																					p.L185fs	GBM(35;611 746 20780 22741 36496)	Atlas-Indel,Pindel	.											.	MASP2	71	.	0			c.554delT						PASS	.						22.0	24.0	23.0					1																	11105002		2201	4299	6500	SO:0001627	intron_variant	10747	exon5			.	X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.544+462C>-	chr1.hg19:g.11105002delG		142.0	0.0	0		119.0	56.0	0.470588	NM_139208	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Frame_Shift_Del	DEL	ENST00000400897.3	hg19	CCDS123.1																																																																																			.	.	.	none		0.667	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1	NM_006610	
DACH2	117154	hgsc.bcm.edu	37	X	85906115	85906115	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chrX:85906115delA	ENST00000373125.4	+	4	717	c.717delA	c.(715-717)ggafs	p.G239fs	DACH2_ENST00000510272.1_Frame_Shift_Del_p.G20fs|DACH2_ENST00000373131.1_Frame_Shift_Del_p.G226fs|DACH2_ENST00000508860.1_Frame_Shift_Del_p.G72fs	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	239					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CTCTTCAGGGAAATGGAAGCC	0.433																																					p.G239fs		Atlas-Indel,Pindel	.											.	DACH2	263	.	0			c.716delG						PASS	.						99.0	78.0	85.0					X																	85906115		2203	4299	6502	SO:0001589	frameshift_variant	117154	exon4			.	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.717delA	chrX.hg19:g.85906115delA	ENSP00000362217:p.Gly239fs	228.0	0.0	0		237.0	106.0	0.447257	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Frame_Shift_Del	DEL	ENST00000373125.4	hg19	CCDS14455.1																																																																																			.	.	.	none		0.433	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
PLCD1	5333	hgsc.bcm.edu	37	3	38053124	38053124	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr3:38053124delC	ENST00000334661.4	-	4	691	c.469delG	c.(469-471)gacfs	p.D157fs	Y_RNA_ENST00000363709.1_RNA|PLCD1_ENST00000479619.1_5'UTR|PLCD1_ENST00000463876.1_Frame_Shift_Del_p.D178fs	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	157	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		ATCTTGTTGTCCTTGTTTTTG	0.522																																					p.D178fs		Atlas-Indel,Pindel	.											.	PLCD1	87	.	0			c.533delA						PASS	.						147.0	136.0	140.0					3																	38053124		2203	4300	6503	SO:0001589	frameshift_variant	5333	exon4			.		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.469delG	chr3.hg19:g.38053124delC	ENSP00000335600:p.Asp157fs	134.0	0.0	0		111.0	49.0	0.441441	NM_001130964	B3KR14|Q86VN8	Frame_Shift_Del	DEL	ENST00000334661.4	hg19	CCDS2671.1																																																																																			.	.	.	none		0.522	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
ALG2	85365	hgsc.bcm.edu	37	9	101980479	101980480	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr9:101980479_101980480insA	ENST00000476832.1	-	2	1048_1049	c.987_988insT	c.(985-990)attgtcfs	p.V330fs	ALG2_ENST00000319033.6_Frame_Shift_Ins_p.V237fs	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				TCCAGAGGGACAATGCCAAAGT	0.495																																					p.V330fs		Atlas-Indel,Pindel	.											.	ALG2	37	.	0			c.988_989insT						PASS	.																																			SO:0001589	frameshift_variant	85365	exon2			.	AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.988dupT	chr9.hg19:g.101980481_101980481dupA	ENSP00000417764:p.Val330fs	171.0	0.0	0		145.0	68.0	0.468966	NM_033087	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Frame_Shift_Ins	INS	ENST00000476832.1	hg19	CCDS6739.1																																																																																			.	.	.	none		0.495	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215080.1	NM_033087	
FOXN1	8456	hgsc.bcm.edu	37	17	26861931	26861932	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr17:26861931_26861932delCC	ENST00000226247.2	+	7	1371_1372	c.1342_1343delCC	c.(1342-1344)cccfs	p.P448fs	FOXN1_ENST00000579795.1_Frame_Shift_Del_p.P448fs	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	448					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					GGGGCACACACCCTCCTGCTAT	0.649																																					p.447_448del		Atlas-Indel,Pindel	.											.	FOXN1	51	.	0			c.1341_1342del						PASS	.																																			SO:0001589	frameshift_variant	8456	exon7			.	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.1342_1343delCC	chr17.hg19:g.26861931_26861932delCC	ENSP00000226247:p.Pro448fs	160.0	0.0	0		188.0	42.0	0.223404	NM_003593	B2R9Q7|O15352	Frame_Shift_Del	DEL	ENST00000226247.2	hg19	CCDS11232.1																																																																																			.	.	.	none		0.649	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
TTN	7273	hgsc.bcm.edu	37	2	179480386	179480388	+	In_Frame_Del	DEL	TTA	TTA	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	TTA	TTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr2:179480386_179480388delTTA	ENST00000591111.1	-	208	43741_43743	c.43517_43519delTAA	c.(43516-43521)gtaaat>gat	p.14506_14507VN>D	TTN_ENST00000342992.6_In_Frame_Del_p.13579_13580VN>D|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_In_Frame_Del_p.7207_7208VN>D|TTN_ENST00000460472.2_In_Frame_Del_p.7082_7083VN>D|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_In_Frame_Del_p.16147_16148VN>D|TTN_ENST00000342175.6_In_Frame_Del_p.7274_7275VN>D|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14506	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGACATATTTACAGGTTCATC	0.384																																					p.16147_16148del		Pindel	.											.	TTN	18412	.	0			c.48441_48443del						PASS	.																																			SO:0001651	inframe_deletion	7273	exon258			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43517_43519delTAA	chr2.hg19:g.179480386_179480388delTTA	ENSP00000465570:p.Val14506_Asn14507delinsAsp	177.0	0.0	.		167.0	49.0	0.293	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.384	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PREX1	57580	hgsc.bcm.edu	37	20	47261019	47261033	+	In_Frame_Del	DEL	GATTGCTGTTACACT	GATTGCTGTTACACT	-			TCGA-SX-A71S-01A-11D-A33Q-10	TCGA-SX-A71S-10A-01D-A33Q-10	GATTGCTGTTACACT	GATTGCTGTTACACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	158b7380-c848-4b01-a581-e79ff31ca48f	0175a079-c143-46a1-975c-4d940bd28bc4	g.chr20:47261019_47261033delGATTGCTGTTACACT	ENST00000371941.3	-	27	3537_3551	c.3515_3529delAGTGTAACAGCAATC	c.(3514-3531)gagtgtaacagcaatcga>gga	p.1172_1177ECNSNR>G	PREX1_ENST00000396220.1_In_Frame_Del_p.1172_1177ECNSNR>G|PREX1_ENST00000496915.1_5'Flank	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1172					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ACCGAGTCTCGATTGCTGTTACACTCGCTGCAAAG	0.581																																					p.1172_1177del		Pindel	.											.	PREX1	441	.	0			c.3516_3530del						PASS	.																																			SO:0001651	inframe_deletion	57580	exon27			.	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3515_3529delAGTGTAACAGCAATC	chr20.hg19:g.47261019_47261033delGATTGCTGTTACACT	ENSP00000361009:p.Glu1172_Arg1177delinsGly	92.0	0.0	.		62.0	19.0	0.306	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	In_Frame_Del	DEL	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.	.	none		0.581	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
