#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD2	57540	hgsc.bcm.edu	37	1	11561256	11561256	+	Silent	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:11561256C>T	ENST00000294484.6	+	2	345	c.207C>T	c.(205-207)acC>acT	p.T69T	PTCHD2_ENST00000389575.3_Silent_p.T69T	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	69					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGGCCTTCACCAATCCGTGCT	0.642																																					p.T69T		Atlas-SNP	.											.	PTCHD2	193	.	0			c.C207T						PASS	.						72.0	74.0	73.0					1																	11561256		2068	4188	6256	SO:0001819	synonymous_variant	57540	exon2			CTTCACCAATCCG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.207C>T	chr1.hg19:g.11561256C>T		76.0	0.0	.		75.0	29.0	.	NM_020780	Q5VTU9|Q9UJD6	Silent	SNP	ENST00000294484.6	hg19	CCDS41247.1																																																																																			.	.	.	none		0.642	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
KLHDC7A	127707	hgsc.bcm.edu	37	1	18808064	18808064	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:18808064C>T	ENST00000400664.1	+	1	641	c.589C>T	c.(589-591)Cca>Tca	p.P197S		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	197						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCGTGAGCATCCAGGACTGGG	0.602																																					p.P197S		Atlas-SNP	.											.	KLHDC7A	60	.	0			c.C589T						PASS	.						45.0	47.0	46.0					1																	18808064		2203	4300	6503	SO:0001583	missense	127707	exon1			GAGCATCCAGGAC	AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.589C>T	chr1.hg19:g.18808064C>T	ENSP00000383505:p.Pro197Ser	37.0	0.0	.		27.0	6.0	.	NM_152375	Q8N8W6	Missense_Mutation	SNP	ENST00000400664.1	hg19	CCDS185.2	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864315	0.32977	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.72394	-0.65	5.7	3.79	0.43588	.	1.829710	0.03990	U	0.294708	T	0.54367	0.1854	N	0.14661	0.345	0.09310	N	1	B	0.21905	0.062	B	0.20577	0.03	T	0.42015	-0.9476	10	0.14656	T	0.56	.	7.7248	0.28753	0.1675:0.7492:0.0:0.0834	.	197	Q5VTJ3	KLD7A_HUMAN	S	197;134	ENSP00000383505:P197S	ENSP00000383505:P197S	P	+	1	0	KLHDC7A	18680651	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.281000	0.18810	0.710000	0.31997	0.591000	0.81541	CCA	.	.	.	none		0.602	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006923.3	NM_152375	
SNRNP40	9410	hgsc.bcm.edu	37	1	31744229	31744229	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:31744229T>A	ENST00000263694.4	-	6	790	c.772A>T	c.(772-774)Aca>Tca	p.T258S	SNRNP40_ENST00000446633.2_Missense_Mutation_p.T258S|SNRNP40_ENST00000373720.3_5'Flank|SNRNP40_ENST00000489853.1_5'UTR	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)	258					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						AAGTTACCTGTATTGTCCATT	0.423																																					p.T258S		Atlas-SNP	.											.	SNRNP40	18	.	0			c.A772T						PASS	.						74.0	76.0	76.0					1																	31744229		2203	4300	6503	SO:0001583	missense	9410	exon6			TACCTGTATTGTC	AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.772A>T	chr1.hg19:g.31744229T>A	ENSP00000263694:p.Thr258Ser	29.0	0.0	.		31.0	7.0	.	NM_004814	B4DQJ1|O75938|O95320	Missense_Mutation	SNP	ENST00000263694.4	hg19	CCDS340.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.169851	0.57584	.	.	ENSG00000060688	ENST00000263694;ENST00000446633	T;T	0.66638	-0.22;-0.22	5.52	5.52	0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.044686	0.85682	D	0.000000	T	0.65165	0.2665	L	0.50333	1.59	0.58432	D	0.999999	B;B	0.19935	0.04;0.022	B;B	0.31101	0.122;0.124	T	0.61792	-0.6990	10	0.39692	T	0.17	.	15.6465	0.77061	0.0:0.0:0.0:1.0	.	258;258	B4DQJ1;Q96DI7	.;SNR40_HUMAN	S	258	ENSP00000263694:T258S;ENSP00000406841:T258S	ENSP00000263694:T258S	T	-	1	0	SNRNP40	31516816	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.895000	0.69814	2.091000	0.63221	0.460000	0.39030	ACA	.	.	.	none		0.423	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010657.1	NM_004814	
CFAP57	149465	hgsc.bcm.edu	37	1	43649431	43649431	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:43649431C>A	ENST00000372492.4	+	4	968	c.644C>A	c.(643-645)aCt>aAt	p.T215N	WDR65_ENST00000528956.1_Missense_Mutation_p.T215N	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		215										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTCGTTGGCACTGACACAGGC	0.502																																					p.T215N		Atlas-SNP	.											.	WDR65	76	.	0			c.C644A						PASS	.						142.0	133.0	136.0					1																	43649431		2203	4300	6503	SO:0001583	missense	149465	exon4			TTGGCACTGACAC																												ENST00000372492.4:c.644C>A	chr1.hg19:g.43649431C>A	ENSP00000361570:p.Thr215Asn	112.0	0.0	.		95.0	36.0	.	NM_152498	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	hg19		.	.	.	.	.	.	.	.	.	.	C	27.8	4.865019	0.91511	.	.	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.48201	0.82;0.82	6.07	6.07	0.98685	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67268	0.2875	M	0.80982	2.52	0.80722	D	1	P;P	0.51653	0.947;0.845	P;P	0.54100	0.742;0.731	T	0.68473	-0.5399	10	0.59425	D	0.04	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	215;215	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	N	215	ENSP00000361570:T215N;ENSP00000435310:T215N	ENSP00000361570:T215N	T	+	2	0	WDR65	43422018	1.000000	0.71417	0.997000	0.53966	0.910000	0.53928	4.461000	0.60115	2.885000	0.99019	0.655000	0.94253	ACT	.	.	.	none		0.502	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
BTBD19	149478	hgsc.bcm.edu	37	1	45278737	45278737	+	Splice_Site	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:45278737G>T	ENST00000450269.1	+	5	822		c.e5+1		BTBD19_ENST00000453418.1_Splice_Site|BTBD19_ENST00000409335.2_Splice_Site	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19											breast(1)|endometrium(1)	2						CCACAGCCAGGTACTGCTCCC	0.632																																					.		Atlas-SNP	.											.	BTBD19	16	.	0			c.483+1G>T						PASS	.						130.0	111.0	117.0					1																	45278737		692	1591	2283	SO:0001630	splice_region_variant	149478	exon5			AGCCAGGTACTGC			1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.483+1G>T	chr1.hg19:g.45278737G>T		67.0	0.0	.		50.0	14.0	.	NM_001136537	B4E384|B7ZC36|B7ZC37	Splice_Site	SNP	ENST00000450269.1	hg19		.	.	.	.	.	.	.	.	.	.	G	19.21	3.784191	0.70222	.	.	ENSG00000222009	ENST00000450269;ENST00000409335	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4794	0.61326	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BTBD19	45051324	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	4.986000	0.63851	2.223000	0.72356	0.462000	0.41574	.	.	.	.	none		0.632	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001136537	Intron
HMGCS2	3158	hgsc.bcm.edu	37	1	120300026	120300026	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:120300026G>A	ENST00000369406.3	-	5	935	c.886C>T	c.(886-888)Cag>Tag	p.Q296*	HMGCS2_ENST00000476640.1_5'UTR|HMGCS2_ENST00000544913.2_Nonsense_Mutation_p.Q254*	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	296					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		ATCATGTACTGTAAATCGTCA	0.517																																					p.Q296X		Atlas-SNP	.											.	HMGCS2	58	.	0			c.C886T						PASS	.						95.0	85.0	88.0					1																	120300026		2203	4300	6503	SO:0001587	stop_gained	3158	exon5			TGTACTGTAAATC	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.886C>T	chr1.hg19:g.120300026G>A	ENSP00000358414:p.Gln296*	92.0	0.0	.		74.0	20.0	.	NM_005518	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Nonsense_Mutation	SNP	ENST00000369406.3	hg19	CCDS905.1	.	.	.	.	.	.	.	.	.	.	G	35	5.588598	0.96590	.	.	ENSG00000134240	ENST00000369406;ENST00000544913	.	.	.	5.33	4.36	0.52297	.	0.195185	0.36303	N	0.002662	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-1.6266	8.8144	0.34987	0.0:0.2688:0.5824:0.1487	.	.	.	.	X	296;254	.	ENSP00000358414:Q296X	Q	-	1	0	HMGCS2	120101549	0.983000	0.35010	0.944000	0.38274	0.855000	0.48748	1.916000	0.39986	2.646000	0.89796	0.655000	0.94253	CAG	.	.	.	none		0.517	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518	
PEAR1	375033	hgsc.bcm.edu	37	1	156876561	156876561	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:156876561G>T	ENST00000338302.3	+	7	758	c.533G>T	c.(532-534)tGt>tTt	p.C178F	PEAR1_ENST00000292357.7_Missense_Mutation_p.C178F			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	178					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTTCAGCCCTGTACCCCTGGC	0.632																																					p.C178F		Atlas-SNP	.											.	PEAR1	118	.	0			c.G533T						PASS	.						119.0	104.0	109.0					1																	156876561		2203	4300	6503	SO:0001583	missense	375033	exon6			AGCCCTGTACCCC	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.533G>T	chr1.hg19:g.156876561G>T	ENSP00000344465:p.Cys178Phe	132.0	0.0	.		101.0	39.0	.	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	hg19	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523741	0.64747	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.72835	-0.69;-0.69	4.81	4.81	0.61882	.	0.000000	0.53938	D	0.000045	D	0.90170	0.6928	H	0.99732	4.735	0.58432	D	0.999999	D	0.71674	0.998	D	0.68621	0.959	D	0.94083	0.7346	9	.	.	.	.	15.4054	0.74874	0.0:0.0:1.0:0.0	.	178	Q5VY43	PEAR1_HUMAN	F	178	ENSP00000344465:C178F;ENSP00000292357:C178F	.	C	+	2	0	PEAR1	155143185	1.000000	0.71417	0.632000	0.29296	0.378000	0.30076	8.189000	0.89712	2.497000	0.84241	0.561000	0.74099	TGT	.	.	.	none		0.632	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
TADA1	117143	hgsc.bcm.edu	37	1	166838685	166838685	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:166838685G>C	ENST00000367874.4	-	3	322	c.229C>G	c.(229-231)Cca>Gca	p.P77A		NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	77					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						CCCTTACCTGGTGTAGAAACC	0.398																																					p.P77A		Atlas-SNP	.											.	TADA1	32	.	0			c.C229G						PASS	.						75.0	64.0	67.0					1																	166838685		2203	4300	6503	SO:0001583	missense	117143	exon3			TACCTGGTGTAGA	BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.229C>G	chr1.hg19:g.166838685G>C	ENSP00000356848:p.Pro77Ala	77.0	0.0	.		60.0	25.0	.	NM_053053	A8K4J9	Missense_Mutation	SNP	ENST00000367874.4	hg19	CCDS1255.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336601	0.60963	.	.	ENSG00000152382	ENST00000367874	T	0.50548	0.74	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.21145	0.0509	N	0.08118	0	0.47153	D	0.999336	B;P	0.37708	0.149;0.606	B;B	0.43018	0.196;0.405	T	0.11446	-1.0587	9	0.17832	T	0.49	.	17.4199	0.87512	0.0:0.0:1.0:0.0	.	77;77	A8K4J9;Q96BN2	.;TADA1_HUMAN	A	77	ENSP00000356848:P77A	ENSP00000356848:P77A	P	-	1	0	TADA1	165105309	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.289000	0.78701	2.707000	0.92482	0.655000	0.94253	CCA	.	.	.	none		0.398	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082881.1	NM_053053	
ADCY10	55811	hgsc.bcm.edu	37	1	167871039	167871039	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:167871039A>T	ENST00000367851.4	-	5	481	c.297T>A	c.(295-297)gaT>gaA	p.D99E	ADCY10_ENST00000545172.1_Intron|ADCY10_ENST00000367848.1_Missense_Mutation_p.D7E	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	99	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CTAGCAGTGCATCACCTTCAG	0.463																																					p.D99E		Atlas-SNP	.											.	ADCY10	175	.	0			c.T297A						PASS	.						126.0	130.0	129.0					1																	167871039		2203	4300	6503	SO:0001583	missense	55811	exon5			CAGTGCATCACCT	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.297T>A	chr1.hg19:g.167871039A>T	ENSP00000356825:p.Asp99Glu	59.0	0.0	.		62.0	18.0	.	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	hg19	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	A	17.68	3.448680	0.63178	.	.	ENSG00000143199	ENST00000367851;ENST00000367848	D;T	0.87256	-2.23;0.04	5.78	-9.57	0.00562	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000003	D	0.90137	0.6918	M	0.85373	2.75	0.35082	D	0.763464	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.93979	0.7256	9	0.87932	D	0	-29.5589	18.8216	0.92099	0.2805:0.0:0.7195:0.0	.	7;99	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	E	99;7	ENSP00000356825:D99E;ENSP00000356822:D7E	ENSP00000356822:D7E	D	-	3	2	ADCY10	166137663	0.626000	0.27120	0.019000	0.16419	0.642000	0.38348	-0.516000	0.06282	-2.105000	0.00842	-0.468000	0.05107	GAT	.	.	.	none		0.463	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
PRRC2C	23215	hgsc.bcm.edu	37	1	171526383	171526383	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:171526383G>T	ENST00000338920.4	+	19	5363	c.5126G>T	c.(5125-5127)tGg>tTg	p.W1709L	PRRC2C_ENST00000367742.3_Missense_Mutation_p.W1711L|PRRC2C_ENST00000392078.3_Missense_Mutation_p.W1711L|PRRC2C_ENST00000426496.2_Missense_Mutation_p.W1709L	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1709					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TTTAAGGTCTGGAACAAAAAG	0.398																																					p.W1709L		Atlas-SNP	.											.	.	.	.	0			c.G5126T						PASS	.						28.0	32.0	31.0					1																	171526383		1620	2828	4448	SO:0001583	missense	23215	exon19			AGGTCTGGAACAA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.5126G>T	chr1.hg19:g.171526383G>T	ENSP00000343629:p.Trp1709Leu	119.0	0.0	.		71.0	22.0	.	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	hg19	CCDS1296.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.42|14.42	2.530678|2.530678	0.45073|0.45073	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000495585|ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	.|T;T;T;T	.|0.01838	.|4.62;4.61;4.61;4.62	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	.|0.000000	.|0.44285	.|D	.|0.000468	.|T	.|0.07413	.|0.0187	L|L	0.56769|0.56769	1.78|1.78	0.53688|0.53688	D|D	0.999979|0.999979	.|D	.|0.76494	.|0.999	.|D	.|0.69479	.|0.964	.|T	.|0.11743	.|-1.0575	.|10	.|0.87932	.|D	.|0	.|.	20.3242|20.3242	0.98691|0.98691	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1709	.|Q9Y520-4	.|.	X|L	257|1711;1710;1709;1711;1709;1466	.|ENSP00000375928:W1711L;ENSP00000410219:W1709L;ENSP00000356716:W1711L;ENSP00000343629:W1709L	.|ENSP00000343629:W1709L	G|W	+|+	1|2	0|0	PRRC2C|PRRC2C	169793007|169793007	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	6.908000|6.908000	0.75730|0.75730	2.817000|2.817000	0.96982|0.96982	0.549000|0.549000	0.68633|0.68633	GGA|TGG	.	.	.	none		0.398	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
ARPC5	10092	hgsc.bcm.edu	37	1	183604774	183604774	+	Silent	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:183604774C>A	ENST00000359856.6	-	1	87	c.21G>T	c.(19-21)tcG>tcT	p.S7S	RGL1_ENST00000304685.4_5'Flank|RGL1_ENST00000536277.1_5'Flank|ARPC5_ENST00000294742.6_Silent_p.S7S|ARPC5_ENST00000462965.1_5'Flank|ARPC5_ENST00000367534.1_Silent_p.S7S	NM_005717.3	NP_005708.1	O15511	ARPC5_HUMAN	actin related protein 2/3 complex, subunit 5, 16kDa	7					actin cytoskeleton organization (GO:0030036)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|large_intestine(1)|lung(2)	4						AGCGGGCCGACGACACTGTGT	0.632																																					p.S7S	Melanoma(136;1596 1789 3041 4830 41075)	Atlas-SNP	.											.	ARPC5	6	.	0			c.G21T						PASS	.						85.0	68.0	74.0					1																	183604774		2203	4300	6503	SO:0001819	synonymous_variant	10092	exon1			GGCCGACGACACT	AF017807	CCDS1357.1, CCDS58050.1	1q	2011-07-06	2002-08-29		ENSG00000162704	ENSG00000162704		"""Actin related protein 2/3 complex subunits"""	708	protein-coding gene	gene with protein product	"""Arp2/3 protein complex subunit p16"""	604227	"""actin related protein 2/3 complex, subunit 5 (16 kD)"""			9359840, 9230079	Standard	NM_005717		Approved	p16-Arc, ARC16, dJ127C7.3	uc021pgb.2	O15511	OTTHUMG00000035326	ENST00000359856.6:c.21G>T	chr1.hg19:g.183604774C>A		69.0	0.0	.		71.0	20.0	.	NM_005717	A6NEC4|Q6PG42	Silent	SNP	ENST00000359856.6	hg19	CCDS1357.1																																																																																			.	.	.	none		0.632	ARPC5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000085477.1	NM_005717	
HMCN1	83872	hgsc.bcm.edu	37	1	186101461	186101461	+	Splice_Site	SNP	A	A	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:186101461A>C	ENST00000271588.4	+	86	13461	c.13232A>C	c.(13231-13233)aAt>aCt	p.N4411T	HMCN1_ENST00000367492.2_Splice_Site_p.N4411T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4411	Ig-like C2-type 43.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTTCCATAGAATGAAGATGCC	0.403																																					p.N4411T		Atlas-SNP	.											.	HMCN1	797	.	0			c.A13232C						PASS	.						87.0	84.0	85.0					1																	186101461		2203	4300	6503	SO:0001630	splice_region_variant	83872	exon86			CATAGAATGAAGA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13231-1A>C	chr1.hg19:g.186101461A>C		73.0	0.0	.		61.0	18.0	.	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	9.020	0.984732	0.18889	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.71579	1.63;-0.58	5.46	5.46	0.80206	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.125941	0.64402	D	0.000001	T	0.67050	0.2852	N	0.11870	0.19	0.37850	D	0.929355	D	0.69078	0.997	D	0.81914	0.995	T	0.65471	-0.6160	10	0.14252	T	0.57	.	10.7243	0.46059	0.8578:0.0:0.0:0.1422	.	4411	Q96RW7	HMCN1_HUMAN	T	4411	ENSP00000271588:N4411T;ENSP00000356462:N4411T	ENSP00000271588:N4411T	N	+	2	0	HMCN1	184368084	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	4.620000	0.61226	2.186000	0.69663	0.533000	0.62120	AAT	.	.	.	none		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	Missense_Mutation
TMCC2	9911	hgsc.bcm.edu	37	1	205211011	205211011	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:205211011C>A	ENST00000358024.3	+	2	975	c.586C>A	c.(586-588)Cac>Aac	p.H196N	TMCC2_ENST00000545499.1_Missense_Mutation_p.H118N|TMCC2_ENST00000495538.1_3'UTR	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	196						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TGGCAGCCCTCACCTGCTGCG	0.721																																					p.H196N		Atlas-SNP	.											.	TMCC2	89	.	0			c.C586A						PASS	.						11.0	11.0	11.0					1																	205211011		2168	4246	6414	SO:0001583	missense	9911	exon2			AGCCCTCACCTGC	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.586C>A	chr1.hg19:g.205211011C>A	ENSP00000350718:p.His196Asn	32.0	0.0	.		25.0	12.0	.	NM_014858	A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	hg19	CCDS30984.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265906	0.80358	.	.	ENSG00000133069	ENST00000358024;ENST00000545499	T;T	0.32272	1.46;1.5	4.95	4.95	0.65309	.	0.095820	0.45867	D	0.000324	T	0.25044	0.0608	N	0.24115	0.695	0.50813	D	0.999895	B	0.23058	0.079	B	0.18263	0.021	T	0.06881	-1.0802	10	0.87932	D	0	.	17.7809	0.88523	0.0:1.0:0.0:0.0	.	196	O75069	TMCC2_HUMAN	N	196;118	ENSP00000350718:H196N;ENSP00000437943:H118N	ENSP00000350718:H196N	H	+	1	0	TMCC2	203477634	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.465000	0.73538	2.273000	0.75805	0.462000	0.41574	CAC	.	.	.	none		0.721	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858	
TSPYL6	388951	hgsc.bcm.edu	37	2	54482228	54482228	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:54482228A>T	ENST00000317802.7	-	1	1181	c.1061T>A	c.(1060-1062)tTt>tAt	p.F354Y	ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000606865.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	354					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						GTGGTCTGAAAACCAGGTGAA	0.512																																					p.F354Y		Atlas-SNP	.											.	TSPYL6	54	.	0			c.T1061A						PASS	.						76.0	82.0	80.0					2																	54482228		2148	4284	6432	SO:0001583	missense	388951	exon1			TCTGAAAACCAGG	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.1061T>A	chr2.hg19:g.54482228A>T	ENSP00000417919:p.Phe354Tyr	87.0	0.0	.		73.0	25.0	.	NM_001003937	Q6NUJ3	Missense_Mutation	SNP	ENST00000317802.7	hg19	CCDS42682.1	.	.	.	.	.	.	.	.	.	.	A	18.98	3.737596	0.69304	.	.	ENSG00000178021	ENST00000317802	T	0.61158	0.13	1.67	1.67	0.24075	.	.	.	.	.	T	0.77916	0.4202	M	0.93854	3.465	0.42947	D	0.99436	D	0.89917	1.0	D	0.91635	0.999	T	0.79050	-0.1962	9	0.87932	D	0	.	7.3612	0.26748	1.0:0.0:0.0:0.0	.	354	Q8N831	TSYL6_HUMAN	Y	354	ENSP00000417919:F354Y	ENSP00000417919:F354Y	F	-	2	0	TSPYL6	54335732	1.000000	0.71417	0.766000	0.31476	0.265000	0.26407	3.776000	0.55356	1.022000	0.39626	0.383000	0.25322	TTT	.	.	.	none		0.512	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	XM_371494	
FANCL	55120	hgsc.bcm.edu	37	2	58425781	58425781	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:58425781G>A	ENST00000233741.4	-	7	524	c.488C>T	c.(487-489)cCa>cTa	p.P163L	FANCL_ENST00000403295.3_Missense_Mutation_p.P163L|FANCL_ENST00000402135.3_Missense_Mutation_p.P163L|FANCL_ENST00000540646.1_Intron|FANCL_ENST00000403676.1_Missense_Mutation_p.P46L	NM_018062.3	NP_060532.2	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L	163	UBC-RWD region (URD).				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|gamete generation (GO:0007276)|protein monoubiquitination (GO:0006513)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)	8						AAAATAATCTGGTGATTCTGC	0.313								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.P163L		Atlas-SNP	.											.	FANCL	35	.	0			c.C488T						PASS	.						58.0	60.0	59.0					2																	58425781		2203	4300	6503	SO:0001583	missense	55120	exon7	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TAATCTGGTGATT	AK001197	CCDS1860.1, CCDS46294.1	2p16.1	2014-09-17	2003-10-14	2003-10-15	ENSG00000115392	ENSG00000115392		"""Zinc fingers, PHD-type"", ""Fanconi anemia, complementation groups"""	20748	protein-coding gene	gene with protein product		608111	"""PHD finger protein 9"""	PHF9			Standard	NM_018062		Approved	FLJ10335, FAAP43, Pog	uc002rzx.4	Q9NW38	OTTHUMG00000129349	ENST00000233741.4:c.488C>T	chr2.hg19:g.58425781G>A	ENSP00000233741:p.Pro163Leu	207.0	0.0	.		181.0	51.0	.	NM_018062	Q6GU60	Missense_Mutation	SNP	ENST00000233741.4	hg19	CCDS1860.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418254	0.83449	.	.	ENSG00000115392	ENST00000403295;ENST00000233741;ENST00000402135;ENST00000403676;ENST00000449070;ENST00000417361	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.54	5.54	0.83059	Fanconi anemia complex, subunit FancL, WD-repeat containing domain (1);	0.100460	0.64402	D	0.000001	T	0.71239	0.3316	M	0.87269	2.87	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.997;0.998	D;D;D;D	0.79784	0.993;0.991;0.934;0.947	T	0.75733	-0.3214	10	0.87932	D	0	-29.5995	19.8426	0.96695	0.0:0.0:1.0:0.0	.	104;163;163;163	C9JZA9;B5MC31;Q9NW38-2;Q9NW38	.;.;.;FANCL_HUMAN	L	163;163;163;46;104;46	ENSP00000386097:P163L;ENSP00000233741:P163L;ENSP00000385021:P163L;ENSP00000384046:P46L;ENSP00000401280:P104L;ENSP00000389448:P46L	ENSP00000233741:P163L	P	-	2	0	FANCL	58279285	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.706000	0.74649	2.759000	0.94783	0.563000	0.77884	CCA	.	.	.	none		0.313	FANCL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251497.1	NM_018062	
EHBP1	23301	hgsc.bcm.edu	37	2	63175859	63175859	+	Silent	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:63175859A>G	ENST00000263991.5	+	14	2465	c.1983A>G	c.(1981-1983)ggA>ggG	p.G661G	EHBP1_ENST00000405015.3_Silent_p.G626G|EHBP1_ENST00000431489.1_Silent_p.G626G|EHBP1_ENST00000354487.3_Silent_p.G626G|EHBP1_ENST00000405289.1_Silent_p.G626G	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	661						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AGAGCTCTGGAAGGACTTCAG	0.458																																					p.G661G		Atlas-SNP	.											.	EHBP1	127	.	0			c.A1983G						PASS	.						55.0	56.0	55.0					2																	63175859		2203	4300	6503	SO:0001819	synonymous_variant	23301	exon14			CTCTGGAAGGACT	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.1983A>G	chr2.hg19:g.63175859A>G		105.0	0.0	.		87.0	24.0	.	NM_015252	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Silent	SNP	ENST00000263991.5	hg19	CCDS1872.1																																																																																			.	.	.	none		0.458	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252	
RNF181	51255	hgsc.bcm.edu	37	2	85823986	85823987	+	Missense_Mutation	DNP	GA	GA	AC			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:85823986_85823987GA>AC	ENST00000306368.4	+	3	289_290	c.259_260GA>AC	c.(259-261)GAg>ACg	p.E87T	RNF181_ENST00000441634.1_Missense_Mutation_p.E87T	NM_016494.3	NP_057578.1	Q9P0P0	RN181_HUMAN	ring finger protein 181	87					protein autoubiquitination (GO:0051865)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)|stomach(1)	2						TGAGGAGGAGGAGACTGCCATT	0.535																																					p.E87K|p.E87A		Atlas-SNP	.											.	RNF181	10	.	0			c.G259A|c.A260C						PASS	.																																			SO:0001583	missense	51255	exon3			GAGGAGGAGACTG|AGGAGGAGACTGC	AF151072	CCDS1981.1	2p11.2	2013-01-09			ENSG00000168894	ENSG00000168894		"""RING-type (C3HC4) zinc fingers"""	28037	protein-coding gene	gene with protein product		612490				11042152	Standard	XM_005264359		Approved	HSPC238	uc002spv.1	Q9P0P0	OTTHUMG00000130182	Exception_encountered	chr2.hg19:g.85823986_85823987delinsAC	ENSP00000306906:p.Glu87Thr	92.0	0.0	.		46.0	14.0	.	NM_016494	Q53H81	Missense_Mutation	SNP	ENST00000306368.4	hg19	CCDS1981.1																																																																																			.	.	.	none		0.535	RNF181-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252500.1	NM_016494	
TTN	7273	hgsc.bcm.edu	37	2	179426840	179426840	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:179426840T>A	ENST00000591111.1	-	276	79320	c.79096A>T	c.(79096-79098)Act>Tct	p.T26366S	TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T25439S|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T19067S|TTN_ENST00000460472.2_Missense_Mutation_p.T18942S|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T28007S|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T19134S			Q8WZ42	TITIN_HUMAN	titin	26366	Ig-like 127.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGACTCTAGTTGTCTCTTTA	0.363																																					p.T28007S		Atlas-SNP	.											.	TTN	18412	.	0			c.A84019T						PASS	.						45.0	47.0	46.0					2																	179426840		1883	4112	5995	SO:0001583	missense	7273	exon326			CTCTAGTTGTCTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.79096A>T	chr2.hg19:g.179426840T>A	ENSP00000465570:p.Thr26366Ser	90.0	0.0	.		85.0	21.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	13.09	2.134735	0.37728	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	6.05	4.88	0.63580	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42877	0.1222	N	0.20445	0.575	0.49582	D	0.999808	D;D;D;D	0.56746	0.977;0.977;0.977;0.958	P;P;P;P	0.55011	0.766;0.766;0.766;0.689	T	0.44787	-0.9305	9	0.87932	D	0	.	13.6782	0.62467	0.0:0.0:0.1285:0.8715	.	18942;19067;19134;26366	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	25439;18942;19134;19067;18940	ENSP00000343764:T25439S;ENSP00000434586:T18942S;ENSP00000340554:T19134S;ENSP00000352154:T19067S	ENSP00000340554:T19134S	T	-	1	0	TTN	179135086	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	6.190000	0.72057	1.076000	0.40961	0.528000	0.53228	ACT	.	.	.	none		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PMS1	5378	hgsc.bcm.edu	37	2	190717495	190717495	+	Missense_Mutation	SNP	A	A	T	rs375164425		TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:190717495A>T	ENST00000441310.2	+	7	1047	c.814A>T	c.(814-816)Atc>Ttc	p.I272F	PMS1_ENST00000409823.3_Missense_Mutation_p.I233F|PMS1_ENST00000447232.2_Missense_Mutation_p.I272F|PMS1_ENST00000432292.3_Missense_Mutation_p.I96F|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000418224.3_Missense_Mutation_p.I96F	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	272					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TCAAAAAGATATCTTAAAGGT	0.313			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																													p.I272F		Atlas-SNP	.	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	.	PMS1	78	.	0			c.A814T						PASS	.						56.0	58.0	57.0					2																	190717495		2203	4299	6502	SO:0001583	missense	5378	exon7			AAAGATATCTTAA		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.814A>T	chr2.hg19:g.190717495A>T	ENSP00000406490:p.Ile272Phe	226.0	0.0	.		190.0	69.0	.	NM_001128144	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	ENST00000441310.2	hg19	CCDS2302.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.553094	0.65425	.	.	ENSG00000064933	ENST00000392338;ENST00000441310;ENST00000418224;ENST00000409823;ENST00000447232;ENST00000432292;ENST00000424307;ENST00000409593	D;D;D;D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03;-2.03;-2.03;-2.03	5.39	5.39	0.77823	Ribosomal protein S5 domain 2-type fold (1);DNA mismatch repair protein, N-terminal (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);DNA mismatch repair protein, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92750	0.7695	M	0.85630	2.765	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.986;1.0;1.0;0.994;0.987;0.986;0.986	D;D;D;D;D;D;D	0.87578	0.952;0.998;0.998;0.979;0.952;0.952;0.952	D	0.92936	0.6368	10	0.45353	T	0.12	-13.672	15.6976	0.77512	1.0:0.0:0.0:0.0	.	272;233;233;57;233;272;272	Q4VAL4;B4DMF4;Q5FBZ9;Q5FBZ6;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;.;.;PMS1_HUMAN	F	96;272;96;233;272;96;211;57	ENSP00000406490:I272F;ENSP00000404492:I96F;ENSP00000387125:I233F;ENSP00000401064:I272F;ENSP00000398378:I96F;ENSP00000389938:I211F;ENSP00000387169:I57F	ENSP00000376149:I96F	I	+	1	0	PMS1	190425740	1.000000	0.71417	1.000000	0.80357	0.366000	0.29705	4.548000	0.60718	2.168000	0.68352	0.397000	0.26171	ATC	.	.	.	alt		0.313	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2		
GLS	2744	hgsc.bcm.edu	37	2	191797508	191797508	+	Intron	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:191797508A>G	ENST00000320717.3	+	14	1908				GLS_ENST00000471443.1_3'UTR|GLS_ENST00000409626.1_Missense_Mutation_p.K144E|GLS_ENST00000409428.1_Intron|GLS_ENST00000338435.4_Missense_Mutation_p.K573E|GLS_ENST00000409215.1_Missense_Mutation_p.K78E	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	GACAGTATGGAAAAAAGTGTC	0.358																																					p.K573E		Atlas-SNP	.											.	GLS	47	.	0			c.A1717G						PASS	.						41.0	41.0	41.0					2																	191797508		876	1991	2867	SO:0001627	intron_variant	2744	exon15			GTATGGAAAAAAG	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1650+1145A>G	chr2.hg19:g.191797508A>G		73.0	0.0	.		50.0	16.0	.	NM_001256310	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	hg19	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.184100	0.57800	.	.	ENSG00000115419	ENST00000338435;ENST00000409626;ENST00000409215	T	0.49139	0.79	5.57	5.57	0.84162	.	.	.	.	.	T	0.40670	0.1126	.	.	.	0.31282	N	0.690478	B;P	0.42871	0.052;0.792	B;B	0.36608	0.027;0.229	T	0.51725	-0.8669	8	0.48119	T	0.1	.	15.7213	0.77713	1.0:0.0:0.0:0.0	.	227;573	Q68D38;O94925-3	.;.	E	573;144;78	ENSP00000340689:K573E	ENSP00000340689:K573E	K	+	1	0	GLS	191505753	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.850000	0.92190	2.102000	0.63906	0.533000	0.62120	AAA	.	.	.	none		0.358	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
STAT1	6772	hgsc.bcm.edu	37	2	191873805	191873805	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:191873805C>G	ENST00000361099.3	-	4	544	c.157G>C	c.(157-159)Gcc>Ccc	p.A53P	STAT1_ENST00000392323.2_Missense_Mutation_p.A55P|STAT1_ENST00000392322.3_Missense_Mutation_p.A53P|STAT1_ENST00000540176.1_Missense_Mutation_p.A53P|STAT1_ENST00000409465.1_Missense_Mutation_p.A53P	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	53					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CGGATGGTGGCAAATGAAACA	0.373																																					p.A53P		Atlas-SNP	.											.	STAT1	93	.	0			c.G157C						PASS	.						113.0	106.0	108.0					2																	191873805		2203	4300	6503	SO:0001583	missense	6772	exon4			TGGTGGCAAATGA		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.157G>C	chr2.hg19:g.191873805C>G	ENSP00000354394:p.Ala53Pro	78.0	0.0	.		69.0	16.0	.	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	hg19	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	C	34	5.300702	0.95601	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000540176;ENST00000392322;ENST00000392323;ENST00000424722;ENST00000454414;ENST00000432058	T;T;T;T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19	5.52	5.52	0.82312	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.80308	0.4599	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83341	-0.0008	10	0.72032	D	0.01	-28.6958	18.4444	0.90678	0.0:1.0:0.0:0.0	.	53;53	P42224-2;P42224	.;STAT1_HUMAN	P	53;53;53;53;55;53;53;53	ENSP00000354394:A53P;ENSP00000386244:A53P;ENSP00000438703:A53P;ENSP00000376136:A53P;ENSP00000376137:A55P;ENSP00000402548:A53P;ENSP00000411398:A53P;ENSP00000416019:A53P	ENSP00000354394:A53P	A	-	1	0	STAT1	191582050	1.000000	0.71417	0.977000	0.42913	0.863000	0.49368	7.818000	0.86416	2.602000	0.87976	0.557000	0.71058	GCC	.	.	.	none		0.373	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
DNPEP	23549	hgsc.bcm.edu	37	2	220251040	220251040	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:220251040C>T	ENST00000273075.4	-	5	647	c.427G>A	c.(427-429)Gac>Aac	p.D143N	DNPEP_ENST00000373972.1_Missense_Mutation_p.D68N|DNPEP_ENST00000523282.1_Missense_Mutation_p.D151N|AC053503.4_ENST00000420563.1_RNA	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	133					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGAGTCAGGTCACGGTCAAAC	0.612																																					p.D143N		Atlas-SNP	.											.	DNPEP	40	.	0			c.G427A						PASS	.						109.0	114.0	112.0					2																	220251040		2112	4221	6333	SO:0001583	missense	23549	exon5			TCAGGTCACGGTC		CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.427G>A	chr2.hg19:g.220251040C>T	ENSP00000273075:p.Asp143Asn	79.0	0.0	.		85.0	21.0	.	NM_012100	Q9BW44|Q9NUV5	Missense_Mutation	SNP	ENST00000273075.4	hg19	CCDS42823.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902953	0.92035	.	.	ENSG00000123992	ENST00000273075;ENST00000337010;ENST00000373972;ENST00000523282;ENST00000535056;ENST00000457935;ENST00000429013;ENST00000521459;ENST00000322176;ENST00000434339;ENST00000430206	.	.	.	5.25	4.38	0.52667	Peptidase M18, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.87204	0.6119	H	0.97158	3.95	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.998;0.999;1.0;0.999	D	0.90886	0.4757	9	0.87932	D	0	-5.5253	13.5776	0.61883	0.0:0.9251:0.0:0.0749	.	151;143;151;133;143	E7ETB3;B7Z822;B7Z7F0;Q9ULA0;Q53SB6	.;.;.;DNPEP_HUMAN;.	N	143;143;68;151;36;151;129;143;143;68;68	.	ENSP00000273075:D143N	D	-	1	0	DNPEP	219959284	1.000000	0.71417	0.934000	0.37439	0.798000	0.45092	7.422000	0.80217	1.217000	0.43442	0.561000	0.74099	GAC	.	.	.	none		0.612	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000130212.1	NM_012100	
SLC19A3	80704	hgsc.bcm.edu	37	2	228566972	228566972	+	Silent	SNP	T	T	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:228566972T>C	ENST00000258403.3	-	2	134	c.63A>G	c.(61-63)ttA>ttG	p.L21L	SLC19A3_ENST00000409287.1_Silent_p.L21L|SLC19A3_ENST00000541617.1_5'UTR	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	21					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)			breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	AAAAACCAAATAAGCAGAGGA	0.393																																					p.L21L		Atlas-SNP	.											.	SLC19A3	62	.	0			c.A63G						PASS	.						114.0	120.0	118.0					2																	228566972		2203	4300	6503	SO:0001819	synonymous_variant	80704	exon2			ACCAAATAAGCAG	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.63A>G	chr2.hg19:g.228566972T>C		59.0	0.0	.		77.0	27.0	.	NM_025243		Silent	SNP	ENST00000258403.3	hg19	CCDS2468.1																																																																																			.	.	.	none		0.393	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
UGT1A5	54579	hgsc.bcm.edu	37	2	234622288	234622288	+	Silent	SNP	T	T	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr2:234622288T>G	ENST00000373414.3	+	1	651	c.651T>G	c.(649-651)ccT>ccG	p.P217P	UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000608381.1_Silent_p.P217P|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000480628.1_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	217						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		TGCTCTACCCTCTGGCCCTGT	0.493																																					p.P217P		Atlas-SNP	.											.	UGT1A5	66	.	0			c.T651G						PASS	.						219.0	205.0	210.0					2																	234622288		2203	4300	6503	SO:0001819	synonymous_variant	54579	exon1			CTACCCTCTGGCC	M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.651T>G	chr2.hg19:g.234622288T>G		108.0	0.0	.		102.0	39.0	.	NM_019078	B8K294	Silent	SNP	ENST00000373414.3	hg19	CCDS33404.1																																																																																			.	.	.	none		0.493	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130985.1	NM_019078	
CNTN6	27255	hgsc.bcm.edu	37	3	1337389	1337389	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr3:1337389G>C	ENST00000446702.2	+	6	1186	c.559G>C	c.(559-561)Gaa>Caa	p.E187Q	CNTN6_ENST00000350110.2_Missense_Mutation_p.E187Q|CNTN6_ENST00000539053.1_Missense_Mutation_p.E115Q			Q9UQ52	CNTN6_HUMAN	contactin 6	187	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TGCCAAAGTGGAACCATCAGA	0.453																																					p.E187Q		Atlas-SNP	.											.	CNTN6	245	.	0			c.G559C						PASS	.						102.0	93.0	96.0					3																	1337389		2203	4300	6503	SO:0001583	missense	27255	exon6			AAAGTGGAACCAT	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.559G>C	chr3.hg19:g.1337389G>C	ENSP00000407822:p.Glu187Gln	120.0	0.0	.		116.0	39.0	.	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	hg19	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.251401	0.59212	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.67523	-0.27;-0.27;-0.27	5.79	4.91	0.64330	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.101551	0.42821	N	0.000649	T	0.54498	0.1862	L	0.31371	0.925	0.58432	D	0.999998	B;B	0.31274	0.019;0.317	B;B	0.26094	0.015;0.066	T	0.51076	-0.8751	10	0.30078	T	0.28	.	16.6803	0.85290	0.0:0.1297:0.8703:0.0	.	115;187	B4DGV0;Q9UQ52	.;CNTN6_HUMAN	Q	187;115;187	ENSP00000407822:E187Q;ENSP00000442791:E115Q;ENSP00000341882:E187Q	ENSP00000341882:E187Q	E	+	1	0	CNTN6	1312389	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	6.506000	0.73712	1.419000	0.47118	0.655000	0.94253	GAA	.	.	.	none		0.453	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
PLXNB1	5364	hgsc.bcm.edu	37	3	48463585	48463585	+	Silent	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr3:48463585A>G	ENST00000358536.4	-	6	1718	c.1449T>C	c.(1447-1449)gcT>gcC	p.A483A	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Silent_p.A483A|PLXNB1_ENST00000456774.1_Silent_p.A483A|PLXNB1_ENST00000296440.6_Silent_p.A483A	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	483					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCAGGTGCTGAGCACAGGAAG	0.587																																					p.A483A		Atlas-SNP	.											.	PLXNB1	150	.	0			c.T1449C						PASS	.						66.0	60.0	62.0					3																	48463585		2203	4300	6503	SO:0001819	synonymous_variant	5364	exon6			GTGCTGAGCACAG	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.1449T>C	chr3.hg19:g.48463585A>G		71.0	0.0	.		65.0	26.0	.	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	ENST00000358536.4	hg19	CCDS2765.1																																																																																			.	.	.	none		0.587	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
ROBO2	6092	hgsc.bcm.edu	37	3	77626674	77626674	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr3:77626674T>C	ENST00000461745.1	+	15	3137	c.2237T>C	c.(2236-2238)cTg>cCg	p.L746P	ROBO2_ENST00000332191.8_Missense_Mutation_p.L746P|ROBO2_ENST00000487694.3_Missense_Mutation_p.L762P	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	746	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GTCACTGTACTGACAGTTGGA	0.448																																					p.L746P		Atlas-SNP	.											.	ROBO2	527	.	0			c.T2237C						PASS	.						92.0	93.0	92.0					3																	77626674		1901	4119	6020	SO:0001583	missense	6092	exon15			CTGTACTGACAGT	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2237T>C	chr3.hg19:g.77626674T>C	ENSP00000417164:p.Leu746Pro	202.0	0.0	.		216.0	77.0	.	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	hg19	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008858	0.75046	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.57752	0.38;0.38;0.38	5.66	5.66	0.87406	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.36002	N	0.002843	T	0.59715	0.2214	L	0.41632	1.29	0.37584	D	0.919925	D;D;D	0.60160	0.984;0.97;0.987	P;P;P	0.57846	0.828;0.786;0.828	T	0.62374	-0.6868	9	0.35671	T	0.21	.	15.8956	0.79333	0.0:0.0:0.0:1.0	.	762;746;746	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	P	762;762;766;746;746;467	ENSP00000417335:L762P;ENSP00000417164:L746P;ENSP00000327536:L746P	ENSP00000327536:L746P	L	+	2	0	ROBO2	77709364	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	6.139000	0.71728	2.154000	0.67381	0.402000	0.26972	CTG	.	.	.	none		0.448	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
ABCC5	10057	hgsc.bcm.edu	37	3	183639163	183639163	+	Silent	SNP	G	G	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr3:183639163G>C	ENST00000334444.6	-	30	4479	c.4239C>G	c.(4237-4239)gtC>gtG	p.V1413V	ABCC5_ENST00000265586.6_Silent_p.V1370V	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1413	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	TGGACAGAAGGACCGATGGGG	0.547																																					p.V1413V		Atlas-SNP	.											.	ABCC5	142	.	0			c.C4239G						PASS	.						99.0	108.0	105.0					3																	183639163		2112	4243	6355	SO:0001819	synonymous_variant	10057	exon30			CAGAAGGACCGAT	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.4239C>G	chr3.hg19:g.183639163G>C		206.0	0.0	.		160.0	55.0	.	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	hg19	CCDS43176.1																																																																																			.	.	.	none		0.547	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
HGFAC	3083	hgsc.bcm.edu	37	4	3447058	3447058	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr4:3447058C>A	ENST00000382774.3	+	9	1198	c.1083C>A	c.(1081-1083)taC>taA	p.Y361*	HGFAC_ENST00000511533.1_Nonsense_Mutation_p.Y361*	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	361	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCTGGGAGTACTGCCGCCTGG	0.677																																					p.Y361X		Atlas-SNP	.											.	HGFAC	69	.	0			c.C1083A						PASS	.						38.0	28.0	31.0					4																	3447058		2179	4288	6467	SO:0001587	stop_gained	3083	exon9			GGAGTACTGCCGC	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.1083C>A	chr4.hg19:g.3447058C>A	ENSP00000372224:p.Tyr361*	107.0	0.0	.		91.0	38.0	.	NM_001528	Q14726|Q2M1W7|Q53X47	Nonsense_Mutation	SNP	ENST00000382774.3	hg19	CCDS3369.1	.	.	.	.	.	.	.	.	.	.	C	36	5.967662	0.97156	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	.	.	.	3.49	1.7	0.24286	.	0.250171	0.34110	U	0.004254	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8091	0.23794	0.0:0.7478:0.0:0.2522	.	.	.	.	X	361	.	ENSP00000372224:Y361X	Y	+	3	2	HGFAC	3416856	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	0.700000	0.25601	0.167000	0.19631	-0.448000	0.05591	TAC	.	.	.	none		0.677	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
RBM47	54502	hgsc.bcm.edu	37	4	40440004	40440004	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr4:40440004C>T	ENST00000381793.2	-	3	1303	c.907G>A	c.(907-909)Ggc>Agc	p.G303S	RBM47_ENST00000515809.1_Intron|RBM47_ENST00000295971.7_Missense_Mutation_p.G303S|RBM47_ENST00000381795.6_Missense_Mutation_p.G303S|RBM47_ENST00000319592.4_Missense_Mutation_p.G303S|RBM47_ENST00000514014.1_Missense_Mutation_p.G265S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	303	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						AGCTCAGTGCCGTTGAGGTTG	0.662																																					p.G303S		Atlas-SNP	.											.	RBM47	146	.	0			c.G907A						PASS	.						48.0	42.0	44.0					4																	40440004		2203	4300	6503	SO:0001583	missense	54502	exon4			CAGTGCCGTTGAG	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.907G>A	chr4.hg19:g.40440004C>T	ENSP00000371212:p.Gly303Ser	49.0	0.0	.		44.0	21.0	.	NM_001098634	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	ENST00000381793.2	hg19	CCDS43223.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059780	0.55325	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000514014	D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54	5.58	4.71	0.59529	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.85195	0.5641	M	0.72576	2.205	0.80722	D	1	D;P	0.71674	0.998;0.828	P;P	0.57776	0.827;0.507	D	0.86236	0.1640	10	0.87932	D	0	-31.4629	10.2085	0.43126	0.1366:0.7926:0.0:0.0708	.	303;303	A0AV96-2;A0AV96	.;RBM47_HUMAN	S	303;303;303;303;265	ENSP00000320108:G303S;ENSP00000371212:G303S;ENSP00000371214:G303S;ENSP00000295971:G303S;ENSP00000423243:G265S	ENSP00000295971:G303S	G	-	1	0	RBM47	40134761	1.000000	0.71417	0.997000	0.53966	0.090000	0.18270	5.721000	0.68477	2.630000	0.89119	0.462000	0.41574	GGC	.	.	.	none		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
KLHL8	57563	hgsc.bcm.edu	37	4	88091657	88091657	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr4:88091657C>A	ENST00000273963.5	-	7	1660	c.1319G>T	c.(1318-1320)tGg>tTg	p.W440L	KLHL8_ENST00000512111.1_Missense_Mutation_p.W440L|KLHL8_ENST00000545252.1_Missense_Mutation_p.W89L|KLHL8_ENST00000498875.2_Missense_Mutation_p.W364L|KLHL8_ENST00000425278.2_Missense_Mutation_p.W257L	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	440					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CACTGTACTCCACTGATCAGA	0.423																																					p.W440L		Atlas-SNP	.											.	KLHL8	51	.	0			c.G1319T						PASS	.						120.0	109.0	113.0					4																	88091657		2203	4300	6503	SO:0001583	missense	57563	exon7			GTACTCCACTGAT	AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1319G>T	chr4.hg19:g.88091657C>A	ENSP00000273963:p.Trp440Leu	358.0	0.0	.		337.0	82.0	.	NM_020803	Q53XA3|Q6N018	Missense_Mutation	SNP	ENST00000273963.5	hg19	CCDS3617.1	.	.	.	.	.	.	.	.	.	.	C	32	5.140373	0.94560	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000425278;ENST00000545252;ENST00000512111	D;D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18;-4.18	5.54	5.54	0.83059	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.98957	0.9645	H	0.97214	3.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.99316	1.0905	10	0.87932	D	0	.	19.4987	0.95085	0.0:1.0:0.0:0.0	.	257;364;440	Q68DU9;Q6N018;Q9P2G9	.;.;KLHL8_HUMAN	L	440;364;257;89;440	ENSP00000273963:W440L;ENSP00000426451:W364L;ENSP00000408854:W257L;ENSP00000439514:W89L;ENSP00000424131:W440L	ENSP00000273963:W440L	W	-	2	0	KLHL8	88310681	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.401000	0.79962	2.609000	0.88269	0.460000	0.39030	TGG	.	.	.	none		0.423	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1		
ETFDH	2110	hgsc.bcm.edu	37	4	159627888	159627888	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr4:159627888G>T	ENST00000511912.1	+	12	1908	c.1576G>T	c.(1576-1578)Ggt>Tgt	p.G526C	ETFDH_ENST00000307738.5_Missense_Mutation_p.G479C	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	526					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		GGCTCTGAGTGGTACTAATCA	0.468																																					p.G526C		Atlas-SNP	.											.	ETFDH	57	.	0			c.G1576T						PASS	.						170.0	162.0	164.0					4																	159627888		2203	4300	6503	SO:0001583	missense	2110	exon12			CTGAGTGGTACTA	S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.1576G>T	chr4.hg19:g.159627888G>T	ENSP00000426638:p.Gly526Cys	63.0	0.0	.		60.0	18.0	.	NM_004453	B4E3R9|J3KND9|Q7Z347	Missense_Mutation	SNP	ENST00000511912.1	hg19	CCDS3800.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348293	0.82132	.	.	ENSG00000171503	ENST00000511912;ENST00000307738	D;D	0.91577	-2.87;-2.87	5.64	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.96895	0.8986	H	0.96805	3.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97943	1.0327	10	0.87932	D	0	0.4172	14.4099	0.67109	0.0711:0.0:0.9289:0.0	.	479;465;526	B4E3R9;B4DEQ0;Q16134	.;.;ETFD_HUMAN	C	526;479	ENSP00000426638:G526C;ENSP00000303552:G479C	ENSP00000303552:G479C	G	+	1	0	ETFDH	159847338	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	1.380000	0.46344	0.591000	0.81541	GGT	.	.	.	none		0.468	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365718.2		
GALNT7	51809	hgsc.bcm.edu	37	4	174213365	174213365	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr4:174213365A>C	ENST00000265000.4	+	3	777	c.694A>C	c.(694-696)Aaa>Caa	p.K232Q	GALNT7_ENST00000512285.1_Missense_Mutation_p.K232Q|GALNT7_ENST00000502407.1_3'UTR	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	232	Catalytic subdomain A.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		CAGTGTAATTAAAAGGACTCC	0.353																																					p.K232Q		Atlas-SNP	.											.	GALNT7	61	.	0			c.A694C						PASS	.						87.0	93.0	91.0					4																	174213365		2203	4300	6503	SO:0001583	missense	51809	exon3			GTAATTAAAAGGA	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.694A>C	chr4.hg19:g.174213365A>C	ENSP00000265000:p.Lys232Gln	176.0	0.0	.		151.0	53.0	.	NM_017423	B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	ENST00000265000.4	hg19	CCDS3815.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.3|26.3	4.724413|4.724413	0.89298|0.89298	.|.	.|.	ENSG00000109586|ENSG00000109586	ENST00000265000;ENST00000512285;ENST00000458613|ENST00000505308	T;T|.	0.61980|.	0.06;0.06|.	5.77|5.77	5.77|5.77	0.91146|0.91146	Glycosyl transferase, family 2 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59459|0.59459	0.2195|0.2195	L|L	0.37897|0.37897	1.145|1.145	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.971;0.998|.	P;D|.	0.68621|.	0.893;0.959|.	T|T	0.55289|0.55289	-0.8164|-0.8164	10|5	0.54805|.	T|.	0.06|.	.|.	16.3948|16.3948	0.83586|0.83586	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	9;232|.	B4DIB4;Q86SF2|.	.;GALT7_HUMAN|.	Q|F	232;232;9|28	ENSP00000265000:K232Q;ENSP00000427050:K232Q|.	ENSP00000265000:K232Q|.	K|L	+|+	1|3	0|2	GALNT7|GALNT7	174449940|174449940	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.339000|9.339000	0.96797|0.96797	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	AAA|TTA	.	.	.	none		0.353	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423	
PPIP5K2	23262	hgsc.bcm.edu	37	5	102509564	102509564	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr5:102509564A>G	ENST00000358359.3	+	21	2926	c.2417A>G	c.(2416-2418)tAt>tGt	p.Y806C	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.Y806C|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.Y806C	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	806					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						AATTTTAGGTATTCTAGAGGT	0.303																																					p.Y806C		Atlas-SNP	.											.	PPIP5K2	98	.	0			c.A2417G						PASS	.						131.0	126.0	128.0					5																	102509564		2202	4299	6501	SO:0001583	missense	23262	exon20			TTAGGTATTCTAG	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.2417A>G	chr5.hg19:g.102509564A>G	ENSP00000351126:p.Tyr806Cys	38.0	0.0	.		36.0	12.0	.	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	hg19		.	.	.	.	.	.	.	.	.	.	A	22.0	4.224670	0.79576	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000509597	T;T;T;T	0.27256	2.35;2.34;2.35;1.68	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000003	T	0.57007	0.2024	M	0.84948	2.725	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79108	0.992;0.973;0.984	T	0.63198	-0.6691	10	0.72032	D	0.01	.	16.5993	0.84807	1.0:0.0:0.0:0.0	.	806;806;806	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	C	806;806;806;806;80	ENSP00000313070:Y806C;ENSP00000351126:Y806C;ENSP00000416016:Y806C;ENSP00000424948:Y80C	ENSP00000313070:Y806C	Y	+	2	0	PPIP5K2	102537463	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.335000	0.96500	2.311000	0.77944	0.528000	0.53228	TAT	.	.	.	none		0.303	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
IK	3550	hgsc.bcm.edu	37	5	140034273	140034273	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr5:140034273G>T	ENST00000417647.2	+	8	737	c.598G>T	c.(598-600)Gag>Tag	p.E200*		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	200					cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGAAAGATGAGGATCCTGA	0.318																																					p.E200X		Atlas-SNP	.											.	IK	46	.	0			c.G598T						PASS	.						47.0	45.0	46.0					5																	140034273		1814	4070	5884	SO:0001587	stop_gained	3550	exon8			AAAGATGAGGATC	BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.598G>T	chr5.hg19:g.140034273G>T	ENSP00000396301:p.Glu200*	362.0	1.0	.		277.0	105.0	.	NM_006083	Q6IPD8	Nonsense_Mutation	SNP	ENST00000417647.2	hg19	CCDS47280.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300878	0.81136	.	.	ENSG00000113141	ENST00000417647;ENST00000508301;ENST00000261812;ENST00000502899	.	.	.	5.92	5.92	0.95590	.	0.044646	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	19.9276	0.97108	0.0:0.0:1.0:0.0	.	.	.	.	X	200	.	ENSP00000261812:E200X	E	+	1	0	IK	140014457	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.605000	0.98321	2.805000	0.96524	0.655000	0.94253	GAG	.	.	.	none		0.318	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372897.1	NM_006083	
RANBP9	10048	hgsc.bcm.edu	37	6	13639868	13639868	+	Silent	SNP	T	T	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:13639868T>C	ENST00000011619.3	-	9	1510	c.1452A>G	c.(1450-1452)ccA>ccG	p.P484P	RANBP9_ENST00000539980.1_Silent_p.P255P	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	484					axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			GGCTCATACTTGGACTACTAA	0.413																																					p.P484P		Atlas-SNP	.											.	RANBP9	42	.	0			c.A1452G						PASS	.						140.0	126.0	131.0					6																	13639868		2203	4300	6503	SO:0001819	synonymous_variant	10048	exon9			CATACTTGGACTA	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.1452A>G	chr6.hg19:g.13639868T>C		97.0	0.0	.		86.0	36.0	.	NM_005493	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Silent	SNP	ENST00000011619.3	hg19	CCDS4529.1																																																																																			.	.	.	none		0.413	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
FAM8A1	51439	hgsc.bcm.edu	37	6	17601243	17601243	+	Silent	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:17601243C>A	ENST00000259963.3	+	1	658	c.603C>A	c.(601-603)ggC>ggA	p.G201G		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	201						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			CAGTCGCGGGCCTGGGACCCC	0.716																																					p.G201G		Atlas-SNP	.											.	FAM8A1	26	.	0			c.C603A						PASS	.						4.0	5.0	5.0					6																	17601243		1915	3803	5718	SO:0001819	synonymous_variant	51439	exon1			CGCGGGCCTGGGA	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.603C>A	chr6.hg19:g.17601243C>A		21.0	0.0	.		23.0	8.0	.	NM_016255	B2R725	Silent	SNP	ENST00000259963.3	hg19	CCDS4540.1																																																																																			.	.	.	none		0.716	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
KDM1B	221656	hgsc.bcm.edu	37	6	18166565	18166565	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:18166565C>G	ENST00000297792.5	+	6	550	c.373C>G	c.(373-375)Cct>Gct	p.P125A	KDM1B_ENST00000388870.2_Missense_Mutation_p.P125A|KDM1B_ENST00000397244.1_Missense_Mutation_p.P125A|KDM1B_ENST00000546309.2_Intron			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	125					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						CAAAACCGAACCTAGTCCCAA	0.398																																					p.P125A		Atlas-SNP	.											.	KDM1B	58	.	0			c.C373G						PASS	.						108.0	103.0	105.0					6																	18166565		2203	4300	6503	SO:0001583	missense	221656	exon6			ACCGAACCTAGTC	AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.373C>G	chr6.hg19:g.18166565C>G	ENSP00000297792:p.Pro125Ala	132.0	0.0	.		124.0	50.0	.	NM_153042	A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Missense_Mutation	SNP	ENST00000297792.5	hg19	CCDS34343.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726252	0.48833	.	.	ENSG00000165097	ENST00000388870;ENST00000397244;ENST00000297792;ENST00000388869	T;T;T	0.40225	1.38;1.04;1.04	5.66	5.66	0.87406	.	0.000000	0.56097	U	0.000024	T	0.47948	0.1473	L	0.35723	1.085	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.14980	-1.0453	10	0.29301	T	0.29	-3.916	20.1253	0.97977	0.0:1.0:0.0:0.0	.	125	A2A2C6	.	A	125	ENSP00000373522:P125A;ENSP00000380419:P125A;ENSP00000297792:P125A	ENSP00000297792:P125A	P	+	1	0	KDM1B	18274544	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.152000	0.77419	2.832000	0.97577	0.655000	0.94253	CCT	.	.	.	none		0.398	KDM1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277080.1	NM_153042	
HIST1H2BB	3018	hgsc.bcm.edu	37	6	26043884	26043884	+	Splice_Site	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:26043884A>G	ENST00000357905.2	-	1	1	c.2T>C	c.(1-3)aTg>aCg	p.M1T	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	1					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						GGGTTCAGGCATTGCTATTCC	0.453																																					p.M1T		Atlas-SNP	.											.	HIST1H2BB	20	.	0			c.T2C						PASS	.						50.0	51.0	50.0					6																	26043884		2203	4300	6503	SO:0001630	splice_region_variant	3018	exon1			TCAGGCATTGCTA	AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.0-1T>C	chr6.hg19:g.26043884A>G		40.0	0.0	.		34.0	15.0	.	NM_021062	Q4KN36	Missense_Mutation	SNP	ENST00000357905.2	hg19	CCDS4575.1	.	.	.	.	.	.	.	.	.	.	A	11.00	1.510401	0.27036	.	.	ENSG00000196226	ENST00000357905	T	0.18960	2.18	5.34	5.34	0.76211	.	0.000000	0.64402	U	0.000001	T	0.34861	0.0912	.	.	.	0.80722	D	1	D	0.55800	0.973	P	0.61201	0.885	T	0.22034	-1.0228	9	0.87932	D	0	.	14.7798	0.69756	1.0:0.0:0.0:0.0	.	1	P33778	H2B1B_HUMAN	T	1	ENSP00000350580:M1T	ENSP00000350580:M1T	M	-	2	0	HIST1H2BB	26151863	1.000000	0.71417	0.975000	0.42487	0.004000	0.04260	7.131000	0.77243	2.126000	0.65437	0.533000	0.62120	ATG	.	.	.	none		0.453	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040083.1	NM_021062	Missense_Mutation
ZNF391	346157	hgsc.bcm.edu	37	6	27368767	27368767	+	Silent	SNP	T	T	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:27368767T>C	ENST00000244576.4	+	3	1163	c.618T>C	c.(616-618)acT>acC	p.T206T		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						GCCGAAGCACTAACCTTAGTC	0.423																																					p.T206T		Atlas-SNP	.											.	ZNF391	90	.	0			c.T618C						PASS	.						71.0	75.0	73.0					6																	27368767		2193	4298	6491	SO:0001819	synonymous_variant	346157	exon3			AAGCACTAACCTT	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.618T>C	chr6.hg19:g.27368767T>C		61.0	0.0	.		48.0	20.0	.	NM_001076781	B4DH77	Silent	SNP	ENST00000244576.4	hg19	CCDS43429.1																																																																																			.	.	.	none		0.423	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040145.2	NM_001076781	
SLC22A7	10864	hgsc.bcm.edu	37	6	43266308	43266308	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:43266308G>T	ENST00000372585.5	+	1	307	c.212G>T	c.(211-213)cGg>cTg	p.R71L	SLC22A7_ENST00000487175.1_Intron|SLC22A7_ENST00000372574.3_Missense_Mutation_p.R71L|SLC22A7_ENST00000372589.3_Missense_Mutation_p.R71L	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	71					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.R71Q(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CATCTTCCCCGGGAGCCTGAT	0.662																																					p.R71L		Atlas-SNP	.											SLC22A7,NS,carcinoma,0,1	SLC22A7	69	.	1	Substitution - Missense(1)	lung(1)	c.G212T						PASS	.						45.0	42.0	43.0					6																	43266308		2203	4300	6503	SO:0001583	missense	10864	exon1			TTCCCCGGGAGCC	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.212G>T	chr6.hg19:g.43266308G>T	ENSP00000361666:p.Arg71Leu	46.0	0.0	.		24.0	11.0	.	NM_006672	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	hg19	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	G	9.154	1.017095	0.19355	.	.	ENSG00000137204	ENST00000449231;ENST00000372589;ENST00000372585;ENST00000372574	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.63	0.872	0.19113	.	0.276047	0.36409	N	0.002603	T	0.12475	0.0303	L	0.28115	0.83	0.36271	D	0.855183	B;B;B	0.14438	0.006;0.01;0.01	B;B;B	0.18263	0.016;0.021;0.021	T	0.32719	-0.9896	10	0.02654	T	1	.	8.7559	0.34645	0.4671:0.0:0.5329:0.0	.	71;71;71	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	L	71	ENSP00000411818:R71L;ENSP00000361670:R71L;ENSP00000361666:R71L;ENSP00000361655:R71L	ENSP00000361655:R71L	R	+	2	0	SLC22A7	43374286	0.000000	0.05858	0.848000	0.33437	0.486000	0.33341	-0.458000	0.06737	-0.127000	0.11661	-0.253000	0.11424	CGG	.	.	.	none		0.662	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
DDO	8528	hgsc.bcm.edu	37	6	110726039	110726039	+	Silent	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:110726039A>G	ENST00000368924.3	-	4	495	c.480T>C	c.(478-480)ttT>ttC	p.F160F	DDO_ENST00000368923.3_Intron	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	132					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		AAGCCTGACCAAACACATACT	0.483																																					p.F160F		Atlas-SNP	.											.	DDO	51	.	0			c.T480C						PASS	.						99.0	88.0	91.0					6																	110726039		2203	4300	6503	SO:0001819	synonymous_variant	8528	exon4			CTGACCAAACACA	D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.480T>C	chr6.hg19:g.110726039A>G		145.0	0.0	.		105.0	47.0	.	NM_003649	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Silent	SNP	ENST00000368924.3	hg19	CCDS5082.1																																																																																			.	.	.	none		0.483	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1		
CCDC170	80129	hgsc.bcm.edu	37	6	151907203	151907203	+	Silent	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:151907203C>T	ENST00000239374.7	+	7	1371	c.1272C>T	c.(1270-1272)aaC>aaT	p.N424N	CCDC170_ENST00000367290.5_Silent_p.N424N	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	424																	TGCGAGACAACTTGAATTTTG	0.433																																					p.N424N		Atlas-SNP	.											.	.	.	.	0			c.C1272T						PASS	.						60.0	60.0	60.0					6																	151907203		1880	4125	6005	SO:0001819	synonymous_variant	80129	exon7			AGACAACTTGAAT	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1272C>T	chr6.hg19:g.151907203C>T		72.0	0.0	.		66.0	24.0	.	NM_025059	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Silent	SNP	ENST00000239374.7	hg19	CCDS43515.1																																																																																			.	.	.	none		0.433	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059	
MAS1	4142	hgsc.bcm.edu	37	6	160328746	160328746	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:160328746G>T	ENST00000252660.4	+	1	773	c.759G>T	c.(757-759)gaG>gaT	p.E253D		NM_002377.2	NP_002368.1	P04201	MAS_HUMAN	MAS1 proto-oncogene, G protein-coupled receptor	253					activation of NF-kappaB-inducing kinase activity (GO:0007250)|anatomical structure morphogenesis (GO:0009653)|cell proliferation (GO:0008283)|cellular response to peptide hormone stimulus (GO:0071375)|G-protein coupled receptor signaling pathway (GO:0007186)|hippocampus development (GO:0021766)|male gonad development (GO:0008584)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|protein kinase C signaling (GO:0070528)|regulation of inflammatory response (GO:0050727)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin receptor activity (GO:0001595)|angiotensin type II receptor activity (GO:0004945)|G-protein coupled receptor activity (GO:0004930)|peptide binding (GO:0042277)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		TGTACTATGAGTATTGGTCGA	0.448																																					p.E253D		Atlas-SNP	.											.	MAS1	42	.	0			c.G759T						PASS	.						133.0	123.0	126.0					6																	160328746		2203	4300	6503	SO:0001583	missense	4142	exon1			CTATGAGTATTGG	M13150	CCDS5272.1	6q24-q27	2014-06-26	2014-06-26		ENSG00000130368	ENSG00000130368		"""GPCR / Class A : Orphans"""	6899	protein-coding gene	gene with protein product		165180	"""MAS1 oncogene"""				Standard	NM_002377		Approved		uc003qsz.3	P04201	OTTHUMG00000015944	ENST00000252660.4:c.759G>T	chr6.hg19:g.160328746G>T	ENSP00000252660:p.Glu253Asp	110.0	0.0	.		110.0	47.0	.	NM_002377	E1P5B3|Q2TBC9|Q6FG47	Missense_Mutation	SNP	ENST00000252660.4	hg19	CCDS5272.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843115	0.32606	.	.	ENSG00000130368	ENST00000252660	T	0.37058	1.22	5.2	5.2	0.72013	GPCR, rhodopsin-like superfamily (1);	0.272836	0.26103	N	0.026338	T	0.17238	0.0414	L	0.39898	1.24	0.34753	D	0.731961	P	0.34615	0.459	B	0.34590	0.186	T	0.08432	-1.0722	10	0.35671	T	0.21	.	12.3072	0.54908	0.0:0.1845:0.8155:0.0	.	253	P04201	MAS_HUMAN	D	253	ENSP00000252660:E253D	ENSP00000252660:E253D	E	+	3	2	MAS1	160248736	0.678000	0.27586	0.981000	0.43875	0.612000	0.37316	0.732000	0.26072	2.407000	0.81776	0.655000	0.94253	GAG	.	.	.	none		0.448	MAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042930.2	NM_002377	
IGF2BP3	10643	hgsc.bcm.edu	37	7	23352352	23352353	+	Splice_Site	DNP	GC	GC	AT			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr7:23352352_23352353GC>AT	ENST00000258729.3	-	14	1998		c.e14+1			NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3						anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						GAGCCCACTTGCCTGGCAAGCA	0.431																																					.		Atlas-SNP	.											.	IGF2BP3	71	.	0			c.1641+2C>T|c.1641+1G>A						PASS	.																																			SO:0001630	splice_region_variant	10643	exon15			CCACTTGCCTGGC|CACTTGCCTGGCA	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1642_1642delinsAT	chr7.hg19:g.23352352_23352353delinsAT		185.0|184.0	0.0	.		237.0	117.0|120.0	.	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Splice_Site	SNP	ENST00000258729.3	hg19	CCDS5382.1																																																																																			.	.	.	none		0.431	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	Intron
GATS	352954	hgsc.bcm.edu	37	7	99821281	99821281	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr7:99821281G>A	ENST00000436886.2	-	4	700	c.452C>T	c.(451-453)tCa>tTa	p.S151L	GATS_ENST00000543273.1_RNA	NM_178831.6	NP_849153.3	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand	151										endometrium(2)|large_intestine(2)|lung(4)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAACTCTGATGACAACGTGTG	0.607																																					p.S151L		Atlas-SNP	.											.	GATS	18	.	0			c.C452T						PASS	.						205.0	216.0	212.0					7																	99821281		2134	4232	6366	SO:0001583	missense	352954	exon4			TCTGATGACAACG	AK095056	CCDS43621.1	7q22.1	2014-08-13	2009-04-08	2009-04-08	ENSG00000160844	ENSG00000239521			29954	protein-coding gene	gene with protein product	"""stromal antigen 3 opposite strand"""					12477932	Standard	NM_178831		Approved	DKFZp686B07267, STAG3OS	uc003uua.4	Q8NAP1	OTTHUMG00000155289	ENST00000436886.2:c.452C>T	chr7.hg19:g.99821281G>A	ENSP00000389760:p.Ser151Leu	378.0	0.0	.		408.0	90.0	.	NM_178831	D6W5V0|Q68D93|Q6P198|Q6PII7|Q7Z720|Q86UK9	Missense_Mutation	SNP	ENST00000436886.2	hg19	CCDS43621.1	.	.	.	.	.	.	.	.	.	.	g	13.87	2.367175	0.41902	.	.	ENSG00000160844	ENST00000436886	.	.	.	1.56	1.56	0.23342	.	0.216774	0.39687	N	0.001293	T	0.31136	0.0787	N	0.12182	0.205	0.35791	D	0.822377	B	0.17038	0.02	B	0.22152	0.038	T	0.23332	-1.0191	9	0.37606	T	0.19	.	9.1169	0.36764	0.0:0.0:1.0:0.0	.	151	Q8NAP1	GATS_HUMAN	L	151	.	ENSP00000389760:S151L	S	-	2	0	GATS	99659217	1.000000	0.71417	0.999000	0.59377	0.322000	0.28314	7.487000	0.81328	0.787000	0.33731	0.173000	0.16961	TCA	.	.	.	none		0.607	GATS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178831	
SRRT	51593	hgsc.bcm.edu	37	7	100482162	100482162	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr7:100482162G>A	ENST00000347433.4	+	7	1089	c.931G>A	c.(931-933)Gac>Aac	p.D311N	SRRT_ENST00000432932.1_Missense_Mutation_p.D311N|SRRT_ENST00000457580.2_Missense_Mutation_p.D311N|SRRT_ENST00000388793.4_Missense_Mutation_p.D311N			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	311	Glu-rich.			D -> Y (in Ref. 4; BAG64018). {ECO:0000305}.	cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GAAGAAGGAAGACGGCAAGCA	0.627																																					p.D311N		Atlas-SNP	.											.	SRRT	108	.	0			c.G931A						PASS	.						47.0	48.0	48.0					7																	100482162		2198	4300	6498	SO:0001583	missense	51593	exon7			AAGGAAGACGGCA		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.931G>A	chr7.hg19:g.100482162G>A	ENSP00000314491:p.Asp311Asn	163.0	0.0	.		234.0	62.0	.	NM_001128853	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	hg19	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414782	0.42817	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433	T;T	0.16597	2.33;2.33	3.91	3.91	0.45181	.	0.380247	0.27031	N	0.021263	T	0.07413	0.0187	N	0.08118	0	0.45567	D	0.998511	P;P;P;B	0.36535	0.557;0.557;0.557;0.421	B;B;B;B	0.30855	0.121;0.121;0.121;0.057	T	0.38824	-0.9643	10	0.21014	T	0.42	.	11.5862	0.50920	0.0:0.0:1.0:0.0	.	311;311;311;311	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	N	311	ENSP00000416553:D311N;ENSP00000314491:D311N	ENSP00000314491:D311N	D	+	1	0	SRRT	100320098	1.000000	0.71417	0.972000	0.41901	0.015000	0.08874	3.933000	0.56545	2.203000	0.70933	0.491000	0.48974	GAC	.	.	.	none		0.627	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
CPED1	79974	hgsc.bcm.edu	37	7	120935571	120935571	+	Silent	SNP	T	T	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr7:120935571T>C	ENST00000310396.5	+	23	3413	c.2946T>C	c.(2944-2946)taT>taC	p.Y982Y		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	982						endoplasmic reticulum (GO:0005783)											TGGGAAGATATTTCAGCAATC	0.323																																					p.Y982Y		Atlas-SNP	.											.	.	.	.	0			c.T2946C						PASS	.						82.0	78.0	79.0					7																	120935571		2203	4300	6503	SO:0001819	synonymous_variant	79974	exon23			AAGATATTTCAGC		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2946T>C	chr7.hg19:g.120935571T>C		114.0	0.0	.		117.0	31.0	.	NM_024913	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	hg19	CCDS34739.1																																																																																			.	.	.	none		0.323	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	
DLGAP2	9228	hgsc.bcm.edu	37	8	1626467	1626467	+	Silent	SNP	G	G	T	rs149482724		TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr8:1626467G>T	ENST00000421627.2	+	9	2270	c.2136G>T	c.(2134-2136)acG>acT	p.T712T	DLGAP2_ENST00000524065.1_3'UTR	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	791					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		ACATCACCACGGAGGACAAAG	0.622																																					p.T712T		Atlas-SNP	.											.	DLGAP2	292	.	0			c.G2136T						PASS	.						58.0	66.0	63.0					8																	1626467		2124	4221	6345	SO:0001819	synonymous_variant	9228	exon9			CACCACGGAGGAC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2136G>T	chr8.hg19:g.1626467G>T		96.0	0.0	.		98.0	9.0	.	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	hg19	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	7.146	0.582724	0.13749	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.09	2.26	0.28386	.	.	.	.	.	T	0.54447	0.1859	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42275	-0.9461	4	.	.	.	-7.5861	6.5711	0.22539	0.0714:0.1308:0.662:0.1358	.	.	.	.	L	715	.	.	R	+	2	0	DLGAP2	1613874	1.000000	0.71417	0.267000	0.24556	0.686000	0.39977	3.695000	0.54749	0.159000	0.19401	-0.321000	0.08615	CGG	.	G|0.999;A|0.001	.	alt		0.622	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
SPAG11B	10407	hgsc.bcm.edu	37	8	7308713	7308713	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr8:7308713A>G	ENST00000297498.2	-	3	389	c.223T>C	c.(223-225)Tct>Cct	p.S75P	SPAG11B_ENST00000528168.1_Missense_Mutation_p.S22P|SPAG11B_ENST00000361111.2_Intron|SPAG11B_ENST00000359758.5_Intron|SPAG11B_ENST00000398462.2_Intron|SPAG11B_ENST00000458665.1_Intron	NM_016512.3	NP_057596.1	Q08648	SG11B_HUMAN	sperm associated antigen 11B	75					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				large_intestine(2)|lung(3)|urinary_tract(1)	6				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		TCCCGGTGAGAGATGTGCACT	0.458																																					p.S75P		Atlas-SNP	.											.	SPAG11B	32	.	0			c.T223C						PASS	.						63.0	77.0	72.0					8																	7308713		2080	4188	6268	SO:0001583	missense	10407	exon3			GGTGAGAGATGTG	AF168616	CCDS5964.1, CCDS5965.1, CCDS5966.1, CCDS5967.1, CCDS47774.1	8p23.1	2014-02-21	2007-03-15	2007-03-15	ENSG00000164871	ENSG00000164871			14534	protein-coding gene	gene with protein product	"""epididymal protein 2B"""	606560				8167223, 1693137	Standard	NM_058200		Approved	HE2, EP2, EP2C, EP2D, EDDM2B	uc003wrl.3	Q08648	OTTHUMG00000129219	ENST00000297498.2:c.223T>C	chr8.hg19:g.7308713A>G	ENSP00000297498:p.Ser75Pro	420.0	0.0	.		507.0	146.0	.	NM_016512	E9PFH0|Q546A0|Q6ZYB2|Q9H4P8|Q9H4P9|Q9H4Q0|Q9H4Q1|Q9H4Q2|Q9NRT3|Q9NRV4|Q9NRV5|Q9NRV6|Q9NRV7|Q9NRV8	Missense_Mutation	SNP	ENST00000297498.2	hg19	CCDS5966.1	.	.	.	.	.	.	.	.	.	.	A	9.682	1.149439	0.21288	.	.	ENSG00000164871	ENST00000297498;ENST00000528168	T;T	0.51071	1.18;0.72	2.69	-2.8	0.05823	.	.	.	.	.	T	0.22126	0.0533	N	0.12746	0.255	0.09310	N	1	B;B	0.16603	0.018;0.003	B;B	0.17433	0.018;0.006	T	0.17048	-1.0382	9	0.23891	T	0.37	.	3.1877	0.06607	0.378:0.0:0.4097:0.2123	.	75;22	Q08648;Q08648-2	SG11B_HUMAN;.	P	75;22	ENSP00000297498:S75P;ENSP00000431230:S22P	ENSP00000297498:S75P	S	-	1	0	SPAG11B	7296123	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.320000	0.08028	-0.619000	0.05648	0.373000	0.22412	TCT	.	.	.	none		0.458	SPAG11B-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251390.2	NM_058202, NM_058200, NM_058201, NM_016512, NM_058203, NM_058206, NM_058207	
ENTPD4	9583	hgsc.bcm.edu	37	8	23305329	23305329	+	Silent	SNP	C	C	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr8:23305329C>G	ENST00000358689.4	-	4	511	c.276G>C	c.(274-276)gtG>gtC	p.V92V	ENTPD4_ENST00000356206.6_Silent_p.V92V|ENTPD4_ENST00000417069.2_Silent_p.V92V	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	92					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		CACAGTCCACCACGATCCCAT	0.453																																					p.V92V		Atlas-SNP	.											.	ENTPD4	56	.	0			c.G276C						PASS	.						259.0	200.0	220.0					8																	23305329		2203	4300	6503	SO:0001819	synonymous_variant	9583	exon4			GTCCACCACGATC	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.276G>C	chr8.hg19:g.23305329C>G		110.0	0.0	.		153.0	77.0	.	NM_004901	D3DSS3|O15092	Silent	SNP	ENST00000358689.4	hg19	CCDS6041.1																																																																																			.	.	.	none		0.453	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901	
ZNF395	55893	hgsc.bcm.edu	37	8	28206326	28206326	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr8:28206326C>G	ENST00000344423.5	-	10	1583	c.1452G>C	c.(1450-1452)aaG>aaC	p.K484N	ZNF395_ENST00000523095.1_Missense_Mutation_p.K484N|ZNF395_ENST00000523202.1_Missense_Mutation_p.K484N	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		TGCGGCACTTCTTAGCCTCCC	0.627																																					p.K484N		Atlas-SNP	.											.	ZNF395	54	.	0			c.G1452C						PASS	.						63.0	60.0	61.0					8																	28206326		2203	4300	6503	SO:0001583	missense	55893	exon10			GCACTTCTTAGCC	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1452G>C	chr8.hg19:g.28206326C>G	ENSP00000340494:p.Lys484Asn	86.0	0.0	.		82.0	21.0	.	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	ENST00000344423.5	hg19	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.885180	0.91814	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.38560	1.13;1.13;1.13	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.69387	0.3105	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74216	-0.3737	10	0.87932	D	0	-24.8941	17.1137	0.86683	0.0:1.0:0.0:0.0	.	484	Q9H8N7	ZN395_HUMAN	N	484	ENSP00000340494:K484N;ENSP00000429640:K484N;ENSP00000428452:K484N	ENSP00000340494:K484N	K	-	3	2	ZNF395	28262245	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.488000	0.45276	2.633000	0.89246	0.650000	0.86243	AAG	.	.	.	none		0.627	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
ADAM32	203102	hgsc.bcm.edu	37	8	39080665	39080665	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr8:39080665T>G	ENST00000379907.4	+	14	1560	c.1433T>G	c.(1432-1434)aTc>aGc	p.I478S	ADAM32_ENST00000519315.1_Missense_Mutation_p.I372S|ADAM32_ENST00000437682.2_Missense_Mutation_p.I379S	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	478	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			ATAACTTTAATCAATGGACTT	0.393																																					p.I478S		Atlas-SNP	.											.	ADAM32	70	.	0			c.T1433G						PASS	.						64.0	62.0	62.0					8																	39080665		1893	4113	6006	SO:0001583	missense	203102	exon14			CTTTAATCAATGG	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1433T>G	chr8.hg19:g.39080665T>G	ENSP00000369238:p.Ile478Ser	66.0	0.0	.		87.0	27.0	.	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	hg19	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	T	7.793	0.711971	0.15306	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907	T;T;T	0.03004	4.08;4.16;4.47	5.55	-11.1	0.00147	ADAM, cysteine-rich (1);Blood coagulation inhibitor, Disintegrin (2);	2.794810	0.02236	N	0.065318	T	0.02610	0.0079	N	0.20574	0.59	0.09310	N	1	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.09377	0.0;0.001;0.004	T	0.26883	-1.0090	10	0.16420	T	0.52	.	13.9077	0.63845	0.1274:0.0861:0.0:0.7864	.	379;372;478	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	S	379;372;478	ENSP00000405978:I379S;ENSP00000429422:I372S;ENSP00000369238:I478S	ENSP00000369238:I478S	I	+	2	0	ADAM32	39199822	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.629000	0.02029	-2.184000	0.00762	-0.339000	0.08088	ATC	.	.	.	none		0.393	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
C9orf152	401546	hgsc.bcm.edu	37	9	112963539	112963539	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr9:112963539G>A	ENST00000400613.4	-	2	1018	c.409C>T	c.(409-411)Caa>Taa	p.Q137*	C9orf152_ENST00000473442.1_Intron	NM_001012993.2	NP_001013011.2	Q5JTZ5	CI152_HUMAN	chromosome 9 open reading frame 152	137										NS(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						TGATGTACTTGATGACTGGTG	0.547																																					p.Q137X		Atlas-SNP	.											.	C9orf152	20	.	0			c.C409T						PASS	.						169.0	154.0	159.0					9																	112963539		2203	4300	6503	SO:0001587	stop_gained	401546	exon2			GTACTTGATGACT	BX648620	CCDS35102.2	9q31.3	2012-04-03			ENSG00000188959	ENSG00000188959			31455	protein-coding gene	gene with protein product							Standard	NM_001012993		Approved	bA470J20.2	uc011lwk.2	Q5JTZ5	OTTHUMG00000020478	ENST00000400613.4:c.409C>T	chr9.hg19:g.112963539G>A	ENSP00000383456:p.Gln137*	62.0	0.0	.		30.0	11.0	.	NM_001012993	A8MWT6	Nonsense_Mutation	SNP	ENST00000400613.4	hg19	CCDS35102.2	.	.	.	.	.	.	.	.	.	.	G	38	6.959087	0.97964	.	.	ENSG00000188959	ENST00000400613	.	.	.	4.16	2.19	0.27852	.	0.833553	0.10475	N	0.670329	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-0.2823	12.1388	0.53986	0.0:0.3309:0.6691:0.0	.	.	.	.	X	137	.	ENSP00000383456:Q137X	Q	-	1	0	C9orf152	112003360	0.002000	0.14202	0.023000	0.16930	0.171000	0.22731	0.763000	0.26517	0.632000	0.30432	0.655000	0.94253	CAA	.	.	.	none		0.547	C9orf152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053602.2	NM_001012993	
OR1L1	26737	hgsc.bcm.edu	37	9	125424669	125424669	+	Silent	SNP	T	T	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr9:125424669T>G	ENST00000373686.1	+	1	825	c.825T>G	c.(823-825)gtT>gtG	p.V275V	OR1L1_ENST00000309623.1_Silent_p.V225V			Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)	17						TCATCACTGTTCTGAAGATTC	0.408																																					p.V225V		Atlas-SNP	.											.	OR1L1	54	.	0			c.T675G						PASS	.						169.0	169.0	169.0					9																	125424669		2203	4300	6503	SO:0001819	synonymous_variant	26737	exon1			CACTGTTCTGAAG		CCDS35127.1, CCDS35127.2	9q33.2	2013-09-20			ENSG00000173679	ENSG00000173679		"""GPCR / Class A : Olfactory receptors"""	8213	protein-coding gene	gene with protein product				OR1L2			Standard	NM_001005236		Approved	OR9-C	uc022bmz.1	Q8NH94	OTTHUMG00000020618	ENST00000373686.1:c.825T>G	chr9.hg19:g.125424669T>G		113.0	0.0	.		80.0	31.0	.	NM_001005236	Q5T7Z3|Q6IFN2	Silent	SNP	ENST00000373686.1	hg19																																																																																				.	.	.	none		0.408	OR1L1-201	KNOWN	basic	protein_coding	protein_coding			
PHYHD1	254295	hgsc.bcm.edu	37	9	131702760	131702760	+	Silent	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr9:131702760C>A	ENST00000372592.3	+	10	1503	c.570C>A	c.(568-570)atC>atA	p.I190I	PHYHD1_ENST00000487504.1_3'UTR|PHYHD1_ENST00000353176.5_Silent_p.I169I|RP11-101E3.5_ENST00000482796.1_5'Flank|PHYHD1_ENST00000308941.5_Missense_Mutation_p.S183Y|PHYHD1_ENST00000421063.2_Silent_p.I169I	NM_001100876.1	NP_001094346.1	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1	190							dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|skin(1)|stomach(3)	10						TCTGGTTCATCCCTGGCTCCC	0.627																																					p.S183Y		Atlas-SNP	.											.	PHYHD1	29	.	0			c.C548A						PASS	.						90.0	95.0	93.0					9																	131702760		2203	4300	6503	SO:0001819	synonymous_variant	254295	exon9			GTTCATCCCTGGC	BC051300	CCDS6914.1, CCDS43885.1, CCDS43886.1	9q34.13	2010-08-13			ENSG00000175287	ENSG00000175287			23396	protein-coding gene	gene with protein product						12477932	Standard	NM_174933		Approved	MGC16638	uc004bwp.2	Q5SRE7	OTTHUMG00000020764	ENST00000372592.3:c.570C>A	chr9.hg19:g.131702760C>A		58.0	0.0	.		61.0	26.0	.	NM_174933	A6PWN9|A6PWP0|B3KT57|B4E3X8|Q5SRE9|Q5SRF0|Q7Z623|Q7Z7P9|Q96GM4	Missense_Mutation	SNP	ENST00000372592.3	hg19	CCDS43885.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941654	0.73557	.	.	ENSG00000175287	ENST00000308941;ENST00000419872	.	.	.	5.25	5.25	0.73442	.	0.956782	0.08660	N	0.912562	T	0.65354	0.2683	.	.	.	0.80722	D	1	D	0.63046	0.992	P	0.62560	0.904	T	0.50583	-0.8811	8	0.16896	T	0.51	-13.1688	9.684	0.40087	0.0:0.84:0.0:0.16	.	183	Q5SRE7-3	.	Y	183;48	.	ENSP00000309515:S183Y	S	+	2	0	PHYHD1	130742581	0.911000	0.30947	1.000000	0.80357	0.998000	0.95712	0.063000	0.14410	2.470000	0.83445	0.555000	0.69702	TCC	.	.	.	none		0.627	PHYHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054506.2	NM_174933	
ZNF22	7570	hgsc.bcm.edu	37	10	45499114	45499114	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr10:45499114C>T	ENST00000298299.3	+	2	891	c.298C>T	c.(298-300)Cag>Tag	p.Q100*	C10orf25_ENST00000298298.1_5'Flank|CEP164P1_ENST00000456938.2_RNA	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22	100					odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				TAATCTCATTCAGCATCGACG	0.413																																					p.Q100X		Atlas-SNP	.											.	ZNF22	28	.	0			c.C298T						PASS	.						57.0	56.0	56.0					10																	45499114		2203	4300	6503	SO:0001587	stop_gained	7570	exon2			CTCATTCAGCATC	BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.298C>T	chr10.hg19:g.45499114C>T	ENSP00000298299:p.Gln100*	42.0	0.0	.		32.0	8.0	.	NM_006963	Q5T741|Q96FM4	Nonsense_Mutation	SNP	ENST00000298299.3	hg19	CCDS7211.1	.	.	.	.	.	.	.	.	.	.	C	40	8.366025	0.98779	.	.	ENSG00000165512	ENST00000298299	.	.	.	5.02	5.02	0.67125	.	0.000000	0.46758	D	0.000280	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-16.5608	10.8467	0.46746	0.1881:0.8119:0.0:0.0	.	.	.	.	X	100	.	ENSP00000298299:Q100X	Q	+	1	0	ZNF22	44819120	0.000000	0.05858	1.000000	0.80357	0.946000	0.59487	-0.103000	0.10940	2.583000	0.87209	0.655000	0.94253	CAG	.	.	.	none		0.413	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047761.1	NM_006963	
ADK	132	hgsc.bcm.edu	37	10	75911070	75911070	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr10:75911070A>C	ENST00000286621.2	+	1	84	c.34A>C	c.(34-36)Aag>Cag	p.K12Q	ADK_ENST00000539909.1_Missense_Mutation_p.K12Q|AP3M1_ENST00000372745.1_5'Flank|AP3M1_ENST00000487653.1_5'Flank|AP3M1_ENST00000355264.4_5'Flank	NM_006721.3	NP_006712.2	P55263	ADK_HUMAN	adenosine kinase	12					adenosine metabolic process (GO:0046085)|AMP salvage (GO:0044209)|circadian regulation of gene expression (GO:0032922)|dATP biosynthetic process (GO:0006175)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of T cell proliferation (GO:0042102)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenosine kinase activity (GO:0004001)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	8	Prostate(51;0.0112)|Ovarian(15;0.148)				Abacavir(DB01048)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Adenosine(DB00640)|Ribavirin(DB00811)	GAAGCCCAAAAAGCTGAAGGT	0.672																																					p.K12Q		Atlas-SNP	.											.	ADK	28	.	0			c.A34C						PASS	.						51.0	47.0	49.0					10																	75911070		1959	3758	5717	SO:0001583	missense	132	exon1			CCCAAAAAGCTGA	U50196	CCDS7343.1, CCDS7344.1, CCDS55716.1, CCDS55717.1	10q22.2	2006-02-21			ENSG00000156110	ENSG00000156110	2.7.1.20		257	protein-coding gene	gene with protein product	"""adenosine 5'-phosphotransferase"""	102750				8577746	Standard	NM_001123		Approved	AK	uc001jwi.3	P55263	OTTHUMG00000018506	ENST00000286621.2:c.34A>C	chr10.hg19:g.75911070A>C	ENSP00000286621:p.Lys12Gln	81.0	0.0	.		105.0	32.0	.	NM_001202450	B7Z783|B7Z800|O00741|O00742|Q16710|Q5JQ10|Q5JQ11|Q9BTN2	Missense_Mutation	SNP	ENST00000286621.2	hg19	CCDS7343.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243859	0.79912	.	.	ENSG00000156110	ENST00000539909;ENST00000286621	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.54695	0.1874	L	0.48362	1.52	0.80722	D	1	P;P	0.48162	0.906;0.906	B;B	0.44224	0.444;0.444	T	0.56842	-0.7912	9	0.45353	T	0.12	-10.7025	13.8494	0.63487	1.0:0.0:0.0:0.0	.	12;12	B7Z783;P55263	.;ADK_HUMAN	Q	12	.	ENSP00000286621:K12Q	K	+	1	0	ADK	75581076	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.757000	0.47557	2.292000	0.77174	0.533000	0.62120	AAG	.	.	.	none		0.672	ADK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048763.1	NM_001123, NM_006721	
CCSER2	54462	hgsc.bcm.edu	37	10	86185593	86185593	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr10:86185593T>G	ENST00000224756.8	+	5	1997	c.1812T>G	c.(1810-1812)caT>caG	p.H604Q	CCSER2_ENST00000494144.1_3'UTR|CCSER2_ENST00000543283.1_Missense_Mutation_p.H31Q|CCSER2_ENST00000372088.2_Missense_Mutation_p.H604Q	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	604	His-rich.				microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)											GACAGGAGCATTACCACCTCA	0.478																																					p.H604Q		Atlas-SNP	.											.	CCSER2	7	.	0			c.T1812G						PASS	.						136.0	115.0	122.0					10																	86185593		2203	4300	6503	SO:0001583	missense	54462	exon5			GGAGCATTACCAC		CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.1812T>G	chr10.hg19:g.86185593T>G	ENSP00000224756:p.His604Gln	100.0	0.0	.		60.0	19.0	.	NM_018999	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	ENST00000224756.8	hg19	CCDS31235.1	.	.	.	.	.	.	.	.	.	.	T	13.11	2.139604	0.37728	.	.	ENSG00000107771	ENST00000224756;ENST00000372088;ENST00000543283	T;T;T	0.29917	1.93;1.91;1.55	6.07	2.64	0.31445	.	0.000000	0.85682	D	0.000000	T	0.18923	0.0454	L	0.33485	1.01	0.48762	D	0.999706	B;B	0.17667	0.023;0.005	B;B	0.14578	0.011;0.005	T	0.08027	-1.0742	10	0.36615	T	0.2	-13.8603	4.0095	0.09616	0.0:0.2881:0.3875:0.3244	.	604;604	Q9H7U1-3;Q9H7U1	.;F190B_HUMAN	Q	604;604;31	ENSP00000224756:H604Q;ENSP00000361160:H604Q;ENSP00000439944:H31Q	ENSP00000224756:H604Q	H	+	3	2	FAM190B	86175573	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	0.712000	0.25779	0.133000	0.18654	0.528000	0.53228	CAT	.	.	.	none		0.478	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999	
RBM20	282996	hgsc.bcm.edu	37	10	112572059	112572059	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr10:112572059C>A	ENST00000369519.3	+	9	1962	c.1904C>A	c.(1903-1905)tCt>tAt	p.S635Y		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	635			S -> A (in CMD1DD; causes the formation of anomalous isoforms in TTN (Titin)). {ECO:0000269|PubMed:22466703}.		heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						AGGCCGCGGTCTCGTAGTCCG	0.632																																					p.S635Y		Atlas-SNP	.											.	RBM20	50	.	0			c.C1904A						PASS	.						11.0	17.0	15.0					10																	112572059		692	1590	2282	SO:0001583	missense	282996	exon9			CGCGGTCTCGTAG	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.1904C>A	chr10.hg19:g.112572059C>A	ENSP00000358532:p.Ser635Tyr	32.0	0.0	.		28.0	12.0	.	NM_001134363	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	hg19	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206618	0.58343	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.95949	-3.86	5.69	5.69	0.88448	.	0.231723	0.36932	N	0.002326	D	0.97269	0.9107	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97574	1.0106	10	0.72032	D	0.01	-15.5825	19.8047	0.96525	0.0:1.0:0.0:0.0	.	635	Q5T481	RBM20_HUMAN	Y	635	ENSP00000358532:S635Y	ENSP00000358532:S635Y	S	+	2	0	RBM20	112562049	1.000000	0.71417	0.875000	0.34327	0.063000	0.16089	7.487000	0.81328	2.692000	0.91855	0.563000	0.77884	TCT	.	.	.	none		0.632	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
FCHSD2	9873	hgsc.bcm.edu	37	11	72552500	72552500	+	Splice_Site	SNP	G	G	A	rs201269620	byFrequency	TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr11:72552500G>A	ENST00000409418.4	-	18	2438	c.2055C>T	c.(2053-2055)aaC>aaT	p.N685N	FCHSD2_ENST00000409263.1_Splice_Site_p.N46N|FCHSD2_ENST00000311172.7_Splice_Site_p.N629N|FCHSD2_ENST00000409314.1_Splice_Site_p.N709N|ATG16L2_ENST00000534905.1_Intron|FCHSD2_ENST00000458644.2_Splice_Site_p.N549N	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	685										endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			AACCCTTACCGTTTGCTGAAG	0.507													G|||	2	0.000399361	0.0	0.0	5008	,	,		17201	0.001		0.0	False		,,,				2504	0.001				p.N685N		Atlas-SNP	.											FCHSD2_ENST00000409418,NS,carcinoma,0,6	FCHSD2	106	.	0			c.C2055T						PASS	.						46.0	40.0	42.0					11																	72552500		2200	4293	6493	SO:0001630	splice_region_variant	9873	exon18			CTTACCGTTTGCT	AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.2056+1C>T	chr11.hg19:g.72552500G>A		100.0	0.0	.		78.0	32.0	.	NM_014824	B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Silent	SNP	ENST00000409418.4	hg19	CCDS8218.2																																																																																			.	G|0.998;A|0.002	0.002	weak		0.507	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824	Silent
PCF11	51585	hgsc.bcm.edu	37	11	82877707	82877707	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr11:82877707A>G	ENST00000298281.4	+	5	2220	c.1768A>G	c.(1768-1770)Agt>Ggt	p.S590G		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	590					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AAACTGGCAAAGTTCCAAGTC	0.373																																					p.S590G		Atlas-SNP	.											PCF11_ENST00000298281,NS,carcinoma,0,2	PCF11	220	.	0			c.A1768G						PASS	.						69.0	70.0	70.0					11																	82877707		1801	3982	5783	SO:0001583	missense	51585	exon5			TGGCAAAGTTCCA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1768A>G	chr11.hg19:g.82877707A>G	ENSP00000298281:p.Ser590Gly	192.0	0.0	.		159.0	38.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	3.378	-0.127022	0.06795	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.42900	2.0;0.96;0.99	6.07	4.96	0.65561	.	0.165679	0.43747	D	0.000537	T	0.17916	0.0430	N	0.04880	-0.145	0.25814	N	0.984368	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.11421	-1.0588	9	.	.	.	.	4.9308	0.13916	0.7534:0.0:0.2466:0.0	.	590;590	E9PQ01;O94913	.;PCF11_HUMAN	G	590	ENSP00000298281:S590G;ENSP00000434540:S590G;ENSP00000431567:S590G	.	S	+	1	0	PCF11	82555355	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.144000	0.64832	2.326000	0.78906	0.533000	0.62120	AGT	.	.	.	none		0.373	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
VAMP1	6843	hgsc.bcm.edu	37	12	6574108	6574108	+	Splice_Site	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr12:6574108C>T	ENST00000396308.3	-	4	434		c.e4-1		VAMP1_ENST00000361716.3_Splice_Site|TAPBPL_ENST00000545700.1_Intron|VAMP1_ENST00000544432.1_Splice_Site|VAMP1_ENST00000400911.3_Splice_Site|VAMP1_ENST00000535180.1_Splice_Site	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)						neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)				endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	TGATCATCATCTGAGGAAACA	0.463																																					.		Atlas-SNP	.											VAMP1,NS,carcinoma,0,1	VAMP1	6	.	0			c.289-1G>A						PASS	.						181.0	159.0	167.0					12																	6574108		2203	4300	6503	SO:0001630	splice_region_variant	6843	exon5			CATCATCTGAGGA		CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.289-1G>A	chr12.hg19:g.6574108C>T		35.0	0.0	.		30.0	12.0	.	NM_016830	A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	Splice_Site	SNP	ENST00000396308.3	hg19	CCDS41740.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696389	0.88830	.	.	ENSG00000139190	ENST00000400911;ENST00000361716;ENST00000535180;ENST00000355479;ENST00000396308;ENST00000396943	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8991	0.96978	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VAMP1	6444369	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.708000	0.92522	0.655000	0.94253	.	.	.	.	none		0.463	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399078.1		Intron
ATF7IP	55729	hgsc.bcm.edu	37	12	14577946	14577946	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr12:14577946A>G	ENST00000540793.1	+	1	1252	c.1097A>G	c.(1096-1098)gAa>gGa	p.E366G	ATF7IP_ENST00000544627.1_Missense_Mutation_p.E374G|ATF7IP_ENST00000261168.4_Missense_Mutation_p.E366G|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Missense_Mutation_p.E366G|ATF7IP_ENST00000536444.1_Missense_Mutation_p.E366G			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	366	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CGACCTCCTGAAAATGAAAAG	0.343																																					p.E366G		Atlas-SNP	.											.	ATF7IP	136	.	0			c.A1097G						PASS	.						77.0	86.0	83.0					12																	14577946		2203	4299	6502	SO:0001583	missense	55729	exon2			CTCCTGAAAATGA	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1097A>G	chr12.hg19:g.14577946A>G	ENSP00000444589:p.Glu366Gly	56.0	0.0	.		58.0	33.0	.	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	hg19	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982845	0.74474	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.35421	1.69;1.68;1.69;1.69;1.31;1.69	5.1	3.95	0.45737	.	0.000000	0.64402	D	0.000017	T	0.38852	0.1056	L	0.50333	1.59	0.34100	D	0.661804	P;B;B;B;B	0.44946	0.846;0.011;0.015;0.015;0.001	P;B;B;B;B	0.47470	0.548;0.01;0.027;0.027;0.007	T	0.57757	-0.7756	10	0.87932	D	0	-12.7544	10.2279	0.43236	0.9202:0.0:0.0798:0.0	.	374;366;366;366;366	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2	.;.;.;MCAF1_HUMAN;.	G	366;366;366;374;366;366	ENSP00000261168:E366G;ENSP00000443179:E366G;ENSP00000445955:E366G;ENSP00000440440:E374G;ENSP00000379575:E366G;ENSP00000444589:E366G	ENSP00000261168:E366G	E	+	2	0	ATF7IP	14469213	1.000000	0.71417	0.995000	0.50966	0.862000	0.49288	3.175000	0.50855	2.038000	0.60285	0.482000	0.46254	GAA	.	.	.	none		0.343	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
PDZRN4	29951	hgsc.bcm.edu	37	12	41967250	41967250	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr12:41967250A>C	ENST00000402685.2	+	10	2677	c.2669A>C	c.(2668-2670)aAg>aCg	p.K890T	PDZRN4_ENST00000298919.7_Missense_Mutation_p.K630T|PDZRN4_ENST00000539469.2_Missense_Mutation_p.K632T	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	890							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				ATGGAATGGAAGGTGAAAATT	0.498																																					p.K890T		Atlas-SNP	.											.	PDZRN4	346	.	0			c.A2669C						PASS	.						114.0	104.0	107.0					12																	41967250		2203	4300	6503	SO:0001583	missense	29951	exon10			AATGGAAGGTGAA	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2669A>C	chr12.hg19:g.41967250A>C	ENSP00000384197:p.Lys890Thr	37.0	0.0	.		51.0	31.0	.	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.091044	0.76756	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.65732	-0.17;-0.17;-0.17	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.81273	0.4788	M	0.85373	2.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.84706	0.0731	10	0.87932	D	0	-49.9998	15.8245	0.78686	1.0:0.0:0.0:0.0	.	890;630;632	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	T	890;632;630	ENSP00000384197:K890T;ENSP00000439990:K632T;ENSP00000298919:K630T	ENSP00000298919:K630T	K	+	2	0	PDZRN4	40253517	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.287000	0.95975	2.274000	0.75844	0.528000	0.53228	AAG	.	.	.	none		0.498	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
PPHLN1	51535	hgsc.bcm.edu	37	12	42768782	42768782	+	Silent	SNP	T	T	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr12:42768782T>C	ENST00000395568.2	+	5	501	c.417T>C	c.(415-417)gaT>gaC	p.D139D	PPHLN1_ENST00000432191.2_Silent_p.D84D|PPHLN1_ENST00000552761.1_Silent_p.D91D|PPHLN1_ENST00000395580.3_Silent_p.D146D|PPHLN1_ENST00000358314.7_Silent_p.D139D|PPHLN1_ENST00000317560.9_Silent_p.D91D|PPHLN1_ENST00000256678.8_Silent_p.D38D|PPHLN1_ENST00000449194.2_Silent_p.D139D|PPHLN1_ENST00000549190.1_Silent_p.D157D|PPHLN1_ENST00000337898.6_Silent_p.D84D	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	139					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		GCCGAAAGGATTCTCCACACA	0.418																																					p.D146D		Atlas-SNP	.											.	PPHLN1	101	.	0			c.T438C						PASS	.						100.0	95.0	97.0					12																	42768782		2203	4300	6503	SO:0001819	synonymous_variant	51535	exon6			AAAGGATTCTCCA	AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.417T>C	chr12.hg19:g.42768782T>C		152.0	0.0	.		201.0	108.0	.	NM_201515	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Silent	SNP	ENST00000395568.2	hg19	CCDS31777.1																																																																																			.	.	.	none		0.418	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404047.1	NM_201515	
SLC38A2	54407	hgsc.bcm.edu	37	12	46756297	46756297	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr12:46756297C>G	ENST00000256689.5	-	14	1748	c.1304G>C	c.(1303-1305)aGg>aCg	p.R435T	SLC38A2_ENST00000551374.1_Missense_Mutation_p.R273T|SLC38A2_ENST00000547252.1_5'Flank	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	435					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		AAAGATATCCCTAATAGTTGG	0.348																																					p.R435T	Ovarian(9;448 492 8335 28722 40361)	Atlas-SNP	.											.	SLC38A2	36	.	0			c.G1304C						PASS	.						78.0	74.0	75.0					12																	46756297		2202	4298	6500	SO:0001583	missense	54407	exon14			ATATCCCTAATAG	AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.1304G>C	chr12.hg19:g.46756297C>G	ENSP00000256689:p.Arg435Thr	157.0	0.0	.		210.0	55.0	.	NM_018976	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Missense_Mutation	SNP	ENST00000256689.5	hg19	CCDS8749.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620493	0.87460	.	.	ENSG00000134294	ENST00000256689;ENST00000551374	T;T	0.02216	4.39;4.39	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.11196	0.0273	M	0.78637	2.42	0.58432	D	0.999999	B;P;D	0.58970	0.367;0.954;0.984	B;P;P	0.58928	0.217;0.848;0.834	T	0.19647	-1.0299	10	0.21540	T	0.41	-17.7125	20.0916	0.97822	0.0:1.0:0.0:0.0	.	273;335;435	F8VQW8;Q96QD8-2;Q96QD8	.;.;S38A2_HUMAN	T	435;273	ENSP00000256689:R435T;ENSP00000450406:R273T	ENSP00000256689:R435T	R	-	2	0	SLC38A2	45042564	1.000000	0.71417	0.997000	0.53966	0.951000	0.60555	3.058000	0.49939	2.737000	0.93849	0.650000	0.86243	AGG	.	.	.	none		0.348	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404226.1		
TBC1D15	64786	hgsc.bcm.edu	37	12	72274296	72274296	+	Silent	SNP	T	T	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr12:72274296T>C	ENST00000550746.1	+	4	316	c.252T>C	c.(250-252)ggT>ggC	p.G84G	TBC1D15_ENST00000319106.8_Silent_p.G92G|TBC1D15_ENST00000393309.3_5'UTR|TBC1D15_ENST00000485960.2_Silent_p.G84G	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	84					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAGAAAGAGGTCATCGAGGAT	0.333																																					p.G92G		Atlas-SNP	.											.	TBC1D15	99	.	0			c.T276C						PASS	.						48.0	42.0	44.0					12																	72274296		2203	4300	6503	SO:0001819	synonymous_variant	64786	exon5			AAGAGGTCATCGA	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.252T>C	chr12.hg19:g.72274296T>C		158.0	0.0	.		224.0	111.0	.	NM_001146214	B4DMT9|B9A6L6|J3KNI9|Q9HA83	Silent	SNP	ENST00000550746.1	hg19	CCDS31858.1																																																																																			.	.	.	none		0.333	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351266.2	NM_022771	
COL4A2	1284	hgsc.bcm.edu	37	13	111090980	111090980	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr13:111090980G>A	ENST00000360467.5	+	15	1183	c.877G>A	c.(877-879)Gga>Aga	p.G293R		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	293	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.G293*(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TTCCTTGAAGGGAGAAGAAGG	0.542																																					p.G293R		Atlas-SNP	.											COL4A2,NS,carcinoma,0,1	COL4A2	178	.	1	Substitution - Nonsense(1)	lung(1)	c.G877A						PASS	.						148.0	150.0	149.0					13																	111090980		1894	4127	6021	SO:0001583	missense	1284	exon15			TTGAAGGGAGAAG	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.877G>A	chr13.hg19:g.111090980G>A	ENSP00000353654:p.Gly293Arg	83.0	0.0	.		66.0	20.0	.	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	hg19	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900715	0.33535	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.99353	-5.77	4.52	4.52	0.55395	.	0.000000	0.50627	D	0.000108	D	0.99507	0.9824	M	0.94101	3.495	0.53688	D	0.999975	D	0.89917	1.0	D	0.97110	1.0	D	0.98190	1.0462	10	0.72032	D	0.01	.	13.127	0.59360	0.0:0.0:1.0:0.0	.	293	P08572	CO4A2_HUMAN	R	293	ENSP00000353654:G293R	ENSP00000257309:G293R	G	+	1	0	COL4A2	109888981	1.000000	0.71417	0.997000	0.53966	0.321000	0.28281	4.562000	0.60816	2.226000	0.72624	0.557000	0.71058	GGA	.	.	.	none		0.542	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
ZFP36L1	677	hgsc.bcm.edu	37	14	69259682	69259682	+	5'UTR	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr14:69259682G>A	ENST00000439696.2	-	0	275				ZFP36L1_ENST00000555997.1_5'Flank|ZFP36L1_ENST00000336440.3_5'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AGCCAGGGGCGAGGATCTGGT	0.642																																					p.R61C		Atlas-SNP	.											.	ZFP36L1	47	.	0			c.C181T						PASS	.						95.0	91.0	92.0					14																	69259682		2203	4300	6503	SO:0001623	5_prime_UTR_variant	677	exon2			AGGGGCGAGGATC	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.-27C>T	chr14.hg19:g.69259682G>A		26.0	0.0	.		26.0	13.0	.	NM_001244701	Q13851	Missense_Mutation	SNP	ENST00000439696.2	hg19	CCDS9791.1	.	.	.	.	.	.	.	.	.	.	G	9.502	1.103360	0.20632	.	.	ENSG00000185650	ENST00000553375	.	.	.	4.28	-4.65	0.03339	.	.	.	.	.	T	0.19406	0.0466	.	.	.	0.22226	N	0.999274	.	.	.	.	.	.	T	0.32214	-0.9915	4	.	.	.	.	3.9918	0.09539	0.3127:0.0:0.2903:0.397	.	.	.	.	C	61	.	.	R	-	1	0	ZFP36L1	68329435	0.000000	0.05858	0.070000	0.20053	0.698000	0.40448	-0.229000	0.09098	-0.399000	0.07668	0.561000	0.74099	CGC	.	.	.	none		0.642	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1		
ATG2B	55102	hgsc.bcm.edu	37	14	96783528	96783528	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr14:96783528A>G	ENST00000359933.4	-	20	4057	c.3164T>C	c.(3163-3165)cTt>cCt	p.L1055P		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1055					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AATATTCAGAAGAACTGAGAG	0.333																																					p.L1055P		Atlas-SNP	.											.	ATG2B	169	.	0			c.T3164C						PASS	.						78.0	79.0	79.0					14																	96783528		1796	4078	5874	SO:0001583	missense	55102	exon20			TTCAGAAGAACTG	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.3164T>C	chr14.hg19:g.96783528A>G	ENSP00000353010:p.Leu1055Pro	108.0	0.0	.		97.0	41.0	.	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.304738	0.81247	.	.	ENSG00000066739	ENST00000359933	T	0.10573	2.86	5.56	5.56	0.83823	.	0.604497	0.14732	U	0.301693	T	0.17109	0.0411	L	0.53249	1.67	0.58432	D	0.999999	P	0.47409	0.895	P	0.47470	0.548	T	0.01238	-1.1409	10	0.34782	T	0.22	.	12.2792	0.54755	0.8732:0.0:0.0:0.1268	.	1055	Q96BY7	ATG2B_HUMAN	P	1055	ENSP00000353010:L1055P	ENSP00000353010:L1055P	L	-	2	0	ATG2B	95853281	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.464000	0.66719	2.239000	0.73571	0.528000	0.53228	CTT	.	.	.	none		0.333	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
SHC4	399694	hgsc.bcm.edu	37	15	49170567	49170567	+	Intron	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr15:49170567C>A	ENST00000332408.4	-	4	1269				SHC4_ENST00000396535.3_5'Flank|EID1_ENST00000558295.1_Intron|EID1_ENST00000530028.2_Missense_Mutation_p.P65Q|EID1_ENST00000560490.1_Missense_Mutation_p.P43Q|SHC4_ENST00000537958.1_5'Flank	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		GAGGCCCAGCCAATGGCGGCG	0.701																																					p.P65Q		Atlas-SNP	.											.	EID1	16	.	0			c.C194A						PASS	.						16.0	20.0	19.0					15																	49170567		2001	4147	6148	SO:0001627	intron_variant	23741	exon1			CCCAGCCAATGGC	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.840+5877G>T	chr15.hg19:g.49170567C>A		60.0	0.0	.		49.0	14.0	.	NM_014335	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	hg19	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	C	9.230	1.035638	0.19590	.	.	ENSG00000255302	ENST00000530028	T	0.54279	0.58	4.04	4.04	0.47022	.	.	.	.	.	T	0.50684	0.1630	L	0.36672	1.1	0.54753	D	0.999982	P	0.48503	0.911	P	0.49421	0.61	T	0.54357	-0.8306	9	0.72032	D	0.01	.	12.0069	0.53265	0.0:1.0:0.0:0.0	.	65	Q9Y6B2	EID1_HUMAN	Q	65	ENSP00000431162:P65Q	ENSP00000431162:P65Q	P	+	2	0	EID1	46957859	0.015000	0.18098	0.110000	0.21437	0.061000	0.15899	0.095000	0.15127	2.530000	0.85305	0.650000	0.86243	CCA	.	.	.	none		0.701	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
MYO5C	55930	hgsc.bcm.edu	37	15	52517329	52517329	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr15:52517329A>G	ENST00000261839.7	-	27	3469	c.3308T>C	c.(3307-3309)aTg>aCg	p.M1103T		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1103						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GATCTCTGACATCTTTTCTGA	0.358																																					p.M1103T		Atlas-SNP	.											.	MYO5C	162	.	0			c.T3308C						PASS	.						102.0	89.0	93.0					15																	52517329		1846	4102	5948	SO:0001583	missense	55930	exon27			TCTGACATCTTTT	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3308T>C	chr15.hg19:g.52517329A>G	ENSP00000261839:p.Met1103Thr	70.0	0.0	.		45.0	17.0	.	NM_018728	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	hg19	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	A	12.19	1.864189	0.32977	.	.	ENSG00000128833	ENST00000261839	T	0.19669	2.13	5.89	5.89	0.94794	.	0.046494	0.85682	D	0.000000	T	0.16642	0.0400	N	0.22421	0.69	0.80722	D	1	P	0.36789	0.57	B	0.38264	0.269	T	0.08700	-1.0709	10	0.15066	T	0.55	.	16.3127	0.82898	1.0:0.0:0.0:0.0	.	1103	Q9NQX4	MYO5C_HUMAN	T	1103	ENSP00000261839:M1103T	ENSP00000261839:M1103T	M	-	2	0	MYO5C	50304621	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.863000	0.75489	2.246000	0.74042	0.533000	0.62120	ATG	.	.	.	none		0.358	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
CCDC64B	146439	hgsc.bcm.edu	37	16	3078253	3078253	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr16:3078253C>G	ENST00000572449.1	-	10	1443	c.1381G>C	c.(1381-1383)Ggg>Cgg	p.G461R	CCDC64B_ENST00000389347.4_Missense_Mutation_p.G461R|CCDC64B_ENST00000573514.1_Missense_Mutation_p.G254R			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	461										breast(1)|endometrium(2)|large_intestine(1)	4						AGCTGCTGCCCGATCACCACC	0.771																																					p.G461R		Atlas-SNP	.											.	CCDC64B	19	.	0			c.G1381C						PASS	.						8.0	9.0	9.0					16																	3078253		1914	3952	5866	SO:0001583	missense	146439	exon9			GCTGCCCGATCAC	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.1381G>C	chr16.hg19:g.3078253C>G	ENSP00000459043:p.Gly461Arg	0.0	0.0	.		10.0	6.0	.	NM_001103175	Q658L9	Missense_Mutation	SNP	ENST00000572449.1	hg19	CCDS45393.1	.	.	.	.	.	.	.	.	.	.	c	17.50	3.405799	0.62288	.	.	ENSG00000162069	ENST00000389347	T	0.30714	1.52	4.97	4.02	0.46733	.	0.230323	0.33040	N	0.005353	T	0.44074	0.1276	L	0.50333	1.59	0.09310	N	0.999998	D	0.89917	1.0	D	0.75484	0.986	T	0.17837	-1.0356	10	0.46703	T	0.11	-47.1987	7.3929	0.26919	0.0:0.8046:0.0:0.1954	.	461	A1A5D9	BICR2_HUMAN	R	461	ENSP00000373998:G461R	ENSP00000373998:G461R	G	-	1	0	CCDC64B	3018254	0.043000	0.20138	0.936000	0.37596	0.459000	0.32528	0.772000	0.26647	1.099000	0.41499	0.556000	0.70494	GGG	.	.	.	none		0.771	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1		
SPIRE2	84501	hgsc.bcm.edu	37	16	89929899	89929899	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr16:89929899G>A	ENST00000378247.3	+	11	1634	c.1591G>A	c.(1591-1593)Gtg>Atg	p.V531M	SPIRE2_ENST00000393062.2_Missense_Mutation_p.V531M	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	531					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		CAGCCACCCCGTGGAGAGCCT	0.582																																					p.V531M		Atlas-SNP	.											.	SPIRE2	63	.	0			c.G1591A						PASS	.						53.0	51.0	51.0					16																	89929899		2198	4300	6498	SO:0001583	missense	84501	exon11			CACCCCGTGGAGA	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.1591G>A	chr16.hg19:g.89929899G>A	ENSP00000367494:p.Val531Met	40.0	0.0	.		39.0	23.0	.	NM_032451	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Missense_Mutation	SNP	ENST00000378247.3	hg19	CCDS32516.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421999	0.83559	.	.	ENSG00000204991	ENST00000378247;ENST00000393062	T;T	0.52754	0.65;0.72	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.73369	0.3578	M	0.85710	2.77	0.80722	D	1	D;P;D;D	0.89917	0.998;0.8;0.999;1.0	D;B;D;D	0.91635	0.917;0.303;0.917;0.999	T	0.75625	-0.3253	10	0.52906	T	0.07	-45.1084	18.6856	0.91562	0.0:0.0:1.0:0.0	.	398;531;483;531	Q8WWL2-4;Q8WWL2-2;Q8WWL2-3;Q8WWL2	.;.;.;SPIR2_HUMAN	M	531	ENSP00000367494:V531M;ENSP00000376782:V531M	ENSP00000367494:V531M	V	+	1	0	SPIRE2	88457400	1.000000	0.71417	0.962000	0.40283	0.527000	0.34593	7.430000	0.80321	2.660000	0.90430	0.467000	0.42956	GTG	.	.	.	none		0.582	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
DHRS13	147015	hgsc.bcm.edu	37	17	27229847	27229847	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr17:27229847G>C	ENST00000378895.4	-	1	242	c.116C>G	c.(115-117)gCc>gGc	p.A39G	DHRS13_ENST00000394901.3_5'UTR|DHRS13_ENST00000426464.2_Missense_Mutation_p.A39G	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	39						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CGTGACCACGGCCGTGCGGCC	0.751																																					p.A39G		Atlas-SNP	.											.	DHRS13	22	.	0			c.C116G						PASS	.						6.0	7.0	7.0					17																	27229847		1759	3831	5590	SO:0001583	missense	147015	exon1			ACCACGGCCGTGC	BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.116C>G	chr17.hg19:g.27229847G>C	ENSP00000368173:p.Ala39Gly	2.0	0.0	.		6.0	5.0	.	NM_144683	Q96BH7	Missense_Mutation	SNP	ENST00000378895.4	hg19	CCDS11246.2	.	.	.	.	.	.	.	.	.	.	g	14.25	2.478736	0.44044	.	.	ENSG00000167536	ENST00000378895;ENST00000426464	D;D	0.89050	-2.46;-1.82	4.4	1.28	0.21552	NAD(P)-binding domain (1);	0.658530	0.15142	N	0.278221	D	0.89805	0.6821	H	0.94542	3.55	0.09310	N	1	B;B	0.12013	0.005;0.001	B;B	0.10450	0.002;0.005	D	0.83708	0.0186	10	0.87932	D	0	.	4.2743	0.10800	0.2818:0.1707:0.5476:0.0	.	39;39	B4DJC5;Q6UX07	.;DHR13_HUMAN	G	39	ENSP00000368173:A39G;ENSP00000412826:A39G	ENSP00000368173:A39G	A	-	2	0	DHRS13	24253973	0.316000	0.24580	0.300000	0.25030	0.071000	0.16799	0.744000	0.26245	0.146000	0.19002	0.306000	0.20318	GCC	.	.	.	none		0.751	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255952.1	NM_144683	
HGS	9146	hgsc.bcm.edu	37	17	79663907	79663907	+	Silent	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr17:79663907C>A	ENST00000329138.4	+	18	1896	c.1761C>A	c.(1759-1761)gcC>gcA	p.A587A		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	587	Gln-rich.|Interaction with NF2.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CGGGACCAGCCAGCTTCCCCA	0.682																																					p.A587A		Atlas-SNP	.											.	HGS	54	.	0			c.C1761A						PASS	.						40.0	49.0	46.0					17																	79663907		2202	4296	6498	SO:0001819	synonymous_variant	9146	exon18			ACCAGCCAGCTTC	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.1761C>A	chr17.hg19:g.79663907C>A		29.0	0.0	.		43.0	15.0	.	NM_004712	Q9NR36	Silent	SNP	ENST00000329138.4	hg19	CCDS11784.1																																																																																			.	.	.	none		0.682	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	
ARHGDIA	396	hgsc.bcm.edu	37	17	79827786	79827786	+	Silent	SNP	T	T	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr17:79827786T>G	ENST00000269321.7	-	2	156	c.21A>C	c.(19-21)acA>acC	p.T7T	ARHGDIA_ENST00000541078.2_Silent_p.T7T|RP11-498C9.3_ENST00000576554.1_RNA|ARHGDIA_ENST00000582520.1_5'Flank|ARHGDIA_ENST00000580685.1_Silent_p.T7T|ARHGDIA_ENST00000581876.1_Silent_p.T7T|RP11-498C9.3_ENST00000576021.1_RNA|ARHGDIA_ENST00000584461.1_Silent_p.T7T|ARHGDIA_ENST00000400721.4_Silent_p.T7T	NM_001185078.1|NM_004309.4	NP_001172007.1|NP_004300.1	P52565	GDIR1_HUMAN	Rho GDP dissociation inhibitor (GDI) alpha	7					cellular component movement (GO:0006928)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of axonogenesis (GO:0050772)|regulation of axonogenesis (GO:0050770)|regulation of protein localization (GO:0032880)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			endometrium(1)|lung(1)|prostate(1)	3	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			GCTGCTCGGCTGTGGGCTCCT	0.647																																					p.T7T		Atlas-SNP	.											.	ARHGDIA	14	.	0			c.A21C						PASS	.						67.0	57.0	60.0					17																	79827786		2203	4300	6503	SO:0001819	synonymous_variant	396	exon2			CTCGGCTGTGGGC	BC028333	CCDS11788.1, CCDS58609.1	17q25.3	2005-12-20				ENSG00000141522			678	protein-coding gene	gene with protein product		601925		GDIA1		9186513	Standard	NM_001185077		Approved	RHOGDI	uc002kbq.3	P52565		ENST00000269321.7:c.21A>C	chr17.hg19:g.79827786T>G		45.0	0.0	.		50.0	14.0	.	NM_004309	A8MXW0|B2R5X1|B4DDD3|B4DUV9|Q6IBM5	Silent	SNP	ENST00000269321.7	hg19	CCDS11788.1																																																																																			.	.	.	none		0.647	ARHGDIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441679.2	NM_004309	
TEX19	400629	hgsc.bcm.edu	37	17	80320408	80320408	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr17:80320408G>T	ENST00000333437.4	+	2	692	c.382G>T	c.(382-384)Gag>Tag	p.E128*		NM_207459.3	NP_997342.1	Q8NA77	TEX19_HUMAN	testis expressed 19	128					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6						ATGGCCTCAGGAGGCTGTGCC	0.617																																					p.E128X		Atlas-SNP	.											.	TEX19	17	.	0			c.G382T						PASS	.						74.0	73.0	74.0					17																	80320408		2203	4300	6503	SO:0001587	stop_gained	400629	exon2			CCTCAGGAGGCTG	BC016939	CCDS11809.1	17q25.3	2009-04-14			ENSG00000182459	ENSG00000182459			33802	protein-coding gene	gene with protein product		615647					Standard	NM_207459		Approved	FLJ35767	uc002keq.3	Q8NA77	OTTHUMG00000132857	ENST00000333437.4:c.382G>T	chr17.hg19:g.80320408G>T	ENSP00000331500:p.Glu128*	77.0	0.0	.		91.0	37.0	.	NM_207459		Nonsense_Mutation	SNP	ENST00000333437.4	hg19	CCDS11809.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290355	0.59976	.	.	ENSG00000182459	ENST00000333437	.	.	.	3.79	1.79	0.24919	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-12.0754	6.2075	0.20610	0.2189:0.0:0.7811:0.0	.	.	.	.	X	128	.	ENSP00000331500:E128X	E	+	1	0	TEX19	77913697	0.004000	0.15560	0.106000	0.21319	0.007000	0.05969	0.207000	0.17395	0.560000	0.29169	0.563000	0.77884	GAG	.	.	.	none		0.617	TEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256331.1	NM_207459	
NEDD4L	23327	hgsc.bcm.edu	37	18	56050535	56050535	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr18:56050535A>T	ENST00000400345.3	+	25	2693	c.2410A>T	c.(2410-2412)Aaa>Taa	p.K804*	NEDD4L_ENST00000431212.2_Nonsense_Mutation_p.K683*|NEDD4L_ENST00000357895.5_Nonsense_Mutation_p.K796*|NEDD4L_ENST00000586263.1_Nonsense_Mutation_p.K776*|NEDD4L_ENST00000256830.9_Nonsense_Mutation_p.K700*|NEDD4L_ENST00000435432.2_Nonsense_Mutation_p.K663*|NEDD4L_ENST00000456173.2_Nonsense_Mutation_p.K663*|NEDD4L_ENST00000382850.4_Nonsense_Mutation_p.K784*|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000456986.1_Nonsense_Mutation_p.K683*|NEDD4L_ENST00000356462.6_Nonsense_Mutation_p.K740*|NEDD4L_ENST00000256832.7_Nonsense_Mutation_p.K664*	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	804	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						AAATGAAAACAAAAGGGAATA	0.343																																					p.K804X		Atlas-SNP	.											.	NEDD4L	126	.	0			c.A2410T						PASS	.						112.0	103.0	106.0					18																	56050535		1845	4049	5894	SO:0001587	stop_gained	23327	exon25			GAAAACAAAAGGG	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.2410A>T	chr18.hg19:g.56050535A>T	ENSP00000383199:p.Lys804*	61.0	0.0	.		62.0	22.0	.	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Nonsense_Mutation	SNP	ENST00000400345.3	hg19	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	A	45	11.885282	0.99613	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9462	0.79796	1.0:0.0:0.0:0.0	.	.	.	.	X	804;784;740;700;664;683;796;663;663;683	.	ENSP00000256830:K700X	K	+	1	0	NEDD4L	54201515	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.681000	0.91228	2.242000	0.73789	0.528000	0.53228	AAA	.	.	.	none		0.343	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
ARRDC5	645432	hgsc.bcm.edu	37	19	4891365	4891365	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr19:4891365C>T	ENST00000381781.2	-	3	721	c.722G>A	c.(721-723)cGg>cAg	p.R241Q	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	241										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		CCGAGACCGCCGCTCTGCACT	0.587																																					p.R241Q		Atlas-SNP	.											.	ARRDC5	19	.	0			c.G722A						PASS	.						62.0	72.0	68.0					19																	4891365		2088	4212	6300	SO:0001583	missense	645432	exon3			GACCGCCGCTCTG		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.722G>A	chr19.hg19:g.4891365C>T	ENSP00000371200:p.Arg241Gln	21.0	0.0	.		24.0	9.0	.	NM_001080523		Missense_Mutation	SNP	ENST00000381781.2	hg19	CCDS45929.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777714	0.31502	.	.	ENSG00000205784	ENST00000381781	T	0.18960	2.18	4.92	1.6	0.23607	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	1.356790	0.05157	N	0.497009	T	0.15609	0.0376	L	0.29908	0.895	0.19300	N	0.999972	B	0.32396	0.369	B	0.23419	0.046	T	0.28933	-1.0028	10	0.44086	T	0.13	-14.9505	8.5502	0.33447	0.0:0.7431:0.0:0.2569	.	241	A6NEK1	ARRD5_HUMAN	Q	241	ENSP00000371200:R241Q	ENSP00000371200:R241Q	R	-	2	0	ARRDC5	4842365	0.028000	0.19301	0.021000	0.16686	0.004000	0.04260	-0.061000	0.11693	0.339000	0.23719	-0.140000	0.14226	CGG	.	.	.	none		0.587	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450443.1	XM_292803	
NDUFA13	51079	hgsc.bcm.edu	37	19	19625679	19625679	+	5'Flank	SNP	G	G	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr19:19625679G>T	ENST00000507754.4	+	0	0				NDUFA13_ENST00000252576.5_5'Flank|NDUFA13_ENST00000428459.2_5'Flank|CTC-260F20.3_ENST00000555938.1_5'Flank|TSSK6_ENST00000360913.3_Silent_p.I186I|TSSK6_ENST00000585580.3_Silent_p.I186I|NDUFA13_ENST00000503283.1_5'Flank|YJEFN3_ENST00000608404.1_5'Flank|NDUFA13_ENST00000512771.3_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						GGTCGTAGGGGATGCCCAGGA	0.662																																					p.I186I		Atlas-SNP	.											.	TSSK6	32	.	0			c.C558A						PASS	.						50.0	37.0	42.0					19																	19625679		2203	4300	6503	SO:0001631	upstream_gene_variant	83983	exon1			GTAGGGGATGCCC	AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211		chr19.hg19:g.19625679G>T	Exception_encountered	14.0	0.0	.		21.0	7.0	.	NM_032037	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Silent	SNP	ENST00000507754.4	hg19	CCDS12404.2																																																																																			.	.	.	none		0.662	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367916.6	NM_015965	
ZNF681	148213	hgsc.bcm.edu	37	19	23927682	23927682	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr19:23927682T>G	ENST00000402377.3	-	4	811	c.670A>C	c.(670-672)Aaa>Caa	p.K224Q	ZNF681_ENST00000395385.3_Missense_Mutation_p.K155Q	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	224				K -> R (in Ref. 1; BAG53769). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ATGTACGATTTCTCTCCAATA	0.323																																					p.K224Q		Atlas-SNP	.											.	ZNF681	76	.	0			c.A670C						PASS	.						48.0	47.0	47.0					19																	23927682		2203	4299	6502	SO:0001583	missense	148213	exon4			ACGATTTCTCTCC	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.670A>C	chr19.hg19:g.23927682T>G	ENSP00000384000:p.Lys224Gln	34.0	0.0	.		31.0	13.0	.	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	hg19	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	14.55	2.569056	0.45798	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.54071	0.59;2.06	1.62	1.62	0.23740	Zinc finger, C2H2 (1);	.	.	.	.	T	0.69513	0.3119	M	0.88906	2.99	0.22305	N	0.999218	D	0.71674	0.998	D	0.67103	0.949	T	0.56817	-0.7916	9	0.87932	D	0	.	3.4119	0.07361	0.0:0.235:0.0:0.765	.	224	Q96N22	ZN681_HUMAN	Q	224;155	ENSP00000384000:K224Q;ENSP00000378783:K155Q	ENSP00000378783:K155Q	K	-	1	0	ZNF681	23719522	0.841000	0.29509	0.004000	0.12327	0.011000	0.07611	2.723000	0.47277	0.722000	0.32252	0.372000	0.22366	AAA	.	.	.	none		0.323	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
CD3EAP	10849	hgsc.bcm.edu	37	19	45912507	45912507	+	Silent	SNP	G	G	A	rs200430601		TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr19:45912507G>A	ENST00000309424.3	+	3	1769	c.1281G>A	c.(1279-1281)aaG>aaA	p.K427K	ERCC1_ENST00000300853.3_3'UTR|ERCC1_ENST00000588738.1_5'Flank|PPP1R13L_ENST00000418234.2_5'Flank|CD3EAP_ENST00000589804.1_Silent_p.K429K|ERCC1_ENST00000423698.2_3'UTR	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	427	Poly-Lys.				rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		agaagaagaagaaagagaGAG	0.582																																					p.K427K		Atlas-SNP	.											.	CD3EAP	27	.	0			c.G1281A						PASS	.						41.0	49.0	46.0					19																	45912507		2201	4296	6497	SO:0001819	synonymous_variant	10849	exon3			GAAGAAGAAAGAG	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.1281G>A	chr19.hg19:g.45912507G>A		90.0	0.0	.		85.0	30.0	.	NM_012099	Q32N11|Q7Z5U2|Q9UPF6	Silent	SNP	ENST00000309424.3	hg19	CCDS12661.1																																																																																			.	.	.	none		0.582	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459538.1	NM_012099	
NFAM1	150372	hgsc.bcm.edu	37	22	42781205	42781205	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr22:42781205C>A	ENST00000329021.5	-	6	812	c.775G>T	c.(775-777)Gat>Tat	p.D259Y		NM_145912.5	NP_666017.1	Q8NET5	NFAM1_HUMAN	NFAT activating protein with ITAM motif 1	259					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cytokine production (GO:0001819)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of B cell differentiation (GO:0045577)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(1)|lung(3)	4						TCGCCATCATCTTCGAATCTA	0.493																																					p.D259Y		Atlas-SNP	.											.	NFAM1	12	.	0			c.G775T						PASS	.						121.0	127.0	125.0					22																	42781205		2203	4300	6503	SO:0001583	missense	150372	exon6			CATCATCTTCGAA	BC038241	CCDS14034.1	22q13.2	2005-02-01			ENSG00000235568	ENSG00000235568			29872	protein-coding gene	gene with protein product		608740				12615919	Standard	NM_145912		Approved	CNAIP	uc003bcn.4	Q8NET5	OTTHUMG00000150923	ENST00000329021.5:c.775G>T	chr22.hg19:g.42781205C>A	ENSP00000333680:p.Asp259Tyr	62.0	0.0	.		37.0	14.0	.	NM_145912	B0QYD0|Q20WL2|Q5JZ96|Q8IUY8|Q8TEM8	Missense_Mutation	SNP	ENST00000329021.5	hg19	CCDS14034.1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434821	0.43224	.	.	ENSG00000235568	ENST00000329021	T	0.46819	0.86	4.38	2.25	0.28309	.	0.629307	0.12632	U	0.452079	T	0.57489	0.2057	L	0.50333	1.59	0.09310	N	1	D	0.76494	0.999	D	0.66979	0.948	T	0.42599	-0.9442	10	0.72032	D	0.01	-1.9549	7.6212	0.28187	0.0:0.7942:0.0:0.2058	.	259	Q8NET5	NFAM1_HUMAN	Y	259	ENSP00000333680:D259Y	ENSP00000333680:D259Y	D	-	1	0	NFAM1	41111149	0.000000	0.05858	0.005000	0.12908	0.002000	0.02628	0.206000	0.17375	0.554000	0.29061	0.561000	0.74099	GAT	.	.	.	none		0.493	NFAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320541.1	NM_145912	
CXorf38	159013	hgsc.bcm.edu	37	X	40496278	40496278	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chrX:40496278A>G	ENST00000327877.5	-	4	628	c.602T>C	c.(601-603)gTa>gCa	p.V201A	CXorf38_ENST00000378426.1_Missense_Mutation_p.V82A|CXorf38_ENST00000378421.1_Missense_Mutation_p.V82A|CXorf38_ENST00000440784.2_Missense_Mutation_p.V116A	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	201										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						TCTGGAGTATACTGCCACAAT	0.353																																					p.V201A		Atlas-SNP	.											.	CXorf38	29	.	0			c.T602C						PASS	.						78.0	73.0	75.0					X																	40496278		2202	4300	6502	SO:0001583	missense	159013	exon4			GAGTATACTGCCA	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.602T>C	chrX.hg19:g.40496278A>G	ENSP00000330488:p.Val201Ala	98.0	0.0	.		86.0	66.0	.	NM_144970	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	hg19	CCDS14253.1	.	.	.	.	.	.	.	.	.	.	A	3.196	-0.164851	0.06502	.	.	ENSG00000185753	ENST00000378426;ENST00000327877;ENST00000378421;ENST00000440784	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	4.84	-0.221	0.13126	.	0.908091	0.09387	N	0.809142	T	0.22399	0.0540	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.28459	-1.0043	10	0.11182	T	0.66	-0.1447	4.6716	0.12692	0.3284:0.0:0.4847:0.1869	.	116;201	E7EN46;Q8TB03	.;CX038_HUMAN	A	82;201;82;116	ENSP00000367683:V82A;ENSP00000330488:V201A;ENSP00000367677:V82A;ENSP00000400019:V116A	ENSP00000330488:V201A	V	-	2	0	CXorf38	40381222	0.001000	0.12720	0.010000	0.14722	0.944000	0.59088	1.064000	0.30579	-0.051000	0.13334	0.345000	0.21793	GTA	.	.	.	none		0.353	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970	
TSPYL2	64061	hgsc.bcm.edu	37	X	53112145	53112145	+	Silent	SNP	G	G	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chrX:53112145G>C	ENST00000375442.4	+	1	597	c.465G>C	c.(463-465)gcG>gcC	p.A155A		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	155					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						TGGGGTGGGCGCCCCAGAGGT	0.582																																					p.A155A		Atlas-SNP	.											.	TSPYL2	53	.	0			c.G465C						PASS	.						25.0	24.0	24.0					X																	53112145		2202	4299	6501	SO:0001819	synonymous_variant	64061	exon1			GTGGGCGCCCCAG	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.465G>C	chrX.hg19:g.53112145G>C		77.0	0.0	.		54.0	43.0	.	NM_022117	O94799|Q96DG7|Q9BZW6	Silent	SNP	ENST00000375442.4	hg19	CCDS14350.1																																																																																			.	.	.	none		0.582	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
AR	367	hgsc.bcm.edu	37	X	66765164	66765164	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chrX:66765164A>T	ENST00000374690.3	+	1	700	c.176A>T	c.(175-177)cAg>cTg	p.Q59L	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q59L|AR_ENST00000504326.1_Missense_Mutation_p.Q59L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	59	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGCTgcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q59L		Atlas-SNP	.											.	AR	249	.	0			c.A176T						PASS	.						7.0	10.0	9.0					X																	66765164		2055	4063	6118	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	TGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.176A>T	chrX.hg19:g.66765164A>T	ENSP00000363822:p.Gln59Leu	71.0	0.0	.		66.0	13.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	12.32	1.901651	0.33535	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.69175	-0.38;-0.38;-0.38	.	.	.	.	1.117170	0.06949	N	0.814177	T	0.47060	0.1425	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.34313	0.448;0.448	B;B	0.36534	0.227;0.227	T	0.31724	-0.9933	8	0.13108	T	0.6	.	.	.	.	.	59;59	E7EVX6;D3YPQ2	.;.	L	59	ENSP00000363822:Q59L;ENSP00000421155:Q59L;ENSP00000379359:Q59L	ENSP00000363822:Q59L	Q	+	2	0	AR	66681889	0.995000	0.38212	0.864000	0.33941	0.503000	0.33858	0.245000	0.18142	0.000000	0.14550	0.000000	0.15137	CAG	.	.	.	none		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
MT-ND5	4540	hgsc.bcm.edu	37	M	12980	12980	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chrM:12980G>C	ENST00000361567.2	+	1	644	c.644G>C	c.(643-645)gGc>gCc	p.G215A	MT-TS2_ENST00000387449.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	215					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCCACTACTAGGCCTCCTCCT	0.532																																					p.G215A		Atlas-SNP	.											.	.	.	.	0			c.G644C						PASS	.																																			SO:0001583	missense	0	exon1			TACTAGGCCTCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.644G>C	chrM.hg19:g.12980G>C	ENSP00000354813:p.Gly215Ala	11.0	0.0	.		167.0	146.0	.	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.532	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-CYB	4519	hgsc.bcm.edu	37	M	14752	14752	+	Silent	SNP	C	C	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chrM:14752C>T	ENST00000361789.2	+	1	6	c.6C>T	c.(4-6)acC>acT	p.T2T	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	2					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACACCAATGACCCCAATACGC	0.408																																					p.T2T		Atlas-SNP	.											.	.	.	.	0			c.C6T						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			AATGACCCCAATA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.6C>T	chrM.hg19:g.14752C>T		120.0	0.0	.		288.0	236.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Silent	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.408	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
DLGAP2	9228	hgsc.bcm.edu	37	8	1626467	1626468	+	Frame_Shift_Ins	INS	-	-	GAGGACT	rs149482724		TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr8:1626467_1626468insGAGGACT	ENST00000421627.2	+	9	2270_2271	c.2136_2137insGAGGACT	c.(2137-2139)gagfs	p.-713fs	DLGAP2_ENST00000524065.1_3'UTR	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2						neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		ACATCACCACGGAGGACAAAGG	0.619																																					p.T712fs		Atlas-Indel,Pindel	.											.	DLGAP2	292	.	0			c.2136_2137insGAGGACT						PASS	.																																			SO:0001589	frameshift_variant	9228	exon9			.	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	Exception_encountered	chr8.hg19:g.1626467_1626468insGAGGACT	ENSP00000400258:p.Glu713fs	96.0	0.0	0		98.0	18.0	0.183673	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Frame_Shift_Ins	INS	ENST00000421627.2	hg19	CCDS47760.1																																																																																			.	.	.	none		0.619	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
KIAA0586	9786	hgsc.bcm.edu	37	14	58965662	58965663	+	Frame_Shift_Ins	INS	-	-	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr14:58965662_58965663insT	ENST00000556134.1	+	28	4381_4382	c.4107_4108insT	c.(4108-4110)tttfs	p.F1370fs	KIAA0586_ENST00000261244.5_Frame_Shift_Ins_p.F1309fs|KIAA0586_ENST00000354386.6_Frame_Shift_Ins_p.F1438fs|KIAA0586_ENST00000423743.3_Frame_Shift_Ins_p.F1341fs|KIAA0586_ENST00000538571.2_3'UTR	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1370					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TATCTCGGCAATTTGACACAGT	0.376																																					p.Q1437fs		Atlas-Indel,Pindel	.											.	KIAA0586	180	.	0			c.4311_4312insT						PASS	.																																			SO:0001589	frameshift_variant	9786	exon29			.	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.4110dupT	chr14.hg19:g.58965665_58965665dupT	ENSP00000452351:p.Phe1370fs	66.0	0.0	0		60.0	26.0	0.433333	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Frame_Shift_Ins	INS	ENST00000556134.1	hg19	CCDS58321.1																																																																																			.	.	.	none		0.376	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
HIVEP1	3096	hgsc.bcm.edu	37	6	12125716	12125716	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:12125716delG	ENST00000379388.2	+	4	6020	c.5688delG	c.(5686-5688)aagfs	p.K1896fs	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1896					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AAGAAAGGAAGTCTCCAGGGG	0.398																																					p.K1896fs		Atlas-Indel,Pindel	.											.	HIVEP1	242	.	0			c.5687delA						PASS	.						55.0	52.0	53.0					6																	12125716		1848	4081	5929	SO:0001589	frameshift_variant	3096	exon4			.	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5688delG	chr6.hg19:g.12125716delG	ENSP00000368698:p.Lys1896fs	62.0	0.0	0		58.0	16.0	0.275862	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Frame_Shift_Del	DEL	ENST00000379388.2	hg19	CCDS43426.1																																																																																			.	.	.	none		0.398	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
NEDD4	4734	hgsc.bcm.edu	37	15	56207818	56207818	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr15:56207818delA	ENST00000508342.1	-	1	1511	c.1212delT	c.(1210-1212)attfs	p.I404fs	NEDD4_ENST00000338963.2_Frame_Shift_Del_p.I404fs|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000506154.1_Frame_Shift_Del_p.I404fs	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	404					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AATTAAGCTTAATTTCTGACA	0.353																																					p.K405fs		Atlas-Indel,Pindel	.											.	NEDD4	167	.	0			c.1213delA						PASS	.						58.0	58.0	58.0					15																	56207818		2193	4292	6485	SO:0001589	frameshift_variant	4734	exon1			.	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1212delT	chr15.hg19:g.56207818delA	ENSP00000424827:p.Ile404fs	119.0	0.0	0		98.0	37.0	0.377551	NM_198400	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Frame_Shift_Del	DEL	ENST00000508342.1	hg19																																																																																				.	.	.	none		0.353	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
DIP2C	22982	hgsc.bcm.edu	37	10	459927	459927	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr10:459927delC	ENST00000280886.6	-	8	1070	c.983delG	c.(982-984)ggcfs	p.G328fs	DIP2C_ENST00000381496.3_Frame_Shift_Del_p.G221fs	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	328						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CGAGATGGTGCCCCACCTCTG	0.672																																					p.G328fs		Atlas-Indel,Pindel	.											.	DIP2C	195	.	0			c.984delC						PASS	.						63.0	63.0	63.0					10																	459927		2203	4300	6503	SO:0001589	frameshift_variant	22982	exon8			.	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.983delG	chr10.hg19:g.459927delC	ENSP00000280886:p.Gly328fs	40.0	0.0	0		39.0	14.0	0.358974	NM_014974	B4DPI5|Q5SS78	Frame_Shift_Del	DEL	ENST00000280886.6	hg19	CCDS7054.1																																																																																			.	.	.	none		0.672	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
NIPBL	25836	hgsc.bcm.edu	37	5	37024711	37024728	+	In_Frame_Del	DEL	AGAGTAATAAAGATTCTC	AGAGTAATAAAGATTCTC	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	AGAGTAATAAAGATTCTC	AGAGTAATAAAGATTCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr5:37024711_37024728delAGAGTAATAAAGATTCTC	ENST00000282516.8	+	30	6098_6115	c.5599_5616delAGAGTAATAAAGATTCTC	c.(5599-5616)agagtaataaagattctcdel	p.RVIKIL1867del	NIPBL_ENST00000448238.2_In_Frame_Del_p.RVIKIL1867del	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1867					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGTCAGGAAAAGAGTAATAAAGATTCTCAGAGACATTT	0.326																																					p.1866_1872del		Atlas-Indel,Pindel	.											.	NIPBL	513	.	0			c.5598_5615del	GRCh37	CM073229	NIPBL	M		PASS	.																																			SO:0001651	inframe_deletion	25836	exon30			.	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5599_5616delAGAGTAATAAAGATTCTC	chr5.hg19:g.37024711_37024728delAGAGTAATAAAGATTCTC	ENSP00000282516:p.Arg1867_Leu1872del	235.0	0.0	0		168.0	24.0	0.142857	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	In_Frame_Del	DEL	ENST00000282516.8	hg19	CCDS3920.1																																																																																			.	.	.	none		0.326	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
NBPF6	653149	hgsc.bcm.edu	37	1	108995872	108995873	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:108995872_108995873delGA	ENST00000444143.2	+	4	566_567	c.348_349delGA	c.(346-351)gggagafs	p.R117fs	NBPF6_ENST00000294652.8_Intron|NBPF6_ENST00000370040.3_Frame_Shift_Del_p.R117fs|NBPF6_ENST00000495380.2_Frame_Shift_Del_p.R117fs			Q5VWK0	NBPF6_HUMAN	neuroblastoma breakpoint family, member 6	117						cytoplasm (GO:0005737)				endometrium(2)	2						TACGGGAAGGGAGAGATGCCTC	0.52																																					p.116_116del		Atlas-Indel,Pindel	.											.	NBPF6	4	.	0			c.347_348del						PASS	.																																			SO:0001589	frameshift_variant	653149	exon4			.		CCDS44184.1	1p13.3	2013-01-17				ENSG00000186086		"""neuroblastoma breakpoint family"""	31988	protein-coding gene	gene with protein product		613996				16079250	Standard	NM_001143987		Approved		uc009wep.3	Q5VWK0	OTTHUMG00000039830	ENST00000444143.2:c.348_349delGA	chr1.hg19:g.108995876_108995877delGA	ENSP00000402703:p.Arg117fs	247.0	0.0	0		208.0	33.0	0.158654	NM_001143987	A4QN25	Frame_Shift_Del	DEL	ENST00000444143.2	hg19	CCDS44184.1																																																																																			.	.	.	none		0.520	NBPF6-203	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276886.3	XM_926213	
ZFP64	55734	hgsc.bcm.edu	37	20	50701317	50701318	+	Frame_Shift_Ins	INS	-	-	G			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr20:50701317_50701318insG	ENST00000361387.2	-	9	1776_1777	c.1716_1717insC	c.(1714-1719)gccaagfs	p.K573fs	ZFP64_ENST00000371523.4_Frame_Shift_Ins_p.K354fs|ZFP64_ENST00000371518.2_Intron	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GTCACGATCTTGGCCACGTGCT	0.629																																					p.K573fs		Atlas-INDEL	.											.	ZFP64	240	.	0			c.1717_1718insC						PASS	.																																			SO:0001589	frameshift_variant	55734	exon9			.	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1717dupC	chr20.hg19:g.50701319_50701319dupG	ENSP00000355179:p.Lys573fs	52.0	0.0	0		27.0	12.0	0.444444	NM_199427	Q9NTS7|Q9NVH4	Frame_Shift_Ins	INS	ENST00000361387.2	hg19	CCDS13439.1																																																																																			.	.	.	none		0.629	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079743.2	NM_018197	
NUP43	348995	hgsc.bcm.edu	37	6	150059828	150059828	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr6:150059828delT	ENST00000340413.2	-	5	665	c.589delA	c.(589-591)atafs	p.I197fs	NUP43_ENST00000460354.2_Frame_Shift_Del_p.I197fs|NUP43_ENST00000367403.3_Intron|NUP43_ENST00000367404.4_Intron	NM_198887.1	NP_942590.1	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	197					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				breast(1)|large_intestine(2)|lung(8)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)		AAATCCCATATTTTCAACTGT	0.323																																					p.I197fs		Atlas-Indel,Pindel	.											.	NUP43	32	.	0			c.590delT						PASS	.						127.0	119.0	122.0					6																	150059828		2203	4297	6500	SO:0001589	frameshift_variant	348995	exon5			.	AF514997	CCDS5218.1	6q25.1	2013-01-10			ENSG00000120253	ENSG00000120253		"""WD repeat domain containing"""	21182	protein-coding gene	gene with protein product		608141				12196509	Standard	XM_005266961		Approved	bA350J20.1, FLJ13287	uc003qmz.3	Q8NFH3	OTTHUMG00000015795	ENST00000340413.2:c.589delA	chr6.hg19:g.150059828delT	ENSP00000342262:p.Ile197fs	51.0	0.0	0		76.0	30.0	0.394737	NM_198887	B4E2F0|Q9H8S0	Frame_Shift_Del	DEL	ENST00000340413.2	hg19	CCDS5218.1																																																																																			.	.	.	none		0.323	NUP43-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396947.1	NM_198887	
HIPK1	204851	hgsc.bcm.edu	37	1	114483624	114483626	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	TGC	TGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:114483624_114483626delTGC	ENST00000369558.1	+	2	851_853	c.619_621delTGC	c.(619-621)tgcdel	p.C207del	HIPK1_ENST00000369555.2_In_Frame_Del_p.C207del|HIPK1_ENST00000369561.4_In_Frame_Del_p.C207del|HIPK1_ENST00000426820.2_In_Frame_Del_p.C207del|HIPK1_ENST00000369554.2_In_Frame_Del_p.C207del|HIPK1_ENST00000369559.4_In_Frame_Del_p.C207del			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGTGGCTAAGTGCTGGAAGAGGA	0.498																																					p.206_207del		Atlas-INDEL	.											.	HIPK1	195	.	0			c.618_620del						PASS	.																																			SO:0001651	inframe_deletion	204851	exon2			.	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.619_621delTGC	chr1.hg19:g.114483624_114483626delTGC	ENSP00000358571:p.Cys207del	55.0	0.0	0		35.0	10.0	0.285714	NM_152696	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	In_Frame_Del	DEL	ENST00000369558.1	hg19	CCDS867.1																																																																																			.	.	.	none		0.498	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
MRPL23	6150	hgsc.bcm.edu	37	11	1972132	1972133	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr11:1972132_1972133delCC	ENST00000397298.3	+	2	106_107	c.21_22delCC	c.(19-24)taccccfs	p.P8fs	MRPL23_ENST00000486931.1_3'UTR|MRPL23_ENST00000397294.3_Frame_Shift_Del_p.P8fs|MRPL23_ENST00000381519.1_Frame_Shift_Del_p.P8fs|MRPL23_ENST00000397297.3_Frame_Shift_Del_p.P8fs|MRPL23_ENST00000381514.3_Frame_Shift_Del_p.P8fs	NM_021134.3	NP_066957.3	Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	8					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|ovary(1)	4		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)		TGTACAGGTACCCCCTGTACCG	0.609																																					p.7_7del		Atlas-Indel,Pindel	.											.	MRPL23	14	.	0			c.20_21del						PASS	.																																			SO:0001589	frameshift_variant	6150	exon2			.	AB051340	CCDS31336.1	11p15.5	2012-09-13			ENSG00000214026	ENSG00000214026		"""Mitochondrial ribosomal proteins / large subunits"""	10322	protein-coding gene	gene with protein product		600789		RPL23L		8541832	Standard	NM_021134		Approved	L23MRP	uc001lux.3	Q16540	OTTHUMG00000012476	ENST00000397298.3:c.21_22delCC	chr11.hg19:g.1972134_1972135delCC	ENSP00000380466:p.Pro8fs	51.0	0.0	0		51.0	14.0	0.27451	NM_021134	A8MT29|Q96Q71	Frame_Shift_Del	DEL	ENST00000397298.3	hg19	CCDS31336.1																																																																																			.	.	.	none		0.609	MRPL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034765.2	NM_021134	
KIAA1109	84162	hgsc.bcm.edu	37	4	123277058	123277059	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr4:123277058_123277059insA	ENST00000264501.4	+	83	14786_14787	c.14413_14414insA	c.(14413-14415)gaafs	p.E4805fs	KIAA1109_ENST00000388738.3_Frame_Shift_Ins_p.E4805fs			Q2LD37	K1109_HUMAN	KIAA1109	4805					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTACAACCATGAAACAGAGACT	0.396																																					p.E4805fs		Atlas-Indel,Pindel	.											.	KIAA1109	424	.	0			c.14413_14414insA						PASS	.																																			SO:0001589	frameshift_variant	84162	exon81			.	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14416dupA	chr4.hg19:g.123277061_123277061dupA	ENSP00000264501:p.Glu4805fs	101.0	0.0	0		92.0	35.0	0.380435	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Frame_Shift_Ins	INS	ENST00000264501.4	hg19	CCDS43267.1																																																																																			.	.	.	none		0.396	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
MED13L	23389	hgsc.bcm.edu	37	12	116418708	116418709	+	Frame_Shift_Ins	INS	-	-	T	rs376850639		TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr12:116418708_116418709insT	ENST00000281928.3	-	23	5416_5417	c.5210_5211insA	c.(5209-5211)aagfs	p.K1737fs		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1737						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CTTGCTCATCCTTCATTGTCTG	0.396																																					p.K1737fs		Atlas-Indel,Pindel	.											.	MED13L	193	.	0			c.5211_5212insA						PASS	.																																			SO:0001589	frameshift_variant	23389	exon23			.	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5211dupA	chr12.hg19:g.116418710_116418710dupT	ENSP00000281928:p.Lys1737fs	53.0	0.0	0		93.0	18.0	0.193548	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Frame_Shift_Ins	INS	ENST00000281928.3	hg19	CCDS9177.1																																																																																			.	.	.	none		0.396	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
EMC4	51234	hgsc.bcm.edu	37	15	34519983	34519983	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr15:34519983delC	ENST00000267750.4	+	3	407	c.291delC	c.(289-291)ttcfs	p.F97fs	EMC4_ENST00000559421.1_Intron|EMC4_ENST00000249209.4_Frame_Shift_Del_p.F97fs|EMC4_ENST00000559078.1_Frame_Shift_Del_p.F97fs|EMC4_ENST00000557879.1_Intron	NM_016454.2	NP_057538.1	Q5J8M3	EMC4_HUMAN	ER membrane protein complex subunit 4	97					apoptotic process (GO:0006915)	ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TCTCCATCTTCCCTACTATGA	0.453																																					p.F97fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.290delT						PASS	.						180.0	154.0	163.0					15																	34519983		2201	4298	6499	SO:0001589	frameshift_variant	51234	exon3			.	BC016348	CCDS10035.1, CCDS66732.1	15q14	2012-05-23	2012-05-23	2012-05-23	ENSG00000128463	ENSG00000128463			28032	protein-coding gene	gene with protein product			"""transmembrane protein 85"""	TMEM85		18586032, 22119785	Standard	NM_001286420		Approved	FLJ90746, MGC24415, PIG17	uc001zhq.3	Q5J8M3	OTTHUMG00000129411	ENST00000267750.4:c.291delC	chr15.hg19:g.34519983delC	ENSP00000267750:p.Phe97fs	98.0	0.0	0		84.0	21.0	0.25	NM_016454	A8K3A9|B4DJQ4|Q96KX9|Q9BUI5|Q9P0T9	Frame_Shift_Del	DEL	ENST00000267750.4	hg19	CCDS10035.1																																																																																			.	.	.	none		0.453	EMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251568.1	NM_016454	
CXorf22	170063	hgsc.bcm.edu	37	X	35994031	35994032	+	Splice_Site	INS	-	-	T			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chrX:35994031_35994032insT	ENST00000297866.5	+	15	2779		c.e15+1			NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22											breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						CCAGCTAAAGGTAACAGTTTAT	0.332																																					.		Pindel	.											.	CXorf22	272	.	0			c.2713+1->T						PASS	.																																			SO:0001630	splice_region_variant	170063	exon15			.	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.2713+1->T	chrX.hg19:g.35994032_35994032dupT		39.0	0.0	.		35.0	18.0	0.514	NM_152632	Q5JRM8|Q8N6X8	Splice_Site	INS	ENST00000297866.5	hg19	CCDS14237.2																																																																																			.	.	.	none		0.332	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	Intron
NBPF4	148545	hgsc.bcm.edu	37	1	108783712	108783713	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-SX-A71U-01A-12D-A33Q-10	TCGA-SX-A71U-10A-01D-A33Q-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d451356-8c58-451d-a6cf-223e76cae191	2c6bb397-d986-49b1-b1dc-1151c8aae19f	g.chr1:108783712_108783713delTC	ENST00000415641.3	-	4	555_556	c.352_353delGA	c.(352-354)gatfs	p.D118fs		NM_001143989.2	NP_001137461.1	Q96M43	NBPF4_HUMAN	neuroblastoma breakpoint family, member 4	118						cytoplasm (GO:0005737)				endometrium(2)|lung(1)|skin(1)	4						GCGGGAGGCATCTCTCCCTTCC	0.54																																					p.118_118del		Pindel	.											.	NBPF4	4	.	0			c.353_354del						PASS	.																																			SO:0001589	frameshift_variant	148545	exon4			.	AK057395	CCDS44182.1	1p13.3	2013-01-17			ENSG00000196427	ENSG00000196427		"""neuroblastoma breakpoint family"""	26550	protein-coding gene	gene with protein product		613994				16079250	Standard	NM_001143989		Approved	FLJ32833	uc009weo.2	Q96M43	OTTHUMG00000011318	ENST00000415641.3:c.352_353delGA	chr1.hg19:g.108783716_108783717delTC	ENSP00000389237:p.Asp118fs	273.0	0.0	.		266.0	33.0	0.124	NM_001143989	Q5T483	Frame_Shift_Del	DEL	ENST00000415641.3	hg19	CCDS44182.1																																																																																			.	.	.	none		0.540	NBPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031255.5	NM_152488	
