#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NIPAL3	57185	hgsc.bcm.edu	37	1	24768627	24768627	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:24768627T>A	ENST00000374399.4	+	4	613	c.245T>A	c.(244-246)cTg>cAg	p.L82Q	NIPAL3_ENST00000358028.4_Missense_Mutation_p.L82Q|NIPAL3_ENST00000428131.1_Missense_Mutation_p.L82Q|NIPAL3_ENST00000003912.3_5'UTR|NIPAL3_ENST00000339255.2_Missense_Mutation_p.L82Q	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	82						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						GGCCTGTTCCTGATGCTTCTG	0.582																																					p.L82Q		Atlas-SNP	.											.	NIPAL3	36	.	0			c.T245A						PASS	.						125.0	113.0	117.0					1																	24768627		2203	4300	6503	SO:0001583	missense	57185	exon4			TGTTCCTGATGCT	BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.245T>A	chr1.hg19:g.24768627T>A	ENSP00000363520:p.Leu82Gln	56.0	0.0	.		51.0	16.0	.	NM_020448	A2A298|Q6MZT9|Q9BVE6	Missense_Mutation	SNP	ENST00000374399.4	hg19	CCDS30631.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.499788	0.85176	.	.	ENSG00000001461	ENST00000374399;ENST00000358028;ENST00000339255;ENST00000428131	T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55	5.22	4.09	0.47781	.	0.139109	0.49305	D	0.000159	D	0.85435	0.5696	M	0.89601	3.045	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.86798	0.1990	10	0.72032	D	0.01	-13.663	11.2516	0.49028	0.0:0.0724:0.0:0.9276	.	82;82;82	Q6P499-3;Q6P499;A6NN97	.;NPAL3_HUMAN;.	Q	82	ENSP00000363520:L82Q;ENSP00000350722:L82Q;ENSP00000343549:L82Q;ENSP00000406509:L82Q	ENSP00000343549:L82Q	L	+	2	0	NIPAL3	24641214	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.253000	0.78320	0.911000	0.36747	0.533000	0.62120	CTG	.	.	.	none		0.582	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276996.1	NM_020448	
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74808658	74808658	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:74808658C>A	ENST00000370899.3	+	10	1155	c.1118C>A	c.(1117-1119)aCc>aAc	p.T373N	TNNI3K_ENST00000326637.3_Missense_Mutation_p.T272N|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.T373N|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.T386N|TNNI3K_ENST00000370891.2_Missense_Mutation_p.T373N|RP11-439H8.4_ENST00000415549.2_RNA	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		TATGGAGATACCCCCTTACAC	0.363																																					p.T373N		Atlas-SNP	.											.,1	.	.	.	0			c.C1118A						PASS	.						171.0	158.0	162.0					1																	74808658		2203	4300	6503	SO:0001583	missense	100526835	exon10			GAGATACCCCCTT			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1118C>A	chr1.hg19:g.74808658C>A	ENSP00000359936:p.Thr373Asn	183.0	0.0	.		140.0	55.0	.	NM_001199327		Missense_Mutation	SNP	ENST00000370899.3	hg19		.	.	.	.	.	.	.	.	.	.	C	22.9	4.352277	0.82132	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.75050	-0.83;-0.83;-0.9;-0.9;-0.83	5.77	5.77	0.91146	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.88396	0.6425	M	0.89785	3.06	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.996	D	0.89504	0.3766	10	0.72032	D	0.01	.	19.9928	0.97374	0.0:1.0:0.0:0.0	.	272;373;373;373	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	N	373;373;373;373;272	ENSP00000359936:T373N;ENSP00000359932:T373N;ENSP00000450895:T373N;ENSP00000359928:T373N;ENSP00000322251:T272N	ENSP00000322251:T272N	T	+	2	0	RP11-653A5.2;AC093158.1	74581246	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.551000	0.67274	2.745000	0.94114	0.650000	0.86243	ACC	.	.	.	none		0.363	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
WNT2B	7482	hgsc.bcm.edu	37	1	113058824	113058824	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:113058824C>A	ENST00000369684.4	+	3	951	c.466C>A	c.(466-468)Cgc>Agc	p.R156S	WNT2B_ENST00000256640.5_Missense_Mutation_p.R64S|WNT2B_ENST00000478360.1_3'UTR|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Missense_Mutation_p.R137S	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	156					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGCTATTACTCGCGCCTGTAG	0.562																																					p.R156S		Atlas-SNP	.											.	WNT2B	51	.	0			c.C466A						PASS	.						137.0	126.0	130.0					1																	113058824		2203	4300	6503	SO:0001583	missense	7482	exon3			ATTACTCGCGCCT	AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.466C>A	chr1.hg19:g.113058824C>A	ENSP00000358698:p.Arg156Ser	169.0	0.0	.		132.0	46.0	.	NM_024494	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	ENST00000369684.4	hg19	CCDS847.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562764	0.86335	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	T;T;T	0.77358	-1.09;-1.09;-1.09	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.89504	0.6734	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.987	D	0.90387	0.4392	10	0.59425	D	0.04	.	19.2708	0.94008	0.0:1.0:0.0:0.0	.	156;137	Q93097;Q93097-2	WNT2B_HUMAN;.	S	64;137;156	ENSP00000256640:R64S;ENSP00000358700:R137S;ENSP00000358698:R156S	ENSP00000256640:R64S	R	+	1	0	WNT2B	112860347	0.939000	0.31865	0.998000	0.56505	0.953000	0.61014	2.076000	0.41548	2.644000	0.89710	0.561000	0.74099	CGC	.	.	.	none		0.562	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030692.1	NM_004185	
PGLYRP3	114771	hgsc.bcm.edu	37	1	153283087	153283087	+	Splice_Site	SNP	C	C	T	rs375220818		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:153283087C>T	ENST00000290722.1	-	1	107	c.55G>A	c.(55-57)Gat>Aat	p.D19N		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	19					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TAAAACTTACCCCAAGCCTGG	0.493																																					p.D19N		Atlas-SNP	.											.	PGLYRP3	55	.	0			c.G55A						PASS	.						149.0	154.0	152.0					1																	153283087		2203	4300	6503	SO:0001630	splice_region_variant	114771	exon1			ACTTACCCCAAGC	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.55+1G>A	chr1.hg19:g.153283087C>T		196.0	0.0	.		129.0	47.0	.	NM_052891	A1A4U8|Q5SY65	Missense_Mutation	SNP	ENST00000290722.1	hg19	CCDS1035.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.601956	0.28534	.	.	ENSG00000159527	ENST00000290722	T	0.07444	3.19	3.22	1.35	0.21983	N-acetylmuramoyl-L-alanine amidase domain (1);	0.794118	0.10474	N	0.670413	T	0.02380	0.0073	L	0.48642	1.525	0.21445	N	0.999685	P	0.37688	0.605	B	0.35413	0.202	T	0.44559	-0.9320	9	.	.	.	.	5.3598	0.16081	0.0:0.735:0.0:0.265	.	19	Q96LB9	PGRP3_HUMAN	N	19	ENSP00000290722:D19N	.	D	-	1	0	PGLYRP3	151549711	0.958000	0.32768	0.703000	0.30354	0.007000	0.05969	2.781000	0.47750	0.374000	0.24650	-0.136000	0.14681	GAT	.	.	.	none		0.493	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891	Missense_Mutation
NUP210L	91181	hgsc.bcm.edu	37	1	153974267	153974267	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:153974267G>C	ENST00000368559.3	-	36	5196	c.5125C>G	c.(5125-5127)Caa>Gaa	p.Q1709E	NUP210L_ENST00000368553.1_Intron|NUP210L_ENST00000271854.3_Intron	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1709					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CCGATATCTTGTTTGTGGCTA	0.413																																					p.Q1709E		Atlas-SNP	.											.	NUP210L	181	.	0			c.C5125G						PASS	.						238.0	220.0	225.0					1																	153974267		1876	4114	5990	SO:0001583	missense	91181	exon36			TATCTTGTTTGTG	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.5125C>G	chr1.hg19:g.153974267G>C	ENSP00000357547:p.Gln1709Glu	146.0	0.0	.		99.0	30.0	.	NM_207308	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	hg19	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	G	1.526	-0.545710	0.04024	.	.	ENSG00000143552	ENST00000368559	T	0.04917	3.53	4.28	-0.146	0.13432	.	0.968910	0.08488	N	0.938435	T	0.01765	0.0056	L	0.44542	1.39	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.46652	-0.9176	10	0.28530	T	0.3	-35.7249	7.2674	0.26237	0.0:0.2873:0.3793:0.3334	.	1709	Q5VU65	P210L_HUMAN	E	1709	ENSP00000357547:Q1709E	ENSP00000357547:Q1709E	Q	-	1	0	NUP210L	152240891	0.768000	0.28519	0.000000	0.03702	0.250000	0.25880	1.989000	0.40707	-0.207000	0.10187	0.561000	0.74099	CAA	.	.	.	none		0.413	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
HAX1	10456	hgsc.bcm.edu	37	1	154247707	154247707	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:154247707T>C	ENST00000328703.7	+	5	847	c.634T>C	c.(634-636)Tct>Cct	p.S212P	HAX1_ENST00000532105.1_Missense_Mutation_p.S84P|HAX1_ENST00000483970.2_Missense_Mutation_p.S220P|HAX1_ENST00000457918.2_Missense_Mutation_p.S164P	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	212	Involved in ATP2A2 binding.|Involved in GNA13 binding.|Involved in HCLS1 binding.|Involved in PKD2 binding.|Involved in PLN binding.|Required for localization in sarcoplasmic reticulum. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CAAGAGCATCTCTGTGACCAA	0.488									Kostmann syndrome																												p.S212P		Atlas-SNP	.											.	HAX1	25	.	0			c.T634C						PASS	.						71.0	72.0	72.0					1																	154247707		2203	4300	6503	SO:0001583	missense	10456	exon5	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	AGCATCTCTGTGA	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.634T>C	chr1.hg19:g.154247707T>C	ENSP00000329002:p.Ser212Pro	124.0	0.0	.		100.0	37.0	.	NM_006118	A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Missense_Mutation	SNP	ENST00000328703.7	hg19	CCDS1064.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.614964	0.66672	.	.	ENSG00000143575	ENST00000328703;ENST00000457918;ENST00000483970;ENST00000435087;ENST00000532105	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.6	4.46	0.54185	.	0.415528	0.25233	N	0.032160	T	0.68860	0.3047	M	0.80183	2.485	0.41243	D	0.98665	D;D;D;D	0.67145	0.984;0.996;0.996;0.992	P;D;D;P	0.63703	0.828;0.917;0.917;0.882	T	0.73949	-0.3821	10	0.87932	D	0	-19.8327	9.6673	0.39992	0.1554:0.0:0.0:0.8446	.	220;186;164;212	O00165-2;O00165-3;O00165-5;O00165	.;.;.;HAX1_HUMAN	P	212;164;220;216;84	ENSP00000329002:S212P;ENSP00000411448:S164P;ENSP00000435088:S220P;ENSP00000394920:S216P;ENSP00000433951:S84P	ENSP00000329002:S212P	S	+	1	0	HAX1	152514331	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	1.873000	0.39558	0.918000	0.36919	0.460000	0.39030	TCT	.	.	.	none		0.488	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087650.1	NM_006118	
KIAA1614	57710	hgsc.bcm.edu	37	1	180910417	180910417	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:180910417A>T	ENST00000367588.4	+	7	3210	c.3155A>T	c.(3154-3156)cAc>cTc	p.H1052L	KIAA1614_ENST00000367587.1_Missense_Mutation_p.H673L|KIAA1614_ENST00000461346.1_3'UTR|RP11-46A10.5_ENST00000358073.2_RNA	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	1052	Ser-rich.									NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CAATCCCTGCACCCGGTGAGT	0.627																																					p.H1052L		Atlas-SNP	.											.	KIAA1614	75	.	0			c.A3155T						PASS	.						28.0	33.0	31.0					1																	180910417		1953	4131	6084	SO:0001583	missense	57710	exon7			CCCTGCACCCGGT	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.3155A>T	chr1.hg19:g.180910417A>T	ENSP00000356560:p.His1052Leu	154.0	0.0	.		146.0	49.0	.	NM_020950	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	hg19	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.377776	0.42105	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.25414	2.38;1.8	5.21	-1.02	0.10135	.	0.919516	0.09186	N	0.836801	T	0.21103	0.0508	L	0.44542	1.39	0.36487	D	0.868171	B;P	0.36535	0.403;0.557	B;B	0.36186	0.12;0.219	T	0.29941	-0.9995	9	0.46703	T	0.11	0.0845	9.023	0.36211	0.582:0.0:0.418:0.0	.	673;1052	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	L	1052;673	ENSP00000356560:H1052L;ENSP00000356559:H673L	ENSP00000356559:H673L	H	+	2	0	KIAA1614	179177040	0.007000	0.16637	0.097000	0.21041	0.888000	0.51559	-0.051000	0.11885	-0.214000	0.10078	0.459000	0.35465	CAC	.	.	.	none		0.627	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
CACNA1E	777	hgsc.bcm.edu	37	1	181452978	181452978	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:181452978C>G	ENST00000367573.2	+	1	98	c.98C>G	c.(97-99)tCg>tGg	p.S33W	CACNA1E_ENST00000358338.5_5'UTR|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000526775.1_Missense_Mutation_p.S33W|CACNA1E_ENST00000360108.3_Missense_Mutation_p.S33W|CACNA1E_ENST00000357570.5_5'UTR|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S33W	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	33					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GTGCCGGCCTCGGGGCAGGCG	0.662																																					p.S33W		Atlas-SNP	.											.	CACNA1E	778	.	0			c.C98G						PASS	.						44.0	52.0	49.0					1																	181452978		1866	4078	5944	SO:0001583	missense	777	exon1			CGGCCTCGGGGCA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.98C>G	chr1.hg19:g.181452978C>G	ENSP00000356545:p.Ser33Trp	138.0	0.0	.		139.0	44.0	.	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.672842	0.47781	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000360108;ENST00000367573	D;D;D;D;D	0.97328	-4.34;-3.97;-3.93;-3.93;-3.97	5.67	5.67	0.87782	.	0.487945	0.18345	N	0.144056	D	0.94833	0.8331	L	0.29908	0.895	0.80722	D	1	D	0.55605	0.972	P	0.47134	0.539	D	0.94502	0.7710	10	0.87932	D	0	.	11.9558	0.52981	0.0:0.9198:0.0:0.0802	.	33	Q15878-3	.	W	33	ENSP00000432038:S33W;ENSP00000356542:S33W;ENSP00000434814:S33W;ENSP00000353222:S33W;ENSP00000356545:S33W	ENSP00000353222:S33W	S	+	2	0	CACNA1E	179719601	0.414000	0.25408	1.000000	0.80357	0.984000	0.73092	0.778000	0.26732	2.667000	0.90743	0.561000	0.74099	TCG	.	.	.	none		0.662	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
DNAH14	127602	hgsc.bcm.edu	37	1	225539372	225539372	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:225539372C>T	ENST00000445597.2	+	50	8632	c.8632C>T	c.(8632-8634)Caa>Taa	p.Q2878*	DNAH14_ENST00000430092.1_Nonsense_Mutation_p.Q3681*|DNAH14_ENST00000439375.2_Nonsense_Mutation_p.Q3681*			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2878					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AGGTGAAAGTCAACATCTTCA	0.368																																					p.Q3681X		Atlas-SNP	.											.	DNAH14	300	.	0			c.C11041T						PASS	.						82.0	73.0	76.0					1																	225539372		692	1591	2283	SO:0001587	stop_gained	127602	exon70			GAAAGTCAACATC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8632C>T	chr1.hg19:g.225539372C>T	ENSP00000409472:p.Gln2878*	173.0	0.0	.		133.0	44.0	.	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Nonsense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	C	38	7.235998	0.98154	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	.	.	.	5.18	-2.58	0.06228	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	4.4412	0.11575	0.3325:0.2728:0.3261:0.0687	.	.	.	.	X	2878;3681;3681	.	ENSP00000414402:Q3681X	Q	+	1	0	DNAH14	223605995	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	-0.202000	0.09451	-0.280000	0.09154	0.603000	0.83216	CAA	.	.	.	none		0.368	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
SIPA1L2	57568	hgsc.bcm.edu	37	1	232615472	232615472	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:232615472A>C	ENST00000366630.1	-	6	2344	c.1986T>G	c.(1984-1986)gaT>gaG	p.D662E	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.D662E			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	662	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TGCCCGTGGAATCAGCTGAAA	0.408																																					p.D662E		Atlas-SNP	.											.	SIPA1L2	218	.	0			c.T1986G						PASS	.						134.0	144.0	141.0					1																	232615472		2082	4252	6334	SO:0001583	missense	57568	exon5			CGTGGAATCAGCT	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.1986T>G	chr1.hg19:g.232615472A>C	ENSP00000355589:p.Asp662Glu	42.0	0.0	.		40.0	12.0	.	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	hg19	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.609252	0.87258	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.94232	-3.38;-3.38	5.54	0.415	0.16411	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.95843	0.8647	M	0.85859	2.78	0.47341	D	0.999394	D	0.69078	0.997	D	0.72075	0.976	D	0.94353	0.7581	10	0.87932	D	0	-29.4799	9.2931	0.37800	0.7007:0.0:0.2993:0.0	.	662	Q9P2F8	SI1L2_HUMAN	E	662	ENSP00000355589:D662E;ENSP00000262861:D662E	ENSP00000262861:D662E	D	-	3	2	SIPA1L2	230682095	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.660000	0.37397	0.100000	0.17581	0.533000	0.62120	GAT	.	.	.	none		0.408	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
C2orf78	388960	hgsc.bcm.edu	37	2	74043598	74043598	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr2:74043598T>G	ENST00000409561.1	+	3	2369	c.2248T>G	c.(2248-2250)Tac>Gac	p.Y750D		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	750										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TGCTGTGGCTTACCCTGCTCG	0.537																																					p.Y750D		Atlas-SNP	.											.	C2orf78	150	.	0			c.T2248G						PASS	.						159.0	166.0	164.0					2																	74043598		2116	4225	6341	SO:0001583	missense	388960	exon3			GTGGCTTACCCTG	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.2248T>G	chr2.hg19:g.74043598T>G	ENSP00000387124:p.Tyr750Asp	214.0	0.0	.		236.0	56.0	.	NM_001080474		Missense_Mutation	SNP	ENST00000409561.1	hg19	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	T	1.402	-0.577786	0.03854	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.45668	0.89	5.08	-10.2	0.00374	.	1.247370	0.05957	N	0.639954	T	0.16769	0.0403	N	0.16130	0.375	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.12041	-1.0563	10	0.32370	T	0.25	1.7364	1.4355	0.02342	0.4555:0.2176:0.1839:0.143	.	750	A6NCI8	CB078_HUMAN	D	750;720	ENSP00000387124:Y750D	ENSP00000340692:Y720D	Y	+	1	0	C2orf78	73897106	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.317000	0.02707	-2.190000	0.00757	-0.490000	0.04691	TAC	.	.	.	none		0.537	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474	
ATF2	1386	hgsc.bcm.edu	37	2	175945471	175945471	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr2:175945471T>G	ENST00000264110.2	-	13	1506	c.1208A>C	c.(1207-1209)aAt>aCt	p.N403T	ATF2_ENST00000409499.1_Missense_Mutation_p.N42T|ATF2_ENST00000426833.3_Missense_Mutation_p.N385T|ATF2_ENST00000538946.1_3'UTR|ATF2_ENST00000487334.2_3'UTR|ATF2_ENST00000409437.1_Missense_Mutation_p.N287T|ATF2_ENST00000345739.5_Missense_Mutation_p.N345T|ATF2_ENST00000392544.1_Missense_Mutation_p.N403T|ATF2_ENST00000409635.1_Missense_Mutation_p.N345T|ATF2_ENST00000392543.2_Missense_Mutation_p.N24T	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	403	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	TGCCACTTCATTTCTCAGCAG	0.388																																					p.N403T	Pancreas(17;87 705 4534 15538 30988)	Atlas-SNP	.											.	ATF2	52	.	0			c.A1208C						PASS	.						156.0	153.0	154.0					2																	175945471		2203	4300	6503	SO:0001583	missense	1386	exon13			ACTTCATTTCTCA	X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.1208A>C	chr2.hg19:g.175945471T>G	ENSP00000264110:p.Asn403Thr	53.0	0.0	.		59.0	26.0	.	NM_001880	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Missense_Mutation	SNP	ENST00000264110.2	hg19	CCDS2262.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.620506	0.87460	.	.	ENSG00000115966	ENST00000264110;ENST00000345739;ENST00000542046;ENST00000409437;ENST00000409635;ENST00000392544;ENST00000409499;ENST00000426833;ENST00000392543	T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48	5.91	5.91	0.95273	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	T	0.60907	0.2305	L	0.28192	0.835	0.80722	D	1	D;P;D;B;B	0.76494	0.997;0.854;0.999;0.41;0.288	D;P;D;P;B	0.79108	0.992;0.505;0.972;0.475;0.103	T	0.60031	-0.7342	10	0.36615	T	0.2	-42.5065	16.3453	0.83126	0.0:0.0:0.0:1.0	.	385;380;42;345;403	A4D7U4;B3KY57;Q96JT8;Q3B7B7;P15336	.;.;.;.;ATF2_HUMAN	T	403;345;380;287;345;403;42;385;24	ENSP00000264110:N403T;ENSP00000340576:N345T;ENSP00000386326:N287T;ENSP00000387093:N345T;ENSP00000376327:N403T;ENSP00000407911:N385T	ENSP00000264110:N403T	N	-	2	0	ATF2	175653717	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.909000	0.69923	2.261000	0.74972	0.533000	0.62120	AAT	.	.	.	none		0.388	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255562.1	NM_001880	
TTN	7273	hgsc.bcm.edu	37	2	179575930	179575930	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr2:179575930G>C	ENST00000591111.1	-	95	27306	c.27082C>G	c.(27082-27084)Cca>Gca	p.P9028A	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.P9345A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P8101A|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13166	Ig-like 73.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTACATTTGGGCTGTCTTTC	0.428																																					p.P9345A		Atlas-SNP	.											.	TTN	18412	.	0			c.C28033G						PASS	.						212.0	209.0	210.0					2																	179575930		1869	4109	5978	SO:0001583	missense	7273	exon97			CATTTGGGCTGTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27082C>G	chr2.hg19:g.179575930G>C	ENSP00000465570:p.Pro9028Ala	142.0	0.0	.		176.0	93.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	8.880	0.951423	0.18431	.	.	ENSG00000155657	ENST00000342992	T	0.41400	1.0	5.76	0.755	0.18415	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.21881	0.0527	N	0.16307	0.4	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26155	-1.0111	9	0.87932	D	0	.	0.6363	0.00802	0.308:0.1208:0.3244:0.2469	.	9028	Q8WZ42	TITIN_HUMAN	A	8101	ENSP00000343764:P8101A	ENSP00000343764:P8101A	P	-	1	0	TTN	179284175	0.913000	0.31002	0.693000	0.30195	0.889000	0.51656	0.482000	0.22276	-0.064000	0.13043	-0.169000	0.13324	CCA	.	.	.	none		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC40A1	30061	hgsc.bcm.edu	37	2	190428539	190428539	+	Silent	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr2:190428539T>A	ENST00000261024.2	-	7	1599	c.1173A>T	c.(1171-1173)gtA>gtT	p.V391V		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	391					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			CAGGCATGAATACAGAGATCA	0.453																																					p.V391V		Atlas-SNP	.											.	SLC40A1	51	.	0			c.A1173T						PASS	.						84.0	78.0	80.0					2																	190428539		2203	4300	6503	SO:0001819	synonymous_variant	30061	exon7			CATGAATACAGAG	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1173A>T	chr2.hg19:g.190428539T>A		119.0	0.0	.		117.0	25.0	.	NM_014585	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Silent	SNP	ENST00000261024.2	hg19	CCDS2299.1																																																																																			.	.	.	none		0.453	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		
FGD5	152273	hgsc.bcm.edu	37	3	14861143	14861143	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr3:14861143G>A	ENST00000285046.5	+	1	675	c.565G>A	c.(565-567)Gtc>Atc	p.V189I	FGD5_ENST00000543601.1_5'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	189	Glu-rich.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						TGGAGAGGGGGTCTTCCAGAG	0.637																																					p.V189I		Atlas-SNP	.											.	FGD5	248	.	0			c.G565A						PASS	.						32.0	41.0	38.0					3																	14861143		692	1591	2283	SO:0001583	missense	152273	exon1			GAGGGGGTCTTCC	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.565G>A	chr3.hg19:g.14861143G>A	ENSP00000285046:p.Val189Ile	101.0	0.0	.		125.0	51.0	.	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	hg19	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	G	9.096	1.003024	0.19121	.	.	ENSG00000154783	ENST00000285046	T	0.75260	-0.92	5.21	-1.04	0.10068	.	2.198090	0.02044	N	0.049557	T	0.53061	0.1773	N	0.12182	0.205	0.09310	N	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.29822	-0.9999	10	0.33940	T	0.23	-4.0	1.0228	0.01521	0.3558:0.155:0.3405:0.1487	.	189	Q6ZNL6	FGD5_HUMAN	I	189	ENSP00000285046:V189I	ENSP00000285046:V189I	V	+	1	0	FGD5	14836147	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.344000	0.19962	-0.288000	0.09051	0.591000	0.81541	GTC	.	.	.	none		0.637	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
TRANK1	9881	hgsc.bcm.edu	37	3	36898563	36898563	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr3:36898563C>G	ENST00000429976.2	-	12	2765	c.2518G>C	c.(2518-2520)Gga>Cga	p.G840R	TRANK1_ENST00000428977.2_Missense_Mutation_p.G290R|TRANK1_ENST00000301807.6_Missense_Mutation_p.G290R	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	840							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TGGATGCTTCCTTTCAGGTGC	0.537																																					p.G840R		Atlas-SNP	.											.	TRANK1	398	.	0			c.G2518C						PASS	.						60.0	59.0	59.0					3																	36898563		1986	4166	6152	SO:0001583	missense	9881	exon12			TGCTTCCTTTCAG	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.2518G>C	chr3.hg19:g.36898563C>G	ENSP00000416168:p.Gly840Arg	80.0	0.0	.		62.0	22.0	.	NM_014831	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	hg19	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584939	0.65992	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.30182	1.54;1.95;1.54	5.51	5.51	0.81932	.	0.099482	0.44688	D	0.000427	T	0.38348	0.1037	N	0.24115	0.695	0.39623	D	0.970059	D	0.71674	0.998	D	0.66716	0.946	T	0.07673	-1.0760	10	0.25106	T	0.35	.	14.6176	0.68560	0.1457:0.8542:0.0:0.0	.	840	O15050	TRNK1_HUMAN	R	290;840;290	ENSP00000416826:G290R;ENSP00000416168:G840R;ENSP00000301807:G290R	ENSP00000301807:G290R	G	-	1	0	TRANK1	36873567	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.438000	0.44837	2.768000	0.95171	0.561000	0.74099	GGA	.	.	.	none		0.537	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
DNAH1	25981	hgsc.bcm.edu	37	3	52422336	52422336	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr3:52422336G>C	ENST00000420323.2	+	57	9418	c.9157G>C	c.(9157-9159)Gtg>Ctg	p.V3053L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3053	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGCCAAGGCCGTGGAGCCCAA	0.652																																					p.V3053L		Atlas-SNP	.											.	DNAH1	534	.	0			c.G9157C						PASS	.						39.0	42.0	41.0					3																	52422336		2070	4193	6263	SO:0001583	missense	25981	exon57			AAGGCCGTGGAGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.9157G>C	chr3.hg19:g.52422336G>C	ENSP00000401514:p.Val3053Leu	80.0	0.0	.		91.0	40.0	.	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163685	0.78226	.	.	ENSG00000114841	ENST00000420323	T	0.79454	-1.27	4.29	4.29	0.51040	.	0.000000	0.56097	D	0.000038	D	0.90577	0.7046	M	0.93808	3.46	0.53688	D	0.999974	D	0.71674	0.998	D	0.68943	0.961	D	0.93448	0.6799	10	0.87932	D	0	.	16.9513	0.86246	0.0:0.0:1.0:0.0	.	3053	C9JXH6	.	L	3053	ENSP00000401514:V3053L	ENSP00000401514:V3053L	V	+	1	0	DNAH1	52397376	1.000000	0.71417	0.996000	0.52242	0.906000	0.53458	6.903000	0.75703	2.229000	0.72834	0.561000	0.74099	GTG	.	.	.	none		0.652	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
OSBPL11	114885	hgsc.bcm.edu	37	3	125266348	125266348	+	Silent	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr3:125266348T>C	ENST00000296220.5	-	10	2032	c.1743A>G	c.(1741-1743)gtA>gtG	p.V581V		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	581					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						CACCCAGTTCTACCCAAGGAA	0.438																																					p.V581V		Atlas-SNP	.											.	OSBPL11	64	.	0			c.A1743G						PASS	.						137.0	125.0	129.0					3																	125266348		2203	4300	6503	SO:0001819	synonymous_variant	114885	exon10			CAGTTCTACCCAA	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.1743A>G	chr3.hg19:g.125266348T>C		136.0	0.0	.		129.0	67.0	.	NM_022776	A8K9I7	Silent	SNP	ENST00000296220.5	hg19	CCDS3033.1																																																																																			.	.	.	none		0.438	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
TRIM42	287015	hgsc.bcm.edu	37	3	140397260	140397260	+	Silent	SNP	C	C	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr3:140397260C>T	ENST00000286349.3	+	1	380	c.189C>T	c.(187-189)tgC>tgT	p.C63C		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	63	Cys-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCCCCAACTGCCATTGGTGTT	0.557																																					p.C63C		Atlas-SNP	.											.	TRIM42	143	.	0			c.C189T						PASS	.						134.0	110.0	118.0					3																	140397260		2203	4300	6503	SO:0001819	synonymous_variant	287015	exon1			CAACTGCCATTGG	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.189C>T	chr3.hg19:g.140397260C>T		82.0	0.0	.		109.0	51.0	.	NM_152616	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	hg19	CCDS3113.1																																																																																			.	.	.	none		0.557	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
PLD1	5337	hgsc.bcm.edu	37	3	171362716	171362716	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr3:171362716T>C	ENST00000351298.4	-	22	2653	c.2527A>G	c.(2527-2529)Atg>Gtg	p.M843V	PLD1_ENST00000340989.4_Missense_Mutation_p.M843V|PLD1_ENST00000356327.5_Missense_Mutation_p.M805V|PLD1_ENST00000342215.6_3'UTR	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	843	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TTGAAGTGCATGATTGCCTGT	0.463																																					p.M843V	NSCLC(149;2174 3517 34058)	Atlas-SNP	.											.	PLD1	134	.	0			c.A2527G						PASS	.						124.0	113.0	117.0					3																	171362716		2203	4300	6503	SO:0001583	missense	5337	exon22			AGTGCATGATTGC	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.2527A>G	chr3.hg19:g.171362716T>C	ENSP00000342793:p.Met843Val	75.0	0.0	.		86.0	19.0	.	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	hg19	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279208	0.80692	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000340989	T;T;T	0.34859	1.34;1.34;1.34	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.56202	0.1969	M	0.64567	1.98	0.80722	D	1	P;P;P	0.50819	0.855;0.937;0.939	P;P;D	0.64877	0.644;0.864;0.93	T	0.55995	-0.8052	10	0.51188	T	0.08	-36.3673	15.0031	0.71489	0.0:0.0:0.0:1.0	.	843;828;843	Q13393-4;Q59EA4;Q13393	.;.;PLD1_HUMAN	V	805;843;843	ENSP00000348681:M805V;ENSP00000342793:M843V;ENSP00000340326:M843V	ENSP00000340326:M843V	M	-	1	0	PLD1	172845410	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	7.609000	0.82925	2.194000	0.70268	0.533000	0.62120	ATG	.	.	.	none		0.463	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
MUC20	200958	hgsc.bcm.edu	37	3	195453023	195453023	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr3:195453023A>G	ENST00000447234.2	+	2	1675	c.1549A>G	c.(1549-1551)Acc>Gcc	p.T517A	MUC20_ENST00000436408.1_Missense_Mutation_p.T517A|MUC20_ENST00000320736.6_Missense_Mutation_p.T346A|MUC20_ENST00000445522.2_Missense_Mutation_p.T482A	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	517	Involved in oligomerization.		Missing. {ECO:0000269|PubMed:14702039}.		activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CGGGGCCACGACCCTCAGTGG	0.582																																					p.T346A		Atlas-SNP	.											.	MUC20	84	.	0			c.A1036G						PASS	.						56.0	53.0	54.0					3																	195453023		2122	4218	6340	SO:0001583	missense	200958	exon3			GCCACGACCCTCA	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1549A>G	chr3.hg19:g.195453023A>G	ENSP00000414350:p.Thr517Ala	234.0	0.0	.		283.0	109.0	.	NM_152673	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	ENST00000447234.2	hg19		.	.	.	.	.	.	.	.	.	.	A	12.67	2.008608	0.35415	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.13778	2.98;2.98;3.15;2.56	3.97	-3.15	0.05233	.	0.867446	0.09841	N	0.748862	T	0.07954	0.0199	L	0.34521	1.04	0.09310	N	1	P	0.35507	0.506	B	0.31812	0.136	T	0.23119	-1.0197	10	0.48119	T	0.1	0.2299	4.3567	0.11181	0.4003:0.0:0.4259:0.1738	.	346	E9PH32	.	A	517;346;517;482	ENSP00000414350:T517A;ENSP00000325431:T346A;ENSP00000396774:T517A;ENSP00000405629:T482A	ENSP00000325431:T346A	T	+	1	0	MUC20	196938694	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.788000	0.01763	-0.716000	0.04962	0.421000	0.28195	ACC	.	.	.	none		0.582	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
TADA2B	93624	hgsc.bcm.edu	37	4	7056602	7056602	+	Silent	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr4:7056602T>C	ENST00000310074.7	+	2	1273	c.1084T>C	c.(1084-1086)Tta>Cta	p.L362L	TADA2B_ENST00000512388.1_Silent_p.L287L|TADA2B_ENST00000515646.1_Silent_p.L270L	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	362					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						CTGCAGCTCTTTAAACTTGAG	0.537																																					p.L362L		Atlas-SNP	.											.	TADA2B	29	.	0			c.T1084C						PASS	.						70.0	74.0	73.0					4																	7056602		1944	4140	6084	SO:0001819	synonymous_variant	93624	exon2			AGCTCTTTAAACT	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.1084T>C	chr4.hg19:g.7056602T>C		132.0	0.0	.		102.0	44.0	.	NM_152293	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Silent	SNP	ENST00000310074.7	hg19	CCDS47007.1																																																																																			.	.	.	none		0.537	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293	
MOB1B	92597	hgsc.bcm.edu	37	4	71768265	71768265	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr4:71768265G>T	ENST00000309395.2	+	1	213	c.12G>T	c.(10-12)ttG>ttT	p.L4F	MOB1B_ENST00000396051.2_5'UTR|MOB1B_ENST00000511449.1_3'UTR	NM_001244766.1|NM_173468.3	NP_001231695.1|NP_775739.1	Q7L9L4	MOB1B_HUMAN	MOB kinase activator 1B	4					hippo signaling (GO:0035329)|positive regulation of phosphorylation (GO:0042327)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	kinase activator activity (GO:0019209)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)										TGAGCTTCTTGTTGTGAGTAG	0.726																																					p.L4F		Atlas-SNP	.											.	.	.	.	0			c.G12T						PASS	.						9.0	10.0	10.0					4																	71768265		2154	4235	6389	SO:0001583	missense	92597	exon1			CTTCTTGTTGTGA	BC038112	CCDS34002.1, CCDS58903.1	4q13.3	2011-09-28	2011-09-28	2011-09-27	ENSG00000173542	ENSG00000173542		"""MOB kinase activators"""	29801	protein-coding gene	gene with protein product	"""Mob4A protein"""	609282	"""MOB1, Mps One Binder kinase activator-like 1A (yeast)"", ""MOB1 Mps One Binder homolog B (yeast)"""	MOBKL1A		15067004	Standard	NM_173468		Approved	MOB4A	uc003hfw.3	Q7L9L4	OTTHUMG00000160844	ENST00000309395.2:c.12G>T	chr4.hg19:g.71768265G>T	ENSP00000310189:p.Leu4Phe	52.0	0.0	.		36.0	10.0	.	NM_001244767	B2R8U6|B4DRY3|Q8IY23	Missense_Mutation	SNP	ENST00000309395.2	hg19	CCDS34002.1	.	.	.	.	.	.	.	.	.	.	G	9.947	1.219208	0.22373	.	.	ENSG00000173542	ENST00000309395	.	.	.	3.97	2.23	0.28157	.	0.780131	0.11880	N	0.520563	T	0.16642	0.0400	N	0.01228	-0.945	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.12837	0.008;0.001	T	0.10451	-1.0629	9	0.11182	T	0.66	.	6.3657	0.21453	0.2295:0.0:0.7705:0.0	.	4;4	Q7L9L4;B3KSH6	MOB1B_HUMAN;.	F	4	.	ENSP00000310189:L4F	L	+	3	2	MOBKL1A	71987129	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	0.824000	0.27379	0.450000	0.26774	0.491000	0.48974	TTG	.	.	.	none		0.726	MOB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362634.1	NM_173468	
PRDM5	11107	hgsc.bcm.edu	37	4	121702315	121702315	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr4:121702315G>A	ENST00000264808.3	-	12	1666	c.1426C>T	c.(1426-1428)Ctt>Ttt	p.L476F	PRDM5_ENST00000428209.2_Missense_Mutation_p.L445F|PRDM5_ENST00000515109.1_Missense_Mutation_p.L445F	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	476					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TGACTTCTAAGCACTGAAGGT	0.353																																					p.L476F		Atlas-SNP	.											.	PRDM5	76	.	0			c.C1426T						PASS	.						157.0	137.0	143.0					4																	121702315		2203	4300	6503	SO:0001583	missense	11107	exon12			TTCTAAGCACTGA	AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.1426C>T	chr4.hg19:g.121702315G>A	ENSP00000264808:p.Leu476Phe	94.0	0.0	.		89.0	22.0	.	NM_018699	Q0VAI9|Q0VAJ0|Q6NXQ7	Missense_Mutation	SNP	ENST00000264808.3	hg19	CCDS3716.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762993	0.89932	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	T;T;T	0.52057	0.68;0.68;0.68	5.9	5.9	0.94986	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.71384	0.3333	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.997	T	0.71991	-0.4425	10	0.66056	D	0.02	-23.0771	20.2704	0.98474	0.0:0.0:1.0:0.0	.	445;445;476	Q0VAI9;Q9NQX1-2;Q9NQX1	.;.;PRDM5_HUMAN	F	476;445;445	ENSP00000264808:L476F;ENSP00000422309:L445F;ENSP00000404832:L445F	ENSP00000264808:L476F	L	-	1	0	PRDM5	121921765	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.675000	0.98638	2.793000	0.96121	0.591000	0.81541	CTT	.	.	.	none		0.353	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2		
ZNF622	90441	hgsc.bcm.edu	37	5	16463272	16463272	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:16463272T>C	ENST00000308683.2	-	3	1120	c.994A>G	c.(994-996)Aag>Gag	p.K332E		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	332					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						GTGAAGAGCTTACAGTGGCTT	0.413																																					p.K332E		Atlas-SNP	.											.	ZNF622	49	.	0			c.A994G						PASS	.						185.0	186.0	186.0					5																	16463272		2203	4300	6503	SO:0001583	missense	90441	exon3			AGAGCTTACAGTG	AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.994A>G	chr5.hg19:g.16463272T>C	ENSP00000310042:p.Lys332Glu	287.0	0.0	.		253.0	84.0	.	NM_033414		Missense_Mutation	SNP	ENST00000308683.2	hg19	CCDS3886.1	.	.	.	.	.	.	.	.	.	.	T	32	5.118738	0.94385	.	.	ENSG00000173545	ENST00000308683	T	0.46451	0.87	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.73179	0.3554	M	0.92691	3.335	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.80386	-0.1404	10	0.72032	D	0.01	-5.2815	16.2879	0.82732	0.0:0.0:0.0:1.0	.	332	Q969S3	ZN622_HUMAN	E	332	ENSP00000310042:K332E	ENSP00000310042:K332E	K	-	1	0	ZNF622	16516272	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	7.988000	0.88194	2.242000	0.73789	0.533000	0.62120	AAG	.	.	.	none		0.413	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	NM_033414	
MAN2A1	4124	hgsc.bcm.edu	37	5	109155930	109155930	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:109155930A>C	ENST00000261483.4	+	15	3390	c.2338A>C	c.(2338-2340)Act>Cct	p.T780P		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	780					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GCAAATGATGACTAAAGAAGA	0.313																																					p.T780P		Atlas-SNP	.											.	MAN2A1	136	.	0			c.A2338C						PASS	.						57.0	56.0	56.0					5																	109155930		2202	4300	6502	SO:0001583	missense	4124	exon15			ATGATGACTAAAG		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.2338A>C	chr5.hg19:g.109155930A>C	ENSP00000261483:p.Thr780Pro	50.0	0.0	.		43.0	19.0	.	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	hg19	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	A	10.27	1.303856	0.23736	.	.	ENSG00000112893	ENST00000261483	T	0.78707	-1.2	5.97	3.56	0.40772	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.633028	0.16350	N	0.218261	T	0.72260	0.3438	M	0.61703	1.905	0.09310	N	1	B	0.11235	0.004	B	0.18263	0.021	T	0.58999	-0.7536	10	0.30078	T	0.28	-7.0965	8.6679	0.34132	0.8031:0.1298:0.067:0.0	.	780	Q16706	MA2A1_HUMAN	P	780	ENSP00000261483:T780P	ENSP00000261483:T780P	T	+	1	0	MAN2A1	109183829	0.010000	0.17322	0.110000	0.21437	0.981000	0.71138	2.300000	0.43620	0.495000	0.27882	-0.256000	0.11100	ACT	.	.	.	none		0.313	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
SNCAIP	9627	hgsc.bcm.edu	37	5	121758736	121758736	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:121758736G>A	ENST00000261368.8	+	4	566	c.304G>A	c.(304-306)Gtg>Atg	p.V102M	SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000379538.3_Intron|SNCAIP_ENST00000503116.2_Missense_Mutation_p.V149M|SNCAIP_ENST00000379533.2_Missense_Mutation_p.V149M|SNCAIP_ENST00000504884.2_Intron|SNCAIP_ENST00000261367.7_Missense_Mutation_p.V149M|SNCAIP_ENST00000379536.2_Missense_Mutation_p.V102M|SNCAIP_ENST00000414317.2_Intron	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	102					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GAACCAGAAAGTGGTTGAGTA	0.552																																					p.V102M		Atlas-SNP	.											.	SNCAIP	308	.	0			c.G304A						PASS	.						55.0	60.0	58.0					5																	121758736		2203	4300	6503	SO:0001583	missense	9627	exon4			CAGAAAGTGGTTG	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.304G>A	chr5.hg19:g.121758736G>A	ENSP00000261368:p.Val102Met	224.0	0.0	.		186.0	62.0	.	NM_005460	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	hg19	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280488	0.59758	.	.	ENSG00000064692	ENST00000514467;ENST00000506272;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000261367;ENST00000503116	T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.53	2.75	0.32379	.	0.885835	0.09030	U	0.858812	T	0.23094	0.0558	N	0.24115	0.695	0.58432	D	0.999994	B;B;B;B	0.32526	0.257;0.374;0.374;0.257	B;B;B;B	0.33521	0.049;0.165;0.165;0.049	T	0.02320	-1.1177	10	0.66056	D	0.02	.	8.6976	0.34305	0.1371:0.1257:0.7373:0.0	.	102;149;149;102	D6R9G8;Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5	.;.;.;SNCAP_HUMAN	M	102;149;102;102;149;102;149;149	ENSP00000427090:V102M;ENSP00000426551:V149M;ENSP00000422106:V102M;ENSP00000261368:V102M;ENSP00000368848:V149M;ENSP00000368851:V102M;ENSP00000261367:V149M;ENSP00000423199:V149M	ENSP00000261367:V149M	V	+	1	0	SNCAIP	121786635	0.996000	0.38824	0.051000	0.19133	0.975000	0.68041	3.922000	0.56462	0.294000	0.22547	0.561000	0.74099	GTG	.	.	.	none		0.552	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
SIL1	64374	hgsc.bcm.edu	37	5	138378379	138378379	+	Missense_Mutation	SNP	G	G	T	rs55660322		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:138378379G>T	ENST00000394817.2	-	5	522	c.383C>A	c.(382-384)tCt>tAt	p.S128Y	CTB-46B19.2_ENST00000512875.2_RNA|SIL1_ENST00000265195.5_Missense_Mutation_p.S128Y|SIL1_ENST00000509534.1_Missense_Mutation_p.S135Y	NM_022464.4	NP_071909.1	Q9H173	SIL1_HUMAN	SIL1 nucleotide exchange factor	128	Interaction with HSPA5 and localization to the endoplasmic reticulum. {ECO:0000250}.				intracellular protein transport (GO:0006886)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAGATCCTGAGATGTGTAGGT	0.463									Marinesco-Sjgren syndrome																												p.S128Y		Atlas-SNP	.											.	SIL1	31	.	0			c.C383A						PASS	.						221.0	200.0	207.0					5																	138378379		2203	4300	6503	SO:0001583	missense	64374	exon6	Familial Cancer Database	Marinesco-Sjogren syndrome	TCCTGAGATGTGT	AK075177	CCDS4209.1	5q31	2013-08-21	2013-08-21		ENSG00000120725	ENSG00000120725			24624	protein-coding gene	gene with protein product		608005	"""Marinesco-Sjogren syndrome"", ""SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)"""	MSS		11101517, 12356756, 16282977	Standard	XM_006714671		Approved	BAP, ULG5	uc003ldp.3	Q9H173	OTTHUMG00000129226	ENST00000394817.2:c.383C>A	chr5.hg19:g.138378379G>T	ENSP00000378294:p.Ser128Tyr	60.0	0.0	.		62.0	23.0	.	NM_001037633	D3DQC2|Q8N2L3	Missense_Mutation	SNP	ENST00000394817.2	hg19	CCDS4209.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943178	0.73672	.	.	ENSG00000120725	ENST00000394817;ENST00000265195;ENST00000537511;ENST00000509534;ENST00000508639	T;T;T;T	0.72051	-0.61;-0.61;-0.62;-0.22	4.97	4.97	0.65823	.	0.265230	0.39759	N	0.001272	T	0.76292	0.3967	L	0.56769	1.78	0.42774	D	0.993843	D;D	0.62365	0.991;0.991	P;P	0.54544	0.755;0.676	T	0.78695	-0.2104	10	0.66056	D	0.02	-14.7438	13.924	0.63950	0.0:0.0:1.0:0.0	.	135;128	D6REA1;Q9H173	.;SIL1_HUMAN	Y	128;128;107;135;128	ENSP00000378294:S128Y;ENSP00000265195:S128Y;ENSP00000426858:S135Y;ENSP00000427371:S128Y	ENSP00000265195:S128Y	S	-	2	0	SIL1	138406278	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.244000	0.65400	2.746000	0.94184	0.555000	0.69702	TCT	.	.	.	alt		0.463	SIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251319.1	NM_022464	
PCDHGA2	56113	hgsc.bcm.edu	37	5	140720354	140720354	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:140720354T>C	ENST00000394576.2	+	1	1816	c.1816T>C	c.(1816-1818)Tac>Cac	p.Y606H	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	606	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGCTGTCTTACCACCTGCT	0.692																																					p.Y606H		Atlas-SNP	.											.	PCDHGA2	205	.	0			c.T1816C						PASS	.						60.0	70.0	66.0					5																	140720354		2203	4299	6502	SO:0001583	missense	56113	exon1			CTGTCTTACCACC	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1816T>C	chr5.hg19:g.140720354T>C	ENSP00000378077:p.Tyr606His	56.0	0.0	.		67.0	19.0	.	NM_018915	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	hg19	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	15.58	2.874786	0.51695	.	.	ENSG00000081853	ENST00000394576	T	0.62941	-0.01	5.14	5.14	0.70334	Cadherin (4);Cadherin-like (1);	0.000000	0.37669	U	0.001992	D	0.88581	0.6475	H	0.99609	4.655	0.33366	D	0.573012	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.95385	0.8476	10	0.87932	D	0	.	14.99	0.71381	0.0:0.0:0.0:1.0	.	606;606	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	H	606	ENSP00000378077:Y606H	ENSP00000378077:Y606H	Y	+	1	0	PCDHGA2	140700538	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	7.952000	0.87827	2.093000	0.63338	0.397000	0.26171	TAC	.	.	.	none		0.692	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
POU4F3	5459	hgsc.bcm.edu	37	5	145719332	145719332	+	Silent	SNP	C	C	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:145719332C>T	ENST00000230732.4	+	2	431	c.342C>T	c.(340-342)ggC>ggT	p.G114G	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	114					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCACCAGGGCCTCGAAGGCG	0.662																																					p.G114G		Atlas-SNP	.											.	POU4F3	47	.	0			c.C342T						PASS	.						113.0	99.0	104.0					5																	145719332		2203	4299	6502	SO:0001819	synonymous_variant	5459	exon2			CCAGGGCCTCGAA	U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.342C>T	chr5.hg19:g.145719332C>T		50.0	0.0	.		46.0	21.0	.	NM_002700	O60557|Q2M3F8	Silent	SNP	ENST00000230732.4	hg19	CCDS4281.1																																																																																			.	.	.	none		0.662	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251887.2	NM_002700	
DUSP1	1843	hgsc.bcm.edu	37	5	172196606	172196606	+	Silent	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:172196606G>T	ENST00000239223.3	-	3	947	c.705C>A	c.(703-705)tcC>tcA	p.S235S	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	235	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		CGTTGAACCAGGAGCTGATGT	0.493																																					p.S235S		Atlas-SNP	.											.	DUSP1	27	.	0			c.C705A						PASS	.						217.0	196.0	203.0					5																	172196606		2203	4300	6503	SO:0001819	synonymous_variant	1843	exon3			GAACCAGGAGCTG	X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.705C>A	chr5.hg19:g.172196606G>T		92.0	0.0	.		53.0	18.0	.	NM_004417	D3DQL9|Q2V508	Silent	SNP	ENST00000239223.3	hg19	CCDS4380.1																																																																																			.	.	.	none		0.493	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252943.3	NM_004417	
MOG	4340	hgsc.bcm.edu	37	6	29634002	29634002	+	Silent	SNP	T	T	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr6:29634002T>G	ENST00000376917.3	+	3	739	c.510T>G	c.(508-510)acT>acG	p.T170T	MOG_ENST00000396701.2_Silent_p.T170T|MOG_ENST00000396704.3_Silent_p.T170T|MOG_ENST00000416766.2_Intron|MOG_ENST00000483013.1_Silent_p.T54T|MOG_ENST00000533330.2_3'UTR|MOG_ENST00000490427.1_Silent_p.T54T|MOG_ENST00000376894.4_Silent_p.T170T|MOG_ENST00000494692.1_Silent_p.T170T|MOG_ENST00000376898.3_Silent_p.T170T|MOG_ENST00000376902.3_3'UTR|MOG_ENST00000376888.2_Silent_p.T54T|MOG_ENST00000376891.4_Silent_p.T170T|MOG_ENST00000431798.2_Silent_p.T170T	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein	170					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						TGCAGATCACTGTTGGCCTCA	0.542																																					p.T170T		Atlas-SNP	.											.	MOG	47	.	0			c.T510G						PASS	.						256.0	224.0	236.0					6																	29634002		1511	2709	4220	SO:0001819	synonymous_variant	4340	exon3			GATCACTGTTGGC		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099	ENST00000376917.3:c.510T>G	chr6.hg19:g.29634002T>G		56.0	0.0	.		46.0	20.0	.	NM_001008229	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	ENST00000376917.3	hg19	CCDS34370.1																																																																																			.	.	.	none		0.542	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433	
HLA-V	352962	hgsc.bcm.edu	37	6	29759857	29759857	+	RNA	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr6:29759857G>T	ENST00000457107.1	+	0	0									major histocompatibility complex, class I, V (pseudogene)																		CCCAACCTGTGTCGGGTCCTT	0.592																																					p.V25F		Atlas-SNP	.											.	.	.	.	0			c.G73T						PASS	.																																					0	exon1			ACCTGTGTCGGGT	M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		chr6.hg19:g.29759857G>T		10.0	0.0	.		9.0	7.0	.	NM_001207043		Missense_Mutation	SNP	ENST00000457107.1	hg19																																																																																				.	.	.	none		0.592	HLA-V-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000105231.1	NG_002729	
MDC1	9656	hgsc.bcm.edu	37	6	30681674	30681674	+	Silent	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr6:30681674G>C	ENST00000376406.3	-	3	1070	c.423C>G	c.(421-423)tcC>tcG	p.S141S	MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Silent_p.S141S|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	141	Interaction with CHEK2.|Interaction with the MRN complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						GAGGGCCCCGGGAGACAAAGG	0.562								Other conserved DNA damage response genes																													p.S141S		Atlas-SNP	.											.	MDC1	218	.	0			c.C423G						PASS	.						65.0	75.0	72.0					6																	30681674		1511	2709	4220	SO:0001819	synonymous_variant	9656	exon3			GCCCCGGGAGACA	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.423C>G	chr6.hg19:g.30681674G>C		144.0	0.0	.		109.0	47.0	.	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	hg19	CCDS34384.1																																																																																			.	.	.	none		0.562	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
MAPK14	1432	hgsc.bcm.edu	37	6	36027090	36027091	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr6:36027090_36027091AC>CA	ENST00000229794.4	+	3	659_660	c.271_272AC>CA	c.(271-273)ACa>CAa	p.T91Q	MAPK14_ENST00000229795.3_Missense_Mutation_p.T91Q|MAPK14_ENST00000468133.1_Missense_Mutation_p.T14Q|MAPK14_ENST00000310795.4_Missense_Mutation_p.T91Q	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14	91	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						GGACGTTTTTACACCTGCAAGG	0.337																																					p.T91P|p.T91K	Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)	Atlas-SNP	.											.	MAPK14	75	.	0			c.A271C|c.C272A						PASS	.																																			SO:0001583	missense	1432	exon3			GTTTTTACACCTG|TTTTTACACCTGC	L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	Exception_encountered	chr6.hg19:g.36027090_36027091delinsCA	ENSP00000229794:p.Thr91Gln	22.0	0.0	.		21.0	10.0	.	NM_139012	A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Missense_Mutation	SNP	ENST00000229794.4	hg19	CCDS4816.1																																																																																			.	.	.	none		0.337	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357450.1	NM_001315	
ZNF292	23036	hgsc.bcm.edu	37	6	87967887	87967887	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr6:87967887A>G	ENST00000369577.3	+	8	4583	c.4540A>G	c.(4540-4542)Aca>Gca	p.T1514A	ZNF292_ENST00000339907.4_Missense_Mutation_p.T1509A	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1514						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TCATGTTTCAACAGGTTGTGT	0.448																																					p.T1514A		Atlas-SNP	.											.	ZNF292	479	.	0			c.A4540G						PASS	.						41.0	41.0	41.0					6																	87967887		1995	4156	6151	SO:0001583	missense	23036	exon8			GTTTCAACAGGTT	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.4540A>G	chr6.hg19:g.87967887A>G	ENSP00000358590:p.Thr1514Ala	104.0	0.0	.		57.0	19.0	.	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	hg19	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	A	7.769	0.707088	0.15239	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07114	3.22;3.23	5.87	-8.87	0.00792	.	0.913634	0.09402	N	0.806994	T	0.01061	0.0035	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47761	-0.9092	10	0.54805	T	0.06	.	1.7259	0.02921	0.22:0.2477:0.3344:0.1979	.	1514	O60281	ZN292_HUMAN	A	1514;1509	ENSP00000358590:T1514A;ENSP00000342847:T1509A	ENSP00000342847:T1509A	T	+	1	0	ZNF292	88024606	0.000000	0.05858	0.004000	0.12327	0.911000	0.54048	-0.943000	0.03917	-1.272000	0.02427	-0.250000	0.11733	ACA	.	.	.	none		0.448	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
CASP8AP2	9994	hgsc.bcm.edu	37	6	90575693	90575693	+	RNA	SNP	C	C	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr6:90575693C>G	ENST00000551025.1	+	0	4121									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CCAAATTCAGCTCATTCTACC	0.289																																					p.A895G	Colon(187;1656 2025 17045 31481 39901)	Atlas-SNP	.											.	CASP8AP2	108	.	0			c.C2684G						PASS	.						16.0	15.0	16.0					6																	90575693		1803	4056	5859			9994	exon8			ATTCAGCTCATTC	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		chr6.hg19:g.90575693C>G		199.0	0.0	.		173.0	50.0	.	NM_001137667		Missense_Mutation	SNP	ENST00000551025.1	hg19																																																																																				.	.	.	none		0.289	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
HOXA7	3204	hgsc.bcm.edu	37	7	27194784	27194784	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr7:27194784T>C	ENST00000242159.3	-	2	570	c.437A>G	c.(436-438)gAg>gGg	p.E146G	HOXA7_ENST00000523796.2_5'UTR|HOXA-AS3_ENST00000524304.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7	146					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						GAACTCCTTCTCCAGCTCCAG	0.597																																					p.E146G		Atlas-SNP	.											.	HOXA7	34	.	0			c.A437G						PASS	.						100.0	98.0	98.0					7																	27194784		2203	4300	6503	SO:0001583	missense	3204	exon2			TCCTTCTCCAGCT		CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217	ENST00000242159.3:c.437A>G	chr7.hg19:g.27194784T>C	ENSP00000242159:p.Glu146Gly	66.0	0.0	.		72.0	23.0	.	NM_006896	A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	Missense_Mutation	SNP	ENST00000242159.3	hg19	CCDS5408.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440700	0.83993	.	.	ENSG00000122592	ENST00000242159	D	0.97831	-4.56	5.0	5.0	0.66597	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99127	0.9699	H	0.97186	3.955	0.80722	D	1	D	0.54207	0.965	D	0.69142	0.962	D	0.99078	1.0836	10	0.72032	D	0.01	.	14.697	0.69129	0.0:0.0:0.0:1.0	.	146	P31268	HXA7_HUMAN	G	146	ENSP00000242159:E146G	ENSP00000242159:E146G	E	-	2	0	HOXA7	27161309	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	7.904000	0.87408	1.887000	0.54652	0.379000	0.24179	GAG	.	.	.	none		0.597	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358695.1		
PCLO	27445	hgsc.bcm.edu	37	7	82545774	82545774	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr7:82545774C>T	ENST00000333891.9	-	7	11865	c.11528G>A	c.(11527-11529)aGa>aAa	p.R3843K	PCLO_ENST00000423517.2_Missense_Mutation_p.R3843K|PCLO_ENST00000437081.1_Missense_Mutation_p.R563K	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCGGGTTGGTCTTGTGCTACT	0.473																																					p.R3843K		Atlas-SNP	.											.	PCLO	1506	.	0			c.G11528A						PASS	.						303.0	287.0	292.0					7																	82545774		2036	4183	6219	SO:0001583	missense	27445	exon7			GTTGGTCTTGTGC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11528G>A	chr7.hg19:g.82545774C>T	ENSP00000334319:p.Arg3843Lys	171.0	0.0	.		204.0	42.0	.	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.060110	0.55432	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.31769	1.48;1.5	5.67	5.67	0.87782	.	.	.	.	.	T	0.59390	0.2190	M	0.73962	2.25	0.58432	D	0.99999	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.83275	0.978;0.996;0.996	T	0.61417	-0.7067	9	0.87932	D	0	.	19.7691	0.96356	0.0:1.0:0.0:0.0	.	3774;3843;3843	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	K	3843;3843;563	ENSP00000334319:R3843K;ENSP00000388393:R3843K	ENSP00000334319:R3843K	R	-	2	0	PCLO	82383710	1.000000	0.71417	0.896000	0.35187	0.120000	0.20174	7.818000	0.86416	2.689000	0.91719	0.462000	0.41574	AGA	.	.	.	none		0.473	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
UBN2	254048	hgsc.bcm.edu	37	7	138943310	138943310	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr7:138943310G>T	ENST00000473989.3	+	4	740	c.740G>T	c.(739-741)cGc>cTc	p.R247L	UBN2_ENST00000288561.8_Missense_Mutation_p.R164L	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	247						extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						CTACAGTTTCGCCAAGCTTCA	0.363																																					p.R247L		Atlas-SNP	.											.	UBN2	90	.	0			c.G740T						PASS	.						103.0	93.0	96.0					7																	138943310		1854	4090	5944	SO:0001583	missense	254048	exon4			AGTTTCGCCAAGC	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.740G>T	chr7.hg19:g.138943310G>T	ENSP00000418648:p.Arg247Leu	83.0	0.0	.		76.0	38.0	.	NM_173569	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	hg19	CCDS43655.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.450349|5.450349	0.96205|0.96205	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000483726|ENST00000486663;ENST00000473989;ENST00000288561	.|T;T;T	.|0.27256	.|1.68;1.68;1.68	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54175|0.54175	0.1842|0.1842	M|M	0.76328|0.76328	2.33|2.33	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.85130	.|0.997	T|T	0.56986|0.56986	-0.7888|-0.7888	5|10	.|0.72032	.|D	.|0.01	-7.8458|-7.8458	19.2541|19.2541	0.93938|0.93938	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|247	.|Q6ZU65	.|UBN2_HUMAN	S|L	16|70;247;164	.|ENSP00000417849:R70L;ENSP00000418648:R247L;ENSP00000288561:R164L	.|ENSP00000288561:R164L	A|R	+|+	1|2	0|0	UBN2|UBN2	138593850|138593850	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.713000|9.713000	0.98740|0.98740	2.628000|2.628000	0.89032|0.89032	0.460000|0.460000	0.39030|0.39030	GCC|CGC	.	.	.	none		0.363	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569	
GIMAP8	155038	hgsc.bcm.edu	37	7	150171317	150171317	+	Silent	SNP	C	C	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr7:150171317C>T	ENST00000307271.3	+	4	1474	c.900C>T	c.(898-900)atC>atT	p.I300I		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	300	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		AAGTTTCGATCATTGATGCTC	0.478																																					p.I300I		Atlas-SNP	.											.	GIMAP8	136	.	0			c.C900T						PASS	.						81.0	89.0	87.0					7																	150171317		2203	4300	6503	SO:0001819	synonymous_variant	155038	exon4			TTCGATCATTGAT	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.900C>T	chr7.hg19:g.150171317C>T		118.0	0.0	.		159.0	40.0	.	NM_175571		Silent	SNP	ENST00000307271.3	hg19	CCDS34777.1																																																																																			.	.	.	none		0.478	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
AGPAT6	137964	hgsc.bcm.edu	37	8	41476269	41476269	+	Silent	SNP	C	C	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr8:41476269C>A	ENST00000396987.3	+	11	2047	c.1120C>A	c.(1120-1122)Cga>Aga	p.R374R	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	374					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			GTACCTGCTGCGAATGATGAC	0.547																																					p.R374R		Atlas-SNP	.											.	AGPAT6	32	.	0			c.C1120A						PASS	.						204.0	178.0	187.0					8																	41476269		2203	4300	6503	SO:0001819	synonymous_variant	137964	exon11			CTGCTGCGAATGA	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.1120C>A	chr8.hg19:g.41476269C>A		70.0	0.0	.		66.0	25.0	.	NM_178819	Q86V89	Silent	SNP	ENST00000396987.3	hg19	CCDS6117.1																																																																																			.	.	.	none		0.547	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
OXR1	55074	hgsc.bcm.edu	37	8	107719085	107719085	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr8:107719085A>G	ENST00000442977.2	+	8	1438	c.1339A>G	c.(1339-1341)Aat>Gat	p.N447D	OXR1_ENST00000497705.1_Missense_Mutation_p.N379D|OXR1_ENST00000517566.2_Missense_Mutation_p.N446D|OXR1_ENST00000312046.6_Missense_Mutation_p.N439D|OXR1_ENST00000531443.1_Missense_Mutation_p.N446D|OXR1_ENST00000445937.1_Missense_Mutation_p.N446D|OXR1_ENST00000452423.2_5'UTR	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	447					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			TATAAAAGGTAATTCAGACCA	0.338																																					p.N447D		Atlas-SNP	.											.	OXR1	190	.	0			c.A1339G						PASS	.						70.0	71.0	70.0					8																	107719085		2203	4300	6503	SO:0001583	missense	55074	exon8			AAAGGTAATTCAG	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.1339A>G	chr8.hg19:g.107719085A>G	ENSP00000405424:p.Asn447Asp	140.0	0.0	.		139.0	59.0	.	NM_001198532	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	hg19	CCDS56548.1	.	.	.	.	.	.	.	.	.	.	A	3.501	-0.101859	0.06967	.	.	ENSG00000164830	ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977;ENST00000497705;ENST00000312046	T;T;T;T;T;T	0.22743	2.78;2.78;2.78;2.78;1.94;2.77	5.29	0.47	0.16747	.	1.123310	0.06446	N	0.726853	T	0.14098	0.0341	L	0.29908	0.895	0.09310	N	0.999999	B;B;B;B;B	0.23249	0.0;0.001;0.0;0.003;0.082	B;B;B;B;B	0.20767	0.003;0.001;0.001;0.004;0.031	T	0.35599	-0.9782	10	0.22109	T	0.4	-12.2398	5.566	0.17170	0.4857:0.1807:0.3335:0.0	.	439;447;446;379;446	Q8N573-2;Q8N573;D3HIS6;Q8N573-3;Q8N573-5	.;OXR1_HUMAN;.;.;.	D	446;446;446;447;379;439	ENSP00000402918:N446D;ENSP00000431966:N446D;ENSP00000429205:N446D;ENSP00000405424:N447D;ENSP00000431014:N379D;ENSP00000311026:N439D	ENSP00000311026:N439D	N	+	1	0	OXR1	107788261	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.254000	0.18314	0.128000	0.18479	0.482000	0.46254	AAT	.	.	.	none		0.338	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
FAM83A	84985	hgsc.bcm.edu	37	8	124195568	124195569	+	Missense_Mutation	DNP	AC	AC	CT			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr8:124195568_124195569AC>CT	ENST00000518448.1	+	2	2486_2487	c.472_473AC>CT	c.(472-474)ACt>CTt	p.T158L	FAM83A_ENST00000546351.1_Missense_Mutation_p.T158L|FAM83A_ENST00000522648.1_Missense_Mutation_p.T158L|FAM83A_ENST00000276699.6_Missense_Mutation_p.T158L|U3_ENST00000408534.1_RNA|FAM83A_ENST00000318462.6_Missense_Mutation_p.T158L|FAM83A_ENST00000536633.1_Missense_Mutation_p.T158L|RP11-539E17.5_ENST00000522383.1_RNA			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	158										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			CATCACCCGGACTAGCCAGGTA	0.594																																					p.T158P|p.T158I		Atlas-SNP	.											.	FAM83A	64	.	0			c.A472C|c.C473T						PASS	.																																			SO:0001583	missense	84985	exon1			ACCCGGACTAGCC|CCCGGACTAGCCA	BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	Exception_encountered	chr8.hg19:g.124195568_124195569delinsCT	ENSP00000428876:p.Thr158Leu	50.0|48.0	0.0	.		43.0|45.0	14.0	.	NM_032899	Q71HL2|Q8N7I1|Q96I47	Missense_Mutation	SNP	ENST00000518448.1	hg19	CCDS6340.1																																																																																			.	.	.	none		0.594	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381737.1	NM_032899	
PKN3	29941	hgsc.bcm.edu	37	9	131477477	131477477	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr9:131477477G>A	ENST00000291906.4	+	14	2072	c.1679G>A	c.(1678-1680)cGc>cAc	p.R560H	PKN3_ENST00000485301.1_3'UTR	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	560	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						CAGGACTTCCGCTGCTTAGCT	0.612																																					p.R560H		Atlas-SNP	.											PKN3,colon,carcinoma,0,1	PKN3	62	.	0			c.G1679A						PASS	.						58.0	62.0	61.0					9																	131477477		2203	4300	6503	SO:0001583	missense	29941	exon14			ACTTCCGCTGCTT	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.1679G>A	chr9.hg19:g.131477477G>A	ENSP00000291906:p.Arg560His	146.0	0.0	.		108.0	38.0	.	NM_013355	Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	hg19	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.671151	0.47781	.	.	ENSG00000160447	ENST00000291906	T	0.66280	-0.2	5.33	4.43	0.53597	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.50752	0.1634	L	0.35723	1.085	0.39701	D	0.97118	B	0.17268	0.021	B	0.17722	0.019	T	0.49969	-0.8882	9	0.48119	T	0.1	.	9.7494	0.40466	0.0949:0.0:0.9051:0.0	.	560	Q6P5Z2	PKN3_HUMAN	H	560	ENSP00000291906:R560H	ENSP00000291906:R560H	R	+	2	0	PKN3	130517298	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	1.236000	0.32683	1.255000	0.44051	0.557000	0.71058	CGC	.	.	.	none		0.612	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
RXRA	6256	hgsc.bcm.edu	37	9	137325968	137325968	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr9:137325968C>T	ENST00000481739.1	+	9	1208	c.1156C>T	c.(1156-1158)Ccg>Tcg	p.P386S	RXRA_ENST00000540193.1_Missense_Mutation_p.P289S|RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	386	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GCTCTCGAACCCGGCCGAGGT	0.652																																					p.P386S		Atlas-SNP	.											.	RXRA	52	.	0			c.C1156T						PASS	.						53.0	56.0	55.0					9																	137325968		2203	4300	6503	SO:0001583	missense	6256	exon9			TCGAACCCGGCCG	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1156C>T	chr9.hg19:g.137325968C>T	ENSP00000419692:p.Pro386Ser	46.0	0.0	.		59.0	21.0	.	NM_002957	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	hg19	CCDS35172.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315159	0.40996	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.96265	-3.96;-3.96	4.3	4.3	0.51218	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.91556	0.7333	N	0.15975	0.35	0.80722	D	1	B	0.17667	0.023	B	0.10450	0.005	D	0.87989	0.2748	10	0.33940	T	0.23	.	17.1165	0.86690	0.0:1.0:0.0:0.0	.	386	P19793	RXRA_HUMAN	S	386;289	ENSP00000419692:P386S;ENSP00000442123:P289S	ENSP00000419692:P386S	P	+	1	0	RXRA	136465789	1.000000	0.71417	0.985000	0.45067	0.978000	0.69477	7.443000	0.80521	2.102000	0.63906	0.491000	0.48974	CCG	.	.	.	none		0.652	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
SVIL	6840	hgsc.bcm.edu	37	10	29756744	29756744	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr10:29756744T>A	ENST00000355867.4	-	33	6656	c.5904A>T	c.(5902-5904)gaA>gaT	p.E1968D	PTCHD3P1_ENST00000414457.1_RNA|PTCHD3P1_ENST00000413405.1_RNA|SVIL_ENST00000375400.3_Missense_Mutation_p.E1542D|SVIL_ENST00000375398.2_Missense_Mutation_p.E1968D|PTCHD3P1_ENST00000446807.1_RNA|PTCHD3P1_ENST00000445521.1_RNA|PTCHD3P1_ENST00000455774.1_RNA|SVIL_ENST00000535393.1_Missense_Mutation_p.E882D|PTCHD3P1_ENST00000423223.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1968					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GCTCGGAGCCTTCATCACACT	0.498																																					p.E1968D		Atlas-SNP	.											.	SVIL	226	.	0			c.A5904T						PASS	.						128.0	111.0	117.0					10																	29756744		2203	4300	6503	SO:0001583	missense	6840	exon33			GGAGCCTTCATCA	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.5904A>T	chr10.hg19:g.29756744T>A	ENSP00000348128:p.Glu1968Asp	73.0	0.0	.		66.0	23.0	.	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	hg19	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.371683	0.61624	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.42	-2.88	0.05682	.	0.000000	0.85682	D	0.000000	T	0.74068	0.3668	M	0.93763	3.455	0.80722	D	1	D;D;D	0.89917	1.0;0.992;0.997	D;D;D	0.97110	1.0;0.985;0.972	T	0.76119	-0.3076	10	0.72032	D	0.01	-19.859	11.3269	0.49454	0.0:0.3744:0.0:0.6256	.	882;1542;1968	F5H2Q5;O95425-2;O95425	.;.;SVIL_HUMAN	D	1542;1968;1968;882	ENSP00000364549:E1542D;ENSP00000364547:E1968D;ENSP00000348128:E1968D;ENSP00000445472:E882D	ENSP00000348128:E1968D	E	-	3	2	SVIL	29796750	0.996000	0.38824	0.332000	0.25469	0.295000	0.27426	0.336000	0.19823	-0.671000	0.05274	-0.256000	0.11100	GAA	.	.	.	none		0.498	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
TET1	80312	hgsc.bcm.edu	37	10	70451029	70451029	+	Missense_Mutation	SNP	A	A	G	rs147755307		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr10:70451029A>G	ENST00000373644.4	+	12	6078	c.5869A>G	c.(5869-5871)Atg>Gtg	p.M1957V		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1957					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CTCTTCTCCAATGGAAGAAGA	0.542																																					p.M1957V		Atlas-SNP	.											.	TET1	255	.	0			c.A5869G						PASS	.	A	VAL/MET	0,4406		0,0,2203	116.0	102.0	107.0		5869	-1.6	0.0	10	dbSNP_134	107	1,8599	1.2+/-3.3	0,1,4299	no	missense	TET1	NM_030625.2	21	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	1957/2137	70451029	1,13005	2203	4300	6503	SO:0001583	missense	80312	exon12			TCTCCAATGGAAG	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5869A>G	chr10.hg19:g.70451029A>G	ENSP00000362748:p.Met1957Val	102.0	0.0	.		85.0	4.0	.	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.433229	0.00182	0.0	1.16E-4	ENSG00000138336	ENST00000373644	T	0.05580	3.42	5.53	-1.65	0.08291	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	2.646000	0.01051	N	0.004474	T	0.01835	0.0058	N	0.00879	-1.12	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40478	-0.9561	10	0.06236	T	0.91	.	4.764	0.13123	0.364:0.2719:0.3641:0.0	.	1957	Q8NFU7	TET1_HUMAN	V	1957	ENSP00000362748:M1957V	ENSP00000362748:M1957V	M	+	1	0	TET1	70121035	0.000000	0.05858	0.000000	0.03702	0.104000	0.19210	0.332000	0.19751	-0.345000	0.08325	-0.313000	0.08912	ATG	.	A|1.000;G|0.000	0.000	weak		0.542	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
LRRC20	55222	hgsc.bcm.edu	37	10	72083705	72083705	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr10:72083705G>C	ENST00000355790.4	-	4	791	c.314C>G	c.(313-315)tCc>tGc	p.S105C	LRRC20_ENST00000395011.1_Missense_Mutation_p.S55C|LRRC20_ENST00000373224.1_Missense_Mutation_p.S105C|LRRC20_ENST00000395010.1_Intron|LRRC20_ENST00000358141.2_Missense_Mutation_p.S55C	NM_001278212.1|NM_001278214.1|NM_207119.1	NP_001265141.1|NP_001265143.1|NP_997002.1	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20	105										endometrium(2)|large_intestine(4)|lung(2)|urinary_tract(1)	9						CTGGTTCCGGGACAGGTCAAT	0.637																																					p.S105C		Atlas-SNP	.											.	LRRC20	19	.	0			c.C314G						PASS	.						97.0	83.0	88.0					10																	72083705		2203	4300	6503	SO:0001583	missense	55222	exon4			TTCCGGGACAGGT	BC024001	CCDS7300.1, CCDS7301.1, CCDS7302.1, CCDS73145.1	10q22.2	2004-04-15			ENSG00000172731	ENSG00000172731			23421	protein-coding gene	gene with protein product							Standard	NM_207119		Approved	FLJ10751, FLJ10844	uc031pvr.1	Q8TCA0	OTTHUMG00000018407	ENST00000355790.4:c.314C>G	chr10.hg19:g.72083705G>C	ENSP00000348043:p.Ser105Cys	98.0	0.0	.		96.0	45.0	.	NM_207119	Q5T6D4|Q5T6D6|Q9NVA6|Q9NVG3	Missense_Mutation	SNP	ENST00000355790.4	hg19	CCDS7302.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.430343	0.83776	.	.	ENSG00000172731	ENST00000373224;ENST00000355790;ENST00000395011;ENST00000358141;ENST00000446961	T;T;T;T;T	0.59502	0.26;0.26;1.53;1.53;0.26	5.37	5.37	0.77165	.	0.114590	0.64402	D	0.000012	T	0.76550	0.4003	M	0.77486	2.375	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71870	0.971;0.975	T	0.78352	-0.2237	10	0.54805	T	0.06	-36.6006	17.6721	0.88221	0.0:0.0:1.0:0.0	.	55;105	Q8TCA0-2;Q8TCA0	.;LRC20_HUMAN	C	105;105;55;55;105	ENSP00000362321:S105C;ENSP00000348043:S105C;ENSP00000378458:S55C;ENSP00000350860:S55C;ENSP00000413745:S105C	ENSP00000348043:S105C	S	-	2	0	LRRC20	71753711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.513000	0.81739	2.514000	0.84764	0.563000	0.77884	TCC	.	.	.	none		0.637	LRRC20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048510.1	NM_018239	
CDH23	64072	hgsc.bcm.edu	37	10	73550921	73550921	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr10:73550921G>A	ENST00000224721.6	+	46	6102	c.6097G>A	c.(6097-6099)Gac>Aac	p.D2033N		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2028	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TGTCATCATTGACCGGGAGGC	0.622																																					p.D2028N		Atlas-SNP	.											.	CDH23	365	.	0			c.G6082A						PASS	.						44.0	49.0	47.0					10																	73550921		2189	4288	6477	SO:0001583	missense	64072	exon45			ATCATTGACCGGG	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.6097G>A	chr10.hg19:g.73550921G>A	ENSP00000224721:p.Asp2033Asn	44.0	0.0	.		38.0	15.0	.	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	hg19		.	.	.	.	.	.	.	.	.	.	G	35	5.558045	0.96514	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.91	5.91	0.95273	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.85208	0.5644	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85488	0.1183	9	0.52906	T	0.07	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	2028	Q9H251	CAD23_HUMAN	N	2033;2028;2031	.	ENSP00000224721:D2033N	D	+	1	0	CDH23	73220927	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	9.132000	0.94455	2.793000	0.96121	0.655000	0.94253	GAC	.	.	.	none		0.622	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
SLC16A12	387700	hgsc.bcm.edu	37	10	91195920	91195920	+	Silent	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr10:91195920T>A	ENST00000341233.4	-	7	1485	c.1095A>T	c.(1093-1095)ccA>ccT	p.P365P	SLC16A12_ENST00000371790.4_Silent_p.P395P	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	365						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						TGGTCACTACTGGGATCAAAG	0.512																																					p.P395P		Atlas-SNP	.											.	SLC16A12	40	.	0			c.A1185T						PASS	.						129.0	101.0	110.0					10																	91195920		2203	4300	6503	SO:0001819	synonymous_variant	387700	exon7			CACTACTGGGATC		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.1095A>T	chr10.hg19:g.91195920T>A		109.0	0.0	.		102.0	37.0	.	NM_213606	Q5M9M9|Q5T7J2|Q6ZV76	Silent	SNP	ENST00000341233.4	hg19																																																																																				.	.	.	none		0.512	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606	
SLIT1	6585	hgsc.bcm.edu	37	10	98803147	98803147	+	Silent	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr10:98803147G>A	ENST00000266058.4	-	19	2222	c.1977C>T	c.(1975-1977)acC>acT	p.T659T	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Silent_p.T659T	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	659					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GGGACTGGAGGGTGTCGAAGG	0.642																																					p.T659T		Atlas-SNP	.											.	SLIT1	154	.	0			c.C1977T						PASS	.						204.0	207.0	206.0					10																	98803147		2203	4300	6503	SO:0001819	synonymous_variant	6585	exon19			CTGGAGGGTGTCG	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1977C>T	chr10.hg19:g.98803147G>A		110.0	0.0	.		106.0	36.0	.	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Silent	SNP	ENST00000266058.4	hg19	CCDS7453.1																																																																																			.	.	.	none		0.642	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
TIAL1	7073	hgsc.bcm.edu	37	10	121339523	121339523	+	Splice_Site	SNP	C	C	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr10:121339523C>G	ENST00000436547.2	-	6	416		c.e6-1		TIAL1_ENST00000463089.2_5'Flank|TIAL1_ENST00000369092.4_Splice_Site|TIAL1_ENST00000369093.2_Splice_Site	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1						apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		CCGGGCATCCCTGTGAAAAGA	0.368																																					.		Atlas-SNP	.											.	TIAL1	47	.	0			c.423-1G>C						PASS	.						52.0	52.0	52.0					10																	121339523		2203	4300	6503	SO:0001630	splice_region_variant	7073	exon7			GCATCCCTGTGAA	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.372-1G>C	chr10.hg19:g.121339523C>G		78.0	0.0	.		63.0	26.0	.	NM_001033925	A8K3T0|A8K4L9	Splice_Site	SNP	ENST00000436547.2	hg19	CCDS7613.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410918	0.83340	.	.	ENSG00000151923	ENST00000369093;ENST00000369092;ENST00000436547;ENST00000412524	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4345	0.94786	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TIAL1	121329513	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.717000	0.84732	2.587000	0.87381	0.563000	0.77884	.	.	.	.	none		0.368	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050672.2	NM_022333, NM_003252	Intron
RIC8A	60626	hgsc.bcm.edu	37	11	209726	209726	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:209726A>C	ENST00000526104.1	+	3	1796	c.452A>C	c.(451-453)tAc>tCc	p.Y151S	BET1L_ENST00000529614.2_5'Flank|BET1L_ENST00000410108.1_5'Flank|RIC8A_ENST00000325207.5_Missense_Mutation_p.Y151S|BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000332865.6_5'Flank|RIC8A_ENST00000527696.1_Missense_Mutation_p.Y145S|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000486280.1_5'Flank			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	151					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTGGGGCTGTACCGTGAGAGG	0.612																																					p.Y151S		Atlas-SNP	.											.	RIC8A	45	.	0			c.A452C						PASS	.						58.0	51.0	54.0					11																	209726		2203	4300	6503	SO:0001583	missense	60626	exon3			GGCTGTACCGTGA	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.452A>C	chr11.hg19:g.209726A>C	ENSP00000432008:p.Tyr151Ser	63.0	0.0	.		55.0	15.0	.	NM_021932	Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	ENST00000526104.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.422|8.422	0.846586|0.846586	0.16963|0.16963	.|.	.|.	ENSG00000177963|ENSG00000177963	ENST00000527728|ENST00000526104;ENST00000325207;ENST00000528357;ENST00000530889;ENST00000527696;ENST00000527468	.|.	.|.	.|.	4.45|4.45	-1.06|-1.06	0.10002|0.10002	.|Armadillo-type fold (1);	.|0.377347	.|0.30667	.|N	.|0.009138	T|T	0.21468|0.21468	0.0517|0.0517	N|N	0.21194|0.21194	0.64|0.64	0.09310|0.09310	N|N	0.999995|0.999995	.|B;B;B	.|0.17852	.|0.004;0.024;0.019	.|B;B;B	.|0.17979	.|0.005;0.02;0.011	T|T	0.13442|0.13442	-1.0509|-1.0509	5|9	.|0.22109	.|T	.|0.4	-1.5871|-1.5871	5.6898|5.6898	0.17823|0.17823	0.6387:0.1321:0.2291:0.0|0.6387:0.1321:0.2291:0.0	.|.	.|145;151;151	.|Q9NPQ8-2;Q9NPQ8;Q9NPQ8-3	.|.;RIC8A_HUMAN;.	P|S	33|151;151;127;155;145;41	.|.	.|ENSP00000325941:Y151S	T|Y	+|+	1|2	0|0	RIC8A|RIC8A	199726|199726	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.694000|0.694000	0.40290|0.40290	0.532000|0.532000	0.23067|0.23067	-0.289000|-0.289000	0.09038|0.09038	0.459000|0.459000	0.35465|0.35465	ACC|TAC	.	.	.	none		0.612	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000384761.1	NM_021932	
KCNQ1	3784	hgsc.bcm.edu	37	11	2799217	2799217	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:2799217G>C	ENST00000155840.5	+	15	1852	c.1744G>C	c.(1744-1746)Gat>Cat	p.D582H	KCNQ1_ENST00000526095.1_3'UTR|KCNQ1_ENST00000335475.5_Missense_Mutation_p.D455H	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	582					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	AAAGAGCAAGGATCGCGGCAG	0.637																																					p.D582H		Atlas-SNP	.											.	KCNQ1	60	.	0			c.G1744C						PASS	.						69.0	69.0	69.0					11																	2799217		2202	4299	6501	SO:0001583	missense	3784	exon15			AGCAAGGATCGCG	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1744G>C	chr11.hg19:g.2799217G>C	ENSP00000155840:p.Asp582His	39.0	0.0	.		39.0	19.0	.	NM_000218	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	ENST00000155840.5	hg19	CCDS7736.1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397789	0.42512	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.99671	-6.35;-6.35	3.11	3.11	0.35812	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.071471	0.52532	D	0.000063	D	0.99438	0.9801	M	0.78049	2.395	0.48762	D	0.999707	P;P;D	0.63046	0.511;0.567;0.992	B;B;D	0.67900	0.18;0.275;0.954	D	0.97889	1.0296	10	0.59425	D	0.04	-30.827	12.4561	0.55706	0.0:0.0:1.0:0.0	.	455;455;582	P51787-2;Q14D14;P51787	.;.;KCNQ1_HUMAN	H	582;455	ENSP00000155840:D582H;ENSP00000334497:D455H	ENSP00000155840:D582H	D	+	1	0	KCNQ1	2755793	1.000000	0.71417	1.000000	0.80357	0.220000	0.24768	7.172000	0.77604	2.043000	0.60533	0.313000	0.20887	GAT	.	.	.	none		0.637	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	
C11orf58	10944	hgsc.bcm.edu	37	11	16776551	16776551	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:16776551T>G	ENST00000228136.4	+	5	830	c.452T>G	c.(451-453)cTc>cGc	p.L151R	C11orf58_ENST00000525684.1_3'UTR|C11orf58_ENST00000422258.2_Missense_Mutation_p.L107R			O00193	SMAP_HUMAN	chromosome 11 open reading frame 58	151										NS(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)	7						GCTGAAGAACTCCAAGCTGCT	0.393																																					p.L151R		Atlas-SNP	.											.	C11orf58	14	.	0			c.T452G						PASS	.						72.0	77.0	75.0					11																	16776551		2200	4294	6494	SO:0001583	missense	10944	exon5			AAGAACTCCAAGC	BC007103	CCDS7822.1	11p15.1	2012-05-30			ENSG00000110696	ENSG00000110696			16990	protein-coding gene	gene with protein product	"""small acidic protein"""					9263035	Standard	NM_014267		Approved	SMAP	uc001mmk.2	O00193	OTTHUMG00000165910	ENST00000228136.4:c.452T>G	chr11.hg19:g.16776551T>G	ENSP00000228136:p.Leu151Arg	148.0	0.0	.		102.0	34.0	.	NM_014267	B2RD28	Missense_Mutation	SNP	ENST00000228136.4	hg19	CCDS7822.1	.	.	.	.	.	.	.	.	.	.	T	8.393	0.840219	0.16891	.	.	ENSG00000110696	ENST00000228136;ENST00000422258	.	.	.	5.21	5.21	0.72293	.	0.639834	0.16310	N	0.220024	T	0.32704	0.0838	L	0.29908	0.895	0.37202	D	0.904438	B	0.25312	0.123	B	0.16289	0.015	T	0.20706	-1.0267	9	0.07030	T	0.85	.	6.5732	0.22551	0.0:0.0785:0.1566:0.7649	.	151	O00193	SMAP_HUMAN	R	151;107	.	ENSP00000228136:L151R	L	+	2	0	C11orf58	16733127	0.978000	0.34361	0.989000	0.46669	0.994000	0.84299	2.518000	0.45537	1.951000	0.56629	0.528000	0.53228	CTC	.	.	.	none		0.393	C11orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387023.2	NM_014267	
ARHGAP42	143872	hgsc.bcm.edu	37	11	100843950	100843950	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:100843950T>A	ENST00000298815.8	+	18	1598	c.1595T>A	c.(1594-1596)cTt>cAt	p.L532H	ARHGAP42_ENST00000524892.2_Missense_Mutation_p.L498H	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	532	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						GTCTCAAATCTTGGTGTCATA	0.318																																					p.L532H		Atlas-SNP	.											.	ARHGAP42	32	.	0			c.T1595A						PASS	.						47.0	39.0	42.0					11																	100843950		692	1591	2283	SO:0001583	missense	143872	exon18			CAAATCTTGGTGT			11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.1595T>A	chr11.hg19:g.100843950T>A	ENSP00000298815:p.Leu532His	103.0	0.0	.		68.0	30.0	.	NM_152432	Q96M56	Missense_Mutation	SNP	ENST00000298815.8	hg19		.	.	.	.	.	.	.	.	.	.	T	25.5	4.645213	0.87859	.	.	ENSG00000165895	ENST00000524892;ENST00000298815	T;T	0.57907	0.37;0.37	6.17	6.17	0.99709	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000002	D	0.84379	0.5459	H	0.99042	4.41	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90701	0.4620	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	532	A6NI28	RHG42_HUMAN	H	498;532	ENSP00000431776:L498H;ENSP00000298815:L532H	ENSP00000298815:L532H	L	+	2	0	ARHGAP42	100349160	1.000000	0.71417	0.962000	0.40283	0.992000	0.81027	7.633000	0.83260	2.371000	0.80710	0.533000	0.62120	CTT	.	.	.	none		0.318	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152432	
HSPB2	3316	hgsc.bcm.edu	37	11	111784216	111784216	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:111784216T>C	ENST00000304298.3	+	2	734	c.146T>C	c.(145-147)gTc>gCc	p.V49A	CRYAB_ENST00000526180.1_5'Flank|CRYAB_ENST00000527950.1_Intron|CRYAB_ENST00000525823.1_5'Flank|CRYAB_ENST00000227251.3_5'Flank|CRYAB_ENST00000533280.1_5'Flank|HSPB2-C11orf52_ENST00000534100.1_Intron|CRYAB_ENST00000531198.1_5'Flank|HSPB2_ENST00000537382.1_Missense_Mutation_p.V49A|CRYAB_ENST00000533475.1_Intron|CRYAB_ENST00000533971.1_5'Flank	NM_001541.3	NP_001532.1	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	49					positive regulation of catalytic activity (GO:0043085)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)			large_intestine(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		GGCTACTATGTCCGGCCTCGG	0.627																																					p.V49A		Atlas-SNP	.											.	HSPB2	20	.	0			c.T146C						PASS	.						136.0	147.0	144.0					11																	111784216		2201	4297	6498	SO:0001583	missense	3316	exon2			ACTATGTCCGGCC	U75898	CCDS8352.1	11q22-q23	2011-09-02	2002-08-29			ENSG00000170276		"""Heat shock proteins / HSPB"""	5247	protein-coding gene	gene with protein product		602179	"""heat shock 27kD protein 2"""			9344664, 9490724	Standard	NM_001541		Approved	Hs.78846, MKBP	uc001pmg.2	Q16082		ENST00000304298.3:c.146T>C	chr11.hg19:g.111784216T>C	ENSP00000302476:p.Val49Ala	38.0	0.0	.		27.0	10.0	.	NM_001541	Q6I9U7	Missense_Mutation	SNP	ENST00000304298.3	hg19	CCDS8352.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.304473	0.40795	.	.	ENSG00000170276	ENST00000304298;ENST00000537382	D;D	0.90004	-2.6;-2.6	4.86	4.86	0.63082	.	0.429389	0.21511	N	0.073367	T	0.79621	0.4477	N	0.14661	0.345	0.35008	D	0.756652	B	0.14438	0.01	B	0.11329	0.006	T	0.77550	-0.2546	10	0.17369	T	0.5	-25.4453	14.9188	0.70818	0.0:0.0:0.0:1.0	.	49	Q16082	HSPB2_HUMAN	A	49	ENSP00000302476:V49A;ENSP00000445585:V49A	ENSP00000302476:V49A	V	+	2	0	HSPB2	111289426	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.167000	0.71902	2.177000	0.69029	0.455000	0.32223	GTC	.	.	.	none		0.627	HSPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391669.1		
BCL9L	283149	hgsc.bcm.edu	37	11	118771955	118771955	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:118771955G>C	ENST00000334801.3	-	6	3461	c.2497C>G	c.(2497-2499)Cag>Gag	p.Q833E	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	833	Met-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		AGCATCTTCTGCGGGCCGCCC	0.647																																					p.Q833E		Atlas-SNP	.											.	BCL9L	254	.	0			c.C2497G						PASS	.						65.0	64.0	64.0					11																	118771955		2200	4295	6495	SO:0001583	missense	283149	exon6			TCTTCTGCGGGCC	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2497C>G	chr11.hg19:g.118771955G>C	ENSP00000335320:p.Gln833Glu	75.0	0.0	.		62.0	20.0	.	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	hg19	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833281	0.50951	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	T	0.79653	-1.29	5.21	4.23	0.50019	.	0.000000	0.48286	D	0.000188	D	0.83843	0.5342	L	0.53249	1.67	0.33316	D	0.566665	P;P	0.49783	0.928;0.882	P;P	0.54856	0.762;0.582	D	0.88896	0.3349	10	0.66056	D	0.02	-11.7031	14.8728	0.70471	0.0:0.1441:0.8559:0.0	.	828;833	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	E	833;796;126;833;833	ENSP00000335320:Q833E	ENSP00000335320:Q833E	Q	-	1	0	BCL9L	118277165	1.000000	0.71417	0.982000	0.44146	0.880000	0.50808	6.524000	0.73791	2.415000	0.81967	0.655000	0.94253	CAG	.	.	.	none		0.647	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
ARHGAP32	9743	hgsc.bcm.edu	37	11	129034246	129034246	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:129034246G>A	ENST00000310343.9	-	2	192	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	ARHGAP32_ENST00000524655.1_5'Flank	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	65					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CAATCAGGCCGCTCTCGAGGG	0.343																																					p.R65W		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.C193T						PASS	.						74.0	63.0	67.0					11																	129034246		1566	3578	5144	SO:0001583	missense	9743	exon2			CAGGCCGCTCTCG	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.193C>T	chr11.hg19:g.129034246G>A	ENSP00000310561:p.Arg65Trp	60.0	0.0	.		57.0	14.0	.	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	hg19	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692891	0.68271	.	.	ENSG00000134909	ENST00000310343;ENST00000525234	T;T	0.33216	1.42;1.42	5.02	5.02	0.67125	.	.	.	.	.	T	0.44222	0.1283	L	0.39898	1.24	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.35822	-0.9773	9	0.87932	D	0	.	11.3313	0.49477	0.0:0.0:0.8182:0.1818	.	65	A7KAX9	RHG32_HUMAN	W	65;25	ENSP00000310561:R65W;ENSP00000432303:R25W	ENSP00000310561:R65W	R	-	1	2	ARHGAP32	128539456	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.936000	0.40183	2.492000	0.84095	0.655000	0.94253	CGG	.	.	.	none		0.343	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
TMTC1	83857	hgsc.bcm.edu	37	12	29908774	29908774	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr12:29908774A>G	ENST00000539277.1	-	4	657	c.599T>C	c.(598-600)gTg>gCg	p.V200A	TMTC1_ENST00000551659.1_Missense_Mutation_p.V200A|TMTC1_ENST00000256062.5_Missense_Mutation_p.V92A|TMTC1_ENST00000381224.2_Missense_Mutation_p.V92A|TMTC1_ENST00000552618.1_Missense_Mutation_p.V200A	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	200						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.V92A(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GAAGGGAGACACCGTGGAAGG	0.468																																					p.V200A		Atlas-SNP	.											TMTC1,NS,carcinoma,0,1	TMTC1	147	.	1	Substitution - Missense(1)	lung(1)	c.T599C						PASS	.						95.0	88.0	90.0					12																	29908774		2203	4300	6503	SO:0001583	missense	83857	exon4			GGAGACACCGTGG		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.599T>C	chr12.hg19:g.29908774A>G	ENSP00000442046:p.Val200Ala	150.0	0.0	.		172.0	37.0	.	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	hg19	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	A	4.340	0.062471	0.08388	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.68624	-0.34;-0.11;-0.34;-0.2;1.5	5.45	1.58	0.23477	.	0.896727	0.09708	N	0.766111	T	0.37237	0.0996	N	0.02357	-0.585	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.21518	-1.0243	9	.	.	.	0.1217	8.5489	0.33440	0.3291:0.0:0.6709:0.0	.	92;200	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	A	92;200;200;200;92	ENSP00000256062:V92A;ENSP00000448112:V200A;ENSP00000449043:V200A;ENSP00000442046:V200A;ENSP00000370622:V92A	.	V	-	2	0	TMTC1	29800041	0.698000	0.27777	0.516000	0.27786	0.771000	0.43674	2.015000	0.40961	0.266000	0.21894	-0.468000	0.05107	GTG	.	.	.	none		0.468	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
IFNG	3458	hgsc.bcm.edu	37	12	68552039	68552039	+	Splice_Site	SNP	T	T	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr12:68552039T>G	ENST00000229135.3	-	2	246	c.115A>C	c.(115-117)Aat>Cat	p.N39H	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	39					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	TGACCTGCATTCTAAAAAAAA	0.303																																					p.N39H		Atlas-SNP	.											.	IFNG	38	.	0			c.A115C						PASS	.						45.0	46.0	46.0					12																	68552039		2202	4299	6501	SO:0001630	splice_region_variant	3458	exon2			CTGCATTCTAAAA		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.115-1A>C	chr12.hg19:g.68552039T>G		50.0	0.0	.		63.0	31.0	.	NM_000619	B5BU88|Q53ZV4	Missense_Mutation	SNP	ENST00000229135.3	hg19	CCDS8980.1	.	.	.	.	.	.	.	.	.	.	T	11.67	1.709060	0.30322	.	.	ENSG00000111537	ENST00000229135	T	0.52983	0.64	5.2	4.06	0.47325	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.171430	0.49916	D	0.000123	T	0.66247	0.2770	M	0.85710	2.77	0.42308	D	0.992201	D	0.69078	0.997	D	0.65987	0.94	T	0.68269	-0.5453	9	.	.	.	-28.2407	7.9531	0.30027	0.0:0.0934:0.0:0.9066	.	39	P01579	IFNG_HUMAN	H	39	ENSP00000229135:N39H	.	N	-	1	0	IFNG	66838306	1.000000	0.71417	0.924000	0.36721	0.002000	0.02628	2.660000	0.46749	0.932000	0.37266	-0.250000	0.11733	AAT	.	.	.	none		0.303	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1		Missense_Mutation
AKAP11	11215	hgsc.bcm.edu	37	13	42882690	42882690	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr13:42882690A>T	ENST00000025301.2	+	9	5393	c.5218A>T	c.(5218-5220)Agt>Tgt	p.S1740C		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1740	Ser-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GTCCAATTTAAGTTTTGAAGA	0.388																																					p.S1740C		Atlas-SNP	.											.	AKAP11	146	.	0			c.A5218T						PASS	.						116.0	108.0	110.0					13																	42882690		2203	4300	6503	SO:0001583	missense	11215	exon9			AATTTAAGTTTTG	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5218A>T	chr13.hg19:g.42882690A>T	ENSP00000025301:p.Ser1740Cys	72.0	0.0	.		47.0	26.0	.	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	hg19	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.783681	0.90282	.	.	ENSG00000023516	ENST00000025301	T	0.20463	2.07	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.46718	0.1407	M	0.72894	2.215	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.43637	-0.9379	10	0.54805	T	0.06	.	15.7898	0.78345	1.0:0.0:0.0:0.0	.	1740	Q9UKA4	AKA11_HUMAN	C	1740	ENSP00000025301:S1740C	ENSP00000025301:S1740C	S	+	1	0	AKAP11	41780690	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.815000	0.91973	2.187000	0.69744	0.528000	0.53228	AGT	.	.	.	none		0.388	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
TBC1D4	9882	hgsc.bcm.edu	37	13	75869072	75869072	+	Silent	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr13:75869072G>T	ENST00000377636.3	-	18	3580	c.3234C>A	c.(3232-3234)atC>atA	p.I1078I	TBC1D4_ENST00000377625.2_Silent_p.I1015I|TBC1D4_ENST00000478591.1_5'UTR|TBC1D4_ENST00000431480.2_Silent_p.I1070I|TBC1D4_ENST00000425511.1_Silent_p.I242I	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	1078	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GACTGGGGCTGATTTCATTTT	0.403																																					p.I1078I		Atlas-SNP	.											.	TBC1D4	142	.	0			c.C3234A						PASS	.						82.0	81.0	81.0					13																	75869072		1916	4169	6085	SO:0001819	synonymous_variant	9882	exon18			GGGGCTGATTTCA	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.3234C>A	chr13.hg19:g.75869072G>T		117.0	0.0	.		75.0	21.0	.	NM_014832	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Silent	SNP	ENST00000377636.3	hg19	CCDS41901.1																																																																																			.	.	.	none		0.403	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832	
SLC7A7	9056	hgsc.bcm.edu	37	14	23240288	23240288	+	IGR	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr14:23240288G>T	ENST00000397532.3	-	0	2447				OXA1L_ENST00000358043.5_Missense_Mutation_p.R318L|OXA1L_ENST00000412791.1_Missense_Mutation_p.R334L|SLC7A7_ENST00000554061.1_5'Flank|OXA1L_ENST00000285848.5_Missense_Mutation_p.R394L|OXA1L_ENST00000604262.1_Missense_Mutation_p.R334L			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		TCCTGTCTCCGGATTCCAGCA	0.483																																					p.R394L		Atlas-SNP	.											.	OXA1L	49	.	0			c.G1181T						PASS	.						137.0	121.0	127.0					14																	23240288		2203	4300	6503	SO:0001628	intergenic_variant	5018	exon8			GTCTCCGGATTCC	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692		chr14.hg19:g.23240288G>T		120.0	0.0	.		89.0	4.0	.	NM_005015	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	ENST00000397532.3	hg19	CCDS9574.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.756988	0.69648	.	.	ENSG00000155463	ENST00000285848;ENST00000412791;ENST00000358043	T;T;T	0.39592	1.07;1.15;1.07	5.71	4.63	0.57726	.	0.048408	0.85682	D	0.000000	T	0.64659	0.2618	M	0.80746	2.51	0.80722	D	1	D;D;D	0.69078	0.988;0.989;0.997	D;D;D	0.68483	0.913;0.958;0.95	T	0.69087	-0.5238	10	0.72032	D	0.01	-22.9462	14.5012	0.67722	0.085:0.0:0.915:0.0	.	334;334;394	E7EVY0;Q15070;Q2M1J6	.;OXA1L_HUMAN;.	L	394;334;318	ENSP00000285848:R394L;ENSP00000387601:R334L;ENSP00000350740:R318L	ENSP00000285848:R394L	R	+	2	0	OXA1L	22310128	1.000000	0.71417	1.000000	0.80357	0.426000	0.31534	6.148000	0.71788	2.677000	0.91161	0.609000	0.83330	CGG	.	.	.	none		0.483	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3		
LRP10	26020	hgsc.bcm.edu	37	14	23344406	23344406	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr14:23344406G>A	ENST00000359591.4	+	4	1049	c.358G>A	c.(358-360)Ggg>Agg	p.G120R	LRP10_ENST00000546834.1_Missense_Mutation_p.G120R	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	120	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		CAGCTATGCTGGGGCCAGAGC	0.632																																					p.G120R		Atlas-SNP	.											.	LRP10	72	.	0			c.G358A						PASS	.						44.0	41.0	42.0					14																	23344406		2203	4300	6503	SO:0001583	missense	26020	exon4			TATGCTGGGGCCA	AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.358G>A	chr14.hg19:g.23344406G>A	ENSP00000352601:p.Gly120Arg	65.0	0.0	.		67.0	14.0	.	NM_014045	A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	hg19	CCDS9578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.04|17.04	3.287260|3.287260	0.59867|0.59867	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000359591;ENST00000546834|ENST00000551466	T;T|.	0.28666|.	1.6;1.6|.	5.4|5.4	5.4|5.4	0.78164|0.78164	CUB (3);|.	0.122018|.	0.56097|.	D|.	0.000023|.	T|.	0.46367|.	0.1389|.	L|L	0.27053|0.27053	0.805|0.805	0.36299|0.36299	D|D	0.856899|0.856899	D|.	0.76494|.	0.999|.	D|.	0.66716|.	0.946|.	T|.	0.51585|.	-0.8687|.	10|.	0.24483|.	T|.	0.36|.	-20.6468|-20.6468	11.7283|11.7283	0.51722|0.51722	0.0:0.0:0.8237:0.1763|0.0:0.0:0.8237:0.1763	.|.	120|.	Q7Z4F1|.	LRP10_HUMAN|.	R|X	120|21	ENSP00000352601:G120R;ENSP00000447559:G120R|.	ENSP00000352601:G120R|.	G|W	+|+	1|2	0|0	LRP10|LRP10	22414246|22414246	0.992000|0.992000	0.36948|0.36948	0.992000|0.992000	0.48379|0.48379	0.961000|0.961000	0.63080|0.63080	2.281000|2.281000	0.43452|0.43452	2.547000|2.547000	0.85894|0.85894	0.563000|0.563000	0.77884|0.77884	GGG|TGG	.	.	.	none		0.632	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3		
LRP10	26020	hgsc.bcm.edu	37	14	23344686	23344686	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr14:23344686G>C	ENST00000359591.4	+	5	1220	c.529G>C	c.(529-531)Gac>Cac	p.D177H	LRP10_ENST00000546834.1_Missense_Mutation_p.D177H	NM_014045.3	NP_054764.2	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein 10	177					endocytosis (GO:0006897)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(2)	32	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		TTGCAGCTCAGACCCCTTCCC	0.572																																					p.D177H		Atlas-SNP	.											.	LRP10	72	.	0			c.G529C						PASS	.						136.0	111.0	119.0					14																	23344686		2203	4300	6503	SO:0001583	missense	26020	exon5			AGCTCAGACCCCT	AF131760	CCDS9578.1	14q11.2	2013-05-29			ENSG00000197324	ENSG00000197324		"""Low density lipoprotein receptors"""	14553	protein-coding gene	gene with protein product		609921				11123907	Standard	XM_005267510		Approved	DKFZP564C1940, MGC8675, LRP9, MST087, MSTP087	uc001whd.3	Q7Z4F1	OTTHUMG00000028705	ENST00000359591.4:c.529G>C	chr14.hg19:g.23344686G>C	ENSP00000352601:p.Asp177His	112.0	0.0	.		83.0	23.0	.	NM_014045	A8K4R5|D3DS31|O95882|Q14CK7|Q86T02|Q8NCZ4|Q9HC42|Q9UG33	Missense_Mutation	SNP	ENST00000359591.4	hg19	CCDS9578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.854|9.854	1.194470|1.194470	0.22037|0.22037	.|.	.|.	ENSG00000197324|ENSG00000197324	ENST00000359591;ENST00000546834|ENST00000551466	D;D|.	0.94330|.	-3.2;-3.4|.	5.2|5.2	3.22|3.22	0.36961|0.36961	.|.	0.294917|.	0.36665|.	N|.	0.002472|.	T|T	0.34948|0.34948	0.0915|0.0915	N|N	0.25380|0.25380	0.74|0.74	0.32900|0.32900	D|D	0.51306|0.51306	B|.	0.09022|.	0.002|.	B|.	0.06405|.	0.002|.	T|T	0.43048|0.43048	-0.9415|-0.9415	10|5	0.32370|.	T|.	0.25|.	-15.981|-15.981	6.461|6.461	0.21956|0.21956	0.0985:0.359:0.5425:0.0|0.0985:0.359:0.5425:0.0	.|.	177|.	Q7Z4F1|.	LRP10_HUMAN|.	H|T	177|78	ENSP00000352601:D177H;ENSP00000447559:D177H|.	ENSP00000352601:D177H|.	D|R	+|+	1|2	0|0	LRP10|LRP10	22414526|22414526	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.857000|0.857000	0.48899|0.48899	1.419000|1.419000	0.34793|0.34793	1.424000|1.424000	0.47217|0.47217	0.655000|0.655000	0.94253|0.94253	GAC|AGA	.	.	.	none		0.572	LRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071663.3		
SLC7A8	23428	hgsc.bcm.edu	37	14	23634563	23634563	+	Silent	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr14:23634563G>A	ENST00000316902.7	-	3	1164	c.439C>T	c.(439-441)Ctg>Ttg	p.L147L	SLC7A8_ENST00000469263.1_Silent_p.L147L	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	147					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	AGCGGCTGCAGCACGTAGTTG	0.582																																					p.L147L		Atlas-SNP	.											.	SLC7A8	54	.	0			c.C439T						PASS	.						57.0	44.0	48.0					14																	23634563		2203	4300	6503	SO:0001819	synonymous_variant	23428	exon3			GCTGCAGCACGTA	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.439C>T	chr14.hg19:g.23634563G>A		87.0	0.0	.		67.0	21.0	.	NM_012244	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Silent	SNP	ENST00000316902.7	hg19	CCDS9590.1																																																																																			.	.	.	none		0.582	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
HOMEZ	57594	hgsc.bcm.edu	37	14	23744802	23744802	+	Silent	SNP	A	A	G	rs148005528		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr14:23744802A>G	ENST00000357460.5	-	2	1799	c.1635T>C	c.(1633-1635)gaT>gaC	p.D545D	HOMEZ_ENST00000431326.2_Silent_p.D547D|HOMEZ_ENST00000561013.1_Silent_p.D547D	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GTATGatcacatcatcatcat	0.443																																					p.D545D		Atlas-SNP	.											.	HOMEZ	80	.	0			c.T1635C						PASS	.						30.0	32.0	31.0					14																	23744802		2079	4051	6130	SO:0001819	synonymous_variant	57594	exon2			GATCACATCATCA	AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.1635T>C	chr14.hg19:g.23744802A>G		110.0	0.0	.		115.0	58.0	.	NM_020834	A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Silent	SNP	ENST00000357460.5	hg19	CCDS45085.1																																																																																			.	.	.	none		0.443	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000416939.2	NM_020834	
RDH12	145226	hgsc.bcm.edu	37	14	68192868	68192868	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr14:68192868C>A	ENST00000551171.1	+	6	768	c.444C>A	c.(442-444)caC>caA	p.H148Q	RDH12_ENST00000267502.3_Missense_Mutation_p.H148Q|RDH12_ENST00000539142.1_Missense_Mutation_p.H148Q	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	148					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	GAGTCAACCACCTGGGTAAGT	0.443																																					p.H148Q		Atlas-SNP	.											.	RDH12	43	.	0			c.C444A						PASS	.						114.0	114.0	114.0					14																	68192868		2203	4300	6503	SO:0001583	missense	145226	exon6			CAACCACCTGGGT	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.444C>A	chr14.hg19:g.68192868C>A	ENSP00000449079:p.His148Gln	90.0	0.0	.		86.0	38.0	.	NM_152443	B2RDA2|Q8TAW6	Missense_Mutation	SNP	ENST00000551171.1	hg19	CCDS9787.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422880	0.62733	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	D;D;D	0.87256	-2.23;-2.23;-2.23	6.04	3.28	0.37604	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92954	0.7758	M	0.89214	3.015	0.53005	D	0.999962	D	0.67145	0.996	D	0.74023	0.982	D	0.92340	0.5881	10	0.87932	D	0	.	8.3376	0.32224	0.0:0.6449:0.0:0.3551	.	148	Q96NR8	RDH12_HUMAN	Q	148	ENSP00000449079:H148Q;ENSP00000267502:H148Q;ENSP00000438715:H148Q	ENSP00000267502:H148Q	H	+	3	2	RDH12	67262621	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.886000	0.28241	0.914000	0.36822	-0.217000	0.12591	CAC	.	.	.	none		0.443	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1		
PPP2R5C	5527	hgsc.bcm.edu	37	14	102368158	102368158	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr14:102368158G>C	ENST00000334743.5	+	9	1003	c.955G>C	c.(955-957)Gaa>Caa	p.E319Q	PPP2R5C_ENST00000422945.2_Missense_Mutation_p.E350Q|PPP2R5C_ENST00000557095.1_Missense_Mutation_p.E319Q|PPP2R5C_ENST00000445439.3_Missense_Mutation_p.E319Q|PPP2R5C_ENST00000350249.3_Missense_Mutation_p.E319Q|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.E374Q	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	319					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						TGAACCATCAGAATTTGTGAA	0.443																																					p.E374Q		Atlas-SNP	.											.	PPP2R5C	74	.	0			c.G1120C						PASS	.						94.0	95.0	95.0					14																	102368158		2203	4300	6503	SO:0001583	missense	5527	exon11			CCATCAGAATTTG	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.955G>C	chr14.hg19:g.102368158G>C	ENSP00000333905:p.Glu319Gln	82.0	0.0	.		90.0	35.0	.	NM_001161726	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	ENST00000334743.5	hg19	CCDS9964.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523143	0.44866	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334756;ENST00000445439;ENST00000334743;ENST00000557095;ENST00000557716	T;T;T;T;T	0.51071	0.72;0.78;0.72;0.82;0.73	5.3	5.3	0.74995	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66954	0.2842	M	0.69358	2.11	0.80722	D	1	P;P;D;P;B;P	0.60575	0.826;0.531;0.988;0.856;0.049;0.847	B;B;D;P;B;D	0.70716	0.422;0.294;0.97;0.557;0.216;0.923	T	0.63129	-0.6706	10	0.30854	T	0.27	-11.4511	18.9542	0.92653	0.0:0.0:1.0:0.0	.	350;217;319;319;319;374	F5GWP3;E9PHN5;Q13362-3;Q13362;Q13362-2;Q6ZN33	.;.;.;2A5G_HUMAN;.;.	Q	350;374;348;319;217;319;319;319;115	ENSP00000412324:E350Q;ENSP00000329009:E374Q;ENSP00000450931:E348Q;ENSP00000262239:E319Q;ENSP00000333905:E319Q	ENSP00000329009:E374Q	E	+	1	0	PPP2R5C	101437911	1.000000	0.71417	0.142000	0.22268	0.959000	0.62525	7.799000	0.85936	2.490000	0.84030	0.655000	0.94253	GAA	.	.	.	none		0.443	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414373.2	NM_002719	
GATM	2628	hgsc.bcm.edu	37	15	45668863	45668863	+	Nonsense_Mutation	SNP	A	A	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr15:45668863A>C	ENST00000396659.3	-	2	563	c.224T>G	c.(223-225)tTa>tGa	p.L75*	GATM_ENST00000558336.1_Nonsense_Mutation_p.L75*|GATM_ENST00000458245.5_5'Flank	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	75					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	CACTTCCTCTAAGGGGTCCCA	0.542																																					p.L75X		Atlas-SNP	.											.	GATM	34	.	0			c.T224G						PASS	.						135.0	127.0	129.0					15																	45668863		2198	4298	6496	SO:0001587	stop_gained	2628	exon2			TCCTCTAAGGGGT	S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.224T>G	chr15.hg19:g.45668863A>C	ENSP00000379895:p.Leu75*	57.0	0.0	.		73.0	31.0	.	NM_001482	B4DH99|B4DPI3|Q53EQ4	Nonsense_Mutation	SNP	ENST00000396659.3	hg19	CCDS10122.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.405479	0.83230	.	.	ENSG00000171766	ENST00000396659	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5014	14.1188	0.65172	1.0:0.0:0.0:0.0	.	.	.	.	X	75	.	ENSP00000379895:L75X	L	-	2	0	GATM	43456155	1.000000	0.71417	0.962000	0.40283	0.993000	0.82548	8.884000	0.92432	2.210000	0.71456	0.533000	0.62120	TTA	.	.	.	none		0.542	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254220.2	NM_001482	
FGF7	2252	hgsc.bcm.edu	37	15	49716529	49716529	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr15:49716529C>G	ENST00000267843.4	+	2	646	c.35C>G	c.(34-36)aCt>aGt	p.T12S	FAM227B_ENST00000561064.1_Intron|FAM227B_ENST00000299338.6_Intron|FGF7_ENST00000560270.1_Missense_Mutation_p.T12S	NM_002009.3	NP_002000.1	P21781	FGF7_HUMAN	fibroblast growth factor 7	12					actin cytoskeleton reorganization (GO:0031532)|branching involved in salivary gland morphogenesis (GO:0060445)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle morphogenesis (GO:0031069)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization to cell surface (GO:0034394)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|response to wounding (GO:0009611)|secretion by lung epithelial cell involved in lung growth (GO:0061033)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)		ATCCTGCCAACTTTGCTCTAC	0.383																																					p.T12S		Atlas-SNP	.											.	FGF7	21	.	0			c.C35G						PASS	.						192.0	168.0	176.0					15																	49716529		2196	4295	6491	SO:0001583	missense	2252	exon2			TGCCAACTTTGCT	M60828	CCDS10131.1	15q21.2	2014-01-30	2010-08-18		ENSG00000140285	ENSG00000140285		"""Endogenous ligands"""	3685	protein-coding gene	gene with protein product	"""keratinocyte growth factor"""	148180	"""fibroblast growth factor 7 (keratinocyte growth factor)"""			7749227, 1409637	Standard	NM_002009		Approved	KGF	uc001zxn.3	P21781	OTTHUMG00000131517	ENST00000267843.4:c.35C>G	chr15.hg19:g.49716529C>G	ENSP00000267843:p.Thr12Ser	87.0	0.0	.		53.0	22.0	.	NM_002009	H0YNY5|Q6FGV5|Q96FG5	Missense_Mutation	SNP	ENST00000267843.4	hg19	CCDS10131.1	.	.	.	.	.	.	.	.	.	.	C	7.769	0.706993	0.15239	.	.	ENSG00000140285	ENST00000267843	T	0.23348	1.91	5.7	3.72	0.42706	.	0.719107	0.14365	N	0.324213	T	0.17450	0.0419	.	.	.	0.31782	N	0.630781	B	0.10296	0.003	B	0.06405	0.002	T	0.10894	-1.0610	9	0.29301	T	0.29	.	9.8033	0.40777	0.0:0.6371:0.2844:0.0784	.	12	P21781	FGF7_HUMAN	S	12	ENSP00000267843:T12S	ENSP00000267843:T12S	T	+	2	0	FGF7	47503821	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.034000	0.41145	1.425000	0.47237	0.655000	0.94253	ACT	.	.	.	none		0.383	FGF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254374.3	NM_002009	
C16orf96	342346	hgsc.bcm.edu	37	16	4628972	4628972	+	Silent	SNP	A	A	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr16:4628972A>C	ENST00000444310.4	+	6	2187	c.2187A>C	c.(2185-2187)acA>acC	p.T729T		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GCCTCGGGACAACAGTGGACA	0.537																																					p.T729T		Atlas-SNP	.											.	C16orf96	28	.	0			c.A2187C						PASS	.						100.0	99.0	100.0					16																	4628972		692	1591	2283	SO:0001819	synonymous_variant	342346	exon6			CGGGACAACAGTG		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2187A>C	chr16.hg19:g.4628972A>C		100.0	0.0	.		116.0	20.0	.	NM_001145011		Silent	SNP	ENST00000444310.4	hg19	CCDS53986.1																																																																																			.	.	.	none		0.537	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
SETD1A	9739	hgsc.bcm.edu	37	16	30982956	30982956	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr16:30982956G>A	ENST00000262519.8	+	13	3960	c.3274G>A	c.(3274-3276)Gtg>Atg	p.V1092M		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1092	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						GCCAGCACCTGTGGAGGTGCC	0.662																																					p.V1092M		Atlas-SNP	.											.	SETD1A	143	.	0			c.G3274A						PASS	.						35.0	38.0	37.0					16																	30982956		2197	4299	6496	SO:0001583	missense	9739	exon13			GCACCTGTGGAGG	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3274G>A	chr16.hg19:g.30982956G>A	ENSP00000262519:p.Val1092Met	61.0	0.0	.		67.0	14.0	.	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	hg19	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353357	0.24512	.	.	ENSG00000099381	ENST00000262519	D	0.94897	-3.55	5.81	5.81	0.92471	.	0.788898	0.11531	N	0.554670	D	0.93262	0.7853	L	0.46157	1.445	0.20821	N	0.999847	B	0.22480	0.07	B	0.31016	0.123	D	0.86220	0.1630	10	0.51188	T	0.08	.	15.5798	0.76425	0.0:0.0:1.0:0.0	.	1092	O15047	SET1A_HUMAN	M	1092	ENSP00000262519:V1092M	ENSP00000262519:V1092M	V	+	1	0	SETD1A	30890457	0.274000	0.24191	0.181000	0.23098	0.366000	0.29705	1.028000	0.30128	2.752000	0.94435	0.467000	0.42956	GTG	.	.	.	none		0.662	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
NKD1	85407	hgsc.bcm.edu	37	16	50583410	50583410	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr16:50583410G>A	ENST00000268459.3	+	3	360	c.136G>A	c.(136-138)Ggt>Agt	p.G46S	NKD1_ENST00000564336.1_3'UTR|RP11-401P9.1_ENST00000569940.2_RNA	NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	46					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CTGCCCGGGCGGTGTCTCGGG	0.687																																					p.G46S		Atlas-SNP	.											.	NKD1	43	.	0			c.G136A						PASS	.						24.0	26.0	25.0					16																	50583410		2195	4298	6493	SO:0001583	missense	85407	exon3			CCGGGCGGTGTCT	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.136G>A	chr16.hg19:g.50583410G>A	ENSP00000268459:p.Gly46Ser	52.0	0.0	.		70.0	38.0	.	NM_033119	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	hg19	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	G	6.267	0.417444	0.11870	.	.	ENSG00000140807	ENST00000268459	T	0.62232	0.04	4.15	1.98	0.26296	.	0.774566	0.12349	N	0.476745	T	0.28699	0.0711	N	0.02011	-0.69	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.23404	-1.0189	10	0.06494	T	0.89	-5.2334	8.1969	0.31402	0.2365:0.0:0.7635:0.0	.	46	Q969G9	NKD1_HUMAN	S	46	ENSP00000268459:G46S	ENSP00000268459:G46S	G	+	1	0	NKD1	49140911	0.996000	0.38824	0.078000	0.20375	0.659000	0.38960	1.536000	0.36072	0.941000	0.37499	0.313000	0.20887	GGT	.	.	.	none		0.687	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1		
DDX28	55794	hgsc.bcm.edu	37	16	68057034	68057034	+	Silent	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr16:68057034G>A	ENST00000332395.5	-	1	736	c.72C>T	c.(70-72)ctC>ctT	p.L24L	DUS2_ENST00000432752.1_5'Flank|DUS2_ENST00000565263.1_5'UTR|DUS2_ENST00000358896.6_5'Flank	NM_018380.3	NP_060850.2	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	24						mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		TGCGGACCGTGAGGCCCCGTC	0.672																																					p.L24L		Atlas-SNP	.											.	DDX28	29	.	0			c.C72T						PASS	.						15.0	17.0	16.0					16																	68057034		2175	4253	6428	SO:0001819	synonymous_variant	55794	exon1			GACCGTGAGGCCC	AF329821	CCDS10858.1	16q22.1-q22.3	2008-02-05	2003-06-13		ENSG00000182810	ENSG00000182810		"""DEAD-boxes"""	17330	protein-coding gene	gene with protein product		607618	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28"""			10493829, 11350955	Standard	NM_018380		Approved	MDDX28, FLJ11282	uc002evh.2	Q9NUL7	OTTHUMG00000137549	ENST00000332395.5:c.72C>T	chr16.hg19:g.68057034G>A		11.0	0.0	.		25.0	15.0	.	NM_018380		Silent	SNP	ENST00000332395.5	hg19	CCDS10858.1																																																																																			.	.	.	none		0.672	DDX28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268883.1	NM_018380	
WWP2	11060	hgsc.bcm.edu	37	16	69820957	69820957	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr16:69820957T>A	ENST00000359154.2	+	2	145	c.44T>A	c.(43-45)tTt>tAt	p.F15Y	WWP2_ENST00000569174.1_Missense_Mutation_p.F15Y|WWP2_ENST00000448661.1_Missense_Mutation_p.F15Y|SNORA62_ENST00000516634.1_RNA|WWP2_ENST00000356003.2_Missense_Mutation_p.F15Y	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	15					cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GCCCTGCCTTTTGAGAAGTCT	0.468																																					p.F15Y		Atlas-SNP	.											.	WWP2	88	.	0			c.T44A						PASS	.						118.0	98.0	105.0					16																	69820957		2198	4300	6498	SO:0001583	missense	11060	exon2			TGCCTTTTGAGAA	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.44T>A	chr16.hg19:g.69820957T>A	ENSP00000352069:p.Phe15Tyr	73.0	0.0	.		83.0	19.0	.	NM_001270454	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	hg19	CCDS10885.1	.	.	.	.	.	.	.	.	.	.	T	9.974	1.226372	0.22542	.	.	ENSG00000198373	ENST00000359154;ENST00000448661;ENST00000356003	T;T;T	0.29397	1.57;1.57;1.57	5.29	4.19	0.49359	C2 calcium/lipid-binding domain, CaLB (1);	0.560166	0.20039	N	0.100552	T	0.14527	0.0351	N	0.14661	0.345	0.80722	D	1	B	0.29909	0.261	B	0.25759	0.063	T	0.10019	-1.0648	9	.	.	.	.	5.4691	0.16660	0.0:0.0909:0.1754:0.7337	.	15	O00308	WWP2_HUMAN	Y	15	ENSP00000352069:F15Y;ENSP00000396871:F15Y;ENSP00000348283:F15Y	.	F	+	2	0	WWP2	68378458	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.190000	0.42630	0.859000	0.35456	0.460000	0.39030	TTT	.	.	.	none		0.468	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014	
C17orf107	100130311	hgsc.bcm.edu	37	17	4799846	4799846	+	5'Flank	SNP	T	T	C	rs372981603		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr17:4799846T>C	ENST00000381365.3	+	0	0				C17orf107_ENST00000521575.1_5'Flank|MINK1_ENST00000453408.3_Silent_p.D1226D|MINK1_ENST00000355280.6_Silent_p.D1246D|MINK1_ENST00000347992.7_Silent_p.D1217D	NM_001145536.1	NP_001139008.1	Q6ZR85	CQ107_HUMAN	chromosome 17 open reading frame 107											endometrium(2)	2						TCATTAAGGATGTGGTGCTGC	0.622																																					p.D1246D		Atlas-SNP	.											.	MINK1	110	.	0			c.T3738C						PASS	.						94.0	101.0	99.0					17																	4799846		2183	4270	6453	SO:0001631	upstream_gene_variant	50488	exon30			TAAGGATGTGGTG	AK128415	CCDS45591.1	17p13.2	2009-09-30			ENSG00000205710	ENSG00000205710			37238	protein-coding gene	gene with protein product							Standard	NM_001145536		Approved		uc002fzl.3	Q6ZR85	OTTHUMG00000164838		chr17.hg19:g.4799846T>C	Exception_encountered	67.0	0.0	.		107.0	34.0	.	NM_153827		Silent	SNP	ENST00000381365.3	hg19	CCDS45591.1																																																																																			.	.	.	alt		0.622	C17orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380556.1	NM_001145536	
COX10	1352	hgsc.bcm.edu	37	17	14110151	14110151	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr17:14110151T>A	ENST00000261643.3	+	7	1030	c.953T>A	c.(952-954)cTc>cAc	p.L318H	COX10_ENST00000537334.1_Missense_Mutation_p.L101H|COX10_ENST00000536205.1_Missense_Mutation_p.L126H	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	318					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GGAGGAATCCTCTACTCCTGG	0.587																																					p.L318H		Atlas-SNP	.											.	COX10	36	.	0			c.T953A						PASS	.						61.0	68.0	66.0					17																	14110151		2203	4300	6503	SO:0001583	missense	1352	exon7			GAATCCTCTACTC	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.953T>A	chr17.hg19:g.14110151T>A	ENSP00000261643:p.Leu318His	66.0	0.0	.		91.0	45.0	.	NM_001303	B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	ENST00000261643.3	hg19	CCDS11166.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647456	0.87958	.	.	ENSG00000006695	ENST00000261643;ENST00000536205;ENST00000537334	D;D;D	0.93906	-3.31;-3.31;-3.31	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.97829	0.9287	H	0.97158	3.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.99257	1.0889	10	0.87932	D	0	-10.0897	14.9423	0.71003	0.0:0.0:0.0:1.0	.	126;318	B4DJ50;Q12887	.;COX10_HUMAN	H	318;126;101	ENSP00000261643:L318H;ENSP00000439494:L126H;ENSP00000443354:L101H	ENSP00000261643:L318H	L	+	2	0	COX10	14050876	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.577000	0.82486	2.005000	0.58758	0.533000	0.62120	CTC	.	.	.	none		0.587	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
FLII	2314	hgsc.bcm.edu	37	17	18151250	18151250	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr17:18151250A>G	ENST00000327031.4	-	19	2513	c.2288T>C	c.(2287-2289)aTg>aCg	p.M763T	FLII_ENST00000379450.4_Missense_Mutation_p.M677T|FLII_ENST00000579294.1_Missense_Mutation_p.M752T|FLII_ENST00000545457.2_Missense_Mutation_p.M708T|FLII_ENST00000578558.1_Intron	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	763	Interaction with ACTL6A.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					TACCAGCCGCATTCTTGGCAT	0.622																																					p.M763T		Atlas-SNP	.											.	FLII	79	.	0			c.T2288C						PASS	.						117.0	106.0	110.0					17																	18151250		2203	4300	6503	SO:0001583	missense	2314	exon19			AGCCGCATTCTTG	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.2288T>C	chr17.hg19:g.18151250A>G	ENSP00000324573:p.Met763Thr	78.0	0.0	.		78.0	39.0	.	NM_002018	B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	ENST00000327031.4	hg19	CCDS11192.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204846	0.38905	.	.	ENSG00000177731	ENST00000327031;ENST00000379450	T;T	0.53640	0.61;0.61	5.21	5.21	0.72293	Gelsolin domain (1);	0.136494	0.64402	D	0.000003	T	0.37625	0.1010	N	0.22421	0.69	0.47009	D	0.999288	B;B;B;B	0.30563	0.189;0.189;0.02;0.285	B;B;B;B	0.33846	0.113;0.113;0.103;0.171	T	0.22521	-1.0214	10	0.36615	T	0.2	-36.048	15.0785	0.72096	1.0:0.0:0.0:0.0	.	677;677;763;732	E7EPM0;B4DIL0;Q13045;B4DIX0	.;.;FLII_HUMAN;.	T	763;677	ENSP00000324573:M763T;ENSP00000368763:M677T	ENSP00000324573:M763T	M	-	2	0	FLII	18091975	1.000000	0.71417	0.990000	0.47175	0.800000	0.45204	6.897000	0.75671	1.971000	0.57363	0.379000	0.24179	ATG	.	.	.	none		0.622	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
TRIM65	201292	hgsc.bcm.edu	37	17	73887171	73887171	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr17:73887171T>A	ENST00000269383.3	-	6	1308	c.1243A>T	c.(1243-1245)Aac>Tac	p.N415Y		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	415	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGGCCAATGTTGTCTGTGTGG	0.697																																					p.N415Y		Atlas-SNP	.											.	TRIM65	23	.	0			c.A1243T						PASS	.						30.0	31.0	30.0					17																	73887171		2202	4296	6498	SO:0001583	missense	201292	exon6			CAATGTTGTCTGT	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.1243A>T	chr17.hg19:g.73887171T>A	ENSP00000269383:p.Asn415Tyr	23.0	0.0	.		20.0	8.0	.	NM_173547	Q4G0F0|Q6DKJ6|Q9BRP6	Missense_Mutation	SNP	ENST00000269383.3	hg19	CCDS11732.1	.	.	.	.	.	.	.	.	.	.	T	16.83	3.230594	0.58777	.	.	ENSG00000141569	ENST00000269383	T	0.68331	-0.32	5.33	5.33	0.75918	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.56097	D	0.000025	T	0.57066	0.2028	L	0.28458	0.855	0.37276	D	0.907619	B	0.28400	0.21	B	0.38921	0.285	T	0.54330	-0.8310	10	0.02654	T	1	.	15.2933	0.73882	0.0:0.0:0.0:1.0	.	415	Q6PJ69	TRI65_HUMAN	Y	415	ENSP00000269383:N415Y	ENSP00000269383:N415Y	N	-	1	0	TRIM65	71398766	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	3.892000	0.56235	2.030000	0.59900	0.448000	0.29417	AAC	.	.	.	none		0.697	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547	
CBX4	8535	hgsc.bcm.edu	37	17	77807927	77807927	+	Missense_Mutation	SNP	A	A	G	rs200965379		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr17:77807927A>G	ENST00000269397.4	-	5	1691	c.1514T>C	c.(1513-1515)gTg>gCg	p.V505A		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	505	Interaction with BMI1.|Poly-Ala.			V -> VAA (in Ref. 3; ACA49234). {ECO:0000305}.	chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			tgccgccgccaccgccaccgc	0.711																																					p.V505A		Atlas-SNP	.											CBX4,uveal_tract,malignant_melanoma,0,1	CBX4	40	.	0			c.T1514C						PASS	.						15.0	21.0	19.0					17																	77807927		1776	3704	5480	SO:0001583	missense	8535	exon5			GCCGCCACCGCCA	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1514T>C	chr17.hg19:g.77807927A>G	ENSP00000269397:p.Val505Ala	44.0	1.0	.		44.0	6.0	.	NM_003655	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	hg19	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	a	0.008	-1.872700	0.00542	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	.	.	.	0.575	0.575	0.17374	.	2.519730	0.02140	N	0.057046	T	0.20333	0.0489	N	0.08118	0	0.19775	N	0.999955	B	0.13594	0.008	B	0.04013	0.001	T	0.16217	-1.0410	8	0.32370	T	0.25	.	.	.	.	.	505	O00257	CBX4_HUMAN	A	505;235	.	ENSP00000269397:V505A	V	-	2	0	CBX4	75422522	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	0.179000	0.16840	0.475000	0.27415	0.158000	0.16466	GTG	.	.	.	weak		0.711	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
SLC25A52	147407	hgsc.bcm.edu	37	18	29340393	29340393	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr18:29340393G>A	ENST00000579441.2	-	1	231	c.232C>T	c.(232-234)Cga>Tga	p.R78*	SLC25A52_ENST00000269205.5_Nonsense_Mutation_p.R88*			Q3SY17	S2552_HUMAN	solute carrier family 25, member 52	78					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											TACAAATTTCGAAATCCATCC	0.463																																					p.R88X		Atlas-SNP	.											.	.	.	.	0			c.C262T						PASS	.						120.0	107.0	112.0					18																	29340393		2203	4300	6503	SO:0001587	stop_gained	147407	exon1			AATTTCGAAATCC		CCDS32812.1, CCDS32812.2	18q12.1	2013-07-15	2012-03-29	2012-03-29	ENSG00000141437	ENSG00000141437		"""Solute carriers"""	23324	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 2"""	MCART2			Standard	NM_001034172		Approved		uc002kxa.3	Q3SY17	OTTHUMG00000179617	ENST00000579441.2:c.232C>T	chr18.hg19:g.29340393G>A	ENSP00000462754:p.Arg78*	132.0	0.0	.		118.0	36.0	.	NM_001034172		Nonsense_Mutation	SNP	ENST00000579441.2	hg19		.	.	.	.	.	.	.	.	.	.	G	36	5.905485	0.97087	.	.	ENSG00000141437	ENST00000269205;ENST00000535708	.	.	.	1.03	1.03	0.20045	.	0.259609	0.30538	N	0.009404	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	7.9599	0.30066	0.0:0.0:1.0:0.0	.	.	.	.	X	88;78	.	ENSP00000372612:R88X	R	-	1	2	MCART2	27594391	0.991000	0.36638	0.295000	0.24960	0.834000	0.47266	0.956000	0.29202	0.877000	0.35895	0.505000	0.49811	CGA	.	.	.	none		0.463	SLC25A52-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_084000	
CACNA1A	773	hgsc.bcm.edu	37	19	13372413	13372413	+	Silent	SNP	G	G	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr19:13372413G>A	ENST00000360228.5	-	26	4100	c.4101C>T	c.(4099-4101)gaC>gaT	p.D1367D	CACNA1A_ENST00000573710.2_Silent_p.D1368D	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1368					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TCACCACACAGTCAAACACAG	0.522																																					p.D1368D		Atlas-SNP	.											.	CACNA1A	715	.	0			c.C4104T						PASS	.						48.0	46.0	47.0					19																	13372413		2040	4201	6241	SO:0001819	synonymous_variant	773	exon26			CACACAGTCAAAC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4101C>T	chr19.hg19:g.13372413G>A		51.0	0.0	.		68.0	27.0	.	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	hg19	CCDS45998.1																																																																																			.	.	.	none		0.522	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
ARHGAP33	115703	hgsc.bcm.edu	37	19	36279024	36279024	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr19:36279024C>T	ENST00000007510.4	+	21	3701	c.3557C>T	c.(3556-3558)tCc>tTc	p.S1186F	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.S1025F|AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.S1022F			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1186	Poly-Ser.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						TCTTCCTCCTCCTCTTCCCCT	0.692																																					p.S1025F		Atlas-SNP	.											.	ARHGAP33	102	.	0			c.C3074T						PASS	.						30.0	34.0	33.0					19																	36279024		2193	4287	6480	SO:0001583	missense	115703	exon21			CCTCCTCCTCTTC	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3557C>T	chr19.hg19:g.36279024C>T	ENSP00000007510:p.Ser1186Phe	168.0	0.0	.		114.0	36.0	.	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	hg19		.	.	.	.	.	.	.	.	.	.	c	15.16	2.750938	0.49257	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.21543	2.63;2.0;2.33	4.68	3.55	0.40652	.	0.000000	0.44285	D	0.000469	T	0.22126	0.0533	N	0.19112	0.55	0.24977	N	0.991621	D;D	0.64830	0.994;0.994	P;P	0.56865	0.808;0.808	T	0.02345	-1.1173	10	0.66056	D	0.02	.	8.8936	0.35449	0.1653:0.6739:0.1608:0.0	.	1022;1025	O14559-10;O14559-11	.;.	F	1186;1025;1022	ENSP00000007510:S1186F;ENSP00000320038:S1025F;ENSP00000368227:S1022F	ENSP00000007510:S1186F	S	+	2	0	ARHGAP33	40970864	0.014000	0.17966	0.999000	0.59377	0.889000	0.51656	0.825000	0.27393	2.325000	0.78763	0.401000	0.26515	TCC	.	.	.	none		0.692	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
SARS2	54938	hgsc.bcm.edu	37	19	39409424	39409424	+	Silent	SNP	A	A	G			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr19:39409424A>G	ENST00000221431.6	-	8	948	c.789T>C	c.(787-789)ctT>ctC	p.L263L	CTC-360G5.8_ENST00000599996.1_Missense_Mutation_p.S333P|SARS2_ENST00000600042.1_Silent_p.L265L|SARS2_ENST00000430193.3_Silent_p.L263L|SARS2_ENST00000598831.1_5'Flank|SARS2_ENST00000448145.2_Silent_p.L263L|SARS2_ENST00000594171.1_Silent_p.L73L	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	263					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CTCCGCGGAGAAGGTCTGGCA	0.647																																					p.L265L		Atlas-SNP	.											.	SARS2	33	.	0			c.T795C						PASS	.						58.0	40.0	46.0					19																	39409424		2187	4267	6454	SO:0001819	synonymous_variant	54938	exon9			GCGGAGAAGGTCT	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.789T>C	chr19.hg19:g.39409424A>G		71.0	0.0	.		40.0	14.0	.	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Silent	SNP	ENST00000221431.6	hg19	CCDS33017.1																																																																																			.	.	.	none		0.647	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
DKKL1	27120	hgsc.bcm.edu	37	19	49868766	49868766	+	Splice_Site	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr19:49868766G>T	ENST00000221498.2	+	3	589	c.184G>T	c.(184-186)Ggt>Tgt	p.G62C	DKKL1_ENST00000594268.1_Intron	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	62					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		CCGGCCCCAGGGTAACCTGCT	0.617																																					p.G62C		Atlas-SNP	.											.	DKKL1	23	.	0			c.G184T						PASS	.						45.0	44.0	44.0					19																	49868766		2203	4300	6503	SO:0001630	splice_region_variant	27120	exon3			CCCCAGGGTAACC	AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.184-1G>T	chr19.hg19:g.49868766G>T		55.0	0.0	.		35.0	11.0	.	NM_014419		Missense_Mutation	SNP	ENST00000221498.2	hg19	CCDS12762.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353860	0.41700	.	.	ENSG00000104901	ENST00000221498	T	0.12255	2.7	4.72	3.68	0.42216	.	0.570475	0.14682	N	0.304666	T	0.07638	0.0192	N	0.08118	0	0.30619	N	0.758645	D	0.53619	0.961	B	0.43950	0.437	T	0.08743	-1.0707	9	.	.	.	-3.2024	8.3814	0.32474	0.1131:0.0:0.8869:0.0	.	62	Q9UK85	DKKL1_HUMAN	C	62	ENSP00000221498:G62C	.	G	+	1	0	DKKL1	54560578	1.000000	0.71417	1.000000	0.80357	0.319000	0.28217	2.193000	0.42658	1.091000	0.41335	0.462000	0.41574	GGT	.	.	.	none		0.617	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465454.2	NM_014419	Missense_Mutation
CASS4	57091	hgsc.bcm.edu	37	20	55026927	55026927	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr20:55026927G>T	ENST00000360314.3	+	6	920	c.695G>T	c.(694-696)aGc>aTc	p.S232I	CASS4_ENST00000371336.3_Missense_Mutation_p.S232I|CASS4_ENST00000434344.1_Intron	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	232					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						GGCGGTTACAGCACATTACCA	0.502																																					p.S232I		Atlas-SNP	.											.	CASS4	121	.	0			c.G695T						PASS	.						62.0	58.0	60.0					20																	55026927		2203	4300	6503	SO:0001583	missense	57091	exon5			GTTACAGCACATT	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.695G>T	chr20.hg19:g.55026927G>T	ENSP00000353462:p.Ser232Ile	184.0	0.0	.		195.0	47.0	.	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	hg19	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210183	0.39003	.	.	ENSG00000087589	ENST00000360314;ENST00000371336	T;T	0.14022	2.54;2.54	5.23	-1.56	0.08532	.	0.840559	0.11112	N	0.598507	T	0.08802	0.0218	N	0.22421	0.69	0.22903	N	0.998584	B;B;B	0.26081	0.052;0.141;0.087	B;B;B	0.31547	0.033;0.132;0.046	T	0.38564	-0.9655	10	0.40728	T	0.16	-6.211	6.0264	0.19658	0.5951:0.125:0.2799:0.0	.	178;232;232	B4DII4;Q9NQ75-2;Q9NQ75	.;.;CASS4_HUMAN	I	232	ENSP00000353462:S232I;ENSP00000360387:S232I	ENSP00000353462:S232I	S	+	2	0	CASS4	54460334	0.006000	0.16342	0.001000	0.08648	0.046000	0.14306	0.119000	0.15626	-0.277000	0.09193	-0.253000	0.11424	AGC	.	.	.	none		0.502	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
LSM14B	149986	hgsc.bcm.edu	37	20	60704972	60704972	+	Missense_Mutation	SNP	G	G	C	rs139247673	byFrequency	TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr20:60704972G>C	ENST00000279068.6	+	4	719	c.559G>C	c.(559-561)Ggt>Cgt	p.G187R	LSM14B_ENST00000253001.4_Intron	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	187					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			GCAGCTCAACGGTCGTCAGGC	0.552																																					p.G187R		Atlas-SNP	.											.	LSM14B	62	.	0			c.G559C						PASS	.						32.0	35.0	34.0					20																	60704972		2076	4203	6279	SO:0001583	missense	149986	exon4			CTCAACGGTCGTC	AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.559G>C	chr20.hg19:g.60704972G>C	ENSP00000279068:p.Gly187Arg	115.0	0.0	.		139.0	32.0	.	NM_144703	Q6PFW8|Q96LH8	Missense_Mutation	SNP	ENST00000279068.6	hg19	CCDS46626.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400557	0.25291	.	.	ENSG00000149657	ENST00000279068;ENST00000444156;ENST00000400318;ENST00000279069;ENST00000370906;ENST00000361670	T;T;T	0.47528	0.86;0.84;0.85	5.59	2.61	0.31194	.	.	.	.	.	T	0.60560	0.2278	M	0.67953	2.075	0.23966	N	0.996323	P;D;P;P	0.89917	0.955;1.0;0.955;0.954	P;D;B;P	0.97110	0.513;1.0;0.416;0.62	T	0.51818	-0.8657	9	0.13470	T	0.59	.	9.7243	0.40322	0.271:0.0:0.729:0.0	.	107;143;187;213	E9PG81;C9J454;Q9BX40;Q5TBQ0	.;.;LS14B_HUMAN;.	R	187;143;213;187;143;107	ENSP00000279068:G187R;ENSP00000383172:G213R;ENSP00000355209:G107R	ENSP00000279068:G187R	G	+	1	0	LSM14B	60138367	0.931000	0.31567	0.462000	0.27118	0.111000	0.19643	2.157000	0.42320	0.321000	0.23259	0.555000	0.69702	GGT	.	G|0.990;A|0.010	.	alt		0.552	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4	NM_144703	
COL6A2	1292	hgsc.bcm.edu	37	21	47544599	47544599	+	Missense_Mutation	SNP	G	G	T	rs147158850	byFrequency	TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr21:47544599G>T	ENST00000300527.4	+	22	1810	c.1706G>T	c.(1705-1707)cGg>cTg	p.R569L	COL6A2_ENST00000310645.5_Missense_Mutation_p.R569L|COL6A2_ENST00000357838.4_Missense_Mutation_p.R569L|COL6A2_ENST00000397763.1_Missense_Mutation_p.R569L|COL6A2_ENST00000409416.1_Missense_Mutation_p.R569L	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	569	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCAGGCCCTCGGGGGCCAAGA	0.667																																					p.R569L		Atlas-SNP	.											.	COL6A2	351	.	0			c.G1706T						PASS	.						44.0	52.0	49.0					21																	47544599		2201	4300	6501	SO:0001583	missense	1292	exon22			GCCCTCGGGGGCC	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1706G>T	chr21.hg19:g.47544599G>T	ENSP00000300527:p.Arg569Leu	110.0	0.0	.		72.0	28.0	.	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	hg19	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814804	0.90790	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	D;D;D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46;-3.46;-3.21	4.08	4.08	0.47627	.	0.110157	0.64402	D	0.000015	D	0.96473	0.8849	M	0.64567	1.98	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.997	D	0.96914	0.9669	10	0.59425	D	0.04	-5.6344	16.3469	0.83138	0.0:0.0:1.0:0.0	.	569;569;569	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	L	569;569;569;569;569;110	ENSP00000300527:R569L;ENSP00000350497:R569L;ENSP00000312529:R569L;ENSP00000387115:R569L;ENSP00000380870:R569L;ENSP00000395751:R110L	ENSP00000300527:R569L	R	+	2	0	COL6A2	46369027	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	6.434000	0.73408	1.852000	0.53769	0.585000	0.79938	CGG	.	G|0.999;A|0.001	.	alt		0.667	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
SHANK3	85358	hgsc.bcm.edu	37	22	51160753	51160753	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr22:51160753A>T	ENST00000414786.2	+	21	4677	c.4450A>T	c.(4450-4452)Agc>Tgc	p.S1484C	SHANK3_ENST00000262795.3_Missense_Mutation_p.S1514C|SHANK3_ENST00000445220.2_Missense_Mutation_p.S1500C			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1498					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CAGTGAGCTCAGCTCCCGCCT	0.632																																					p.S1484C		Atlas-SNP	.											.	SHANK3	96	.	0			c.A4450T						PASS	.						25.0	29.0	28.0					22																	51160753		1937	4003	5940	SO:0001583	missense	85358	exon21			GAGCTCAGCTCCC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4450A>T	chr22.hg19:g.51160753A>T	ENSP00000464552:p.Ser1484Cys	182.0	0.0	.		148.0	53.0	.	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.99	3.522943	0.64747	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.54479	0.57;0.69	5.43	4.4	0.53042	.	0.045054	0.85682	D	0.000000	T	0.66626	0.2808	M	0.68952	2.095	0.29241	N	0.872645	D;D;D	0.89917	0.996;0.999;1.0	P;D;D	0.77557	0.819;0.99;0.956	T	0.63708	-0.6576	10	0.72032	D	0.01	.	8.8082	0.34952	0.9114:0.0:0.0886:0.0	.	1498;1499;1514	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	C	1514;1500	ENSP00000442518:S1514C;ENSP00000446078:S1500C	ENSP00000442518:S1514C	S	+	1	0	SHANK3	49507619	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.406000	0.73276	2.064000	0.61679	0.460000	0.39030	AGC	.	.	.	none		0.632	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
MT-ND1	4535	hgsc.bcm.edu	37	M	3791	3791	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chrM:3791T>C	ENST00000361390.2	+	1	485	c.485T>C	c.(484-486)cTc>cCc	p.L162P	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR1_ENST00000389680.2_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	162					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTCCTTTAACCTCTCCACCCT	0.458																																					p.L162P		Atlas-SNP	.											.	.	.	.	0			c.T485C						PASS	.																																			SO:0001583	missense	10625	exon1			TTAACCTCTCCAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.485T>C	chrM.hg19:g.3791T>C	ENSP00000354687:p.Leu162Pro	8.0	0.0	.		51.0	48.0	.	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.	.	none		0.458	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
APLF	200558	hgsc.bcm.edu	37	2	68740321	68740322	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr2:68740321_68740322insA	ENST00000303795.4	+	4	622_623	c.451_452insA	c.(451-453)gaafs	p.E151fs		NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	151					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						AGGAAGCACAGAAATAGCCAAG	0.376																																					p.E151fs		Atlas-Indel,Pindel	.											.	APLF	69	.	0			c.451_452insA						PASS	.																																			SO:0001589	frameshift_variant	200558	exon4			.	BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.454dupA	chr2.hg19:g.68740324_68740324dupA	ENSP00000307004:p.Glu151fs	113.0	0.0	0		127.0	35.0	0.275591	NM_173545	A8K476|Q53P47|Q53PB9|Q53QU0	Frame_Shift_Ins	INS	ENST00000303795.4	hg19	CCDS1888.1																																																																																			.	.	.	none		0.376	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545	
HSD17B1	3292	hgsc.bcm.edu	37	17	40706580	40706580	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr17:40706580delA	ENST00000585807.1	+	5	4417	c.697delA	c.(697-699)aacfs	p.N233fs	RP11-400F19.8_ENST00000585572.1_RNA|HSD17B1_ENST00000225929.5_Frame_Shift_Del_p.N234fs|RP11-400F19.6_ENST00000590513.1_RNA	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	233					bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	GGCGGCGCAGAACCCTGAGGA	0.692																																					p.Q232fs		Atlas-Indel,Pindel	.											.	HSD17B1	24	.	0			c.696delG						PASS	.						47.0	37.0	40.0					17																	40706580		2203	4300	6503	SO:0001589	frameshift_variant	3292	exon5			.		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.697delA	chr17.hg19:g.40706580delA	ENSP00000466799:p.Asn233fs	68.0	0.0	0		80.0	18.0	0.225	NM_000413	B3KXS1|Q2M2L8	Frame_Shift_Del	DEL	ENST00000585807.1	hg19	CCDS11428.1																																																																																			.	.	.	none		0.692	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450392.1	NM_000413	
TRPM1	4308	hgsc.bcm.edu	37	15	31294200	31294200	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr15:31294200delG	ENST00000256552.6	-	28	4850	c.4703delC	c.(4702-4704)ccafs	p.P1568fs	TRPM1_ENST00000542188.1_Frame_Shift_Del_p.P1585fs|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Frame_Shift_Del_p.P1546fs	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CCTGAGAGATGGGAATCCCAA	0.433																																					p.P1585fs		Atlas-Indel,Pindel	.											.	TRPM1	183	.	0			c.4755delA						PASS	.						205.0	187.0	193.0					15																	31294200		1890	4112	6002	SO:0001589	frameshift_variant	4308	exon27			.	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.4703delC	chr15.hg19:g.31294200delG	ENSP00000256552:p.Pro1568fs	84.0	0.0	0		74.0	20.0	0.27027	NM_001252020		Frame_Shift_Del	DEL	ENST00000256552.6	hg19	CCDS58346.1																																																																																			.	.	.	none		0.433	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
TTN	7273	hgsc.bcm.edu	37	2	179398278	179398278	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr2:179398278delG	ENST00000591111.1	-	308	98365	c.98141delC	c.(98140-98142)cctfs	p.P32715fs	TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Frame_Shift_Del_p.P25483fs|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN_ENST00000589042.1_Frame_Shift_Del_p.P34356fs|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Frame_Shift_Del_p.P25416fs|TTN-AS1_ENST00000585358.1_RNA|TTN_ENST00000460472.2_Frame_Shift_Del_p.P25291fs|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.P31788fs|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591867.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32715					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCTGTTGGAGGTGGGTGTAG	0.448																																					p.P34355fs		Atlas-Indel,Pindel	.											.	TTN	18412	.	0			c.103065delT						PASS	.						110.0	97.0	101.0					2																	179398278		1962	4174	6136	SO:0001589	frameshift_variant	7273	exon358			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98141delC	chr2.hg19:g.179398278delG	ENSP00000465570:p.Pro32715fs	83.0	0.0	0		90.0	52.0	0.577778	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PPIL1	51645	hgsc.bcm.edu	37	6	36823708	36823708	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr6:36823708delT	ENST00000373699.5	-	4	633	c.382delA	c.(382-384)attfs	p.I128fs	PPIL1_ENST00000483552.1_5'UTR	NM_016059.4	NP_057143.1	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 1	128	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			lung(1)|ovary(1)	2						CGGCCAAAAATGGTGTGTTTG	0.552																																					p.I128fs		Atlas-Indel,Pindel	.											.	PPIL1	6	.	0			c.383delT						PASS	.						90.0	79.0	83.0					6																	36823708		2203	4300	6503	SO:0001589	frameshift_variant	51645	exon4			.	AF090992	CCDS4826.1	6p21.1	2008-08-29			ENSG00000137168	ENSG00000137168			9260	protein-coding gene	gene with protein product		601301				10072585, 8978786	Standard	NM_016059		Approved	CYPL1	uc003omu.2	Q9Y3C6	OTTHUMG00000014612	ENST00000373699.5:c.382delA	chr6.hg19:g.36823708delT	ENSP00000362803:p.Ile128fs	106.0	0.0	0		78.0	27.0	0.346154	NM_016059	O15001|Q5TDC9	Frame_Shift_Del	DEL	ENST00000373699.5	hg19	CCDS4826.1																																																																																			.	.	.	none		0.552	PPIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040382.1		
AGO2	27161	hgsc.bcm.edu	37	8	141554392	141554393	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr8:141554392_141554393delAC	ENST00000220592.5	-	14	1870_1871	c.1758_1759delGT	c.(1756-1761)gtgttcfs	p.F587fs	AGO2_ENST00000519980.1_Frame_Shift_Del_p.F587fs	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	587	Interaction with GW182 family members. {ECO:0000255}.|Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GGCTGCTGGAACACCGGCGGCC	0.653																																					p.587_587del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1759_1760del						PASS	.																																			SO:0001589	frameshift_variant	27161	exon14			.	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1758_1759delGT	chr8.hg19:g.141554394_141554395delAC	ENSP00000220592:p.Phe587fs	42.0	0.0	0		38.0	12.0	0.315789	NM_012154	Q8TCZ5|Q8WV58|Q96ID1	Frame_Shift_Del	DEL	ENST00000220592.5	hg19	CCDS6380.1																																																																																			.	.	.	none		0.653	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4		
SPDL1	54908	hgsc.bcm.edu	37	5	169018070	169018071	+	Frame_Shift_Ins	INS	-	-	G	rs535922596		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr5:169018070_169018071insG	ENST00000265295.4	+	3	457_458	c.178_179insG	c.(178-180)tatfs	p.Y60fs	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		ACAAGAAAAATATACCCTTCAA	0.312																																					p.Y60_T61delinsX		Atlas-Indel,Pindel	.											.	.	.	.	0			c.178_179insG						PASS	.																																			SO:0001589	frameshift_variant	54908	exon3			.	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	Exception_encountered	chr5.hg19:g.169018070_169018071insG	ENSP00000265295:p.Tyr60fs	194.0	0.0	0		146.0	59.0	0.40411	NM_017785		Frame_Shift_Ins	INS	ENST00000265295.4	hg19	CCDS4370.1																																																																																			.	.	.	none		0.312	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
RSF1	51773	hgsc.bcm.edu	37	11	77378053	77378054	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr11:77378053_77378054insCA	ENST00000308488.6	-	16	4536_4537	c.4234_4235insTG	c.(4234-4236)gggfs	p.G1412fs	RSF1_ENST00000360355.2_Frame_Shift_Ins_p.G1381fs|RSF1_ENST00000480887.1_Frame_Shift_Ins_p.G1160fs			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1412					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TGCCTCCTGCCCACCACTTGTC	0.485																																					p.G1412fs		Atlas-Indel,Pindel	.											.	RSF1	105	.	0			c.4235_4236insTG						PASS	.																																			SO:0001589	frameshift_variant	51773	exon16			.	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.4233_4234dupTG	chr11.hg19:g.77378054_77378055dupCA	ENSP00000311513:p.Gly1412fs	76.0	0.0	0		103.0	30.0	0.291262	NM_016578	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Frame_Shift_Ins	INS	ENST00000308488.6	hg19	CCDS8253.1																																																																																			.	.	.	none		0.485	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
NEFH	4744	hgsc.bcm.edu	37	22	29885584	29885585	+	In_Frame_Ins	INS	-	-	CAAGTCCCCTGAGAAGGC	rs200984527|rs267607533		TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr22:29885584_29885585insCAAGTCCCCTGAGAAGGC	ENST00000310624.6	+	4	1988_1989	c.1955_1956insCAAGTCCCCTGAGAAGGC	c.(1954-1959)gccaag>gcCAAGTCCCCTGAGAAGGCcaag	p.652_653AK>AKSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCTGAGAAGGCCAAGTCCCCAG	0.559																																					p.A652delinsAKSPEKA		Atlas-INDEL	.											.,1	NEFH	178	.	0			c.1955_1956insCAAGTCCCCTGAGAAGGC						PASS	.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	chr22.hg19:g.29885584_29885585insCAAGTCCCCTGAGAAGGC	ENSP00000311997:p.Lys647_Ala652dup	138.0	0.0	0		158.0	39.0	0.246835	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.	.	none		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
KCNT2	343450	hgsc.bcm.edu	37	1	196303029	196303029	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:196303029delC	ENST00000294725.9	-	17	2860	c.1945delG	c.(1945-1947)gacfs	p.D649fs	KCNT2_ENST00000609185.1_Frame_Shift_Del_p.D599fs|KCNT2_ENST00000367431.4_Frame_Shift_Del_p.D599fs|KCNT2_ENST00000367433.5_Frame_Shift_Del_p.D649fs|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Frame_Shift_Del_p.D260fs			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	649					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCTGATTGGTCACTTAGAAGA	0.373																																					p.D649fs		Atlas-Indel,Pindel	.											.	KCNT2	243	.	0			c.1946delA						PASS	.						144.0	134.0	137.0					1																	196303029		2203	4300	6503	SO:0001589	frameshift_variant	343450	exon17			.	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1945delG	chr1.hg19:g.196303029delC	ENSP00000294725:p.Asp649fs	68.0	0.0	0		55.0	21.0	0.381818	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Frame_Shift_Del	DEL	ENST00000294725.9	hg19	CCDS1384.1																																																																																			.	.	.	none		0.373	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
CTAGE1	64693	hgsc.bcm.edu	37	18	19995661	19995661	+	5'Flank	DEL	G	G	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr18:19995661delG	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Frame_Shift_Del_p.S705fs			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					ATCCCTTGGAGAAAAATAATC	0.493																																					p.S705fs		Atlas-Indel,Pindel	.											.	CTAGE1	146	.	0			c.2115delT						PASS	.						54.0	60.0	58.0					18																	19995661		2125	4239	6364	SO:0001631	upstream_gene_variant	64693	exon1			.	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			chr18.hg19:g.19995661delG	Exception_encountered	114.0	0.0	0		109.0	33.0	0.302752	NM_172241	B0YIZ3	Frame_Shift_Del	DEL	ENST00000525417.1	hg19																																																																																				.	.	.	none		0.493	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241	
USP14	9097	hgsc.bcm.edu	37	18	192871	192871	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr18:192871delA	ENST00000261601.7	+	6	525	c.434delA	c.(433-435)gaafs	p.E145fs	USP14_ENST00000383589.2_Frame_Shift_Del_p.E99fs|USP14_ENST00000582707.1_Frame_Shift_Del_p.E110fs|USP14_ENST00000400266.3_Frame_Shift_Del_p.E134fs	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	145	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				GCTTCAGGGGAAATGGCTTCA	0.378																																					p.E145fs		Atlas-Indel,Pindel	.											.	USP14	41	.	0			c.433delG						PASS	.						179.0	176.0	177.0					18																	192871		2203	4300	6503	SO:0001589	frameshift_variant	9097	exon6			.	U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.434delA	chr18.hg19:g.192871delA	ENSP00000261601:p.Glu145fs	79.0	0.0	0		77.0	34.0	0.441558	NM_005151	J3QRZ5|Q53XY5	Frame_Shift_Del	DEL	ENST00000261601.7	hg19	CCDS32780.1																																																																																			.	.	.	none		0.378	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440305.3	NM_005151	
OBSCN	84033	hgsc.bcm.edu	37	1	228521014	228521017	+	Frame_Shift_Del	DEL	CAAG	CAAG	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	CAAG	CAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:228521014_228521017delCAAG	ENST00000422127.1	+	58	15890_15893	c.15846_15849delCAAG	c.(15844-15849)ctcaagfs	p.LK5282fs	OBSCN_ENST00000284548.11_Frame_Shift_Del_p.LK5282fs|OBSCN_ENST00000570156.2_Frame_Shift_Del_p.LK6239fs|OBSCN_ENST00000366709.4_Frame_Shift_Del_p.LK2401fs|OBSCN_ENST00000366707.4_Frame_Shift_Del_p.LK2916fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5282	Ig-like 50.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGTTCCAGCTCAAGGTGAAAGGTG	0.613																																					p.6239_6240del		Atlas-Indel,Pindel	.											.	OBSCN	2142	.	0			c.18716_18719del						PASS	.																																			SO:0001589	frameshift_variant	84033	exon69			.	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15846_15849delCAAG	chr1.hg19:g.228521014_228521017delCAAG	ENSP00000409493:p.Leu5282fs	99.0	0.0	0		81.0	34.0	0.419753	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Del	DEL	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.	.	none		0.613	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
MAGEC1	9947	hgsc.bcm.edu	37	X	140993981	140994085	+	In_Frame_Del	DEL	CCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	CCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	-	rs144495362|rs77648555|rs146798989|rs143600642|rs138695129|rs150017439|rs176043|rs176045|rs176044|rs146036055|rs386828015|rs112112998|rs80051600|rs78189215|rs150327147|rs75148863|rs176046|rs140075882|rs200821167|rs149195933|rs141817885	byFrequency	TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	CCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	CCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chrX:140993981_140994085delCCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	ENST00000285879.4	+	4	1077_1181	c.791_895delCCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	c.(790-897)gcccagtcttctctccagattcctgtgagcccctccttctcctccactttagtgagtcttttccagagttcccctgagagaactcagagtacttttgagggttttccc>gcc	p.QSSLQIPVSPSFSSTLVSLFQSSPERTQSTFEGFP265del	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	265								p.Q265K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGGTTTTGCCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTCCCCAGTCTCC	0.495										HNSCC(15;0.026)																											p.264_298del		Pindel	.											.	MAGEC1	317	.	1	Substitution - Missense(1)	lung(1)	c.790_894del						PASS	.																																			SO:0001651	inframe_deletion	9947	exon4			.	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.791_895delCCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	chrX.hg19:g.140993981_140994085delCCCAGTCTTCTCTCCAGATTCCTGTGAGCCCCTCCTTCTCCTCCACTTTAGTGAGTCTTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTC	ENSP00000285879:p.Gln265_Pro299del	273.0	0.0	.		251.0	19.0	0.076	NM_005462	A0PK03|O75451|Q8TCV4	In_Frame_Del	DEL	ENST00000285879.4	hg19	CCDS35417.1																																																																																			.	.	.	none		0.495	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
CR1	1378	hgsc.bcm.edu	37	1	207734400	207734405	+	In_Frame_Del	DEL	TGGCTT	TGGCTT	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	TGGCTT	TGGCTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:207734400_207734405delTGGCTT	ENST00000367049.4	+	21	3504_3509	c.3504_3509delTGGCTT	c.(3502-3510)cctggcttt>cct	p.GF1169del	CR1_ENST00000367052.1_Intron|CR1_ENST00000367053.1_In_Frame_Del_p.GF719del|CR1_ENST00000400960.2_Intron|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000367051.1_In_Frame_Del_p.GF719del	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	719	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GGTGTCAGCCTGGCTTTGTCATGAAA	0.49																																					p.1168_1170del		Pindel	.											.	CR1	354	.	0			c.3503_3508del						PASS	.																																			SO:0001651	inframe_deletion	1378	exon21			.	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.3504_3509delTGGCTT	chr1.hg19:g.207734400_207734405delTGGCTT	ENSP00000356016:p.Gly1169_Phe1170del	174.0	0.0	.		119.0	20.0	0.168	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	In_Frame_Del	DEL	ENST00000367049.4	hg19	CCDS44308.1																																																																																			.	.	.	none		0.490	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
CR1	1378	hgsc.bcm.edu	37	1	207715843	207715848	+	In_Frame_Del	DEL	TGGCTT	TGGCTT	-			TCGA-SX-A71V-01A-11D-A33Q-10	TCGA-SX-A71V-10A-01D-A33Q-10	TGGCTT	TGGCTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7879708e-a807-4002-9d4d-efc84d51a4e5	af4acae0-89a6-4004-ad5b-149db143f98b	g.chr1:207715843_207715848delTGGCTT	ENST00000367049.4	+	13	2154_2159	c.2154_2159delTGGCTT	c.(2152-2160)cctggcttt>cct	p.GF719del	CR1_ENST00000367052.1_In_Frame_Del_p.GF719del|CR1_ENST00000367053.1_Intron|CR1_ENST00000400960.2_In_Frame_Del_p.GF719del|CR1_ENST00000367050.4_Intron|CR1_ENST00000367051.1_In_Frame_Del_p.GF269del	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	269	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GGTGTCAGCCTGGCTTTGTCATGAAA	0.49																																					p.718_720del		Pindel	.											.	CR1	354	.	0			c.2153_2158del						PASS	.																																			SO:0001651	inframe_deletion	1378	exon13			.	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.2154_2159delTGGCTT	chr1.hg19:g.207715843_207715848delTGGCTT	ENSP00000356016:p.Gly719_Phe720del	194.0	0.0	.		140.0	16.0	0.114	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	In_Frame_Del	DEL	ENST00000367049.4	hg19	CCDS44308.1																																																																																			.	.	.	none		0.490	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
