#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NRD1	4898	hgsc.bcm.edu	37	1	52306066	52306066	+	Missense_Mutation	SNP	T	T	A	rs397701944|rs35723519|rs72663147|rs60220085	byFrequency	TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr1:52306066T>A	ENST00000354831.7	-	2	651	c.462A>T	c.(460-462)gaA>gaT	p.E154D	NRD1_ENST00000539524.1_Missense_Mutation_p.E22D|NRD1_ENST00000352171.7_Missense_Mutation_p.E154D|NRD1_ENST00000544028.1_Missense_Mutation_p.E22D|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.E154D(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						catcatcatcttcttcttctt	0.383																																					p.E154D		Atlas-SNP	.											NRD1,NS,other,0,1	NRD1	89	.	1	Substitution - Missense(1)	pancreas(1)	c.A462T						PASS	.						133.0	87.0	102.0					1																	52306066		2197	4279	6476	SO:0001583	missense	4898	exon2			ATCATCTTCTTCT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.462A>T	chr1.hg19:g.52306066T>A	ENSP00000346890:p.Glu154Asp	199.0	1.0	.		149.0	12.0	.	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	3.657	-0.070254	0.07228	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.35236	1.5;3.33;1.32;1.47	4.18	-8.37	0.00976	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	.	.	.	.	T	0.13713	0.0332	.	.	.	0.27047	N	0.963871	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.30387	-0.9980	8	0.10111	T	0.7	-0.1322	7.3006	0.26418	0.2722:0.0:0.1296:0.5982	.	154;153;154	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	D	154;154;22;154;22	ENSP00000262679:E154D;ENSP00000346890:E154D;ENSP00000444416:E22D;ENSP00000442262:E22D	ENSP00000262679:E154D	E	-	3	2	NRD1	52078654	0.054000	0.20591	0.259000	0.24435	0.479000	0.33129	-0.582000	0.05814	-1.768000	0.01298	-0.542000	0.04241	GAA	.	.	.	weak		0.383	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
LRPPRC	10128	hgsc.bcm.edu	37	2	44139609	44139609	+	Silent	SNP	T	T	C			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr2:44139609T>C	ENST00000260665.7	-	30	3294	c.3237A>G	c.(3235-3237)tcA>tcG	p.S1079S		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1079					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AATAATCTTCTGACATCAGTA	0.328																																					p.S1079S		Atlas-SNP	.											.	LRPPRC	105	.	0			c.A3237G						PASS	.						117.0	113.0	114.0					2																	44139609		2202	4297	6499	SO:0001819	synonymous_variant	10128	exon30			ATCTTCTGACATC	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3237A>G	chr2.hg19:g.44139609T>C		363.0	0.0	.		210.0	80.0	.	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	ENST00000260665.7	hg19	CCDS33189.1																																																																																			.	.	.	none		0.328	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
SMEK2	57223	hgsc.bcm.edu	37	2	55805411	55805411	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr2:55805411A>T	ENST00000345102.5	-	10	1837	c.1536T>A	c.(1534-1536)caT>caA	p.H512Q	SMEK2_ENST00000272313.5_Intron|SMEK2_ENST00000407823.3_Intron	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	512					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			agggggtagaatgggaatggg	0.323																																					p.H512Q		Atlas-SNP	.											.	SMEK2	86	.	0			c.T1536A						PASS	.						111.0	113.0	112.0					2																	55805411		692	1591	2283	SO:0001583	missense	57223	exon10			GGTAGAATGGGAA	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1536T>A	chr2.hg19:g.55805411A>T	ENSP00000339769:p.His512Gln	189.0	0.0	.		119.0	55.0	.	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	hg19	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	A	3.267	-0.149862	0.06585	.	.	ENSG00000138041	ENST00000345102	T	0.40225	1.04	1.84	0.645	0.17782	Armadillo-type fold (1);	1.447810	0.05139	U	0.493933	T	0.20577	0.0495	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18085	-1.0348	10	0.18710	T	0.47	.	3.6958	0.08364	0.7972:0.0:0.2028:0.0	.	512	Q5MIZ7	P4R3B_HUMAN	Q	512	ENSP00000339769:H512Q	ENSP00000339769:H512Q	H	-	3	2	SMEK2	55658915	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	0.114000	0.15520	0.187000	0.20147	0.383000	0.25322	CAT	.	.	.	none		0.323	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
DPP10	57628	hgsc.bcm.edu	37	2	116497451	116497451	+	Silent	SNP	G	G	A	rs541980291		TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr2:116497451G>A	ENST00000410059.1	+	9	1314	c.834G>A	c.(832-834)aaG>aaA	p.K278K	DPP10_ENST00000310323.8_Silent_p.K271K|DPP10_ENST00000409163.1_Silent_p.K228K|DPP10_ENST00000393147.2_Silent_p.K282K	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	278						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CCAAAGGAAAGCAGTATCCGT	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		20710	0.0		0.0	False		,,,				2504	0.001				p.K282K		Atlas-SNP	.											.	DPP10	415	.	0			c.G846A						PASS	.						222.0	197.0	205.0					2																	116497451		2203	4300	6503	SO:0001819	synonymous_variant	57628	exon9			AGGAAAGCAGTAT	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.834G>A	chr2.hg19:g.116497451G>A		175.0	0.0	.		87.0	7.0	.	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	hg19	CCDS46400.1																																																																																			.	.	.	none		0.433	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
GPR148	344561	hgsc.bcm.edu	37	2	131487490	131487490	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr2:131487490T>C	ENST00000309926.4	+	1	848	c.766T>C	c.(766-768)Tat>Cat	p.Y256H		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					GGGGCAGGGCTATTCCCGGGC	0.567																																					p.Y256H		Atlas-SNP	.											.	GPR148	54	.	0			c.T766C						PASS	.						122.0	116.0	118.0					2																	131487490		2203	4300	6503	SO:0001583	missense	344561	exon1			CAGGGCTATTCCC	AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.766T>C	chr2.hg19:g.131487490T>C	ENSP00000308908:p.Tyr256His	66.0	0.0	.		39.0	17.0	.	NM_207364	Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	ENST00000309926.4	hg19	CCDS2163.1	.	.	.	.	.	.	.	.	.	.	.	14.59	2.581074	0.46006	.	.	ENSG00000173302	ENST00000309926	T	0.36340	1.26	2.87	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.119947	0.34932	U	0.003580	T	0.31734	0.0806	N	0.19112	0.55	0.27290	N	0.957872	D	0.55385	0.971	P	0.55161	0.77	T	0.08330	-1.0727	10	0.23302	T	0.38	-0.0036	9.4681	0.38824	0.0:0.0:0.0:1.0	.	256	Q8TDV2	GP148_HUMAN	H	256	ENSP00000308908:Y256H	ENSP00000308908:Y256H	Y	+	1	0	GPR148	131203960	0.837000	0.29446	0.200000	0.23457	0.707000	0.40811	3.721000	0.54941	1.276000	0.44395	0.379000	0.24179	TAT	.	.	.	none		0.567	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092	
SGOL2	151246	hgsc.bcm.edu	37	2	201436485	201436485	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr2:201436485A>T	ENST00000357799.4	+	7	1514	c.1416A>T	c.(1414-1416)aaA>aaT	p.K472N		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	472					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						AACTAAAGAAAATGACCCTTC	0.388																																					p.K472N		Atlas-SNP	.											.	SGOL2	126	.	0			c.A1416T						PASS	.						151.0	151.0	151.0					2																	201436485		1827	4081	5908	SO:0001583	missense	151246	exon7			AAAGAAAATGACC	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.1416A>T	chr2.hg19:g.201436485A>T	ENSP00000350447:p.Lys472Asn	130.0	0.0	.		87.0	46.0	.	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	hg19	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	A	11.53	1.667269	0.29604	.	.	ENSG00000163535	ENST00000357799	T	0.49720	0.77	5.15	3.92	0.45320	.	0.504521	0.19999	N	0.101377	T	0.40886	0.1135	L	0.50333	1.59	0.23371	N	0.997817	P;P;P	0.40431	0.717;0.717;0.717	B;B;B	0.37198	0.243;0.243;0.243	T	0.45818	-0.9235	10	0.72032	D	0.01	-6.3242	11.4245	0.50003	0.8502:0.1498:0.0:0.0	.	472;472;472	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	N	472	ENSP00000350447:K472N	ENSP00000350447:K472N	K	+	3	2	SGOL2	201144730	0.018000	0.18449	0.053000	0.19242	0.163000	0.22366	0.469000	0.22067	2.285000	0.76669	0.477000	0.44152	AAA	.	.	.	none		0.388	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
UGT1A4	54657	hgsc.bcm.edu	37	2	234627924	234627924	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr2:234627924C>G	ENST00000373409.3	+	1	501	c.458C>G	c.(457-459)cCc>cGc	p.P153R	UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A10_ENST00000344644.5_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	153					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	TTAACAGACCCCGTTAACCTC	0.483																																					p.P153R	Melanoma(99;1011 1962 13201 26492)	Atlas-SNP	.											.	UGT1A4	63	.	0			c.C458G						PASS	.						186.0	187.0	186.0					2																	234627924		2203	4300	6503	SO:0001583	missense	54657	exon1			CAGACCCCGTTAA	M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.458C>G	chr2.hg19:g.234627924C>G	ENSP00000362508:p.Pro153Arg	303.0	0.0	.		174.0	57.0	.	NM_007120	B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	ENST00000373409.3	hg19	CCDS33405.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.408615	0.62399	.	.	ENSG00000244474	ENST00000373409	T	0.64085	-0.08	4.31	3.41	0.39046	.	.	.	.	.	D	0.82323	0.5012	M	0.92026	3.265	0.39588	D	0.96953	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86763	0.1968	9	0.87932	D	0	.	14.1475	0.65360	0.0:0.8489:0.1511:0.0	.	153;153	B8K288;P22310	.;UD14_HUMAN	R	153	ENSP00000362508:P153R	ENSP00000362508:P153R	P	+	2	0	UGT1A4	234292663	0.664000	0.27457	0.002000	0.10522	0.002000	0.02628	3.930000	0.56522	0.764000	0.33197	0.491000	0.48974	CCC	.	.	.	none		0.483	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130984.1	NM_007120	
SH3BP5	9467	hgsc.bcm.edu	37	3	15298489	15298489	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr3:15298489C>T	ENST00000383791.3	-	8	1241	c.1021G>A	c.(1021-1023)Gtt>Att	p.V341I	SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA|SH3BP5_ENST00000253688.5_Missense_Mutation_p.V184I|SH3BP5_ENST00000426925.1_Missense_Mutation_p.V184I|SH3BP5_ENST00000408919.3_Missense_Mutation_p.V184I	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	341	Ser-rich.				intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GGCCTCACAACCGCAGGGAAC	0.572																																					p.V341I		Atlas-SNP	.											.	SH3BP5	32	.	0			c.G1021A						PASS	.						79.0	68.0	71.0					3																	15298489		2203	4300	6503	SO:0001583	missense	9467	exon8			TCACAACCGCAGG	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.1021G>A	chr3.hg19:g.15298489C>T	ENSP00000373301:p.Val341Ile	92.0	0.0	.		63.0	20.0	.	NM_004844	B3KQW6|Q5JWV9	Missense_Mutation	SNP	ENST00000383791.3	hg19	CCDS2625.2	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800873	0.31869	.	.	ENSG00000131370	ENST00000383791;ENST00000426925;ENST00000253688;ENST00000408919	.	.	.	5.43	4.56	0.56223	.	0.475884	0.23055	N	0.052451	T	0.41073	0.1143	L	0.40543	1.245	0.26692	N	0.971326	B	0.12630	0.006	B	0.11329	0.006	T	0.38650	-0.9651	9	0.56958	D	0.05	-13.6705	13.829	0.63368	0.0:0.9254:0.0:0.0746	.	341	O60239	3BP5_HUMAN	I	341;184;184;184	.	ENSP00000253688:V184I	V	-	1	0	SH3BP5	15273493	0.048000	0.20356	0.036000	0.18154	0.411000	0.31082	3.448000	0.52943	1.314000	0.45095	0.456000	0.33151	GTT	.	.	.	none		0.572	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340740.2	NM_004844	
KIAA0232	9778	hgsc.bcm.edu	37	4	6865878	6865878	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr4:6865878G>T	ENST00000307659.5	+	7	4224	c.3769G>T	c.(3769-3771)Gat>Tat	p.D1257Y	KIAA0232_ENST00000425103.1_Missense_Mutation_p.D1257Y	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	1257							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TGCTTATGAAGATAATCCAGT	0.393																																					p.D1257Y		Atlas-SNP	.											.	KIAA0232	102	.	0			c.G3769T						PASS	.						84.0	76.0	78.0					4																	6865878		1863	4110	5973	SO:0001583	missense	9778	exon7			TATGAAGATAATC	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.3769G>T	chr4.hg19:g.6865878G>T	ENSP00000303928:p.Asp1257Tyr	141.0	0.0	.		91.0	34.0	.	NM_014743	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	hg19	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289279	0.80914	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.43	5.43	0.79202	.	0.200580	0.43919	D	0.000507	T	0.63438	0.2511	N	0.24115	0.695	0.52501	D	0.999958	D	0.63046	0.992	P	0.60473	0.875	T	0.67628	-0.5622	9	0.87932	D	0	-33.6837	19.1974	0.93695	0.0:0.0:1.0:0.0	.	1257	Q92628	K0232_HUMAN	Y	1257	.	ENSP00000303928:D1257Y	D	+	1	0	KIAA0232	6916779	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	4.717000	0.61923	2.708000	0.92522	0.655000	0.94253	GAT	.	.	.	none		0.393	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
ALB	213	hgsc.bcm.edu	37	4	74277773	74277773	+	Silent	SNP	A	A	G			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr4:74277773A>G	ENST00000503124.1	+	5	531	c.324A>G	c.(322-324)ttA>ttG	p.L108L	ALB_ENST00000295897.4_Silent_p.L258L|ALB_ENST00000415165.2_Silent_p.L66L|ALB_ENST00000401494.3_Silent_p.L143L|ALB_ENST00000509063.1_Silent_p.L258L|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTTCCAAGTTAGTGACAGATC	0.448																																					p.L258L		Atlas-SNP	.											.	ALB	132	.	0			c.A774G						PASS	.						163.0	154.0	157.0					4																	74277773		2203	4300	6503	SO:0001819	synonymous_variant	213	exon7			CAAGTTAGTGACA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.324A>G	chr4.hg19:g.74277773A>G		131.0	0.0	.		78.0	29.0	.	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Silent	SNP	ENST00000503124.1	hg19		.	.	.	.	.	.	.	.	.	.	A	5.075	0.199470	0.09652	.	.	ENSG00000163631	ENST00000511370	.	.	.	6.02	-2.56	0.06268	.	.	.	.	.	T	0.18635	0.0447	.	.	.	0.23320	N	0.997914	.	.	.	.	.	.	T	0.26292	-1.0107	4	.	.	.	-0.2498	1.6874	0.02845	0.2818:0.1219:0.3593:0.237	.	.	.	.	G	103	.	.	S	+	1	0	ALB	74496637	0.041000	0.20044	0.019000	0.16419	0.625000	0.37756	-0.401000	0.07232	-0.286000	0.09076	0.533000	0.62120	AGT	.	.	.	none		0.448	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ITGA1	3672	hgsc.bcm.edu	37	5	52235508	52235508	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr5:52235508G>A	ENST00000282588.6	+	25	3625	c.3167G>A	c.(3166-3168)cGa>cAa	p.R1056Q	CTD-2175A23.1_ENST00000505701.1_RNA|CTD-2175A23.1_ENST00000503559.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1056					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				CATCTCAAACGAGGCACAATT	0.333																																					p.R1056Q		Atlas-SNP	.											.	ITGA1	112	.	0			c.G3167A						PASS	.						73.0	71.0	72.0					5																	52235508		2203	4300	6503	SO:0001583	missense	3672	exon25			TCAAACGAGGCAC	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3167G>A	chr5.hg19:g.52235508G>A	ENSP00000282588:p.Arg1056Gln	186.0	0.0	.		108.0	7.0	.	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	hg19	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	G	8.692	0.907639	0.17833	.	.	ENSG00000213949	ENST00000282588	T	0.46819	0.86	6.05	2.19	0.27852	.	0.307081	0.26553	N	0.023732	T	0.35941	0.0949	L	0.40543	1.245	0.26987	N	0.965229	B	0.22276	0.067	B	0.24541	0.054	T	0.24440	-1.0160	10	0.40728	T	0.16	.	8.7957	0.34878	0.1521:0.1263:0.7215:0.0	.	1056	P56199	ITA1_HUMAN	Q	1056	ENSP00000282588:R1056Q	ENSP00000282588:R1056Q	R	+	2	0	ITGA1	52271265	0.253000	0.23982	1.000000	0.80357	0.146000	0.21551	-0.082000	0.11304	0.449000	0.26747	-0.961000	0.02630	CGA	.	.	.	none		0.333	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
GCNT2	2651	hgsc.bcm.edu	37	6	10529942	10529942	+	Nonsense_Mutation	SNP	C	C	G	rs377397535		TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr6:10529942C>G	ENST00000379597.3	+	1	1354	c.798C>G	c.(796-798)taC>taG	p.Y266*	GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_Nonsense_Mutation_p.Y266*			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	266					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		GCACGGCCTACGTGGCTCTCA	0.458																																					p.Y266X		Atlas-SNP	.											.	GCNT2	123	.	0			c.C798G						PASS	.						135.0	128.0	130.0					6																	10529942		2203	4300	6503	SO:0001587	stop_gained	2651	exon3			GGCCTACGTGGCT	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.798C>G	chr6.hg19:g.10529942C>G	ENSP00000368917:p.Tyr266*	95.0	0.0	.		35.0	11.0	.	NM_145649		Nonsense_Mutation	SNP	ENST00000379597.3	hg19	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	C	40	8.527037	0.98850	.	.	ENSG00000111846	ENST00000495262;ENST00000379597	.	.	.	5.7	-2.52	0.06346	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.0933	13.3481	0.60587	0.0:0.4988:0.0:0.5012	.	.	.	.	X	266	.	ENSP00000368917:Y266X	Y	+	3	2	GCNT2	10637928	0.061000	0.20836	0.972000	0.41901	0.910000	0.53928	-0.622000	0.05553	-0.685000	0.05177	-1.072000	0.02254	TAC	.	.	.	alt		0.458	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
MRPS18A	55168	hgsc.bcm.edu	37	6	43646267	43646267	+	Silent	SNP	C	C	T	rs568509997		TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr6:43646267C>T	ENST00000372133.3	-	3	251	c.240G>A	c.(238-240)aaG>aaA	p.K80K	MRPS18A_ENST00000372116.1_Silent_p.K80K	NM_018135.3	NP_060605.1	Q9NVS2	RT18A_HUMAN	mitochondrial ribosomal protein S18A	80					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			kidney(3)|large_intestine(1)	4	all_cancers(18;6.56e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000479)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0102)|OV - Ovarian serous cystadenocarcinoma(102;0.137)			CATAGTTATACTTGTGCTTCA	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20679	0.0		0.0	False		,,,				2504	0.0				p.K80K		Atlas-SNP	.											.	MRPS18A	14	.	0			c.G240A						PASS	.						114.0	96.0	102.0					6																	43646267		2203	4300	6503	SO:0001819	synonymous_variant	55168	exon3			GTTATACTTGTGC	AB049952	CCDS4906.1, CCDS55006.1	6p21.3	2012-09-13			ENSG00000096080	ENSG00000096080		"""Mitochondrial ribosomal proteins / small subunits"""	14515	protein-coding gene	gene with protein product		611981				11279123, 11543634	Standard	NM_018135		Approved	FLJ10548, MRPS18-3	uc003ovy.2	Q9NVS2	OTTHUMG00000014750	ENST00000372133.3:c.240G>A	chr6.hg19:g.43646267C>T		86.0	0.0	.		57.0	21.0	.	NM_001193343	A6XND3|Q5QPA4	Silent	SNP	ENST00000372133.3	hg19	CCDS4906.1																																																																																			.	.	.	none		0.527	MRPS18A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040697.1	NM_018135	
CFTR	1080	hgsc.bcm.edu	37	7	117232346	117232346	+	Silent	SNP	C	C	A	rs121908760|rs35722447		TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr7:117232346C>A	ENST00000003084.6	+	14	2257	c.2125C>A	c.(2125-2127)Cga>Aga	p.R709R	CFTR_ENST00000454343.1_Silent_p.R648R	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	709					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	CAACTCTATACGAAAATTTTC	0.383									Cystic Fibrosis																												p.R709R		Atlas-SNP	.											.	CFTR	171	.	0			c.C2125A	GRCh37	CM950248	CFTR	M	rs121908760	PASS	.						42.0	43.0	43.0					7																	117232346		2203	4300	6503	SO:0001819	synonymous_variant	1080	exon14	Familial Cancer Database	CF	TCTATACGAAAAT	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2125C>A	chr7.hg19:g.117232346C>A		78.0	0.0	.		66.0	17.0	.	NM_000492	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Silent	SNP	ENST00000003084.6	hg19	CCDS5773.1																																																																																			.	.	.	alt		0.383	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
SPAG11B	10407	hgsc.bcm.edu	37	8	7320361	7320361	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr8:7320361C>T	ENST00000297498.2	-	2	248	c.82G>A	c.(82-84)Gtg>Atg	p.V28M	SPAG11B_ENST00000361111.2_Missense_Mutation_p.V28M|SPAG11B_ENST00000359758.5_Missense_Mutation_p.V28M|SPAG11B_ENST00000317900.5_Missense_Mutation_p.V28M|SPAG11B_ENST00000398462.2_Missense_Mutation_p.V28M	NM_016512.3	NP_057596.1	Q08648	SG11B_HUMAN	sperm associated antigen 11B	28					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				large_intestine(2)|lung(3)|urinary_tract(1)	6				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GAGTGGTTCACATGTCTGGCT	0.587																																					p.V28M		Atlas-SNP	.											SPAG11B_ENST00000398462,NS,carcinoma,0,3	SPAG11B	32	.	0			c.G82A						PASS	.						94.0	103.0	100.0					8																	7320361		2201	4295	6496	SO:0001583	missense	10407	exon2			GGTTCACATGTCT	AF168616	CCDS5964.1, CCDS5965.1, CCDS5966.1, CCDS5967.1, CCDS47774.1	8p23.1	2014-02-21	2007-03-15	2007-03-15	ENSG00000164871	ENSG00000164871			14534	protein-coding gene	gene with protein product	"""epididymal protein 2B"""	606560				8167223, 1693137	Standard	NM_058200		Approved	HE2, EP2, EP2C, EP2D, EDDM2B	uc003wrl.3	Q08648	OTTHUMG00000129219	ENST00000297498.2:c.82G>A	chr8.hg19:g.7320361C>T	ENSP00000297498:p.Val28Met	755.0	0.0	.		447.0	66.0	.	NM_016512	E9PFH0|Q546A0|Q6ZYB2|Q9H4P8|Q9H4P9|Q9H4Q0|Q9H4Q1|Q9H4Q2|Q9NRT3|Q9NRV4|Q9NRV5|Q9NRV6|Q9NRV7|Q9NRV8	Missense_Mutation	SNP	ENST00000297498.2	hg19	CCDS5966.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866049	0.32977	.	.	ENSG00000164871	ENST00000528943;ENST00000359758;ENST00000361111;ENST00000297498;ENST00000398462;ENST00000317900	T;T;T	0.54279	1.17;0.58;1.18	2.59	-1.72	0.08107	.	.	.	.	.	T	0.56645	0.1999	L	0.43152	1.355	0.09310	N	1	P;D;D;D;D	0.89917	0.926;0.97;0.996;0.994;1.0	P;P;D;D;D	0.91635	0.628;0.744;0.992;0.986;0.999	T	0.47598	-0.9105	9	0.72032	D	0.01	.	3.3012	0.06984	0.0:0.3248:0.2202:0.455	.	28;28;28;28;28	Q08648-3;A8MZA0;Q08648;Q6PDA7-3;E9PAK7	.;.;SG11B_HUMAN;.;.	M	11;28;28;28;28;28	ENSP00000437154:V11M;ENSP00000354411:V28M;ENSP00000297498:V28M	ENSP00000297498:V28M	V	-	1	0	SPAG11B	7307771	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.299000	0.08254	-0.461000	0.06993	0.461000	0.40582	GTG	.	.	.	none		0.587	SPAG11B-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251390.2	NM_058202, NM_058200, NM_058201, NM_016512, NM_058203, NM_058206, NM_058207	
GNE	10020	hgsc.bcm.edu	37	9	36246171	36246171	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr9:36246171A>G	ENST00000539815.1	-	2	513	c.473T>C	c.(472-474)gTg>gCg	p.V158A	GNE_ENST00000539208.1_Missense_Mutation_p.V99A|GNE_ENST00000396594.3_Missense_Mutation_p.V189A|GNE_ENST00000543356.2_Missense_Mutation_p.V153A|GNE_ENST00000377902.5_Missense_Mutation_p.V158A|GNE_ENST00000447283.2_Missense_Mutation_p.V158A			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	158					carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			GGTGCAGCACACATGATAATG	0.483																																					p.V189A	GBM(184;106 2118 20004 35750 50727)	Atlas-SNP	.											.	GNE	141	.	0			c.T566C						PASS	.						189.0	151.0	164.0					9																	36246171		2203	4300	6503	SO:0001583	missense	10020	exon3			CAGCACACATGAT	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.473T>C	chr9.hg19:g.36246171A>G	ENSP00000439155:p.Val158Ala	86.0	0.0	.		52.0	20.0	.	NM_001128227	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	ENST00000539815.1	hg19	CCDS6602.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.787539	0.31593	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000339267;ENST00000539815;ENST00000543356;ENST00000539208;ENST00000447283	D;D;D;D;D	0.99207	-5.56;-5.56;-5.56;-5.56;-5.56	5.77	5.77	0.91146	.	0.054309	0.64402	D	0.000001	D	0.93077	0.7796	N	0.00347	-1.61	0.41973	D	0.990766	B;B;B;B;B	0.11235	0.0;0.0;0.0;0.0;0.004	B;B;B;B;B	0.14023	0.001;0.001;0.001;0.001;0.01	D	0.89903	0.4046	10	0.36615	T	0.2	0.989	8.5662	0.33540	0.9149:0.0:0.0851:0.0	.	99;117;189;158;158	F5H499;Q9Y223-3;Q9Y223-2;Q9Y223;A7UNU7	.;.;.;GLCNE_HUMAN;.	A	158;189;153;158;130;99;158	ENSP00000367134:V158A;ENSP00000379839:V189A;ENSP00000439155:V158A;ENSP00000445117:V99A;ENSP00000414760:V158A	ENSP00000340770:V153A	V	-	2	0	GNE	36236171	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.584000	0.67490	2.204000	0.70986	0.383000	0.25322	GTG	.	.	.	none		0.483	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476	
ZBTB5	9925	hgsc.bcm.edu	37	9	37442187	37442187	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr9:37442187G>T	ENST00000307750.4	-	2	550	c.362C>A	c.(361-363)aCa>aAa	p.T121K		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T121K(1)		NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		CAGCGTCCTTGTCGTTAAGTA	0.532																																					p.T121K		Atlas-SNP	.											ZBTB5,NS,carcinoma,0,1	ZBTB5	43	.	1	Substitution - Missense(1)	ovary(1)	c.C362A						PASS	.						97.0	89.0	92.0					9																	37442187		2203	4300	6503	SO:0001583	missense	9925	exon2			GTCCTTGTCGTTA	AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.362C>A	chr9.hg19:g.37442187G>T	ENSP00000307604:p.Thr121Lys	75.0	0.0	.		45.0	17.0	.	NM_014872		Missense_Mutation	SNP	ENST00000307750.4	hg19	CCDS6610.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935859	0.73442	.	.	ENSG00000168795	ENST00000307750	T	0.65916	-0.18	5.54	5.54	0.83059	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.62925	0.2468	N	0.11427	0.14	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.57642	-0.7776	10	0.11794	T	0.64	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	121	O15062	ZBTB5_HUMAN	K	121	ENSP00000307604:T121K	ENSP00000307604:T121K	T	-	2	0	ZBTB5	37432187	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.211000	0.77933	2.884000	0.98904	0.655000	0.94253	ACA	.	.	.	none		0.532	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052462.1	NM_014872	
COL15A1	1306	hgsc.bcm.edu	37	9	101806896	101806896	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr9:101806896T>C	ENST00000375001.3	+	25	3044	c.2621T>C	c.(2620-2622)cTg>cCg	p.L874P		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	874	Nonhelical region 5 (NC5).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GACATTCCTCTGGAAAGGCTG	0.512																																					p.L874P		Atlas-SNP	.											.	COL15A1	211	.	0			c.T2621C						PASS	.						108.0	101.0	103.0					9																	101806896		2203	4300	6503	SO:0001583	missense	1306	exon25			TTCCTCTGGAAAG	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2621T>C	chr9.hg19:g.101806896T>C	ENSP00000364140:p.Leu874Pro	87.0	0.0	.		53.0	20.0	.	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	hg19	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	T	12.61	1.991071	0.35131	.	.	ENSG00000204291	ENST00000375001	T	0.34472	1.36	4.99	4.99	0.66335	C-type lectin fold (1);	0.658378	0.14535	N	0.313620	T	0.39600	0.1084	N	0.12831	0.26	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.13361	-1.0512	10	0.29301	T	0.29	-5.7456	11.3753	0.49724	0.0:0.0:0.0:1.0	.	874	P39059	COFA1_HUMAN	P	874	ENSP00000364140:L874P	ENSP00000364140:L874P	L	+	2	0	COL15A1	100846717	1.000000	0.71417	0.909000	0.35828	0.577000	0.36160	4.646000	0.61411	2.005000	0.58758	0.402000	0.26972	CTG	.	.	.	none		0.512	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
HK1	3098	hgsc.bcm.edu	37	10	71160778	71160778	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr10:71160778G>A	ENST00000359426.6	+	18	2745	c.2641G>A	c.(2641-2643)Gaa>Aaa	p.E881K	HK1_ENST00000448642.2_Missense_Mutation_p.E916K|HK1_ENST00000360289.2_Missense_Mutation_p.E869K|HK1_ENST00000404387.2_Missense_Mutation_p.E885K|HK1_ENST00000298649.3_Missense_Mutation_p.E880K	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	881	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GACGGTGAAGGAACTGTCACC	0.557																																					p.E885K		Atlas-SNP	.											.	HK1	170	.	0			c.G2653A						PASS	.						92.0	84.0	87.0					10																	71160778		2203	4300	6503	SO:0001583	missense	3098	exon21			GTGAAGGAACTGT	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.2641G>A	chr10.hg19:g.71160778G>A	ENSP00000352398:p.Glu881Lys	105.0	0.0	.		46.0	16.0	.	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	hg19	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.850351	0.51270	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.96396	-4.0;-4.0;-4.0;-4.0;-4.0	5.78	5.78	0.91487	Hexokinase, C-terminal (1);	0.132704	0.64402	D	0.000002	D	0.93598	0.7956	L	0.33668	1.02	0.58432	D	0.999999	B;B;B;B;B	0.10296	0.001;0.0;0.003;0.001;0.003	B;B;B;B;B	0.11329	0.005;0.003;0.006;0.005;0.002	D	0.88826	0.3302	10	0.23891	T	0.37	-29.3498	20.3681	0.98887	0.0:0.0:1.0:0.0	.	881;880;916;885;869	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	K	869;916;885;880;881;881	ENSP00000353433:E869K;ENSP00000402103:E916K;ENSP00000384774:E885K;ENSP00000298649:E880K;ENSP00000352398:E881K	ENSP00000298649:E880K	E	+	1	0	HK1	70830784	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.336000	0.65935	2.890000	0.99128	0.655000	0.94253	GAA	.	.	.	none		0.557	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
ZNF641	121274	hgsc.bcm.edu	37	12	48736774	48736774	+	Silent	SNP	T	T	C			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr12:48736774T>C	ENST00000544117.2	-	6	2007	c.1299A>G	c.(1297-1299)agA>agG	p.R433R	ZNF641_ENST00000448928.3_Silent_p.R410R|ZNF641_ENST00000547026.1_Silent_p.R419R|ZNF641_ENST00000301042.3_Silent_p.R433R			Q96N77	ZN641_HUMAN	zinc finger protein 641	433					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	12						CAGATGTTCCTCTGTCCCAGC	0.552																																					p.R433R		Atlas-SNP	.											.	ZNF641	28	.	0			c.A1299G						PASS	.						61.0	56.0	58.0					12																	48736774		2203	4300	6503	SO:0001819	synonymous_variant	121274	exon7			TGTTCCTCTGTCC	BC018090	CCDS8763.1, CCDS53787.1, CCDS53788.1	12q13.11	2013-01-08				ENSG00000167528		"""Zinc fingers, C2H2-type"", ""-"""	31834	protein-coding gene	gene with protein product		613906					Standard	NM_152320		Approved	FLJ31295	uc001rro.2	Q96N77		ENST00000544117.2:c.1299A>G	chr12.hg19:g.48736774T>C		58.0	0.0	.		49.0	34.0	.	NM_152320	B3KS43|B4DNU5|Q8TCQ7|Q8WVE1	Silent	SNP	ENST00000544117.2	hg19	CCDS8763.1																																																																																			.	.	.	none		0.552	ZNF641-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406518.1	NM_152320	
ARHGEF25	115557	hgsc.bcm.edu	37	12	58009666	58009666	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr12:58009666G>A	ENST00000286494.4	+	13	1746	c.1286G>A	c.(1285-1287)cGc>cAc	p.R429H	ARHGEF25_ENST00000333972.7_Missense_Mutation_p.R468H|AC025165.8_ENST00000610219.1_RNA|AC025165.8_ENST00000593846.1_RNA|AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	429	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						GACCCTTGCCGCTTTGCACTG	0.617																																					p.R468H		Atlas-SNP	.											.	ARHGEF25	111	.	0			c.G1403A						PASS	.						88.0	85.0	87.0					12																	58009666		2203	4300	6503	SO:0001583	missense	115557	exon14			CTTGCCGCTTTGC		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.1286G>A	chr12.hg19:g.58009666G>A	ENSP00000286494:p.Arg429His	91.0	0.0	.		63.0	22.0	.	NM_001111270	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Missense_Mutation	SNP	ENST00000286494.4	hg19	CCDS8947.1	.	.	.	.	.	.	.	.	.	.	g	15.84	2.951692	0.53186	.	.	ENSG00000240771	ENST00000333972;ENST00000286494	T;T	0.25414	1.8;1.8	4.91	4.91	0.64330	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.38111	N	0.001820	T	0.25457	0.0619	M	0.75447	2.3	0.54753	D	0.999988	P;P	0.51537	0.946;0.627	B;B	0.36666	0.23;0.116	T	0.13548	-1.0505	10	0.87932	D	0	.	9.3708	0.38252	0.0951:0.0:0.9049:0.0	.	468;429	F8W7Z4;Q86VW2	.;ARHGP_HUMAN	H	468;429	ENSP00000335560:R468H;ENSP00000286494:R429H	ENSP00000286494:R429H	R	+	2	0	ARHGEF25	56295933	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	2.702000	0.47102	2.724000	0.93272	0.561000	0.74099	CGC	.	.	.	none		0.617	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	
GRIP1	23426	hgsc.bcm.edu	37	12	66935595	66935595	+	Splice_Site	SNP	C	C	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr12:66935595C>T	ENST00000398016.3	-	3	340	c.272G>A	c.(271-273)aGa>aAa	p.R91K	GRIP1_ENST00000286445.7_Splice_Site_p.R91K|GRIP1_ENST00000359742.4_Splice_Site_p.R91K	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		AGGCAGTTACCTAGCAGCAAT	0.428																																					p.R91K		Atlas-SNP	.											.	GRIP1	106	.	0			c.G272A						PASS	.						216.0	218.0	217.0					12																	66935595		1891	4124	6015	SO:0001630	splice_region_variant	23426	exon3			AGTTACCTAGCAG	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.272+1G>A	chr12.hg19:g.66935595C>T		205.0	0.0	.		127.0	80.0	.	NM_001178074	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	hg19	CCDS41807.1	.	.	.	.	.	.	.	.	.	.	C	36	5.600611	0.96614	.	.	ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215;ENST00000545666;ENST00000542309;ENST00000539540;ENST00000541947	T;T;T;T;T;T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68;1.68	5.36	5.36	0.76844	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.45397	0.1340	L	0.44542	1.39	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.994	D;D;D	0.87578	0.945;0.998;0.945	T	0.11155	-1.0599	9	.	.	.	-18.0174	19.4655	0.94935	0.0:1.0:0.0:0.0	.	91;91;91	F5H4N6;Q9Y3R0;Q9Y3R0-3	.;GRIP1_HUMAN;.	K	91;91;91;91;35;35;64;35;35;117	ENSP00000381098:R91K;ENSP00000352780:R91K;ENSP00000286445:R91K;ENSP00000446047:R91K;ENSP00000446024:R35K;ENSP00000446011:R35K;ENSP00000439124:R64K;ENSP00000438500:R35K;ENSP00000443392:R35K;ENSP00000438921:R117K	.	R	-	2	0	GRIP1	65221862	1.000000	0.71417	0.997000	0.53966	0.854000	0.48673	7.782000	0.85680	2.698000	0.92095	0.655000	0.94253	AGA	.	.	.	none		0.428	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		Missense_Mutation
IRF2BPL	64207	hgsc.bcm.edu	37	14	77494080	77494080	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr14:77494080A>T	ENST00000238647.3	-	1	954	c.56T>A	c.(55-57)cTg>cAg	p.L19Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	19					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						CATGCGGGGCAGGTCGCACAG	0.652																																					p.L19Q		Atlas-SNP	.											.	IRF2BPL	40	.	0			c.T56A						PASS	.						30.0	32.0	31.0					14																	77494080		2203	4298	6501	SO:0001583	missense	64207	exon1			CGGGGCAGGTCGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.56T>A	chr14.hg19:g.77494080A>T	ENSP00000238647:p.Leu19Gln	60.0	0.0	.		38.0	18.0	.	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	ENST00000238647.3	hg19	CCDS9854.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.356823	0.61293	.	.	ENSG00000119669	ENST00000238647	T	0.63913	-0.07	4.08	4.08	0.47627	Interferon regulatory factor 2-binding protein 1 &amp (1); 2, zinc finger (1);	0.116341	0.35615	U	0.003086	T	0.77465	0.4134	M	0.76328	2.33	0.54753	D	0.999988	D	0.89917	1.0	D	0.91635	0.999	T	0.80839	-0.1203	10	0.87932	D	0	-13.394	13.2324	0.59951	1.0:0.0:0.0:0.0	.	19	Q9H1B7	I2BPL_HUMAN	Q	19	ENSP00000238647:L19Q	ENSP00000238647:L19Q	L	-	2	0	IRF2BPL	76563833	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.305000	0.89960	1.708000	0.51301	0.260000	0.18958	CTG	.	.	.	none		0.652	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
GAA	2548	hgsc.bcm.edu	37	17	78085901	78085901	+	Splice_Site	SNP	T	T	G			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr17:78085901T>G	ENST00000302262.3	+	12	1973		c.e12+2		GAA_ENST00000390015.3_Splice_Site	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid						cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	CTCCCACAGGTGAGGGCCACG	0.652																																					.		Atlas-SNP	.											.	GAA	66	.	0			c.1754+2T>G						PASS	.						101.0	85.0	90.0					17																	78085901		2203	4300	6503	SO:0001630	splice_region_variant	2548	exon12			CACAGGTGAGGGC		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.1754+2T>G	chr17.hg19:g.78085901T>G		47.0	0.0	.		30.0	20.0	.	NM_000152	Q09GN4|Q14351|Q16302|Q8IWE7	Splice_Site	SNP	ENST00000302262.3	hg19	CCDS32760.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.996347	0.74818	.	.	ENSG00000171298	ENST00000302262;ENST00000390015	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7205	0.62723	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	GAA	75700496	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.203000	0.77864	1.716000	0.51395	0.533000	0.62120	.	.	.	.	none		0.652	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1		Intron
INO80C	125476	hgsc.bcm.edu	37	18	33077699	33077699	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr18:33077699G>A	ENST00000334598.7	-	1	256	c.140C>T	c.(139-141)gCt>gTt	p.A47V	INO80C_ENST00000590757.1_Missense_Mutation_p.A47V|INO80C_ENST00000592173.1_Missense_Mutation_p.A47V|RP11-322E11.6_ENST00000589258.1_Missense_Mutation_p.A47V|INO80C_ENST00000586489.1_5'Flank|INO80C_ENST00000441607.2_Missense_Mutation_p.A47V	NM_194281.3	NP_919257.2	Q6PI98	IN80C_HUMAN	INO80 complex subunit C	47					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)				central_nervous_system(1)|endometrium(1)|lung(3)|prostate(2)|skin(1)	8						AAAGCTGGAAGCGGACGCTTT	0.667																																					p.A47V		Atlas-SNP	.											.	INO80C	18	.	0			c.C140T						PASS	.						22.0	23.0	23.0					18																	33077699		2203	4300	6503	SO:0001583	missense	125476	exon1			CTGGAAGCGGACG		CCDS11914.1, CCDS45853.1	18q12.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000153391	ENSG00000153391		"""INO80 complex subunits"""	26994	protein-coding gene	gene with protein product	"""IES6 homolog (S. cerevisiae)"""		"""chromosome 18 open reading frame 37"""	C18orf37		16230350	Standard	NM_001098817		Approved	FLJ38183, hIes6, IES6	uc010dmt.3	Q6PI98	OTTHUMG00000132564	ENST00000334598.7:c.140C>T	chr18.hg19:g.33077699G>A	ENSP00000334473:p.Ala47Val	97.0	0.0	.		47.0	16.0	.	NM_194281	B4DUI4|E9PCS7|Q86WR1|Q8N994	Missense_Mutation	SNP	ENST00000334598.7	hg19	CCDS11914.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351758	0.41700	.	.	ENSG00000153391	ENST00000283410;ENST00000441607;ENST00000334598	.	.	.	4.37	0.0571	0.14322	.	0.677038	0.15251	N	0.272331	T	0.25494	0.0620	L	0.36672	1.1	0.09310	N	0.999995	B;B;B	0.32829	0.267;0.004;0.386	B;B;B	0.25140	0.041;0.015;0.058	T	0.22138	-1.0225	9	0.05620	T	0.96	.	13.8549	0.63519	0.0:0.6381:0.3619:0.0	.	47;47;47	E9PCS7;Q6PI98;Q6PI98-3	.;IN80C_HUMAN;.	V	47	.	ENSP00000283410:A47V	A	-	2	0	INO80C	31331697	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.555000	0.23422	-0.088000	0.12506	0.555000	0.69702	GCT	.	.	.	none		0.667	INO80C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255768.1	NM_194281	
CNDP2	55748	hgsc.bcm.edu	37	18	72185851	72185851	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr18:72185851G>A	ENST00000324262.4	+	10	1502	c.1186G>A	c.(1186-1188)Gct>Act	p.A396T	CNDP2_ENST00000579847.1_Missense_Mutation_p.A396T|CNDP2_ENST00000324301.8_Missense_Mutation_p.A312T	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	396					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		TCATTACCTGGCTGGGAGAAG	0.572																																					p.A396T		Atlas-SNP	.											.	CNDP2	55	.	0			c.G1186A						PASS	.						105.0	99.0	101.0					18																	72185851		2203	4300	6503	SO:0001583	missense	55748	exon10			TACCTGGCTGGGA	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.1186G>A	chr18.hg19:g.72185851G>A	ENSP00000325548:p.Ala396Thr	92.0	0.0	.		47.0	18.0	.	NM_018235	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	hg19	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337023	0.81801	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.56941	0.43;0.43	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.77745	0.4176	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.967	T	0.81488	-0.0910	10	0.87932	D	0	-18.9123	19.4462	0.94847	0.0:0.0:1.0:0.0	.	312;396	Q96KP4-2;Q96KP4	.;CNDP2_HUMAN	T	396;312	ENSP00000325548:A396T;ENSP00000325756:A312T	ENSP00000325548:A396T	A	+	1	0	CNDP2	70336831	1.000000	0.71417	0.710000	0.30468	0.041000	0.13682	9.618000	0.98365	2.595000	0.87683	0.650000	0.86243	GCT	.	.	.	none		0.572	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
ZNF99	7652	hgsc.bcm.edu	37	19	22941916	22941916	+	Silent	SNP	A	A	C			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr19:22941916A>C	ENST00000596209.1	-	4	885	c.795T>G	c.(793-795)gtT>gtG	p.V265V	ZNF99_ENST00000397104.3_Intron	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AATTGTTAAAAACTTTGCCAC	0.333																																					p.V265V		Atlas-SNP	.											.	ZNF99	273	.	0			c.T795G						PASS	.						23.0	24.0	24.0					19																	22941916		2031	4208	6239	SO:0001819	synonymous_variant	7652	exon4			GTTAAAAACTTTG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.795T>G	chr19.hg19:g.22941916A>C		61.0	0.0	.		38.0	17.0	.	NM_001080409	M0R335	Silent	SNP	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.	.	none		0.333	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
FBXO46	23403	hgsc.bcm.edu	37	19	46216657	46216658	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr19:46216657_46216658TG>CT	ENST00000317683.3	-	2	229_230	c.96_97CA>AG	c.(94-99)ctCAag>ctAGag	p.K33E		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	33										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		GCTGATGGCTTGAGGGCCGCAG	0.683																																					p.K33E|p.L32L		Atlas-SNP	.											.	FBXO46	34	.	0			c.A97G|c.C96A						PASS	.																																			SO:0001583	missense	23403	exon2			ATGGCTTGAGGGC|TGGCTTGAGGGCC	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.96_97delinsCT	chr19.hg19:g.46216657_46216658delinsCT	ENSP00000410007:p.Lys33Glu	42.0|41.0	0.0	.		29.0	11.0	.	NM_001080469		Missense_Mutation|Silent	SNP	ENST00000317683.3	hg19	CCDS46116.1																																																																																			.	.	.	none		0.683	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1	XM_371179	
IRF2BP1	26145	hgsc.bcm.edu	37	19	46387535	46387535	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr19:46387535G>C	ENST00000302165.3	-	1	1841	c.1498C>G	c.(1498-1500)Ccc>Gcc	p.P500A		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		CAGCACAGGGGGGCCCCAGGG	0.687																																					p.P500A		Atlas-SNP	.											.	IRF2BP1	23	.	0			c.C1498G						PASS	.						12.0	14.0	13.0					19																	46387535		2179	4270	6449	SO:0001583	missense	26145	exon1			ACAGGGGGGCCCC	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.1498C>G	chr19.hg19:g.46387535G>C	ENSP00000307265:p.Pro500Ala	67.0	0.0	.		42.0	13.0	.	NM_015649	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Missense_Mutation	SNP	ENST00000302165.3	hg19	CCDS12678.1	.	.	.	.	.	.	.	.	.	.	G	7.291	0.611129	0.14066	.	.	ENSG00000170604	ENST00000302165	T	0.47869	0.83	4.71	3.68	0.42216	.	0.199902	0.32343	N	0.006230	T	0.25344	0.0616	N	0.08118	0	0.40030	D	0.975524	B	0.29862	0.259	B	0.19666	0.026	T	0.14008	-1.0488	10	0.56958	D	0.05	.	10.6802	0.45811	0.0937:0.0:0.9063:0.0	.	500	Q8IU81	I2BP1_HUMAN	A	500	ENSP00000307265:P500A	ENSP00000307265:P500A	P	-	1	0	IRF2BP1	51079375	1.000000	0.71417	0.987000	0.45799	0.119000	0.20118	5.061000	0.64319	1.199000	0.43173	-0.140000	0.14226	CCC	.	.	.	none		0.687	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
HUWE1	10075	hgsc.bcm.edu	37	X	53565885	53565885	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chrX:53565885G>A	ENST00000342160.3	-	75	12246	c.11789C>T	c.(11788-11790)tCc>tTc	p.S3930F	HUWE1_ENST00000262854.6_Missense_Mutation_p.S3930F			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3930					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGGGTCAAGGGAGGAAGGCGT	0.602																																					p.S3930F		Atlas-SNP	.											.	HUWE1	724	.	0			c.C11789T						PASS	.						75.0	52.0	60.0					X																	53565885		2203	4300	6503	SO:0001583	missense	10075	exon76			TCAAGGGAGGAAG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11789C>T	chrX.hg19:g.53565885G>A	ENSP00000340648:p.Ser3930Phe	59.0	0.0	.		53.0	46.0	.	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472928	0.43942	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.39592	1.07;1.07	5.62	5.62	0.85841	.	0.135606	0.51477	D	0.000092	T	0.51736	0.1692	L	0.43152	1.355	0.80722	D	1	B;P;D	0.57899	0.055;0.936;0.981	B;P;P	0.54706	0.031;0.578;0.759	T	0.54241	-0.8323	10	0.87932	D	0	.	17.2701	0.87098	0.0:0.0:1.0:0.0	.	752;3930;3914	Q5H935;Q7Z6Z7;Q7Z6Z7-2	.;HUWE1_HUMAN;.	F	3930	ENSP00000340648:S3930F;ENSP00000262854:S3930F	ENSP00000262854:S3930F	S	-	2	0	HUWE1	53582610	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.788000	0.91834	2.344000	0.79699	0.600000	0.82982	TCC	.	.	.	none		0.602	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
MT-CO3	4514	hgsc.bcm.edu	37	M	9720	9720	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chrM:9720T>C	ENST00000362079.2	+	1	514	c.514T>C	c.(514-516)Tat>Cat	p.Y172H	MT-TH_ENST00000387441.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	172					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						TACTGGGTCTCTATTTTACCC	0.438																																					p.Y172H		Atlas-SNP	.											.	.	.	.	0			c.T514C						PASS	.																																			SO:0001583	missense	5742	exon1			GGTCTCTATTTTA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.514T>C	chrM.hg19:g.9720T>C	ENSP00000354982:p.Tyr172His	11.0	0.0	.		105.0	6.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.438	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
HHIPL1	84439	hgsc.bcm.edu	37	14	100118913	100118913	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr14:100118913delG	ENST00000330710.5	+	2	706	c.608delG	c.(607-609)aggfs	p.R203fs	HHIPL1_ENST00000357223.2_Frame_Shift_Del_p.R203fs	NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	203					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GTCCATGCCAGGGATGGCACC	0.677																																					p.R203fs		Atlas-INDEL	.											.	HHIPL1	86	.	0			c.607delA						PASS	.						49.0	41.0	44.0					14																	100118913		2202	4299	6501	SO:0001589	frameshift_variant	84439	exon2			.	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.608delG	chr14.hg19:g.100118913delG	ENSP00000330601:p.Arg203fs	69.0	0.0	0		23.0	10.0	0.434783	NM_032425	A2RUF8|B2RN09|Q6UXX2	Frame_Shift_Del	DEL	ENST00000330710.5	hg19	CCDS45162.1																																																																																			.	.	.	none		0.677	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
UNC79	57578	hgsc.bcm.edu	37	14	94125586	94125586	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr14:94125586delC	ENST00000393151.2	+	40	6621	c.6621delC	c.(6619-6621)atcfs	p.I2207fs	UNC79_ENST00000555664.1_Frame_Shift_Del_p.I2168fs|UNC79_ENST00000553484.1_Frame_Shift_Del_p.I2229fs|UNC79_ENST00000256339.4_Frame_Shift_Del_p.I2030fs			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2207					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCTTGAAGATCCCTTCTACCA	0.299																																					p.I2030fs		Atlas-Indel,Pindel	.											.	UNC79	366	.	0			c.6089delT						PASS	.						64.0	66.0	66.0					14																	94125586		2202	4298	6500	SO:0001589	frameshift_variant	57578	exon40			.	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6621delC	chr14.hg19:g.94125586delC	ENSP00000376858:p.Ile2207fs	137.0	0.0	0		80.0	30.0	0.375	NM_020818	B5MDL6|Q6ZUT7	Frame_Shift_Del	DEL	ENST00000393151.2	hg19																																																																																				.	.	.	none		0.299	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
C11orf24	53838	hgsc.bcm.edu	37	11	68030090	68030107	+	In_Frame_Del	DEL	TGGAGGCCGCAGTCGTAA	TGGAGGCCGCAGTCGTAA	-	rs199576193|rs201174414|rs201655090|rs373234316		TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	TGGAGGCCGCAGTCGTAA	TGGAGGCCGCAGTCGTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr11:68030090_68030107delTGGAGGCCGCAGTCGTAA	ENST00000304271.6	-	4	758_775	c.356_373delTTACGACTGCGGCCTCCA	c.(355-375)attacgactgcggcctccagt>agt	p.ITTAAS119del	C11orf24_ENST00000530166.1_5'UTR|C11orf24_ENST00000533310.1_Intron	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	119						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						ACAGTCATACTGGAGGCCGCAGTCGTAATGGAGGCCGC	0.601																																					p.119_125del	NSCLC(21;855 905 4198 36694)	Atlas-INDEL	.											C11orf24,NS,carcinoma,0,1	C11orf24	35	.	0			c.357_374del						PASS	.																																			SO:0001651	inframe_deletion	53838	exon4			.	AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.356_373delTTACGACTGCGGCCTCCA	chr11.hg19:g.68030090_68030107delTGGAGGCCGCAGTCGTAA	ENSP00000307264:p.Ile119_Ser124del	92.0	0.0	0		63.0	15.0	0.238095	NM_022338	Q9H2K4	In_Frame_Del	DEL	ENST00000304271.6	hg19	CCDS8180.1																																																																																			.	.	.	none		0.601	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394750.1	NM_022338	
UNC79	57578	hgsc.bcm.edu	37	14	94060077	94060077	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A71W-01A-12D-A34Z-10	TCGA-SX-A71W-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	39d5e130-8dd3-4884-81ca-045c8ae54290	365767f7-d1f9-4779-86a3-9b5ad8bbe963	g.chr14:94060077delC	ENST00000393151.2	+	23	3084	c.3084delC	c.(3082-3084)gtcfs	p.V1028fs	UNC79_ENST00000555664.1_Frame_Shift_Del_p.V1028fs|UNC79_ENST00000553484.1_Frame_Shift_Del_p.V1028fs|UNC79_ENST00000256339.4_Frame_Shift_Del_p.V851fs			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1028					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CCCTGGCAGTCCCTCTTCTCC	0.483																																					p.V851fs		Atlas-Indel,Pindel	.											.	UNC79	366	.	0			c.2552delT						PASS	.						253.0	214.0	228.0					14																	94060077		2203	4300	6503	SO:0001589	frameshift_variant	57578	exon23			.	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3084delC	chr14.hg19:g.94060077delC	ENSP00000376858:p.Val1028fs	335.0	0.0	0		207.0	87.0	0.42029	NM_020818	B5MDL6|Q6ZUT7	Frame_Shift_Del	DEL	ENST00000393151.2	hg19																																																																																				.	.	.	none		0.483	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
