#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM52	339456	hgsc.bcm.edu	37	1	1849559	1849559	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr1:1849559A>G	ENST00000310991.3	-	5	399	c.392T>C	c.(391-393)cTg>cCg	p.L131P	TMEM52_ENST00000378602.3_Missense_Mutation_p.L116P	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	131						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCCAAAGGGCAGGGGCAACCG	0.637																																					p.L131P		Atlas-SNP	.											.	TMEM52	21	.	0			c.T392C						PASS	.						70.0	70.0	70.0					1																	1849559		2203	4300	6503	SO:0001583	missense	339456	exon5			AAGGGCAGGGGCA	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.392T>C	chr1.hg19:g.1849559A>G	ENSP00000311122:p.Leu131Pro	90.0	0.0	.		78.0	39.0	.	NM_178545	Q4VXS6|Q6UX25	Missense_Mutation	SNP	ENST00000310991.3	hg19	CCDS35.1	.	.	.	.	.	.	.	.	.	.	.	11.55	1.671700	0.29693	.	.	ENSG00000178821	ENST00000378602;ENST00000310991	T;T	0.35789	1.29;1.29	3.12	3.12	0.35913	.	0.416227	0.16370	N	0.217372	T	0.46737	0.1408	L	0.44542	1.39	0.31254	N	0.693716	D;P	0.69078	0.997;0.772	D;P	0.66351	0.943;0.632	T	0.49133	-0.8971	10	0.51188	T	0.08	-0.8967	9.9579	0.41678	1.0:0.0:0.0:0.0	.	131;116	Q8NDY8;Q8NDY8-2	TMM52_HUMAN;.	P	116;131	ENSP00000367865:L116P;ENSP00000311122:L131P	ENSP00000311122:L131P	L	-	2	0	TMEM52	1839419	0.012000	0.17670	0.490000	0.27465	0.016000	0.09150	1.648000	0.37271	1.669000	0.50854	0.418000	0.28097	CTG	.	.	.	none		0.637	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	NM_178545	
EPHA8	2046	hgsc.bcm.edu	37	1	22903066	22903066	+	Silent	SNP	T	T	C	rs570237058		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr1:22903066T>C	ENST00000166244.3	+	3	588	c.516T>C	c.(514-516)agT>agC	p.S172S	EPHA8_ENST00000538803.1_Silent_p.S172S|EPHA8_ENST00000374644.4_Silent_p.S172S	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGTGCGCAGTGTGGGTCCCC	0.592													T|||	1	0.000199681	0.0	0.0014	5008	,	,		17796	0.0		0.0	False		,,,				2504	0.0				p.S172S		Atlas-SNP	.											.	EPHA8	221	.	0			c.T516C						PASS	.						90.0	79.0	83.0					1																	22903066		2203	4300	6503	SO:0001819	synonymous_variant	2046	exon3			GCGCAGTGTGGGT	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.516T>C	chr1.hg19:g.22903066T>C		99.0	0.0	.		69.0	35.0	.	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	hg19	CCDS225.1																																																																																			.	.	.	none		0.592	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
PEX11B	8799	hgsc.bcm.edu	37	1	145522603	145522603	+	Missense_Mutation	SNP	G	G	A	rs369527712		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr1:145522603G>A	ENST00000369306.3	+	4	613	c.464G>A	c.(463-465)cGg>cAg	p.R155Q	ITGA10_ENST00000538811.1_5'Flank|ITGA10_ENST00000539363.1_5'Flank|PEX11B_ENST00000537888.1_Missense_Mutation_p.R141Q|ITGA10_ENST00000369304.3_5'Flank	NM_003846.2	NP_003837.1	O96011	PX11B_HUMAN	peroxisomal biogenesis factor 11 beta	155					peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|protein homooligomerization (GO:0051260)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCTTGTAGCCGGCGACTGAAA	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		17434	0.001		0.0	False		,,,				2504	0.0				p.R155Q		Atlas-SNP	.											.	PEX11B	26	.	0			c.G464A						PASS	.	G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	93.0	90.0	91.0		422,464	4.3	1.0	1		91	0,8600		0,0,4300	no	missense,missense	PEX11B	NM_001184795.1,NM_003846.2	43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	141/246,155/260	145522603	1,13005	2203	4300	6503	SO:0001583	missense	8799	exon4			GTAGCCGGCGACT	AF093670	CCDS72870.1, CCDS72871.1	1q21	2008-08-26	2008-08-26		ENSG00000131779	ENSG00000131779			8853	protein-coding gene	gene with protein product		603867	"""peroxisomal biogenesis factor 11B"""			9792670	Standard	NM_003846		Approved		uc001eny.2	O96011	OTTHUMG00000013756	ENST00000369306.3:c.464G>A	chr1.hg19:g.145522603G>A	ENSP00000358312:p.Arg155Gln	103.0	0.0	.		85.0	26.0	.	NM_003846	B3KN85|B4DXH9|Q96ET2	Missense_Mutation	SNP	ENST00000369306.3	hg19	CCDS917.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939499	0.52972	2.27E-4	0.0	ENSG00000131779	ENST00000369306;ENST00000537888	T;T	0.41400	1.0;1.0	5.23	4.31	0.51392	.	0.261053	0.36932	N	0.002331	T	0.08223	0.0205	N	0.12182	0.205	0.33147	D	0.545202	P;P	0.47604	0.826;0.898	B;B	0.32533	0.142;0.147	T	0.07986	-1.0744	10	0.15952	T	0.53	-15.2013	12.9098	0.58173	0.0:0.0:0.8365:0.1635	.	141;155	B4DXH9;O96011	.;PX11B_HUMAN	Q	155;141	ENSP00000358312:R155Q;ENSP00000437510:R141Q	ENSP00000358312:R155Q	R	+	2	0	PEX11B	144233960	0.998000	0.40836	0.978000	0.43139	0.985000	0.73830	1.788000	0.38714	1.408000	0.46895	0.591000	0.81541	CGG	.	.	.	none		0.532	PEX11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038549.1	NM_003846	
LYST	1130	hgsc.bcm.edu	37	1	235904811	235904811	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr1:235904811C>T	ENST00000389794.3	-	31	8443	c.8269G>A	c.(8269-8271)Gct>Act	p.A2757T	LYST_ENST00000389793.2_Missense_Mutation_p.A2757T			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2757					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCTTGTGCAGCGTGGGCTGGC	0.438																																					p.A2757T		Atlas-SNP	.											.	LYST	370	.	0			c.G8269A						PASS	.						175.0	154.0	161.0					1																	235904811		2203	4300	6503	SO:0001583	missense	1130	exon31			GTGCAGCGTGGGC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8269G>A	chr1.hg19:g.235904811C>T	ENSP00000374444:p.Ala2757Thr	220.0	0.0	.		170.0	57.0	.	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	hg19	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	c	6.807	0.517876	0.13005	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.60920	0.15;0.15	5.63	-3.34	0.04943	.	0.354203	0.36972	N	0.002306	T	0.16342	0.0393	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34725	-0.9817	10	0.02654	T	1	.	1.3225	0.02119	0.3033:0.0855:0.2092:0.4021	.	2757	Q99698	LYST_HUMAN	T	2757	ENSP00000374444:A2757T;ENSP00000374443:A2757T	ENSP00000374443:A2757T	A	-	1	0	LYST	233971434	0.822000	0.29219	0.952000	0.39060	0.141000	0.21300	0.448000	0.21726	-0.670000	0.05282	-1.158000	0.01797	GCT	.	.	.	none		0.438	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
OR2M4	26245	hgsc.bcm.edu	37	1	248402822	248402822	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr1:248402822C>G	ENST00000306687.1	+	1	592	c.592C>G	c.(592-594)Cta>Gta	p.L198V		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	198					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATTTGAAAGACTACTTGTCAT	0.418																																					p.L198V		Atlas-SNP	.											.	OR2M4	111	.	0			c.C592G						PASS	.						126.0	125.0	125.0					1																	248402822		2203	4300	6503	SO:0001583	missense	26245	exon1			GAAAGACTACTTG	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.592C>G	chr1.hg19:g.248402822C>G	ENSP00000306688:p.Leu198Val	312.0	0.0	.		295.0	18.0	.	NM_017504	Q15611|Q8NG82	Missense_Mutation	SNP	ENST00000306687.1	hg19	CCDS31108.1	.	.	.	.	.	.	.	.	.	.	c	0.004	-2.358263	0.00214	.	.	ENSG00000171180	ENST00000306687	T	0.37915	1.17	3.34	-3.45	0.04781	GPCR, rhodopsin-like superfamily (1);	5.055650	0.00963	N	0.003125	T	0.13970	0.0338	N	0.05619	-0.005	0.09310	N	1	B	0.13594	0.008	B	0.23150	0.044	T	0.16837	-1.0389	10	0.05351	T	0.99	.	0.5132	0.00599	0.3604:0.1921:0.2485:0.199	.	198	Q96R27	OR2M4_HUMAN	V	198	ENSP00000306688:L198V	ENSP00000306688:L198V	L	+	1	2	OR2M4	246469445	0.000000	0.05858	0.001000	0.08648	0.512000	0.34134	-2.918000	0.00695	-0.440000	0.07211	0.543000	0.68304	CTA	.	.	.	none		0.418	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097352.1	NM_017504	
PXDN	7837	hgsc.bcm.edu	37	2	1687921	1687921	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:1687921T>C	ENST00000252804.4	-	5	469	c.419A>G	c.(418-420)tAc>tGc	p.Y140C		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	140					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		AAAGTGCAGGTATCTAGAGGA	0.363																																					p.Y140C		Atlas-SNP	.											.	PXDN	255	.	0			c.A419G						PASS	.						37.0	38.0	38.0					2																	1687921		1825	4074	5899	SO:0001583	missense	7837	exon5			TGCAGGTATCTAG	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.419A>G	chr2.hg19:g.1687921T>C	ENSP00000252804:p.Tyr140Cys	43.0	0.0	.		43.0	22.0	.	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	hg19	CCDS46221.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	19.69|19.69|19.69	3.873824|3.873824|3.873824	0.72180|0.72180|0.72180	.|.|.	.|.|.	ENSG00000130508|ENSG00000130508|ENSG00000130508	ENST00000447941|ENST00000433670|ENST00000252804;ENST00000425171	.|.|T;T	.|.|0.58506	.|.|0.33;0.99	5.72|5.72|5.72	5.72|5.72|5.72	0.89469|0.89469|0.89469	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.73822|0.73822|0.73822	0.3636|0.3636|0.3636	M|M|M	0.64404|0.64404|0.64404	1.975|1.975|1.975	0.54753|0.54753|0.54753	D|D|D	0.999988|0.999988|0.999988	.|.|D;D	.|.|0.76494	.|.|0.999;0.995	.|.|D;D	.|.|0.76575	.|.|0.988;0.972	T|T|T	0.76637|0.76637|0.76637	-0.2886|-0.2886|-0.2886	5|5|10	.|.|0.87932	.|.|D	.|.|0	-57.8067|-57.8067|-57.8067	15.9741|15.9741|15.9741	0.80044|0.80044|0.80044	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|.|140;140	.|.|Q92626-2;Q92626	.|.|.;PXDN_HUMAN	M|A|C	63|136|140;116	.|.|ENSP00000252804:Y140C;ENSP00000398363:Y116C	.|.|ENSP00000252804:Y140C	I|T|Y	-|-|-	3|1|2	3|0|0	PXDN|PXDN|PXDN	1666928|1666928|1666928	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.704000|0.704000|0.704000	0.40688|0.40688|0.40688	7.883000|7.883000|7.883000	0.87264|0.87264|0.87264	2.169000|2.169000|2.169000	0.68431|0.68431|0.68431	0.460000|0.460000|0.460000	0.39030|0.39030|0.39030	ATA|ACC|TAC	.	.	.	none		0.363	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
PUM2	23369	hgsc.bcm.edu	37	2	20483190	20483190	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:20483190C>T	ENST00000361078.2	-	10	1371	c.1349G>A	c.(1348-1350)gGc>gAc	p.G450D	PUM2_ENST00000403432.1_Missense_Mutation_p.G450D|PUM2_ENST00000338086.5_Missense_Mutation_p.G450D|PUM2_ENST00000319801.5_Missense_Mutation_p.G450D|PUM2_ENST00000536417.1_Missense_Mutation_p.G394D			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	450	Ala-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCTCCAGGGCCAACCACTAA	0.428																																					p.G450D		Atlas-SNP	.											.	PUM2	91	.	0			c.G1349A						PASS	.						92.0	91.0	92.0					2																	20483190		2203	4300	6503	SO:0001583	missense	23369	exon10			CCAGGGCCAACCA	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1349G>A	chr2.hg19:g.20483190C>T	ENSP00000354370:p.Gly450Asp	149.0	0.0	.		114.0	10.0	.	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	hg19		.	.	.	.	.	.	.	.	.	.	C	25.8	4.679173	0.88542	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.24908	1.84;2.11;2.18;1.92;1.84;1.83	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.36608	0.0973	L	0.55481	1.735	0.80722	D	1	P;P;P	0.50066	0.752;0.931;0.721	P;P;P	0.47673	0.507;0.554;0.46	T	0.00768	-1.1574	10	0.34782	T	0.22	-7.7954	20.8598	0.99761	0.0:1.0:0.0:0.0	.	394;450;450	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	D	450;450;450;341;450;394	ENSP00000338173:G450D;ENSP00000354370:G450D;ENSP00000326746:G450D;ENSP00000409905:G341D;ENSP00000385992:G450D;ENSP00000440093:G394D	ENSP00000326746:G450D	G	-	2	0	PUM2	20346671	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.927000	0.63440	2.937000	0.99478	0.650000	0.86243	GGC	.	.	.	none		0.428	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
CLIP4	79745	hgsc.bcm.edu	37	2	29404714	29404714	+	Silent	SNP	C	C	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:29404714C>A	ENST00000320081.5	+	16	2328	c.2073C>A	c.(2071-2073)acC>acA	p.T691T	CLIP4_ENST00000404424.1_Silent_p.T691T|CLIP4_ENST00000401617.2_Intron	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	691										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					GCAGAGTGACCTATCGGGGAA	0.403																																					p.T691T		Atlas-SNP	.											.	CLIP4	69	.	0			c.C2073A						PASS	.						99.0	100.0	100.0					2																	29404714		2203	4300	6503	SO:0001819	synonymous_variant	79745	exon16			AGTGACCTATCGG	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.2073C>A	chr2.hg19:g.29404714C>A		124.0	0.0	.		106.0	47.0	.	NM_024692	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Silent	SNP	ENST00000320081.5	hg19	CCDS1770.1																																																																																			.	.	.	none		0.403	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
BIRC6	57448	hgsc.bcm.edu	37	2	32640306	32640306	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:32640306G>T	ENST00000421745.2	+	10	2081	c.1947G>T	c.(1945-1947)atG>atT	p.M649I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	649					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.M649I(1)|p.M621I(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TTTCACAGATGAACAATATTA	0.378																																					p.M649I	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											BIRC6_ENST00000421745,NS,carcinoma,0,2	BIRC6	838	.	2	Substitution - Missense(2)	lung(2)	c.G1947T						PASS	.						75.0	74.0	74.0					2																	32640306		2203	4300	6503	SO:0001583	missense	57448	exon10			ACAGATGAACAAT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1947G>T	chr2.hg19:g.32640306G>T	ENSP00000393596:p.Met649Ile	105.0	0.0	.		101.0	54.0	.	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862687	0.51482	.	.	ENSG00000115760	ENST00000421745	T	0.74737	-0.87	5.56	5.56	0.83823	.	0.087525	0.85682	D	0.000000	T	0.64461	0.2600	N	0.24115	0.695	0.58432	D	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.56571	-0.7957	10	0.26408	T	0.33	.	19.8856	0.96911	0.0:0.0:1.0:0.0	.	649	Q9NR09	BIRC6_HUMAN	I	649	ENSP00000393596:M649I	ENSP00000393596:M649I	M	+	3	0	BIRC6	32493810	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.506000	0.97992	2.771000	0.95319	0.650000	0.86243	ATG	.	.	.	none		0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
GCFC2	6936	hgsc.bcm.edu	37	2	75907421	75907421	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:75907421C>A	ENST00000321027.3	-	12	1843	c.1710G>T	c.(1708-1710)tgG>tgT	p.W570C	GCFC2_ENST00000541687.1_3'UTR|MRPL19_ENST00000358788.6_Intron|GCFC2_ENST00000409857.3_Missense_Mutation_p.W532C	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	570					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										ACAAAGGATCCCAAAGGAATT	0.323																																					p.W570C		Atlas-SNP	.											.	.	.	.	0			c.G1710T						PASS	.						102.0	106.0	104.0					2																	75907421		2203	4299	6502	SO:0001583	missense	6936	exon12			AGGATCCCAAAGG	AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.1710G>T	chr2.hg19:g.75907421C>A	ENSP00000318690:p.Trp570Cys	124.0	0.0	.		109.0	52.0	.	NM_003203	A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	ENST00000321027.3	hg19	CCDS1961.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804904	0.70682	.	.	ENSG00000005436	ENST00000321027;ENST00000409857	T;T	0.68479	-0.33;-0.33	5.42	5.42	0.78866	GC-rich sequence DNA-binding factor domain (1);	0.000000	0.85682	D	0.000000	D	0.84772	0.5546	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87287	0.2296	10	0.87932	D	0	-7.8026	17.0811	0.86599	0.0:1.0:0.0:0.0	.	570	P16383	GCF_HUMAN	C	570;532	ENSP00000318690:W570C;ENSP00000386552:W532C	ENSP00000318690:W570C	W	-	3	0	C2orf3	75760929	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.129000	0.71657	2.722000	0.93159	0.650000	0.86243	TGG	.	.	.	none		0.323	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252255.2	NM_003203	
CCDC141	285025	hgsc.bcm.edu	37	2	179720165	179720165	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:179720165A>T	ENST00000420890.2	-	19	3086	c.2969T>A	c.(2968-2970)tTg>tAg	p.L990*	CCDC141_ENST00000295723.5_Nonsense_Mutation_p.L415*	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	990										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATGTTTTTGCAAATCCTTCAT	0.338																																					p.L990X		Atlas-SNP	.											.	CCDC141	362	.	0			c.T2969A						PASS	.						123.0	120.0	121.0					2																	179720165		2203	4300	6503	SO:0001587	stop_gained	285025	exon19			TTTTGCAAATCCT	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2969T>A	chr2.hg19:g.179720165A>T	ENSP00000395995:p.Leu990*	384.0	0.0	.		325.0	144.0	.	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Nonsense_Mutation	SNP	ENST00000420890.2	hg19		.	.	.	.	.	.	.	.	.	.	A	36	5.972060	0.97162	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	.	.	.	4.99	4.99	0.66335	.	0.000000	0.41712	D	0.000821	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.431	15.0074	0.71524	1.0:0.0:0.0:0.0	.	.	.	.	X	990;434;415	.	ENSP00000295723:L415X	L	-	2	0	CCDC141	179428410	1.000000	0.71417	0.990000	0.47175	0.209000	0.24338	7.831000	0.86748	1.993000	0.58246	0.533000	0.62120	TTG	.	.	.	none		0.338	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
ABI2	10152	hgsc.bcm.edu	37	2	204267454	204267454	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:204267454C>G	ENST00000422511.2	+	9	1121	c.1090C>G	c.(1090-1092)Cca>Gca	p.P364A	ABI2_ENST00000261018.7_Missense_Mutation_p.P183A|ABI2_ENST00000261016.6_Missense_Mutation_p.P285A|RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000424558.1_Missense_Mutation_p.P391A|ABI2_ENST00000295851.5_Missense_Mutation_p.P397A|ABI2_ENST00000261017.5_Missense_Mutation_p.P330A|ABI2_ENST00000430574.1_3'UTR|ABI2_ENST00000430418.1_Missense_Mutation_p.P342A			Q9NYB9	ABI2_HUMAN	abl-interactor 2	397	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|cell migration (GO:0016477)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|Rac protein signal transduction (GO:0016601)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	cytoskeletal adaptor activity (GO:0008093)|DNA binding (GO:0003677)|kinase binding (GO:0019900)|proline-rich region binding (GO:0070064)|protein complex binding (GO:0032403)|SH3 domain binding (GO:0017124)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(3)|large_intestine(1)|liver(2)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	15						TAGCCAGAATCCAGGTTAGTT	0.368																																					p.P330A		Atlas-SNP	.											.	ABI2	44	.	0			c.C988G						PASS	.						98.0	96.0	97.0					2																	204267454		2203	4300	6503	SO:0001583	missense	10152	exon7			CAGAATCCAGGTT	AF260261	CCDS2358.1, CCDS63093.1, CCDS63094.1, CCDS74634.1	2q33	2010-09-20	2009-07-23		ENSG00000138443	ENSG00000138443			24011	protein-coding gene	gene with protein product		606442				7590236, 10964520	Standard	XM_005246217		Approved	ABI-2, AIP-1, ABI2B, AblBP3, argBPIA, SSH3BP2	uc002uzz.3	Q9NYB9	OTTHUMG00000132879	ENST00000422511.2:c.1090C>G	chr2.hg19:g.204267454C>G	ENSP00000396249:p.Pro364Ala	148.0	0.0	.		145.0	9.0	.	NM_005759	B4DSN1|Q13147|Q13249|Q13801|Q9BV70	Missense_Mutation	SNP	ENST00000422511.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.94|18.94	3.730696|3.730696	0.69074|0.69074	.|.	.|.	ENSG00000138443|ENSG00000138443	ENST00000451591;ENST00000454023|ENST00000295851;ENST00000261017;ENST00000430418;ENST00000424558;ENST00000261016;ENST00000417864;ENST00000422511;ENST00000261018	.|T;T;T;T;T;T;T;T	.|0.41400	.|1.2;1.22;1.35;1.21;1.03;1.51;1.18;1.0	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.203600	.|0.52532	.|D	.|0.000061	T|T	0.22003|0.22003	0.0530|0.0530	N|N	0.02539|0.02539	-0.55|-0.55	0.80722|0.80722	D|D	1|1	.|B;P;P;B;P;P;P;B;B	.|0.41131	.|0.439;0.58;0.524;0.212;0.525;0.646;0.739;0.39;0.051	.|B;B;B;B;B;B;B;B;B	.|0.36666	.|0.23;0.184;0.095;0.094;0.115;0.124;0.225;0.054;0.097	T|T	0.25882|0.25882	-1.0119|-1.0119	5|10	.|0.49607	.|T	.|0.09	-8.0595|-8.0595	17.8057|17.8057	0.88600|0.88600	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|183;232;122;274;391;342;285;397;330	.|B7Z5L1;B7Z612;B4DMM5;B7Z836;Q9NYB9-4;E9PEZ7;Q9NYB9-3;Q9NYB9;Q9NYB9-2	.|.;.;.;.;.;.;.;ABI2_HUMAN;.	M|A	200;176|397;330;342;391;285;397;364;183	.|ENSP00000295851:P397A;ENSP00000261017:P330A;ENSP00000408898:P342A;ENSP00000391433:P391A;ENSP00000261016:P285A;ENSP00000414703:P397A;ENSP00000396249:P364A;ENSP00000261018:P183A	.|ENSP00000261016:P285A	I|P	+|+	3|1	3|0	ABI2|ABI2	203975699|203975699	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.263000|7.263000	0.78421|0.78421	2.636000|2.636000	0.89361|0.89361	0.655000|0.655000	0.94253|0.94253	ATC|CCA	.	.	.	none		0.368	ABI2-007	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000336179.2	NM_005759	
ATP2B2	491	hgsc.bcm.edu	37	3	10400378	10400378	+	Silent	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:10400378T>C	ENST00000352432.4	-	13	2202	c.2133A>G	c.(2131-2133)ccA>ccG	p.P711P	ATP2B2_ENST00000360273.2_Silent_p.P711P|ATP2B2_ENST00000343816.4_Silent_p.P697P|ATP2B2_ENST00000383800.4_Silent_p.P666P|ATP2B2_ENST00000397077.1_Silent_p.P666P			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	711					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GGCCTACCTCTGGCCGCACCG	0.622																																					p.P711P	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											.	ATP2B2	304	.	0			c.A2133G						PASS	.						34.0	27.0	30.0					3																	10400378		2203	4300	6503	SO:0001819	synonymous_variant	491	exon14			TACCTCTGGCCGC	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2133A>G	chr3.hg19:g.10400378T>C		61.0	0.0	.		66.0	30.0	.	NM_001001331	O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	hg19	CCDS33701.1																																																																																			.	.	.	none		0.622	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
LRRC58	116064	hgsc.bcm.edu	37	3	120050190	120050190	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:120050190G>A	ENST00000295628.3	-	4	1068	c.973C>T	c.(973-975)Cca>Tca	p.P325S		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	325										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		TGCATCAGTGGGAGGCGATAC	0.438																																					p.P325S		Atlas-SNP	.											.	LRRC58	18	.	0			c.C973T						PASS	.						83.0	83.0	83.0					3																	120050190		1928	4134	6062	SO:0001583	missense	116064	exon4			TCAGTGGGAGGCG	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.973C>T	chr3.hg19:g.120050190G>A	ENSP00000295628:p.Pro325Ser	276.0	0.0	.		237.0	119.0	.	NM_001099678		Missense_Mutation	SNP	ENST00000295628.3	hg19	CCDS46892.1	.	.	.	.	.	.	.	.	.	.	G	32	5.106531	0.94292	.	.	ENSG00000163428	ENST00000295628	T	0.55052	0.54	5.61	5.61	0.85477	.	0.047934	0.85682	D	0.000000	T	0.74397	0.3711	M	0.88377	2.95	0.80722	D	1	D	0.71674	0.998	P	0.57425	0.82	T	0.79999	-0.1566	10	0.87932	D	0	-10.0529	18.612	0.91288	0.0:0.0:1.0:0.0	.	325	Q96CX6	LRC58_HUMAN	S	325	ENSP00000295628:P325S	ENSP00000295628:P325S	P	-	1	0	LRRC58	121532880	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.768000	0.98965	2.638000	0.89438	0.655000	0.94253	CCA	.	.	.	none		0.438	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296	
GOLGB1	2804	hgsc.bcm.edu	37	3	121435943	121435943	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:121435943G>T	ENST00000340645.5	-	9	1039	c.914C>A	c.(913-915)aCt>aAt	p.T305N	GOLGB1_ENST00000393667.3_Missense_Mutation_p.T310N	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	305					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		GTTCCTCAAAGTATTATGCTC	0.378																																					p.T310N		Atlas-SNP	.											.	GOLGB1	319	.	0			c.C929A						PASS	.						76.0	75.0	75.0					3																	121435943		2203	4300	6503	SO:0001583	missense	2804	exon9			CTCAAAGTATTAT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.914C>A	chr3.hg19:g.121435943G>T	ENSP00000341848:p.Thr305Asn	156.0	0.0	.		150.0	62.0	.	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.33|10.33	1.320829|1.320829	0.23994|0.23994	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000489400|ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	.|T;T;T	.|0.23552	.|2.53;2.53;1.9	5.93|5.93	2.19|2.19	0.27852|0.27852	.|.	.|0.485196	.|0.20990	.|N	.|0.082042	T|T	0.30634|0.30634	0.0771|0.0771	L|L	0.45137|0.45137	1.4|1.4	0.24072|0.24072	N|N	0.995973|0.995973	.|D;D;D;D;D	.|0.67145	.|0.996;0.988;0.996;0.988;0.978	.|P;P;P;P;P	.|0.58266	.|0.834;0.836;0.834;0.756;0.675	T|T	0.11891|0.11891	-1.0569|-1.0569	5|10	.|0.20046	.|T	.|0.44	.|.	8.3021|8.3021	0.32021|0.32021	0.3197:0.0:0.6803:0.0|0.3197:0.0:0.6803:0.0	.|.	.|230;269;310;310;305	.|F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.|.;.;.;.;GOGB1_HUMAN	I|N	176|305;310;269;117	.|ENSP00000341848:T305N;ENSP00000377275:T310N;ENSP00000418231:T269N	.|ENSP00000341848:T305N	L|T	-|-	1|2	0|0	GOLGB1|GOLGB1	122918633|122918633	0.797000|0.797000	0.28877|0.28877	0.838000|0.838000	0.33150|0.33150	0.211000|0.211000	0.24417|0.24417	1.008000|1.008000	0.29872|0.29872	0.440000|0.440000	0.26502|0.26502	0.555000|0.555000	0.69702|0.69702	CTT|ACT	.	.	.	none		0.378	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
PDIA5	10954	hgsc.bcm.edu	37	3	122880182	122880182	+	Silent	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:122880182T>C	ENST00000316218.7	+	16	1454	c.1359T>C	c.(1357-1359)gcT>gcC	p.A453A	PDIA5_ENST00000467157.1_3'UTR	NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	453	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		CCTGTGCCGCTGTTGACTGTG	0.547																																					p.A453A		Atlas-SNP	.											.	PDIA5	66	.	0			c.T1359C						PASS	.						100.0	88.0	92.0					3																	122880182		2203	4300	6503	SO:0001819	synonymous_variant	10954	exon16			TGCCGCTGTTGAC	AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.1359T>C	chr3.hg19:g.122880182T>C		54.0	0.0	.		45.0	32.0	.	NM_006810	D3DN95|Q9BV43	Silent	SNP	ENST00000316218.7	hg19	CCDS3020.1																																																																																			.	.	.	none		0.547	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356192.1	NM_006810	
PLOD2	5352	hgsc.bcm.edu	37	3	145824360	145824360	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:145824360G>T	ENST00000360060.3	-	5	751	c.574C>A	c.(574-576)Cag>Aag	p.Q192K	PLOD2_ENST00000494950.1_Missense_Mutation_p.Q137K|RP11-274H2.2_ENST00000480247.1_RNA|PLOD2_ENST00000282903.5_Missense_Mutation_p.Q192K	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	192					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	TAAAAGAGCTGATCATCATCA	0.348																																					p.Q192K		Atlas-SNP	.											.	PLOD2	81	.	0			c.C574A						PASS	.						160.0	158.0	159.0					3																	145824360		2203	4300	6503	SO:0001583	missense	5352	exon5			AGAGCTGATCATC	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.574C>A	chr3.hg19:g.145824360G>T	ENSP00000353170:p.Gln192Lys	134.0	0.0	.		89.0	35.0	.	NM_182943	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	hg19	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002651	0.93227	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000494950;ENST00000469350	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.73984	0.3657	M	0.92169	3.28	0.80722	D	1	D;D;D	0.89917	0.994;0.998;1.0	D;D;D	0.91635	0.965;0.996;0.999	T	0.81437	-0.0933	10	0.87932	D	0	-34.5777	18.8329	0.92148	0.0:0.0:1.0:0.0	.	137;192;192	E7ETU9;O00469;O00469-2	.;PLOD2_HUMAN;.	K	192;192;137;164	ENSP00000282903:Q192K;ENSP00000353170:Q192K;ENSP00000420094:Q137K;ENSP00000419963:Q164K	ENSP00000282903:Q192K	Q	-	1	0	PLOD2	147307050	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.444000	0.97578	2.442000	0.82660	0.655000	0.94253	CAG	.	.	.	none		0.348	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
PLOD2	5352	hgsc.bcm.edu	37	3	145824369	145824369	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:145824369C>T	ENST00000360060.3	-	5	742	c.565G>A	c.(565-567)Gat>Aat	p.D189N	PLOD2_ENST00000494950.1_Missense_Mutation_p.D134N|RP11-274H2.2_ENST00000480247.1_RNA|PLOD2_ENST00000282903.5_Missense_Mutation_p.D189N	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	189					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	TGATCATCATCATTATCCTGG	0.348																																					p.D189N		Atlas-SNP	.											.	PLOD2	81	.	0			c.G565A						PASS	.						158.0	157.0	157.0					3																	145824369		2203	4300	6503	SO:0001583	missense	5352	exon5			CATCATCATTATC	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.565G>A	chr3.hg19:g.145824369C>T	ENSP00000353170:p.Asp189Asn	140.0	0.0	.		92.0	36.0	.	NM_182943	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	hg19	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	C	33	5.214470	0.95104	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000494950;ENST00000469350	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.63034	0.2477	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.995	T	0.68614	-0.5362	10	0.54805	T	0.06	-38.5898	18.8329	0.92148	0.0:1.0:0.0:0.0	.	134;189;189	E7ETU9;O00469;O00469-2	.;PLOD2_HUMAN;.	N	189;189;134;161	ENSP00000282903:D189N;ENSP00000353170:D189N;ENSP00000420094:D134N;ENSP00000419963:D161N	ENSP00000282903:D189N	D	-	1	0	PLOD2	147307059	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.463000	0.80869	2.442000	0.82660	0.655000	0.94253	GAT	.	.	.	none		0.348	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
GFM1	85476	hgsc.bcm.edu	37	3	158362456	158362456	+	Silent	SNP	T	T	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:158362456T>G	ENST00000486715.1	+	1	390	c.33T>G	c.(31-33)gcT>gcG	p.A11A	GFM1_ENST00000264263.5_Silent_p.A11A|GFM1_ENST00000478576.1_Silent_p.A11A	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CCGTCGCGGCTCTGGGGCGCG	0.667											OREG0015898	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A11A		Atlas-SNP	.											.	GFM1	83	.	0			c.T33G						PASS	.						6.0	8.0	7.0					3																	158362456		2165	4239	6404	SO:0001819	synonymous_variant	85476	exon1			CGCGGCTCTGGGG	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.33T>G	chr3.hg19:g.158362456T>G		153.0	0.0	.	1793	140.0	68.0	.	NM_024996		Silent	SNP	ENST00000486715.1	hg19	CCDS33885.1																																																																																			.	.	.	none		0.667	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
ATP8A1	10396	hgsc.bcm.edu	37	4	42457327	42457327	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr4:42457327T>A	ENST00000381668.5	-	29	3035	c.2804A>T	c.(2803-2805)gAc>gTc	p.D935V	ATP8A1_ENST00000264449.10_Missense_Mutation_p.D920V	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	935					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	GGTGTTGAAGTCCAGGGCATT	0.443																																					p.D935V		Atlas-SNP	.											.	ATP8A1	206	.	0			c.A2804T						PASS	.						166.0	139.0	148.0					4																	42457327		2203	4300	6503	SO:0001583	missense	10396	exon29			TTGAAGTCCAGGG	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2804A>T	chr4.hg19:g.42457327T>A	ENSP00000371084:p.Asp935Val	182.0	0.0	.		140.0	67.0	.	NM_006095	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	hg19	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.284164	0.23392	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.71341	-0.56;-0.56	5.09	5.09	0.68999	.	0.069887	0.56097	D	0.000023	T	0.59335	0.2186	L	0.28115	0.83	0.80722	D	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.14023	0.01;0.007;0.007	T	0.55309	-0.8161	10	0.36615	T	0.2	.	15.1662	0.72828	0.0:0.0:0.0:1.0	.	920;935;927	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	V	935;920	ENSP00000371084:D935V;ENSP00000264449:D920V	ENSP00000264449:D920V	D	-	2	0	ATP8A1	42152084	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.734000	0.62043	2.030000	0.59900	0.455000	0.32223	GAC	.	.	.	none		0.443	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
UGT2A1	10941	hgsc.bcm.edu	37	4	70512663	70512663	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr4:70512663A>T	ENST00000503640.1	-	1	755	c.700T>A	c.(700-702)Tat>Aat	p.Y234N	UGT2A1_ENST00000286604.4_Missense_Mutation_p.Y234N|UGT2A1_ENST00000512704.1_Missense_Mutation_p.Y234N|UGT2A1_ENST00000514019.1_Missense_Mutation_p.Y234N	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	234					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						GCTTTACTATAGTATGAATCC	0.338																																					p.Y234N		Atlas-SNP	.											.	UGT2A1	131	.	0			c.T700A						PASS	.						56.0	56.0	56.0					4																	70512663		2200	4298	6498	SO:0001583	missense	10941	exon2			TACTATAGTATGA	AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.700T>A	chr4.hg19:g.70512663A>T	ENSP00000424478:p.Tyr234Asn	75.0	0.0	.		76.0	28.0	.	NM_001252274	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	ENST00000503640.1	hg19	CCDS3529.1	.	.	.	.	.	.	.	.	.	.	A	18.05	3.538159	0.65085	.	.	ENSG00000173610	ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T	0.62232	0.08;0.04;0.08;0.08	5.78	5.78	0.91487	.	0.127268	0.56097	D	0.000040	T	0.80869	0.4706	M	0.84846	2.72	.	.	.	D;D;D;D	0.89917	1.0;1.0;0.994;0.994	D;D;D;D	0.97110	1.0;1.0;0.93;0.93	D	0.85603	0.1253	9	0.66056	D	0.02	.	14.0552	0.64764	1.0:0.0:0.0:0.0	.	234;234;234;234	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1	.;.;.;UD2A1_HUMAN	N	234	ENSP00000424478:Y234N;ENSP00000421432:Y234N;ENSP00000425497:Y234N;ENSP00000286604:Y234N	ENSP00000286604:Y234N	Y	-	1	0	UGT2A1	70547252	1.000000	0.71417	0.994000	0.49952	0.733000	0.41908	7.912000	0.87465	2.215000	0.71742	0.482000	0.46254	TAT	.	.	.	none		0.338	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798	
PCDH10	57575	hgsc.bcm.edu	37	4	134072787	134072787	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr4:134072787C>G	ENST00000264360.5	+	1	2318	c.1492C>G	c.(1492-1494)Ctt>Gtt	p.L498V	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	498	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CAACGCCCAGCTTGCCTACTC	0.587																																					p.L498V		Atlas-SNP	.											.	PCDH10	290	.	0			c.C1492G						PASS	.						59.0	61.0	60.0					4																	134072787		2203	4299	6502	SO:0001583	missense	57575	exon1			GCCCAGCTTGCCT	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1492C>G	chr4.hg19:g.134072787C>G	ENSP00000264360:p.Leu498Val	125.0	0.0	.		71.0	25.0	.	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	hg19	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	8.080	0.772215	0.16051	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.48836	0.8	4.51	1.71	0.24356	Cadherin (4);Cadherin-like (1);	0.000000	0.35179	N	0.003395	T	0.22666	0.0547	N	0.12611	0.24	0.32518	N	0.536591	B;B	0.14012	0.007;0.009	B;B	0.23574	0.004;0.047	T	0.16958	-1.0385	10	0.13470	T	0.59	.	4.0843	0.09940	0.3205:0.4962:0.0:0.1832	.	498;498	Q9P2E7;Q96SF0	PCD10_HUMAN;.	V	498	ENSP00000264360:L498V	ENSP00000264360:L498V	L	+	1	0	PCDH10	134292237	0.927000	0.31430	0.858000	0.33744	0.998000	0.95712	1.899000	0.39818	0.127000	0.18452	0.655000	0.94253	CTT	.	.	.	none		0.587	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
MAML3	55534	hgsc.bcm.edu	37	4	140640884	140640884	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr4:140640884G>C	ENST00000509479.2	-	5	3866	c.3010C>G	c.(3010-3012)Cag>Gag	p.Q1004E	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					CTCAGTCCCTGTGGGAAGTGC	0.602																																					p.Q1000E		Atlas-SNP	.											.	MAML3	192	.	0			c.C2998G						PASS	.						45.0	47.0	47.0					4																	140640884		2103	4232	6335	SO:0001583	missense	55534	exon6			GTCCCTGTGGGAA	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.3010C>G	chr4.hg19:g.140640884G>C	ENSP00000421180:p.Gln1004Glu	77.0	0.0	.		45.0	19.0	.	NM_018717		Missense_Mutation	SNP	ENST00000509479.2	hg19	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089751	0.76756	.	.	ENSG00000196782	ENST00000509479;ENST00000538400	T	0.38240	1.15	4.86	4.86	0.63082	.	0.147180	0.45126	D	0.000383	T	0.61223	0.2330	M	0.81942	2.565	0.80722	D	1	D;D	0.54207	0.965;0.965	P;P	0.61201	0.885;0.885	T	0.66196	-0.5984	10	0.56958	D	0.05	.	18.3673	0.90396	0.0:0.0:1.0:0.0	.	1004;1000	E7EVW8;Q96JK9	.;MAML3_HUMAN	E	1004;311	ENSP00000421180:Q1004E	ENSP00000421180:Q1004E	Q	-	1	0	MAML3	140860334	1.000000	0.71417	0.979000	0.43373	0.959000	0.62525	7.904000	0.87408	2.401000	0.81631	0.591000	0.81541	CAG	.	.	.	none		0.602	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
SRPK1	6732	hgsc.bcm.edu	37	6	35803124	35803125	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr6:35803124_35803125GC>AT	ENST00000373825.2	-	16	2209_2210	c.1924_1925GC>AT	c.(1924-1926)GCc>ATc	p.A642I	SRPK1_ENST00000423325.2_Missense_Mutation_p.A626I|SRPK1_ENST00000373822.1_Missense_Mutation_p.A534I					SRSF protein kinase 1											endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						GGCGGCAGTGGCTCTCTTCTCA	0.564																																					p.A642V|p.A642T	NSCLC(31;67 978 16289 24856 26454)	Atlas-SNP	.											.	SRPK1	61	.	0			c.C1925T|c.G1924A						PASS	.																																			SO:0001583	missense	6732	exon16			GCAGTGGCTCTCT|CAGTGGCTCTCTT	U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1924_1925delinsAT	chr6.hg19:g.35803124_35803125delinsAT	ENSP00000362931:p.Ala642Ile	93.0|94.0	0.0	.		25.0	23.0	.	NM_003137		Missense_Mutation	SNP	ENST00000373825.2	hg19	CCDS47415.1																																																																																			.	.	.	none		0.564	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040319.3	NM_003137	
PKHD1	5314	hgsc.bcm.edu	37	6	51913390	51913390	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr6:51913390C>G	ENST00000371117.3	-	23	2582	c.2307G>C	c.(2305-2307)gaG>gaC	p.E769D	PKHD1_ENST00000340994.4_Missense_Mutation_p.E769D	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	769					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GTCCAGATCCCTCTTCTGTTC	0.522																																					p.E769D		Atlas-SNP	.											PKHD1_ENST00000340994,NS,carcinoma,0,2	PKHD1	927	.	0			c.G2307C						PASS	.						114.0	95.0	101.0					6																	51913390		2203	4300	6503	SO:0001583	missense	5314	exon23			AGATCCCTCTTCT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2307G>C	chr6.hg19:g.51913390C>G	ENSP00000360158:p.Glu769Asp	70.0	0.0	.		34.0	26.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746328	0.30955	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87571	-2.06;-2.27	5.65	0.145	0.14829	.	0.742423	0.12926	N	0.427779	T	0.56202	0.1969	L	0.37850	1.14	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.39482	-0.9612	10	0.19590	T	0.45	.	1.7503	0.02970	0.2806:0.0806:0.1461:0.4928	.	769;769	P08F94-2;P08F94	.;PKHD1_HUMAN	D	769	ENSP00000360158:E769D;ENSP00000341097:E769D	ENSP00000341097:E769D	E	-	3	2	PKHD1	52021349	0.002000	0.14202	0.000000	0.03702	0.349000	0.29174	0.845000	0.27668	-0.198000	0.10333	-0.302000	0.09304	GAG	.	.	.	none		0.522	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
CD164	8763	hgsc.bcm.edu	37	6	109699166	109699166	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr6:109699166A>T	ENST00000310786.4	-	3	333	c.268T>A	c.(268-270)Tat>Aat	p.Y90N	CD164_ENST00000275080.7_Missense_Mutation_p.Y90N|CD164_ENST00000506649.1_5'UTR|CD164_ENST00000368961.5_Missense_Mutation_p.Y90N|CD164_ENST00000413644.2_Missense_Mutation_p.Y90N|CD164_ENST00000504373.1_Missense_Mutation_p.Y56N|CD164_ENST00000324953.5_Missense_Mutation_p.Y90N|CD164_ENST00000512821.1_Missense_Mutation_p.Y90N	NM_001142404.1|NM_006016.4	NP_001135876.1|NP_006007.2	Q04900	MUC24_HUMAN	CD164 molecule, sialomucin	90					cell adhesion (GO:0007155)|hemopoiesis (GO:0030097)|heterophilic cell-cell adhesion (GO:0007157)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(1)|lung(2)	3		all_cancers(87;4.65e-22)|all_epithelial(87;2.54e-20)|all_lung(197;1.6e-05)|Lung NSC(302;2.92e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.0175)		Epithelial(106;7.83e-46)|all cancers(137;1.15e-45)|OV - Ovarian serous cystadenocarcinoma(136;2.89e-26)|BRCA - Breast invasive adenocarcinoma(108;0.00128)|GBM - Glioblastoma multiforme(226;0.16)		TGTGAACAATAGCTCTCATCT	0.443																																					p.Y90N		Atlas-SNP	.											.	CD164	10	.	0			c.T268A						PASS	.						115.0	104.0	108.0					6																	109699166		2203	4300	6503	SO:0001583	missense	8763	exon3			AACAATAGCTCTC	AF106518	CCDS5073.1, CCDS47462.1, CCDS47463.1, CCDS47464.1, CCDS47465.1	6q21	2014-09-05	2006-03-28		ENSG00000135535	ENSG00000135535		"""CD molecules"""	1632	protein-coding gene	gene with protein product		603356	"""CD164 antigen, sialomucin"""			9680353, 9763543	Standard	NM_006016		Approved	MUC-24, MGC-24	uc003pte.3	Q04900	OTTHUMG00000015339	ENST00000310786.4:c.268T>A	chr6.hg19:g.109699166A>T	ENSP00000309376:p.Tyr90Asn	34.0	0.0	.		17.0	12.0	.	NM_006016	B4DQ85|E1P5E7|E1P5E8|E1P5E9|O95413|Q5JSU6|Q9BPV0|Q9NR26	Missense_Mutation	SNP	ENST00000310786.4	hg19	CCDS5073.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.498712	0.64298	.	.	ENSG00000135535	ENST00000413644;ENST00000368961;ENST00000324953;ENST00000310786;ENST00000275080;ENST00000512821;ENST00000504373	T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86	4.65	1.74	0.24563	.	0.788335	0.11567	N	0.551169	T	0.30759	0.0775	L	0.52573	1.65	0.29687	N	0.841213	P;P;P;P;P	0.46512	0.739;0.741;0.879;0.78;0.739	P;P;P;P;B	0.50708	0.63;0.528;0.648;0.511;0.377	T	0.16305	-1.0407	10	0.62326	D	0.03	-6.0273	3.4508	0.07498	0.6908:0.0:0.1178:0.1914	.	90;90;90;90;90	Q04900-5;Q04900-3;Q04900-4;Q04900;Q04900-2	.;.;.;MUC24_HUMAN;.	N	90;90;90;90;90;90;56	ENSP00000402237:Y90N;ENSP00000357957:Y90N;ENSP00000314177:Y90N;ENSP00000309376:Y90N;ENSP00000275080:Y90N;ENSP00000427546:Y90N;ENSP00000422999:Y56N	ENSP00000275080:Y90N	Y	-	1	0	CD164	109805859	0.903000	0.30736	0.976000	0.42696	0.351000	0.29236	0.322000	0.19576	0.786000	0.33708	0.460000	0.39030	TAT	.	.	.	none		0.443	CD164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041742.1	NM_006016	
ABCA13	154664	hgsc.bcm.edu	37	7	48431545	48431545	+	Silent	SNP	C	C	T	rs189672968	byFrequency	TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr7:48431545C>T	ENST00000435803.1	+	38	11706	c.11682C>T	c.(11680-11682)ccC>ccT	p.P3894P		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3894	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCCACCCTCCCACTTCTGGAA	0.522																																					p.P3894P		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C11682T						PASS	.						78.0	78.0	78.0					7																	48431545		2002	4160	6162	SO:0001819	synonymous_variant	154664	exon38			CCCTCCCACTTCT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11682C>T	chr7.hg19:g.48431545C>T		123.0	0.0	.		88.0	8.0	.	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	hg19	CCDS47584.1																																																																																			.	C|0.999;G|0.001	.	alt		0.522	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
MCPH1	79648	hgsc.bcm.edu	37	8	6266814	6266814	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr8:6266814G>A	ENST00000344683.5	+	2	113	c.37G>A	c.(37-39)Gtt>Att	p.V13I	RP11-115C21.2_ENST00000500118.2_RNA|MCPH1_ENST00000522905.1_Missense_Mutation_p.V13I|RP11-115C21.2_ENST00000523225.1_RNA|MCPH1_ENST00000519480.1_Missense_Mutation_p.V13I|RP11-115C21.2_ENST00000606853.1_RNA	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	13	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		AGTGGCCTATGTTGAAGTGTG	0.363																																					p.V13I	Colon(95;1448 1467 8277 34473 35819)	Atlas-SNP	.											.	MCPH1	65	.	0			c.G37A						PASS	.						170.0	158.0	162.0					8																	6266814		1898	4124	6022	SO:0001583	missense	79648	exon2			GCCTATGTTGAAG	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.37G>A	chr8.hg19:g.6266814G>A	ENSP00000342924:p.Val13Ile	251.0	0.0	.		199.0	81.0	.	NM_001172575	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	ENST00000344683.5	hg19	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856648	0.91433	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	D;D;D	0.84370	-1.84;-1.84;-1.84	5.33	5.33	0.75918	BRCT (3);	0.000000	0.64402	D	0.000004	D	0.92011	0.7469	M	0.74881	2.28	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.985;0.998;0.985	D	0.92820	0.6271	10	0.87932	D	0	-22.1517	16.5324	0.84365	0.0:0.0:1.0:0.0	.	13;13;13	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	I	13	ENSP00000342924:V13I;ENSP00000430962:V13I;ENSP00000430768:V13I	ENSP00000342924:V13I	V	+	1	0	MCPH1	6254222	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.390000	0.73204	2.488000	0.83962	0.591000	0.81541	GTT	.	.	.	none		0.363	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
WWP1	11059	hgsc.bcm.edu	37	8	87410646	87410646	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr8:87410646T>C	ENST00000517970.1	+	6	717	c.410T>C	c.(409-411)gTt>gCt	p.V137A	WWP1_ENST00000349423.2_Intron|WWP1_ENST00000341922.2_Intron|WWP1_ENST00000265428.4_Missense_Mutation_p.V137A	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	137					central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GAATTGACAGTTGTGCTTGAT	0.328																																					p.V137A		Atlas-SNP	.											.	WWP1	97	.	0			c.T410C						PASS	.						79.0	84.0	82.0					8																	87410646		2203	4299	6502	SO:0001583	missense	11059	exon6			TGACAGTTGTGCT	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.410T>C	chr8.hg19:g.87410646T>C	ENSP00000427793:p.Val137Ala	234.0	0.0	.		204.0	109.0	.	NM_007013	O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	ENST00000517970.1	hg19	CCDS6242.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.718480	0.68844	.	.	ENSG00000123124	ENST00000517970;ENST00000265428	T;T	0.68765	-0.35;-0.35	5.69	5.69	0.88448	C2 calcium/lipid-binding domain, CaLB (1);	0.487699	0.21187	N	0.078705	T	0.68393	0.2996	L	0.58101	1.795	0.80722	D	1	P	0.51351	0.944	P	0.46850	0.529	T	0.66736	-0.5848	10	0.28530	T	0.3	.	15.9391	0.79739	0.0:0.0:0.0:1.0	.	137	Q9H0M0	WWP1_HUMAN	A	137	ENSP00000427793:V137A;ENSP00000265428:V137A	ENSP00000265428:V137A	V	+	2	0	WWP1	87479762	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.829000	0.69316	2.165000	0.68154	0.528000	0.53228	GTT	.	.	.	none		0.328	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
PARP10	84875	hgsc.bcm.edu	37	8	145057194	145057194	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr8:145057194T>A	ENST00000313028.7	-	9	2556	c.2462A>T	c.(2461-2463)gAg>gTg	p.E821V	PARP10_ENST00000525773.1_Missense_Mutation_p.E833V|PARP10_ENST00000524918.1_Missense_Mutation_p.E812V|PARP10_ENST00000533665.1_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	821	Myc binding.|PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGCCAGACGCTCCAGGTTGTT	0.657																																					p.E821V		Atlas-SNP	.											.	PARP10	57	.	0			c.A2462T						PASS	.						56.0	60.0	59.0					8																	145057194		2203	4300	6503	SO:0001583	missense	84875	exon9			AGACGCTCCAGGT	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.2462A>T	chr8.hg19:g.145057194T>A	ENSP00000325618:p.Glu821Val	36.0	0.0	.		27.0	11.0	.	NM_032789	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	hg19	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.483160	0.44147	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	T;T;T	0.15834	2.39;2.39;2.39	5.09	3.92	0.45320	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.118179	0.37955	N	0.001871	T	0.21387	0.0515	N	0.17631	0.505	0.33963	D	0.645837	D;D	0.65815	0.995;0.995	D;D	0.68943	0.961;0.961	T	0.22521	-1.0214	10	0.23891	T	0.37	.	9.28	0.37722	0.0:0.0:0.1818:0.8182	.	833;821	E9PNI7;Q53GL7	.;PAR10_HUMAN	V	812;527;821;833	ENSP00000431620:E812V;ENSP00000325618:E821V;ENSP00000434776:E833V	ENSP00000325618:E821V	E	-	2	0	PARP10	145129182	0.009000	0.17119	0.729000	0.30791	0.249000	0.25844	0.114000	0.15520	0.871000	0.35750	0.451000	0.29950	GAG	.	.	.	none		0.657	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789	
DAPK1	1612	hgsc.bcm.edu	37	9	90312114	90312114	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr9:90312114C>G	ENST00000408954.3	+	22	2941	c.2606C>G	c.(2605-2607)cCc>cGc	p.P869R	DAPK1_ENST00000491893.1_Intron|DAPK1_ENST00000472284.1_Missense_Mutation_p.P869R|DAPK1_ENST00000469640.2_Missense_Mutation_p.P869R|DAPK1_ENST00000358077.5_Missense_Mutation_p.P869R	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	869					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						GTTGAAGAACCCATAGGTGAG	0.527									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.P869R		Atlas-SNP	.											.	DAPK1	329	.	0			c.C2606G						PASS	.						82.0	78.0	79.0					9																	90312114		1995	4162	6157	SO:0001583	missense	1612	exon22	Familial Cancer Database	Familial CLL	AAGAACCCATAGG	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2606C>G	chr9.hg19:g.90312114C>G	ENSP00000386135:p.Pro869Arg	234.0	0.0	.		180.0	85.0	.	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	hg19	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.294346	0.40594	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954	T;T;T;T	0.70516	-0.29;-0.29;-0.49;-0.29	5.5	4.61	0.57282	.	0.000000	0.52532	D	0.000080	T	0.62109	0.2401	L	0.46157	1.445	0.40576	D	0.981348	B	0.23650	0.089	B	0.17098	0.017	T	0.63620	-0.6596	10	0.72032	D	0.01	.	9.8246	0.40903	0.1396:0.7875:0.0:0.0729	.	869	P53355	DAPK1_HUMAN	R	869	ENSP00000350785:P869R;ENSP00000417076:P869R;ENSP00000418885:P869R;ENSP00000386135:P869R	ENSP00000350785:P869R	P	+	2	0	DAPK1	89501934	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.045000	0.41250	1.559000	0.49555	0.655000	0.94253	CCC	.	.	.	none		0.527	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
LMX1B	4010	hgsc.bcm.edu	37	9	129456044	129456044	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr9:129456044G>C	ENST00000373474.4	+	6	846	c.839G>C	c.(838-840)cGg>cCg	p.R280P	LMX1B_ENST00000425646.2_Missense_Mutation_p.R257P|LMX1B_ENST00000526117.1_Missense_Mutation_p.R280P|LMX1B_ENST00000561065.1_Missense_Mutation_p.R257P|LMX1B_ENST00000355497.5_Missense_Mutation_p.R280P			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	280					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CTGGCGCGGCGGCACCAGCAG	0.741									Nail-Patella Syndrome																												p.R280P	Pancreas(110;1796 2278 18357 20466)	Atlas-SNP	.											.	LMX1B	86	.	0			c.G839C						PASS	.						4.0	4.0	4.0					9																	129456044		1996	3909	5905	SO:0001583	missense	4010	exon6	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	CGCGGCGGCACCA	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.839G>C	chr9.hg19:g.129456044G>C	ENSP00000362573:p.Arg280Pro	16.0	0.0	.		21.0	13.0	.	NM_001174146	F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	hg19	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517624	0.64634	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	T;T;T;T	0.78246	-1.16;-1.16;-1.07;-1.16	4.56	3.65	0.41850	Homeobox (1);	0.000000	0.85682	D	0.000000	T	0.76543	0.4002	M	0.66939	2.045	0.80722	D	1	P;B;P	0.37015	0.578;0.369;0.502	B;B;B	0.39068	0.289;0.112;0.224	T	0.77167	-0.2687	10	0.62326	D	0.03	.	12.7907	0.57533	0.0:0.0:0.8352:0.1648	.	257;257;280	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	P	280;280;280;257	ENSP00000436930:R280P;ENSP00000362573:R280P;ENSP00000347684:R280P;ENSP00000390923:R257P	ENSP00000347684:R280P	R	+	2	0	LMX1B	128495865	1.000000	0.71417	0.532000	0.27989	0.961000	0.63080	6.065000	0.71176	0.867000	0.35654	0.561000	0.74099	CGG	.	.	.	none		0.741	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
SEC16A	9919	hgsc.bcm.edu	37	9	139360854	139360854	+	Silent	SNP	A	A	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr9:139360854A>G	ENST00000371706.3	-	5	3489	c.3456T>C	c.(3454-3456)gaT>gaC	p.D1152D	SEC16A_ENST00000290037.6_Silent_p.D1152D|SEC16A_ENST00000313050.7_Silent_p.D1330D|SEC16A_ENST00000431893.2_Silent_p.D1152D			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1152	Required for endoplasmic reticulum localization.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GATCGGGGTCATCGTCAAAAC	0.627																																					p.D1330D		Atlas-SNP	.											.	SEC16A	249	.	0			c.T3990C						PASS	.						24.0	30.0	28.0					9																	139360854		2163	4267	6430	SO:0001819	synonymous_variant	9919	exon7			GGGGTCATCGTCA	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.3456T>C	chr9.hg19:g.139360854A>G		79.0	0.0	.		73.0	28.0	.	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	hg19		.	.	.	.	.	.	.	.	.	.	A	3.831	-0.035868	0.07497	.	.	ENSG00000148396	ENST00000433860	.	.	.	5.69	-11.4	0.00090	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.346	10.1481	0.42776	0.2182:0.2055:0.5134:0.0629	.	.	.	.	R	27	.	.	X	-	1	0	SEC16A	138480675	0.000000	0.05858	0.010000	0.14722	0.419000	0.31324	-1.735000	0.01847	-4.404000	0.00051	-1.139000	0.01908	TGA	.	.	.	none		0.627	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
ZMYND19	116225	hgsc.bcm.edu	37	9	140477471	140477471	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr9:140477471C>A	ENST00000298585.2	-	5	730	c.504G>T	c.(502-504)gaG>gaT	p.E168D		NM_138462.2	NP_612471.1	Q96E35	ZMY19_HUMAN	zinc finger, MYND-type containing 19	168						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synapse (GO:0045202)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		GGTAGTGGCACTCATAGTAGG	0.537																																					p.E168D		Atlas-SNP	.											.	ZMYND19	16	.	0			c.G504T						PASS	.						256.0	205.0	222.0					9																	140477471		2203	4300	6503	SO:0001583	missense	116225	exon5			GTGGCACTCATAG	BC012948	CCDS7048.1	9q34.3	2008-02-05			ENSG00000165724	ENSG00000165724		"""Zinc fingers, MYND-type"""	21146	protein-coding gene	gene with protein product		611424					Standard	NM_138462		Approved	MIZIP	uc004cno.1	Q96E35	OTTHUMG00000020992	ENST00000298585.2:c.504G>T	chr9.hg19:g.140477471C>A	ENSP00000298585:p.Glu168Asp	81.0	0.0	.		43.0	19.0	.	NM_138462	Q5T366	Missense_Mutation	SNP	ENST00000298585.2	hg19	CCDS7048.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308524	0.81247	.	.	ENSG00000165724	ENST00000298585	.	.	.	5.29	3.2	0.36748	.	0.048852	0.85682	D	0.000000	T	0.69223	0.3087	M	0.68317	2.08	0.49483	D	0.999792	D	0.63046	0.992	D	0.77004	0.989	T	0.70234	-0.4928	9	0.87932	D	0	-33.5417	7.342	0.26641	0.0:0.7433:0.0:0.2567	.	168	Q96E35	ZMY19_HUMAN	D	168	.	ENSP00000298585:E168D	E	-	3	2	ZMYND19	139597292	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	2.044000	0.41241	1.239000	0.43787	0.561000	0.74099	GAG	.	.	.	none		0.537	ZMYND19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055356.1	NM_138462	
FRMD4A	55691	hgsc.bcm.edu	37	10	13803654	13803654	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr10:13803654A>T	ENST00000357447.2	-	8	825	c.457T>A	c.(457-459)Ttt>Att	p.F153I	FRMD4A_ENST00000342409.2_Missense_Mutation_p.F169I|FRMD4A_ENST00000378503.1_Missense_Mutation_p.F153I|FRMD4A_ENST00000358621.4_Missense_Mutation_p.F138I	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	153	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TACCTAGAAAAATCTCCCTTT	0.333																																					p.F153I		Atlas-SNP	.											.	FRMD4A	108	.	0			c.T457A						PASS	.						104.0	107.0	106.0					10																	13803654		2203	4300	6503	SO:0001583	missense	55691	exon8			TAGAAAAATCTCC	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.457T>A	chr10.hg19:g.13803654A>T	ENSP00000350032:p.Phe153Ile	194.0	0.0	.		144.0	65.0	.	NM_018027	A7E2Y3|Q5T377	Missense_Mutation	SNP	ENST00000357447.2	hg19	CCDS7101.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.440458	0.83993	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.04	5.04	0.67666	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	T	0.44726	0.1307	M	0.62723	1.935	0.58432	D	0.999997	P;P;P	0.51933	0.831;0.902;0.949	P;P;P	0.55222	0.716;0.598;0.771	T	0.45056	-0.9287	10	0.87932	D	0	-11.814	11.4873	0.50361	1.0:0.0:0.0:0.0	.	169;186;153	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	I	138;153;153;186;169	ENSP00000351438:F138I;ENSP00000350032:F153I;ENSP00000367764:F153I;ENSP00000264546:F186I;ENSP00000344237:F169I	ENSP00000264546:F186I	F	-	1	0	FRMD4A	13843660	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.129000	0.64739	2.003000	0.58678	0.533000	0.62120	TTT	.	.	.	none		0.333	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027	
KIAA1279	26128	hgsc.bcm.edu	37	10	70748678	70748678	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr10:70748678G>C	ENST00000361983.4	+	1	192	c.90G>C	c.(88-90)aaG>aaC	p.K30N		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	30					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						ATCCGGAGAAGGAACCATACA	0.622											OREG0020215	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K30N		Atlas-SNP	.											.	KIAA1279	35	.	0			c.G90C						PASS	.						65.0	74.0	71.0					10																	70748678		2203	4300	6503	SO:0001583	missense	26128	exon1			GGAGAAGGAACCA	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.90G>C	chr10.hg19:g.70748678G>C	ENSP00000354848:p.Lys30Asn	164.0	0.0	.	1124	158.0	70.0	.	NM_015634	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	ENST00000361983.4	hg19	CCDS7284.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601804	0.28534	.	.	ENSG00000198954	ENST00000361983	T	0.42900	0.96	5.73	2.82	0.32997	.	0.102956	0.64402	D	0.000002	T	0.17534	0.0421	N	0.05441	-0.05	0.31545	N	0.659403	B	0.02656	0.0	B	0.01281	0.0	T	0.27297	-1.0078	10	0.06099	T	0.92	-12.8014	8.5315	0.33337	0.1689:0.2585:0.5727:0.0	.	30	Q96EK5	KBP_HUMAN	N	30	ENSP00000354848:K30N	ENSP00000354848:K30N	K	+	3	2	KIAA1279	70418684	0.922000	0.31269	1.000000	0.80357	0.992000	0.81027	-0.005000	0.12855	0.781000	0.33589	0.650000	0.86243	AAG	.	.	.	none		0.622	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048370.1	NM_015634	
TEX36	387718	hgsc.bcm.edu	37	10	127371554	127371554	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr10:127371554G>T	ENST00000368821.3	-	1	159	c.5C>A	c.(4-6)aCc>aAc	p.T2N	RP11-383C5.3_ENST00000415305.2_lincRNA	NM_001128202.1	NP_001121674.1	Q5VZQ5	TEX36_HUMAN	testis expressed 36	2																	TCGCCCTTTGGTCATTCTCTC	0.527																																					p.T2N		Atlas-SNP	.											.	.	.	.	0			c.C5A						PASS	.						241.0	205.0	216.0					10																	127371554		692	1591	2283	SO:0001583	missense	387718	exon1			CCTTTGGTCATTC		CCDS44493.1	10q26.13	2012-08-13	2012-08-13	2012-08-13	ENSG00000175018	ENSG00000175018			31653	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 122"""	C10orf122			Standard	NM_001128202		Approved	bA383C5.1	uc001lik.4	Q5VZQ5	OTTHUMG00000019229	ENST00000368821.3:c.5C>A	chr10.hg19:g.127371554G>T	ENSP00000357811:p.Thr2Asn	150.0	0.0	.		124.0	49.0	.	NM_001128202	Q0P5T8	Missense_Mutation	SNP	ENST00000368821.3	hg19	CCDS44493.1	.	.	.	.	.	.	.	.	.	.	G	4.844	0.156920	0.09236	.	.	ENSG00000175018	ENST00000532135;ENST00000526819;ENST00000368821	T;T;T	0.41400	1.0;1.0;1.0	3.95	1.05	0.20165	.	0.987018	0.08237	N	0.976680	T	0.26774	0.0655	N	0.24115	0.695	0.22280	N	0.999235	B;B	0.29716	0.255;0.15	B;B	0.28784	0.094;0.048	T	0.28933	-1.0028	10	0.66056	D	0.02	-9.5095	4.23	0.10599	0.2124:0.1904:0.5972:0.0	.	2;2	Q5VZQ5;E9PJL2	CJ122_HUMAN;.	N	2	ENSP00000431764:T2N;ENSP00000434299:T2N;ENSP00000357811:T2N	ENSP00000357811:T2N	T	-	2	0	C10orf122	127361544	0.984000	0.35163	0.877000	0.34402	0.005000	0.04900	0.323000	0.19593	0.236000	0.21180	-0.312000	0.09012	ACC	.	.	.	none		0.527	TEX36-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000050915.1	NM_001128202	
ZBED5	58486	hgsc.bcm.edu	37	11	10875463	10875463	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr11:10875463C>A	ENST00000432999.2	-	3	1528	c.1030G>T	c.(1030-1032)Gat>Tat	p.D344Y	ZBED5_ENST00000525350.1_Intron|ZBED5_ENST00000413761.2_Missense_Mutation_p.D344Y	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	344							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						ctagaagcatcactacaaaca	0.388																																					p.D344Y		Atlas-SNP	.											.	ZBED5	50	.	0			c.G1030T						PASS	.						57.0	45.0	49.0					11																	10875463		692	1590	2282	SO:0001583	missense	58486	exon3			AAGCATCACTACA	AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.1030G>T	chr11.hg19:g.10875463C>A	ENSP00000398106:p.Asp344Tyr	119.0	0.0	.		104.0	38.0	.	NM_021211	B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Missense_Mutation	SNP	ENST00000432999.2	hg19		.	.	.	.	.	.	.	.	.	.	C	14.43	2.532990	0.45073	.	.	ENSG00000236287	ENST00000432999;ENST00000413761	T;T	0.41400	1.0;1.0	4.18	4.18	0.49190	Ribonuclease H-like (1);	.	.	.	.	T	0.68044	0.2958	M	0.88105	2.93	0.34446	D	0.700191	D	0.89917	1.0	D	0.97110	1.0	T	0.79291	-0.1864	9	0.87932	D	0	.	12.3074	0.54910	0.0:1.0:0.0:0.0	.	344	Q49AG3	ZBED5_HUMAN	Y	344	ENSP00000398106:D344Y;ENSP00000415939:D344Y	ENSP00000415939:D344Y	D	-	1	0	ZBED5	10832039	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.670000	0.46833	2.620000	0.88729	0.650000	0.86243	GAT	.	.	.	none		0.388	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000317691.1	NM_021211	
OR4C13	283092	hgsc.bcm.edu	37	11	49974862	49974862	+	Silent	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr11:49974862T>C	ENST00000555099.1	+	1	920	c.888T>C	c.(886-888)atT>atC	p.I296I		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						AAAATGCCATTAGGAAATTGT	0.378																																					p.I296I		Atlas-SNP	.											.	OR4C13	96	.	0			c.T888C						PASS	.						42.0	42.0	42.0					11																	49974862		2192	4292	6484	SO:0001819	synonymous_variant	283092	exon1			TGCCATTAGGAAA	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.888T>C	chr11.hg19:g.49974862T>C		43.0	0.0	.		27.0	12.0	.	NM_001001955	A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	ENST00000555099.1	hg19	CCDS31495.1																																																																																			.	.	.	none		0.378	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955	
CASP4	837	hgsc.bcm.edu	37	11	104819264	104819264	+	Silent	SNP	C	C	T	rs552187293		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr11:104819264C>T	ENST00000444739.2	-	6	1831	c.921G>A	c.(919-921)acG>acA	p.T307T	CASP4_ENST00000393150.3_Silent_p.T251T|CASP4_ENST00000531333.1_5'Flank	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	307					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)	p.T307T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		ACATACGTGGCGTTGAAGAGC	0.448													c|||	1	0.000199681	0.0	0.0	5008	,	,		20358	0.0		0.0	False		,,,				2504	0.001				p.T307T		Atlas-SNP	.											CASP4,NS,carcinoma,0,2	CASP4	57	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G921A						PASS	.						133.0	97.0	109.0					11																	104819264		2202	4299	6501	SO:0001819	synonymous_variant	837	exon6			ACGTGGCGTTGAA	U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.921G>A	chr11.hg19:g.104819264C>T		77.0	0.0	.		62.0	23.0	.	NM_001225	A2NHL8|A2NHM0	Silent	SNP	ENST00000444739.2	hg19	CCDS8327.1																																																																																			.	.	.	none		0.448	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
COLCA2	120376	hgsc.bcm.edu	37	11	111179041	111179041	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr11:111179041A>G	ENST00000398035.2	+	5	1102	c.344A>G	c.(343-345)gAt>gGt	p.D115G	COLCA2_ENST00000526216.1_Missense_Mutation_p.D115G	NM_001136105.2	NP_001129577.1	A8K830	COLC2_HUMAN	colorectal cancer associated 2	115						cytoplasm (GO:0005737)											GAGGACTTGGATGCTCTCCAG	0.557																																					p.D212G		Atlas-SNP	.											.	C11orf93	10	.	0			c.A635G						PASS	.						103.0	90.0	94.0					11																	111179041		692	1591	2283	SO:0001583	missense	120376	exon5			ACTTGGATGCTCT	BC042557	CCDS44728.1, CCDS73378.1	11q23.1	2013-10-11	2013-08-22	2013-08-22	ENSG00000214290	ENSG00000214290			26978	protein-coding gene	gene with protein product	"""cancer susceptibility candidate 13"""	615694	"""chromosome 11 open reading frame 93"""	C11orf93		21071539	Standard	NM_001271457		Approved	CASC13	uc031qea.1	A8K830	OTTHUMG00000166657	ENST00000398035.2:c.344A>G	chr11.hg19:g.111179041A>G	ENSP00000381115:p.Asp115Gly	53.0	0.0	.		51.0	25.0	.	NM_001271458	E9PMJ8|Q2TBJ3|V5LD62|V5LDI3|V5LDV1|V5LE09|V5LEU3	Missense_Mutation	SNP	ENST00000398035.2	hg19	CCDS44728.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.693519	0.48202	.	.	ENSG00000214290	ENST00000398035;ENST00000526216	.	.	.	6.17	5.03	0.67393	.	0.000000	0.31246	U	0.007999	T	0.48447	0.1500	L	0.34521	1.04	0.33141	D	0.544383	D	0.58620	0.983	P	0.54544	0.755	T	0.59343	-0.7472	8	.	.	.	-28.9424	11.5339	0.50626	0.8502:0.1498:0.0:0.0	.	115	A8K830	CK093_HUMAN	G	115	.	.	D	+	2	0	C11orf93	110684251	1.000000	0.71417	0.273000	0.24645	0.025000	0.11179	3.948000	0.56660	1.124000	0.41980	0.533000	0.62120	GAT	.	.	.	none		0.557	COLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390991.1	NM_001136105	
NCAPD3	23310	hgsc.bcm.edu	37	11	134023240	134023240	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr11:134023240G>A	ENST00000534548.2	-	33	4335	c.4271C>T	c.(4270-4272)aCg>aTg	p.T1424M	NCAPD3_ENST00000526787.2_5'UTR	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1424					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TGCTCCAAACGTGACATCACT	0.542																																					p.T1424M		Atlas-SNP	.											.	NCAPD3	141	.	0			c.C4271T						PASS	.						212.0	176.0	188.0					11																	134023240		2201	4297	6498	SO:0001583	missense	23310	exon33			CCAAACGTGACAT	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.4271C>T	chr11.hg19:g.134023240G>A	ENSP00000433681:p.Thr1424Met	126.0	0.0	.		83.0	35.0	.	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	hg19	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140591	0.77775	.	.	ENSG00000151503	ENST00000534548	T	0.48522	0.81	5.44	5.44	0.79542	.	0.052095	0.85682	D	0.000000	T	0.68091	0.2963	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69142	0.962;0.948	T	0.70204	-0.4936	10	0.87932	D	0	-18.9547	19.206	0.93730	0.0:0.0:1.0:0.0	.	1424;484	P42695;Q96FA6	CNDD3_HUMAN;.	M	1424	ENSP00000433681:T1424M	ENSP00000433681:T1424M	T	-	2	0	NCAPD3	133528450	1.000000	0.71417	0.914000	0.36105	0.773000	0.43773	6.493000	0.73658	2.712000	0.92718	0.561000	0.74099	ACG	.	.	.	none		0.542	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
BCDIN3D	144233	hgsc.bcm.edu	37	12	50232203	50232203	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr12:50232203A>T	ENST00000333924.4	-	2	871	c.830T>A	c.(829-831)cTg>cAg	p.L277Q	BCDIN3D-AS1_ENST00000548872.1_RNA|BCDIN3D-AS1_ENST00000549124.1_RNA	NM_181708.2	NP_859059.1	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	277					miRNA metabolic process (GO:0010586)|negative regulation of pre-miRNA processing (GO:2000632)|RNA methylation (GO:0001510)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	O-methyltransferase activity (GO:0008171)|RNA methyltransferase activity (GO:0008173)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)	9						TTTTTCTATCAGTGATTCAGG	0.403																																					p.L277Q		Atlas-SNP	.											.	BCDIN3D	20	.	0			c.T830A						PASS	.						140.0	137.0	138.0					12																	50232203		2203	4300	6503	SO:0001583	missense	144233	exon2			TCTATCAGTGATT		CCDS8790.1	12q13.13	2008-03-12				ENSG00000186666			27050	protein-coding gene	gene with protein product							Standard	NM_181708		Approved		uc001rvh.3	Q7Z5W3	OTTHUMG00000169807	ENST00000333924.4:c.830T>A	chr12.hg19:g.50232203A>T	ENSP00000335201:p.Leu277Gln	24.0	0.0	.		22.0	7.0	.	NM_181708	A8K829	Missense_Mutation	SNP	ENST00000333924.4	hg19	CCDS8790.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.583428	0.28268	.	.	ENSG00000186666	ENST00000333924	T	0.50277	0.75	4.35	0.717	0.18196	.	1.385570	0.04949	N	0.460066	T	0.29256	0.0728	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.26430	-1.0103	10	0.59425	D	0.04	-17.2455	2.4992	0.04629	0.5719:0.0:0.2253:0.2029	.	277	Q7Z5W3	BN3D2_HUMAN	Q	277	ENSP00000335201:L277Q	ENSP00000335201:L277Q	L	-	2	0	BCDIN3D	48518470	0.000000	0.05858	0.006000	0.13384	0.768000	0.43524	0.590000	0.23954	0.117000	0.18138	0.402000	0.26972	CTG	.	.	.	none		0.403	BCDIN3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405982.1	NM_181708	
NABP2	79035	hgsc.bcm.edu	37	12	56619250	56619250	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr12:56619250T>C	ENST00000380198.2	+	2	671	c.173T>C	c.(172-174)gTt>gCt	p.V58A	NABP2_ENST00000267023.4_Missense_Mutation_p.V58A|NABP2_ENST00000341463.5_Missense_Mutation_p.V58A			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	58					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)										TGGGACGATGTTGGCAATCTG	0.537																																					p.V58A		Atlas-SNP	.											.	.	.	.	0			c.T173C						PASS	.						180.0	154.0	163.0					12																	56619250		2203	4300	6503	SO:0001583	missense	79035	exon3			ACGATGTTGGCAA	BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.173T>C	chr12.hg19:g.56619250T>C	ENSP00000369545:p.Val58Ala	137.0	0.0	.		83.0	40.0	.	NM_024068	A6NDF8|Q6XYC8	Missense_Mutation	SNP	ENST00000380198.2	hg19	CCDS8911.1	.	.	.	.	.	.	.	.	.	.	T	11.40	1.628069	0.28978	.	.	ENSG00000139579	ENST00000447747;ENST00000399713;ENST00000267023;ENST00000380198;ENST00000341463	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	4.59	3.44	0.39384	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.096640	0.39759	N	0.001268	T	0.16896	0.0406	N	0.14661	0.345	0.40726	D	0.982701	B;B;B	0.21452	0.056;0.034;0.014	B;B;B	0.25759	0.026;0.044;0.063	T	0.07927	-1.0747	10	0.25751	T	0.34	-14.59	8.9473	0.35767	0.0:0.0914:0.0:0.9086	.	58;58;58	C9JT95;C9JMP5;Q9BQ15	.;.;SOSB1_HUMAN	A	58	ENSP00000413902:V58A;ENSP00000408616:V58A;ENSP00000267023:V58A;ENSP00000369545:V58A;ENSP00000368862:V58A	ENSP00000267023:V58A	V	+	2	0	OBFC2B	54905517	1.000000	0.71417	0.987000	0.45799	0.757000	0.42996	6.043000	0.71004	1.852000	0.53769	0.374000	0.22700	GTT	.	.	.	none		0.537	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326610.1	NM_024068	
KIF5A	3798	hgsc.bcm.edu	37	12	57963875	57963875	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr12:57963875G>A	ENST00000455537.2	+	12	1497	c.1223G>A	c.(1222-1224)cGc>cAc	p.R408H	KIF5A_ENST00000286452.5_Missense_Mutation_p.R319H	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	408					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						ATCGTGGTGCGCATCGCGCCC	0.627																																					p.R408H		Atlas-SNP	.											.	KIF5A	143	.	0			c.G1223A						PASS	.						57.0	45.0	49.0					12																	57963875		2203	4300	6503	SO:0001583	missense	3798	exon12			TGGTGCGCATCGC	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1223G>A	chr12.hg19:g.57963875G>A	ENSP00000408979:p.Arg408His	65.0	0.0	.		47.0	21.0	.	NM_004984	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	hg19	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496792	0.26861	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.76968	-1.06;-1.06	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.67933	0.2946	N	0.25890	0.77	0.58432	D	0.999996	B;B	0.15719	0.007;0.014	B;B	0.08055	0.003;0.003	T	0.63332	-0.6661	10	0.40728	T	0.16	.	17.1515	0.86779	0.0:0.0:1.0:0.0	.	319;408	B7Z2M7;Q12840	.;KIF5A_HUMAN	H	408;319	ENSP00000408979:R408H;ENSP00000286452:R319H	ENSP00000286452:R319H	R	+	2	0	KIF5A	56250142	1.000000	0.71417	0.999000	0.59377	0.062000	0.15995	4.074000	0.57577	2.667000	0.90743	0.655000	0.94253	CGC	.	.	.	none		0.627	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
FICD	11153	hgsc.bcm.edu	37	12	108913231	108913231	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr12:108913231G>C	ENST00000552695.1	+	3	1591	c.1356G>C	c.(1354-1356)gaG>gaC	p.E452D	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	452					negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						GGTTCAAGGAGACGCTTCCTG	0.498																																					p.E452D		Atlas-SNP	.											.	FICD	35	.	0			c.G1356C						PASS	.						48.0	40.0	43.0					12																	108913231		2203	4300	6503	SO:0001583	missense	11153	exon3			CAAGGAGACGCTT	AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.1356G>C	chr12.hg19:g.108913231G>C	ENSP00000446479:p.Glu452Asp	42.0	0.0	.		34.0	11.0	.	NM_007076	O75406	Missense_Mutation	SNP	ENST00000552695.1	hg19	CCDS9116.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369148	0.42003	.	.	ENSG00000198855	ENST00000552695	.	.	.	6.02	4.21	0.49690	.	0.212676	0.50627	D	0.000109	T	0.29652	0.0740	N	0.08118	0	0.80722	D	1	B	0.27791	0.189	B	0.22386	0.039	T	0.09314	-1.0680	9	0.48119	T	0.1	-14.3343	8.8477	0.35181	0.2969:0.0:0.7031:0.0	.	452	Q9BVA6	FICD_HUMAN	D	452	.	ENSP00000446479:E452D	E	+	3	2	FICD	107437361	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.997000	0.40786	0.891000	0.36235	-0.136000	0.14681	GAG	.	.	.	none		0.498	FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404842.1	NM_007076	
CHAMP1	283489	hgsc.bcm.edu	37	13	115091586	115091586	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr13:115091586G>A	ENST00000361283.1	+	3	2578	c.2269G>A	c.(2269-2271)Gta>Ata	p.V757I		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	757	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TAAAAATCATGTAGCAGCCCA	0.348																																					p.V757I		Atlas-SNP	.											.	.	.	.	0			c.G2269A						PASS	.						69.0	71.0	70.0					13																	115091586		2203	4300	6503	SO:0001583	missense	283489	exon3			AATCATGTAGCAG	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.2269G>A	chr13.hg19:g.115091586G>A	ENSP00000354730:p.Val757Ile	139.0	0.0	.		97.0	45.0	.	NM_001164144	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	ENST00000361283.1	hg19	CCDS9545.1	.	.	.	.	.	.	.	.	.	.	g	16.10	3.026411	0.54683	.	.	ENSG00000198824	ENST00000361283	T	0.41400	1.0	5.81	4.96	0.65561	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000057	T	0.37073	0.0990	L	0.31845	0.965	0.29635	N	0.845125	D	0.55605	0.972	P	0.48334	0.574	T	0.25882	-1.0119	9	.	.	.	-10.4679	10.7799	0.46371	0.0695:0.1292:0.8013:0.0	.	757	Q96JM3	ZN828_HUMAN	I	757	ENSP00000354730:V757I	.	V	+	1	0	ZNF828	114109688	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.615000	0.46368	2.746000	0.94184	0.655000	0.94253	GTA	.	.	.	none		0.348	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436	
NRDE2	55051	hgsc.bcm.edu	37	14	90755068	90755068	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr14:90755068T>C	ENST00000354366.3	-	11	2883	c.2651A>G	c.(2650-2652)gAc>gGc	p.D884G	NRDE2_ENST00000357904.3_Missense_Mutation_p.D653G	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	884																	ACCCAAACAGTCCTGCAGTGC	0.527																																					p.D884G		Atlas-SNP	.											.	.	.	.	0			c.A2651G						PASS	.						61.0	60.0	60.0					14																	90755068		2203	4300	6503	SO:0001583	missense	55051	exon11			AAACAGTCCTGCA	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.2651A>G	chr14.hg19:g.90755068T>C	ENSP00000346335:p.Asp884Gly	61.0	0.0	.		78.0	42.0	.	NM_017970	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	ENST00000354366.3	hg19	CCDS9890.1	.	.	.	.	.	.	.	.	.	.	T	9.884	1.202458	0.22121	.	.	ENSG00000119720	ENST00000354366;ENST00000357904	T;T	0.32515	1.85;1.45	5.1	3.91	0.45181	.	0.183302	0.46442	D	0.000284	T	0.27731	0.0682	M	0.72118	2.19	0.42839	D	0.994042	P;P	0.40144	0.704;0.495	B;B	0.30401	0.115;0.106	T	0.08207	-1.0733	10	0.25751	T	0.34	-33.9301	11.8658	0.52493	0.0:0.0:0.1464:0.8536	.	653;884	E9PBK4;Q9H7Z3	.;CN102_HUMAN	G	884;653	ENSP00000346335:D884G;ENSP00000350579:D653G	ENSP00000346335:D884G	D	-	2	0	C14orf102	89824821	1.000000	0.71417	0.979000	0.43373	0.044000	0.14063	1.437000	0.34991	0.916000	0.36871	0.528000	0.53228	GAC	.	.	.	none		0.527	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970	
MAPK6	5597	hgsc.bcm.edu	37	15	52357196	52357196	+	Nonstop_Mutation	SNP	A	A	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr15:52357196A>T	ENST00000261845.5	+	6	2972	c.2165A>T	c.(2164-2166)tAa>tTa	p.*722L	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	0					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CATCTGAACTAAAACACTCAG	0.338																																					p.X722L		Atlas-SNP	.											.	MAPK6	70	.	0			c.A2165T						PASS	.						36.0	38.0	38.0					15																	52357196		2135	4102	6237	SO:0001578	stop_lost	5597	exon6			TGAACTAAAACAC	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.2165A>T	chr15.hg19:g.52357196A>T	ENSP00000261845:p.*722Leuext*24	131.0	0.0	.		112.0	44.0	.	NM_002748	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	hg19	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	A	11.66	1.706321	0.30232	.	.	ENSG00000069956	ENST00000261845	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8766	0.63655	1.0:0.0:0.0:0.0	.	.	.	.	L	722	.	.	X	+	2	2	MAPK6	50144488	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.522000	0.53480	1.709000	0.51313	0.444000	0.29173	TAA	.	.	.	none		0.338	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
MPG	4350	hgsc.bcm.edu	37	16	135675	135675	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr16:135675C>A	ENST00000219431.4	+	5	1027	c.796C>A	c.(796-798)Cat>Aat	p.H266N	MPG_ENST00000397817.1_Missense_Mutation_p.H249N|NPRL3_ENST00000405960.3_5'Flank	NM_002434.3	NP_002425.2	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase	266					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)	alkylbase DNA N-glycosylase activity (GO:0003905)|damaged DNA binding (GO:0003684)|DNA-3-methyladenine glycosylase activity (GO:0008725)|DNA-3-methylguanine glycosylase activity (GO:0052822)|DNA-7-methyladenine glycosylase activity (GO:0052821)|DNA-7-methylguanine glycosylase activity (GO:0043916)			endometrium(4)|kidney(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				GGGCGTCGGCCATGCAGGGGA	0.677								Base excision repair (BER), DNA glycosylases																													p.H266N		Atlas-SNP	.											.	MPG	26	.	0			c.C796A						PASS	.						19.0	22.0	21.0					16																	135675		2201	4299	6500	SO:0001583	missense	4350	exon5			GTCGGCCATGCAG		CCDS32345.1, CCDS32346.1, CCDS42087.1	16p13.3	2008-07-29			ENSG00000103152	ENSG00000103152	3.2.2.21		7211	protein-coding gene	gene with protein product	"""alkyladenine DNA glycosylase"""	156565				1874728	Standard	NM_002434		Approved	MDG	uc002cfo.4	P29372	OTTHUMG00000047887	ENST00000219431.4:c.796C>A	chr16.hg19:g.135675C>A	ENSP00000219431:p.His266Asn	91.0	0.0	.		95.0	58.0	.	NM_002434	G5E9E2|Q13770|Q15275|Q15961|Q5J9I4|Q96BZ6|Q96S33|Q9NNX5	Missense_Mutation	SNP	ENST00000219431.4	hg19	CCDS32346.1	.	.	.	.	.	.	.	.	.	.	C	4.676	0.125740	0.08931	.	.	ENSG00000103152	ENST00000436333;ENST00000397817;ENST00000356432;ENST00000219431	T;T;T;T	0.15718	2.4;2.4;2.4;2.4	5.39	-10.8	0.00216	Formyl transferase, C-terminal-like (1);	0.916781	0.09550	N	0.787006	T	0.03178	0.0093	N	0.01729	-0.75	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25047	-1.0143	10	0.15066	T	0.55	-18.2344	1.8122	0.03092	0.3214:0.2239:0.0751:0.3795	.	261;266	Q5J9I4;P29372	.;3MG_HUMAN	N	249;249;261;266	ENSP00000388097:H249N;ENSP00000380918:H249N;ENSP00000348809:H261N;ENSP00000219431:H266N	ENSP00000219431:H266N	H	+	1	0	MPG	75675	0.000000	0.05858	0.000000	0.03702	0.265000	0.26407	-0.133000	0.10451	-2.198000	0.00749	-0.505000	0.04504	CAT	.	.	.	none		0.677	MPG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109121.4		
CRAMP1L	57585	hgsc.bcm.edu	37	16	1717963	1717963	+	Splice_Site	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr16:1717963G>A	ENST00000397412.3	+	18	3202	c.3103G>A	c.(3103-3105)Ggc>Agc	p.G1035S	CRAMP1L_ENST00000436138.3_Splice_Site_p.G1032S|CRAMP1L_ENST00000293925.5_Splice_Site_p.G1035S|LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000262317.4_Splice_Site_p.G413S			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1035						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						CTCCCAGCAGGGCTCATCTGT	0.537																																					p.G1035S		Atlas-SNP	.											.	CRAMP1L	60	.	0			c.G3103A						PASS	.						49.0	45.0	46.0					16																	1717963		2008	4186	6194	SO:0001630	splice_region_variant	57585	exon17			CAGCAGGGCTCAT	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3103-1G>A	chr16.hg19:g.1717963G>A		103.0	0.0	.		122.0	65.0	.	NM_020825	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	ENST00000397412.3	hg19	CCDS10440.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.636|9.636	1.137722|1.137722	0.21123|0.21123	.|.	.|.	ENSG00000007545|ENSG00000007545	ENST00000415022|ENST00000397412;ENST00000293925;ENST00000436138;ENST00000262317	.|.	.|.	.|.	5.86|5.86	3.88|3.88	0.44766|0.44766	.|.	0.761849|0.761849	0.12840|0.12840	N|N	0.434905|0.434905	T|T	0.44180|0.44180	0.1281|0.1281	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|B	.|0.23249	.|0.082	.|B	.|0.28011	.|0.085	T|T	0.12708|0.12708	-1.0537|-1.0537	6|8	.|.	.|.	.|.	-3.5501|-3.5501	9.7444|9.7444	0.40437|0.40437	0.0756:0.1391:0.7853:0.0|0.0756:0.1391:0.7853:0.0	.|.	.|1035	.|Q96RY5	.|CRML_HUMAN	E|S	135|1035;1035;1032;413	.|.	.|.	G|G	+|+	2|1	0|0	CRAMP1L|CRAMP1L	1657964|1657964	0.995000|0.995000	0.38212|0.38212	0.655000|0.655000	0.29622|0.29622	0.263000|0.263000	0.26337|0.26337	2.508000|2.508000	0.45450|0.45450	0.786000|0.786000	0.33708|0.33708	0.650000|0.650000	0.86243|0.86243	GGG|GGC	.	.	.	none		0.537	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		Missense_Mutation
ANKFY1	51479	hgsc.bcm.edu	37	17	4087143	4087143	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:4087143G>A	ENST00000341657.4	-	13	1797	c.1762C>T	c.(1762-1764)Cga>Tga	p.R588*	ANKFY1_ENST00000574367.1_Nonsense_Mutation_p.R588*|CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000573722.1_5'Flank|Y_RNA_ENST00000516003.1_RNA|ANKFY1_ENST00000570535.1_Nonsense_Mutation_p.R630*	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	588					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GTCTGGTCTCGGGAATCTTTG	0.527																																					p.R630X		Atlas-SNP	.											.	ANKFY1	81	.	0			c.C1888T						PASS	.						130.0	134.0	133.0					17																	4087143		1936	4146	6082	SO:0001587	stop_gained	51479	exon13			GGTCTCGGGAATC	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.1762C>T	chr17.hg19:g.4087143G>A	ENSP00000343362:p.Arg588*	68.0	0.0	.		35.0	9.0	.	NM_001257999	A8KA65|Q5RKV4|Q9ULG5	Nonsense_Mutation	SNP	ENST00000341657.4	hg19		.	.	.	.	.	.	.	.	.	.	G	36	5.646460	0.96704	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	4.81	-0.265	0.12946	.	0.197229	0.41001	D	0.000965	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-0.3118	7.3258	0.26555	0.0923:0.0:0.3819:0.5258	.	.	.	.	X	588;529	.	ENSP00000343362:R588X	R	-	1	2	ANKFY1	4033892	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.230000	0.32612	0.388000	0.25054	0.467000	0.42956	CGA	.	.	.	none		0.527	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
MYO18A	399687	hgsc.bcm.edu	37	17	27441098	27441098	+	Silent	SNP	C	C	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:27441098C>A	ENST00000527372.1	-	15	2709	c.2529G>T	c.(2527-2529)gcG>gcT	p.A843A	MYO18A_ENST00000354329.4_Silent_p.A843A|MYO18A_ENST00000533112.1_Silent_p.A843A|MYO18A_ENST00000531253.1_Silent_p.A843A	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	843	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			AGTCGTCAAACGCCAGCTCGA	0.607																																					p.A843A	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.G2529T						PASS	.						39.0	47.0	45.0					17																	27441098		1988	4160	6148	SO:0001819	synonymous_variant	399687	exon15			GTCAAACGCCAGC	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2529G>T	chr17.hg19:g.27441098C>A		23.0	0.0	.		24.0	6.0	.	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	hg19	CCDS45642.1																																																																																			.	.	.	none		0.607	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
TMEM106A	113277	hgsc.bcm.edu	37	17	41365867	41365867	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:41365867G>T	ENST00000331615.3	+	4	469	c.232G>T	c.(232-234)Gct>Tct	p.A78S	TMEM106A_ENST00000541594.1_Missense_Mutation_p.A30S|TMEM106A_ENST00000536052.1_Missense_Mutation_p.A78S|TMEM106A_ENST00000592564.1_3'UTR|TMEM106A_ENST00000588659.1_Missense_Mutation_p.A78S	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	78						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		GCAGTTGGTGGCTCTCATTCC	0.572																																					p.A78S		Atlas-SNP	.											.	TMEM106A	20	.	0			c.G232T						PASS	.						103.0	80.0	88.0					17																	41365867		2203	4296	6499	SO:0001583	missense	113277	exon4			TTGGTGGCTCTCA	AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.232G>T	chr17.hg19:g.41365867G>T	ENSP00000330774:p.Ala78Ser	50.0	0.0	.		22.0	9.0	.	NM_145041	A8K2X2|B7Z698	Missense_Mutation	SNP	ENST00000331615.3	hg19	CCDS11462.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040236	0.93630	.	.	ENSG00000184988	ENST00000331615;ENST00000536052;ENST00000541594	T;T;T	0.38401	1.14;1.14;1.14	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.65481	0.2695	M	0.86028	2.79	0.54753	D	0.999982	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.70439	-0.4871	10	0.87932	D	0	-19.9634	16.644	0.85172	0.0:0.0:1.0:0.0	.	78;30;78	B7Z779;B7Z698;Q96A25	.;.;T106A_HUMAN	S	78;78;30	ENSP00000330774:A78S;ENSP00000439835:A78S;ENSP00000439844:A30S	ENSP00000330774:A78S	A	+	1	0	TMEM106A	38721393	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.837000	0.75354	2.646000	0.89796	0.655000	0.94253	GCT	.	.	.	none		0.572	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2	NM_145041	
MED13	9969	hgsc.bcm.edu	37	17	60038289	60038289	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:60038289A>T	ENST00000397786.2	-	23	5495	c.5419T>A	c.(5419-5421)Tgc>Agc	p.C1807S		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1807					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGATCTGTGCAAGATGCAAGA	0.333																																					p.C1807S		Atlas-SNP	.											.	MED13	181	.	0			c.T5419A						PASS	.						120.0	110.0	113.0					17																	60038289		1841	4094	5935	SO:0001583	missense	9969	exon23			CTGTGCAAGATGC	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5419T>A	chr17.hg19:g.60038289A>T	ENSP00000380888:p.Cys1807Ser	166.0	0.0	.		180.0	106.0	.	NM_005121	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	hg19	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.798802	0.90538	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.82711	-1.64	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.90511	0.7027	M	0.75447	2.3	0.80722	D	1	D	0.62365	0.991	D	0.78314	0.991	D	0.91619	0.5309	10	0.72032	D	0.01	-7.5787	15.3239	0.74144	1.0:0.0:0.0:0.0	.	1807	Q9UHV7	MED13_HUMAN	S	1807;1806	ENSP00000380888:C1807S	ENSP00000262436:C1806S	C	-	1	0	MED13	57393071	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.842000	0.92136	2.016000	0.59253	0.519000	0.50382	TGC	.	.	.	none		0.333	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
PSMC5	5705	hgsc.bcm.edu	37	17	61909160	61909160	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:61909160C>T	ENST00000310144.6	+	11	1465	c.1157C>T	c.(1156-1158)gCa>gTa	p.A386V	PSMC5_ENST00000375812.4_Missense_Mutation_p.A378V|FTSJ3_ENST00000580295.1_5'Flank|PSMC5_ENST00000580864.1_Missense_Mutation_p.A378V|PSMC5_ENST00000581882.1_Missense_Mutation_p.A378V	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	386	May mediate interaction with PRPF9. {ECO:0000250|UniProtKB:P62196}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						TTTGAGATGGCAGTAGCCAAG	0.527																																					p.A386V		Atlas-SNP	.											.	PSMC5	41	.	0			c.C1157T						PASS	.						111.0	87.0	95.0					17																	61909160		2203	4300	6503	SO:0001583	missense	5705	exon11			AGATGGCAGTAGC	L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.1157C>T	chr17.hg19:g.61909160C>T	ENSP00000310572:p.Ala386Val	118.0	0.0	.		142.0	46.0	.	NM_002805	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Missense_Mutation	SNP	ENST00000310144.6	hg19	CCDS11645.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557777	0.86231	.	.	ENSG00000087191	ENST00000310144;ENST00000375812	T;T	0.80653	-1.4;-1.4	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.90256	0.6953	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.63703	0.763;0.917	D	0.91405	0.5146	10	0.87932	D	0	.	16.9624	0.86275	0.0:1.0:0.0:0.0	.	378;386	A8K3Z3;P62195	.;PRS8_HUMAN	V	386;378	ENSP00000310572:A386V;ENSP00000364970:A378V	ENSP00000310572:A386V	A	+	2	0	PSMC5	59262892	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	5.877000	0.69675	2.873000	0.98535	0.561000	0.74099	GCA	.	.	.	none		0.527	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444404.1	NM_002805	
PPAN	56342	hgsc.bcm.edu	37	19	10218531	10218531	+	Splice_Site	SNP	G	G	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr19:10218531G>C	ENST00000253107.7	+	4	448		c.e4+1		PPAN_ENST00000556468.1_Splice_Site|PPAN-P2RY11_ENST00000393796.4_Splice_Site|PPAN_ENST00000393793.1_Splice_Site|PPAN-P2RY11_ENST00000428358.1_Splice_Site|SNORD105_ENST00000386910.1_RNA|SNORD105B_ENST00000458770.1_RNA	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)						RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			GGTCAAGAAGGTGAGAGGGGT	0.597																																					.		Atlas-SNP	.											.	PPAN	43	.	0			c.342+1G>C						PASS	.						76.0	90.0	85.0					19																	10218531		2203	4299	6502	SO:0001630	splice_region_variant	56342	exon4			AAGAAGGTGAGAG	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.342+1G>C	chr19.hg19:g.10218531G>C		43.0	0.0	.		57.0	25.0	.	NM_020230	C9J3F9|Q9BW97|Q9H170	Splice_Site	SNP	ENST00000253107.7	hg19	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989428	0.53934	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793;ENST00000446223;ENST00000430370	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1466	0.89659	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPAN;PPAN-P2RY11	10079531	1.000000	0.71417	0.984000	0.44739	0.522000	0.34438	7.352000	0.79404	2.586000	0.87340	0.561000	0.74099	.	.	.	.	none		0.597	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230	Intron
COX7A1	1346	hgsc.bcm.edu	37	19	36641914	36641914	+	Silent	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr19:36641914G>A	ENST00000292907.3	-	4	671	c.210C>T	c.(208-210)tcC>tcT	p.S70S	COX7A1_ENST00000437291.2_Silent_p.S14S|AD001527.7_ENST00000604228.1_RNA	NM_001864.2	NP_001855.1	P24310	CX7A1_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)	70					generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)	integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			endometrium(2)|large_intestine(1)	3	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCCAGCCAAGGGAGTACAAGC	0.542																																					p.S70S		Atlas-SNP	.											.	COX7A1	9	.	0			c.C210T						PASS	.						135.0	116.0	122.0					19																	36641914		2203	4300	6503	SO:0001819	synonymous_variant	1346	exon4			GCCAAGGGAGTAC	BC002757	CCDS12490.1	19q13.1	2011-07-04			ENSG00000161281	ENSG00000161281	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2287	protein-coding gene	gene with protein product		123995		COX7A		1327965, 2550906	Standard	NM_001864		Approved	COX7AH	uc002odm.1	P24310	OTTHUMG00000048144	ENST00000292907.3:c.210C>T	chr19.hg19:g.36641914G>A		109.0	0.0	.		74.0	35.0	.	NM_001864		Silent	SNP	ENST00000292907.3	hg19	CCDS12490.1	.	.	.	.	.	.	.	.	.	.	g	7.112	0.576232	0.13686	.	.	ENSG00000161281	ENST00000437291	.	.	.	4.54	3.51	0.40186	.	.	.	.	.	T	0.58395	0.2119	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54503	-0.8284	4	.	.	.	-14.8375	8.4726	0.32995	0.1061:0.0:0.8939:0.0	.	.	.	.	L	100	.	.	P	-	2	0	COX7A1	41333754	1.000000	0.71417	0.991000	0.47740	0.585000	0.36419	2.050000	0.41297	1.121000	0.41925	0.643000	0.83706	CCC	.	.	.	none		0.542	COX7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109545.2	NM_001864	
FIZ1	84922	hgsc.bcm.edu	37	19	56109104	56109104	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr19:56109104G>T	ENST00000221665.3	-	2	217	c.128C>A	c.(127-129)gCc>gAc	p.A43D	FIZ1_ENST00000592585.1_Missense_Mutation_p.A43D|ZNF524_ENST00000301073.3_5'Flank	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	43					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TGTGTGCCGGGCAAAGTGGCG	0.672																																					p.A43D		Atlas-SNP	.											FIZ1,NS,carcinoma,0,1	FIZ1	29	.	0			c.C128A						PASS	.						50.0	46.0	48.0					19																	56109104		2203	4299	6502	SO:0001583	missense	84922	exon2			TGCCGGGCAAAGT	AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.128C>A	chr19.hg19:g.56109104G>T	ENSP00000221665:p.Ala43Asp	109.0	0.0	.		77.0	33.0	.	NM_032836	A2RU72|Q6ZMJ7	Missense_Mutation	SNP	ENST00000221665.3	hg19	CCDS12928.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.779874	0.31502	.	.	ENSG00000179943	ENST00000221665	T	0.18810	2.19	3.57	3.57	0.40892	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17238	0.0414	N	0.21282	0.65	0.09310	N	1	B	0.25850	0.136	B	0.33196	0.159	T	0.20207	-1.0282	9	0.72032	D	0.01	-17.8725	9.9577	0.41678	0.0:0.0:0.7965:0.2035	.	43	Q96SL8	FIZ1_HUMAN	D	43	ENSP00000221665:A43D	ENSP00000221665:A43D	A	-	2	0	FIZ1	60800916	0.000000	0.05858	0.988000	0.46212	0.756000	0.42949	0.243000	0.18106	2.017000	0.59298	0.462000	0.41574	GCC	.	.	.	none		0.672	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453350.1	NM_032836	
SNRPB2	6629	hgsc.bcm.edu	37	20	16719517	16719517	+	Silent	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr20:16719517T>C	ENST00000246071.6	+	5	615	c.399T>C	c.(397-399)aaT>aaC	p.N133N	SNRPB2_ENST00000377943.5_Silent_p.N133N	NM_003092.4	NP_003083.1	P08579	RU2B_HUMAN	small nuclear ribonucleoprotein polypeptide B	133					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	nucleotide binding (GO:0000166)|snRNA binding (GO:0017069)			large_intestine(2)|lung(2)|urinary_tract(1)	5						ATTCAGCTAATACCCAAGGAA	0.323																																					p.N133N		Atlas-SNP	.											.	SNRPB2	12	.	0			c.T399C						PASS	.						65.0	66.0	66.0					20																	16719517		2203	4298	6501	SO:0001819	synonymous_variant	6629	exon5			AGCTAATACCCAA		CCDS13123.1	20p12.1	2013-02-12	2010-07-07		ENSG00000125870	ENSG00000125870		"""RNA binding motif (RRM) containing"""	11155	protein-coding gene	gene with protein product		603520	"""small nuclear ribonucleoprotein polypeptide B2"", ""small nuclear ribonucleoprotein polypeptide B''"""			2951739	Standard	NM_198220		Approved	Msl1	uc002wpi.2	P08579	OTTHUMG00000031933	ENST00000246071.6:c.399T>C	chr20.hg19:g.16719517T>C		166.0	0.0	.		210.0	131.0	.	NM_003092	B2R7J3|D3DW21|Q9UJD4	Silent	SNP	ENST00000246071.6	hg19	CCDS13123.1																																																																																			.	.	.	none		0.323	SNRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078110.1	NM_003092	
SYS1	90196	hgsc.bcm.edu	37	20	43995569	43995569	+	Silent	SNP	T	T	A	rs564852027		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr20:43995569T>A	ENST00000243918.5	+	4	576	c.285T>A	c.(283-285)acT>acA	p.T95T	SYS1_ENST00000414310.1_Silent_p.T74T|SYS1-DBNDD2_ENST00000452133.1_Intron|SYS1_ENST00000372727.1_Silent_p.T95T|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1_ENST00000426004.1_Intron|SYS1_ENST00000479779.1_3'UTR	NM_033542.3	NP_291020.1	Q8N2H4	SYS1_HUMAN	Sys1 golgi trafficking protein	95					protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|large_intestine(2)|prostate(1)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				TGGATTTCACTGTCACTGTCC	0.587																																					p.T95T		Atlas-SNP	.											.	SYS1	15	.	0			c.T285A						PASS	.						161.0	137.0	145.0					20																	43995569		2203	4300	6503	SO:0001819	synonymous_variant	90196	exon5			TTTCACTGTCACT	AL021578	CCDS13351.1, CCDS56192.1	20q13.12	2014-05-07	2014-05-07	2006-11-06	ENSG00000204070	ENSG00000204070			16162	protein-coding gene	gene with protein product		612979	"""chromosome 20 open reading frame 169"", ""SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)"""	C20orf169		15077113	Standard	NM_001197129		Approved	dJ453C12.4	uc002xnv.3	Q8N2H4	OTTHUMG00000032579	ENST00000243918.5:c.285T>A	chr20.hg19:g.43995569T>A		135.0	0.0	.		145.0	47.0	.	NM_001197129	C9JFB3|E1P620|Q5QPU7|Q96SD8|Q9BQZ2|Q9BQZ4|Q9H1F7	Silent	SNP	ENST00000243918.5	hg19	CCDS13351.1																																																																																			.	.	.	none		0.587	SYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079453.2	NM_033542	
CDH22	64405	hgsc.bcm.edu	37	20	44806794	44806794	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr20:44806794C>A	ENST00000372262.3	-	10	2106	c.1706G>T	c.(1705-1707)cGg>cTg	p.R569L	CDH22_ENST00000537909.1_Missense_Mutation_p.R569L	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	569	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CTGCTCCTGCCGGTTGAAGCC	0.642																																					p.R569L		Atlas-SNP	.											.	CDH22	112	.	0			c.G1706T						PASS	.						75.0	57.0	63.0					20																	44806794		2203	4300	6503	SO:0001583	missense	64405	exon11			TCCTGCCGGTTGA	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1706G>T	chr20.hg19:g.44806794C>A	ENSP00000361336:p.Arg569Leu	74.0	0.0	.		69.0	37.0	.	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	hg19	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711454	0.89112	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.59638	0.25;0.25	4.36	4.36	0.52297	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	M	0.76328	2.33	0.58432	D	0.999997	D	0.54964	0.969	P	0.50708	0.648	T	0.71094	-0.4692	10	0.46703	T	0.11	.	15.618	0.76784	0.0:1.0:0.0:0.0	.	569	Q9UJ99	CAD22_HUMAN	L	569	ENSP00000361336:R569L;ENSP00000437790:R569L	ENSP00000361336:R569L	R	-	2	0	CDH22	44240201	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.586000	0.60984	2.263000	0.75096	0.650000	0.86243	CGG	.	.	.	none		0.642	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
MYT1	4661	hgsc.bcm.edu	37	20	62843457	62843457	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr20:62843457G>A	ENST00000328439.1	+	9	1847	c.1483G>A	c.(1483-1485)Ggt>Agt	p.G495S	MYT1_ENST00000360149.4_Missense_Mutation_p.G197S|MYT1_ENST00000536311.1_Missense_Mutation_p.G495S	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Interaction with CDC2-CCNB1.|Interaction with PIN1.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CACAGGCCAGGGTCACGTGAA	0.637																																					p.G495S	GBM(59;481 1041 20555 21139 33705)	Atlas-SNP	.											.	MYT1	152	.	0			c.G1483A						PASS	.						136.0	126.0	129.0					20																	62843457		2203	4300	6503	SO:0001583	missense	4661	exon9			GGCCAGGGTCACG	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1483G>A	chr20.hg19:g.62843457G>A	ENSP00000327465:p.Gly495Ser	25.0	0.0	.		29.0	21.0	.	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	hg19	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822666	0.71028	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.72505	-0.66;-0.61;1.74	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.87442	0.6178	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.999	D	0.90880	0.4753	10	0.87932	D	0	-27.2192	17.4965	0.87719	0.0:0.0:1.0:0.0	.	495;495;197	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	S	197;495;495	ENSP00000353269:G197S;ENSP00000327465:G495S;ENSP00000442412:G495S	ENSP00000327465:G495S	G	+	1	0	MYT1	62313901	1.000000	0.71417	0.997000	0.53966	0.689000	0.40095	9.725000	0.98778	2.187000	0.69744	0.557000	0.71058	GGT	.	.	.	none		0.637	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
TIAM1	7074	hgsc.bcm.edu	37	21	32638851	32638851	+	Silent	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr21:32638851G>A	ENST00000286827.3	-	5	909	c.438C>T	c.(436-438)ggC>ggT	p.G146G	TIAM1_ENST00000541036.1_Silent_p.G146G|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	146					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GCTGCCTCCTGCCTCCCTCAG	0.547																																					p.G146G		Atlas-SNP	.											.	TIAM1	522	.	0			c.C438T						PASS	.						106.0	94.0	98.0					21																	32638851		2203	4300	6503	SO:0001819	synonymous_variant	7074	exon5			CCTCCTGCCTCCC		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.438C>T	chr21.hg19:g.32638851G>A		52.0	0.0	.		62.0	30.0	.	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	hg19	CCDS13609.1																																																																																			.	.	.	none		0.547	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
URB1	9875	hgsc.bcm.edu	37	21	33687358	33687358	+	Silent	SNP	A	A	G			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr21:33687358A>G	ENST00000382751.3	-	39	6802	c.6687T>C	c.(6685-6687)gcT>gcC	p.A2229A		NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	2229						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						CCGGCCGCTGAGCCCCCAGCC	0.592																																					p.A2229A		Atlas-SNP	.											.	URB1	176	.	0			c.T6687C						PASS	.						38.0	41.0	40.0					21																	33687358		692	1591	2283	SO:0001819	synonymous_variant	9875	exon39			CCGCTGAGCCCCC	AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.6687T>C	chr21.hg19:g.33687358A>G		110.0	0.0	.		88.0	41.0	.	NM_014825	D3DSE5|Q96NX1|Q9NYQ1	Silent	SNP	ENST00000382751.3	hg19	CCDS46645.1																																																																																			.	.	.	none		0.592	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139400.2		
RANBP1	5902	hgsc.bcm.edu	37	22	20109843	20109843	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr22:20109843G>A	ENST00000331821.3	+	3	311	c.209G>A	c.(208-210)cGa>cAa	p.R70Q	RANBP1_ENST00000430524.1_5'UTR|RANBP1_ENST00000402752.1_Missense_Mutation_p.R70Q	NM_002882.2	NP_002873.1	P43487	RANG_HUMAN	RAN binding protein 1	70	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|positive regulation of mitotic centrosome separation (GO:0046604)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|spindle organization (GO:0007051)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Ran GTPase binding (GO:0008536)			breast(1)|large_intestine(1)|lung(1)|ovary(1)	4	Colorectal(54;0.0993)					TGGAAGGAGCGAGGCACTGGT	0.562																																					p.R70Q		Atlas-SNP	.											.	RANBP1	19	.	0			c.G209A						PASS	.						75.0	67.0	70.0					22																	20109843		2203	4300	6503	SO:0001583	missense	5902	exon3			AGGAGCGAGGCAC	D38076	CCDS13775.1, CCDS63408.1, CCDS74823.1	22q11.21	2008-06-16			ENSG00000099901	ENSG00000099901			9847	protein-coding gene	gene with protein product		601180				7616957, 10330396	Standard	NM_001278639		Approved	HTF9A	uc002zro.1	P43487	OTTHUMG00000150490	ENST00000331821.3:c.209G>A	chr22.hg19:g.20109843G>A	ENSP00000327583:p.Arg70Gln	101.0	0.0	.		62.0	10.0	.	NM_002882	Q53EY3	Missense_Mutation	SNP	ENST00000331821.3	hg19	CCDS13775.1	.	.	.	.	.	.	.	.	.	.	G	36	5.878801	0.97055	.	.	ENSG00000099901	ENST00000432879;ENST00000402752;ENST00000447917;ENST00000331821;ENST00000411892;ENST00000416427;ENST00000421656;ENST00000423859;ENST00000418705	T;T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.53	5.53	0.82687	Pleckstrin homology-type (1);Ran binding protein 1 (3);	0.000000	0.85682	D	0.000000	D	0.85133	0.5627	M	0.93808	3.46	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.994;0.952;0.986	D	0.88552	0.3117	10	0.72032	D	0.01	-3.2042	19.4537	0.94878	0.0:0.0:1.0:0.0	.	70;70;70	B4DE76;Q53EY3;P43487	.;.;RANG_HUMAN	Q	147;70;70;70;70;20;20;20;20	ENSP00000404724:R147Q;ENSP00000384925:R70Q;ENSP00000327583:R70Q;ENSP00000395472:R70Q;ENSP00000404126:R20Q;ENSP00000400940:R20Q;ENSP00000404298:R20Q;ENSP00000413502:R20Q	ENSP00000327583:R70Q	R	+	2	0	RANBP1	18489843	1.000000	0.71417	0.999000	0.59377	0.859000	0.49053	9.618000	0.98365	2.606000	0.88127	0.563000	0.77884	CGA	.	.	.	none		0.562	RANBP1-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343733.1	NM_002882	
IGLL1	3543	hgsc.bcm.edu	37	22	23922377	23922377	+	Start_Codon_SNP	SNP	T	T	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr22:23922377T>C	ENST00000330377.2	-	1	118	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	KB-208E9.1_ENST00000608615.1_lincRNA|IGLL1_ENST00000249053.3_Start_Codon_SNP_p.M1V	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	1					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12						CCTGGCCTCATCGGCCCTCAG	0.687																																					p.M1V		Atlas-SNP	.											.	IGLL1	27	.	0			c.A1G						PASS	.						5.0	5.0	5.0					22																	23922377		2065	4047	6112	SO:0001582	initiator_codon_variant	3543	exon1			GCCTCATCGGCCC	X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL		3139558, 2511029	Standard	NM_020070		Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.1A>G	chr22.hg19:g.23922377T>C	ENSP00000329312:p.Met1Val	57.0	0.0	.		40.0	36.0	.	NM_020070	Q0P681	Missense_Mutation	SNP	ENST00000330377.2	hg19	CCDS13809.1	.	.	.	.	.	.	.	.	.	.	t	8.672	0.903037	0.17760	.	.	ENSG00000128322	ENST00000249053;ENST00000330377;ENST00000438703	T;T	0.01099	6.65;5.34	1.74	1.74	0.24563	.	.	.	.	.	T	0.01092	0.0036	.	.	.	0.80722	D	1	B;B	0.23540	0.087;0.023	B;B	0.20384	0.029;0.006	T	0.56511	-0.7967	8	0.87932	D	0	.	3.5228	0.07748	0.0:0.2088:0.0:0.7912	.	1;1	Q0P681;P15814	.;IGLL1_HUMAN	V	1	ENSP00000329312:M1V;ENSP00000403391:M1V	ENSP00000249053:M1V	M	-	1	0	IGLL1	22252377	0.002000	0.14202	0.014000	0.15608	0.214000	0.24535	0.451000	0.21779	1.078000	0.41014	0.241000	0.17934	ATG	.	.	.	none		0.687	IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319569.1	NM_020070	Missense_Mutation
MKL1	57591	hgsc.bcm.edu	37	22	40803843	40803843	+	IGR	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr22:40803843G>A	ENST00000355630.3	-	0	4496				SGSM3_ENST00000248929.9_Silent_p.L525L|SGSM3_ENST00000454798.2_Silent_p.L458L	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						TCAACGGCCTGCGAGGTGGGG	0.627			T	RBM15	acute megakaryocytic leukemia																																p.L525L		Atlas-SNP	.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	SGSM3	48	.	0			c.G1575A						PASS	.						50.0	53.0	52.0					22																	40803843		2203	4300	6503	SO:0001628	intergenic_variant	27352	exon14			CGGCCTGCGAGGT	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		chr22.hg19:g.40803843G>A		81.0	0.0	.		44.0	41.0	.	NM_015705	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Silent	SNP	ENST00000355630.3	hg19	CCDS14003.1																																																																																			.	.	.	none		0.627	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
GPR173	54328	hgsc.bcm.edu	37	X	53106377	53106377	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chrX:53106377A>C	ENST00000332582.4	+	2	1065	c.574A>C	c.(574-576)Atg>Ctg	p.M192L		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	192					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						CTTCATGCTTATGTTGGCTGT	0.537																																					p.M192L		Atlas-SNP	.											.	GPR173	66	.	0			c.A574C						PASS	.						39.0	37.0	38.0					X																	53106377		2200	4299	6499	SO:0001583	missense	54328	exon2			ATGCTTATGTTGG	AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.574A>C	chrX.hg19:g.53106377A>C	ENSP00000331600:p.Met192Leu	46.0	0.0	.		31.0	31.0	.	NM_018969	B1B0A5	Missense_Mutation	SNP	ENST00000332582.4	hg19	CCDS14349.1	.	.	.	.	.	.	.	.	.	.	A	3.370	-0.128697	0.06753	.	.	ENSG00000184194	ENST00000332582	T	0.70516	-0.49	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.53433	0.1796	L	0.28400	0.85	0.58432	D	0.999999	B	0.11235	0.004	B	0.18871	0.023	T	0.47182	-0.9137	10	0.02654	T	1	-11.4851	11.4995	0.50428	1.0:0.0:0.0:0.0	.	192	Q9NS66	GP173_HUMAN	L	192	ENSP00000331600:M192L	ENSP00000331600:M192L	M	+	1	0	GPR173	53123102	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.287000	0.72671	1.614000	0.50241	0.430000	0.28490	ATG	.	.	.	none		0.537	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056717.2	NM_018969	
PAK3	5063	hgsc.bcm.edu	37	X	110385396	110385396	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chrX:110385396G>A	ENST00000372010.1	+	6	690	c.248G>A	c.(247-249)gGg>gAg	p.G83E	PAK3_ENST00000425146.1_Missense_Mutation_p.G83E|PAK3_ENST00000519681.1_Missense_Mutation_p.G83E|PAK3_ENST00000372007.5_Missense_Mutation_p.G83E|PAK3_ENST00000262836.4_Missense_Mutation_p.G83E|PAK3_ENST00000518291.1_Missense_Mutation_p.G83E|PAK3_ENST00000446737.1_Missense_Mutation_p.G83E|PAK3_ENST00000417227.1_Missense_Mutation_p.G83E|PAK3_ENST00000360648.4_Missense_Mutation_p.G83E			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	83	Autoregulatory region. {ECO:0000250}.|CRIB. {ECO:0000255|PROSITE- ProRule:PRU00057}.|GTPase-binding. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						ATTCATGTGGGGTTTGATGCA	0.393										TSP Lung(19;0.15)																											p.G83E		Atlas-SNP	.											.	PAK3	179	.	0			c.G248A						PASS	.						195.0	193.0	194.0					X																	110385396		2203	4300	6503	SO:0001583	missense	5063	exon4			ATGTGGGGTTTGA	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.248G>A	chrX.hg19:g.110385396G>A	ENSP00000361080:p.Gly83Glu	78.0	0.0	.		51.0	48.0	.	NM_001128166	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	hg19	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.502816	0.85176	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	D;D;D;D;D;D;D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39;-3.39;-3.39;-3.39;-3.39;-3.39;-3.39	5.96	5.09	0.68999	PAK-box/P21-Rho-binding (3);	0.110129	0.64402	D	0.000007	D	0.97123	0.9060	M	0.88031	2.925	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.85130	0.996;0.997;0.994;0.987	D	0.97620	1.0135	10	0.87932	D	0	.	15.638	0.76970	0.0:0.0:0.8618:0.1382	.	83;83;83;83	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	E	83	ENSP00000410853:G83E;ENSP00000401982:G83E;ENSP00000361080:G83E;ENSP00000429113:G83E;ENSP00000361077:G83E;ENSP00000428921:G83E;ENSP00000405642:G83E;ENSP00000353864:G83E;ENSP00000389172:G83E;ENSP00000262836:G83E	ENSP00000262836:G83E	G	+	2	0	PAK3	110272052	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	1.251000	0.43983	0.600000	0.82982	GGG	.	.	.	none		0.393	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
MT-CYB	4519	hgsc.bcm.edu	37	M	14804	14804	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chrM:14804G>C	ENST00000361789.2	+	1	58	c.58G>C	c.(58-60)Gac>Cac	p.D20H	MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	20					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACTCATTCATCGACCTCCCCA	0.443																																					p.D20H		Atlas-SNP	.											.	.	.	.	0			c.G58C						PASS	.																																			SO:0001583	missense	0	exon1			TTCATCGACCTCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.58G>C	chrM.hg19:g.14804G>C	ENSP00000354554:p.Asp20His	50.0	0.0	.		11.0	10.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.443	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
ABHD3	171586	hgsc.bcm.edu	37	18	19283591	19283591	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr18:19283591delG	ENST00000289119.2	-	2	419	c.280delC	c.(280-282)ctgfs	p.L95fs	ABHD3_ENST00000579875.1_5'UTR|ABHD3_ENST00000578270.1_5'UTR|ABHD3_ENST00000580981.1_Frame_Shift_Del_p.L95fs	NM_138340.4	NP_612213.2	Q8WU67	ABHD3_HUMAN	abhydrolase domain containing 3	95						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(2)	10						GGTCTAAGCAGGGTCTGTCCT	0.517																																					p.L94fs		Atlas-Indel,Pindel	.											.	ABHD3	32	.	0			c.281delT						PASS	.						97.0	86.0	89.0					18																	19283591		2203	4300	6503	SO:0001589	frameshift_variant	171586	exon2			.	AK024880	CCDS32802.1	18q11.1	2011-02-16			ENSG00000158201	ENSG00000158201		"""Abhydrolase domain containing"""	18718	protein-coding gene	gene with protein product		612197					Standard	NM_138340		Approved	LABH3	uc002ktl.2	Q8WU67		ENST00000289119.2:c.280delC	chr18.hg19:g.19283591delG	ENSP00000289119:p.Leu95fs	73.0	0.0	0		59.0	20.0	0.338983	NM_138340	B0YIV0|B7Z5C2|O43411	Frame_Shift_Del	DEL	ENST00000289119.2	hg19	CCDS32802.1																																																																																			.	.	.	none		0.517	ABHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444757.1		
WDR35	57539	hgsc.bcm.edu	37	2	20113904	20113904	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:20113904delG	ENST00000345530.3	-	27	3404	c.3289delC	c.(3289-3291)ctcfs	p.L1097fs	WDR35_ENST00000416055.2_Intron|WDR35_ENST00000281405.4_Frame_Shift_Del_p.L1086fs	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	1097					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTGAACTGAGGGTCTCTAAA	0.413																																					p.L1097fs		Atlas-Indel,Pindel	.											.	WDR35	92	.	0			c.3290delT						PASS	.						120.0	121.0	121.0					2																	20113904		2203	4300	6503	SO:0001589	frameshift_variant	57539	exon27			.	AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.3289delC	chr2.hg19:g.20113904delG	ENSP00000314444:p.Leu1097fs	256.0	0.0	0		230.0	95.0	0.413043	NM_001006657	B3KVI5|Q4ZG01|Q8NE11	Frame_Shift_Del	DEL	ENST00000345530.3	hg19	CCDS33152.1																																																																																			.	.	.	none		0.413	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
NF2	4771	hgsc.bcm.edu	37	22	30050649	30050649	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr22:30050649delG	ENST00000338641.4	+	5	892	c.451delG	c.(451-453)ggtfs	p.G151fs	NF2_ENST00000361452.4_Frame_Shift_Del_p.G110fs|NF2_ENST00000403435.1_Frame_Shift_Del_p.G151fs|NF2_ENST00000353887.4_Frame_Shift_Del_p.G68fs|NF2_ENST00000347330.5_Intron|NF2_ENST00000403999.3_Frame_Shift_Del_p.G151fs|NF2_ENST00000334961.7_Frame_Shift_Del_p.G68fs|NF2_ENST00000413209.2_Intron|NF2_ENST00000361166.4_Frame_Shift_Del_p.G151fs|NF2_ENST00000397789.3_Frame_Shift_Del_p.G151fs|NF2_ENST00000361676.4_Frame_Shift_Del_p.G109fs	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	151	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(4)|p.Y150fs*46(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						TTTCCAGTATGGTGACTACGA	0.463			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.Y150X		Atlas-Indel,Pindel	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	1312	.	5	Unknown(4)|Deletion - Frameshift(1)	meninges(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)	c.450delT						PASS	.						163.0	165.0	164.0					22																	30050649		2203	4300	6503	SO:0001589	frameshift_variant	4771	exon5	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	.	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.451delG	chr22.hg19:g.30050649delG	ENSP00000344666:p.Gly151fs	156.0	0.0	0		105.0	98.0	0.933333	NM_181832	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Frame_Shift_Del	DEL	ENST00000338641.4	hg19	CCDS13861.1																																																																																			.	.	.	none		0.463	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
MIOS	54468	hgsc.bcm.edu	37	7	7612994	7612994	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr7:7612994delT	ENST00000340080.4	+	4	1309	c.888delT	c.(886-888)tatfs	p.Y296fs	MIOS_ENST00000405785.1_Frame_Shift_Del_p.Y296fs	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	296						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTAGATTGTATGATATGCAGC	0.408																																					p.Y296fs		Atlas-Indel,Pindel	.											.	MIOS	68	.	0			c.887delA						PASS	.						101.0	96.0	98.0					7																	7612994		1907	4106	6013	SO:0001589	frameshift_variant	54468	exon4			.		CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.888delT	chr7.hg19:g.7612994delT	ENSP00000339881:p.Tyr296fs	104.0	0.0	0		103.0	41.0	0.398058	NM_019005	B2RTV6|O75216|Q7L551|Q9H092	Frame_Shift_Del	DEL	ENST00000340080.4	hg19	CCDS43554.1																																																																																			.	.	.	none		0.408	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	NM_019005	
TRIM65	201292	hgsc.bcm.edu	37	17	73887900	73887901	+	Frame_Shift_Del	DEL	AG	AG	-	rs372788583		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:73887900_73887901delAG	ENST00000269383.3	-	5	1043_1044	c.978_979delCT	c.(976-981)ctctggfs	p.W327fs		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTACTCTGCCAGAGTTTCCTCC	0.574																																					p.327_327del		Atlas-Indel,Pindel	.											.	TRIM65	23	.	0			c.979_980del						PASS	.			5,4259		0,5,2127						3.4	1.0			113	14,8240		6,2,4119	no	frameshift	TRIM65	NM_173547.2		6,7,6246	A1A1,A1R,RR		0.1696,0.1173,0.1518				19,12499				SO:0001589	frameshift_variant	201292	exon5			.	BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.978_979delCT	chr17.hg19:g.73887902_73887903delAG	ENSP00000269383:p.Trp327fs	72.0	0.0	0		68.0	41.0	0.602941	NM_173547	Q4G0F0|Q6DKJ6|Q9BRP6	Frame_Shift_Del	DEL	ENST00000269383.3	hg19	CCDS11732.1																																																																																			.	.	.	weak		0.574	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255170.2	NM_173547	
WDR81	124997	hgsc.bcm.edu	37	17	1634163	1634164	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:1634163_1634164insA	ENST00000409644.1	+	3	3890_3891	c.3890_3891insA	c.(3889-3894)agctgcfs	p.SC1297fs	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000446363.1_De_novo_Start_OutOfFrame|WDR81_ENST00000437219.2_Frame_Shift_Ins_p.SC94fs|WDR81_ENST00000545662.1_De_novo_Start_OutOfFrame|WDR81_ENST00000419248.1_Frame_Shift_Ins_p.SC70fs|WDR81_ENST00000309182.5_Frame_Shift_Ins_p.SC246fs	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1297					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCTGTGCTCAGCTGCCTCCTCC	0.639																																					p.S1297fs		Atlas-INDEL	.											.	WDR81	180	.	0			c.3890_3891insA						PASS	.																																			SO:0001589	frameshift_variant	124997	exon3			.	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	Exception_encountered	chr17.hg19:g.1634163_1634164insA	ENSP00000386609:p.Ser1297fs	53.0	0.0	0		34.0	16.0	0.470588	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Frame_Shift_Ins	INS	ENST00000409644.1	hg19	CCDS54062.1																																																																																			.	.	.	none		0.639	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
SGSM2	9905	hgsc.bcm.edu	37	17	2282478	2282480	+	In_Frame_Del	DEL	CAT	CAT	-	rs143690160		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	CAT	CAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:2282478_2282480delCAT	ENST00000426855.2	+	22	3088_3090	c.2913_2915delCAT	c.(2911-2916)gacatc>gac	p.I973del	RP1-59D14.5_ENST00000573007.1_RNA|RP1-59D14.5_ENST00000574290.1_RNA|SGSM2_ENST00000574563.1_In_Frame_Del_p.I973del|SGSM2_ENST00000268989.3_In_Frame_Del_p.I1018del	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	973					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.I1018delI(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		ACTTCACTGACATCATCAAGTTT	0.581																																					p.1016_1017del		Atlas-Indel,Pindel	.											.	SGSM2	60	.	1	Deletion - In frame(1)	large_intestine(1)	c.3047_3049del						PASS	.																																			SO:0001651	inframe_deletion	9905	exon23			.	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.2913_2915delCAT	chr17.hg19:g.2282481_2282483delCAT	ENSP00000415107:p.Ile973del	124.0	0.0	0		93.0	32.0	0.344086	NM_014853	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	In_Frame_Del	DEL	ENST00000426855.2	hg19	CCDS45570.1																																																																																			.	.	.	none		0.581	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
RPGRIP1L	23322	hgsc.bcm.edu	37	16	53674983	53674984	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr16:53674983_53674984insA	ENST00000379925.3	-	19	2969_2970	c.2919_2920insT	c.(2917-2922)aagaagfs	p.K974fs	RPGRIP1L_ENST00000563746.1_Frame_Shift_Ins_p.K974fs|RPGRIP1L_ENST00000564374.1_Frame_Shift_Ins_p.K974fs|RPGRIP1L_ENST00000568009.1_5'Flank|RPGRIP1L_ENST00000262135.4_Frame_Shift_Ins_p.K974fs	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	974					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				AAAGATACCTTCTTATCTACAG	0.337																																					p.K974_V975delinsX		Atlas-Indel,Pindel	.											.	RPGRIP1L	118	.	0			c.2920_2921insT						PASS	.																																			SO:0001589	frameshift_variant	23322	exon19			.		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2919_2920insT	chr16.hg19:g.53674983_53674984insA	ENSP00000369257:p.Lys974fs	130.0	0.0	0		152.0	92.0	0.605263	NM_001127897	A0PJ88|Q9Y2K8	Frame_Shift_Ins	INS	ENST00000379925.3	hg19	CCDS32447.1																																																																																			.	.	.	none		0.337	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
NXPH4	11247	hgsc.bcm.edu	37	12	57619136	57619140	+	Frame_Shift_Del	DEL	CTACG	CTACG	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	CTACG	CTACG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr12:57619136_57619140delCTACG	ENST00000349394.5	+	2	708_712	c.533_537delCTACG	c.(532-537)tctacgfs	p.ST178fs	NXPH4_ENST00000555154.1_3'UTR|Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	178	IV (linker domain).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						CCTCTGCAGTCTACGCTCGCCCTGG	0.732																																					p.178_179del		Atlas-INDEL	.											.	NXPH4	40	.	0			c.532_536del						PASS	.																																			SO:0001589	frameshift_variant	11247	exon2			.	AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.533_537delCTACG	chr12.hg19:g.57619136_57619140delCTACG	ENSP00000333593:p.Ser178fs	51.0	0.0	0		25.0	14.0	0.56	NM_007224	A8K4I4|Q7Z6L3|Q8N462	Frame_Shift_Del	DEL	ENST00000349394.5	hg19	CCDS8933.1																																																																																			.	.	.	none		0.732	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412474.1	NM_007224	
CLEC1A	51267	hgsc.bcm.edu	37	12	10251473	10251480	+	Frame_Shift_Del	DEL	CCCCATCA	CCCCATCA	-	rs553428572		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	CCCCATCA	CCCCATCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr12:10251473_10251480delCCCCATCA	ENST00000315330.4	-	1	104_111	c.42_49delTGATGGGG	c.(40-51)gatgatggggacfs	p.DDGD14fs	CLEC1A_ENST00000420265.2_Frame_Shift_Del_p.DDGD14fs|CLEC1A_ENST00000457018.2_Frame_Shift_Del_p.DDGD14fs	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	14					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						ATGGTGGTGTCCCCATCATCATCCAGCA	0.591																																					p.15_17del		Atlas-Indel,Pindel	.											.	CLEC1A	48	.	0			c.43_50del						PASS	.																																			SO:0001589	frameshift_variant	51267	exon1			.	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.42_49delTGATGGGG	chr12.hg19:g.10251473_10251480delCCCCATCA	ENSP00000326407:p.Asp14fs	175.0	0.0	0		100.0	34.0	0.34	NM_016511	Q8IUW7|Q9NZH3	Frame_Shift_Del	DEL	ENST00000315330.4	hg19	CCDS8612.1																																																																																			.	.	.	none		0.591	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511	
DET1	55070	hgsc.bcm.edu	37	15	89074206	89074214	+	In_Frame_Del	DEL	ACCTGGAAG	ACCTGGAAG	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	ACCTGGAAG	ACCTGGAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr15:89074206_89074214delACCTGGAAG	ENST00000268148.8	-	2	868_876	c.723_731delCTTCCAGGT	c.(721-732)gtcttccaggtg>gtg	p.241_244VFQV>V	DET1_ENST00000559656.1_5'Flank|DET1_ENST00000564406.1_In_Frame_Del_p.252_255VFQV>V|DET1_ENST00000444300.1_In_Frame_Del_p.252_255VFQV>V|DET1_ENST00000558413.1_Splice_Site_p.A92del	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	241						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TTCAGGAGTCACCTGGAAGACATGGATGG	0.502																																					p.253_255del		Atlas-Indel,Pindel	.											.	DET1	55	.	0			c.757_765del						PASS	.																																			SO:0001651	inframe_deletion	55070	exon3			.	BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.723_731delCTTCCAGGT	chr15.hg19:g.89074206_89074214delACCTGGAAG	ENSP00000268148:p.Val241_Gln243del	105.0	0.0	0		54.0	11.0	0.203704	NM_017996	B3KNN6|Q2VPC0|Q9NWD5	In_Frame_Del	DEL	ENST00000268148.8	hg19	CCDS45344.1																																																																																			.	.	.	none		0.502	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415442.2	NM_017996	
CDCP2	200008	hgsc.bcm.edu	37	1	54605763	54605763	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr1:54605763delT	ENST00000371330.1	-	4	1627	c.780delA	c.(778-780)gtafs	p.V260fs	RP11-446E24.4_ENST00000525949.1_5'Flank|CDCP2_ENST00000530059.1_5'Flank	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	260	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)				kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						TGGCCATGTATACCTCCTGGC	0.612																																					p.Y261fs		Atlas-Indel,Pindel	.											.	CDCP2	52	.	0			c.781delT						PASS	.						41.0	32.0	35.0					1																	54605763		2143	4212	6355	SO:0001589	frameshift_variant	200008	exon4			.		CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.780delA	chr1.hg19:g.54605763delT	ENSP00000360381:p.Val260fs	85.0	0.0	0		61.0	34.0	0.557377	NM_201546	Q6ZWJ3	Frame_Shift_Del	DEL	ENST00000371330.1	hg19	CCDS588.2																																																																																			.	.	.	none		0.612	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000022209.2	NM_201546	
NEFH	4744	hgsc.bcm.edu	37	22	29885585	29885586	+	In_Frame_Ins	INS	-	-	AAGTCCCCTGAGAAGGCC	rs200984527|rs267607533		TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr22:29885585_29885586insAAGTCCCCTGAGAAGGCC	ENST00000310624.6	+	4	1989_1990	c.1956_1957insAAGTCCCCTGAGAAGGCC	c.(1957-1959)aag>AAGTCCCCTGAGAAGGCCaag	p.653_653K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	659	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CTGAGAAGGCCAAGTCCCCAGA	0.564																																					p.A652delinsAKSPEKA		Atlas-INDEL	.											.,1	NEFH	178	.	0			c.1956_1957insAAGTCCCCTGAGAAGGCC						PASS	.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1939_1956dupAAGTCCCCTGAGAAGGCC	chr22.hg19:g.29885585_29885586insAAGTCCCCTGAGAAGGCC	ENSP00000311997:p.SerProGluLysAlaLys653dup	43.0	0.0	0		38.0	19.0	0.5	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.	.	none		0.564	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MTMR14	64419	hgsc.bcm.edu	37	3	9730673	9730673	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr3:9730673delC	ENST00000296003.4	+	16	1462	c.1340delC	c.(1339-1341)tccfs	p.S447fs	MTMR14_ENST00000353332.5_Frame_Shift_Del_p.S447fs|MTMR14_ENST00000351233.5_Frame_Shift_Del_p.S447fs|MTMR14_ENST00000420925.1_Frame_Shift_Del_p.S201fs	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	447					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					AGCGACTTCTCCCTGGTCATG	0.602																																					p.S447fs		Atlas-INDEL	.											.	MTMR14	43	.	0			c.1339delT						PASS	.						48.0	53.0	51.0					3																	9730673		2079	4221	6300	SO:0001589	frameshift_variant	64419	exon16			.	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1340delC	chr3.hg19:g.9730673delC	ENSP00000296003:p.Ser447fs	39.0	0.0	0		21.0	11.0	0.52381	NM_001077525	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Frame_Shift_Del	DEL	ENST00000296003.4	hg19	CCDS43043.1																																																																																			.	.	.	none		0.602	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
PPM1G	5496	hgsc.bcm.edu	37	2	27604506	27604506	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr2:27604506delT	ENST00000344034.4	-	10	1865	c.1601delA	c.(1600-1602)aatfs	p.N534fs	ZNF513_ENST00000323703.6_5'Flank|ZNF513_ENST00000491924.1_5'Flank|PPM1G_ENST00000350803.4_Frame_Shift_Del_p.N534fs|ZNF513_ENST00000407879.1_5'Flank	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	534					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GCTGTTGCCATTTTCTTCAGC	0.537																																					p.N534fs		Atlas-Indel,Pindel	.											.	PPM1G	42	.	0			c.1602delT						PASS	.						250.0	237.0	241.0					2																	27604506		2203	4300	6503	SO:0001589	frameshift_variant	5496	exon10			.	Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.1601delA	chr2.hg19:g.27604506delT	ENSP00000342778:p.Asn534fs	231.0	0.0	0		218.0	101.0	0.463303	NM_177983		Frame_Shift_Del	DEL	ENST00000344034.4	hg19	CCDS1752.1																																																																																			.	.	.	none		0.537	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215032.1	NM_002707	
SGSM2	9905	hgsc.bcm.edu	37	17	2278871	2278878	+	Frame_Shift_Del	DEL	CCGGGACT	CCGGGACT	-	rs61739394	byFrequency	TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	CCGGGACT	CCGGGACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr17:2278871_2278878delCCGGGACT	ENST00000426855.2	+	17	2226_2233	c.2051_2058delCCGGGACT	c.(2050-2058)cccgggactfs	p.PGT687fs	RP1-59D14.5_ENST00000573007.1_RNA|RP1-59D14.5_ENST00000574290.1_RNA|SGSM2_ENST00000574563.1_Frame_Shift_Del_p.PGT687fs|SGSM2_ENST00000268989.3_Frame_Shift_Del_p.PGT732fs	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	687	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.G730W(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		GAAGCAGGACCCGGGACTCCGGGCACCG	0.615																																					p.729_731del		Atlas-Indel,Pindel	.											.	SGSM2	60	.	1	Substitution - Missense(1)	kidney(1)	c.2185_2192del						PASS	.																																			SO:0001589	frameshift_variant	9905	exon18			.	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.2051_2058delCCGGGACT	chr17.hg19:g.2278871_2278878delCCGGGACT	ENSP00000415107:p.Pro687fs	49.0	0.0	0		38.0	15.0	0.394737	NM_014853	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Frame_Shift_Del	DEL	ENST00000426855.2	hg19	CCDS45570.1																																																																																			.	.	.	none		0.615	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
HN1L	90861	hgsc.bcm.edu	37	16	1735486	1735486	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A7SL-01A-11D-A34Z-10	TCGA-SX-A7SL-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e274845c-65ec-4db0-89f9-7d502ac2e427	e96052fd-169c-4e27-bd82-a5b6c796da53	g.chr16:1735486delC	ENST00000248098.3	+	2	148	c.91delC	c.(91-93)ccafs	p.P31fs	LA16c-431H6.6_ENST00000454337.1_3'UTR|HN1L_ENST00000382710.4_Frame_Shift_Del_p.P19fs|HN1L_ENST00000561516.1_Frame_Shift_Del_p.P31fs|HN1L_ENST00000562684.1_Frame_Shift_Del_p.P59fs|HN1L_ENST00000569765.1_Frame_Shift_Del_p.P59fs|HN1L_ENST00000382711.5_Frame_Shift_Del_p.P15fs|HN1L_ENST00000569256.1_Intron	NM_144570.2	NP_653171.1	Q9H910	HN1L_HUMAN	hematological and neurological expressed 1-like	31						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|kidney(2)|lung(3)|upper_aerodigestive_tract(1)	9						TTTTGGAAGTCCAGAAGAAGC	0.478																																					p.S30fs		Atlas-Indel,Pindel	.											.	HN1L	17	.	0			c.90delT						PASS	.						89.0	86.0	87.0					16																	1735486		2199	4300	6499	SO:0001589	frameshift_variant	90861	exon2			.	AK023154	CCDS10441.1	16p13.3	2006-12-13	2006-12-13	2006-12-13	ENSG00000206053	ENSG00000206053			14137	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 34"""	C16orf34		15094197	Standard	NM_144570		Approved	FLJ13092, L11, KIAA1426	uc002cmg.3	Q9H910	OTTHUMG00000047859	ENST00000248098.3:c.91delC	chr16.hg19:g.1735486delC	ENSP00000248098:p.Pro31fs	79.0	0.0	0		73.0	48.0	0.657534	NM_144570	B1AJY2|Q6EIC7	Frame_Shift_Del	DEL	ENST00000248098.3	hg19	CCDS10441.1																																																																																			.	.	.	none		0.478	HN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109086.2	NM_144570	
