#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CELA2A	63036	hgsc.bcm.edu	37	1	15789342	15789342	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:15789342C>A	ENST00000359621.4	+	4	367	c.342C>A	c.(340-342)aaC>aaA	p.N114K		NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	114	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						GGAACTCCAACCAAATCTCCA	0.582																																					p.N114K		Atlas-SNP	.											.	CELA2A	32	.	0			c.C342A						PASS	.						121.0	125.0	124.0					1																	15789342		2203	4300	6503	SO:0001583	missense	63036	exon4			CTCCAACCAAATC		CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.342C>A	chr1.hg19:g.15789342C>A	ENSP00000352639:p.Asn114Lys	111.0	0.0	.		72.0	21.0	.	NM_033440	B2R5I4|Q14243	Missense_Mutation	SNP	ENST00000359621.4	hg19	CCDS157.1	.	.	.	.	.	.	.	.	.	.	C	6.323	0.427644	0.11987	.	.	ENSG00000142615	ENST00000359621	D	0.88277	-2.36	4.12	3.16	0.36331	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.565730	0.03988	N	0.294417	T	0.75133	0.3808	N	0.02539	-0.55	0.09310	N	1	B	0.18741	0.03	B	0.22386	0.039	T	0.64330	-0.6433	10	0.13470	T	0.59	.	8.2539	0.31743	0.1825:0.653:0.1645:0.0	.	114	P08217	CEL2A_HUMAN	K	114	ENSP00000352639:N114K	ENSP00000352639:N114K	N	+	3	2	CELA2A	15661929	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	0.083000	0.14871	0.666000	0.31087	0.281000	0.19383	AAC	.	.	.	none		0.582	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006445.1	NM_033440	
MAN1C1	57134	hgsc.bcm.edu	37	1	26109142	26109142	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:26109142C>G	ENST00000374332.4	+	11	2047	c.1717C>G	c.(1717-1719)Ccc>Gcc	p.P573A	MAN1C1_ENST00000263979.3_Missense_Mutation_p.P393A|MAN1C1_ENST00000374329.1_Missense_Mutation_p.P344A	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	573					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CAGTAGCACCCCCAACCACGA	0.542																																					p.P573A		Atlas-SNP	.											.	MAN1C1	48	.	0			c.C1717G						PASS	.						157.0	142.0	147.0					1																	26109142		2203	4300	6503	SO:0001583	missense	57134	exon11			AGCACCCCCAACC	AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.1717C>G	chr1.hg19:g.26109142C>G	ENSP00000363452:p.Pro573Ala	83.0	0.0	.		62.0	28.0	.	NM_020379	A6NNE2|B2RNP2|Q9Y545	Missense_Mutation	SNP	ENST00000374332.4	hg19	CCDS265.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.006504	0.35415	.	.	ENSG00000117643	ENST00000374332;ENST00000263979;ENST00000374329	T;T;T	0.72051	-0.62;-0.62;-0.62	5.0	5.0	0.66597	.	0.205916	0.44097	D	0.000492	T	0.73210	0.3558	M	0.65677	2.01	0.47511	D	0.999445	P	0.36354	0.549	B	0.40444	0.329	T	0.73357	-0.4008	10	0.36615	T	0.2	.	18.2971	0.90150	0.0:1.0:0.0:0.0	.	573	Q9NR34	MA1C1_HUMAN	A	573;393;344	ENSP00000363452:P573A;ENSP00000263979:P393A;ENSP00000363449:P344A	ENSP00000263979:P393A	P	+	1	0	MAN1C1	25981729	0.997000	0.39634	0.930000	0.37139	0.679000	0.39708	3.736000	0.55052	2.319000	0.78375	0.561000	0.74099	CCC	.	.	.	none		0.542	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012828.3	NM_020379	
PPP1R8	5511	hgsc.bcm.edu	37	1	28157385	28157385	+	Silent	SNP	G	G	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:28157385G>C	ENST00000311772.5	+	1	97	c.39G>C	c.(37-39)ctG>ctC	p.L13L	PPP1R8_ENST00000373931.4_5'UTR|PPP1R8_ENST00000236412.7_5'UTR	NM_014110.4	NP_054829.2	Q12972	PP1R8_HUMAN	protein phosphatase 1, regulatory subunit 8	13	Interaction with CDC5L, SF3B1 and MELK.				cell proliferation (GO:0008283)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|protein phosphatase type 1 regulator activity (GO:0008599)|protein serine/threonine phosphatase inhibitor activity (GO:0004865)|ribonuclease E activity (GO:0008995)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|lung(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.76e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00248)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTCCCGCTGTTCGACTGCC	0.652																																					p.L13L		Atlas-SNP	.											.	PPP1R8	17	.	0			c.G39C						PASS	.						6.0	6.0	6.0					1																	28157385		2096	4160	6256	SO:0001819	synonymous_variant	5511	exon1			CCCGCTGTTCGAC	AF061959	CCDS311.1, CCDS312.1, CCDS313.1	1p35.3	2012-04-17	2011-10-04		ENSG00000117751	ENSG00000117751		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9296	protein-coding gene	gene with protein product	"""RNase E"", ""nuclear subunit of PP-1"", ""nuclear inhibitor of protein phosphatase-1"", ""activator of RNA decay"", ""protein phosphatase 1 regulatory subunit 8"""	602636	"""protein phosphatase 1, regulatory (inhibitor) subunit 8"""			7524097, 8473324	Standard	NM_014110		Approved	ard-1, NIPP-1, PRO2047, ARD1, NIPP1	uc001bov.2	Q12972	OTTHUMG00000003734	ENST00000311772.5:c.39G>C	chr1.hg19:g.28157385G>C		81.0	0.0	.		65.0	19.0	.	NM_014110	Q5TEJ2|Q5TEJ4|Q5TIF2|Q6PKF6|Q9UBH1|Q9UBZ0	Silent	SNP	ENST00000311772.5	hg19	CCDS311.1																																																																																			.	.	.	none		0.652	PPP1R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010528.1	NM_014110	
LURAP1	541468	hgsc.bcm.edu	37	1	46685818	46685818	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:46685818G>A	ENST00000371980.3	+	2	739	c.646G>A	c.(646-648)Gat>Aat	p.D216N	POMGNT1_ENST00000371992.1_5'UTR|POMGNT1_ENST00000396420.3_5'UTR	NM_001013615.2	NP_001013633.1	Q96LR2	LURA1_HUMAN	leucine rich adaptor protein 1	216					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)											GTCACCAGAGGATGAGAGTGC	0.567																																					p.D216N		Atlas-SNP	.											.	.	.	.	0			c.G646A						PASS	.						51.0	52.0	52.0					1																	46685818		2203	4300	6503	SO:0001583	missense	541468	exon2			CCAGAGGATGAGA	AK057892	CCDS30703.1	1p34.1	2012-02-01	2012-02-01	2012-02-01	ENSG00000171357	ENSG00000171357			32327	protein-coding gene	gene with protein product	"""leucine repeat adaptor protein 35a"""		"""chromosome 1 open reading frame 190"""	C1orf190		21048106	Standard	NM_001013615		Approved	FLJ25163, LRAP35a	uc010oma.2	Q96LR2	OTTHUMG00000007605	ENST00000371980.3:c.646G>A	chr1.hg19:g.46685818G>A	ENSP00000361048:p.Asp216Asn	30.0	0.0	.		35.0	13.0	.	NM_001013615		Missense_Mutation	SNP	ENST00000371980.3	hg19	CCDS30703.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731556	0.30684	.	.	ENSG00000171357	ENST00000371980	.	.	.	5.33	4.36	0.52297	.	0.898838	0.09783	N	0.756440	T	0.27205	0.0667	N	0.24115	0.695	0.26481	N	0.975106	B	0.10296	0.003	B	0.11329	0.006	T	0.07443	-1.0772	9	0.30078	T	0.28	-15.8251	5.1771	0.15141	0.0803:0.145:0.6247:0.15	.	216	Q96LR2	LP35A_HUMAN	N	216	.	ENSP00000361048:D216N	D	+	1	0	C1orf190	46458405	0.992000	0.36948	0.996000	0.52242	0.954000	0.61252	1.980000	0.40618	2.503000	0.84419	0.557000	0.71058	GAT	.	.	.	none		0.567	LURAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020154.1	NM_001013615	
SSX2IP	117178	hgsc.bcm.edu	37	1	85116084	85116084	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:85116084G>A	ENST00000342203.3	-	13	1894	c.1631C>T	c.(1630-1632)tCa>tTa	p.S544L	SSX2IP_ENST00000370612.4_Missense_Mutation_p.S544L|SSX2IP_ENST00000603677.1_Missense_Mutation_p.S63L|SSX2IP_ENST00000437941.2_Missense_Mutation_p.S517L|SSX2IP_ENST00000605755.1_Missense_Mutation_p.S517L	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	544					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GCAAAAGTCTGAAGTGGAAGG	0.423																																					p.S544L		Atlas-SNP	.											.	SSX2IP	53	.	0			c.C1631T						PASS	.						157.0	158.0	158.0					1																	85116084		2203	4300	6503	SO:0001583	missense	117178	exon14			AAGTCTGAAGTGG		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.1631C>T	chr1.hg19:g.85116084G>A	ENSP00000340279:p.Ser544Leu	99.0	0.0	.		103.0	6.0	.	NM_001166417	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	hg19	CCDS699.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225873	0.58668	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000370612	T;T	0.49139	0.8;0.79	5.37	4.46	0.54185	.	0.488922	0.21259	N	0.077513	T	0.19406	0.0466	L	0.44542	1.39	0.29393	N	0.862506	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.09862	-1.0655	10	0.29301	T	0.29	-27.8433	9.8504	0.41053	0.0948:0.0:0.9052:0.0	.	544;544;517	Q9Y2D8-2;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	L	544;517;544	ENSP00000340279:S544L;ENSP00000412781:S517L	ENSP00000340279:S544L	S	-	2	0	SSX2IP	84888672	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.321000	0.51999	1.255000	0.44051	0.655000	0.94253	TCA	.	.	.	none		0.423	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
DNTTIP2	30836	hgsc.bcm.edu	37	1	94341887	94341887	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:94341887T>A	ENST00000436063.2	-	2	1661	c.1604A>T	c.(1603-1605)cAt>cTt	p.H535L	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	535					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		ATTTTCGTCATGGTCTGATGA	0.338																																					p.H535L		Atlas-SNP	.											.	DNTTIP2	59	.	0			c.A1604T						PASS	.						144.0	128.0	133.0					1																	94341887		1826	3969	5795	SO:0001583	missense	30836	exon2			TCGTCATGGTCTG	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.1604A>T	chr1.hg19:g.94341887T>A	ENSP00000411010:p.His535Leu	294.0	0.0	.		265.0	73.0	.	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	hg19	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	T	2.905	-0.226532	0.06022	.	.	ENSG00000067334	ENST00000436063	T	0.14144	2.53	5.44	-0.376	0.12505	.	1.507750	0.04004	N	0.297049	T	0.03220	0.0094	L	0.57536	1.79	0.09310	N	1	B	0.29716	0.255	B	0.23275	0.045	T	0.37454	-0.9705	10	0.10902	T	0.67	.	4.1395	0.10186	0.2885:0.2841:0.0:0.4275	.	535	Q5QJE6	TDIF2_HUMAN	L	535	ENSP00000411010:H535L	ENSP00000352137:H535L	H	-	2	0	DNTTIP2	94114475	0.000000	0.05858	0.003000	0.11579	0.065000	0.16274	0.473000	0.22132	-0.194000	0.10399	0.533000	0.62120	CAT	.	.	.	none		0.338	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
HAO2	51179	hgsc.bcm.edu	37	1	119925589	119925589	+	Silent	SNP	A	A	G	rs199672779		TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:119925589A>G	ENST00000325945.3	+	3	256	c.183A>G	c.(181-183)agA>agG	p.R61R	HAO2_ENST00000361035.4_Silent_p.R74R	NM_001005783.1|NM_016527.2	NP_001005783.1|NP_057611.1	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2 (long chain)	61	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				fatty acid oxidation (GO:0019395)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		TGGACACCAGAACCACAATCC	0.542																																					p.R61R		Atlas-SNP	.											.	HAO2	62	.	0			c.A183G						PASS	.						121.0	94.0	103.0					1																	119925589		2203	4300	6503	SO:0001819	synonymous_variant	51179	exon4			CACCAGAACCACA	AF231917	CCDS901.1	1p13.3-p13.1	2008-07-18			ENSG00000116882	ENSG00000116882	1.1.3.15		4810	protein-coding gene	gene with protein product	"""(S)-2-hydroxy-acid oxidase"", ""glycolate oxidase"", ""long-chain L-2-hydroxy acid oxidase"", ""growth-inhibiting protein 16"""	605176				10777549	Standard	XM_005270913		Approved	HAOX2, GIG16	uc001ehr.1	Q9NYQ3	OTTHUMG00000012410	ENST00000325945.3:c.183A>G	chr1.hg19:g.119925589A>G		32.0	0.0	.		43.0	4.0	.	NM_001005783	Q2TU86|Q5QP00|Q9UJS6	Silent	SNP	ENST00000325945.3	hg19	CCDS901.1																																																																																			.	A|0.999;C|0.001	.	alt		0.542	HAO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034984.1	NM_001005783	
OBSCN	84033	hgsc.bcm.edu	37	1	228558813	228558813	+	Silent	SNP	A	A	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:228558813A>G	ENST00000422127.1	+	94	20378	c.20334A>G	c.(20332-20334)gtA>gtG	p.V6778V	OBSCN_ENST00000366707.4_Silent_p.V4412V|OBSCN_ENST00000570156.2_Silent_p.V7735V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6778					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCCTCGGCGTAGCCCGGCACC	0.652																																					p.V7735V		Atlas-SNP	.											.	OBSCN	2142	.	0			c.A23205G						PASS	.						30.0	34.0	33.0					1																	228558813		2071	4205	6276	SO:0001819	synonymous_variant	84033	exon105			CGGCGTAGCCCGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.20334A>G	chr1.hg19:g.228558813A>G		76.0	0.0	.		56.0	20.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	a	8.379	0.837015	0.16891	.	.	ENSG00000154358	ENST00000441106	.	.	.	4.79	0.632	0.17705	.	.	.	.	.	T	0.45094	0.1325	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22347	-1.0219	4	.	.	.	.	3.6268	0.08116	0.093:0.251:0.4623:0.1937	.	.	.	.	G	1395	.	.	S	+	1	0	OBSCN	226625436	0.584000	0.26766	0.857000	0.33713	0.037000	0.13140	-0.174000	0.09839	-0.032000	0.13758	-0.253000	0.11424	AGC	.	.	.	none		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
HEATR5B	54497	hgsc.bcm.edu	37	2	37255868	37255868	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr2:37255868G>C	ENST00000233099.5	-	23	3652	c.3557C>G	c.(3556-3558)tCt>tGt	p.S1186C	HEATR5B_ENST00000354531.2_Missense_Mutation_p.S1186C	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1186						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TAGCCAATGAGAAAGTTTTTC	0.358																																					p.S1186C		Atlas-SNP	.											HEATR5B,NS,carcinoma,0,1	HEATR5B	185	.	0			c.C3557G						PASS	.						77.0	78.0	78.0					2																	37255868		2203	4300	6503	SO:0001583	missense	54497	exon23			CAATGAGAAAGTT	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.3557C>G	chr2.hg19:g.37255868G>C	ENSP00000233099:p.Ser1186Cys	177.0	0.0	.		154.0	53.0	.	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	hg19	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894573	0.72639	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.60171	0.21;0.21	4.68	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.104740	0.64402	D	0.000002	T	0.76456	0.3990	M	0.77616	2.38	0.58432	D	0.999999	D	0.89917	1.0	D	0.72075	0.976	T	0.79626	-0.1725	10	0.54805	T	0.06	-7.9536	17.6029	0.88030	0.0:0.0:1.0:0.0	.	1186	Q9P2D3	HTR5B_HUMAN	C	1186	ENSP00000233099:S1186C;ENSP00000346531:S1186C	ENSP00000233099:S1186C	S	-	2	0	HEATR5B	37109372	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	7.935000	0.87658	2.143000	0.66587	0.655000	0.94253	TCT	.	.	.	none		0.358	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
MAP3K19	80122	hgsc.bcm.edu	37	2	135744888	135744888	+	Silent	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr2:135744888G>A	ENST00000375845.3	-	7	1584	c.1554C>T	c.(1552-1554)gtC>gtT	p.V518V	MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392915.1_Silent_p.V535V|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Silent_p.V405V	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	518							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CAGGTATGTTGACACTATGGT	0.428																																					p.V518V		Atlas-SNP	.											.	.	.	.	0			c.C1554T						PASS	.						193.0	180.0	184.0					2																	135744888		2203	4300	6503	SO:0001819	synonymous_variant	80122	exon7			TATGTTGACACTA	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1554C>T	chr2.hg19:g.135744888G>A		295.0	0.0	.		233.0	89.0	.	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Silent	SNP	ENST00000375845.3	hg19	CCDS2176.2																																																																																			.	.	.	none		0.428	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
TTN	7273	hgsc.bcm.edu	37	2	179615537	179615537	+	Intron	SNP	C	C	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr2:179615537C>A	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.V3864L|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTCATATACTTCCTCCTTC	0.383																																					p.V3864L		Atlas-SNP	.											.	TTN	18412	.	0			c.G11590T						PASS	.						89.0	87.0	88.0					2																	179615537		2203	4299	6502	SO:0001627	intron_variant	7273	exon46			CATATACTTCCTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+2313G>T	chr2.hg19:g.179615537C>A		167.0	0.0	.		138.0	47.0	.	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.21	2.767157	0.49574	.	.	ENSG00000155657	ENST00000360870	T	0.57595	0.39	5.55	-1.34	0.09143	.	.	.	.	.	T	0.24890	0.0604	N	0.08118	0	0.24042	N	0.99608	B	0.02656	0.0	B	0.08055	0.003	T	0.26883	-1.0090	9	0.07030	T	0.85	.	8.6105	0.33800	0.0:0.55:0.1411:0.3089	.	3864	Q8WZ42-6	.	L	3864	ENSP00000354117:V3864L	ENSP00000354117:V3864L	V	-	1	0	TTN	179323782	0.142000	0.22610	0.007000	0.13788	0.428000	0.31595	0.002000	0.13061	-0.365000	0.08076	0.655000	0.94253	GTA	.	.	.	none		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ANKMY1	51281	hgsc.bcm.edu	37	2	241463492	241463492	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr2:241463492C>A	ENST00000272972.3	-	7	1589	c.1375G>T	c.(1375-1377)Ggc>Tgc	p.G459C	ANKMY1_ENST00000536462.1_Missense_Mutation_p.G271C|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000405002.1_Missense_Mutation_p.G229C|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000373318.2_Missense_Mutation_p.G318C|ANKMY1_ENST00000401804.1_Missense_Mutation_p.G548C|ANKMY1_ENST00000391987.1_Missense_Mutation_p.G459C|ANKMY1_ENST00000373320.4_Missense_Mutation_p.G229C|ANKMY1_ENST00000405523.3_Missense_Mutation_p.G318C|ANKMY1_ENST00000361678.4_Missense_Mutation_p.G318C|ANKMY1_ENST00000403283.1_Missense_Mutation_p.G397C	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	459							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		CACAGACTGCCCCGGTCTGTG	0.597																																					p.G459C		Atlas-SNP	.											.	ANKMY1	112	.	0			c.G1375T						PASS	.						120.0	107.0	111.0					2																	241463492		2203	4300	6503	SO:0001583	missense	51281	exon7			GACTGCCCCGGTC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1375G>T	chr2.hg19:g.241463492C>A	ENSP00000272972:p.Gly459Cys	42.0	0.0	.		39.0	13.0	.	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	hg19	CCDS2536.1	.	.	.	.	.	.	.	.	.	.	C	6.247	0.413729	0.11812	.	.	ENSG00000144504	ENST00000373318;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T	0.54479	2.98;0.59;2.31;0.59;4.46;2.54;0.57;2.37;2.3;2.63	4.06	-8.12	0.01078	Ankyrin repeat-containing domain (1);	2.746800	0.00846	N	0.001781	T	0.25975	0.0633	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B;B	0.11235	0.0;0.004;0.0;0.001;0.0;0.0	B;B;B;B;B;B	0.08055	0.0;0.003;0.001;0.001;0.001;0.0	T	0.27536	-1.0071	10	0.49607	T	0.09	-18.3189	6.7555	0.23512	0.6542:0.2072:0.0:0.1386	.	459;271;229;318;318;459	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;Q9P2S6-2;Q9P2S6	.;.;.;.;.;ANKY1_HUMAN	C	318;459;318;459;229;397;548;271;318;229	ENSP00000362415:G318C;ENSP00000272972:G459C;ENSP00000355097:G318C;ENSP00000375847:G459C;ENSP00000362417:G229C;ENSP00000383968:G397C;ENSP00000385887:G548C;ENSP00000444707:G271C;ENSP00000385635:G318C;ENSP00000385145:G229C	ENSP00000272972:G459C	G	-	1	0	ANKMY1	241112165	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.025000	0.00640	-2.201000	0.00746	-1.337000	0.01257	GGC	.	.	.	none		0.597	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
MUC4	4585	hgsc.bcm.edu	37	3	195505828	195505828	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr3:195505828G>T	ENST00000463781.3	-	2	13082	c.12623C>A	c.(12622-12624)cCt>cAt	p.P4208H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4208H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGAGGGGTGGCGTG	0.592																																					p.P4208H		Atlas-SNP	.											.	MUC4	1505	.	0			c.C12623A						PASS	.						17.0	16.0	16.0					3																	195505828		688	1570	2258	SO:0001583	missense	4585	exon2			GGAAGAGGGGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12623C>A	chr3.hg19:g.195505828G>T	ENSP00000417498:p.Pro4208His	67.0	0.0	.		45.0	6.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.993	0.184423	0.09495	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36340	1.46;1.26	.	.	.	.	.	.	.	.	T	0.33235	0.0856	N	0.19112	0.55	0.23101	N	0.998295	D	0.56521	0.976	P	0.62298	0.9	T	0.14392	-1.0474	7	.	.	.	.	3.6132	0.08067	2.0E-4:0.4969:0.5026:2.0E-4	.	4080	E7ESK3	.	H	4208	ENSP00000417498:P4208H;ENSP00000420243:P4208H	.	P	-	2	0	MUC4	196990607	.	.	0.019000	0.16419	0.029000	0.11900	.	.	0.088000	0.17205	0.089000	0.15464	CCT	.	.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	hgsc.bcm.edu	37	3	195509071	195509071	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr3:195509071G>T	ENST00000463781.3	-	2	9839	c.9380C>A	c.(9379-9381)tCc>tAc	p.S3127Y	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3127Y|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGTGTCGGT	0.577																																					p.S3127Y		Atlas-SNP	.											.	MUC4	1505	.	0			c.C9380A						PASS	.						12.0	7.0	9.0					3																	195509071		650	1516	2166	SO:0001583	missense	4585	exon2			GCTGAGGAAGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9380C>A	chr3.hg19:g.195509071G>T	ENSP00000417498:p.Ser3127Tyr	55.0	0.0	.		61.0	6.0	.	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	7.146	0.582778	0.13749	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.45	.	.	.	.	.	.	.	.	T	0.22513	0.0543	N	0.19112	0.55	0.21933	N	0.999467	P	0.50156	0.932	B	0.43990	0.438	T	0.14476	-1.0471	7	.	.	.	.	6.8646	0.24086	1.0E-4:0.0:0.9999:0.0	.	2999	E7ESK3	.	Y	3127	ENSP00000417498:S3127Y;ENSP00000420243:S3127Y	.	S	-	2	0	MUC4	196993850	0.693000	0.27728	0.000000	0.03702	0.000000	0.00434	1.020000	0.30027	-0.000000	0.14550	0.000000	0.15137	TCC	.	.	.	none		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZFYVE28	57732	hgsc.bcm.edu	37	4	2337512	2337512	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr4:2337512G>C	ENST00000290974.2	-	6	960	c.621C>G	c.(619-621)gaC>gaG	p.D207E	ZFYVE28_ENST00000515169.1_Missense_Mutation_p.D137E|ZFYVE28_ENST00000511071.1_Intron|ZFYVE28_ENST00000515312.1_Missense_Mutation_p.D137E|ZFYVE28_ENST00000509171.1_Intron|ZFYVE28_ENST00000503000.1_Missense_Mutation_p.D207E	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	207					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GGTACCCGAAGTCCAGGGCCC	0.632																																					p.D207E		Atlas-SNP	.											.	ZFYVE28	79	.	0			c.C621G						PASS	.						93.0	74.0	80.0					4																	2337512		2184	4275	6459	SO:0001583	missense	57732	exon6			CCCGAAGTCCAGG	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.621C>G	chr4.hg19:g.2337512G>C	ENSP00000290974:p.Asp207Glu	32.0	0.0	.		40.0	15.0	.	NM_020972	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	hg19	CCDS33942.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282949	0.23392	.	.	ENSG00000159733	ENST00000290974;ENST00000515312;ENST00000515169;ENST00000503000	T;T;T;T	0.28255	1.62;1.62;2.7;1.62	4.81	0.466	0.16716	.	0.344757	0.32218	N	0.006401	T	0.10380	0.0254	N	0.03608	-0.345	0.23492	N	0.997569	B	0.09022	0.002	B	0.08055	0.003	T	0.22277	-1.0221	10	0.25106	T	0.35	.	5.0301	0.14405	0.0942:0.5179:0.2697:0.1182	.	207	Q9HCC9	LST2_HUMAN	E	207;137;137;207	ENSP00000290974:D207E;ENSP00000426299:D137E;ENSP00000425766:D137E;ENSP00000423694:D207E	ENSP00000290974:D207E	D	-	3	2	ZFYVE28	2307310	1.000000	0.71417	0.828000	0.32881	0.980000	0.70556	2.009000	0.40903	0.447000	0.26695	0.533000	0.62120	GAC	.	.	.	none		0.632	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
NOP14	8602	hgsc.bcm.edu	37	4	2946954	2946954	+	Silent	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr4:2946954G>A	ENST00000314262.6	-	12	1686	c.1638C>T	c.(1636-1638)ctC>ctT	p.L546L	NOP14_ENST00000502735.1_Silent_p.L546L|NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000505731.1_RNA|NOP14_ENST00000416614.2_Silent_p.L546L|NOP14_ENST00000398071.4_Silent_p.L546L|NOP14-AS1_ENST00000503709.1_RNA|NOP14-AS1_ENST00000507702.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	546					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TCAAATAAATGAGCTGGAAAG	0.512																																					p.L546L		Atlas-SNP	.											.	NOP14	69	.	0			c.C1638T						PASS	.						31.0	29.0	30.0					4																	2946954		2198	4289	6487	SO:0001819	synonymous_variant	8602	exon12			ATAAATGAGCTGG	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1638C>T	chr4.hg19:g.2946954G>A		51.0	0.0	.		45.0	20.0	.	NM_003703	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Silent	SNP	ENST00000314262.6	hg19	CCDS33945.1																																																																																			.	.	.	none		0.512	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703	
TNIP3	79931	hgsc.bcm.edu	37	4	122085296	122085296	+	Silent	SNP	T	T	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr4:122085296T>A	ENST00000509841.1	-	4	294	c.216A>T	c.(214-216)ccA>ccT	p.P72P	TNIP3_ENST00000057513.3_5'UTR|TNIP3_ENST00000507879.1_Silent_p.P65P|TNIP3_ENST00000454328.1_5'UTR	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						CTGTTTTTCCTGGAGTCTTGG	0.388																																					p.P72P		Atlas-SNP	.											.	TNIP3	58	.	0			c.A216T						PASS	.						89.0	86.0	87.0					4																	122085296		2203	4300	6503	SO:0001819	synonymous_variant	79931	exon4			TTTTCCTGGAGTC	AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.216A>T	chr4.hg19:g.122085296T>A		79.0	0.0	.		83.0	33.0	.	NM_001244764		Silent	SNP	ENST00000509841.1	hg19	CCDS58926.1																																																																																			.	.	.	none		0.388	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364000.4	NM_024873	
BHMT2	23743	hgsc.bcm.edu	37	5	78375253	78375253	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr5:78375253T>A	ENST00000255192.3	+	3	294	c.228T>A	c.(226-228)ttT>ttA	p.F76L	BHMT2_ENST00000521567.1_Missense_Mutation_p.F76L|DMGDH_ENST00000520388.1_Intron	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	76	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	CTTTTACCTTTTCTGCCAGTG	0.398																																					p.F76L		Atlas-SNP	.											.	BHMT2	44	.	0			c.T228A						PASS	.						87.0	83.0	84.0					5																	78375253		2203	4300	6503	SO:0001583	missense	23743	exon3			TACCTTTTCTGCC		CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.228T>A	chr5.hg19:g.78375253T>A	ENSP00000255192:p.Phe76Leu	40.0	0.0	.		49.0	14.0	.	NM_017614	B7Z516|Q9NXX7	Missense_Mutation	SNP	ENST00000255192.3	hg19	CCDS4045.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.814416	0.90790	.	.	ENSG00000132840	ENST00000255192;ENST00000521567;ENST00000518666	T;T;T	0.21191	2.02;2.02;2.02	5.72	3.33	0.38152	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.50786	0.1636	M	0.92923	3.36	0.26429	N	0.975969	D;P	0.76494	0.999;0.853	D;P	0.79108	0.992;0.5	T	0.48692	-0.9013	10	0.87932	D	0	-16.3792	8.4267	0.32733	0.0:0.2141:0.0:0.7859	.	76;76	B7Z516;Q9H2M3	.;BHMT2_HUMAN	L	76;76;16	ENSP00000255192:F76L;ENSP00000430278:F76L;ENSP00000428640:F16L	ENSP00000255192:F76L	F	+	3	2	BHMT2	78411009	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.584000	0.36589	1.012000	0.39366	0.533000	0.62120	TTT	.	.	.	none		0.398	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226962.2	NM_017614	
FEM1C	56929	hgsc.bcm.edu	37	5	114860849	114860849	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr5:114860849G>C	ENST00000274457.3	-	3	1571	c.1010C>G	c.(1009-1011)aCc>aGc	p.T337S		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	337					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		ATAGTAAGAGGTATCAGGATG	0.418																																					p.T337S		Atlas-SNP	.											.	FEM1C	50	.	0			c.C1010G						PASS	.						113.0	116.0	115.0					5																	114860849		2202	4300	6502	SO:0001583	missense	56929	exon3			TAAGAGGTATCAG		CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1010C>G	chr5.hg19:g.114860849G>C	ENSP00000274457:p.Thr337Ser	114.0	0.0	.		84.0	32.0	.	NM_020177	B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	ENST00000274457.3	hg19	CCDS4118.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647404	0.67358	.	.	ENSG00000145780	ENST00000274457	T	0.72835	-0.69	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.75874	0.3909	M	0.82517	2.595	0.58432	D	0.999999	P	0.44241	0.829	B	0.40256	0.324	T	0.80826	-0.1209	10	0.62326	D	0.03	-21.2018	19.502	0.95098	0.0:0.0:1.0:0.0	.	337	Q96JP0	FEM1C_HUMAN	S	337	ENSP00000274457:T337S	ENSP00000274457:T337S	T	-	2	0	FEM1C	114888748	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.602000	0.87976	0.655000	0.94253	ACC	.	.	.	none		0.418	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250857.3	NM_020177	
GRAMD3	65983	hgsc.bcm.edu	37	5	125807996	125807996	+	Splice_Site	SNP	A	A	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr5:125807996A>G	ENST00000285689.3	+	4	843	c.382A>G	c.(382-384)Agc>Ggc	p.S128G	GRAMD3_ENST00000502348.1_Splice_Site_p.S19G|GRAMD3_ENST00000542322.1_Splice_Site_p.S136G|GRAMD3_ENST00000515200.1_Splice_Site_p.S105G|GRAMD3_ENST00000513040.1_Splice_Site_p.S143G|GRAMD3_ENST00000511134.1_Splice_Site_p.S112G|GRAMD3_ENST00000514932.1_3'UTR|GRAMD3_ENST00000543198.1_Splice_Site_p.S105G|GRAMD3_ENST00000544396.1_Splice_Site_p.S24G|RP11-517I3.1_ENST00000515808.1_RNA	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	128	GRAM.					cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		ACTGAAGCAAAGTAAGTTCTG	0.388																																					p.S143G		Atlas-SNP	.											.	GRAMD3	30	.	0			c.A427G						PASS	.						159.0	146.0	150.0					5																	125807996		2203	4300	6503	SO:0001630	splice_region_variant	65983	exon4			AAGCAAAGTAAGT	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.382+1A>G	chr5.hg19:g.125807996A>G		106.0	0.0	.		102.0	39.0	.	NM_001146319	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	ENST00000285689.3	hg19	CCDS4136.1	.	.	.	.	.	.	.	.	.	.	A	19.31	3.802280	0.70682	.	.	ENSG00000155324	ENST00000513040;ENST00000506445;ENST00000543367;ENST00000285689;ENST00000515200;ENST00000542322;ENST00000544396;ENST00000543198;ENST00000502348;ENST00000511134	D;D;D;D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	5.87	4.72	0.59763	GRAM (2);	0.111914	0.85682	N	0.000000	D	0.92166	0.7516	M	0.74546	2.27	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.995;0.997;0.991;0.999	D;D;D;P;D	0.72338	0.958;0.923;0.977;0.892;0.958	D	0.92000	0.5610	10	0.56958	D	0.05	.	11.7093	0.51616	0.9307:0.0:0.0693:0.0	.	112;24;136;143;128	B7Z8T2;B7Z1F2;B7Z3R1;B7Z6D8;Q96HH9	.;.;.;.;GRAM3_HUMAN	G	143;142;112;128;105;136;24;105;19;112	ENSP00000426120:S143G;ENSP00000424985:S142G;ENSP00000285689:S128G;ENSP00000426143:S105G;ENSP00000441876:S136G;ENSP00000444049:S24G;ENSP00000442902:S105G;ENSP00000427596:S19G;ENSP00000426088:S112G	ENSP00000285689:S128G	S	+	1	0	GRAMD3	125835895	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.449000	0.80643	1.166000	0.42689	0.533000	0.62120	AGC	.	.	.	none		0.388	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927	Missense_Mutation
PCDHGA1	56114	hgsc.bcm.edu	37	5	140710446	140710446	+	Silent	SNP	C	C	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr5:140710446C>G	ENST00000517417.1	+	1	195	c.195C>G	c.(193-195)cgC>cgG	p.R65R	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Silent_p.R65R	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGAGTCCGCATCGTCTCCA	0.587																																					p.R65R		Atlas-SNP	.											.	PCDHGA1	397	.	0			c.C195G						PASS	.						108.0	115.0	113.0					5																	140710446		2203	4300	6503	SO:0001819	synonymous_variant	56114	exon1			AGTCCGCATCGTC	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.195C>G	chr5.hg19:g.140710446C>G		62.0	0.0	.		74.0	27.0	.	NM_018912	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	hg19	CCDS54922.1																																																																																			.	.	.	none		0.587	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
CLK4	57396	hgsc.bcm.edu	37	5	178032332	178032332	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr5:178032332T>C	ENST00000316308.4	-	11	1354	c.1186A>G	c.(1186-1188)Ata>Gta	p.I396V		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	396	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TGTTGTGGTATGGGTCCTAAT	0.343																																					p.I396V		Atlas-SNP	.											.	CLK4	103	.	0			c.A1186G						PASS	.						164.0	148.0	153.0					5																	178032332		2203	4299	6502	SO:0001583	missense	57396	exon11			GTGGTATGGGTCC	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.1186A>G	chr5.hg19:g.178032332T>C	ENSP00000316948:p.Ile396Val	137.0	0.0	.		105.0	29.0	.	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	hg19	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.273315	0.40194	.	.	ENSG00000113240	ENST00000316308	T	0.19938	2.11	5.47	5.47	0.80525	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.145745	0.64402	D	0.000013	T	0.19846	0.0477	L	0.37697	1.125	0.80722	D	1	B;B	0.21225	0.053;0.053	B;B	0.34991	0.193;0.193	T	0.09574	-1.0668	10	0.30854	T	0.27	.	8.8995	0.35485	0.1663:0.0:0.0:0.8337	.	396;396	B9EG64;Q9HAZ1	.;CLK4_HUMAN	V	396	ENSP00000316948:I396V	ENSP00000316948:I396V	I	-	1	0	CLK4	177964938	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	2.255000	0.43222	2.061000	0.61500	0.477000	0.44152	ATA	.	.	.	none		0.343	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
GFPT2	9945	hgsc.bcm.edu	37	5	179743447	179743447	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr5:179743447C>A	ENST00000253778.8	-	13	1336	c.1167G>T	c.(1165-1167)ttG>ttT	p.L389F	GFPT2_ENST00000520165.1_5'Flank	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	389	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	TCAGTTCCTCCAAAACTTGCC	0.507																																					p.L389F		Atlas-SNP	.											.	GFPT2	74	.	0			c.G1167T						PASS	.						85.0	82.0	83.0					5																	179743447		2029	4213	6242	SO:0001583	missense	9945	exon13			TTCCTCCAAAACT	AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1167G>T	chr5.hg19:g.179743447C>A	ENSP00000253778:p.Leu389Phe	72.0	0.0	.		96.0	49.0	.	NM_005110	Q53XM2|Q9BWS4	Missense_Mutation	SNP	ENST00000253778.8	hg19	CCDS43411.1	.	.	.	.	.	.	.	.	.	.	C	8.577	0.881520	0.17467	.	.	ENSG00000131459	ENST00000253778	T	0.66815	-0.23	5.89	2.61	0.31194	Sugar isomerase (SIS) (2);	0.000000	0.85682	D	0.000000	T	0.54159	0.1841	N	0.01686	-0.76	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.53258	-0.8464	9	.	.	.	-19.7846	10.2944	0.43616	0.0:0.7537:0.0:0.2463	.	389	O94808	GFPT2_HUMAN	F	389	ENSP00000253778:L389F	.	L	-	3	2	GFPT2	179676053	0.999000	0.42202	0.955000	0.39395	0.945000	0.59286	0.747000	0.26290	0.570000	0.29347	0.561000	0.74099	TTG	.	.	.	none		0.507	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	
GLI3	2737	hgsc.bcm.edu	37	7	42187973	42187973	+	Silent	SNP	C	C	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr7:42187973C>T	ENST00000395925.3	-	3	303	c.219G>A	c.(217-219)gaG>gaA	p.E73E	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	73					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TTGAAGGTTCCTCACTGACTT	0.532									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.E73E		Atlas-SNP	.											.	GLI3	312	.	0			c.G219A						PASS	.						150.0	121.0	131.0					7																	42187973		2203	4300	6503	SO:0001819	synonymous_variant	2737	exon3	Familial Cancer Database	;	AGGTTCCTCACTG		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.219G>A	chr7.hg19:g.42187973C>T		196.0	0.0	.		201.0	84.0	.	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	hg19	CCDS5465.1																																																																																			.	.	.	none		0.532	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
DBF4	10926	hgsc.bcm.edu	37	7	87530188	87530188	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr7:87530188G>A	ENST00000265728.1	+	10	1423	c.919G>A	c.(919-921)Gaa>Aaa	p.E307K		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	307					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				TGAAGATCTAGAAACTGTAAA	0.318																																					p.E307K		Atlas-SNP	.											.	DBF4	67	.	0			c.G919A						PASS	.						111.0	125.0	120.0					7																	87530188		2203	4300	6503	SO:0001583	missense	10926	exon10			GATCTAGAAACTG	AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.919G>A	chr7.hg19:g.87530188G>A	ENSP00000265728:p.Glu307Lys	52.0	0.0	.		58.0	27.0	.	NM_006716	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Missense_Mutation	SNP	ENST00000265728.1	hg19	CCDS5611.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.054701	0.55325	.	.	ENSG00000006634	ENST00000265728	T	0.32272	1.46	4.93	3.97	0.46021	Zinc finger, DBF-type (3);	0.496290	0.22384	N	0.060764	T	0.25082	0.0609	L	0.36672	1.1	0.36946	D	0.892611	B;B	0.32031	0.304;0.352	B;B	0.34242	0.068;0.178	T	0.17228	-1.0376	10	0.40728	T	0.16	-16.1246	11.2252	0.48880	0.0:0.2654:0.7346:0.0	.	83;307	B7Z8C6;Q9UBU7	.;DBF4A_HUMAN	K	307	ENSP00000265728:E307K	ENSP00000265728:E307K	E	+	1	0	DBF4	87368124	0.975000	0.34042	0.896000	0.35187	0.979000	0.70002	1.952000	0.40343	2.663000	0.90544	0.591000	0.81541	GAA	.	.	.	none		0.318	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253678.1	NM_006716	
MUC17	140453	hgsc.bcm.edu	37	7	100674406	100674406	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr7:100674406A>T	ENST00000306151.4	+	2	152	c.88A>T	c.(88-90)Agt>Tgt	p.S30C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	30					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCAGACCTCAGTGTGAACAG	0.532																																					p.S30C		Atlas-SNP	.											.	MUC17	804	.	0			c.A88T						PASS	.						191.0	167.0	175.0					7																	100674406		2203	4300	6503	SO:0001583	missense	140453	exon2			GACCTCAGTGTGA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.88A>T	chr7.hg19:g.100674406A>T	ENSP00000302716:p.Ser30Cys	171.0	0.0	.		125.0	43.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	4.680	0.126381	0.08931	.	.	ENSG00000169876	ENST00000306151	T	0.02682	4.2	1.9	-0.636	0.11508	.	.	.	.	.	T	0.02156	0.0067	N	0.08118	0	0.09310	N	1	D	0.57899	0.981	P	0.49477	0.612	T	0.45249	-0.9274	9	0.87932	D	0	.	2.6293	0.04939	0.4862:0.3252:0.1887:0.0	.	30	Q685J3	MUC17_HUMAN	C	30	ENSP00000302716:S30C	ENSP00000302716:S30C	S	+	1	0	MUC17	100461126	0.000000	0.05858	0.001000	0.08648	0.190000	0.23558	0.102000	0.15272	-0.154000	0.11118	0.411000	0.27672	AGT	.	.	.	none		0.532	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
TMEM229A	730130	hgsc.bcm.edu	37	7	123672485	123672485	+	Silent	SNP	T	T	C	rs527643423	byFrequency	TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr7:123672485T>C	ENST00000455783.1	-	1	1038	c.573A>G	c.(571-573)caA>caG	p.Q191Q	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	191						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						gctgctgctgttgctgctgcc	0.726													t|||	115	0.0229633	0.0552	0.0086	5008	,	,		10756	0.0079		0.0129	False		,,,				2504	0.0153				p.Q191Q		Atlas-SNP	.											.	TMEM229A	31	.	0			c.A573G						PASS	.						2.0	4.0	3.0					7																	123672485		466	1222	1688	SO:0001819	synonymous_variant	730130	exon1			CTGCTGTTGCTGC	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.573A>G	chr7.hg19:g.123672485T>C		7.0	0.0	.		17.0	8.0	.	NM_001136002	A4D0X6	Silent	SNP	ENST00000455783.1	hg19	CCDS47694.1																																																																																			.	.	.	none		0.726	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
VPS37A	137492	hgsc.bcm.edu	37	8	17142073	17142073	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr8:17142073A>G	ENST00000324849.4	+	10	1735	c.1061A>G	c.(1060-1062)gAg>gGg	p.E354G	VPS37A_ENST00000521829.1_Missense_Mutation_p.E329G	NM_001145152.1|NM_152415.2	NP_001138624.1|NP_689628.2	Q8NEZ2	VP37A_HUMAN	vacuolar protein sorting 37 homolog A (S. cerevisiae)	354	VPS37 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00646}.				cell death (GO:0008219)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	10				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		GACTTCTTGGAGGGAAAGATG	0.393																																					p.E354G		Atlas-SNP	.											.	VPS37A	22	.	0			c.A1061G						PASS	.						108.0	109.0	108.0					8																	17142073		2203	4300	6503	SO:0001583	missense	137492	exon10			TCTTGGAGGGAAA		CCDS6001.1, CCDS47811.1	8p22	2012-06-29	2006-04-04		ENSG00000155975	ENSG00000155975			24928	protein-coding gene	gene with protein product	"""hepatocellular carcinoma related protein 1"""	609927	"""vacuolar protein sorting 37A (yeast)"", ""polyglutamine binding protein 2"""	PQBP2		15240819, 15218037, 22717650	Standard	NM_152415		Approved	FLJ32642, HCRP1, SPG53	uc003wxj.3	Q8NEZ2	OTTHUMG00000130785	ENST00000324849.4:c.1061A>G	chr8.hg19:g.17142073A>G	ENSP00000318629:p.Glu354Gly	117.0	0.0	.		116.0	42.0	.	NM_152415	Q336D5|Q6NW27|Q8N3D7|Q8TBL7|Q96DL9	Missense_Mutation	SNP	ENST00000324849.4	hg19	CCDS6001.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307807	0.81247	.	.	ENSG00000155975	ENST00000324849;ENST00000521829;ENST00000521976	T;T;T	0.78707	-1.2;-1.2;-1.2	5.31	5.31	0.75309	Modifier of rudimentary, Modr (2);	0.000000	0.85682	D	0.000000	D	0.84593	0.5506	L	0.55834	1.745	0.80722	D	1	D;D;D	0.76494	0.99;0.997;0.999	D;D;D	0.78314	0.921;0.954;0.991	T	0.82313	-0.0519	10	0.27785	T	0.31	-11.7351	15.9692	0.79998	1.0:0.0:0.0:0.0	.	125;329;354	B3KW95;Q8NEZ2-2;Q8NEZ2	.;.;VP37A_HUMAN	G	354;329;127	ENSP00000318629:E354G;ENSP00000429680:E329G;ENSP00000429858:E127G	ENSP00000318629:E354G	E	+	2	0	VPS37A	17186444	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	8.962000	0.93254	2.302000	0.77476	0.533000	0.62120	GAG	.	.	.	none		0.393	VPS37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253301.2	NM_152415	
KIF13B	23303	hgsc.bcm.edu	37	8	28980929	28980929	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr8:28980929T>G	ENST00000524189.1	-	28	3471	c.3433A>C	c.(3433-3435)Atg>Ctg	p.M1145L	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1145					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GAGGGGACCATCACCGCGTTC	0.552																																					p.M1145L		Atlas-SNP	.											.	KIF13B	192	.	0			c.A3433C						PASS	.						99.0	100.0	100.0					8																	28980929		1965	4150	6115	SO:0001583	missense	23303	exon28			GGACCATCACCGC	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3433A>C	chr8.hg19:g.28980929T>G	ENSP00000427900:p.Met1145Leu	30.0	0.0	.		36.0	9.0	.	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	hg19	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	T	3.369	-0.128796	0.06753	.	.	ENSG00000197892	ENST00000524189	T	0.73047	-0.71	4.63	4.63	0.57726	.	0.038546	0.85682	D	0.000000	T	0.41396	0.1157	N	0.02225	-0.63	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46665	-0.9175	10	0.02654	T	1	.	14.2118	0.65769	0.0:0.0:0.0:1.0	.	1145	F8VPJ2	.	L	1145	ENSP00000427900:M1145L	ENSP00000427900:M1145L	M	-	1	0	KIF13B	29036848	0.991000	0.36638	0.896000	0.35187	0.838000	0.47535	2.211000	0.42825	1.929000	0.55896	0.533000	0.62120	ATG	.	.	.	none		0.552	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
TMEM245	23731	hgsc.bcm.edu	37	9	111819564	111819564	+	Silent	SNP	C	C	T	rs201566707		TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr9:111819564C>T	ENST00000374586.3	-	12	1792	c.1761G>A	c.(1759-1761)ttG>ttA	p.L587L		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	587						integral component of membrane (GO:0016021)											GACTGACATGCAACTTCTGTC	0.398																																					p.L587L		Atlas-SNP	.											.	.	.	.	0			c.G1761A						PASS	.						81.0	78.0	79.0					9																	111819564		1899	4129	6028	SO:0001819	synonymous_variant	23731	exon12			GACATGCAACTTC	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1761G>A	chr9.hg19:g.111819564C>T		105.0	0.0	.		81.0	34.0	.	NM_032012	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Silent	SNP	ENST00000374586.3	hg19	CCDS43858.1	.	.	.	.	.	.	.	.	.	.	C	8.570	0.879929	0.17467	.	.	ENSG00000106771	ENST00000413712	.	.	.	5.47	4.56	0.56223	.	.	.	.	.	T	0.70753	0.3260	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70197	-0.4938	4	.	.	.	-9.3841	15.3007	0.73949	0.0:0.735:0.265:0.0	.	.	.	.	T	180	.	.	A	-	1	0	C9orf5	110859385	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	1.986000	0.40677	1.272000	0.44329	0.655000	0.94253	GCA	.	C|0.999;A|0.001	.	alt		0.398	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012	
USP20	10868	hgsc.bcm.edu	37	9	132638511	132638511	+	Silent	SNP	C	C	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr9:132638511C>T	ENST00000315480.4	+	22	2561	c.2403C>T	c.(2401-2403)ttC>ttT	p.F801F	USP20_ENST00000358355.1_Silent_p.F801F|USP20_ENST00000372429.3_Silent_p.F801F			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	801	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				TCGACACCTTCATCAAGGTGC	0.667																																					p.F801F		Atlas-SNP	.											.	USP20	186	.	0			c.C2403T						PASS	.						23.0	25.0	24.0					9																	132638511		2073	4199	6272	SO:0001819	synonymous_variant	10868	exon22			CACCTTCATCAAG	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2403C>T	chr9.hg19:g.132638511C>T		65.0	0.0	.		62.0	25.0	.	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Silent	SNP	ENST00000315480.4	hg19	CCDS43892.1																																																																																			.	.	.	none		0.667	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
TUBAL3	79861	hgsc.bcm.edu	37	10	5443030	5443030	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr10:5443030G>T	ENST00000380419.3	-	2	61	c.24C>A	c.(22-24)caC>caA	p.H8Q	TUBAL3_ENST00000479328.1_Intron	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	8					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						CTTGACCGATGTGGATGGAAA	0.488																																					p.H8Q		Atlas-SNP	.											.	TUBAL3	54	.	0			c.C24A						PASS	.						89.0	85.0	86.0					10																	5443030		2203	4300	6503	SO:0001583	missense	79861	exon2			ACCGATGTGGATG	AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.24C>A	chr10.hg19:g.5443030G>T	ENSP00000369784:p.His8Gln	54.0	0.0	.		48.0	17.0	.	NM_024803	B4DKL2|Q4QQJ5|Q9H6Z0	Missense_Mutation	SNP	ENST00000380419.3	hg19	CCDS7066.2	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922227	0.33908	.	.	ENSG00000178462	ENST00000380419	T	0.63255	-0.03	4.06	2.19	0.27852	Tubulin/FtsZ, GTPase domain (3);	0.168717	0.28647	N	0.014618	T	0.60274	0.2256	N	0.16833	0.445	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	T	0.60616	-0.7228	10	0.87932	D	0	.	7.209	0.25923	0.2913:0.0:0.7087:0.0	.	8	A6NHL2	TBAL3_HUMAN	Q	8	ENSP00000369784:H8Q	ENSP00000369784:H8Q	H	-	3	2	TUBAL3	5433030	0.810000	0.29049	0.715000	0.30552	0.060000	0.15804	0.327000	0.19663	0.449000	0.26747	-0.136000	0.14681	CAC	.	.	.	none		0.488	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046548.2	NM_024803	
PALD1	27143	hgsc.bcm.edu	37	10	72324203	72324203	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr10:72324203T>G	ENST00000263563.6	+	19	2614	c.2346T>G	c.(2344-2346)atT>atG	p.I782M		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	782						cytosol (GO:0005829)											TCTGCCTGATTCTCTTCAACG	0.632																																					p.I782M		Atlas-SNP	.											KIAA1274,NS,haematopoietic_neoplasm,0,3	.	.	.	0			c.T2346G						PASS	.						122.0	117.0	119.0					10																	72324203		2203	4300	6503	SO:0001583	missense	27143	exon19			CCTGATTCTCTTC	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.2346T>G	chr10.hg19:g.72324203T>G	ENSP00000263563:p.Ile782Met	86.0	0.0	.		99.0	40.0	.	NM_014431	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	ENST00000263563.6	hg19	CCDS31215.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.20|15.20	2.763695|2.763695	0.49574|0.49574	.|.	.|.	ENSG00000107719|ENSG00000107719	ENST00000263563;ENST00000373214|ENST00000426268	T|.	0.29917|.	1.55|.	5.12|5.12	-1.85|-1.85	0.07784|0.07784	.|.	0.120287|.	0.56097|.	D|.	0.000040|.	T|T	0.67571|0.67571	0.2907|0.2907	M|M	0.79011|0.79011	2.435|2.435	0.49798|0.49798	D|D	0.999823|0.999823	P|.	0.52463|.	0.953|.	D|.	0.63597|.	0.916|.	T|T	0.65776|0.65776	-0.6086|-0.6086	10|5	0.87932|.	D|.	0|.	-9.6058|-9.6058	7.9563|7.9563	0.30045|0.30045	0.0:0.5989:0.151:0.2501|0.0:0.5989:0.151:0.2501	.|.	782|.	Q9ULE6|.	PALD_HUMAN|.	M|A	782;758|163	ENSP00000263563:I782M|.	ENSP00000263563:I782M|.	I|S	+|+	3|1	3|0	KIAA1274|KIAA1274	71994209|71994209	0.997000|0.997000	0.39634|0.39634	0.994000|0.994000	0.49952|0.49952	0.268000|0.268000	0.26511|0.26511	0.541000|0.541000	0.23207|0.23207	-0.223000|-0.223000	0.09943|0.09943	-0.425000|-0.425000	0.05940|0.05940	ATT|TCT	.	.	.	none		0.632	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
KAT6B	23522	hgsc.bcm.edu	37	10	76788653	76788653	+	Silent	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr10:76788653G>A	ENST00000287239.4	+	18	4560	c.4071G>A	c.(4069-4071)gaG>gaA	p.E1357E	KAT6B_ENST00000372725.1_Silent_p.E1065E|KAT6B_ENST00000372711.1_Silent_p.E1174E|KAT6B_ENST00000372724.1_Silent_p.E1065E|KAT6B_ENST00000372714.1_Silent_p.E1065E	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1357	Poly-Glu.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										aagaggaggaggaggaggaag	0.453																																					p.E1357E		Atlas-SNP	.											.	.	.	.	0			c.G4071A						PASS	.						41.0	42.0	41.0					10																	76788653		2203	4300	6503	SO:0001819	synonymous_variant	23522	exon18			GGAGGAGGAGGAG	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4071G>A	chr10.hg19:g.76788653G>A		33.0	0.0	.		24.0	5.0	.	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	hg19	CCDS7345.1																																																																																			.	.	.	none		0.453	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KIF20B	9585	hgsc.bcm.edu	37	10	91479191	91479191	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr10:91479191A>T	ENST00000371728.3	+	13	1515	c.1450A>T	c.(1450-1452)Act>Tct	p.T484S	KIF20B_ENST00000260753.4_Missense_Mutation_p.T484S|KIF20B_ENST00000394289.2_Missense_Mutation_p.T484S|KIF20B_ENST00000416354.1_Missense_Mutation_p.T484S	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	484					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TGTCCCAGACACTTTAAATTC	0.279																																					p.T484S		Atlas-SNP	.											.	KIF20B	191	.	0			c.A1450T						PASS	.						35.0	39.0	38.0					10																	91479191		2153	4287	6440	SO:0001583	missense	9585	exon13			CCAGACACTTTAA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1450A>T	chr10.hg19:g.91479191A>T	ENSP00000360793:p.Thr484Ser	132.0	0.0	.		91.0	37.0	.	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	hg19		.	.	.	.	.	.	.	.	.	.	A	7.315	0.615724	0.14129	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.63	1.83	0.25207	Kinesin, motor domain (1);	0.370049	0.23367	N	0.048955	T	0.47581	0.1453	L	0.28274	0.84	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.13407	0.006;0.009	T	0.13202	-1.0518	10	0.19590	T	0.45	-0.0742	1.5376	0.02548	0.5113:0.1337:0.2256:0.1293	.	484;484	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	S	484	ENSP00000260753:T484S;ENSP00000411545:T484S;ENSP00000377830:T484S;ENSP00000360793:T484S	ENSP00000260753:T484S	T	+	1	0	KIF20B	91469171	0.000000	0.05858	0.478000	0.27316	0.794000	0.44872	-0.552000	0.06020	0.421000	0.25980	0.377000	0.23210	ACT	.	.	.	none		0.279	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
CD151	977	hgsc.bcm.edu	37	11	836827	836827	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr11:836827A>G	ENST00000397420.3	+	5	584	c.335A>G	c.(334-336)tAc>tGc	p.Y112C	CD151_ENST00000397421.1_Missense_Mutation_p.Y112C|CD151_ENST00000528011.1_Missense_Mutation_p.Y112C|CD151_ENST00000322008.4_Missense_Mutation_p.Y112C			P48509	CD151_HUMAN	CD151 molecule (Raph blood group)	112					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|T cell proliferation (GO:0042098)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.54e-25)|Epithelial(43;1.22e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.91e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATCCTCGCCTACGCCTACTAC	0.607																																					p.Y112C	Esophageal Squamous(14;501 559 15826 37823 38305)	Atlas-SNP	.											.	CD151	7	.	0			c.A335G						PASS	.						72.0	60.0	64.0					11																	836827		2198	4294	6492	SO:0001583	missense	977	exon4			TCGCCTACGCCTA	AL161965, BC013302, D29963	CCDS7719.1	11p15.5	2014-07-18	2006-03-28		ENSG00000177697	ENSG00000177697		"""CD molecules"", ""Blood group antigens"", ""Tetraspanins"""	1630	protein-coding gene	gene with protein product		602243	"""CD151 antigen"", ""CD151 antigen (Raph blood group)"""			9070943	Standard	NM_004357		Approved	SFA-1, PETA-3, TSPAN24, RAPH	uc001lsb.3	P48509	OTTHUMG00000133311	ENST00000397420.3:c.335A>G	chr11.hg19:g.836827A>G	ENSP00000380565:p.Tyr112Cys	98.0	0.0	.		63.0	25.0	.	NM_139030	A8KAK8|E9PI15|Q14826|Q86U54|Q96TE3	Missense_Mutation	SNP	ENST00000397420.3	hg19	CCDS7719.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.852392	0.51270	.	.	ENSG00000177697	ENST00000397420;ENST00000322008;ENST00000397421;ENST00000526693;ENST00000524748;ENST00000527341;ENST00000530320;ENST00000528011	D;D;D;D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59;-2.59	4.74	4.74	0.60224	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	D	0.95472	0.8529	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.96508	0.9376	10	0.87932	D	0	.	14.3849	0.66938	1.0:0.0:0.0:0.0	.	112	P48509	CD151_HUMAN	C	112	ENSP00000380565:Y112C;ENSP00000324101:Y112C;ENSP00000380566:Y112C;ENSP00000435054:Y112C;ENSP00000431403:Y112C;ENSP00000436591:Y112C;ENSP00000433787:Y112C;ENSP00000432990:Y112C	ENSP00000324101:Y112C	Y	+	2	0	CD151	826827	1.000000	0.71417	0.982000	0.44146	0.092000	0.18411	6.692000	0.74578	1.992000	0.58205	0.459000	0.35465	TAC	.	.	.	none		0.607	CD151-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257108.1	NM_004357	
ARFIP2	23647	hgsc.bcm.edu	37	11	6500088	6500088	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr11:6500088C>A	ENST00000254584.2	-	5	500	c.417G>T	c.(415-417)aaG>aaT	p.K139N	ARFIP2_ENST00000423813.2_Missense_Mutation_p.K101N|ARFIP2_ENST00000396777.3_Missense_Mutation_p.K139N|TIMM10B_ENST00000472836.1_5'Flank|ARFIP2_ENST00000445086.2_Missense_Mutation_p.K54N|TIMM10B_ENST00000530751.1_5'Flank|TIMM10B_ENST00000254616.6_5'Flank|ARFIP2_ENST00000525235.1_Missense_Mutation_p.K139N	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	139	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CACTCTCATACTTGCGCTTCG	0.577																																					p.K172N	Melanoma(119;796 1674 9049 20480 24794)	Atlas-SNP	.											.	ARFIP2	23	.	0			c.G516T						PASS	.						84.0	60.0	68.0					11																	6500088		2201	4296	6497	SO:0001583	missense	23647	exon5			CTCATACTTGCGC	BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.417G>T	chr11.hg19:g.6500088C>A	ENSP00000254584:p.Lys139Asn	53.0	0.0	.		70.0	30.0	.	NM_001242854	B4DX86|B4E306|D3DQT5	Missense_Mutation	SNP	ENST00000254584.2	hg19	CCDS7765.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.163707	0.57476	.	.	ENSG00000132254	ENST00000254584;ENST00000396777;ENST00000445086;ENST00000423813;ENST00000525235	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	5.67	3.81	0.43845	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.86834	0.6028	M	0.79693	2.465	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;0.999	D	0.87256	0.2276	10	0.52906	T	0.07	.	11.391	0.49815	0.0:0.8534:0.0:0.1466	.	172;54;139	B4DUZ3;B4E306;P53365	.;.;ARFP2_HUMAN	N	139;139;54;101;139	ENSP00000254584:K139N;ENSP00000379998:K139N;ENSP00000391427:K54N;ENSP00000398375:K101N;ENSP00000434124:K139N	ENSP00000254584:K139N	K	-	3	2	ARFIP2	6456664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.141000	0.42168	1.408000	0.46895	0.561000	0.74099	AAG	.	.	.	none		0.577	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387044.1	NM_012402	
KIAA1731	85459	hgsc.bcm.edu	37	11	93461858	93461858	+	Silent	SNP	T	T	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr11:93461858T>A	ENST00000325212.6	+	25	7335	c.7173T>A	c.(7171-7173)acT>acA	p.T2391T	SNORA25_ENST00000384384.1_RNA|KIAA1731_ENST00000344196.4_Silent_p.T571T|KIAA1731_ENST00000411936.1_Silent_p.T2391T|KIAA1731_ENST00000531700.1_Silent_p.T571T|SNORA32_ENST00000384072.1_RNA|SNORD6_ENST00000365444.1_RNA|TAF1D_ENST00000546088.1_5'Flank			Q9C0D2	K1731_HUMAN	KIAA1731	2391						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAACAGAAACTGGCCATGGTA	0.333																																					p.T2391T		Atlas-SNP	.											.	KIAA1731	173	.	0			c.T7173A						PASS	.						135.0	121.0	125.0					11																	93461858		692	1591	2283	SO:0001819	synonymous_variant	85459	exon25			AGAAACTGGCCAT	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.7173T>A	chr11.hg19:g.93461858T>A		31.0	0.0	.		33.0	12.0	.	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Silent	SNP	ENST00000325212.6	hg19	CCDS44708.1																																																																																			.	.	.	none		0.333	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
SIK3	23387	hgsc.bcm.edu	37	11	116729011	116729011	+	Missense_Mutation	SNP	T	T	C	rs537893827	byFrequency	TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr11:116729011T>C	ENST00000292055.4	-	20	2887	c.2852A>G	c.(2851-2853)cAg>cGg	p.Q951R	SIK3_ENST00000542607.1_Missense_Mutation_p.Q891R|SIK3_ENST00000446921.2_Missense_Mutation_p.Q949R|SIK3_ENST00000434315.2_Missense_Mutation_p.Q790R|AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000375288.1_Missense_Mutation_p.Q286R|SIK3_ENST00000375300.1_Missense_Mutation_p.Q1009R	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	951	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						ctgttgctgctgttgctgctg	0.592																																					p.Q951R		Atlas-SNP	.											.	SIK3	112	.	0			c.A2852G						PASS	.						40.0	39.0	39.0					11																	116729011		2201	4296	6497	SO:0001583	missense	23387	exon20			TGCTGCTGTTGCT	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2852A>G	chr11.hg19:g.116729011T>C	ENSP00000292055:p.Gln951Arg	89.0	0.0	.		96.0	18.0	.	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	hg19	CCDS8379.1	.	.	.	.	.	.	.	.	.	.	T	8.339	0.828231	0.16749	.	.	ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000375288;ENST00000542607;ENST00000434315	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	5.22	2.87	0.33458	.	0.213574	0.23076	U	0.052215	T	0.16257	0.0391	N	0.12182	0.205	0.44168	D	0.996977	B;B;B;B;B	0.11235	0.004;0.001;0.0;0.001;0.0	B;B;B;B;B	0.10450	0.005;0.001;0.001;0.002;0.002	T	0.05053	-1.0909	10	0.72032	D	0.01	.	6.9418	0.24496	0.0:0.1912:0.0:0.8088	.	951;891;790;951;286	Q9Y2K2-3;A1A5A8;A1A5A9;Q9Y2K2;Q9Y2K2-2	.;.;.;SIK3_HUMAN;.	R	1009;951;286;891;790	ENSP00000364449:Q1009R;ENSP00000292055:Q951R;ENSP00000364437:Q286R;ENSP00000438108:Q891R;ENSP00000415873:Q790R	ENSP00000292055:Q951R	Q	-	2	0	SIK3	116234221	1.000000	0.71417	0.995000	0.50966	0.191000	0.23601	3.827000	0.55745	0.821000	0.34540	0.533000	0.62120	CAG	.	.	.	none		0.592	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
PRPF40B	25766	hgsc.bcm.edu	37	12	50025231	50025231	+	Silent	SNP	C	C	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr12:50025231C>G	ENST00000380281.1	+	2	130	c.66C>G	c.(64-66)ccC>ccG	p.P22P	PRPF40B_ENST00000548825.2_Silent_p.P44P|PRPF40B_ENST00000261897.1_Silent_p.P16P			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	22	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						TGGGGCTACCCCCCATGAGTC	0.597																																					p.P44P		Atlas-SNP	.											.	PRPF40B	83	.	0			c.C132G						PASS	.						100.0	102.0	101.0					12																	50025231		2203	4300	6503	SO:0001819	synonymous_variant	25766	exon3			GCTACCCCCCATG	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.66C>G	chr12.hg19:g.50025231C>G		143.0	0.0	.		161.0	40.0	.	NM_001031698	O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Silent	SNP	ENST00000380281.1	hg19																																																																																				.	.	.	none		0.597	PRPF40B-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000404838.1	NM_012272	
UNG	7374	hgsc.bcm.edu	37	12	109536367	109536367	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr12:109536367G>A	ENST00000242576.2	+	2	369	c.263G>A	c.(262-264)cGc>cAc	p.R88H	UNG_ENST00000336865.2_Missense_Mutation_p.R79H	NM_080911.2	NP_550433.1			uracil-DNA glycosylase											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						CTCGCGGCCCGCAACGTGCCC	0.617								Base excision repair (BER), DNA glycosylases	Immune Deficiency with Hyper-IgM																												p.R88H		Atlas-SNP	.											.	UNG	30	.	0			c.G263A						PASS	.						39.0	46.0	44.0					12																	109536367		2202	4287	6489	SO:0001583	missense	7374	exon2	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	CGGCCCGCAACGT	A64377	CCDS9124.1, CCDS9125.1	12q23-q24.1	2014-09-17			ENSG00000076248	ENSG00000076248	3.2.2.27		12572	protein-coding gene	gene with protein product	"""uracil-DNA glycosylase 1, uracil-DNA glycosylase 2"""	191525		DGU		1923798, 17101234	Standard	NM_080911		Approved	UDG, UNG1, UNG2, HIGM4	uc001tnz.2	P13051	OTTHUMG00000169247	ENST00000242576.2:c.263G>A	chr12.hg19:g.109536367G>A	ENSP00000242576:p.Arg88His	110.0	0.0	.		119.0	67.0	.	NM_080911		Missense_Mutation	SNP	ENST00000242576.2	hg19	CCDS9124.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776487	0.90195	.	.	ENSG00000076248	ENST00000242576;ENST00000336865;ENST00000537518	T;T	0.77750	-0.11;-1.12	4.21	4.21	0.49690	.	0.201019	0.43919	D	0.000502	T	0.80576	0.4649	M	0.64404	1.975	0.49213	D	0.999761	D;D	0.61697	0.99;0.987	P;P	0.49999	0.628;0.467	D	0.84208	0.0454	10	0.87932	D	0	-18.7494	15.3137	0.74056	0.0:0.0:1.0:0.0	.	79;88	E5KTA6;P13051	.;UNG_HUMAN	H	88;79;45	ENSP00000242576:R88H;ENSP00000337398:R79H	ENSP00000242576:R88H	R	+	2	0	UNG	108020750	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	3.714000	0.54889	2.182000	0.69389	0.455000	0.32223	CGC	.	.	.	none		0.617	UNG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403067.1	NM_080911	
HECTD4	283450	hgsc.bcm.edu	37	12	112622150	112622150	+	Silent	SNP	C	C	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr12:112622150C>G	ENST00000430131.2	-	60	10499	c.9354G>C	c.(9352-9354)ctG>ctC	p.L3118L	HECTD4_ENST00000550722.1_Silent_p.L3394L|HECTD4_ENST00000377560.5_Silent_p.L3368L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3118					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										cGGTGCTGCACAGGGAAATGT	0.672																																					p.L3406L		Atlas-SNP	.											.	.	.	.	0			c.G10218C						PASS	.						20.0	26.0	24.0					12																	112622150		1997	4171	6168	SO:0001819	synonymous_variant	283450	exon61			GCTGCACAGGGAA	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9354G>C	chr12.hg19:g.112622150C>G		30.0	0.0	.		41.0	21.0	.	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	hg19																																																																																				.	.	.	none		0.672	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
RILPL1	353116	hgsc.bcm.edu	37	12	124017929	124017929	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr12:124017929A>G	ENST00000376874.4	-	1	336	c.101T>C	c.(100-102)gTg>gCg	p.V34A		NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	34					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CTCGTGGCCCACAAGCGACGC	0.677																																					p.V34A		Atlas-SNP	.											.	RILPL1	23	.	0			c.T101C						PASS	.						8.0	11.0	10.0					12																	124017929		2117	4182	6299	SO:0001583	missense	353116	exon1			TGGCCCACAAGCG	AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.101T>C	chr12.hg19:g.124017929A>G	ENSP00000366070:p.Val34Ala	52.0	0.0	.		50.0	29.0	.	NM_178314	Q66K36|Q8N1M0	Missense_Mutation	SNP	ENST00000376874.4	hg19	CCDS45006.1	.	.	.	.	.	.	.	.	.	.	A	33	5.253266	0.95336	.	.	ENSG00000188026	ENST00000376874	T	0.53423	0.62	4.59	4.59	0.56863	JNK/Rab-associated protein-1, N-terminal (1);	0.000000	0.64402	D	0.000007	T	0.52677	0.1749	L	0.53249	1.67	0.80722	D	1	P;D	0.53619	0.792;0.961	B;P	0.50082	0.415;0.63	T	0.58929	-0.7549	10	0.87932	D	0	18.0805	13.6685	0.62409	1.0:0.0:0.0:0.0	.	10;34	Q5EBL4-2;Q5EBL4	.;RIPL1_HUMAN	A	34	ENSP00000366070:V34A	ENSP00000366070:V34A	V	-	2	0	RILPL1	122583882	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.114000	0.77103	1.726000	0.51525	0.486000	0.48141	GTG	.	.	.	none		0.677	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400595.1	NM_178314	
COG3	83548	hgsc.bcm.edu	37	13	46054390	46054390	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr13:46054390C>G	ENST00000349995.5	+	4	626	c.514C>G	c.(514-516)Cta>Gta	p.L172V		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	172					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GACAGGAACCCTACATGAAGC	0.363																																					p.L172V	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-SNP	.											.	COG3	52	.	0			c.C514G						PASS	.						101.0	101.0	101.0					13																	46054390		2203	4300	6503	SO:0001583	missense	83548	exon4			GGAACCCTACATG	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.514C>G	chr13.hg19:g.46054390C>G	ENSP00000258654:p.Leu172Val	100.0	0.0	.		123.0	37.0	.	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	hg19	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485022	0.63962	.	.	ENSG00000136152	ENST00000349995	T	0.59638	0.25	5.98	3.26	0.37387	.	0.000000	0.64402	D	0.000001	T	0.75982	0.3924	M	0.87097	2.86	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;0.996	D;D;P	0.87578	0.997;0.998;0.865	T	0.77448	-0.2584	10	0.66056	D	0.02	-7.9329	9.7147	0.40268	0.0:0.7711:0.0:0.2289	.	9;172;172	B4E2F3;Q96JB2;Q96JB2-2	.;COG3_HUMAN;.	V	172	ENSP00000258654:L172V	ENSP00000258654:L172V	L	+	1	2	COG3	44952391	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	2.857000	0.48349	0.822000	0.34565	-0.229000	0.12294	CTA	.	.	.	none		0.363	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
NALCN	259232	hgsc.bcm.edu	37	13	101760142	101760142	+	Splice_Site	SNP	T	T	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr13:101760142T>C	ENST00000251127.6	-	21	2446		c.e21-2			NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective						calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATTGGAATGCTAGAAATAAAT	0.318																																					.		Atlas-SNP	.											.	NALCN	431	.	0			c.2365-2A>G						PASS	.						107.0	97.0	100.0					13																	101760142		2202	4300	6502	SO:0001630	splice_region_variant	259232	exon22			GAATGCTAGAAAT	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2365-2A>G	chr13.hg19:g.101760142T>C		222.0	0.0	.		217.0	94.0	.	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Splice_Site	SNP	ENST00000251127.6	hg19	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459576	0.63401	.	.	ENSG00000102452	ENST00000251127	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6931	0.77469	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NALCN	100558143	1.000000	0.71417	0.945000	0.38365	0.630000	0.37929	5.847000	0.69451	2.097000	0.63578	0.528000	0.53228	.	.	.	.	none		0.318	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	Intron
NIN	51199	hgsc.bcm.edu	37	14	51273464	51273464	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr14:51273464G>C	ENST00000382041.3	-	4	446	c.256C>G	c.(256-258)Caa>Gaa	p.Q86E	NIN_ENST00000324330.9_Missense_Mutation_p.Q86E|NIN_ENST00000389868.3_Missense_Mutation_p.Q86E|NIN_ENST00000382043.4_Missense_Mutation_p.Q86E|NIN_ENST00000453196.1_Missense_Mutation_p.Q86E|NIN_ENST00000245441.5_Missense_Mutation_p.Q86E|NIN_ENST00000530997.2_Missense_Mutation_p.Q86E	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	86					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CCTGGTTCTTGAAAGTGTTCT	0.363			T	PDGFRB	MPD																																p.Q86E		Atlas-SNP	.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	NIN	475	.	0			c.C256G						PASS	.						114.0	111.0	112.0					14																	51273464		2203	4300	6503	SO:0001583	missense	51199	exon4			GTTCTTGAAAGTG	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.256C>G	chr14.hg19:g.51273464G>C	ENSP00000371472:p.Gln86Glu	63.0	0.0	.		39.0	14.0	.	NM_020921	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	hg19	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	G	2.935	-0.220218	0.06061	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401;ENST00000496749	T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.51	1.21	0.21127	.	0.499688	0.21964	N	0.066546	T	0.12263	0.0298	N	0.11023	0.085	0.25242	N	0.989742	B;B;B;B;B	0.13145	0.007;0.003;0.001;0.0;0.0	B;B;B;B;B	0.13407	0.009;0.006;0.002;0.002;0.002	T	0.28459	-1.0043	10	0.19590	T	0.45	-4.0393	11.4578	0.50191	0.0:0.3593:0.5227:0.118	.	92;86;86;86;86	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	E	86;86;86;86;92;86;86;86;48;86	ENSP00000245441:Q86E;ENSP00000374518:Q86E;ENSP00000371474:Q86E;ENSP00000371472:Q86E;ENSP00000324210:Q86E;ENSP00000412391:Q86E;ENSP00000398641:Q48E;ENSP00000431826:Q86E	ENSP00000245441:Q86E	Q	-	1	0	NIN	50343214	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.799000	0.27028	0.642000	0.30620	0.491000	0.48974	CAA	.	.	.	none		0.363	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
HIF1A	3091	hgsc.bcm.edu	37	14	62207303	62207303	+	Silent	SNP	T	T	G			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr14:62207303T>G	ENST00000337138.4	+	11	1882	c.1617T>G	c.(1615-1617)ctT>ctG	p.L539L	HIF1A_ENST00000323441.6_Silent_p.L539L|HIF1A-AS2_ENST00000554254.1_lincRNA|RP11-618G20.1_ENST00000555937.1_RNA|HIF1A_ENST00000394997.1_Silent_p.L540L|HIF1A_ENST00000557538.1_Silent_p.L480L|HIF1A_ENST00000539097.1_Silent_p.L563L	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	539	NTAD.|ODD.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TAGAAAAACTTTTTGCTGAAG	0.289																																					p.L563L		Atlas-SNP	.											.	HIF1A	120	.	0			c.T1689G						PASS	.						95.0	95.0	95.0					14																	62207303		2203	4300	6503	SO:0001819	synonymous_variant	3091	exon11			AAAACTTTTTGCT	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1617T>G	chr14.hg19:g.62207303T>G		84.0	0.0	.		101.0	36.0	.	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Silent	SNP	ENST00000337138.4	hg19	CCDS9753.1																																																																																			.	.	.	none		0.289	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
C15orf57	90416	hgsc.bcm.edu	37	15	40846226	40846226	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr15:40846226G>A	ENST00000358005.3	-	4	775	c.502C>T	c.(502-504)Cca>Tca	p.P168S	C15orf57_ENST00000558750.1_Missense_Mutation_p.P177S|RP11-111A22.1_ENST00000561460.1_RNA|C15orf57_ENST00000559911.1_Intron|C15orf57_ENST00000560305.1_Intron|RP11-111A22.1_ENST00000561039.1_RNA|C15orf57_ENST00000561011.1_Intron|C15orf57_ENST00000558113.1_Intron|C15orf57_ENST00000416810.2_Missense_Mutation_p.P168S	NM_001080791.1|NM_052849.2	NP_001074260.1|NP_443081.1	Q9BV29	CO057_HUMAN	chromosome 15 open reading frame 57	168										endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	9						TCGGCCACTGGCTTCTCAACC	0.537																																					p.P177S		Atlas-SNP	.											.	C15orf57	20	.	0			c.C529T						PASS	.						65.0	57.0	60.0					15																	40846226		2203	4300	6503	SO:0001583	missense	90416	exon4			CCACTGGCTTCTC	BC012189	CCDS10060.1, CCDS42022.1, CCDS73706.1	15q15.1	2008-05-30	2008-05-30	2008-05-30	ENSG00000128891	ENSG00000128891			28295	protein-coding gene	gene with protein product			"""coiled-coil domain containing 32"""	CCDC32		12477932	Standard	NM_001080791		Approved	MGC20481	uc001zma.1	Q9BV29	OTTHUMG00000129993	ENST00000358005.3:c.502C>T	chr15.hg19:g.40846226G>A	ENSP00000350695:p.Pro168Ser	84.0	0.0	.		94.0	41.0	.	NM_001080791	A8KAL4|Q86TC4|Q8N788|Q8NAR7	Missense_Mutation	SNP	ENST00000358005.3	hg19	CCDS10060.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867941	0.32977	.	.	ENSG00000128891	ENST00000358005;ENST00000416810	T	0.42900	0.96	5.35	4.44	0.53790	.	0.298703	0.31821	N	0.007006	T	0.29093	0.0723	L	0.40543	1.245	0.29718	N	0.838855	B;B	0.29988	0.112;0.264	B;B	0.24701	0.032;0.055	T	0.17440	-1.0369	10	0.13108	T	0.6	-15.494	9.8807	0.41231	0.0728:0.1386:0.7886:0.0	.	168;177	Q9BV29;Q9BV29-2	CO057_HUMAN;.	S	168;177	ENSP00000350695:P168S	ENSP00000350695:P168S	P	-	1	0	C15orf57	38633518	1.000000	0.71417	0.996000	0.52242	0.669000	0.39330	1.577000	0.36515	1.487000	0.48415	0.655000	0.94253	CCA	.	.	.	none		0.537	C15orf57-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252259.2	NM_052849	
RPL4	6124	hgsc.bcm.edu	37	15	66791910	66791910	+	Silent	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr15:66791910G>T	ENST00000307961.6	-	10	1211	c.1119C>A	c.(1117-1119)ggC>ggA	p.G373G	SNAPC5_ENST00000307979.7_5'Flank|SNAPC5_ENST00000395589.2_5'Flank|SNORD18C_ENST00000362704.1_RNA|SNORD18B_ENST00000365659.1_RNA|SNAPC5_ENST00000563480.2_5'Flank|SNAPC5_ENST00000316634.5_5'Flank|MIR4512_ENST00000583257.1_RNA|RPL4_ENST00000568588.1_Silent_p.G279G|SNAPC5_ENST00000566658.1_5'Flank	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	373	Lys-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						CAGGCTTCTTGCCTGCAACCG	0.517																																					p.G373G		Atlas-SNP	.											.	RPL4	29	.	0			c.C1119A						PASS	.						36.0	39.0	38.0					15																	66791910		2198	4294	6492	SO:0001819	synonymous_variant	6124	exon10			CTTCTTGCCTGCA	AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.1119C>A	chr15.hg19:g.66791910G>T		107.0	0.0	.		105.0	40.0	.	NM_000968	A8K502|P39029|Q4VBR0|Q969Z9	Silent	SNP	ENST00000307961.6	hg19	CCDS10218.1																																																																																			.	.	.	none		0.517	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256903.2	NM_000968	
DNAJA4	55466	hgsc.bcm.edu	37	15	78566592	78566592	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr15:78566592G>T	ENST00000394852.3	+	4	662	c.472G>T	c.(472-474)Ggg>Tgg	p.G158W	DNAJA4_ENST00000446172.2_Missense_Mutation_p.G131W|DNAJA4_ENST00000343789.3_Missense_Mutation_p.G158W|DNAJA4_ENST00000394855.3_Missense_Mutation_p.G187W	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	158					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						CAAGGGGCGGGGGATGCAGAT	0.622																																					p.G187W		Atlas-SNP	.											.	DNAJA4	63	.	0			c.G559T						PASS	.						65.0	52.0	57.0					15																	78566592		2196	4293	6489	SO:0001583	missense	55466	exon5			GGGCGGGGGATGC	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.472G>T	chr15.hg19:g.78566592G>T	ENSP00000378321:p.Gly158Trp	50.0	0.0	.		53.0	20.0	.	NM_018602	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	ENST00000394852.3	hg19	CCDS45316.1	.	.	.	.	.	.	.	.	.	.	G	33	5.220515	0.95139	.	.	ENSG00000140403	ENST00000394855;ENST00000343789;ENST00000394852;ENST00000446172	T;T;T;D	0.85339	-1.47;-1.39;-1.39;-1.97	5.91	5.91	0.95273	HSP40/DnaJ peptide-binding (1);Heat shock protein DnaJ, cysteine-rich domain (4);	0.000000	0.85682	D	0.000000	D	0.96892	0.8985	H	0.99942	5.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98616	1.0665	10	0.87932	D	0	-14.2943	19.2867	0.94077	0.0:0.0:1.0:0.0	.	73;131;158;187	Q9P1H1;E9PDM9;Q8WW22;Q8WW22-2	.;.;DNJA4_HUMAN;.	W	187;158;158;131	ENSP00000378324:G187W;ENSP00000339581:G158W;ENSP00000378321:G158W;ENSP00000413499:G131W	ENSP00000339581:G158W	G	+	1	0	DNAJA4	76353647	1.000000	0.71417	0.832000	0.32986	0.990000	0.78478	9.658000	0.98594	2.793000	0.96121	0.655000	0.94253	GGG	.	.	.	none		0.622	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602	
EME2	197342	hgsc.bcm.edu	37	16	1823269	1823269	+	Missense_Mutation	SNP	A	A	G	rs372940829	byFrequency	TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr16:1823269A>G	ENST00000568449.1	+	1	62	c.41A>G	c.(40-42)cAg>cGg	p.Q14R	MRPS34_ENST00000177742.3_5'Flank|NME3_ENST00000219302.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000563498.1_5'Flank|EME2_ENST00000307394.7_Missense_Mutation_p.Q14R	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	14					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						GTCTCTTGCCAGGGCCGGGGC	0.736								Direct reversal of damage;Homologous recombination					a|||	4	0.000798722	0.003	0.0	5008	,	,		10624	0.0		0.0	False		,,,				2504	0.0				p.Q14R		Atlas-SNP	.											.	EME2	40	.	0			c.A41G						PASS	.	A	ARG/GLN	2,3076		0,2,1537	3.0	5.0	4.0		41	-0.3	0.0	16		4	0,6824		0,0,3412	no	missense	EME2	NM_001010865.1	43	0,2,4949	GG,GA,AA		0.0,0.065,0.0202	benign	14/445	1823269	2,9900	1539	3412	4951	SO:0001583	missense	197342	exon1			CTTGCCAGGGCCG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.41A>G	chr16.hg19:g.1823269A>G	ENSP00000457353:p.Gln14Arg	5.0	0.0	.		13.0	6.0	.	NM_001257370	Q8TEP2|Q96RY3	Missense_Mutation	SNP	ENST00000568449.1	hg19	CCDS58404.1	.	.	.	.	.	.	.	.	.	.	a	1.144	-0.648714	0.03506	6.5E-4	0.0	ENSG00000197774	ENST00000307394;ENST00000454910	.	.	.	3.03	-0.341	0.12639	.	0.834282	0.09836	N	0.749571	T	0.15998	0.0385	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32903	-0.9889	8	0.06891	T	0.86	1.3716	8.4242	0.32718	0.1085:0.0:0.7482:0.1433	.	14	A4GXA9	EME2_HUMAN	R	14	.	ENSP00000303779:Q14R	Q	+	2	0	EME2	1763270	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.801000	0.04550	-0.678000	0.05224	-2.469000	0.00203	CAG	.	.	.	weak		0.736	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
MYLK3	91807	hgsc.bcm.edu	37	16	46771758	46771758	+	Missense_Mutation	SNP	G	G	A	rs374905189		TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr16:46771758G>A	ENST00000394809.4	-	3	981	c.866C>T	c.(865-867)tCg>tTg	p.S289L	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	289					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CCTGCTGGACGATGCTCCTTG	0.667																																					p.S289L		Atlas-SNP	.											.	MYLK3	82	.	0			c.C866T						PASS	.	G	LEU/SER	0,4406		0,0,2203	81.0	80.0	80.0		866	-0.4	0.0	16		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYLK3	NM_182493.2	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	289/820	46771758	1,13005	2203	4300	6503	SO:0001583	missense	91807	exon3			CTGGACGATGCTC	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.866C>T	chr16.hg19:g.46771758G>A	ENSP00000378288:p.Ser289Leu	48.0	0.0	.		34.0	8.0	.	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	hg19	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893498	0.33442	0.0	1.16E-4	ENSG00000140795	ENST00000394809	T	0.69435	-0.4	4.94	-0.448	0.12230	.	0.616301	0.12413	N	0.471152	T	0.45094	0.1325	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.22591	-1.0212	10	0.24483	T	0.36	.	7.4858	0.27432	0.6492:0.0:0.3508:0.0	.	289	Q32MK0	MYLK3_HUMAN	L	289	ENSP00000378288:S289L	ENSP00000378288:S289L	S	-	2	0	MYLK3	45329259	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.096000	0.15147	-0.029000	0.13827	0.655000	0.94253	TCG	.	.	.	weak		0.667	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
KCTD19	146212	hgsc.bcm.edu	37	16	67337132	67337132	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr16:67337132C>A	ENST00000304372.5	-	4	615	c.560G>T	c.(559-561)aGc>aTc	p.S187I	KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	187					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		AGTCACTAGGCTGGGATATTT	0.577																																					p.S187I		Atlas-SNP	.											.	KCTD19	82	.	0			c.G560T						PASS	.						79.0	83.0	81.0					16																	67337132		2093	4215	6308	SO:0001583	missense	146212	exon4			ACTAGGCTGGGAT	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.560G>T	chr16.hg19:g.67337132C>A	ENSP00000305702:p.Ser187Ile	80.0	0.0	.		51.0	21.0	.	NM_001100915	B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	hg19	CCDS42179.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601465	0.46423	.	.	ENSG00000168676	ENST00000304372	T	0.60424	0.19	5.82	3.83	0.44106	.	0.366488	0.29980	N	0.010709	T	0.33933	0.0880	N	0.14661	0.345	0.28909	N	0.892832	B	0.17038	0.02	B	0.14023	0.01	T	0.11916	-1.0568	10	0.40728	T	0.16	-11.966	3.7416	0.08532	0.1448:0.5549:0.2088:0.0915	.	187	Q17RG1	KCD19_HUMAN	I	187	ENSP00000305702:S187I	ENSP00000305702:S187I	S	-	2	0	KCTD19	65894633	0.995000	0.38212	1.000000	0.80357	0.984000	0.73092	1.566000	0.36396	1.479000	0.48272	0.655000	0.94253	AGC	.	.	.	none		0.577	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367	
ESRP2	80004	hgsc.bcm.edu	37	16	68265766	68265766	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr16:68265766T>C	ENST00000565858.1	-	10	1354	c.1268A>G	c.(1267-1269)aAg>aGg	p.K423R	RP11-96D1.11_ENST00000571197.1_RNA|ESRP2_ENST00000473183.2_Missense_Mutation_p.K413R	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	423	RRM 2.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						CAGCATGCCCTTGTGCCTGCG	0.617																																					p.K413R		Atlas-SNP	.											.	ESRP2	118	.	0			c.A1238G						PASS	.						52.0	47.0	49.0					16																	68265766		2198	4300	6498	SO:0001583	missense	80004	exon10			ATGCCCTTGTGCC	AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.1268A>G	chr16.hg19:g.68265766T>C	ENSP00000454554:p.Lys423Arg	85.0	0.0	.		63.0	26.0	.	NM_024939	Q8N6H8|Q8WZ15|Q9H6I4	Missense_Mutation	SNP	ENST00000565858.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.90	2.075230	0.36662	.	.	ENSG00000103067	ENST00000473183	T	0.29917	1.55	5.93	5.93	0.95920	RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.23210	0.0561	N	0.11845	0.185	0.58432	D	0.999998	B;B	0.27068	0.167;0.002	B;B	0.37508	0.252;0.046	T	0.11891	-1.0569	10	0.11794	T	0.64	-15.5772	16.3829	0.83481	0.0:0.0:0.0:1.0	.	423;413	Q9H6T0;Q9H6T0-2	ESRP2_HUMAN;.	R	413	ENSP00000418748:K413R	ENSP00000418748:K413R	K	-	2	0	ESRP2	66823267	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.243000	0.72384	2.271000	0.75665	0.459000	0.35465	AAG	.	.	.	none		0.617	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	NM_024939	
FXR2	9513	hgsc.bcm.edu	37	17	7506290	7506290	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr17:7506290G>T	ENST00000250113.7	-	6	814	c.480C>A	c.(478-480)ttC>ttA	p.F160L		NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	160						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.?(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		GGGCTTTCTTGAACTCTTTAT	0.463																																					p.F160L		Atlas-SNP	.											.	FXR2	44	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.C480A						PASS	.						88.0	83.0	85.0					17																	7506290		1857	4103	5960	SO:0001583	missense	9513	exon6			TTTCTTGAACTCT	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.480C>A	chr17.hg19:g.7506290G>T	ENSP00000250113:p.Phe160Leu	82.0	0.0	.		52.0	17.0	.	NM_004860	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	hg19	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423205	0.62733	.	.	ENSG00000129245	ENST00000250113	T	0.56941	0.43	6.03	3.02	0.34903	.	0.050013	0.85682	D	0.000000	T	0.45796	0.1360	L	0.49455	1.56	0.48395	D	0.999643	B;B	0.20550	0.046;0.046	B;B	0.24006	0.05;0.05	T	0.39354	-0.9618	10	0.62326	D	0.03	2.3364	9.635	0.39802	0.2243:0.0:0.7757:0.0	.	160;160	Q86V09;P51116	.;FXR2_HUMAN	L	160	ENSP00000250113:F160L	ENSP00000250113:F160L	F	-	3	2	FXR2	7447015	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.970000	0.29383	0.457000	0.26962	0.655000	0.94253	TTC	.	.	.	none		0.463	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		
TBCD	6904	hgsc.bcm.edu	37	17	80858535	80858535	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr17:80858535T>A	ENST00000355528.4	+	18	1788	c.1658T>A	c.(1657-1659)aTt>aAt	p.I553N	TBCD_ENST00000397466.2_Missense_Mutation_p.I167N|TBCD_ENST00000539345.2_Missense_Mutation_p.I553N	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	553					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			AGTGTGTTTATTGCCGGCTTT	0.478																																					p.I553N		Atlas-SNP	.											.	TBCD	94	.	0			c.T1658A						PASS	.						143.0	141.0	142.0					17																	80858535		2017	4169	6186	SO:0001583	missense	6904	exon18			TGTTTATTGCCGG	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1658T>A	chr17.hg19:g.80858535T>A	ENSP00000347719:p.Ile553Asn	233.0	0.0	.		166.0	70.0	.	NM_005993	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	hg19	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.417097	0.42918	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.69561	-0.41;-0.41	5.23	5.23	0.72850	Armadillo-like helical (1);Armadillo-type fold (1);	0.067842	0.56097	D	0.000032	D	0.84786	0.5549	M	0.92219	3.285	0.50171	D	0.99985	D;D;D	0.89917	1.0;0.999;0.991	D;D;D	0.74348	0.976;0.983;0.92	D	0.88364	0.2990	9	.	.	.	.	13.0491	0.58944	0.0:0.0:0.0:1.0	.	553;553;553	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	N	553;304;167;553	ENSP00000347719:I553N;ENSP00000380608:I167N	.	I	+	2	0	TBCD	78451824	1.000000	0.71417	0.310000	0.25168	0.011000	0.07611	5.948000	0.70249	1.982000	0.57802	0.533000	0.62120	ATT	.	.	.	none		0.478	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
MIER2	54531	hgsc.bcm.edu	37	19	327981	327981	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr19:327981G>T	ENST00000264819.4	-	4	262	c.252C>A	c.(250-252)gaC>gaA	p.D84E	MIER2_ENST00000592722.1_5'UTR	NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	84					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAAGGGCATGTCGTTGCTCT	0.617																																					p.D84E		Atlas-SNP	.											.	MIER2	51	.	0			c.C252A						PASS	.						98.0	75.0	83.0					19																	327981		2203	4300	6503	SO:0001583	missense	54531	exon4			GGGCATGTCGTTG	AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.252C>A	chr19.hg19:g.327981G>T	ENSP00000264819:p.Asp84Glu	57.0	0.0	.		40.0	9.0	.	NM_017550	Q9ULM7	Missense_Mutation	SNP	ENST00000264819.4	hg19	CCDS32855.1	.	.	.	.	.	.	.	.	.	.	.	12.28	1.891165	0.33348	.	.	ENSG00000105556	ENST00000264819	T	0.20881	2.04	5.01	5.01	0.66863	.	0.131175	0.34223	N	0.004142	T	0.14270	0.0345	N	0.26042	0.785	0.36198	D	0.85053	B	0.18166	0.026	B	0.12837	0.008	T	0.15350	-1.0440	10	0.22706	T	0.39	-26.9904	11.1838	0.48644	0.0:0.0:0.8034:0.1966	.	84	Q8N344	MIER2_HUMAN	E	84	ENSP00000264819:D84E	ENSP00000264819:D84E	D	-	3	2	MIER2	278981	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	2.566000	0.45948	2.328000	0.79073	0.563000	0.77884	GAC	.	.	.	none		0.617	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451784.1	XM_041843	
ZNF442	79973	hgsc.bcm.edu	37	19	12460640	12460640	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr19:12460640G>A	ENST00000242804.4	-	6	2341	c.1759C>T	c.(1759-1761)Ctt>Ttt	p.L587F	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Missense_Mutation_p.L518F	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	587					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						TGTCCTCGAAGGAAACGAGAA	0.423																																					p.L587F		Atlas-SNP	.											.	ZNF442	102	.	0			c.C1759T						PASS	.						122.0	108.0	112.0					19																	12460640		2203	4300	6503	SO:0001583	missense	79973	exon6			CTCGAAGGAAACG	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.1759C>T	chr19.hg19:g.12460640G>A	ENSP00000242804:p.Leu587Phe	133.0	0.0	.		98.0	37.0	.	NM_030824	B4DJ48	Missense_Mutation	SNP	ENST00000242804.4	hg19	CCDS12271.1	.	.	.	.	.	.	.	.	.	.	G	9.506	1.104614	0.20632	.	.	ENSG00000198342	ENST00000242804;ENST00000438182	T;T	0.52057	0.68;0.68	0.792	-0.362	0.12560	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33876	0.0878	L	0.48174	1.505	0.09310	N	1	B	0.31274	0.317	B	0.26969	0.075	T	0.18335	-1.0340	9	0.42905	T	0.14	.	5.0248	0.14379	0.2454:0.0:0.7546:0.0	.	587	Q9H7R0	ZN442_HUMAN	F	587;518	ENSP00000242804:L587F;ENSP00000388634:L518F	ENSP00000242804:L587F	L	-	1	0	ZNF442	12321640	0.004000	0.15560	0.001000	0.08648	0.030000	0.12068	-0.320000	0.08028	-0.075000	0.12798	0.306000	0.20318	CTT	.	.	.	none		0.423	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	NM_030824	
EPHX3	79852	hgsc.bcm.edu	37	19	15342598	15342598	+	Silent	SNP	G	G	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr19:15342598G>A	ENST00000221730.3	-	2	538	c.318C>T	c.(316-318)ttC>ttT	p.F106F	EPHX3_ENST00000602233.1_Silent_p.F106F|EPHX3_ENST00000435261.1_Silent_p.F106F	NM_024794.2	NP_079070.1	Q9H6B9	EPHX3_HUMAN	epoxide hydrolase 3	106						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						AGTTCTCAGGGAAGCCGTGCA	0.657																																					p.F106F		Atlas-SNP	.											.	EPHX3	22	.	0			c.C318T						PASS	.						64.0	67.0	66.0					19																	15342598		2203	4300	6503	SO:0001819	synonymous_variant	79852	exon3			CTCAGGGAAGCCG	AK026061	CCDS12327.1	19p13.13	2011-10-05	2009-04-06	2009-04-06	ENSG00000105131	ENSG00000105131		"""Abhydrolase domain containing"""	23760	protein-coding gene	gene with protein product			"""abhydrolase domain containing 9"""	ABHD9			Standard	NM_024794		Approved	FLJ22408	uc002nap.3	Q9H6B9		ENST00000221730.3:c.318C>T	chr19.hg19:g.15342598G>A		40.0	0.0	.		46.0	21.0	.	NM_001142886	A3KMR3	Silent	SNP	ENST00000221730.3	hg19	CCDS12327.1																																																																																			.	.	.	none		0.657	EPHX3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465797.1	NM_024794	
RABAC1	10567	hgsc.bcm.edu	37	19	42461049	42461049	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr19:42461049G>C	ENST00000222008.6	-	5	604	c.507C>G	c.(505-507)ttC>ttG	p.F169L	RABAC1_ENST00000601891.1_Missense_Mutation_p.F135L|RABAC1_ENST00000601078.1_Missense_Mutation_p.F75L	NM_006423.2	NP_006414.2	Q9UI14	PRAF1_HUMAN	Rab acceptor 1 (prenylated)	169	Required for interaction with GDI1. {ECO:0000250}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	identical protein binding (GO:0042802)			central_nervous_system(1)|kidney(1)|prostate(1)	3						CAATCTGGTGGAAGGCAGCGT	0.682																																					p.F169L		Atlas-SNP	.											.	RABAC1	6	.	0			c.C507G						PASS	.						42.0	39.0	40.0					19																	42461049		2202	4297	6499	SO:0001583	missense	10567	exon5			CTGGTGGAAGGCA	AJ133534	CCDS12593.1	19q13.2	2012-09-20			ENSG00000105404	ENSG00000105404			9794	protein-coding gene	gene with protein product	"""PRA1 domain family 1"", ""prenylated Rab acceptor 1"""	604925				10329441, 10751420	Standard	NM_006423		Approved	PRA1, PRAF1, YIP3	uc002osf.3	Q9UI14		ENST00000222008.6:c.507C>G	chr19.hg19:g.42461049G>C	ENSP00000222008:p.Phe169Leu	96.0	0.0	.		91.0	39.0	.	NM_006423	Q7Z4Y2|Q9Y3R1	Missense_Mutation	SNP	ENST00000222008.6	hg19	CCDS12593.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834121	0.50951	.	.	ENSG00000105404	ENST00000222008	T	0.38401	1.14	4.65	2.45	0.29901	.	0.000000	0.85682	D	0.000000	T	0.32496	0.0831	L	0.45698	1.435	0.58432	D	0.999996	P	0.47841	0.901	P	0.48598	0.583	T	0.05289	-1.0894	10	0.27785	T	0.31	-25.6508	5.0709	0.14606	0.1909:0.1743:0.6348:0.0	.	169	Q9UI14	PRAF1_HUMAN	L	169	ENSP00000222008:F169L	ENSP00000222008:F169L	F	-	3	2	RABAC1	47152889	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.693000	0.37742	0.495000	0.27882	0.563000	0.77884	TTC	.	.	.	none		0.682	RABAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463388.1	NM_006423	
TPRX1	284355	hgsc.bcm.edu	37	19	48305603	48305603	+	Missense_Mutation	SNP	G	G	A	rs199739873		TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr19:48305603G>A	ENST00000322175.3	-	2	820	c.665C>T	c.(664-666)cCg>cTg	p.P222L	TPRX1_ENST00000543508.1_Missense_Mutation_p.P212L|TPRX1_ENST00000535759.1_Missense_Mutation_p.P319L	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	222	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P222L(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gcctgggatcgggcctgggtt	0.667																																					p.P222L	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-SNP	.											TPRX1,NS,carcinoma,0,1	TPRX1	46	.	1	Substitution - Missense(1)	prostate(1)	c.C665T						PASS	.						12.0	10.0	10.0					19																	48305603		1907	3812	5719	SO:0001583	missense	284355	exon2			GGGATCGGGCCTG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.665C>T	chr19.hg19:g.48305603G>A	ENSP00000323455:p.Pro222Leu	52.0	0.0	.		42.0	21.0	.	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	hg19	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	g	4.957	0.177797	0.09443	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D;T	0.93659	-2.02;-3.26;-0.19	0.401	-0.802	0.10889	.	.	.	.	.	D	0.83727	0.5317	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.70901	-0.4746	8	0.56958	D	0.05	.	.	.	.	.	222	Q8N7U7	TPRX1_HUMAN	L	222;319;212	ENSP00000323455:P222L;ENSP00000438832:P319L;ENSP00000438712:P212L	ENSP00000323455:P222L	P	-	2	0	TPRX1	52997415	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.050000	0.03510	-0.453000	0.07076	-0.462000	0.05337	CCG	.	.	.	weak		0.667	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
SLC12A5	57468	hgsc.bcm.edu	37	20	44670004	44670004	+	Silent	SNP	T	T	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr20:44670004T>C	ENST00000454036.2	+	8	1009	c.960T>C	c.(958-960)caT>caC	p.H320H	SLC12A5_ENST00000243964.3_Silent_p.H297H	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	320					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TGTCTCGCCATGGCTTTGATG	0.572																																					p.H320H		Atlas-SNP	.											.	SLC12A5	181	.	0			c.T960C						PASS	.						104.0	92.0	96.0					20																	44670004		2203	4300	6503	SO:0001819	synonymous_variant	57468	exon8			TCGCCATGGCTTT	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.960T>C	chr20.hg19:g.44670004T>C		75.0	0.0	.		77.0	17.0	.	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	hg19	CCDS46610.1																																																																																			.	.	.	none		0.572	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
DNAJC5	80331	hgsc.bcm.edu	37	20	62560863	62560863	+	Silent	SNP	C	C	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr20:62560863C>T	ENST00000360864.4	+	3	459	c.306C>T	c.(304-306)tcC>tcT	p.S102S	DNAJC5_ENST00000369911.2_Silent_p.S102S	NM_025219.2	NP_079495.1	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	102					cell death (GO:0008219)|exocytosis (GO:0006887)|negative regulation of neuron apoptotic process (GO:0043524)|neurotransmitter secretion (GO:0007269)|regulated secretory pathway (GO:0045055)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)				cervix(1)|endometrium(1)|lung(1)|pancreas(1)|upper_aerodigestive_tract(1)	5	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCGTGCTGTCCAGCTGGTGGG	0.642																																					p.S102S		Atlas-SNP	.											.	DNAJC5	16	.	0			c.C306T						PASS	.						118.0	94.0	102.0					20																	62560863		2203	4300	6503	SO:0001819	synonymous_variant	80331	exon3			GCTGTCCAGCTGG		CCDS13546.1	20q13.33	2014-09-17			ENSG00000101152	ENSG00000101152		"""Heat shock proteins / DNAJ (HSP40)"""	16235	protein-coding gene	gene with protein product		611203	"""ceroid-lipofuscinosis, neuronal 4 (Kufs disease)"""	CLN4			Standard	NM_025219		Approved	FLJ00118, FLJ13070, DNAJC5A	uc002yhf.3	Q9H3Z4	OTTHUMG00000033007	ENST00000360864.4:c.306C>T	chr20.hg19:g.62560863C>T		25.0	0.0	.		21.0	9.0	.	NM_025219	A8K0M0|B3KY68|E1P5G8|Q9H3Z5|Q9H7H2	Silent	SNP	ENST00000360864.4	hg19	CCDS13546.1																																																																																			.	.	.	none		0.642	DNAJC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080244.1	NM_025219	
SOX18	54345	hgsc.bcm.edu	37	20	62680619	62680619	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr20:62680619C>T	ENST00000340356.7	-	1	375	c.251G>A	c.(250-252)cGc>cAc	p.R84H	ZNF512B_ENST00000450537.1_5'Flank	NM_018419.2	NP_060889.1	P35713	SOX18_HUMAN	SRY (sex determining region Y)-box 18	84					angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|cell maturation (GO:0048469)|embryonic heart tube development (GO:0035050)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|establishment of endothelial barrier (GO:0061028)|hair cycle process (GO:0022405)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell proliferation (GO:0072091)|stem cell fate specification (GO:0048866)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)	nuclear chromatin (GO:0000790)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			lung(3)	3	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					CCGCCGGATGCGCGACTCGTC	0.736																																					p.R84H	GBM(27;64 690 17108 39708)	Atlas-SNP	.											.	SOX18	5	.	0			c.G251A						PASS	.						24.0	27.0	26.0					20																	62680619		2194	4289	6483	SO:0001583	missense	54345	exon1			CGGATGCGCGACT	AB033888	CCDS13552.1	20q13.33	2008-07-28			ENSG00000203883	ENSG00000203883		"""SRY (sex determining region Y)-boxes"""	11194	protein-coding gene	gene with protein product		601618				10807548	Standard	NM_018419		Approved		uc002yhs.3	P35713	OTTHUMG00000033017	ENST00000340356.7:c.251G>A	chr20.hg19:g.62680619C>T	ENSP00000341815:p.Arg84His	41.0	0.0	.		39.0	19.0	.	NM_018419	Q0VGA9|Q9NPH8	Missense_Mutation	SNP	ENST00000340356.7	hg19	CCDS13552.1	.	.	.	.	.	.	.	.	.	.	c	22.7	4.321194	0.81580	.	.	ENSG00000203883	ENST00000340356	D	0.93906	-3.31	2.44	2.44	0.29823	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (2);	0.000000	0.64402	U	0.000006	D	0.92522	0.7625	N	0.20445	0.575	0.48341	D	0.999631	D	0.89917	1.0	D	0.87578	0.998	D	0.91194	0.4986	10	0.38643	T	0.18	.	12.5069	0.55986	0.0:1.0:0.0:0.0	.	84	P35713	SOX18_HUMAN	H	84	ENSP00000341815:R84H	ENSP00000341815:R84H	R	-	2	0	SOX18	62151063	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	2.710000	0.47169	1.197000	0.43143	0.187000	0.17357	CGC	.	.	.	none		0.736	SOX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080265.1		
MCM3AP	8888	hgsc.bcm.edu	37	21	47665020	47665020	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr21:47665020A>C	ENST00000397708.1	-	24	4993	c.4739T>G	c.(4738-4740)aTt>aGt	p.I1580S	MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP_ENST00000291688.1_Missense_Mutation_p.I1580S|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1580					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CTCATGGCCAATCCCGTCTTC	0.542																																					p.I1580S		Atlas-SNP	.											.	MCM3AP	146	.	0			c.T4739G						PASS	.						63.0	65.0	64.0					21																	47665020		2203	4300	6503	SO:0001583	missense	8888	exon23			TGGCCAATCCCGT	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4739T>G	chr21.hg19:g.47665020A>C	ENSP00000380820:p.Ile1580Ser	58.0	0.0	.		60.0	22.0	.	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	hg19	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	A	12.96	2.094267	0.36952	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03831	3.79;3.79	5.31	5.31	0.75309	.	0.754197	0.12852	N	0.433865	T	0.07908	0.0198	L	0.44542	1.39	0.18873	N	0.999984	B;P	0.36909	0.181;0.573	B;B	0.37833	0.057;0.259	T	0.20672	-1.0268	10	0.87932	D	0	-2.8064	15.2629	0.73637	1.0:0.0:0.0:0.0	.	1580;75	O60318;B3KT88	MCM3A_HUMAN;.	S	1580;1580;75	ENSP00000380820:I1580S;ENSP00000291688:I1580S	ENSP00000291688:I1580S	I	-	2	0	MCM3AP	46489448	0.863000	0.29885	0.041000	0.18516	0.496000	0.33645	7.945000	0.87732	2.003000	0.58678	0.459000	0.35465	ATT	.	.	.	none		0.542	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
CENPI	2491	hgsc.bcm.edu	37	X	100402791	100402791	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chrX:100402791G>T	ENST00000372927.1	+	18	2143	c.1866G>T	c.(1864-1866)ttG>ttT	p.L622F	CENPI_ENST00000423383.1_Missense_Mutation_p.L622F|CENPI_ENST00000218507.5_Missense_Mutation_p.L622F	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	622					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						AAAATGAGTTGGTACAAAAGG	0.318																																					p.L622F		Atlas-SNP	.											.	CENPI	70	.	0			c.G1866T						PASS	.						62.0	53.0	56.0					X																	100402791		2203	4297	6500	SO:0001583	missense	2491	exon18			TGAGTTGGTACAA	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.1866G>T	chrX.hg19:g.100402791G>T	ENSP00000362018:p.Leu622Phe	162.0	0.0	.		136.0	90.0	.	NM_006733	Q5JWZ9|Q96ED0	Missense_Mutation	SNP	ENST00000372927.1	hg19	CCDS14479.1	.	.	.	.	.	.	.	.	.	.	G	4.054	0.007761	0.07866	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372927	.	.	.	5.12	1.06	0.20224	.	1.201730	0.05831	N	0.617505	T	0.25938	0.0632	L	0.27053	0.805	0.09310	N	1	B;B	0.17038	0.02;0.02	B;B	0.14578	0.011;0.011	T	0.20042	-1.0287	9	0.10111	T	0.7	0.5429	4.4124	0.11439	0.1768:0.0:0.3555:0.4677	.	622;622	B4DZL4;Q92674	.;CENPI_HUMAN	F	622	.	ENSP00000218507:L622F	L	+	3	2	CENPI	100289447	0.000000	0.05858	0.000000	0.03702	0.282000	0.26991	0.391000	0.20784	-0.148000	0.11234	0.462000	0.41574	TTG	.	.	.	none		0.318	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	NM_006733	
MT-ND6	4541	hgsc.bcm.edu	37	M	14569	14569	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chrM:14569G>C	ENST00000361681.2	-	1	104	c.105C>G	c.(103-105)agC>agG	p.S35R	MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	35					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CCGACCACACCGCTAACAATC	0.383																																					p.S35X		Atlas-SNP	.											.	.	.	.	0			c.C105G						PASS	.																																			SO:0001583	missense	0	exon1			CACACCGCTAACA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.105C>G	chrM.hg19:g.14569G>C	ENSP00000354665:p.Ser35Arg	31.0	0.0	.		77.0	73.0	.	ENST00000361681	Q34774|Q8HG30	Nonsense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.	.	none		0.383	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
MUC17	140453	hgsc.bcm.edu	37	7	100674408	100674408	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr7:100674408delT	ENST00000306151.4	+	2	154	c.90delT	c.(88-90)agtfs	p.S30fs		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	30					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGACCTCAGTGTGAACAGGG	0.532																																					p.S30fs		Atlas-INDEL	.											.	MUC17	804	.	0			c.89delG						PASS	.						194.0	169.0	177.0					7																	100674408		2203	4300	6503	SO:0001589	frameshift_variant	140453	exon2			.	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.90delT	chr7.hg19:g.100674408delT	ENSP00000302716:p.Ser30fs	169.0	0.0	0		124.0	44.0	0.354839	NM_001040105	O14761|Q685J2|Q8TDH7	Frame_Shift_Del	DEL	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.	.	none		0.532	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CLCN5	1184	hgsc.bcm.edu	37	X	49851346	49851347	+	In_Frame_Ins	INS	-	-	TAA			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chrX:49851346_49851347insTAA	ENST00000307367.2	+	8	1457_1458	c.1166_1167insTAA	c.(1165-1170)tttaat>ttTAAtaat	p.390_391insN	CLCN5_ENST00000376091.3_In_Frame_Ins_p.460_461insN|CLCN5_ENST00000376108.3_In_Frame_Ins_p.390_391insN|CLCN5_ENST00000376088.3_In_Frame_Ins_p.460_461insN			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	390					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TCTGAGCTGTTTAATGACTGTG	0.515																																					p.F459delinsFN		Atlas-Indel,Pindel	.											.	CLCN5	137	.	0			c.1376_1377insTAA						PASS	.																																			SO:0001652	inframe_insertion	1184	exon11			.	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1167_1169dupTAA	chrX.hg19:g.49851347_49851349dupTAA	ENSP00000304257:p.Asn390_Asn390dup	75.0	0.0	0		58.0	38.0	0.655172	NM_001127898	A1L475|B3KPN6|Q5JQD5|Q7RTN8	In_Frame_Ins	INS	ENST00000307367.2	hg19	CCDS14328.1																																																																																			.	.	.	none		0.515	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
GNL2	29889	hgsc.bcm.edu	37	1	38039944	38039951	+	Splice_Site	DEL	CTGGGGGG	CTGGGGGG	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	CTGGGGGG	CTGGGGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:38039944_38039951delCTGGGGGG	ENST00000373062.3	-	12	1507_1514	c.1409_1416delCCCCCCAG	c.(1408-1416)gccccccag>g	p.APQ470fs		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	470					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				CTGCTCTTACCTGGGGGGCCACAAGTGG	0.553																																					p.470_472del		Atlas-Indel,Pindel	.											.	GNL2	58	.	0			c.1410_1416del						PASS	.																																			SO:0001630	splice_region_variant	29889	exon12			.	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1416+1CCCCCCAG>-	chr1.hg19:g.38039944_38039951delCTGGGGGG		45.0	0.0	0		44.0	16.0	0.363636	NM_013285	Q9BWN7	Frame_Shift_Del	DEL	ENST00000373062.3	hg19	CCDS421.1																																																																																			.	.	.	none		0.553	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	Frame_Shift_Del
RRBP1	6238	hgsc.bcm.edu	37	20	17602147	17602148	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr20:17602147_17602148delGT	ENST00000377813.1	-	16	3672_3673	c.3369_3370delAC	c.(3367-3372)acactgfs	p.L1124fs	RRBP1_ENST00000360807.4_Frame_Shift_Del_p.L691fs|RRBP1_ENST00000470422.1_5'UTR|RRBP1_ENST00000455029.2_Frame_Shift_Del_p.L465fs|RRBP1_ENST00000377807.2_Frame_Shift_Del_p.L691fs|RRBP1_ENST00000246043.4_Frame_Shift_Del_p.L1124fs			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1124					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TCGGCCTGCAGTGTGCTCTGCG	0.594																																					p.691_691del		Atlas-INDEL	.											.	RRBP1	157	.	0			c.2071_2072del						PASS	.																																			SO:0001589	frameshift_variant	6238	exon17			.	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.3369_3370delAC	chr20.hg19:g.17602149_17602150delGT	ENSP00000367044:p.Leu1124fs	28.0	0.0	0		26.0	10.0	0.384615	NM_001042576	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Frame_Shift_Del	DEL	ENST00000377813.1	hg19																																																																																				.	.	.	none		0.594	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
PGLYRP4	57115	hgsc.bcm.edu	37	1	153320386	153320386	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:153320386delA	ENST00000359650.5	-	2	87	c.23delT	c.(22-24)ttcfs	p.F8fs	PGLYRP4_ENST00000368739.3_Frame_Shift_Del_p.F8fs|PGLYRP4_ENST00000490266.1_5'UTR	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	8					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGAGCAGAGAAGACAAGAAG	0.502																																					p.F8fs		Atlas-Indel,Pindel	.											.	PGLYRP4	45	.	0			c.24delC						PASS	.						51.0	52.0	52.0					1																	153320386		2203	4300	6503	SO:0001589	frameshift_variant	57115	exon2			.	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.23delT	chr1.hg19:g.153320386delA	ENSP00000352672:p.Phe8fs	117.0	0.0	0		96.0	40.0	0.416667	NM_020393	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Frame_Shift_Del	DEL	ENST00000359650.5	hg19	CCDS30871.1																																																																																			.	.	.	none		0.502	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
TRIP4	9325	hgsc.bcm.edu	37	15	64710865	64710867	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	TGG	TGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr15:64710865_64710867delTGG	ENST00000261884.3	+	9	1356_1358	c.1296_1298delTGG	c.(1294-1299)gatggt>gat	p.G434del	RN7SL707P_ENST00000582206.1_RNA	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	434					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						AAGGCTTTGATGGTGGCTGGTGC	0.453																																					p.432_433del		Atlas-Indel,Pindel	.											.	TRIP4	43	.	0			c.1295_1297del						PASS	.																																			SO:0001651	inframe_deletion	9325	exon9			.	L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.1296_1298delTGG	chr15.hg19:g.64710868_64710870delTGG	ENSP00000261884:p.Gly434del	99.0	0.0	0		104.0	34.0	0.326923	NM_016213	B2RAS0|Q96ED7|Q9UKH0	In_Frame_Del	DEL	ENST00000261884.3	hg19	CCDS10194.1																																																																																			.	.	.	none		0.453	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
ARID2	196528	hgsc.bcm.edu	37	12	46244757	46244758	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr12:46244757_46244758delCC	ENST00000334344.6	+	15	3023_3024	c.2851_2852delCC	c.(2851-2853)ccafs	p.P951fs	ARID2_ENST00000444670.1_Frame_Shift_Del_p.P561fs|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000422737.1_Frame_Shift_Del_p.P802fs|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	951	Gln-rich.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCTTGCTAATCCAGCAGCTCTT	0.47			"""N, S, F"""		hepatocellular carcinoma																																p.950_951del		Atlas-Indel,Pindel	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.2850_2851del						PASS	.																																			SO:0001589	frameshift_variant	196528	exon15			.		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2851_2852delCC	chr12.hg19:g.46244757_46244758delCC	ENSP00000335044:p.Pro951fs	75.0	0.0	0		115.0	21.0	0.182609	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.	.	none		0.470	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
SETD2	29072	hgsc.bcm.edu	37	3	47165283	47165286	+	Frame_Shift_Del	DEL	TTTT	TTTT	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	TTTT	TTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr3:47165283_47165286delTTTT	ENST00000409792.3	-	3	882_885	c.840_843delAAAA	c.(838-843)aaaaaafs	p.KK280fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	280					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GGGAATCTTCTTTTTTTGAGGAAA	0.338			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.281_282del		Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.841_844del						PASS	.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.840_843delAAAA	chr3.hg19:g.47165283_47165286delTTTT	ENSP00000386759:p.Lys280fs	162.0	0.0	0		166.0	109.0	0.656627	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.	.	none		0.338	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
VPS13A	23230	hgsc.bcm.edu	37	9	79955390	79955390	+	Frame_Shift_Del	DEL	T	T	-	rs370606167		TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr9:79955390delT	ENST00000360280.3	+	50	7210	c.6950delT	c.(6949-6951)attfs	p.I2317fs	VPS13A_ENST00000376634.4_Frame_Shift_Del_p.I2317fs|VPS13A_ENST00000376636.3_Frame_Shift_Del_p.I2278fs|VPS13A_ENST00000357409.5_Frame_Shift_Del_p.I2317fs	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2317					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTTTATATGATTAAAAACAAA	0.323																																					p.I2317fs		Atlas-Indel,Pindel	.											.	VPS13A	735	.	0			c.6949delA						PASS	.						77.0	81.0	80.0					9																	79955390		2203	4296	6499	SO:0001589	frameshift_variant	23230	exon50			.	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.6950delT	chr9.hg19:g.79955390delT	ENSP00000353422:p.Ile2317fs	198.0	0.0	0		190.0	67.0	0.352632	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Frame_Shift_Del	DEL	ENST00000360280.3	hg19	CCDS6655.1																																																																																			.	.	.	none		0.323	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
POLR2D	5433	hgsc.bcm.edu	37	2	128610641	128610642	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr2:128610641_128610642insA	ENST00000272645.4	-	2	167_168	c.111_112insT	c.(109-114)gttcatfs	p.H38fs	POLR2D_ENST00000487079.1_Intron|POLR2D_ENST00000409698.1_5'UTR|POLR2D_ENST00000409955.1_Frame_Shift_Ins_p.H38fs	NM_004805.3	NP_004796.1	O15514	RPB4_HUMAN	polymerase (RNA) II (DNA directed) polypeptide D	38					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus in response to heat stress (GO:0031990)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleotide-excision repair (GO:0006289)|positive regulation of translational initiation (GO:0045948)|positive regulation of viral transcription (GO:0050434)|recruitment of 3'-end processing factors to RNA polymerase II holoenzyme complex (GO:0034402)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)|translation initiation factor binding (GO:0031369)			large_intestine(1)|lung(4)|urinary_tract(1)	6	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0675)		AGAAGCATATGAACTTCTGAAT	0.386																																					p.H38fs		Atlas-Indel,Pindel	.											.	POLR2D	13	.	0			c.112_113insT						PASS	.																																			SO:0001589	frameshift_variant	5433	exon2			.	U85510	CCDS2151.1	2q21	2013-01-21			ENSG00000144231	ENSG00000144231		"""RNA polymerase subunits"""	9191	protein-coding gene	gene with protein product	"""RNA polymerase II subunit hsRBP4"""	606017				9528765	Standard	NM_004805		Approved	RBP4	uc002tpj.3	O15514	OTTHUMG00000131531	ENST00000272645.4:c.112dupT	chr2.hg19:g.128610643_128610643dupA	ENSP00000272645:p.His38fs	127.0	0.0	0		116.0	46.0	0.396552	NM_004805	Q52LT4	Frame_Shift_Ins	INS	ENST00000272645.4	hg19	CCDS2151.1																																																																																			.	.	.	none		0.386	POLR2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254388.3	NM_004805	
PHF20L1	51105	hgsc.bcm.edu	37	8	133851799	133851799	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr8:133851799delG	ENST00000395386.2	+	18	2658	c.2359delG	c.(2359-2361)gggfs	p.G787fs	PHF20L1_ENST00000220847.7_Frame_Shift_Del_p.G174fs|AF230666.2_ENST00000608375.1_RNA|PHF20L1_ENST00000395390.2_Frame_Shift_Del_p.G762fs|AF230666.2_ENST00000429151.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	787							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AGTGCTACACGGGCTACAGCT	0.403																																					p.H786fs		Atlas-Indel,Pindel	.											.	PHF20L1	129	.	0			c.2358delC						PASS	.						106.0	96.0	99.0					8																	133851799		1892	4120	6012	SO:0001589	frameshift_variant	51105	exon18			.	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2359delG	chr8.hg19:g.133851799delG	ENSP00000378784:p.Gly787fs	50.0	0.0	0		54.0	21.0	0.388889	NM_016018	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Frame_Shift_Del	DEL	ENST00000395386.2	hg19	CCDS6367.2																																																																																			.	.	.	none		0.403	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
CNOT1	23019	hgsc.bcm.edu	37	16	58608632	58608633	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr16:58608632_58608633insA	ENST00000317147.5	-	16	2191_2192	c.1859_1860insT	c.(1858-1860)ttafs	p.L620fs	CNOT1_ENST00000441024.2_Frame_Shift_Ins_p.L620fs|CNOT1_ENST00000569240.1_Frame_Shift_Ins_p.L620fs	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	620					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ACCGTCTCTTTAAAAAAGTCAT	0.396																																					p.L620fs		Atlas-INDEL	.											.	CNOT1	359	.	0			c.1860_1861insT						PASS	.																																			SO:0001589	frameshift_variant	23019	exon16			.	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1860dupT	chr16.hg19:g.58608638_58608638dupA	ENSP00000320949:p.Leu620fs	55.0	0.0	0		44.0	12.0	0.272727	NM_001265612	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Ins	INS	ENST00000317147.5	hg19	CCDS10799.1																																																																																			.	.	.	none		0.396	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
AIM1L	55057	hgsc.bcm.edu	37	1	26664849	26664849	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr1:26664849delA	ENST00000308182.5	-	6	758	c.329delT	c.(328-330)atgfs	p.M110fs	AIM1L_ENST00000522993.1_5'UTR|AIM1L_ENST00000527815.1_Frame_Shift_Del_p.M281fs			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	110	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		TACCAATCTCATGGGCTTCAG	0.607																																					p.M1155fs		Atlas-INDEL	.											.	AIM1L	98	.	0			c.3465delG						PASS	.						70.0	69.0	70.0					1																	26664849		2203	4300	6503	SO:0001589	frameshift_variant	55057	exon7			.			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.329delT	chr1.hg19:g.26664849delA	ENSP00000310435:p.Met110fs	45.0	0.0	0		44.0	10.0	0.227273	NM_001039775	B2RNG3|Q5T137|Q5T150	Frame_Shift_Del	DEL	ENST00000308182.5	hg19																																																																																				.	.	.	none		0.607	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19408098	19408100	+	Splice_Site	DEL	GAG	GAG	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr12:19408098_19408100delGAG	ENST00000299275.6	+	5	437_438	c.431_432delGAG	c.(430-432)aga>a	p.R144del	PLEKHA5_ENST00000543806.1_Splice_Site_p.R36del|PLEKHA5_ENST00000538714.1_Splice_Site_p.R144del|PLEKHA5_ENST00000539256.1_5'UTR|PLEKHA5_ENST00000359180.3_Splice_Site_p.R144del|PLEKHA5_ENST00000309364.4_Splice_Site_p.R144del|PLEKHA5_ENST00000424268.1_Splice_Site_p.R36del|PLEKHA5_ENST00000429027.2_Splice_Site_p.R144del|PLEKHA5_ENST00000317589.4_Splice_Site_p.R144del|PLEKHA5_ENST00000355397.3_Splice_Site_p.R144del	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	144					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CCTGTAGGCAGAGTAAGTTATTT	0.31																																					p.144_144del	Pancreas(196;329 2193 11246 14234 19524)	Atlas-Indel,Pindel	.											.	PLEKHA5	198	.	0			c.430_432del						PASS	.																																			SO:0001630	splice_region_variant	54477	exon5			.	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.432+1GAG>-	chr12.hg19:g.19408098_19408100delGAG		37.0	0.0	0		54.0	14.0	0.259259	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	In_Frame_Del	DEL	ENST00000299275.6	hg19	CCDS8682.1																																																																																			.	.	.	none		0.310	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	In_Frame_Del
STAT1	6772	hgsc.bcm.edu	37	2	191874648	191874649	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr2:191874648_191874649delTG	ENST00000361099.3	-	3	468_469	c.81_82delCA	c.(79-84)cccatgfs	p.M28fs	STAT1_ENST00000392322.3_Frame_Shift_Del_p.M28fs|STAT1_ENST00000409465.1_Frame_Shift_Del_p.M28fs|STAT1_ENST00000540176.1_Frame_Shift_Del_p.M28fs|STAT1_ENST00000392323.2_Frame_Shift_Del_p.M30fs	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	28					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CTGATTTCCATGGGAAAACTGT	0.406																																					p.28_28del		Atlas-Indel,Pindel	.											.	STAT1	93	.	0			c.82_83del						PASS	.																																			SO:0001589	frameshift_variant	6772	exon3			.		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.81_82delCA	chr2.hg19:g.191874648_191874649delTG	ENSP00000354394:p.Met28fs	208.0	0.0	0		186.0	68.0	0.365591	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Frame_Shift_Del	DEL	ENST00000361099.3	hg19	CCDS2309.1																																																																																			.	.	.	none		0.406	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
TLN2	83660	hgsc.bcm.edu	37	15	63073341	63073341	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr15:63073341delG	ENST00000561311.1	+	43	5747	c.5517delG	c.(5515-5517)ctgfs	p.L1839fs	TLN2_ENST00000472902.1_Frame_Shift_Del_p.L232fs|TLN2_ENST00000306829.6_Frame_Shift_Del_p.L1839fs			Q9Y4G6	TLN2_HUMAN	talin 2	1839					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CTCTGTAGCTGGATGAAGGCA	0.453																																					p.L1839fs		Atlas-Indel,Pindel	.											.	TLN2	253	.	0			c.5516delT						PASS	.						60.0	59.0	59.0					15																	63073341		2203	4300	6503	SO:0001589	frameshift_variant	83660	exon41			.	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5517delG	chr15.hg19:g.63073341delG	ENSP00000453508:p.Leu1839fs	54.0	0.0	0		36.0	14.0	0.388889	NM_015059	A6NLB8	Frame_Shift_Del	DEL	ENST00000561311.1	hg19	CCDS32261.1																																																																																			.	.	.	none		0.453	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
FNIP2	57600	hgsc.bcm.edu	37	4	159812799	159812800	+	Splice_Site	INS	-	-	T			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr4:159812799_159812800insT	ENST00000264433.6	+	15	3225		c.e15+1		FNIP2_ENST00000379346.3_Splice_Site|C4orf45_ENST00000508011.1_5'Flank	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2						intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TGCTGATTTTGTAAGTACTGGT	0.347																																					.		Pindel	.											.	FNIP2	90	.	0			c.3150+1->T						PASS	.																																			SO:0001630	splice_region_variant	57600	exon15			.	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.3150+1->T	chr4.hg19:g.159812800_159812800dupT		93.0	0.0	.		90.0	20.0	0.222	NM_020840	Q05DC3|Q96I31|Q9H994	Splice_Site	INS	ENST00000264433.6	hg19	CCDS47155.1																																																																																			.	.	.	none		0.347	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	Intron
MUC17	140453	hgsc.bcm.edu	37	7	100674406	100674408	+	In_Frame_Del	DEL	AGT	AGT	-			TCGA-SX-A7SM-01A-11D-A34Z-10	TCGA-SX-A7SM-10A-01D-A34Z-10	AGT	AGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e6a336f0-67fb-4b2b-b9fd-c5a0fb5d699e	bab99f69-b881-4371-88d4-ffdd35a761fd	g.chr7:100674406_100674408delAGT	ENST00000306151.4	+	2	152_154	c.88_90delAGT	c.(88-90)agtdel	p.S30del		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	30					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCAGACCTCAGTGTGAACAGGG	0.537																																					p.29_30del		Pindel	.											.	MUC17	804	.	0			c.87_89del						PASS	.																																			SO:0001651	inframe_deletion	140453	exon2			.	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.88_90delAGT	chr7.hg19:g.100674406_100674408delAGT	ENSP00000302716:p.Ser30del	169.0	0.0	.		125.0	33.0	0.264	NM_001040105	O14761|Q685J2|Q8TDH7	In_Frame_Del	DEL	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.	.	none		0.537	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
