#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EBNA1BP2	10969	hgsc.bcm.edu	37	1	43637311	43637311	+	Silent	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:43637311C>T	ENST00000236051.2	-	3	303	c.162G>A	c.(160-162)aaG>aaA	p.K54K	WDR65_ENST00000528956.1_5'Flank|WDR65_ENST00000372492.4_5'Flank|EBNA1BP2_ENST00000472982.1_5'UTR|EBNA1BP2_ENST00000431635.2_Silent_p.K109K	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	54					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCAAACATTGCTTCAGGCCAT	0.527																																					p.K109K		Atlas-SNP	.											.	EBNA1BP2	37	.	0			c.G327A						PASS	.						143.0	142.0	143.0					1																	43637311		2203	4300	6503	SO:0001819	synonymous_variant	10969	exon4			ACATTGCTTCAGG	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.162G>A	chr1.hg19:g.43637311C>T		75.0	0.0	.		101.0	37.0	.	NM_001159936	Q96A66	Silent	SNP	ENST00000236051.2	hg19	CCDS478.1																																																																																			.	.	.	none		0.527	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		
NRD1	4898	hgsc.bcm.edu	37	1	52277743	52277743	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:52277743T>C	ENST00000354831.7	-	17	2095	c.1906A>G	c.(1906-1908)Atg>Gtg	p.M636V	NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000544028.1_Missense_Mutation_p.M436V|NRD1_ENST00000539524.1_Missense_Mutation_p.M504V|NRD1_ENST00000352171.7_Missense_Mutation_p.M568V	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	567					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TTCTCACACATGTTTTCCACA	0.368																																					p.M636V		Atlas-SNP	.											.	NRD1	89	.	0			c.A1906G						PASS	.						140.0	127.0	131.0					1																	52277743		2203	4300	6503	SO:0001583	missense	4898	exon17			CACACATGTTTTC	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.1906A>G	chr1.hg19:g.52277743T>C	ENSP00000346890:p.Met636Val	85.0	0.0	.		89.0	31.0	.	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.945|8.945	0.966856|0.966856	0.18659|0.18659	.|.	.|.	ENSG00000078618|ENSG00000078618	ENST00000440943|ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169;ENST00000544028	.|T;T;T;T	.|0.27720	.|1.65;1.66;1.66;1.66	5.98|5.98	4.85|4.85	0.62838|0.62838	.|Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	.|0.175165	.|0.64402	.|D	.|0.000009	T|T	0.12050|0.12050	0.0293|0.0293	N|N	0.01297|0.01297	-0.9|-0.9	0.35327|0.35327	D|D	0.785267|0.785267	.|B;B;B	.|0.13145	.|0.004;0.003;0.007	.|B;B;B	.|0.06405	.|0.002;0.001;0.001	T|T	0.09907|0.09907	-1.0653|-1.0653	5|10	.|0.30854	.|T	.|0.27	-5.3765|-5.3765	12.8858|12.8858	0.58042|0.58042	0.0:0.0:0.3186:0.6814|0.0:0.0:0.3186:0.6814	.|.	.|568;567;636	.|F5H6R2;O43847;B1AKJ5	.|.;NRDC_HUMAN;.	R|V	22|568;636;504;38;568;436	.|ENSP00000262679:M568V;ENSP00000346890:M636V;ENSP00000444416:M504V;ENSP00000442262:M436V	.|ENSP00000262679:M568V	H|M	-|-	2|1	0|0	NRD1|NRD1	52050331|52050331	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.668000|2.668000	0.46816|0.46816	1.068000|1.068000	0.40764|0.40764	0.528000|0.528000	0.53228|0.53228	CAT|ATG	.	.	.	none		0.368	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
LRRC8D	55144	hgsc.bcm.edu	37	1	90399387	90399387	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:90399387A>C	ENST00000337338.5	+	3	1167	c.760A>C	c.(760-762)Atc>Ctc	p.I254L	LRRC8D_ENST00000394593.3_Missense_Mutation_p.I254L	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	254					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TACACCAATGATCAATAAAAC	0.463																																					p.I254L		Atlas-SNP	.											.	LRRC8D	78	.	0			c.A760C						PASS	.						49.0	47.0	48.0					1																	90399387		2203	4300	6503	SO:0001583	missense	55144	exon3			CCAATGATCAATA	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.760A>C	chr1.hg19:g.90399387A>C	ENSP00000338887:p.Ile254Leu	48.0	0.0	.		52.0	20.0	.	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	ENST00000337338.5	hg19	CCDS726.1	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.467060	0.01053	.	.	ENSG00000171492	ENST00000337338;ENST00000394593;ENST00000441269	T;T;T	0.39229	1.67;1.67;1.09	5.88	5.88	0.94601	.	0.132704	0.47093	D	0.000259	T	0.04679	0.0127	N	0.00186	-1.895	0.40496	D	0.980591	B	0.02656	0.0	B	0.01281	0.0	T	0.34750	-0.9816	9	.	.	.	.	16.3009	0.82811	1.0:0.0:0.0:0.0	.	254	Q7L1W4	LRC8D_HUMAN	L	254	ENSP00000338887:I254L;ENSP00000378093:I254L;ENSP00000405784:I254L	.	I	+	1	0	LRRC8D	90171975	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.832000	0.55783	2.246000	0.74042	0.533000	0.62120	ATC	.	.	.	none		0.463	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
PTBP2	58155	hgsc.bcm.edu	37	1	97278858	97278858	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:97278858T>C	ENST00000426398.2	+	14	1536	c.1493T>C	c.(1492-1494)aTg>aCg	p.M498T	PTBP2_ENST00000370197.1_Missense_Mutation_p.M504T|PTBP2_ENST00000609116.1_Missense_Mutation_p.M499T|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000370198.1_Missense_Mutation_p.M503T|PTBP2_ENST00000394184.3_Missense_Mutation_p.M515T|PTBP2_ENST00000541987.1_3'UTR	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	498	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		CTTCTTCAGATGGCAACAGTG	0.338																																					p.M498T		Atlas-SNP	.											.	PTBP2	62	.	0			c.T1493C						PASS	.						69.0	77.0	75.0					1																	97278858		2203	4300	6503	SO:0001583	missense	58155	exon14			TTCAGATGGCAAC	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.1493T>C	chr1.hg19:g.97278858T>C	ENSP00000412788:p.Met498Thr	251.0	0.0	.		247.0	79.0	.	NM_021190	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	hg19	CCDS754.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.282184	0.80692	.	.	ENSG00000117569	ENST00000236228;ENST00000543738;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184	T;T;T;T;T	0.09538	2.97;2.97;2.97;2.97;2.97	5.5	5.5	0.81552	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.38983	0.1061	H	0.95745	3.715	0.80722	D	1	P;P;P;P;B;B;P	0.48694	0.891;0.914;0.66;0.894;0.354;0.059;0.868	D;D;D;D;P;P;D	0.70716	0.966;0.97;0.933;0.949;0.772;0.732;0.93	T	0.54827	-0.8235	10	0.87932	D	0	-4.0584	15.8942	0.79323	0.0:0.0:0.0:1.0	.	507;515;171;503;498;499;504	B4DSU5;B4DSS8;B4DSI2;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3	.;.;.;.;PTBP2_HUMAN;.;.	T	499;171;503;504;498;515	ENSP00000236228:M499T;ENSP00000359217:M503T;ENSP00000359216:M504T;ENSP00000412788:M498T;ENSP00000377738:M515T	ENSP00000236228:M499T	M	+	2	0	PTBP2	97051446	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.993000	0.88291	2.206000	0.71126	0.528000	0.53228	ATG	.	.	.	none		0.338	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1		
MAGI3	260425	hgsc.bcm.edu	37	1	114184618	114184618	+	Silent	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:114184618C>T	ENST00000307546.9	+	10	1521	c.1446C>T	c.(1444-1446)gtC>gtT	p.V482V	MAGI3_ENST00000369615.1_Silent_p.V482V|MAGI3_ENST00000369617.4_Silent_p.V507V|MAGI3_ENST00000369611.4_Silent_p.V482V	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	507	Interaction with PTEN.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGTACCTGTCAATCAGTATG	0.428																																					p.V482V		Atlas-SNP	.											.	MAGI3	181	.	0			c.C1446T						PASS	.						218.0	189.0	199.0					1																	114184618		2203	4300	6503	SO:0001819	synonymous_variant	260425	exon10			ACCTGTCAATCAG	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1446C>T	chr1.hg19:g.114184618C>T		69.0	0.0	.		79.0	29.0	.	NM_152900	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Silent	SNP	ENST00000307546.9	hg19	CCDS44196.1																																																																																			.	.	.	none		0.428	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900	
ITGA10	8515	hgsc.bcm.edu	37	1	145525111	145525111	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:145525111C>A	ENST00000369304.3	+	1	221	c.46C>A	c.(46-48)Ctg>Atg	p.L16M	ITGA10_ENST00000539363.1_Missense_Mutation_p.L16M|ITGA10_ENST00000538811.1_5'UTR	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	16					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCTGGTGTTCCTGACAGGTGA	0.468											OREG0013749	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L16M		Atlas-SNP	.											.	ITGA10	131	.	0			c.C46A						PASS	.						221.0	186.0	197.0					1																	145525111		2203	4300	6503	SO:0001583	missense	8515	exon1			GTGTTCCTGACAG	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.46C>A	chr1.hg19:g.145525111C>A	ENSP00000358310:p.Leu16Met	105.0	0.0	.	1695	109.0	24.0	.	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	hg19	CCDS918.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077591	0.76528	.	.	ENSG00000143127	ENST00000369304;ENST00000539363	T;T	0.61274	0.12;0.29	5.43	5.43	0.79202	.	0.210074	0.29956	N	0.010776	T	0.65270	0.2675	L	0.55990	1.75	0.80722	D	1	D;B;D	0.76494	0.998;0.074;0.999	D;B;D	0.85130	0.994;0.031;0.997	T	0.63501	-0.6623	10	0.46703	T	0.11	.	14.599	0.68427	0.0:1.0:0.0:0.0	.	16;16;16	B2RTV5;O75578;O75578-2	.;ITA10_HUMAN;.	M	16	ENSP00000358310:L16M;ENSP00000439894:L16M	ENSP00000358310:L16M	L	+	1	2	ITGA10	144236468	0.999000	0.42202	0.998000	0.56505	0.899000	0.52679	1.993000	0.40747	2.825000	0.97269	0.655000	0.94253	CTG	.	.	.	none		0.468	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
SNX27	81609	hgsc.bcm.edu	37	1	151611491	151611491	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:151611491G>C	ENST00000458013.2	+	2	559	c.439G>C	c.(439-441)Gac>Cac	p.D147H	SNX27_ENST00000368838.1_Missense_Mutation_p.D54H|SNX27_ENST00000368843.3_Missense_Mutation_p.D147H			Q96L92	SNX27_HUMAN	sorting nexin family member 27	147					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGATCCCAGTGACGACTCGTT	0.468																																					p.D147H	Colon(46;291 966 40145 41237 41888)	Atlas-SNP	.											.	SNX27	44	.	0			c.G439C						PASS	.						134.0	118.0	124.0					1																	151611491		2203	4300	6503	SO:0001583	missense	81609	exon2			CCCAGTGACGACT	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.439G>C	chr1.hg19:g.151611491G>C	ENSP00000400333:p.Asp147His	62.0	0.0	.		84.0	30.0	.	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	ENST00000458013.2	hg19		.	.	.	.	.	.	.	.	.	.	G	21.4	4.140324	0.77775	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.53640	0.61;0.62;0.81	4.49	4.49	0.54785	Phox homologous domain (1);PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.55353	0.1915	M	0.64404	1.975	0.80722	D	1	D;D	0.69078	0.989;0.997	P;P	0.61477	0.838;0.889	T	0.60505	-0.7250	10	0.66056	D	0.02	.	15.8961	0.79336	0.0:0.0:1.0:0.0	.	147;147	Q96L92;Q96L92-3	SNX27_HUMAN;.	H	147;147;54	ENSP00000400333:D147H;ENSP00000357836:D147H;ENSP00000357831:D54H	ENSP00000357831:D54H	D	+	1	0	SNX27	149878115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.235000	0.95353	2.331000	0.79229	0.591000	0.81541	GAC	.	.	.	none		0.468	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
TDRD10	126668	hgsc.bcm.edu	37	1	154520167	154520167	+	3'UTR	SNP	A	A	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:154520167A>T	ENST00000368480.3	+	0	1320				TDRD10_ENST00000368482.4_Missense_Mutation_p.K346M|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10								nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CACATCCTAAAGTTTGAAGAG	0.527																																					p.K346M		Atlas-SNP	.											.	TDRD10	48	.	0			c.A1037T						PASS	.						107.0	103.0	104.0					1																	154520167		2203	4300	6503	SO:0001624	3_prime_UTR_variant	126668	exon13			TCCTAAAGTTTGA	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.*134A>T	chr1.hg19:g.154520167A>T		148.0	0.0	.		173.0	68.0	.	NM_182499	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	hg19	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.753359	0.49362	.	.	ENSG00000163239	ENST00000368482	T	0.31769	1.48	4.9	1.07	0.20283	.	.	.	.	.	T	0.08403	0.0209	.	.	.	0.26631	N	0.972462	P	0.37955	0.612	B	0.37692	0.256	T	0.22208	-1.0223	8	0.35671	T	0.21	.	5.9611	0.19301	0.5122:0.3295:0.0:0.1583	.	346	Q5VZ19-2	.	M	346	ENSP00000357467:K346M	ENSP00000357467:K346M	K	+	2	0	TDRD10	152786791	0.022000	0.18835	0.030000	0.17652	0.002000	0.02628	0.010000	0.13242	0.068000	0.16574	-0.313000	0.08912	AAG	.	.	.	none		0.527	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
SLC30A1	7779	hgsc.bcm.edu	37	1	211751453	211751453	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:211751453T>C	ENST00000367001.4	-	1	631	c.502A>G	c.(502-504)Acc>Gcc	p.T168A		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	168					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		CCGGGGCGGGTGCTCTTAACG	0.701																																					p.T168A		Atlas-SNP	.											.	SLC30A1	27	.	0			c.A502G						PASS	.						17.0	20.0	19.0					1																	211751453		2198	4295	6493	SO:0001583	missense	7779	exon1			GGCGGGTGCTCTT	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.502A>G	chr1.hg19:g.211751453T>C	ENSP00000355968:p.Thr168Ala	34.0	0.0	.		43.0	18.0	.	NM_021194	Q0VAK9|Q9BZF6	Missense_Mutation	SNP	ENST00000367001.4	hg19	CCDS1499.1	.	.	.	.	.	.	.	.	.	.	T	7.932	0.740859	0.15642	.	.	ENSG00000170385	ENST00000367001	T	0.63255	-0.03	4.13	-5.39	0.02664	.	3.281300	0.00751	N	0.001077	T	0.28732	0.0712	N	0.01242	-0.935	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39860	-0.9593	10	0.08837	T	0.75	1.0089	9.0099	0.36135	0.0:0.5305:0.2346:0.2349	.	168	Q9Y6M5	ZNT1_HUMAN	A	168	ENSP00000355968:T168A	ENSP00000355968:T168A	T	-	1	0	SLC30A1	209818076	0.000000	0.05858	0.004000	0.12327	0.024000	0.10985	-1.009000	0.03660	-0.892000	0.03935	-0.624000	0.04008	ACC	.	.	.	none		0.701	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
NSL1	25936	hgsc.bcm.edu	37	1	212960912	212960912	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:212960912T>C	ENST00000366977.3	-	2	320	c.302A>G	c.(301-303)aAt>aGt	p.N101S	NSL1_ENST00000366975.6_Missense_Mutation_p.N101S|NSL1_ENST00000366976.1_Missense_Mutation_p.N101S|NSL1_ENST00000473995.1_5'UTR|NSL1_ENST00000422588.2_Missense_Mutation_p.N101S|NSL1_ENST00000366978.1_5'UTR	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	101					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		CATAAAACAATTATCTGAAGC	0.328																																					p.N101S		Atlas-SNP	.											.	NSL1	24	.	0			c.A302G						PASS	.						86.0	84.0	85.0					1																	212960912		2203	4300	6503	SO:0001583	missense	25936	exon2			AAACAATTATCTG	AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.302A>G	chr1.hg19:g.212960912T>C	ENSP00000355944:p.Asn101Ser	219.0	0.0	.		272.0	92.0	.	NM_015471	E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	ENST00000366977.3	hg19	CCDS1509.1	.	.	.	.	.	.	.	.	.	.	T	2.442	-0.328274	0.05314	.	.	ENSG00000117697	ENST00000366977;ENST00000422588;ENST00000366975;ENST00000366976	T;T;T;T	0.43688	1.56;0.94;1.61;0.97	4.7	2.37	0.29283	.	0.833602	0.11159	N	0.593288	T	0.18509	0.0444	N	0.03115	-0.41	0.09310	N	1	B;B;B	0.14438	0.003;0.003;0.01	B;B;B	0.17098	0.008;0.008;0.017	T	0.29027	-1.0025	10	0.21014	T	0.42	-0.3034	6.3421	0.21328	0.0:0.2038:0.0:0.7962	.	101;101;101	B4E071;Q96IY1;E7ETD5	.;NSL1_HUMAN;.	S	101	ENSP00000355944:N101S;ENSP00000388406:N101S;ENSP00000355942:N101S;ENSP00000355943:N101S	ENSP00000355942:N101S	N	-	2	0	NSL1	211027535	0.000000	0.05858	0.002000	0.10522	0.953000	0.61014	-0.221000	0.09202	0.263000	0.21812	0.533000	0.62120	AAT	.	.	.	none		0.328	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089398.2	NM_015471	
OR2L5	81466	hgsc.bcm.edu	37	1	248186098	248186098	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:248186098G>T	ENST00000355281.1	+	1	849	c.849G>T	c.(847-849)atG>atT	p.M283I	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TCACCCCAATGCTCAACCCCA	0.478																																					p.M283I		Atlas-SNP	.											.	.	.	.	0			c.G849T						PASS	.																																			SO:0001583	missense	81466	exon1			CCCAATGCTCAAC		CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.849G>T	chr1.hg19:g.248186098G>T	ENSP00000347428:p.Met283Ile	53.0	0.0	.		62.0	19.0	.	NM_001258284	Q6IF04	Missense_Mutation	SNP	ENST00000355281.1	hg19	CCDS58068.1	.	.	.	.	.	.	.	.	.	.	.	6.210	0.406895	0.11754	.	.	ENSG00000197454	ENST00000355281	T	0.37411	1.2	2.17	1.13	0.20643	.	.	.	.	.	T	0.34048	0.0884	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31364	-0.9946	6	0.66056	D	0.02	.	5.1487	0.14998	0.0:0.2309:0.5339:0.2351	.	.	.	.	I	283	ENSP00000347428:M283I	ENSP00000347428:M283I	M	+	3	0	OR2L5	246252721	0.006000	0.16342	0.077000	0.20336	0.666000	0.39218	-0.004000	0.12878	0.055000	0.16094	0.184000	0.17185	ATG	.	.	.	none		0.478	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096851.1		
GRHL1	29841	hgsc.bcm.edu	37	2	10140748	10140748	+	Silent	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:10140748T>C	ENST00000324907.9	+	16	1906	c.1770T>C	c.(1768-1770)atT>atC	p.I590I	GRHL1_ENST00000324883.5_Silent_p.I401I|GRHL1_ENST00000480736.1_Silent_p.I44I|AC010969.1_ENST00000340444.1_RNA|GRHL1_ENST00000405379.2_Silent_p.I590I	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	590					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		ACGACAACATTGTGAAGCATT	0.542																																					p.I590I		Atlas-SNP	.											.	GRHL1	95	.	0			c.T1770C						PASS	.						209.0	212.0	211.0					2																	10140748		2203	4300	6503	SO:0001819	synonymous_variant	29841	exon16			CAACATTGTGAAG	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1770T>C	chr2.hg19:g.10140748T>C		45.0	0.0	.		52.0	22.0	.	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Silent	SNP	ENST00000324907.9	hg19	CCDS33144.2																																																																																			.	.	.	none		0.542	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
NBAS	51594	hgsc.bcm.edu	37	2	15415752	15415752	+	Silent	SNP	A	A	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:15415752A>T	ENST00000281513.5	-	44	5605	c.5580T>A	c.(5578-5580)ccT>ccA	p.P1860P	NBAS_ENST00000441750.1_Silent_p.P1740P	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1860					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.P1860P(1)		NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TAATGAGATGAGGGTCTCCAG	0.483																																					p.P1860P		Atlas-SNP	.											NBAS,rectum,NS,0,1	NBAS	246	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T5580A						PASS	.						109.0	107.0	108.0					2																	15415752		2203	4300	6503	SO:0001819	synonymous_variant	51594	exon44			GAGATGAGGGTCT	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5580T>A	chr2.hg19:g.15415752A>T		84.0	1.0	.		93.0	43.0	.	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	hg19	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.327219	0.24080	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.57	1.78	0.24846	.	.	.	.	.	T	0.53867	0.1823	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44050	-0.9353	4	.	.	.	.	6.1768	0.20449	0.574:0.3101:0.1159:0.0	.	.	.	.	H	908	.	.	L	-	2	0	NBAS	15333203	0.802000	0.28943	1.000000	0.80357	0.972000	0.66771	-0.088000	0.11198	0.457000	0.26962	0.482000	0.46254	CTC	.	.	.	none		0.483	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
SMC6	79677	hgsc.bcm.edu	37	2	17881504	17881504	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:17881504G>A	ENST00000448223.2	-	21	2634	c.2365C>T	c.(2365-2367)Caa>Taa	p.Q789*	SMC6_ENST00000351948.4_Nonsense_Mutation_p.Q789*|SMC6_ENST00000402989.1_Nonsense_Mutation_p.Q789*|SMC6_ENST00000381272.4_Nonsense_Mutation_p.Q815*	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	789					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TCCGATAGTTGATTAATTTTG	0.303																																					p.Q789X		Atlas-SNP	.											.	SMC6	102	.	0			c.C2365T						PASS	.						144.0	140.0	141.0					2																	17881504		2202	4296	6498	SO:0001587	stop_gained	79677	exon21			ATAGTTGATTAAT	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.2365C>T	chr2.hg19:g.17881504G>A	ENSP00000404092:p.Gln789*	279.0	1.0	.		290.0	123.0	.	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Nonsense_Mutation	SNP	ENST00000448223.2	hg19	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	G	41	8.532883	0.98852	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989	.	.	.	5.0	5.0	0.66597	.	0.577318	0.18021	N	0.154256	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	11.8172	0.52218	0.0818:0.0:0.9182:0.0	.	.	.	.	X	789;789;815;789	.	ENSP00000323439:Q789X	Q	-	1	0	SMC6	17744985	1.000000	0.71417	0.987000	0.45799	0.865000	0.49528	4.865000	0.62998	2.520000	0.84964	0.585000	0.79938	CAA	.	.	.	none		0.303	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
SRBD1	55133	hgsc.bcm.edu	37	2	45645662	45645662	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:45645662A>C	ENST00000263736.4	-	18	2237	c.2175T>G	c.(2173-2175)aaT>aaG	p.N725K	SRBD1_ENST00000490133.1_5'UTR|SRBD1_ENST00000535761.1_Missense_Mutation_p.N244K	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	725					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CCCTGTTGGCATTGAGTCCTG	0.363																																					p.N725K		Atlas-SNP	.											.	SRBD1	107	.	0			c.T2175G						PASS	.						153.0	110.0	125.0					2																	45645662		2203	4300	6503	SO:0001583	missense	55133	exon18			GTTGGCATTGAGT	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2175T>G	chr2.hg19:g.45645662A>C	ENSP00000263736:p.Asn725Lys	93.0	0.0	.		140.0	54.0	.	NM_018079	Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	hg19	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.073946	0.76415	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	T;T	0.32515	1.78;1.45	5.86	3.53	0.40419	Tex RuvX-like domain (1);	0.000000	0.85682	D	0.000000	T	0.40839	0.1133	L	0.49699	1.58	0.54753	D	0.999984	D	0.54397	0.966	P	0.56865	0.808	T	0.28522	-1.0041	10	0.87932	D	0	.	9.8085	0.40808	0.8618:0.0:0.1382:0.0	.	725	Q8N5C6	SRBD1_HUMAN	K	725;244	ENSP00000263736:N725K;ENSP00000441272:N244K	ENSP00000263736:N725K	N	-	3	2	SRBD1	45499166	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.102000	0.57776	1.061000	0.40601	0.524000	0.50904	AAT	.	.	.	none		0.363	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
SPTBN1	6711	hgsc.bcm.edu	37	2	54874386	54874386	+	Missense_Mutation	SNP	G	G	C	rs200274009		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:54874386G>C	ENST00000356805.4	+	24	5266	c.4985G>C	c.(4984-4986)aGc>aCc	p.S1662T	SPTBN1_ENST00000333896.5_Missense_Mutation_p.S1649T	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1662	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GTGGCCGACAGCCATCCTGAA	0.542																																					p.S1662T		Atlas-SNP	.											.	SPTBN1	378	.	0			c.G4985C						PASS	.						77.0	79.0	78.0					2																	54874386		2203	4300	6503	SO:0001583	missense	6711	exon24			CCGACAGCCATCC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.4985G>C	chr2.hg19:g.54874386G>C	ENSP00000349259:p.Ser1662Thr	23.0	0.0	.		31.0	14.0	.	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893188	0.52121	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.67523	-0.27;0.71	5.66	4.68	0.58851	.	0.333582	0.36167	N	0.002746	T	0.49830	0.1580	N	0.24115	0.695	0.28355	N	0.920718	B;B	0.19935	0.032;0.04	B;B	0.25614	0.062;0.045	T	0.42799	-0.9430	10	0.52906	T	0.07	.	6.8223	0.23864	0.2001:0.0:0.7999:0.0	.	1649;1662	Q01082-3;Q01082	.;SPTB2_HUMAN	T	1662;1649	ENSP00000349259:S1662T;ENSP00000334156:S1649T	ENSP00000334156:S1649T	S	+	2	0	SPTBN1	54727890	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.003000	0.49505	2.689000	0.91719	0.591000	0.81541	AGC	.	G|1.000;A|0.000	.	alt		0.542	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
ITGA6	3655	hgsc.bcm.edu	37	2	173349951	173349951	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:173349951C>T	ENST00000264106.6	+	14	2133	c.1930C>T	c.(1930-1932)Cca>Tca	p.P644S	ITGA6_ENST00000375221.2_Missense_Mutation_p.P644S|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000409532.1_Missense_Mutation_p.P486S|ITGA6_ENST00000343713.4_Missense_Mutation_p.P600S|ITGA6_ENST00000409080.1_Missense_Mutation_p.P605S|ITGA6_ENST00000264107.7_Missense_Mutation_p.P605S			P23229	ITA6_HUMAN	integrin, alpha 6	644					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AGAAGTTCTTCCAATTCTGAA	0.403																																					p.P605S		Atlas-SNP	.											.	ITGA6	171	.	0			c.C1813T						PASS	.						95.0	96.0	96.0					2																	173349951		2203	4300	6503	SO:0001583	missense	3655	exon13			GTTCTTCCAATTC		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1930C>T	chr2.hg19:g.173349951C>T	ENSP00000264106:p.Pro644Ser	154.0	0.0	.		157.0	68.0	.	NM_000210	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	ENST00000264106.6	hg19		.	.	.	.	.	.	.	.	.	.	C	26.4	4.729408	0.89390	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.90504	0.7025	M	0.89904	3.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92409	0.5936	10	0.87932	D	0	.	18.4111	0.90550	0.0:1.0:0.0:0.0	.	600;644;605;605	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	S	486;605;644;644;600;605;644;600	ENSP00000386614:P486S;ENSP00000264107:P605S;ENSP00000264106:P644S;ENSP00000364369:P644S;ENSP00000341078:P600S;ENSP00000386896:P605S;ENSP00000406694:P644S;ENSP00000394169:P600S	ENSP00000264106:P644S	P	+	1	0	ITGA6	173058197	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.497000	0.73674	2.437000	0.82529	0.655000	0.94253	CCA	.	.	.	none		0.403	ITGA6-201	KNOWN	basic	protein_coding	protein_coding			
NAB1	4664	hgsc.bcm.edu	37	2	191524460	191524460	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:191524460G>T	ENST00000337386.5	+	4	1019	c.558G>T	c.(556-558)gaG>gaT	p.E186D	NAB1_ENST00000357215.5_Missense_Mutation_p.E186D|NAB1_ENST00000409581.1_Missense_Mutation_p.E186D|NAB1_ENST00000545490.1_5'Flank|NAB1_ENST00000409641.1_Missense_Mutation_p.E186D	NM_005966.3	NP_005957.2	Q13506	NAB1_HUMAN	NGFI-A binding protein 1 (EGR1 binding protein 1)	186					endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			CCCCAAAGGAGAGCAGTGAGG	0.607																																					p.E186D		Atlas-SNP	.											.	NAB1	31	.	0			c.G558T						PASS	.						32.0	33.0	33.0					2																	191524460		2203	4300	6503	SO:0001583	missense	4664	exon4			AAAGGAGAGCAGT		CCDS2307.1	2q32.3-q33	2008-05-23			ENSG00000138386	ENSG00000138386			7626	protein-coding gene	gene with protein product	"""EGR1 binding protein 1"""	600800				7624335, 8668170, 9418898	Standard	XM_005246579		Approved		uc002usb.3	Q13506	OTTHUMG00000132689	ENST00000337386.5:c.558G>T	chr2.hg19:g.191524460G>T	ENSP00000336894:p.Glu186Asp	79.0	0.0	.		77.0	33.0	.	NM_005966	O75383|O75384|Q6GTU1|Q9UEV1	Missense_Mutation	SNP	ENST00000337386.5	hg19	CCDS2307.1	.	.	.	.	.	.	.	.	.	.	G	6.327	0.428405	0.11987	.	.	ENSG00000138386	ENST00000409581;ENST00000337386;ENST00000357215;ENST00000409641	.	.	.	5.51	-7.42	0.01388	NAB co-repressor, domain (1);	0.097440	0.64402	N	0.000001	T	0.12603	0.0306	N	0.01800	-0.715	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.004;0.005;0.005	T	0.20706	-1.0267	9	0.12766	T	0.61	-13.235	6.2518	0.20850	0.2258:0.0931:0.4985:0.1826	.	186;186;186	F8W8J7;B8ZZS2;Q13506	.;.;NAB1_HUMAN	D	186	.	ENSP00000336894:E186D	E	+	3	2	NAB1	191232705	0.012000	0.17670	0.740000	0.30986	0.983000	0.72400	-0.752000	0.04797	-1.363000	0.02164	-0.367000	0.07326	GAG	.	.	.	none		0.607	NAB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255986.1	NM_005966	
TMBIM1	64114	hgsc.bcm.edu	37	2	219140208	219140208	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:219140208T>C	ENST00000444881.1	-	13	1651	c.926A>G	c.(925-927)gAt>gGt	p.D309G	PNKD_ENST00000273077.4_Intron|TMBIM1_ENST00000396809.2_Missense_Mutation_p.D309G|TMBIM1_ENST00000445635.1_Missense_Mutation_p.D135G|PNKD_ENST00000472650.1_Intron|TMBIM1_ENST00000258412.3_Missense_Mutation_p.D309G			Q969X1	LFG3_HUMAN	transmembrane BAX inhibitor motif containing 1	309					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of Fas signaling pathway (GO:1902045)|negative regulation of metalloenzyme activity (GO:0048553)|positive regulation of blood vessel remodeling (GO:2000504)	endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	death receptor binding (GO:0005123)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(2)	9		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTAATTGCGATCCCCCATCAG	0.567																																					p.D309G		Atlas-SNP	.											.	TMBIM1	20	.	0			c.A926G						PASS	.						141.0	127.0	132.0					2																	219140208		2203	4300	6503	SO:0001583	missense	64114	exon12			TTGCGATCCCCCA	BN000408	CCDS2412.1	2q35	2010-03-18			ENSG00000135926	ENSG00000135926			23410	protein-coding gene	gene with protein product		610364				12477932	Standard	NM_022152		Approved	PP1201, RECS1, LFG3	uc002vhp.1	Q969X1	OTTHUMG00000133105	ENST00000444881.1:c.926A>G	chr2.hg19:g.219140208T>C	ENSP00000409738:p.Asp309Gly	25.0	0.0	.		36.0	14.0	.	NM_022152	B3KQY6|Q8N1R3|Q8TAM3|Q96K13	Missense_Mutation	SNP	ENST00000444881.1	hg19	CCDS2412.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.238335	0.39598	.	.	ENSG00000135926	ENST00000258412;ENST00000444881;ENST00000396809;ENST00000445635;ENST00000543441	T;T;T	0.22945	1.93;1.93;1.93	5.28	-0.281	0.12882	.	1.212450	0.05241	N	0.512237	T	0.12603	0.0306	N	0.04787	-0.16	0.09310	N	1	B;B	0.17465	0.022;0.001	B;B	0.14023	0.01;0.001	T	0.29427	-1.0012	10	0.33141	T	0.24	-0.4623	6.4147	0.21710	0.0:0.4821:0.1591:0.3587	.	247;309	B4DNZ1;Q969X1	.;TMBI1_HUMAN	G	309;309;309;135;247	ENSP00000258412:D309G;ENSP00000409738:D309G;ENSP00000380025:D309G	ENSP00000258412:D309G	D	-	2	0	TMBIM1	218848452	0.000000	0.05858	0.003000	0.11579	0.968000	0.65278	-0.049000	0.11924	-0.168000	0.10853	0.533000	0.62120	GAT	.	.	.	none		0.567	TMBIM1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338559.1	NM_022152	
TRIP12	9320	hgsc.bcm.edu	37	2	230659907	230659907	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:230659907C>T	ENST00000283943.5	-	25	3909	c.3731G>A	c.(3730-3732)gGg>gAg	p.G1244E	TRIP12_ENST00000389044.4_Missense_Mutation_p.G1292E|TRIP12_ENST00000389045.3_Missense_Mutation_p.G974E	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1244					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GCCTCCTGTCCCATTTCCACT	0.448																																					p.G1244E		Atlas-SNP	.											.	TRIP12	207	.	0			c.G3731A						PASS	.						126.0	113.0	118.0					2																	230659907		2203	4300	6503	SO:0001583	missense	9320	exon25			CCTGTCCCATTTC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3731G>A	chr2.hg19:g.230659907C>T	ENSP00000283943:p.Gly1244Glu	71.0	0.0	.		55.0	16.0	.	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	hg19	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.034386	0.93575	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.50277	0.76;1.12;0.75	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.67144	0.2862	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.963;0.996	T	0.67356	-0.5691	10	0.72032	D	0.01	.	19.9433	0.97172	0.0:1.0:0.0:0.0	.	974;1292;1244	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	E	1244;974;1292	ENSP00000283943:G1244E;ENSP00000373697:G974E;ENSP00000373696:G1292E	ENSP00000283943:G1244E	G	-	2	0	TRIP12	230368151	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.365000	0.79537	2.716000	0.92895	0.655000	0.94253	GGG	.	.	.	none		0.448	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
KLHL30	377007	hgsc.bcm.edu	37	2	239057702	239057702	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:239057702G>C	ENST00000409223.1	+	7	1501	c.1394G>C	c.(1393-1395)cGc>cCc	p.R465P	KLHL30_ENST00000305959.4_Missense_Mutation_p.R447P			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	465										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		TCCTCGCCTCGCTGTGCTGCA	0.652																																					p.R465P		Atlas-SNP	.											KLHL30_ENST00000409223,right_upper_lobe,carcinoma,0,2	KLHL30	79	.	0			c.G1394C						PASS	.						74.0	89.0	84.0					2																	239057702		2165	4251	6416	SO:0001583	missense	377007	exon7			CGCCTCGCTGTGC		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1394G>C	chr2.hg19:g.239057702G>C	ENSP00000386389:p.Arg465Pro	15.0	0.0	.		29.0	13.0	.	NM_198582	Q6ZUS1	Missense_Mutation	SNP	ENST00000409223.1	hg19	CCDS46555.2	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464502	0.63513	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	T;T	0.65549	-0.16;-0.16	4.49	4.49	0.54785	Kelch-type beta propeller (1);	0.059738	0.64402	D	0.000002	T	0.70307	0.3209	L	0.38531	1.155	0.54753	D	0.999985	D	0.76494	0.999	D	0.68353	0.957	T	0.73861	-0.3849	10	0.66056	D	0.02	.	16.0887	0.81076	0.0:0.0:1.0:0.0	.	465	Q0D2K2	KLH30_HUMAN	P	465;447	ENSP00000386389:R465P;ENSP00000302386:R447P	ENSP00000302386:R447P	R	+	2	0	KLHL30	238722441	1.000000	0.71417	0.988000	0.46212	0.189000	0.23516	9.102000	0.94226	2.327000	0.79052	0.491000	0.48974	CGC	.	.	.	none		0.652	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328518.1	NM_198582	
XYLB	9942	hgsc.bcm.edu	37	3	38408332	38408332	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr3:38408332C>A	ENST00000207870.3	+	7	631	c.541C>A	c.(541-543)Cag>Aag	p.Q181K	XYLB_ENST00000542835.1_Missense_Mutation_p.Q44K	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	181					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		AAAAATTTACCAGCAGAACCC	0.368																																					p.Q181K		Atlas-SNP	.											.	XYLB	50	.	0			c.C541A						PASS	.						85.0	86.0	86.0					3																	38408332		2203	4300	6503	SO:0001583	missense	9942	exon7			ATTTACCAGCAGA	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.541C>A	chr3.hg19:g.38408332C>A	ENSP00000207870:p.Gln181Lys	32.0	0.0	.		61.0	22.0	.	NM_005108	B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	ENST00000207870.3	hg19	CCDS2678.1	.	.	.	.	.	.	.	.	.	.	c	14.24	2.475111	0.43942	.	.	ENSG00000093217	ENST00000207870;ENST00000542835	T;T	0.16073	2.37;2.37	5.43	4.44	0.53790	Carbohydrate kinase, FGGY, N-terminal (1);	0.472911	0.23189	N	0.050929	T	0.11537	0.0281	N	0.21194	0.64	0.25694	N	0.98565	B;B	0.14012	0.009;0.0	B;B	0.21151	0.033;0.02	T	0.19516	-1.0303	10	0.15066	T	0.55	.	12.751	0.57308	0.1976:0.8024:0.0:0.0	.	44;181	B4DDT2;O75191	.;XYLB_HUMAN	K	181;44	ENSP00000207870:Q181K;ENSP00000443659:Q44K	ENSP00000207870:Q181K	Q	+	1	0	XYLB	38383336	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.763000	0.38461	2.727000	0.93392	0.550000	0.68814	CAG	.	.	.	none		0.368	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108	
QRICH1	54870	hgsc.bcm.edu	37	3	49114324	49114324	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr3:49114324G>A	ENST00000395443.2	-	2	599	c.127C>T	c.(127-129)Cag>Tag	p.Q43*	QRICH1_ENST00000424300.1_Nonsense_Mutation_p.Q43*|QRICH1_ENST00000357496.2_Nonsense_Mutation_p.Q43*	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	43	CARD.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGGAACTCCTGAAGGGCTTCT	0.527																																					p.Q43X		Atlas-SNP	.											.	QRICH1	48	.	0			c.C127T						PASS	.						124.0	115.0	118.0					3																	49114324		2203	4300	6503	SO:0001587	stop_gained	54870	exon2			ACTCCTGAAGGGC		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.127C>T	chr3.hg19:g.49114324G>A	ENSP00000378830:p.Gln43*	75.0	0.0	.		87.0	34.0	.	NM_198880	Q4G0F7|Q7L621|Q8TEA5	Nonsense_Mutation	SNP	ENST00000395443.2	hg19	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708717	0.68615	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300;ENST00000437939;ENST00000450685;ENST00000411682;ENST00000430979	.	.	.	5.62	5.62	0.85841	.	0.055405	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-2.293	19.653	0.95825	0.0:0.0:1.0:0.0	.	.	.	.	X	43	.	ENSP00000350094:Q43X	Q	-	1	0	QRICH1	49089328	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.658000	0.90341	0.655000	0.94253	CAG	.	.	.	none		0.527	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
CHST13	166012	hgsc.bcm.edu	37	3	126260730	126260730	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr3:126260730T>C	ENST00000319340.2	+	3	385	c.335T>C	c.(334-336)gTg>gCg	p.V112A		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	112					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		TACTGCTACGTGCCCAAGGTG	0.721																																					p.V112A		Atlas-SNP	.											.	CHST13	21	.	0			c.T335C						PASS	.						28.0	20.0	22.0					3																	126260730		2194	4286	6480	SO:0001583	missense	166012	exon3			GCTACGTGCCCAA	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.335T>C	chr3.hg19:g.126260730T>C	ENSP00000317404:p.Val112Ala	108.0	0.0	.		67.0	22.0	.	NM_152889	Q3SYA3|Q3SYA5	Missense_Mutation	SNP	ENST00000319340.2	hg19	CCDS3039.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.770907	0.90108	.	.	ENSG00000180767	ENST00000319340;ENST00000383575	D	0.82344	-1.6	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.92635	0.7660	M	0.93854	3.465	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	D	0.93994	0.7269	10	0.72032	D	0.01	-9.0677	12.3582	0.55188	0.0:0.0:0.0:1.0	.	112	Q8NET6	CHSTD_HUMAN	A	112	ENSP00000317404:V112A	ENSP00000317404:V112A	V	+	2	0	CHST13	127743420	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.670000	0.83925	1.806000	0.52798	0.402000	0.26972	GTG	.	.	.	none		0.721	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889	
WDFY3	23001	hgsc.bcm.edu	37	4	85758174	85758174	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr4:85758174C>G	ENST00000295888.4	-	7	891	c.484G>C	c.(484-486)Gac>Cac	p.D162H	WDFY3_ENST00000322366.6_Missense_Mutation_p.D162H	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	162					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGTGGAAGGTCAAAAAACAGA	0.428																																					p.D162H		Atlas-SNP	.											.	WDFY3	314	.	0			c.G484C						PASS	.						87.0	78.0	81.0					4																	85758174		2203	4300	6503	SO:0001583	missense	23001	exon7			GAAGGTCAAAAAA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.484G>C	chr4.hg19:g.85758174C>G	ENSP00000295888:p.Asp162His	213.0	0.0	.		239.0	88.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579583	0.86645	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.27104	1.69;1.69	5.76	4.91	0.64330	.	0.193997	0.52532	D	0.000064	T	0.53465	0.1798	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60500	-0.7251	10	0.87932	D	0	.	16.1206	0.81351	0.1349:0.8651:0.0:0.0	.	162;162	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	H	162	ENSP00000318466:D162H;ENSP00000295888:D162H	ENSP00000295888:D162H	D	-	1	0	WDFY3	85977198	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.666000	0.83877	1.406000	0.46857	0.455000	0.32223	GAC	.	.	.	none		0.428	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
FHDC1	85462	hgsc.bcm.edu	37	4	153897841	153897841	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr4:153897841C>T	ENST00000511601.1	+	12	3586	c.3398C>T	c.(3397-3399)aCg>aTg	p.T1133M	FHDC1_ENST00000260008.3_Missense_Mutation_p.T1133M			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	1133									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					AGTCGGACCACGCTGGGGAGA	0.627																																					p.T1133M		Atlas-SNP	.											.	FHDC1	102	.	0			c.C3398T						PASS	.						15.0	13.0	13.0					4																	153897841		2191	4282	6473	SO:0001583	missense	85462	exon11			GGACCACGCTGGG	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.3398C>T	chr4.hg19:g.153897841C>T	ENSP00000427567:p.Thr1133Met	39.0	0.0	.		38.0	14.0	.	NM_033393		Missense_Mutation	SNP	ENST00000511601.1	hg19	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.784330	0.70222	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.41758	0.99;0.99	5.39	5.39	0.77823	.	0.362675	0.26727	N	0.022801	T	0.49389	0.1554	L	0.29908	0.895	0.09310	N	0.999998	D	0.76494	0.999	P	0.56088	0.791	T	0.48055	-0.9068	10	0.87932	D	0	.	19.1456	0.93467	0.0:1.0:0.0:0.0	.	1133	Q9C0D6	FHDC1_HUMAN	M	1133	ENSP00000427567:T1133M;ENSP00000260008:T1133M	ENSP00000260008:T1133M	T	+	2	0	FHDC1	154117291	0.102000	0.21896	0.005000	0.12908	0.004000	0.04260	4.146000	0.58072	2.534000	0.85438	0.655000	0.94253	ACG	.	.	.	none		0.627	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
IQGAP2	10788	hgsc.bcm.edu	37	5	75970433	75970433	+	Silent	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr5:75970433C>T	ENST00000274364.6	+	27	3723	c.3426C>T	c.(3424-3426)gcC>gcT	p.A1142A	IQGAP2_ENST00000502745.1_Silent_p.A638A|IQGAP2_ENST00000379730.3_Silent_p.A644A|IQGAP2_ENST00000396234.3_Silent_p.A638A	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1142	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GATCAGTGGCCAAGGTTCTTC	0.428																																					p.A1142A		Atlas-SNP	.											.	IQGAP2	186	.	0			c.C3426T						PASS	.						95.0	89.0	91.0					5																	75970433		2203	4300	6503	SO:0001819	synonymous_variant	10788	exon27			AGTGGCCAAGGTT	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3426C>T	chr5.hg19:g.75970433C>T		78.0	0.0	.		99.0	37.0	.	NM_006633	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	ENST00000274364.6	hg19	CCDS34188.1																																																																																			.	.	.	none		0.428	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
FEM1C	56929	hgsc.bcm.edu	37	5	114860103	114860103	+	Silent	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr5:114860103A>G	ENST00000274457.3	-	3	2317	c.1756T>C	c.(1756-1758)Ttg>Ctg	p.L586L		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	586					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		AGACACTGCAATGTGGTATGA	0.363																																					p.L586L		Atlas-SNP	.											.	FEM1C	50	.	0			c.T1756C						PASS	.						98.0	100.0	99.0					5																	114860103		2202	4300	6502	SO:0001819	synonymous_variant	56929	exon3			ACTGCAATGTGGT		CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1756T>C	chr5.hg19:g.114860103A>G		102.0	0.0	.		147.0	57.0	.	NM_020177	B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Silent	SNP	ENST00000274457.3	hg19	CCDS4118.1																																																																																			.	.	.	none		0.363	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250857.3	NM_020177	
PCDHA13	56136	hgsc.bcm.edu	37	5	140263609	140263609	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr5:140263609G>T	ENST00000289272.2	+	1	1756	c.1756G>T	c.(1756-1758)Ggt>Tgt	p.G586C	PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.G586C|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	586	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGTCGGTGGGTGCAGGCCA	0.697																																					p.G586C	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											PCDHA13,NS,carcinoma,0,1	PCDHA13	213	.	0			c.G1756T						PASS	.						57.0	63.0	61.0					5																	140263609		2202	4298	6500	SO:0001583	missense	56136	exon1			TCGGTGGGTGCAG	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1756G>T	chr5.hg19:g.140263609G>T	ENSP00000289272:p.Gly586Cys	54.0	0.0	.		59.0	20.0	.	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	hg19	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640074	0.29157	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.20463	2.07;2.07	4.21	4.21	0.49690	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.47229	0.1434	M	0.89414	3.03	0.22947	N	0.998528	D;D;D	0.71674	0.998;0.995;0.994	P;D;D	0.71870	0.886;0.944;0.975	T	0.43245	-0.9403	9	0.72032	D	0.01	.	5.8955	0.18937	0.1033:0.1979:0.6988:0.0	.	586;586;586	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	C	586	ENSP00000386821:G586C;ENSP00000289272:G586C	ENSP00000289272:G586C	G	+	1	0	PCDHA13	140243793	0.000000	0.05858	0.457000	0.27056	0.048000	0.14542	0.017000	0.13399	2.144000	0.66660	0.655000	0.94253	GGT	.	.	.	none		0.697	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
CLK4	57396	hgsc.bcm.edu	37	5	178045754	178045754	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr5:178045754T>C	ENST00000316308.4	-	3	355	c.187A>G	c.(187-189)Aat>Gat	p.N63D	RN7SKP70_ENST00000516655.1_RNA|CLK4_ENST00000522749.1_5'UTR	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	63					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TCTCGCTCATTCAAGGACCTT	0.368																																					p.N63D		Atlas-SNP	.											.	CLK4	103	.	0			c.A187G						PASS	.						102.0	95.0	97.0					5																	178045754		2203	4300	6503	SO:0001583	missense	57396	exon3			GCTCATTCAAGGA	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.187A>G	chr5.hg19:g.178045754T>C	ENSP00000316948:p.Asn63Asp	67.0	0.0	.		65.0	26.0	.	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	hg19	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	T	15.38	2.817846	0.50633	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.08008	3.14	5.87	4.67	0.58626	.	0.200770	0.51477	D	0.000085	T	0.21761	0.0524	M	0.75447	2.3	0.80722	D	1	P;D;P;D;D	0.69078	0.718;0.997;0.879;0.997;0.997	B;D;P;D;D	0.73380	0.107;0.98;0.482;0.98;0.98	T	0.13019	-1.0525	10	0.18710	T	0.47	.	6.6902	0.23167	0.153:0.0:0.1597:0.6873	.	63;63;63;63;63	B7Z990;B7ZL31;Q4G0Z5;B9EG64;Q9HAZ1	.;.;.;.;CLK4_HUMAN	D	63	ENSP00000316948:N63D	ENSP00000316948:N63D	N	-	1	0	CLK4	177978360	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.188000	0.42612	0.996000	0.38943	0.482000	0.46254	AAT	.	.	.	none		0.368	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
SLC22A7	10864	hgsc.bcm.edu	37	6	43269967	43269967	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr6:43269967T>C	ENST00000372585.5	+	8	1186	c.1091T>C	c.(1090-1092)cTg>cCg	p.L364P	SLC22A7_ENST00000372574.3_Missense_Mutation_p.L362P|SLC22A7_ENST00000372589.3_Missense_Mutation_p.L362P	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	364					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	TATTACGGCCTGAGTCTGGAT	0.572																																					p.L364P		Atlas-SNP	.											.	SLC22A7	69	.	0			c.T1091C						PASS	.						125.0	115.0	118.0					6																	43269967		2203	4300	6503	SO:0001583	missense	10864	exon7			ACGGCCTGAGTCT	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1091T>C	chr6.hg19:g.43269967T>C	ENSP00000361666:p.Leu364Pro	50.0	0.0	.		56.0	18.0	.	NM_153320	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	hg19	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987683	0.74589	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;T	0.70282	-0.08;-0.08;-0.08;-0.47	5.27	4.08	0.47627	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.280243	0.33092	N	0.005292	T	0.78886	0.4354	M	0.93062	3.375	0.80722	D	1	P;P;P	0.46621	0.881;0.855;0.855	P;P;P	0.56398	0.797;0.694;0.694	T	0.81929	-0.0708	10	0.87932	D	0	.	8.9149	0.35576	0.1813:0.0:0.0:0.8187	.	364;362;362	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	P	362;364;362;57	ENSP00000361670:L362P;ENSP00000361666:L364P;ENSP00000361655:L362P;ENSP00000393836:L57P	ENSP00000361655:L362P	L	+	2	0	SLC22A7	43377945	0.987000	0.35691	0.994000	0.49952	0.888000	0.51559	4.148000	0.58085	0.804000	0.34136	0.379000	0.24179	CTG	.	.	.	none		0.572	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
PKHD1	5314	hgsc.bcm.edu	37	6	51924726	51924726	+	Splice_Site	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr6:51924726C>A	ENST00000371117.3	-	15	1508	c.1233G>T	c.(1231-1233)aaG>aaT	p.K411N	PKHD1_ENST00000340994.4_Splice_Site_p.K411N|AL590391.1_ENST00000408630.2_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	411					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CAGTGAATACCTTAGTCCTTG	0.408																																					p.K411N		Atlas-SNP	.											.	PKHD1	927	.	0			c.G1233T						PASS	.						104.0	86.0	92.0					6																	51924726		2203	4300	6503	SO:0001630	splice_region_variant	5314	exon15			GAATACCTTAGTC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1233+1G>T	chr6.hg19:g.51924726C>A		33.0	0.0	.		33.0	8.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017046	0.75161	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88354	-2.37;-2.37	5.47	5.47	0.80525	.	0.074122	0.56097	D	0.000033	D	0.94351	0.8184	M	0.82823	2.61	0.42116	D	0.991401	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.93787	0.7089	9	.	.	.	.	18.6748	0.91525	0.0:1.0:0.0:0.0	.	411;411	P08F94-2;P08F94	.;PKHD1_HUMAN	N	411	ENSP00000360158:K411N;ENSP00000341097:K411N	.	K	-	3	2	PKHD1	52032685	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	5.100000	0.64560	2.723000	0.93209	0.655000	0.94253	AAG	.	.	.	none		0.408	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	Missense_Mutation
SMAP1	60682	hgsc.bcm.edu	37	6	71377783	71377783	+	Silent	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr6:71377783C>A	ENST00000370455.3	+	1	305	c.57C>A	c.(55-57)ctC>ctA	p.L19L	SMAP1_ENST00000422334.2_Silent_p.L19L|SMAP1_ENST00000370452.3_Silent_p.L19L|SMAP1_ENST00000316999.5_Silent_p.L19L	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	19	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						AGCACCAGCTCATCCTATCCA	0.667																																					p.L19L		Atlas-SNP	.											SMAP1_ENST00000370455,NS,carcinoma,0,2	SMAP1	77	.	0			c.C57A						PASS	.						67.0	57.0	60.0					6																	71377783		2203	4300	6503	SO:0001819	synonymous_variant	60682	exon1			CCAGCTCATCCTA	AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.57C>A	chr6.hg19:g.71377783C>A		71.0	0.0	.		81.0	35.0	.	NM_001044305	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Silent	SNP	ENST00000370455.3	hg19	CCDS43478.1																																																																																			.	.	.	none		0.667	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041149.1	NM_001044305	
EEF1A1	1915	hgsc.bcm.edu	37	6	74228567	74228567	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr6:74228567G>T	ENST00000316292.9	-	4	1617	c.626C>A	c.(625-627)cCt>cAt	p.P209H	EEF1A1_ENST00000331523.2_Missense_Mutation_p.P209H|EEF1A1_ENST00000309268.6_Missense_Mutation_p.P209H|EEF1A1_ENST00000491404.1_Intron	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	209	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CTTGAACCAAGGCATCTGAAA	0.488											OREG0003891|OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=EEF1A1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.P209H		Atlas-SNP	.											.	EEF1A1	56	.	0			c.C626A						PASS	.						94.0	87.0	90.0					6																	74228567		2203	4300	6503	SO:0001583	missense	1915	exon5			AACCAAGGCATCT	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.626C>A	chr6.hg19:g.74228567G>T	ENSP00000339063:p.Pro209His	86.0	0.0	.	1151	85.0	38.0	.	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806766	0.70682	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.44881	0.91;0.91;0.91	4.31	4.31	0.51392	Protein synthesis factor, GTP-binding (2);	0.209202	0.40385	U	0.001106	T	0.58637	0.2136	M	0.87038	2.855	0.53688	D	0.999975	P;P;P;P	0.46952	0.887;0.887;0.887;0.887	P;P;P;P	0.56343	0.796;0.796;0.796;0.796	T	0.69079	-0.5240	10	0.87932	D	0	.	17.2248	0.86966	0.0:0.0:1.0:0.0	.	209;209;209;209	P68104;Q53HR5;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;.;EF1A3_HUMAN	H	209;209;209;209;188	ENSP00000339063:P209H;ENSP00000339053:P209H;ENSP00000330054:P209H	ENSP00000339053:P209H	P	-	2	0	EEF1A1	74285288	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	7.413000	0.80104	2.115000	0.64714	0.549000	0.68633	CCT	.	.	.	none		0.488	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
QRSL1	55278	hgsc.bcm.edu	37	6	107111042	107111042	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr6:107111042C>A	ENST00000369046.4	+	10	1452	c.1348C>A	c.(1348-1350)Caa>Aaa	p.Q450K		NM_018292.4	NP_060762.3			glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1											endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		TATTTTTACACAAGCTGTAAA	0.433																																					p.Q450K	NSCLC(192;2127 2142 11668 26277 49545)	Atlas-SNP	.											.	QRSL1	30	.	0			c.C1348A						PASS	.						64.0	63.0	63.0					6																	107111042		2203	4300	6503	SO:0001583	missense	55278	exon10			TTTACACAAGCTG	AK001851	CCDS5057.1	6q21	2014-08-04			ENSG00000130348	ENSG00000130348			21020	protein-coding gene	gene with protein product	"""glutamyl-tRNA(Gln) amidotransferase, subunit A"""					11230166, 19805282	Standard	NM_018292		Approved	GatA, FLJ10989, FLJ12189, DKFZP564C1278, FLJ13447	uc003prm.3	Q9H0R6	OTTHUMG00000015301	ENST00000369046.4:c.1348C>A	chr6.hg19:g.107111042C>A	ENSP00000358042:p.Gln450Lys	57.0	0.0	.		59.0	13.0	.	NM_018292		Missense_Mutation	SNP	ENST00000369046.4	hg19	CCDS5057.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782043	0.90282	.	.	ENSG00000130348	ENST00000369046	T	0.54479	0.57	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	L	0.39898	1.24	0.80722	D	1	D	0.69078	0.997	D	0.74023	0.982	T	0.63791	-0.6557	10	0.87932	D	0	-9.5878	19.2883	0.94087	0.0:1.0:0.0:0.0	.	450	Q9H0R6	GATA_HUMAN	K	450	ENSP00000358042:Q450K	ENSP00000358042:Q450K	Q	+	1	0	QRSL1	107217735	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.487000	0.81328	2.578000	0.87016	0.484000	0.47621	CAA	.	.	.	none		0.433	QRSL1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041667.1	NM_018292	
RAET1E	135250	hgsc.bcm.edu	37	6	150211134	150211134	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr6:150211134C>T	ENST00000357183.4	-	2	365	c.233G>A	c.(232-234)gGg>gAg	p.G78E	RAET1E-AS1_ENST00000446954.2_RNA|RAET1E_ENST00000532335.1_Missense_Mutation_p.G78E|RAET1E_ENST00000529948.1_Missense_Mutation_p.G78E|RAET1E_ENST00000367363.3_Missense_Mutation_p.G42E|RAET1E-AS1_ENST00000605899.1_RNA|RP11-244K5.8_ENST00000606915.1_RNA	NM_139165.2	NP_631904.1	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E	78	MHC class I alpha-1 like.				antigen processing and presentation (GO:0019882)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			cervix(1)|kidney(2)|large_intestine(3)|lung(3)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		TACCTTCTTCCCCAGGAGGCC	0.517																																					p.G78E		Atlas-SNP	.											.	RAET1E	20	.	0			c.G233A						PASS	.						100.0	92.0	95.0					6																	150211134		2203	4300	6503	SO:0001583	missense	135250	exon2			TTCTTCCCCAGGA	AF359243	CCDS5221.1, CCDS59042.1, CCDS59043.1, CCDS59044.1	6q24.3	2011-02-09			ENSG00000164520	ENSG00000164520			16793	protein-coding gene	gene with protein product		609243				11827464	Standard	NM_139165		Approved	LETAL, bA350J20.7, ULBP4	uc003qnl.1	Q8TD07	OTTHUMG00000015796	ENST00000357183.4:c.233G>A	chr6.hg19:g.150211134C>T	ENSP00000349709:p.Gly78Glu	100.0	0.0	.		133.0	45.0	.	NM_139165	A6YF59|Q5VYB7|Q5VYB8|Q8TEZ2|Q96L41	Missense_Mutation	SNP	ENST00000357183.4	hg19	CCDS5221.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.438330	0.43326	.	.	ENSG00000164520	ENST00000532335;ENST00000357183;ENST00000367363;ENST00000529948;ENST00000531073	T;T;T;T;T	0.24723	1.84;1.84;5.83;1.84;3.29	3.85	-0.0414	0.13868	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.619520	0.14505	N	0.315517	T	0.25082	0.0609	L	0.61036	1.89	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.04481	-1.0948	10	0.87932	D	0	-12.1253	4.4654	0.11687	0.0:0.4291:0.3606:0.2102	.	78;42;78	Q8TD07;Q8TD07-2;Q8TD07-3	N2DL4_HUMAN;.;.	E	78;78;42;78;78	ENSP00000437067:G78E;ENSP00000349709:G78E;ENSP00000356332:G42E;ENSP00000432366:G78E;ENSP00000433489:G78E	ENSP00000349709:G78E	G	-	2	0	RAET1E	150252827	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.538000	0.06120	-0.033000	0.13736	0.591000	0.81541	GGG	.	.	.	none		0.517	RAET1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042659.1	NM_139165	
MLXIPL	51085	hgsc.bcm.edu	37	7	73038696	73038696	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr7:73038696G>A	ENST00000313375.3	-	1	174	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	MLXIPL_ENST00000429400.2_Missense_Mutation_p.R43C|MLXIPL_ENST00000354613.1_Missense_Mutation_p.R43C|MLXIPL_ENST00000434326.1_Missense_Mutation_p.R43C|MLXIPL_ENST00000414749.2_Missense_Mutation_p.R43C|MLXIPL_ENST00000395189.1_Missense_Mutation_p.R43C	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	43					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				ACCTGCGAGCGGAGCAAGCCG	0.736																																					p.R43C		Atlas-SNP	.											.	MLXIPL	54	.	0			c.C127T						PASS	.						7.0	8.0	8.0					7																	73038696		2141	4188	6329	SO:0001583	missense	51085	exon1			GCGAGCGGAGCAA	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.127C>T	chr7.hg19:g.73038696G>A	ENSP00000320886:p.Arg43Cys	20.0	0.0	.		49.0	20.0	.	NM_032954	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	hg19	CCDS5553.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458986	0.84317	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189;ENST00000434326;ENST00000453275	T;T;T;T;T;T	0.33216	1.97;1.99;1.98;1.99;1.42;1.42	4.24	4.24	0.50183	.	0.353680	0.21200	N	0.078499	T	0.43765	0.1262	M	0.63843	1.955	0.45056	D	0.998073	D;D;D;D;D	0.76494	0.996;0.998;0.999;0.999;0.999	P;P;P;P;P	0.54924	0.648;0.585;0.764;0.764;0.764	T	0.44907	-0.9297	10	0.87932	D	0	-17.4128	11.9628	0.53017	0.0:0.0:1.0:0.0	.	43;43;43;43;43	Q9NP71-6;Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	.;MLXPL_HUMAN;.;.;.	C	43	ENSP00000412330:R43C;ENSP00000406296:R43C;ENSP00000320886:R43C;ENSP00000346629:R43C;ENSP00000378616:R43C;ENSP00000392636:R43C	ENSP00000320886:R43C	R	-	1	0	MLXIPL	72676632	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.668000	0.68074	2.170000	0.68504	0.491000	0.48974	CGC	.	.	.	none		0.736	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
TRRAP	8295	hgsc.bcm.edu	37	7	98506430	98506430	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr7:98506430G>C	ENST00000359863.4	+	14	1404	c.1195G>C	c.(1195-1197)Gtc>Ctc	p.V399L	TRRAP_ENST00000446306.3_Missense_Mutation_p.V399L|TRRAP_ENST00000355540.3_Missense_Mutation_p.V399L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	399					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.V399I(2)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTCCCTCGCCGTCCAGCTCTT	0.647																																					p.V399L		Atlas-SNP	.											TRRAP_ENST00000359863,NS,carcinoma,0,4	TRRAP	863	.	2	Substitution - Missense(2)	lung(2)	c.G1195C						PASS	.						77.0	50.0	59.0					7																	98506430		2203	4300	6503	SO:0001583	missense	8295	exon14			CTCGCCGTCCAGC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.1195G>C	chr7.hg19:g.98506430G>C	ENSP00000352925:p.Val399Leu	49.0	0.0	.		97.0	42.0	.	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	hg19	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796795	0.90453	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.59772	3.92;0.24	5.84	5.84	0.93424	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.78394	0.4276	M	0.81179	2.53	0.80722	D	1	D;P;P	0.53312	0.959;0.931;0.931	D;P;P	0.65987	0.94;0.872;0.872	T	0.79557	-0.1754	10	0.72032	D	0.01	.	20.1551	0.98106	0.0:0.0:1.0:0.0	.	399;113;399	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	L	399	ENSP00000352925:V399L;ENSP00000347733:V399L	ENSP00000347733:V399L	V	+	1	0	TRRAP	98344366	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	9.625000	0.98406	2.760000	0.94817	0.655000	0.94253	GTC	.	.	.	none		0.647	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
ZKSCAN5	23660	hgsc.bcm.edu	37	7	99117529	99117529	+	Silent	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr7:99117529C>T	ENST00000394170.2	+	4	884	c.633C>T	c.(631-633)tcC>tcT	p.S211S	ZKSCAN5_ENST00000326775.5_Silent_p.S211S|ZKSCAN5_ENST00000451158.1_Silent_p.S211S	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CAACTGGGTCCCAGGTGAGCT	0.547																																					p.S211S		Atlas-SNP	.											.	ZKSCAN5	63	.	0			c.C633T						PASS	.						82.0	74.0	77.0					7																	99117529		2203	4300	6503	SO:0001819	synonymous_variant	23660	exon4			TGGGTCCCAGGTG	AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.633C>T	chr7.hg19:g.99117529C>T		39.0	0.0	.		67.0	35.0	.	NM_145102	A4D280|D6W5S9	Silent	SNP	ENST00000394170.2	hg19	CCDS5667.1																																																																																			.	.	.	none		0.547	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569	
ZNF282	8427	hgsc.bcm.edu	37	7	148892698	148892698	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr7:148892698C>A	ENST00000262085.3	+	1	122	c.17C>A	c.(16-18)aCa>aAa	p.T6K	ZNF282_ENST00000479907.1_Missense_Mutation_p.T6K	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	6					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		TTTGTGTCAACACGGCCGCAG	0.687																																					p.T6K		Atlas-SNP	.											.	ZNF282	42	.	0			c.C17A						PASS	.						17.0	18.0	18.0					7																	148892698		2201	4297	6498	SO:0001583	missense	8427	exon1			TGTCAACACGGCC	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.17C>A	chr7.hg19:g.148892698C>A	ENSP00000262085:p.Thr6Lys	27.0	0.0	.		54.0	22.0	.	NM_003575	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	ENST00000262085.3	hg19	CCDS5895.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383155	0.82792	.	.	ENSG00000170265	ENST00000262085;ENST00000479907	T;T	0.07567	3.18;4.93	4.52	4.52	0.55395	.	0.000000	0.42821	D	0.000660	T	0.13970	0.0338	N	0.14661	0.345	0.37992	D	0.933934	D;D	0.71674	0.998;0.981	D;D	0.73708	0.981;0.95	T	0.18178	-1.0345	10	0.87932	D	0	-10.484	12.7526	0.57316	0.0:1.0:0.0:0.0	.	6;6	B4DRI5;Q9UDV7	.;ZN282_HUMAN	K	6	ENSP00000262085:T6K;ENSP00000418840:T6K	ENSP00000262085:T6K	T	+	2	0	ZNF282	148523631	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.024000	0.41049	2.024000	0.59613	0.313000	0.20887	ACA	.	.	.	none		0.687	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352746.1	NM_003575	
RP1	6101	hgsc.bcm.edu	37	8	55537660	55537660	+	Silent	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr8:55537660G>A	ENST00000220676.1	+	4	1366	c.1218G>A	c.(1216-1218)gaG>gaA	p.E406E		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	406					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.E406D(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GTTTGGCAGAGGAGATAAACA	0.448																																					p.E406E	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											RP1,colon,carcinoma,0,1	RP1	429	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1218A						PASS	.						94.0	93.0	93.0					8																	55537660		2203	4300	6503	SO:0001819	synonymous_variant	6101	exon4			GGCAGAGGAGATA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.1218G>A	chr8.hg19:g.55537660G>A		86.0	0.0	.		93.0	35.0	.	NM_006269		Silent	SNP	ENST00000220676.1	hg19	CCDS6160.1																																																																																			.	.	.	none		0.448	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
ARFGEF1	10565	hgsc.bcm.edu	37	8	68200291	68200291	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr8:68200291T>C	ENST00000262215.3	-	7	1315	c.926A>G	c.(925-927)aAa>aGa	p.K309R		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	309					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CACTTCATTTTTAGATAATGC	0.294																																					p.K309R		Atlas-SNP	.											.	ARFGEF1	196	.	0			c.A926G						PASS	.						143.0	139.0	141.0					8																	68200291		2203	4299	6502	SO:0001583	missense	10565	exon7			TCATTTTTAGATA	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.926A>G	chr8.hg19:g.68200291T>C	ENSP00000262215:p.Lys309Arg	82.0	0.0	.		101.0	38.0	.	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	hg19	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	T	8.851	0.944495	0.18356	.	.	ENSG00000066777	ENST00000262215	T	0.20200	2.09	5.39	5.39	0.77823	Armadillo-type fold (1);	0.222812	0.46758	D	0.000280	T	0.15392	0.0371	N	0.22421	0.69	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.08006	-1.0743	10	0.18710	T	0.47	.	15.6988	0.77521	0.0:0.0:0.0:1.0	.	309	Q9Y6D6	BIG1_HUMAN	R	309	ENSP00000262215:K309R	ENSP00000262215:K309R	K	-	2	0	ARFGEF1	68362845	1.000000	0.71417	1.000000	0.80357	0.549000	0.35272	5.052000	0.64263	2.171000	0.68590	0.377000	0.23210	AAA	.	.	.	none		0.294	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
CLTA	1211	hgsc.bcm.edu	37	9	36204095	36204095	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr9:36204095G>A	ENST00000242285.6	+	4	524	c.404G>A	c.(403-405)tGg>tAg	p.W135*	CLTA_ENST00000433436.2_Nonsense_Mutation_p.W135*|CLTA_ENST00000540080.1_Nonsense_Mutation_p.W83*|CLTA_ENST00000466396.1_Nonsense_Mutation_p.W83*|CLTA_ENST00000345519.5_Nonsense_Mutation_p.W135*|CLTA_ENST00000396603.2_Nonsense_Mutation_p.W135*|CLTA_ENST00000538225.1_Nonsense_Mutation_p.W135*|CLTA_ENST00000470744.1_Nonsense_Mutation_p.W135*			P09496	CLCA_HUMAN	clathrin, light chain A	135	Involved in binding clathrin heavy chain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	clathrin heavy chain binding (GO:0032050)|peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	6			STAD - Stomach adenocarcinoma(86;0.228)			GAAGCAGAGTGGAAAGAAAAG	0.418																																					p.W135X		Atlas-SNP	.											.	CLTA	18	.	0			c.G404A						PASS	.						134.0	106.0	115.0					9																	36204095		2203	4300	6503	SO:0001587	stop_gained	1211	exon4			CAGAGTGGAAAGA		CCDS6600.1, CCDS6601.1, CCDS43802.1, CCDS55306.1, CCDS55307.1	9p13.3	2010-05-11	2010-05-11		ENSG00000122705	ENSG00000122705			2090	protein-coding gene	gene with protein product		118960	"""clathrin, light polypeptide (Lca)"""			7713494	Standard	NM_007096		Approved	Lca	uc003zzc.3	P09496	OTTHUMG00000019896	ENST00000242285.6:c.404G>A	chr9.hg19:g.36204095G>A	ENSP00000242285:p.Trp135*	59.0	0.0	.		66.0	21.0	.	NM_001184761	A8K4W3|B4DIN1|F5H6N3|Q2XPN5|Q53XZ1	Nonsense_Mutation	SNP	ENST00000242285.6	hg19	CCDS6601.1	.	.	.	.	.	.	.	.	.	.	G	34	5.323721	0.95708	.	.	ENSG00000122705	ENST00000433436;ENST00000538225;ENST00000540080;ENST00000345519;ENST00000470744;ENST00000242285;ENST00000466396;ENST00000396603	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-8.2768	17.8186	0.88643	0.0:0.0:1.0:0.0	.	.	.	.	X	135;135;83;135;135;135;83;135	.	ENSP00000242285:W135X	W	+	2	0	CLTA	36194095	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	9.078000	0.94023	2.818000	0.97014	0.655000	0.94253	TGG	.	.	.	none		0.418	CLTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052405.1	NM_007096	
KIF27	55582	hgsc.bcm.edu	37	9	86518501	86518501	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr9:86518501T>C	ENST00000297814.2	-	4	1075	c.932A>G	c.(931-933)aAg>aGg	p.K311R	KIF27_ENST00000334204.2_Missense_Mutation_p.K311R|KIF27_ENST00000413982.1_Missense_Mutation_p.K311R	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	311	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						CATGACAGTCTTAGCACTGCC	0.448																																					p.K311R		Atlas-SNP	.											.	KIF27	103	.	0			c.A932G						PASS	.						77.0	79.0	79.0					9																	86518501		2203	4300	6503	SO:0001583	missense	55582	exon4			ACAGTCTTAGCAC	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.932A>G	chr9.hg19:g.86518501T>C	ENSP00000297814:p.Lys311Arg	143.0	0.0	.		130.0	49.0	.	NM_017576	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	hg19	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076262	0.76415	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204	T;T;T	0.77098	-1.07;-1.07;-1.07	5.8	5.8	0.92144	Kinesin, motor domain (4);	0.000000	0.64402	D	0.000012	T	0.75708	0.3886	N	0.04355	-0.22	0.47009	D	0.999284	D;P;D	0.89917	1.0;0.885;1.0	D;P;D	0.91635	0.988;0.482;0.999	T	0.79574	-0.1747	10	0.35671	T	0.21	.	16.1596	0.81693	0.0:0.0:0.0:1.0	.	311;311;311	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	R	311	ENSP00000297814:K311R;ENSP00000401688:K311R;ENSP00000333928:K311R	ENSP00000297814:K311R	K	-	2	0	KIF27	85708321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.179000	0.65043	2.216000	0.71823	0.533000	0.62120	AAG	.	.	.	none		0.448	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576	
ANKS6	203286	hgsc.bcm.edu	37	9	101498890	101498890	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr9:101498890T>G	ENST00000353234.4	-	15	2574	c.2527A>C	c.(2527-2529)Att>Ctt	p.I843L	ANKS6_ENST00000375019.2_Missense_Mutation_p.I542L|ANKS6_ENST00000540940.1_Missense_Mutation_p.I648L|ANKS6_ENST00000375018.1_Missense_Mutation_p.I844L			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	843						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TCCTGTAAAATTTGTCTCTCG	0.448																																					p.I843L		Atlas-SNP	.											.	ANKS6	59	.	0			c.A2527C						PASS	.						80.0	83.0	82.0					9																	101498890		1910	4119	6029	SO:0001583	missense	203286	exon15			GTAAAATTTGTCT	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.2527A>C	chr9.hg19:g.101498890T>G	ENSP00000297837:p.Ile843Leu	55.0	0.0	.		59.0	11.0	.	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	hg19	CCDS43856.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.6|21.6	4.180089|4.180089	0.78564|0.78564	.|.	.|.	ENSG00000165138|ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940|ENST00000444472	T;T;T;T|.	0.67698|.	1.89;-0.28;-0.26;2.16|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.52075|0.52075	0.1712|0.1712	L|L	0.27053|0.27053	0.805|0.805	0.38043|0.38043	D|D	0.935529|0.935529	D;D|.	0.58268|.	0.982;0.97|.	D;P|.	0.69307|.	0.963;0.804|.	T|T	0.54268|0.54268	-0.8319|-0.8319	10|5	0.62326|.	D|.	0.03|.	-17.0533|-17.0533	13.5089|13.5089	0.61499|0.61499	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	844;843|.	Q68DC2-4;Q68DC2|.	.;ANKS6_HUMAN|.	L|T	542;844;843;648|312	ENSP00000364159:I542L;ENSP00000364158:I844L;ENSP00000297837:I843L;ENSP00000442189:I648L|.	ENSP00000297837:I843L|.	I|N	-|-	1|2	0|0	ANKS6|ANKS6	100538711|100538711	1.000000|1.000000	0.71417|0.71417	0.528000|0.528000	0.27938|0.27938	0.996000|0.996000	0.88848|0.88848	4.077000|4.077000	0.57598|0.57598	2.134000|2.134000	0.65973|0.65973	0.533000|0.533000	0.62120|0.62120	ATT|AAT	.	.	.	none		0.448	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
STX17	55014	hgsc.bcm.edu	37	9	102730737	102730737	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr9:102730737G>A	ENST00000259400.6	+	8	827	c.691G>A	c.(691-693)Gct>Act	p.A231T	STX17_ENST00000525640.1_Missense_Mutation_p.A231T|STX17_ENST00000534052.1_Missense_Mutation_p.A231T|STX17_ENST00000525847.1_3'UTR	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	231	Necessary and sufficient for localization to autophagosome.				autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CAAGCTGGCAGCTCTGCCTGT	0.473																																					p.A231T		Atlas-SNP	.											.	STX17	17	.	0			c.G691A						PASS	.						26.0	30.0	29.0					9																	102730737		2112	4179	6291	SO:0001583	missense	55014	exon8			CTGGCAGCTCTGC	AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.691G>A	chr9.hg19:g.102730737G>A	ENSP00000259400:p.Ala231Thr	52.0	0.0	.		61.0	22.0	.	NM_017919	Q4VXC2	Missense_Mutation	SNP	ENST00000259400.6	hg19	CCDS6745.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753782	0.31046	.	.	ENSG00000136874	ENST00000259400;ENST00000525640;ENST00000534052	.	.	.	5.52	3.65	0.41850	.	0.258408	0.38720	N	0.001584	T	0.43743	0.1261	L	0.36672	1.1	0.40216	D	0.977689	B	0.19817	0.039	B	0.15870	0.014	T	0.25882	-1.0119	9	0.31617	T	0.26	-8.1716	8.8801	0.35370	0.0748:0.0:0.777:0.1481	.	231	P56962	STX17_HUMAN	T	231	.	ENSP00000259400:A231T	A	+	1	0	STX17	101770558	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.513000	0.67037	0.660000	0.30964	0.655000	0.94253	GCT	.	.	.	none		0.473	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053398.3	NM_017919	
ENTPD8	377841	hgsc.bcm.edu	37	9	140332422	140332422	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr9:140332422C>A	ENST00000472938.1	-	2	257	c.241G>T	c.(241-243)Gaa>Taa	p.E81*	ENTPD8_ENST00000344119.2_Nonsense_Mutation_p.E81*|ENTPD8_ENST00000371506.2_Nonsense_Mutation_p.E81*			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	81					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		CACTAACCTTCCACCTGGCAG	0.622																																					p.E81X		Atlas-SNP	.											.	ENTPD8	53	.	0			c.G241T						PASS	.						54.0	58.0	56.0					9																	140332422		2202	4300	6502	SO:0001587	stop_gained	377841	exon3			AACCTTCCACCTG	AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.241G>T	chr9.hg19:g.140332422C>A	ENSP00000420531:p.Glu81*	31.0	0.0	.		20.0	10.0	.	NM_198585	A2BG17|Q6UVZ0	Nonsense_Mutation	SNP	ENST00000472938.1	hg19	CCDS43913.1	.	.	.	.	.	.	.	.	.	.	C	37	6.173688	0.97348	.	.	ENSG00000188833	ENST00000344119;ENST00000371506;ENST00000472938;ENST00000493135	.	.	.	4.3	0.708	0.18144	.	0.719465	0.12972	N	0.424026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9216	0.19086	0.0:0.5815:0.2643:0.1542	.	.	.	.	X	81;81;81;68	.	ENSP00000344089:E81X	E	-	1	0	ENTPD8	139452243	0.000000	0.05858	0.975000	0.42487	0.957000	0.61999	-4.003000	0.00316	0.289000	0.22422	0.561000	0.74099	GAA	.	.	.	none		0.622	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355991.1	NM_198585	
DIP2C	22982	hgsc.bcm.edu	37	10	375429	375429	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr10:375429A>G	ENST00000280886.6	-	30	3784	c.3697T>C	c.(3697-3699)Tac>Cac	p.Y1233H		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1233						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ATCACGGAGTAGGAGCAAAAC	0.597																																					p.Y1233H		Atlas-SNP	.											.	DIP2C	195	.	0			c.T3697C						PASS	.						63.0	53.0	57.0					10																	375429		2203	4300	6503	SO:0001583	missense	22982	exon30			CGGAGTAGGAGCA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3697T>C	chr10.hg19:g.375429A>G	ENSP00000280886:p.Tyr1233His	35.0	0.0	.		24.0	8.0	.	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	hg19	CCDS7054.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.1|20.1	3.932482|3.932482	0.73442|0.73442	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000434695|ENST00000280886;ENST00000535541;ENST00000381503	.|T	.|0.10477	.|2.87	5.84|5.84	5.84|5.84	0.93424|0.93424	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.15522|0.15522	0.0374|0.0374	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|B	.|0.32382	.|0.368	.|B	.|0.37346	.|0.247	T|T	0.06588|0.06588	-1.0818|-1.0818	5|10	.|0.15952	.|T	.|0.53	-25.606|-25.606	16.2141|16.2141	0.82191|0.82191	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1233	.|Q9Y2E4	.|DIP2C_HUMAN	P|H	38|1233;158;82	.|ENSP00000280886:Y1233H	.|ENSP00000280886:Y1233H	L|Y	-|-	2|1	0|0	DIP2C|DIP2C	365429|365429	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.978000|0.978000	0.69477|0.69477	9.339000|9.339000	0.96797|0.96797	2.230000|2.230000	0.72887|0.72887	0.528000|0.528000	0.53228|0.53228	CTA|TAC	.	.	.	none		0.597	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
ASB13	79754	hgsc.bcm.edu	37	10	5683908	5683908	+	Silent	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr10:5683908C>T	ENST00000357700.6	-	5	560	c.534G>A	c.(532-534)gcG>gcA	p.A178A	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	178					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		GAAGCTTTGCCGCATTCACGT	0.537																																					p.A178A		Atlas-SNP	.											.	ASB13	26	.	0			c.G534A						PASS	.						108.0	88.0	95.0					10																	5683908		2203	4300	6503	SO:0001819	synonymous_variant	79754	exon5			CTTTGCCGCATTC	AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.534G>A	chr10.hg19:g.5683908C>T		78.0	0.0	.		84.0	28.0	.	NM_024701	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Silent	SNP	ENST00000357700.6	hg19	CCDS7070.1																																																																																			.	.	.	none		0.537	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046564.1		
IPMK	253430	hgsc.bcm.edu	37	10	59986850	59986850	+	Silent	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr10:59986850A>G	ENST00000373935.3	-	3	649	c.327T>C	c.(325-327)taT>taC	p.Y109Y		NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	109					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						ATTTTGGCAAATATTTTCGTA	0.348																																					p.Y109Y		Atlas-SNP	.											.	IPMK	45	.	0			c.T327C						PASS	.						103.0	104.0	104.0					10																	59986850		2203	4300	6503	SO:0001819	synonymous_variant	253430	exon3			TGGCAAATATTTT	AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.327T>C	chr10.hg19:g.59986850A>G		52.0	0.0	.		49.0	15.0	.	NM_152230		Silent	SNP	ENST00000373935.3	hg19	CCDS7250.1																																																																																			.	.	.	none		0.348	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048142.1	NM_152230	
CCAR1	55749	hgsc.bcm.edu	37	10	70547942	70547942	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr10:70547942C>T	ENST00000265872.6	+	23	3163	c.3044C>T	c.(3043-3045)tCa>tTa	p.S1015L	CCAR1_ENST00000543719.1_Missense_Mutation_p.S1000L|CCAR1_ENST00000535016.1_Missense_Mutation_p.S1000L	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	1015					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						AAGCAGGAATCAAAGGATGTG	0.318																																					p.S1015L		Atlas-SNP	.											.	CCAR1	118	.	0			c.C3044T						PASS	.						115.0	114.0	114.0					10																	70547942		2203	4300	6503	SO:0001583	missense	55749	exon23			AGGAATCAAAGGA	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.3044C>T	chr10.hg19:g.70547942C>T	ENSP00000265872:p.Ser1015Leu	241.0	0.0	.		290.0	118.0	.	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	hg19	CCDS7282.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773748	0.31411	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539	T;T;T;T	0.00316	8.13;8.13;8.13;8.13	5.0	1.92	0.25849	.	0.653955	0.14932	N	0.290013	T	0.00109	0.0003	N	0.12182	0.205	0.18873	N	0.999989	B	0.02656	0.0	B	0.01281	0.0	T	0.07888	-1.0749	10	0.28530	T	0.3	-2.6089	7.6308	0.28238	0.0:0.5156:0.3318:0.1526	.	1015	Q8IX12	CCAR1_HUMAN	L	1015;1000;1000;1000	ENSP00000265872:S1015L;ENSP00000441820:S1000L;ENSP00000445254:S1000L;ENSP00000439252:S1000L	ENSP00000265872:S1015L	S	+	2	0	CCAR1	70217948	0.002000	0.14202	0.997000	0.53966	0.996000	0.88848	0.130000	0.15850	0.511000	0.28236	0.558000	0.71614	TCA	.	.	.	none		0.318	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
SEC24C	9632	hgsc.bcm.edu	37	10	75529171	75529171	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr10:75529171T>G	ENST00000339365.2	+	19	2653	c.2491T>G	c.(2491-2493)Tgc>Ggc	p.C831G	FUT11_ENST00000372841.3_5'Flank|FUT11_ENST00000394790.1_5'Flank|SEC24C_ENST00000411652.2_Missense_Mutation_p.C712G|SEC24C_ENST00000540668.1_Missense_Mutation_p.C79G|SEC24C_ENST00000496827.1_3'UTR|SEC24C_ENST00000535742.1_Missense_Mutation_p.C79G|SEC24C_ENST00000345254.4_Missense_Mutation_p.C831G	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	831					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GGCCCTGAACTGCTGCACCCA	0.567																																					p.C831G		Atlas-SNP	.											.	SEC24C	86	.	0			c.T2491G						PASS	.						53.0	48.0	50.0					10																	75529171		2203	4300	6503	SO:0001583	missense	9632	exon18			CTGAACTGCTGCA	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.2491T>G	chr10.hg19:g.75529171T>G	ENSP00000343405:p.Cys831Gly	85.0	0.0	.		95.0	45.0	.	NM_198597	B4DZT4|Q8WV25	Missense_Mutation	SNP	ENST00000339365.2	hg19	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.435280	0.83885	.	.	ENSG00000176986	ENST00000535742;ENST00000345254;ENST00000540668;ENST00000339365;ENST00000411652	T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82	5.57	5.57	0.84162	Sec23/Sec24 beta-sandwich (1);	0.000000	0.85682	D	0.000000	D	0.87581	0.6213	M	0.84683	2.71	0.80722	D	1	P;D	0.61080	0.952;0.989	D;D	0.85130	0.975;0.997	D	0.89605	0.3837	10	0.87932	D	0	-10.2796	15.7123	0.77641	0.0:0.0:0.0:1.0	.	712;831	E7EP00;P53992	.;SC24C_HUMAN	G	79;831;79;831;712	ENSP00000446174:C79G;ENSP00000321845:C831G;ENSP00000445023:C79G;ENSP00000343405:C831G;ENSP00000402913:C712G	ENSP00000343405:C831G	C	+	1	0	SEC24C	75199177	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.994000	0.88315	2.123000	0.65237	0.260000	0.18958	TGC	.	.	.	none		0.567	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		
AFAP1L2	84632	hgsc.bcm.edu	37	10	116062118	116062118	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr10:116062118A>T	ENST00000304129.4	-	12	1439	c.1410T>A	c.(1408-1410)agT>agA	p.S470R	AFAP1L2_ENST00000369271.3_Missense_Mutation_p.S470R|AFAP1L2_ENST00000545353.1_Missense_Mutation_p.S523R|AFAP1L2_ENST00000491814.1_5'Flank			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	470					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		TTTTGGCCGCACTCACAATAC	0.542																																					p.S470R		Atlas-SNP	.											.	AFAP1L2	90	.	0			c.T1410A						PASS	.						154.0	170.0	165.0					10																	116062118		2203	4300	6503	SO:0001583	missense	84632	exon12			GGCCGCACTCACA	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.1410T>A	chr10.hg19:g.116062118A>T	ENSP00000303042:p.Ser470Arg	56.0	0.0	.		48.0	4.0	.	NM_032550	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Missense_Mutation	SNP	ENST00000304129.4	hg19	CCDS31286.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880627	0.72294	.	.	ENSG00000169129	ENST00000369271;ENST00000304129;ENST00000392974;ENST00000545353	T;T;T	0.17854	2.25;2.25;2.25	5.67	-5.88	0.02290	.	0.233607	0.50627	D	0.000118	T	0.27798	0.0684	M	0.73598	2.24	0.29591	N	0.848408	P;P;P;B;P;P	0.52463	0.953;0.928;0.922;0.249;0.953;0.921	P;P;P;B;P;B	0.53401	0.725;0.494;0.535;0.444;0.615;0.411	T	0.20438	-1.0275	10	0.31617	T	0.26	-8.7309	17.5452	0.87859	0.3705:0.0:0.6295:0.0	.	523;36;524;498;470;470	F5GZE1;B7Z363;B7Z2Q0;Q8N4X5-4;Q8N4X5-2;Q8N4X5	.;.;.;.;.;AF1L2_HUMAN	R	470;470;497;523	ENSP00000358276:S470R;ENSP00000303042:S470R;ENSP00000444511:S523R	ENSP00000303042:S470R	S	-	3	2	AFAP1L2	116052108	0.151000	0.22747	0.270000	0.24601	0.994000	0.84299	-0.307000	0.08167	-1.227000	0.02571	0.533000	0.62120	AGT	.	.	.	none		0.542	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550	
BCCIP	56647	hgsc.bcm.edu	37	10	127515167	127515167	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr10:127515167A>T	ENST00000278100.6	+	2	185	c.173A>T	c.(172-174)aAt>aTt	p.N58I	BCCIP_ENST00000478798.1_3'UTR|BCCIP_ENST00000368759.5_Missense_Mutation_p.N58I|BCCIP_ENST00000299130.3_Missense_Mutation_p.N58I|BCCIP_ENST00000429863.2_Missense_Mutation_p.N58I	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	58					cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CAGGAAGTGAATATTGAATTT	0.308																																					p.N58I		Atlas-SNP	.											.	BCCIP	48	.	0			c.A173T						PASS	.						81.0	83.0	82.0					10																	127515167		2202	4299	6501	SO:0001583	missense	56647	exon2			AAGTGAATATTGA	AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.173A>T	chr10.hg19:g.127515167A>T	ENSP00000278100:p.Asn58Ile	72.0	0.0	.		78.0	16.0	.	NM_016567	B3KP45|Q8ND15|Q96GC4|Q9P288	Missense_Mutation	SNP	ENST00000278100.6	hg19	CCDS7651.1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.934472	0.52866	.	.	ENSG00000107949	ENST00000278100;ENST00000299130;ENST00000368759;ENST00000429863;ENST00000392718	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.09	2.58	0.30949	.	0.364353	0.31257	N	0.007978	T	0.31670	0.0804	L	0.41027	1.25	0.58432	D	0.999998	B;B;B;B;B	0.30068	0.267;0.267;0.225;0.225;0.065	B;B;B;B;B	0.27380	0.079;0.079;0.047;0.047;0.054	T	0.04796	-1.0926	10	0.12766	T	0.61	-32.3549	8.2271	0.31575	0.7938:0.1334:0.0728:0.0	.	58;58;58;58;58	B4E318;B4DUS0;Q9P287-2;Q9P287-4;Q9P287	.;.;.;.;BCCIP_HUMAN	I	58	ENSP00000278100:N58I;ENSP00000299130:N58I;ENSP00000357748:N58I;ENSP00000394758:N58I	ENSP00000278100:N58I	N	+	2	0	BCCIP	127505157	0.972000	0.33761	0.995000	0.50966	0.992000	0.81027	2.162000	0.42367	0.895000	0.36342	0.533000	0.62120	AAT	.	.	.	none		0.308	BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050941.1		
NAV2	89797	hgsc.bcm.edu	37	11	20065595	20065595	+	Silent	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr11:20065595A>G	ENST00000396087.3	+	14	3144	c.3045A>G	c.(3043-3045)tcA>tcG	p.S1015S	NAV2_ENST00000396085.1_Silent_p.S992S|NAV2_ENST00000533917.1_Silent_p.S78S|NAV2_ENST00000527559.2_Silent_p.S944S|NAV2_ENST00000360655.4_Silent_p.S928S|NAV2_ENST00000540292.1_Silent_p.S946S|NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000349880.4_Silent_p.S992S|NAV2_ENST00000311043.8_Silent_p.S78S	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1015					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						TCAAGAAATCAGACGGAGGCT	0.517																																					p.S1015S		Atlas-SNP	.											.	NAV2	255	.	0			c.A3045G						PASS	.						99.0	99.0	99.0					11																	20065595		2203	4300	6503	SO:0001819	synonymous_variant	89797	exon14			GAAATCAGACGGA	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.3045A>G	chr11.hg19:g.20065595A>G		33.0	0.0	.		50.0	17.0	.	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	ENST00000396087.3	hg19	CCDS58126.1																																																																																			.	.	.	none		0.517	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
SLC5A12	159963	hgsc.bcm.edu	37	11	26720062	26720062	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr11:26720062A>G	ENST00000396005.3	-	7	1151	c.842T>C	c.(841-843)cTg>cCg	p.L281P	SLC5A12_ENST00000280467.6_Missense_Mutation_p.L281P	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	281					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						CCAGAGACCCAGCAAGTTAAA	0.448																																					p.L281P		Atlas-SNP	.											.	SLC5A12	134	.	0			c.T842C						PASS	.						116.0	105.0	109.0					11																	26720062		2203	4299	6502	SO:0001583	missense	159963	exon7			AGACCCAGCAAGT	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.842T>C	chr11.hg19:g.26720062A>G	ENSP00000379326:p.Leu281Pro	55.0	0.0	.		76.0	34.0	.	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593547	0.86953	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.87334	-2.24;-2.24;-2.24	6.07	6.07	0.98685	.	0.268718	0.27951	N	0.017189	D	0.86439	0.5933	N	0.11064	0.09	0.80722	D	1	P;D	0.69078	0.942;0.997	P;D	0.73708	0.771;0.981	D	0.85491	0.1185	10	0.22706	T	0.39	.	16.6277	0.84984	1.0:0.0:0.0:0.0	.	281;281	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	P	281;281;93	ENSP00000379326:L281P;ENSP00000280467:L281P;ENSP00000435053:L93P	ENSP00000280467:L281P	L	-	2	0	SLC5A12	26676638	1.000000	0.71417	0.936000	0.37596	0.825000	0.46686	9.154000	0.94694	2.330000	0.79161	0.528000	0.53228	CTG	.	.	.	none		0.448	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
ZNF408	79797	hgsc.bcm.edu	37	11	46724728	46724728	+	Missense_Mutation	SNP	A	A	C	rs376220307|rs148055528	byFrequency	TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr11:46724728A>C	ENST00000311764.2	+	4	817	c.587A>C	c.(586-588)gAa>gCa	p.E196A	ARHGAP1_ENST00000311956.4_5'Flank	NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GTGGTGACAGAAGTGGAGTCT	0.567																																					p.E196A	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	Atlas-SNP	.											ZNF408,caecum,carcinoma,0,1	ZNF408	70	.	0			c.A587C						PASS	.	A	ALA/GLU,ALA/GLU	4,4398		0,4,2197	46.0	39.0	42.0		563,587	0.5	0.6	11		42	36,8500		10,16,4242	no	missense,missense	ZNF408	NM_001184751.1,NM_024741.2	107,107	10,20,6439	CC,CA,AA		0.4217,0.0909,0.3092	benign,benign	188/713,196/721	46724728	40,12898	2201	4268	6469	SO:0001583	missense	79797	exon4			TGACAGAAGTGGA	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.587A>C	chr11.hg19:g.46724728A>C	ENSP00000309606:p.Glu196Ala	31.0	0.0	.		37.0	4.0	.	NM_024741		Missense_Mutation	SNP	ENST00000311764.2	hg19	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083402	0.55861	9.09E-4	0.004217	ENSG00000175213	ENST00000311764	T	0.10477	2.87	5.66	0.47	0.16747	.	0.900334	0.09183	N	0.837160	T	0.07593	0.0191	L	0.32530	0.975	0.09310	N	1	B;B	0.31680	0.335;0.335	B;B	0.25140	0.058;0.058	T	0.40590	-0.9555	10	0.19590	T	0.45	-0.378	9.3275	0.38001	0.6254:0.0:0.3746:0.0	.	188;196	B4DXY4;Q9H9D4	.;ZN408_HUMAN	A	196	ENSP00000309606:E196A	ENSP00000309606:E196A	E	+	2	0	ZNF408	46681304	0.229000	0.23729	0.610000	0.28997	0.457000	0.32468	-0.129000	0.10515	0.078000	0.16900	0.533000	0.62120	GAA	.	.	.	weak		0.567	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
C11orf73	51501	hgsc.bcm.edu	37	11	86048421	86048421	+	Splice_Site	SNP	G	G	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr11:86048421G>C	ENST00000278483.3	+	3	495	c.269G>C	c.(268-270)gGa>gCa	p.G90A	C11orf73_ENST00000530208.1_3'UTR|C11orf73_ENST00000533986.1_Splice_Site_p.G90A	NM_016401.3	NP_057485.2	Q53FT3	HIKES_HUMAN	chromosome 11 open reading frame 73	90					cellular response to heat (GO:0034605)|Golgi organization (GO:0007030)|lung development (GO:0030324)|protein import into nucleus (GO:0006606)|protein transport (GO:0015031)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	Hsp70 protein binding (GO:0030544)|protein transporter activity (GO:0008565)			kidney(1)|large_intestine(1)|urinary_tract(1)	3		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)				TTTCTTGCAGGAGAAGGAAGC	0.338																																					p.G90A		Atlas-SNP	.											.	C11orf73	9	.	0			c.G269C						PASS	.						150.0	142.0	144.0					11																	86048421		2202	4299	6501	SO:0001630	splice_region_variant	51501	exon3			TTGCAGGAGAAGG	BC015991	CCDS8275.1	11q14.2	2013-03-12			ENSG00000149196	ENSG00000149196			26938	protein-coding gene	gene with protein product		614908				11042152, 22541429	Standard	NM_016401		Approved	HSPC138, HSPC179, Hikeshi, OPI10	uc001pbu.3	Q53FT3	OTTHUMG00000167212	ENST00000278483.3:c.269-1G>C	chr11.hg19:g.86048421G>C		76.0	0.0	.		90.0	32.0	.	NM_016401	Q8WVE8|Q9NVQ2|Q9NZZ1|Q9P022|Q9P0N1	Missense_Mutation	SNP	ENST00000278483.3	hg19	CCDS8275.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.348862	0.41599	.	.	ENSG00000149196	ENST00000533986;ENST00000278483	T;T	0.41400	1.0;1.0	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.53142	0.1778	M	0.63428	1.95	0.80722	D	1	B;P	0.45348	0.106;0.856	B;P	0.49887	0.179;0.625	T	0.50541	-0.8816	9	.	.	.	.	18.5985	0.91239	0.0:0.0:1.0:0.0	.	90;90	Q53FT3;E9PPG8	CK073_HUMAN;.	A	90	ENSP00000432699:G90A;ENSP00000278483:G90A	.	G	+	2	0	C11orf73	85726069	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.629000	0.74267	2.566000	0.86566	0.555000	0.69702	GGA	.	.	.	none		0.338	C11orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393747.1	NM_016401	Missense_Mutation
ITPR2	3709	hgsc.bcm.edu	37	12	26810815	26810815	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:26810815T>C	ENST00000381340.3	-	18	2433	c.2017A>G	c.(2017-2019)Atg>Gtg	p.M673V		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	673					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TCTGCTTGCATTGAGACCACC	0.378																																					p.M673V		Atlas-SNP	.											.	ITPR2	270	.	0			c.A2017G						PASS	.						99.0	90.0	93.0					12																	26810815		1858	4096	5954	SO:0001583	missense	3709	exon18			CTTGCATTGAGAC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2017A>G	chr12.hg19:g.26810815T>C	ENSP00000370744:p.Met673Val	126.0	0.0	.		132.0	50.0	.	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	hg19	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	T	0.151	-1.091885	0.01858	.	.	ENSG00000123104	ENST00000381340	D	0.95103	-3.61	4.4	4.4	0.53042	Intracellular calcium-release channel (1);	0.287733	0.43260	D	0.000583	D	0.85283	0.5661	N	0.08118	0	0.80722	D	1	B	0.11235	0.004	B	0.18263	0.021	T	0.79529	-0.1766	10	0.16896	T	0.51	.	9.5261	0.39165	0.157:0.0:0.0:0.843	.	673	Q14571	ITPR2_HUMAN	V	673	ENSP00000370744:M673V	ENSP00000370744:M673V	M	-	1	0	ITPR2	26702082	1.000000	0.71417	0.882000	0.34594	0.934000	0.57294	4.236000	0.58675	1.983000	0.57843	0.533000	0.62120	ATG	.	.	.	none		0.378	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
KMT2D	8085	hgsc.bcm.edu	37	12	49445630	49445630	+	Silent	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:49445630A>G	ENST00000301067.7	-	10	1835	c.1836T>C	c.(1834-1836)ccT>ccC	p.P612P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	612	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GAGACTCCTCAGGTGGAGGGG	0.597																																					p.P612P		Atlas-SNP	.											.	MLL2	1173	.	0			c.T1836C						PASS	.						76.0	79.0	78.0					12																	49445630		2092	4211	6303	SO:0001819	synonymous_variant	8085	exon10			CTCCTCAGGTGGA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1836T>C	chr12.hg19:g.49445630A>G		39.0	0.0	.		45.0	14.0	.	NM_003482	O14687	Silent	SNP	ENST00000301067.7	hg19	CCDS44873.1																																																																																			.	.	.	none		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KERA	11081	hgsc.bcm.edu	37	12	91445296	91445296	+	Splice_Site	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:91445296C>T	ENST00000266719.3	-	3	1134		c.e3-1			NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan						carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						ACATTCACACCTACAGTGACA	0.458																																					.		Atlas-SNP	.											.	KERA	62	.	0			c.887-1G>A						PASS	.						71.0	61.0	64.0					12																	91445296		2203	4299	6502	SO:0001630	splice_region_variant	11081	exon4			TCACACCTACAGT	AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.887-1G>A	chr12.hg19:g.91445296C>T		23.0	0.0	.		26.0	12.0	.	NM_007035		Splice_Site	SNP	ENST00000266719.3	hg19	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054257	0.36277	.	.	ENSG00000139330	ENST00000266719	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2611	0.93968	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KERA	89969427	1.000000	0.71417	0.917000	0.36280	0.020000	0.10135	7.378000	0.79679	2.655000	0.90218	0.655000	0.94253	.	.	.	.	none		0.458	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035	Intron
MTERF2	80298	hgsc.bcm.edu	37	12	107371849	107371849	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:107371849T>A	ENST00000552029.1	-	2	2712	c.644A>T	c.(643-645)cAa>cTa	p.Q215L	C12orf23_ENST00000551237.1_Intron|MTERFD3_ENST00000240050.4_Missense_Mutation_p.Q215L|MTERFD3_ENST00000392830.2_Missense_Mutation_p.Q215L			Q49AM1	MTEF2_HUMAN		215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	transcription regulatory region DNA binding (GO:0044212)			breast(1)|kidney(1)|large_intestine(2)|lung(3)	7						AAATGGGTTTTGGCTTAACAA	0.378																																					p.Q215L		Atlas-SNP	.											.	MTERFD3	32	.	0			c.A644T						PASS	.						44.0	49.0	48.0					12																	107371849		2201	4299	6500	SO:0001583	missense	80298	exon3			GGGTTTTGGCTTA																												ENST00000552029.1:c.644A>T	chr12.hg19:g.107371849T>A	ENSP00000447651:p.Gln215Leu	79.0	0.0	.		102.0	38.0	.	NM_001033050	Q53HM2|Q9H4L6|Q9H7Y9	Missense_Mutation	SNP	ENST00000552029.1	hg19	CCDS9111.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.403428	0.83230	.	.	ENSG00000120832	ENST00000392830;ENST00000240050;ENST00000552029	T;T;T	0.08984	3.03;3.03;3.03	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.28962	0.0719	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00677	-1.1614	10	0.44086	T	0.13	-0.2116	16.1777	0.81874	0.0:0.0:0.0:1.0	.	215	Q49AM1	MTER3_HUMAN	L	215	ENSP00000376575:Q215L;ENSP00000240050:Q215L;ENSP00000447651:Q215L	ENSP00000240050:Q215L	Q	-	2	0	MTERFD3	105895979	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	7.698000	0.84413	2.222000	0.72286	0.383000	0.25322	CAA	.	.	.	none		0.378	MTERFD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406835.1		
ALDH2	217	hgsc.bcm.edu	37	12	112220989	112220990	+	Missense_Mutation	DNP	GC	GC	AA	rs375845001		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:112220989_112220990GC>AA	ENST00000261733.2	+	3	308_309	c.247_248GC>AA	c.(247-249)GCc>AAc	p.A83N	RP11-162P23.2_ENST00000546840.2_Missense_Mutation_p.P80T|ALDH2_ENST00000416293.3_Intron	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	83				VKAARA -> REGRPG (in Ref. 1; CAA28990). {ECO:0000305}.	alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	AGTGAAGGCCGCCCGGGCCGCC	0.594			T	HMGA2	leiomyoma																																p.A83T|p.A83D		Atlas-SNP	.		Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	.	ALDH2	91	.	0			c.G247A|c.C248A						PASS	.																																			SO:0001583	missense	217	exon3			AAGGCCGCCCGGG|AGGCCGCCCGGGC	M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	Exception_encountered	chr12.hg19:g.112220989_112220990delinsAA	ENSP00000261733:p.Ala83Asn	31.0|32.0	0.0	.		36.0	14.0	.	NM_000690	B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Missense_Mutation	SNP	ENST00000261733.2	hg19	CCDS9155.1																																																																																			.	.	.	weak|none		0.594	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405008.1	NM_000690	
C12orf43	64897	hgsc.bcm.edu	37	12	121441960	121441960	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:121441960T>C	ENST00000288757.3	-	6	807	c.785A>G	c.(784-786)aAc>aGc	p.N262S	C12orf43_ENST00000366211.2_Missense_Mutation_p.N221S|C12orf43_ENST00000536407.2_3'UTR|RP11-216P16.2_ENST00000606238.1_RNA|C12orf43_ENST00000537817.1_Missense_Mutation_p.N263S|C12orf43_ENST00000539736.1_Missense_Mutation_p.N252S|C12orf43_ENST00000445832.3_Missense_Mutation_p.N232S	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43	262										cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTGGGTTCAGTTTGCAGGTAT	0.572																																					p.N262S		Atlas-SNP	.											.	C12orf43	30	.	0			c.A785G						PASS	.						184.0	182.0	183.0					12																	121441960		2203	4300	6503	SO:0001583	missense	64897	exon6			GTTCAGTTTGCAG	AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150	ENST00000288757.3:c.785A>G	chr12.hg19:g.121441960T>C	ENSP00000288757:p.Asn262Ser	96.0	0.0	.		121.0	38.0	.	NM_022895	Q53HF0|Q9H9Z7	Missense_Mutation	SNP	ENST00000288757.3	hg19	CCDS9210.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.02|15.02	2.708809|2.708809	0.48517|0.48517	.|.	.|.	ENSG00000157895|ENSG00000157895	ENST00000445832;ENST00000288757;ENST00000537817;ENST00000536407;ENST00000366211;ENST00000539736|ENST00000546272	T;T;T;T|.	0.52983|.	0.67;0.66;0.66;0.64|.	5.5|5.5	1.86|1.86	0.25419|0.25419	.|.	1.121610|.	0.06531|.	N|.	0.741551|.	T|T	0.37919|0.37919	0.1021|0.1021	L|L	0.53249|0.53249	1.67|1.67	0.09310|0.09310	N|N	1|1	B;B;D;B;B|.	0.61697|.	0.102;0.047;0.99;0.021;0.102|.	B;B;P;B;B|.	0.49597|.	0.037;0.013;0.616;0.022;0.037|.	T|T	0.30387|0.30387	-0.9980|-0.9980	10|5	0.66056|.	D|.	0.02|.	.|.	3.2634|3.2634	0.06856|0.06856	0.1723:0.1815:0.0:0.6462|0.1723:0.1815:0.0:0.6462	.|.	252;221;263;252;262|.	G5EA44;F6TFQ5;F5H7W8;B4DWJ9;Q96C57|.	.;.;.;.;CL043_HUMAN|.	S|A	232;262;263;160;221;252|216	ENSP00000409788:N232S;ENSP00000288757:N262S;ENSP00000442224:N263S;ENSP00000437803:N252S|.	ENSP00000288757:N262S|.	N|T	-|-	2|1	0|0	C12orf43|C12orf43	119926343|119926343	0.438000|0.438000	0.25602|0.25602	0.014000|0.014000	0.15608|0.15608	0.014000|0.014000	0.08584|0.08584	0.673000|0.673000	0.25203|0.25203	0.451000|0.451000	0.26802|0.26802	0.533000|0.533000	0.62120|0.62120	AAC|ACT	.	.	.	none		0.572	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022895	
KNTC1	9735	hgsc.bcm.edu	37	12	123089162	123089163	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:123089162_123089163GG>AT	ENST00000333479.7	+	49	5330_5331	c.5153_5154GG>AT	c.(5152-5154)tGG>tAT	p.W1718Y	KNTC1_ENST00000450485.2_Intron|KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000537348.1_Missense_Mutation_p.W143Y	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1718					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GCTGAGAGATGGCTACAGAATA	0.337																																					p.W1718X|p.W1718C		Atlas-SNP	.											.	KNTC1	182	.	0			c.G5153A|c.G5154T						PASS	.																																			SO:0001583	missense	9735	exon49			AGAGATGGCTACA|GAGATGGCTACAG		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	Exception_encountered	chr12.hg19:g.123089162_123089163delinsAT	ENSP00000328236:p.Trp1718Tyr	88.0	0.0	.		77.0	23.0	.	NM_014708	A7E2C4|B3KSG2	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000333479.7	hg19	CCDS45002.1																																																																																			.	.	.	none		0.337	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
CCDC62	84660	hgsc.bcm.edu	37	12	123285813	123285813	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:123285813G>A	ENST00000253079.6	+	9	1464	c.1120G>A	c.(1120-1122)Gat>Aat	p.D374N	CCDC62_ENST00000392441.4_Missense_Mutation_p.D374N|CCDC62_ENST00000392440.2_Missense_Mutation_p.D135N|CCDC62_ENST00000537566.1_Missense_Mutation_p.D135N	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	374					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		GAGCTCTTGCGATGAATGCAA	0.383																																					p.D374N		Atlas-SNP	.											.	CCDC62	119	.	0			c.G1120A						PASS	.						97.0	91.0	93.0					12																	123285813		2203	4300	6503	SO:0001583	missense	84660	exon9			TCTTGCGATGAAT		CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.1120G>A	chr12.hg19:g.123285813G>A	ENSP00000253079:p.Asp374Asn	101.0	0.0	.		122.0	46.0	.	NM_201435	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	hg19	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.668017	0.67814	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	T;T;T;T	0.59364	0.92;0.91;0.27;0.27	5.62	2.84	0.33178	.	0.538297	0.16861	N	0.196523	T	0.46249	0.1383	L	0.59436	1.845	0.09310	N	1	B;P;B	0.44281	0.212;0.831;0.066	B;B;B	0.33042	0.029;0.157;0.011	T	0.41592	-0.9500	10	0.87932	D	0	-2.9694	7.8178	0.29269	0.2517:0.0:0.7483:0.0	.	374;135;374	Q6P9F0-2;Q6P9F0-3;Q6P9F0	.;.;CCD62_HUMAN	N	374;374;135;135	ENSP00000253079:D374N;ENSP00000376236:D374N;ENSP00000445045:D135N;ENSP00000376235:D135N	ENSP00000253079:D374N	D	+	1	0	CCDC62	121851766	0.519000	0.26242	0.000000	0.03702	0.010000	0.07245	2.499000	0.45372	0.344000	0.23847	0.655000	0.94253	GAT	.	.	.	none		0.383	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
PCDH20	64881	hgsc.bcm.edu	37	13	61986120	61986120	+	Silent	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr13:61986120C>T	ENST00000409186.1	-	5	4217	c.2112G>A	c.(2110-2112)caG>caA	p.Q704Q	PCDH20_ENST00000409204.4_Silent_p.Q704Q			Q8N6Y1	PCD20_HUMAN	protocadherin 20	704	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.Q704H(1)|p.Q677H(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		AGGAGCTTTGCTGCTCTCTGT	0.463																																					p.Q704Q		Atlas-SNP	.											PCDH20_ENST00000409186,NS,carcinoma,0,2	PCDH20	265	.	2	Substitution - Missense(2)	lung(2)	c.G2112A						PASS	.						96.0	103.0	101.0					13																	61986120		2203	4299	6502	SO:0001819	synonymous_variant	64881	exon2			GCTTTGCTGCTCT	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2112G>A	chr13.hg19:g.61986120C>T		82.0	0.0	.		85.0	25.0	.	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	ENST00000409186.1	hg19	CCDS9442.2																																																																																			.	.	.	none		0.463	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
RAB20	55647	hgsc.bcm.edu	37	13	111213813	111213813	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr13:111213813C>G	ENST00000267328.3	-	1	267	c.54G>C	c.(52-54)aaG>aaC	p.K18N		NM_017817.1	NP_060287.1	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family	18					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)			endometrium(2)|large_intestine(2)|lung(3)	7	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			GCAGCGACGTCTTCCCCACGT	0.652																																					p.K18N		Atlas-SNP	.											.	RAB20	34	.	0			c.G54C						PASS	.						62.0	57.0	59.0					13																	111213813		2203	4300	6503	SO:0001583	missense	55647	exon1			CGACGTCTTCCCC	AK000436	CCDS9512.1	13q34	2008-07-18			ENSG00000139832	ENSG00000139832		"""RAB, member RAS oncogene"""	18260	protein-coding gene	gene with protein product						11697911	Standard	NM_017817		Approved	FLJ20429	uc001vqy.3	Q9NX57	OTTHUMG00000017343	ENST00000267328.3:c.54G>C	chr13.hg19:g.111213813C>G	ENSP00000267328:p.Lys18Asn	61.0	0.0	.		107.0	22.0	.	NM_017817	Q5T9X5|Q9NX49	Missense_Mutation	SNP	ENST00000267328.3	hg19	CCDS9512.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620006	0.87460	.	.	ENSG00000139832	ENST00000267328	D	0.94232	-3.38	4.06	2.23	0.28157	Small GTP-binding protein domain (1);	0.049143	0.85682	D	0.000000	D	0.96778	0.8948	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96147	0.9105	10	0.87932	D	0	1.1772	9.4073	0.38469	0.0:0.8181:0.0:0.1819	.	18	Q9NX57	RAB20_HUMAN	N	18	ENSP00000267328:K18N	ENSP00000267328:K18N	K	-	3	2	RAB20	110011814	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.658000	0.46733	0.897000	0.36392	0.561000	0.74099	AAG	.	.	.	none		0.652	RAB20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045760.2	NM_017817	
CEBPE	1053	hgsc.bcm.edu	37	14	23586764	23586764	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr14:23586764G>A	ENST00000206513.5	-	2	1302	c.778C>T	c.(778-780)Ctc>Ttc	p.L260F		NM_001805.3	NP_001796.2	Q15744	CEBPE_HUMAN	CCAAT/enhancer binding protein (C/EBP), epsilon	260	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to lipopolysaccharide (GO:0071222)|cytokine biosynthetic process (GO:0042089)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|macrophage differentiation (GO:0030225)|phagocytosis (GO:0006909)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0064)		AGGTTGCGGAGGGTGTCTAGC	0.647																																					p.L260F	NSCLC(63;1230 1818 14565 22565)	Atlas-SNP	.											.	CEBPE	34	.	0			c.C778T						PASS	.						62.0	48.0	53.0					14																	23586764		2203	4300	6503	SO:0001583	missense	1053	exon2			TGCGGAGGGTGTC		CCDS9589.1	14q11.2	2014-09-17			ENSG00000092067	ENSG00000092067		"""basic leucine zipper proteins"""	1836	protein-coding gene	gene with protein product		600749				8661101	Standard	NM_001805		Approved	CRP1	uc001wiv.2	Q15744	OTTHUMG00000028719	ENST00000206513.5:c.778C>T	chr14.hg19:g.23586764G>A	ENSP00000206513:p.Leu260Phe	36.0	0.0	.		39.0	16.0	.	NM_001805	Q15745|Q8IYI2|Q99803	Missense_Mutation	SNP	ENST00000206513.5	hg19	CCDS9589.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840809	0.71488	.	.	ENSG00000092067	ENST00000206513	T	0.52295	0.67	5.38	4.48	0.54585	Basic-leucine zipper (bZIP) transcription factor (2);	0.000000	0.85682	D	0.000000	T	0.67021	0.2849	M	0.81239	2.535	0.45899	D	0.998748	D	0.89917	1.0	D	0.83275	0.996	T	0.70479	-0.4860	10	0.87932	D	0	-21.9209	9.8241	0.40901	0.1613:0.0:0.8387:0.0	.	260	Q15744	CEBPE_HUMAN	F	260	ENSP00000206513:L260F	ENSP00000206513:L260F	L	-	1	0	CEBPE	22656604	1.000000	0.71417	0.850000	0.33497	0.996000	0.88848	3.362000	0.52314	2.532000	0.85374	0.655000	0.94253	CTC	.	.	.	none		0.647	CEBPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071716.2	NM_001805	
KHNYN	23351	hgsc.bcm.edu	37	14	24911432	24911432	+	IGR	SNP	T	T	C	rs201052867		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr14:24911432T>C	ENST00000251343.5	+	0	6225				SDR39U1_ENST00000399390.1_5'Flank|SDR39U1_ENST00000538105.2_Missense_Mutation_p.M12V|SDR39U1_ENST00000555561.1_5'Flank|SDR39U1_ENST00000399395.3_Missense_Mutation_p.D53G|SDR39U1_ENST00000553930.1_5'UTR|SDR39U1_ENST00000555365.1_Intron|SDR39U1_ENST00000554698.1_5'UTR			O15037	KHNYN_HUMAN	KH and NYN domain containing								RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						GACGGCGGCATCGCAGCTCGG	0.667																																					p.D53G		Atlas-SNP	.											.	SDR39U1	19	.	0			c.A158G						PASS	.						26.0	30.0	29.0					14																	24911432		2010	4170	6180	SO:0001628	intergenic_variant	56948	exon3			GCGGCATCGCAGC	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037			chr14.hg19:g.24911432T>C		34.0	0.0	.		35.0	17.0	.	NM_020195	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	ENST00000251343.5	hg19	CCDS32058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.24|14.24	2.476759|2.476759	0.44044|0.44044	.|.	.|.	ENSG00000100445|ENSG00000100445	ENST00000399395;ENST00000336353|ENST00000538105	D|T	0.95853|0.21191	-3.83|2.02	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.207799|.	0.49305|.	N|.	0.000144|.	T|T	0.23492|0.23492	0.0568|0.0568	M|M	0.66297|0.66297	2.02|2.02	0.80722|0.80722	D|D	1|1	P|B	0.35272|0.11235	0.493|0.004	B|B	0.32289|0.12837	0.143|0.008	T|T	0.03278|0.03278	-1.1053|-1.1053	10|8	0.72032|.	D|.	0.01|.	-20.9366|-20.9366	11.7055|11.7055	0.51595|0.51595	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	53|12	Q9NRG7-2|F6RWC2	.|.	G|V	53;79|12	ENSP00000382327:D53G|ENSP00000446077:M12V	ENSP00000336854:D79G|.	D|M	-|-	2|1	0|0	SDR39U1|SDR39U1	23981272|23981272	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.642000|0.642000	0.38348|0.38348	4.911000|4.911000	0.63328|0.63328	2.330000|2.330000	0.79161|0.79161	0.528000|0.528000	0.53228|0.53228	GAT|ATG	.	.	.	alt		0.667	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1		
SERPINA3	12	hgsc.bcm.edu	37	14	95089993	95089993	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr14:95089993G>A	ENST00000467132.1	+	5	2262	c.1114G>A	c.(1114-1116)Gca>Aca	p.A372T	SERPINA3_ENST00000482740.1_Missense_Mutation_p.A154T|SERPINA3_ENST00000393078.3_Missense_Mutation_p.A372T|RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393080.4_Missense_Mutation_p.A372T			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	372	RCL.				acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		GGGCACAGAAGCATCTGCTGC	0.512																																					p.A372T		Atlas-SNP	.											.	SERPINA3	78	.	0			c.G1114A						PASS	.						163.0	140.0	148.0					14																	95089993		2203	4300	6503	SO:0001583	missense	12	exon5			ACAGAAGCATCTG	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.1114G>A	chr14.hg19:g.95089993G>A	ENSP00000450540:p.Ala372Thr	98.0	0.0	.		86.0	24.0	.	NM_001085	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	hg19	CCDS32150.1	.	.	.	.	.	.	.	.	.	.	G	34	5.396546	0.96009	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000467132;ENST00000482740	D;D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79;-2.79	4.95	4.03	0.46877	Serpin domain (3);	0.088586	0.47093	D	0.000244	D	0.93265	0.7854	M	0.92555	3.32	0.45962	D	0.998783	P;P	0.48503	0.656;0.911	P;B	0.44673	0.457;0.44	D	0.94127	0.7385	10	0.87932	D	0	.	14.1908	0.65637	0.0:0.1511:0.8489:0.0	.	372;397	P01011;G3V5I3	AACT_HUMAN;.	T	397;372;372;372;154	ENSP00000452367:A397T;ENSP00000376793:A372T;ENSP00000376795:A372T;ENSP00000450540:A372T;ENSP00000451119:A154T	ENSP00000376793:A372T	A	+	1	0	SERPINA3	94159746	1.000000	0.71417	0.482000	0.27366	0.560000	0.35617	9.300000	0.96151	1.161000	0.42604	0.557000	0.71058	GCA	.	.	.	none		0.512	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085	
SYNE3	161176	hgsc.bcm.edu	37	14	95942145	95942145	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr14:95942145G>A	ENST00000334258.5	-	1	28	c.14C>T	c.(13-15)cCc>cTc	p.P5L	SYNE3_ENST00000557275.1_Missense_Mutation_p.P5L|SYNE3_ENST00000553340.1_Missense_Mutation_p.P5L	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	5					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GTCGTCCTGGGGCTGCTGAGT	0.617																																					p.P5L		Atlas-SNP	.											.	SYNE3	130	.	0			c.C14T						PASS	.																																			SO:0001583	missense	161176	exon1			TCCTGGGGCTGCT	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.14C>T	chr14.hg19:g.95942145G>A	ENSP00000334308:p.Pro5Leu	29.0	0.0	.		32.0	12.0	.	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	hg19	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.003039	0.35320	.	.	ENSG00000176438	ENST00000334258;ENST00000557275;ENST00000553340	T;T;T	0.09723	3.53;3.52;2.95	5.05	4.15	0.48705	.	0.837651	0.09723	N	0.764118	T	0.08313	0.0207	N	0.20685	0.6	0.46203	D	0.998922	B;B;B	0.12013	0.005;0.005;0.003	B;B;B	0.11329	0.006;0.006;0.003	T	0.16748	-1.0392	10	0.29301	T	0.29	-13.6362	10.1912	0.43028	0.1754:0.0:0.8246:0.0	.	5;5;5	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	L	5	ENSP00000334308:P5L;ENSP00000450562:P5L;ENSP00000450774:P5L	ENSP00000334308:P5L	P	-	2	0	C14orf49	95011898	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	3.235000	0.51328	1.115000	0.41800	0.462000	0.41574	CCC	.	.	.	none		0.617	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
ICE2	79664	hgsc.bcm.edu	37	15	60741577	60741577	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr15:60741577A>T	ENST00000261520.4	-	10	1823	c.1589T>A	c.(1588-1590)aTg>aAg	p.M530K	NARG2_ENST00000439632.1_Missense_Mutation_p.M393K	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						ATCTATAGTCATATCATTTTT	0.328																																					p.M530K		Atlas-SNP	.											.	NARG2	82	.	0			c.T1589A						PASS	.						52.0	54.0	53.0					15																	60741577		2203	4297	6500	SO:0001583	missense	79664	exon10			ATAGTCATATCAT																												ENST00000261520.4:c.1589T>A	chr15.hg19:g.60741577A>T	ENSP00000261520:p.Met530Lys	87.0	0.0	.		93.0	38.0	.	NM_024611		Missense_Mutation	SNP	ENST00000261520.4	hg19	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	A	0.372	-0.933198	0.02359	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.06	0.943	0.19531	.	0.776640	0.12418	N	0.470660	T	0.25865	0.0630	N	0.19112	0.55	0.09310	N	1	B;B	0.26400	0.148;0.016	B;B	0.24848	0.056;0.01	T	0.19257	-1.0311	9	0.28530	T	0.3	-0.0038	9.6349	0.39802	0.7606:0.0:0.2394:0.0	.	198;530	B3KXT2;Q659A1	.;NARG2_HUMAN	K	530;393	.	ENSP00000261520:M530K	M	-	2	0	NARG2	58528869	0.003000	0.15002	0.001000	0.08648	0.005000	0.04900	1.397000	0.34543	0.268000	0.21939	0.528000	0.53228	ATG	.	.	.	none		0.328	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
RORA	6095	hgsc.bcm.edu	37	15	60803577	60803577	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr15:60803577A>G	ENST00000335670.6	-	5	768	c.668T>C	c.(667-669)cTg>cCg	p.L223P	RORA_ENST00000261523.5_Missense_Mutation_p.L256P|RP11-219B17.1_ENST00000501579.2_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000449337.2_Missense_Mutation_p.L168P|RP11-219B17.1_ENST00000558140.1_RNA|RORA_ENST00000560004.1_5'Flank|RP11-219B17.1_ENST00000559824.1_RNA|RP11-219B17.1_ENST00000559902.1_RNA|RORA_ENST00000309157.4_Missense_Mutation_p.L248P	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	223	Hinge.				angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						CTGTATGTCCAGGTAGAAGCT	0.532																																					p.L256P		Atlas-SNP	.											.	RORA	114	.	0			c.T767C						PASS	.						193.0	148.0	163.0					15																	60803577		2203	4300	6503	SO:0001583	missense	6095	exon6			ATGTCCAGGTAGA	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.668T>C	chr15.hg19:g.60803577A>G	ENSP00000335087:p.Leu223Pro	148.0	0.0	.		207.0	73.0	.	NM_134260	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	hg19	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	A	16.23	3.063733	0.55432	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	D;D;D;D	0.95001	-3.53;-3.52;-3.58;-3.49	5.9	5.9	0.94986	.	0.065297	0.64402	D	0.000006	D	0.92854	0.7727	L	0.38838	1.175	0.80722	D	1	B;B;D;B	0.54207	0.006;0.005;0.965;0.024	B;B;P;B	0.48488	0.012;0.023;0.579;0.038	D	0.91956	0.5575	10	0.31617	T	0.26	.	16.3322	0.83039	1.0:0.0:0.0:0.0	.	223;248;256;168	P35398-2;P35398-3;P35398;P35398-4	.;.;RORA_HUMAN;.	P	223;168;248;256	ENSP00000335087:L223P;ENSP00000402971:L168P;ENSP00000309753:L248P;ENSP00000261523:L256P	ENSP00000261523:L256P	L	-	2	0	RORA	58590869	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.948000	0.93006	2.251000	0.74343	0.528000	0.53228	CTG	.	.	.	none		0.532	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
AKAP13	11214	hgsc.bcm.edu	37	15	86122646	86122646	+	Silent	SNP	C	C	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr15:86122646C>T	ENST00000394518.2	+	7	1442	c.1347C>T	c.(1345-1347)gaC>gaT	p.D449D	AKAP13_ENST00000361243.2_Silent_p.D449D|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	449					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TTCAGAGAGACTTGGTCATGG	0.512																																					p.D449D	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.C1347T						PASS	.						63.0	67.0	66.0					15																	86122646		2202	4299	6501	SO:0001819	synonymous_variant	11214	exon7			GAGAGACTTGGTC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1347C>T	chr15.hg19:g.86122646C>T		78.0	0.0	.		79.0	31.0	.	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	hg19	CCDS32319.1																																																																																			.	.	.	none		0.512	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
HMOX2	3163	hgsc.bcm.edu	37	16	4557964	4557964	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr16:4557964A>G	ENST00000570646.1	+	4	1060	c.455A>G	c.(454-456)cAt>cGt	p.H152R	HMOX2_ENST00000414777.1_Missense_Mutation_p.H152R|HMOX2_ENST00000575120.1_Missense_Mutation_p.H123R|HMOX2_ENST00000398595.3_Missense_Mutation_p.H152R|HMOX2_ENST00000406590.2_Missense_Mutation_p.H152R|HMOX2_ENST00000458134.3_Missense_Mutation_p.H152R|HMOX2_ENST00000219700.6_Missense_Mutation_p.H152R	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	152					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						CTGGTGGCCCATGCATACACC	0.627																																					p.H152R		Atlas-SNP	.											.	HMOX2	22	.	0			c.A455G						PASS	.						43.0	45.0	45.0					16																	4557964		2197	4300	6497	SO:0001583	missense	3163	exon4			TGGCCCATGCATA		CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.455A>G	chr16.hg19:g.4557964A>G	ENSP00000459214:p.His152Arg	50.0	0.0	.		90.0	41.0	.	NM_001127205	A8MT35|D3DUD5|I3L430|O60605	Missense_Mutation	SNP	ENST00000570646.1	hg19	CCDS10517.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.618349	0.87359	.	.	ENSG00000103415	ENST00000406590;ENST00000458134;ENST00000219700;ENST00000414777;ENST00000398595	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.62	5.62	0.85841	Haem oxygenase conserved site (1);Haem oxygenase-like, multi-helical (2);	0.000000	0.85682	D	0.000000	T	0.68357	0.2992	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79468	-0.1791	10	0.87932	D	0	-17.4632	14.6409	0.68723	1.0:0.0:0.0:0.0	.	152;152	B3KSE0;P30519	.;HMOX2_HUMAN	R	152	ENSP00000385100:H152R;ENSP00000394103:H152R;ENSP00000219700:H152R;ENSP00000391637:H152R;ENSP00000381595:H152R	ENSP00000219700:H152R	H	+	2	0	HMOX2	4497965	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	9.339000	0.96797	2.142000	0.66516	0.459000	0.35465	CAT	.	.	.	none		0.627	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251636.2		
CES1	1066	hgsc.bcm.edu	37	16	55846940	55846940	+	Missense_Mutation	SNP	C	C	T	rs138161688		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr16:55846940C>T	ENST00000361503.4	-	9	1088	c.958G>A	c.(958-960)Ggc>Agc	p.G320S	CES1_ENST00000422046.2_Missense_Mutation_p.G320S|CES1_ENST00000360526.3_Missense_Mutation_p.G321S			P23141	EST1_HUMAN	carboxylesterase 1	320					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	ATCACAGTGCCCAGAAGGGGT	0.532																																					p.G321S	NSCLC(162;1801 2756 42904 52896)	Atlas-SNP	.											.	CES1	78	.	0			c.G961A						PASS	.	G	SER/GLY,SER/GLY,SER/GLY	0,4396		0,0,2198	104.0	100.0	101.0		958,961,958	-7.7	0.0	16	dbSNP_134	101	1,8599		0,1,4299	no	missense,missense,missense	CES1	NM_001025194.1,NM_001025195.1,NM_001266.4	56,56,56	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	320/568,321/569,320/567	55846940	1,12995	2198	4300	6498	SO:0001583	missense	1066	exon9			CAGTGCCCAGAAG	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.958G>A	chr16.hg19:g.55846940C>T	ENSP00000355193:p.Gly320Ser	32.0	0.0	.		48.0	30.0	.	NM_001025195	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	hg19	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	6.832	0.522731	0.13066	0.0	1.16E-4	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.08634	3.22;3.22;3.07	3.85	-7.71	0.01254	Carboxylesterase, type B (1);	1.383420	0.04583	N	0.395340	T	0.02533	0.0077	N	0.02412	-0.56	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.15052	0.012;0.012;0.007	T	0.42344	-0.9457	10	0.32370	T	0.25	.	2.9914	0.05984	0.1197:0.3586:0.3581:0.1636	.	320;320;321	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	S	321;320;320;185	ENSP00000353720:G321S;ENSP00000355193:G320S;ENSP00000390492:G320S	ENSP00000353720:G321S	G	-	1	0	CES1	54404441	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.577000	0.02127	-1.091000	0.03065	-1.907000	0.00523	GGC	.	C|1.000;T|0.000	0.000	weak		0.532	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
E2F4	1874	hgsc.bcm.edu	37	16	67226690	67226690	+	Silent	SNP	G	G	A	rs143700278		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr16:67226690G>A	ENST00000379378.3	+	2	221	c.162G>A	c.(160-162)caG>caA	p.Q54Q	EXOC3L1_ENST00000314586.6_5'Flank|E2F4_ENST00000564718.1_3'UTR|EXOC3L1_ENST00000562887.1_5'Flank	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	54	Leucine-zipper.				blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		CTGTACGCCAGAAGCGGCGGA	0.547																																					p.Q54Q		Atlas-SNP	.											.	E2F4	25	.	0			c.G162A						PASS	.	G		0,4394		0,0,2197	44.0	38.0	40.0		162	4.8	1.0	16	dbSNP_134	40	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	E2F4	NM_001950.3		0,2,6495	AA,AG,GG		0.0233,0.0,0.0154		54/414	67226690	2,12992	2197	4300	6497	SO:0001819	synonymous_variant	1874	exon2			ACGCCAGAAGCGG	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.162G>A	chr16.hg19:g.67226690G>A		63.0	0.0	.		72.0	37.0	.	NM_001950	A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	ENST00000379378.3	hg19	CCDS32464.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.547	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
AARS	16	hgsc.bcm.edu	37	16	70316587	70316587	+	Missense_Mutation	SNP	T	T	C	rs77753666		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr16:70316587T>C	ENST00000261772.8	-	2	223	c.80A>G	c.(79-81)cAc>cGc	p.H27R		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		GGCAGACGAGTGAACATACGT	0.448																																					p.H27R		Atlas-SNP	.											.	AARS	62	.	0			c.A80G						PASS	.						175.0	164.0	168.0					16																	70316587		2198	4300	6498	SO:0001583	missense	16	exon2			GACGAGTGAACAT	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.80A>G	chr16.hg19:g.70316587T>C	ENSP00000261772:p.His27Arg	74.0	0.0	.		100.0	60.0	.	NM_001605		Missense_Mutation	SNP	ENST00000261772.8	hg19	CCDS32474.1	.	.	.	.	.	.	.	.	.	.	T	5.294	0.239679	0.10023	.	.	ENSG00000090861	ENST00000261772	D	0.81739	-1.53	5.56	5.56	0.83823	Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84561	0.5499	L	0.42487	1.325	0.80722	D	1	D	0.67145	0.996	D	0.75020	0.985	T	0.82372	-0.0490	10	0.27082	T	0.32	-19.0749	13.6719	0.62430	0.0:0.0:0.0:1.0	.	27	P49588	SYAC_HUMAN	R	27	ENSP00000261772:H27R	ENSP00000261772:H27R	H	-	2	0	AARS	68874088	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	7.799000	0.85936	2.108000	0.64289	0.482000	0.46254	CAC	.	.	.	alt		0.448	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
FAM92B	339145	hgsc.bcm.edu	37	16	85144008	85144008	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr16:85144008G>C	ENST00000539556.1	-	2	234	c.79C>G	c.(79-81)Cag>Gag	p.Q27E		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	27										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						GAGCAGAACTGCCCAAAGTAC	0.627																																					p.Q27E		Atlas-SNP	.											.	FAM92B	29	.	0			c.C79G						PASS	.						58.0	58.0	58.0					16																	85144008		2198	4300	6498	SO:0001583	missense	339145	exon2			AGAACTGCCCAAA		CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.79C>G	chr16.hg19:g.85144008G>C	ENSP00000443411:p.Gln27Glu	60.0	0.0	.		78.0	23.0	.	NM_198491		Missense_Mutation	SNP	ENST00000539556.1	hg19	CCDS32500.1	.	.	.	.	.	.	.	.	.	.	G	6.166	0.398907	0.11696	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.27256	1.68	5.12	4.15	0.48705	.	0.216981	0.31936	N	0.006838	T	0.16342	0.0393	L	0.31578	0.945	0.28775	N	0.900143	B	0.32939	0.391	B	0.33799	0.17	T	0.15521	-1.0434	10	0.02654	T	1	-29.3987	12.675	0.56889	0.0:0.0:0.8335:0.1665	.	27	Q6ZTR7	FA92B_HUMAN	E	27	ENSP00000443411:Q27E	ENSP00000376937:Q27E	Q	-	1	0	FAM92B	83701509	1.000000	0.71417	0.986000	0.45419	0.959000	0.62525	2.336000	0.43938	1.116000	0.41820	0.561000	0.74099	CAG	.	.	.	none		0.627	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_198491	
PIK3R5	23533	hgsc.bcm.edu	37	17	8794161	8794161	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr17:8794161G>A	ENST00000447110.1	-	7	675	c.551C>T	c.(550-552)aCg>aTg	p.T184M	PIK3R5_ENST00000581552.1_Missense_Mutation_p.T184M|PIK3R5_ENST00000584803.1_Missense_Mutation_p.T184M	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	184					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GTGTCCGGGCGTACTCAGCTT	0.647																																					p.T184M	NSCLC(18;589 615 7696 20311 50332)	Atlas-SNP	.											.	PIK3R5	79	.	0			c.C551T						PASS	.						153.0	116.0	129.0					17																	8794161		2203	4300	6503	SO:0001583	missense	23533	exon7			CCGGGCGTACTCA	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.551C>T	chr17.hg19:g.8794161G>A	ENSP00000392812:p.Thr184Met	35.0	0.0	.		48.0	23.0	.	NM_001142633	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	hg19	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	G	1.328	-0.597516	0.03771	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.77620	-1.11	5.24	4.06	0.47325	.	0.930217	0.09115	N	0.846548	T	0.71048	0.3294	N	0.19112	0.55	0.09310	N	1	P	0.43542	0.81	P	0.50109	0.631	T	0.60089	-0.7331	10	0.44086	T	0.13	-6.0E-4	6.061	0.19839	0.0865:0.1349:0.6404:0.1381	.	184	Q8WYR1	PI3R5_HUMAN	M	184	ENSP00000392812:T184M	ENSP00000269300:T184M	T	-	2	0	PIK3R5	8734886	0.002000	0.14202	0.004000	0.12327	0.019000	0.09904	1.078000	0.30754	2.433000	0.82419	0.555000	0.69702	ACG	.	.	.	none		0.647	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308	
SMCR8	140775	hgsc.bcm.edu	37	17	18220533	18220533	+	Missense_Mutation	SNP	C	C	T	rs571482412	byFrequency	TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr17:18220533C>T	ENST00000406438.3	+	1	1910	c.1430C>T	c.(1429-1431)aCg>aTg	p.T477M	TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	477						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						GTTTTGGGCACGGAGAAATCC	0.512													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19889	0.0		0.0	False		,,,				2504	0.0				p.T477M		Atlas-SNP	.											.	SMCR8	62	.	0			c.C1430T						PASS	.						63.0	65.0	64.0					17																	18220533		2203	4300	6503	SO:0001583	missense	140775	exon1			TGGGCACGGAGAA	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1430C>T	chr17.hg19:g.18220533C>T	ENSP00000385025:p.Thr477Met	39.0	0.0	.		52.0	14.0	.	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	hg19	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	C	13.09	2.131979	0.37630	.	.	ENSG00000176994	ENST00000406438	T	0.34859	1.34	5.73	4.76	0.60689	.	0.269349	0.37012	N	0.002284	T	0.49201	0.1543	L	0.34521	1.04	0.39220	D	0.963485	D	0.89917	1.0	D	0.78314	0.991	T	0.55088	-0.8195	10	0.62326	D	0.03	-23.1601	15.0297	0.71696	0.0:0.9319:0.0:0.0681	.	477	Q8TEV9	SMCR8_HUMAN	M	477	ENSP00000385025:T477M	ENSP00000385025:T477M	T	+	2	0	SMCR8	18161258	0.990000	0.36364	0.882000	0.34594	0.535000	0.34838	2.896000	0.48656	1.437000	0.47472	-0.122000	0.15005	ACG	.	.	.	none		0.512	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
KSR1	8844	hgsc.bcm.edu	37	17	25919618	25919618	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr17:25919618A>G	ENST00000319524.6	+	9	1265	c.1265A>G	c.(1264-1266)cAt>cGt	p.H422R	KSR1_ENST00000509603.2_Missense_Mutation_p.H422R|KSR1_ENST00000398988.3_Missense_Mutation_p.H285R|KSR1_ENST00000268763.6_Missense_Mutation_p.H285R|KSR1_ENST00000581975.1_3'UTR			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	422					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GCCGAACCCCATTTTGGAACC	0.547																																					p.H285R	Esophageal Squamous(88;1120 1336 6324 10502 16832)	Atlas-SNP	.											.	KSR1	151	.	0			c.A854G						PASS	.						71.0	70.0	71.0					17																	25919618		1910	4120	6030	SO:0001583	missense	8844	exon9			AACCCCATTTTGG	U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.1265A>G	chr17.hg19:g.25919618A>G	ENSP00000323178:p.His422Arg	68.0	0.0	.		91.0	34.0	.	NM_014238	F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	ENST00000319524.6	hg19		.	.	.	.	.	.	.	.	.	.	A	16.91	3.251807	0.59212	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982	T;T;T	0.80738	-1.41;-1.34;-1.41	5.14	5.14	0.70334	.	0.463486	0.26136	N	0.026130	T	0.75568	0.3867	L	0.58810	1.83	0.32224	N	0.574889	P;P	0.43826	0.544;0.818	B;B	0.39840	0.162;0.311	T	0.77308	-0.2636	10	0.14252	T	0.57	.	14.1401	0.65313	1.0:0.0:0.0:0.0	.	420;422	Q8IVT5;F5H0K8	KSR1_HUMAN;.	R	422;422;285;285	ENSP00000323178:H422R;ENSP00000438795:H422R;ENSP00000268763:H285R	ENSP00000268763:H285R	H	+	2	0	KSR1	22943745	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	6.933000	0.75874	1.951000	0.56629	0.482000	0.46254	CAT	.	.	.	none		0.547	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_014238	
NR1D1	9572	hgsc.bcm.edu	37	17	38249443	38249443	+	Silent	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr17:38249443A>G	ENST00000246672.3	-	8	2368	c.1738T>C	c.(1738-1740)Ttg>Ctg	p.L580L	THRA_ENST00000584985.1_Silent_p.Q388Q|THRA_ENST00000394121.4_Silent_p.Q427Q|THRA_ENST00000264637.4_Silent_p.Q427Q	NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	580	Ligand-binding.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					GAAGTCTCCAAGGGCCGGTTC	0.637																																					p.L580L		Atlas-SNP	.											.	NR1D1	45	.	0			c.T1738C						PASS	.						44.0	46.0	45.0					17																	38249443		2203	4300	6503	SO:0001819	synonymous_variant	9572	exon8			TCTCCAAGGGCCG	X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.1738T>C	chr17.hg19:g.38249443A>G		60.0	0.0	.		81.0	57.0	.	NM_021724	Q0P5Z4|Q15304	Silent	SNP	ENST00000246672.3	hg19	CCDS11361.1																																																																																			.	.	.	none		0.637	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257135.1		
CEP131	22994	hgsc.bcm.edu	37	17	79166382	79166382	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr17:79166382T>C	ENST00000269392.4	-	20	2697	c.2450A>G	c.(2449-2451)gAg>gGg	p.E817G	AZI1_ENST00000374782.3_Missense_Mutation_p.E778G|AZI1_ENST00000450824.2_Missense_Mutation_p.E814G|AZI1_ENST00000575907.1_Missense_Mutation_p.E781G	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		817					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTCTTCCAGCTCCGCCCGCTG	0.682																																					p.E814G		Atlas-SNP	.											.	AZI1	145	.	0			c.A2441G						PASS	.						22.0	21.0	21.0					17																	79166382		2187	4289	6476	SO:0001583	missense	22994	exon20			TCCAGCTCCGCCC																												ENST00000269392.4:c.2450A>G	chr17.hg19:g.79166382T>C	ENSP00000269392:p.Glu817Gly	54.0	0.0	.		64.0	18.0	.	NM_014984	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	hg19		.	.	.	.	.	.	.	.	.	.	T	18.92	3.725194	0.68959	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.18174	2.23;2.24;2.23	3.28	3.28	0.37604	.	0.064317	0.64402	D	0.000012	T	0.37544	0.1007	M	0.66939	2.045	0.53688	D	0.999972	D;D;D;D	0.89917	1.0;1.0;0.998;0.998	D;D;D;D	0.87578	0.998;0.998;0.948;0.948	T	0.22417	-1.0217	10	0.72032	D	0.01	-15.5695	11.7935	0.52084	0.0:0.0:0.0:1.0	.	814;817;778;814	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	G	814;778;817	ENSP00000393583:E814G;ENSP00000363914:E778G;ENSP00000269392:E817G	ENSP00000269392:E817G	E	-	2	0	AZI1	76780977	1.000000	0.71417	0.904000	0.35570	0.561000	0.35649	5.333000	0.65917	1.368000	0.46115	0.260000	0.18958	GAG	.	.	.	none		0.682	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1		
TGIF1	7050	hgsc.bcm.edu	37	18	3457644	3457644	+	Silent	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr18:3457644T>C	ENST00000330513.5	+	3	1215	c.912T>C	c.(910-912)caT>caC	p.H304H	TGIF1_ENST00000551541.1_Silent_p.H155H|TGIF1_ENST00000401449.1_Silent_p.H155H|TGIF1_ENST00000472042.1_Silent_p.H155H|TGIF1_ENST00000407501.2_Silent_p.H175H|TGIF1_ENST00000405385.3_Silent_p.H155H|TGIF1_ENST00000343820.5_Silent_p.H175H|TGIF1_ENST00000345133.5_Silent_p.H155H|TGIF1_ENST00000548489.2_Silent_p.H189H|TGIF1_ENST00000400167.2_Silent_p.H155H	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	304					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				TGATCTGCCATACCACTGTGA	0.522																																					p.H304H		Atlas-SNP	.											.	TGIF1	41	.	0			c.T912C						PASS	.						79.0	69.0	72.0					18																	3457644		2203	4300	6503	SO:0001819	synonymous_variant	7050	exon3			CTGCCATACCACT	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.912T>C	chr18.hg19:g.3457644T>C		85.0	0.0	.		81.0	25.0	.	NM_170695	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Silent	SNP	ENST00000330513.5	hg19	CCDS11834.1																																																																																			.	.	.	none		0.522	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
GADD45B	4616	hgsc.bcm.edu	37	19	2477521	2477521	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr19:2477521G>C	ENST00000215631.4	+	4	637	c.405G>C	c.(403-405)ttG>ttC	p.L135F		NM_015675.3	NP_056490.2	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	135					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|lung(1)|ovary(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCACGGCTTGGTGGAGGTGG	0.607																																					p.L135F		Atlas-SNP	.											.	GADD45B	6	.	0			c.G405C						PASS	.						45.0	43.0	44.0					19																	2477521		2203	4300	6503	SO:0001583	missense	4616	exon4			CGGCTTGGTGGAG	AF090950	CCDS32868.1	19p13.3	2012-10-02			ENSG00000099860	ENSG00000099860			4096	protein-coding gene	gene with protein product	"""myeloid differentiation primary response"", ""growth arrest and DNA-damage-inducible beta"""	604948		MYD118		1899477, 9827804	Standard	NM_015675		Approved	GADD45BETA, DKFZP566B133	uc002lwb.2	O75293	OTTHUMG00000180434	ENST00000215631.4:c.405G>C	chr19.hg19:g.2477521G>C	ENSP00000215631:p.Leu135Phe	20.0	0.0	.		35.0	17.0	.	NM_015675	A8KAM2|O75960|Q17R46	Missense_Mutation	SNP	ENST00000215631.4	hg19	CCDS32868.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697218	0.88830	.	.	ENSG00000099860	ENST00000215631	T	0.55413	0.52	4.66	4.66	0.58398	.	0.076693	0.53938	D	0.000053	T	0.71484	0.3345	M	0.84082	2.675	0.80722	D	1	D	0.71674	0.998	P	0.62089	0.898	T	0.75852	-0.3171	10	0.51188	T	0.08	.	15.0579	0.71930	0.0:0.0:1.0:0.0	.	135	O75293	GA45B_HUMAN	F	135	ENSP00000215631:L135F	ENSP00000215631:L135F	L	+	3	2	GADD45B	2428521	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.014000	0.57145	2.126000	0.65437	0.542000	0.68232	TTG	.	.	.	none		0.607	GADD45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451337.1	NM_015675	
ZNF283	284349	hgsc.bcm.edu	37	19	44341266	44341266	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr19:44341266A>T	ENST00000324461.7	+	6	569	c.272A>T	c.(271-273)gAc>gTc	p.D91V	ZNF283_ENST00000588797.1_Intron|ZNF283_ENST00000586976.1_3'UTR|ZNF283_ENST00000590950.1_Missense_Mutation_p.D66V|ZNF283_ENST00000310738.8_Missense_Mutation_p.D55V|ZNF283_ENST00000593164.1_Missense_Mutation_p.D66V|ZNF283_ENST00000593268.1_Missense_Mutation_p.D91V	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	91	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				GAATGCCTGGACCCTGCTCAG	0.453																																					p.D91V		Atlas-SNP	.											.	ZNF283	83	.	0			c.A272T						PASS	.						166.0	180.0	175.0					19																	44341266		2203	4300	6503	SO:0001583	missense	284349	exon6			GCCTGGACCCTGC	AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.272A>T	chr19.hg19:g.44341266A>T	ENSP00000327314:p.Asp91Val	82.0	0.0	.		92.0	33.0	.	NM_181845	B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation	SNP	ENST00000324461.7	hg19	CCDS46097.1	.	.	.	.	.	.	.	.	.	.	A	16.64	3.178962	0.57692	.	.	ENSG00000167637	ENST00000324461;ENST00000310738	T;T	0.02837	4.14;4.14	4.08	1.91	0.25777	Krueppel-associated box (4);	.	.	.	.	T	0.14356	0.0347	H	0.95504	3.68	0.34818	D	0.738409	D	0.56521	0.976	P	0.58172	0.834	T	0.04708	-1.0932	9	0.87932	D	0	.	4.0098	0.09618	0.6729:0.2131:0.114:0.0	.	91	Q8N7M2	ZN283_HUMAN	V	91;55	ENSP00000327314:D91V;ENSP00000312519:D55V	ENSP00000312519:D55V	D	+	2	0	ZNF283	49033106	0.087000	0.21565	0.991000	0.47740	0.997000	0.91878	0.216000	0.17585	0.142000	0.18901	0.477000	0.44152	GAC	.	.	.	none		0.453	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459909.1	NM_181845	
SYMPK	8189	hgsc.bcm.edu	37	19	46355636	46355636	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr19:46355636A>G	ENST00000245934.7	-	5	477	c.233T>C	c.(232-234)aTc>aCc	p.I78T		NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	78	Interaction with HSF1.				cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TTGGAATGCGATGATCTCCTG	0.527																																					p.I78T		Atlas-SNP	.											.	SYMPK	104	.	0			c.T233C						PASS	.						174.0	172.0	173.0					19																	46355636		2048	4195	6243	SO:0001583	missense	8189	exon5			AATGCGATGATCT	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.233T>C	chr19.hg19:g.46355636A>G	ENSP00000245934:p.Ile78Thr	112.0	0.0	.		101.0	37.0	.	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	hg19	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	A	17.00	3.276339	0.59649	.	.	ENSG00000125755	ENST00000245934;ENST00000340643	T	0.34072	1.38	4.81	4.81	0.61882	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.30008	0.0751	L	0.38838	1.175	0.80722	D	1	P;P	0.36874	0.572;0.519	B;B	0.36030	0.216;0.177	T	0.12915	-1.0529	10	0.54805	T	0.06	.	12.6398	0.56702	1.0:0.0:0.0:0.0	.	93;78	Q4LE61;Q92797	.;SYMPK_HUMAN	T	78;82	ENSP00000245934:I78T	ENSP00000245934:I78T	I	-	2	0	SYMPK	51047476	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.581000	0.90788	1.929000	0.55896	0.459000	0.35465	ATC	.	.	.	none		0.527	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
ZNF649	65251	hgsc.bcm.edu	37	19	52394350	52394350	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr19:52394350C>A	ENST00000354957.3	-	5	1323	c.1039G>T	c.(1039-1041)Gga>Tga	p.G347*	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Nonsense_Mutation_p.G319*	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		TCAATGCATCCATAAGGTTTC	0.453																																					p.G347X		Atlas-SNP	.											.	ZNF649	72	.	0			c.G1039T						PASS	.						146.0	116.0	126.0					19																	52394350		2203	4300	6503	SO:0001587	stop_gained	65251	exon5			TGCATCCATAAGG	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.1039G>T	chr19.hg19:g.52394350C>A	ENSP00000347043:p.Gly347*	71.0	0.0	.		79.0	30.0	.	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Nonsense_Mutation	SNP	ENST00000354957.3	hg19	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380873	0.82792	.	.	ENSG00000198093	ENST00000354957	.	.	.	2.52	1.47	0.22746	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	1.3017	0.02080	0.2192:0.4244:0.2154:0.141	.	.	.	.	X	347	.	ENSP00000347043:G347X	G	-	1	0	ZNF649	57086162	0.000000	0.05858	0.219000	0.23793	0.013000	0.08279	-2.196000	0.01241	0.273000	0.22049	0.404000	0.27445	GGA	.	.	.	none		0.453	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
CTCFL	140690	hgsc.bcm.edu	37	20	56098332	56098332	+	Silent	SNP	G	G	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr20:56098332G>A	ENST00000608263.1	-	2	1207	c.546C>T	c.(544-546)ctC>ctT	p.L182L	CTCFL_ENST00000371196.2_Silent_p.L182L|CTCFL_ENST00000502686.2_Intron|CTCFL_ENST00000423479.3_Silent_p.L182L|CTCFL_ENST00000608158.1_Silent_p.L182L|CTCFL_ENST00000608425.1_Silent_p.L182L|CTCFL_ENST00000608858.1_Intron|CTCFL_ENST00000609232.1_Silent_p.L182L|CTCFL_ENST00000539382.1_5'UTR|CTCFL_ENST00000433949.3_5'UTR|CTCFL_ENST00000481655.2_Silent_p.L182L|CTCFL_ENST00000429804.3_Silent_p.L182L|CTCFL_ENST00000608440.1_Silent_p.L182L|CTCFL_ENST00000608903.1_Intron|CTCFL_ENST00000422869.2_Silent_p.L182L|CTCFL_ENST00000243914.3_Silent_p.L182L|CTCFL_ENST00000432255.2_Silent_p.L182L	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	182					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GCTCTTCCTCGAGCTAATAAA	0.353																																					p.L182L		Atlas-SNP	.											.	CTCFL	97	.	0			c.C546T						PASS	.						85.0	83.0	84.0					20																	56098332		2202	4300	6502	SO:0001819	synonymous_variant	140690	exon2			TTCCTCGAGCTAA		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.546C>T	chr20.hg19:g.56098332G>A		146.0	0.0	.		163.0	67.0	.	NM_001269044	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Silent	SNP	ENST00000608263.1	hg19	CCDS13459.1																																																																																			.	.	.	none		0.353	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
THOC2	57187	hgsc.bcm.edu	37	X	122766884	122766884	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chrX:122766884T>C	ENST00000245838.8	-	21	2175	c.2144A>G	c.(2143-2145)tAt>tGt	p.Y715C	THOC2_ENST00000355725.4_Missense_Mutation_p.Y715C|THOC2_ENST00000491737.1_Missense_Mutation_p.Y600C	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	715					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						CTGACCAAAATAACCACCCTG	0.388																																					p.Y715C		Atlas-SNP	.											.	THOC2	310	.	0			c.A2144G						PASS	.						120.0	97.0	104.0					X																	122766884		1842	4081	5923	SO:0001583	missense	57187	exon21			CCAAAATAACCAC	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.2144A>G	chrX.hg19:g.122766884T>C	ENSP00000245838:p.Tyr715Cys	59.0	0.0	.		64.0	49.0	.	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	hg19	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.074453	0.76415	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000010	T	0.78046	0.4222	M	0.80982	2.52	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.63033	0.91;0.91	T	0.79647	-0.1716	9	0.45353	T	0.12	-12.6621	15.0184	0.71605	0.0:0.0:0.0:1.0	.	640;715	B4DKZ6;Q8NI27	.;THOC2_HUMAN	C	715;715;600;640	.	ENSP00000245838:Y715C	Y	-	2	0	THOC2	122594565	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.024000	0.88770	1.929000	0.55896	0.437000	0.28790	TAT	.	.	.	none		0.388	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
SMCR8	140775	hgsc.bcm.edu	37	17	18220521	18220521	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr17:18220521delA	ENST00000406438.3	+	1	1898	c.1418delA	c.(1417-1419)gaafs	p.E473fs	TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	473						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						GAAAGTATTGAAGTTTTGGGC	0.502																																					p.E473fs		Atlas-Indel,Pindel	.											.	SMCR8	62	.	0			c.1417delG						PASS	.						68.0	69.0	69.0					17																	18220521		2203	4300	6503	SO:0001589	frameshift_variant	140775	exon1			.	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1418delA	chr17.hg19:g.18220521delA	ENSP00000385025:p.Glu473fs	49.0	0.0	0		51.0	15.0	0.294118	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Frame_Shift_Del	DEL	ENST00000406438.3	hg19	CCDS11195.2																																																																																			.	.	.	none		0.502	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
SLC9A4	389015	hgsc.bcm.edu	37	2	103120119	103120119	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:103120119delT	ENST00000295269.4	+	3	1390	c.933delT	c.(931-933)tatfs	p.Y311fs		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	311					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGTTCAGCTATTTGTCTTACT	0.393																																					p.Y311fs		Atlas-Indel,Pindel	.											.	SLC9A4	115	.	0			c.932delA						PASS	.						199.0	186.0	190.0					2																	103120119		2203	4300	6503	SO:0001589	frameshift_variant	389015	exon3			.		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.933delT	chr2.hg19:g.103120119delT	ENSP00000295269:p.Tyr311fs	211.0	0.0	0		227.0	68.0	0.299559	NM_001011552	Q69YK0	Frame_Shift_Del	DEL	ENST00000295269.4	hg19	CCDS33264.1																																																																																			.	.	.	none		0.393	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3	
PHYKPL	85007	hgsc.bcm.edu	37	5	177632987	177632988	+	IGR	INS	-	-	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr5:177632987_177632988insA	ENST00000308158.5	-	0	2038				HNRNPAB_ENST00000515193.1_Frame_Shift_Ins_p.K119fs|HNRNPAB_ENST00000504898.1_Frame_Shift_Ins_p.K119fs|HNRNPAB_ENST00000506339.1_Frame_Shift_Ins_p.K119fs|PHYKPL_ENST00000481811.1_5'Flank|HNRNPAB_ENST00000355836.5_Frame_Shift_Ins_p.K119fs|HNRNPAB_ENST00000514633.1_Frame_Shift_Ins_p.K119fs|HNRNPAB_ENST00000506259.1_Frame_Shift_Ins_p.K119fs|HNRNPAB_ENST00000358344.3_Frame_Shift_Ins_p.K119fs	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase							mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	TTATCCTGTTCAAAGATGCAGC	0.406																																					p.F118fs		Atlas-Indel,Pindel	.											.	HNRNPAB	24	.	0			c.354_355insA						PASS	.																																			SO:0001628	intergenic_variant	3182	exon3			.	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892		chr5.hg19:g.177632990_177632990dupA		124.0	0.0	0		124.0	54.0	0.435484	NM_004499	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Frame_Shift_Ins	INS	ENST00000308158.5	hg19	CCDS4434.1																																																																																			.	.	.	none		0.406	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
GUCY2C	2984	hgsc.bcm.edu	37	12	14822676	14822676	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr12:14822676delG	ENST00000261170.3	-	10	1398	c.1262delC	c.(1261-1263)cctfs	p.P421fs	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	421					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	AATATCATTAGGAAGTTTAGA	0.383																																					p.P421fs		Atlas-Indel,Pindel	.											.	GUCY2C	126	.	0			c.1263delT						PASS	.						113.0	109.0	111.0					12																	14822676		2203	4300	6503	SO:0001589	frameshift_variant	2984	exon10			.		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1262delC	chr12.hg19:g.14822676delG	ENSP00000261170:p.Pro421fs	58.0	0.0	0		62.0	20.0	0.322581	NM_004963	B2RMY6	Frame_Shift_Del	DEL	ENST00000261170.3	hg19	CCDS8664.1																																																																																			.	.	.	none		0.383	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
VPS52	6293	hgsc.bcm.edu	37	6	33231610	33231610	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr6:33231610delG	ENST00000445902.2	-	16	1885	c.1667delC	c.(1666-1668)tcafs	p.S556fs	VPS52_ENST00000436044.2_Frame_Shift_Del_p.S431fs|VPS52_ENST00000478934.1_5'UTR|VPS52_ENST00000482399.1_3'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	556					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						CTCCTTCCTTGAGGAGAACTC	0.512																																					p.S556fs		Atlas-Indel,Pindel	.											.	VPS52	56	.	0			c.1668delA						PASS	.						75.0	65.0	68.0					6																	33231610		2203	4300	6503	SO:0001589	frameshift_variant	6293	exon16			.	AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1667delC	chr6.hg19:g.33231610delG	ENSP00000409952:p.Ser556fs	55.0	0.0	0		70.0	22.0	0.314286	NM_022553	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Frame_Shift_Del	DEL	ENST00000445902.2	hg19	CCDS4770.2																																																																																			.	.	.	none		0.512	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
DIEXF	27042	hgsc.bcm.edu	37	1	210010373	210010380	+	Frame_Shift_Del	DEL	CTACCCGG	CTACCCGG	-	rs200536666		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	CTACCCGG	CTACCCGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:210010373_210010380delCTACCCGG	ENST00000491415.2	+	6	936_943	c.879_886delCTACCCGG	c.(877-888)ttctacccggaafs	p.FYPE293fs		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	293					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						GGGACCTGTTCTACCCGGAAAGGACTGC	0.49																																					p.293_295del		Atlas-Indel,Pindel	.											.	DIEXF	97	.	0			c.878_885del						PASS	.																																			SO:0001589	frameshift_variant	27042	exon6			.	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.879_886delCTACCCGG	chr1.hg19:g.210010373_210010380delCTACCCGG	ENSP00000419005:p.Phe293fs	77.0	0.0	0		65.0	28.0	0.430769	NM_014388	O75992|Q4VY00|Q63HL9	Frame_Shift_Del	DEL	ENST00000491415.2	hg19	CCDS1493.1																																																																																			.	.	.	none		0.490	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
EPS8L1	54869	hgsc.bcm.edu	37	19	55593489	55593489	+	Frame_Shift_Del	DEL	C	C	-	rs148596546		TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr19:55593489delC	ENST00000201647.6	+	10	987	c.931delC	c.(931-933)cccfs	p.P311fs	EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000540810.1_Frame_Shift_Del_p.P247fs|EPS8L1_ENST00000588359.1_Intron|EPS8L1_ENST00000245618.5_Frame_Shift_Del_p.P184fs|EPS8L1_ENST00000586329.1_Frame_Shift_Del_p.P293fs	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	311					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GGCCAAGCCGCCCTCGGAGGC	0.721																																					p.P310fs	Ovarian(149;255 1863 3636 27051 29647)	Atlas-Indel,Pindel	.											.	EPS8L1	122	.	0			c.930delG						PASS	.						12.0	13.0	13.0					19																	55593489		2185	4270	6455	SO:0001589	frameshift_variant	54869	exon10			.	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.931delC	chr19.hg19:g.55593489delC	ENSP00000201647:p.Pro311fs	111.0	0.0	0		109.0	42.0	0.385321	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Frame_Shift_Del	DEL	ENST00000201647.6	hg19	CCDS12914.1																																																																																			.	.	.	none		0.721	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
LRRC8D	55144	hgsc.bcm.edu	37	1	90399389	90399389	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:90399389delC	ENST00000337338.5	+	3	1169	c.762delC	c.(760-762)atcfs	p.I254fs	LRRC8D_ENST00000394593.3_Frame_Shift_Del_p.I254fs	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	254					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		CACCAATGATCAATAAAACTG	0.463																																					p.I254fs		Atlas-INDEL	.											.	LRRC8D	78	.	0			c.761delT						PASS	.						48.0	46.0	47.0					1																	90399389		2203	4300	6503	SO:0001589	frameshift_variant	55144	exon3			.	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.762delC	chr1.hg19:g.90399389delC	ENSP00000338887:p.Ile254fs	47.0	0.0	0		51.0	19.0	0.372549	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Frame_Shift_Del	DEL	ENST00000337338.5	hg19	CCDS726.1																																																																																			.	.	.	none		0.463	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
SPAG17	200162	hgsc.bcm.edu	37	1	118509280	118509281	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:118509280_118509281insA	ENST00000336338.5	-	47	6548_6549	c.6483_6484insT	c.(6481-6486)aatatcfs	p.I2162fs		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	2162						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATAATCTCGATATTGTGAGAGA	0.421																																					p.I2162fs		Atlas-Indel,Pindel	.											.	SPAG17	263	.	0			c.6484_6485insT						PASS	.																																			SO:0001589	frameshift_variant	200162	exon47			.		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.6484dupT	chr1.hg19:g.118509281_118509281dupA	ENSP00000337804:p.Ile2162fs	115.0	0.0	0		148.0	58.0	0.391892	NM_206996	Q8NAZ1|Q9NT21	Frame_Shift_Ins	INS	ENST00000336338.5	hg19	CCDS899.1																																																																																			.	.	.	none		0.421	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
ERICH3	127254	hgsc.bcm.edu	37	1	75072484	75072484	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:75072484delT	ENST00000326665.5	-	10	1508	c.1290delA	c.(1288-1290)aaafs	p.K430fs	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Frame_Shift_Del_p.K233fs	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		430	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTTTCCTCACTTTCCCCTCAG	0.403																																					p.V431X		Atlas-Indel,Pindel	.											.	C1orf173	380	.	0			c.1291delG						PASS	.						150.0	144.0	146.0					1																	75072484		2203	4298	6501	SO:0001589	frameshift_variant	127254	exon10			.																												ENST00000326665.5:c.1290delA	chr1.hg19:g.75072484delT	ENSP00000322609:p.Lys430fs	334.0	0.0	0		424.0	157.0	0.370283	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Frame_Shift_Del	DEL	ENST00000326665.5	hg19	CCDS30755.1																																																																																			.	.	.	none		0.403	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
LRRC8D	55144	hgsc.bcm.edu	37	1	90399387	90399390	+	Frame_Shift_Del	DEL	ATCA	ATCA	-			TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	ATCA	ATCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr1:90399387_90399390delATCA	ENST00000337338.5	+	3	1167_1170	c.760_763delATCA	c.(760-765)atcaatfs	p.IN254fs	LRRC8D_ENST00000394593.3_Frame_Shift_Del_p.IN254fs	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	254					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TACACCAATGATCAATAAAACTGG	0.461																																					p.253_254del		Pindel	.											.	LRRC8D	78	.	0			c.759_762del						PASS	.																																			SO:0001589	frameshift_variant	55144	exon3			.	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.760_763delATCA	chr1.hg19:g.90399387_90399390delATCA	ENSP00000338887:p.Ile254fs	50.0	0.0	.		55.0	10.0	0.182	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Frame_Shift_Del	DEL	ENST00000337338.5	hg19	CCDS726.1																																																																																			.	.	.	none		0.461	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
MZT2B	80097	hgsc.bcm.edu	37	2	130948157	130948157	+	Frame_Shift_Del	DEL	G	G	-	rs543965632	byFrequency	TCGA-SX-A7SN-01A-11D-A34Z-10	TCGA-SX-A7SN-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d71c98f8-db62-494f-8677-8997e476ee98	7b35d4fc-dac8-427e-b9c4-1acb0a501501	g.chr2:130948157delG	ENST00000281871.6	+	3	790	c.435delG	c.(433-435)aagfs	p.K145fs	MZT2B_ENST00000409255.1_Frame_Shift_Del_p.K205fs	NM_025029.3	NP_079305.2	Q6NZ67	MZT2B_HUMAN	mitotic spindle organizing protein 2B	145						centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				lung(1)	1						GGCTGCCCAAGGGGGGCGGGC	0.657																																					p.K145fs		Pindel	.											.	MZT2B	5	.	0			c.434delA						PASS	.						35.0	41.0	39.0					2																	130948157		2192	4293	6485	SO:0001589	frameshift_variant	80097	exon3			.	BC066296	CCDS2157.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000152082	ENSG00000152082			25886	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2B"""	613450	"""family with sequence similarity 128, member B"""	FAM128B		20360068	Standard	NM_025029		Approved	FLJ14346, MOZART2B	uc002tqu.3	Q6NZ67	OTTHUMG00000131625	ENST00000281871.6:c.435delG	chr2.hg19:g.130948157delG	ENSP00000281871:p.Lys145fs	115.0	0.0	.		132.0	36.0	0.273	NM_025029	Q96CG4	Frame_Shift_Del	DEL	ENST00000281871.6	hg19	CCDS2157.1																																																																																			.	.	.	none		0.657	MZT2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254518.1	NM_025029	
