#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
Unknown	0	hgsc.bcm.edu	37	1	13183800	13183800	+	IGR	SNP	T	T	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:13183800T>A								RP13-221M14.3 (19332 upstream) : PRAMEF26 (32555 downstream)																							ACAACAAGAGTGTTGAGATTC	0.443																																					p.T25S		Atlas-SNP	.											.	.	.	.	0			c.A73T						PASS	.						62.0	46.0	51.0					1																	13183800		691	1591	2282	SO:0001628	intergenic_variant	0	exon2			CAAGAGTGTTGAG																													chr1.hg19:g.13183800T>A		81.0	0.0	.		91.0	48.0	.	NM_001136561		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.443								
LRRC38	126755	hgsc.bcm.edu	37	1	13802427	13802427	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:13802427C>T	ENST00000376085.3	-	2	1226	c.772G>A	c.(772-774)Gtg>Atg	p.V258M		NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	258					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GCAATGGACACGGCCACACCG	0.577																																					p.V258M		Atlas-SNP	.											.	LRRC38	12	.	0			c.G772A						PASS	.																																			SO:0001583	missense	126755	exon2			TGGACACGGCCAC	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.772G>A	chr1.hg19:g.13802427C>T	ENSP00000365253:p.Val258Met	94.0	0.0	.		101.0	44.0	.	NM_001010847	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	hg19	CCDS53269.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579735	0.86645	.	.	ENSG00000162494	ENST00000376085	T	0.63417	-0.04	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000001	T	0.77890	0.4198	M	0.68952	2.095	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.80313	-0.1435	10	0.87932	D	0	.	17.4263	0.87527	0.0:1.0:0.0:0.0	.	258	Q5VT99	LRC38_HUMAN	M	258	ENSP00000365253:V258M	ENSP00000365253:V258M	V	-	1	0	LRRC38	13675014	1.000000	0.71417	0.932000	0.37286	0.904000	0.53231	7.416000	0.80143	2.446000	0.82766	0.561000	0.74099	GTG	.	.	.	none		0.577	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
EIF4G3	8672	hgsc.bcm.edu	37	1	21155712	21155712	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:21155712A>C	ENST00000264211.8	-	25	4141	c.3947T>G	c.(3946-3948)aTt>aGt	p.I1316S	EIF4G3_ENST00000536266.1_Missense_Mutation_p.I920S|EIF4G3_ENST00000537738.1_Missense_Mutation_p.I806S|EIF4G3_ENST00000602326.1_Missense_Mutation_p.I1322S|EIF4G3_ENST00000374937.3_Missense_Mutation_p.I1322S|EIF4G3_ENST00000374935.3_Missense_Mutation_p.I1036S|EIF4G3_ENST00000400422.1_Missense_Mutation_p.I1316S	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1316	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GTACAACCAAATATGGGGAAT	0.373																																					p.I1352S		Atlas-SNP	.											.	EIF4G3	300	.	0			c.T4055G						PASS	.						90.0	93.0	92.0					1																	21155712		2203	4300	6503	SO:0001583	missense	8672	exon29			AACCAAATATGGG	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3947T>G	chr1.hg19:g.21155712A>C	ENSP00000264211:p.Ile1316Ser	114.0	0.0	.		157.0	58.0	.	NM_001198801	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	hg19	CCDS214.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.813791	0.90790	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266;ENST00000435383	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.78	5.78	0.91487	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66674	0.2813	M	0.79475	2.455	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.988;0.986;0.998;0.98	T	0.71069	-0.4699	10	0.87932	D	0	-13.8129	16.1095	0.81250	1.0:0.0:0.0:0.0	.	1511;1036;920;1322;1316	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	S	1316;1512;1316;1036;806;1322;920;82	ENSP00000264211:I1316S;ENSP00000383274:I1316S;ENSP00000364071:I1036S;ENSP00000442010:I806S;ENSP00000364073:I1322S;ENSP00000444693:I920S	ENSP00000264211:I1316S	I	-	2	0	EIF4G3	21028299	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.887000	0.92456	2.210000	0.71456	0.482000	0.46254	ATT	.	.	.	none		0.373	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
ERICH3	127254	hgsc.bcm.edu	37	1	75114960	75114960	+	Silent	SNP	C	C	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:75114960C>A	ENST00000326665.5	-	2	281	c.63G>T	c.(61-63)ctG>ctT	p.L21L		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		21										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AATACCCAGCCAGGTGTTTAT	0.353																																					p.L21L		Atlas-SNP	.											.	C1orf173	380	.	0			c.G63T						PASS	.						110.0	109.0	109.0					1																	75114960		2203	4300	6503	SO:0001819	synonymous_variant	127254	exon2			CCCAGCCAGGTGT																												ENST00000326665.5:c.63G>T	chr1.hg19:g.75114960C>A		39.0	0.0	.		61.0	27.0	.	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	hg19	CCDS30755.1																																																																																			.	.	.	none		0.353	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
BCAR3	8412	hgsc.bcm.edu	37	1	94049639	94049639	+	Silent	SNP	A	A	G			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:94049639A>G	ENST00000370244.1	-	8	1257	c.969T>C	c.(967-969)gaT>gaC	p.D323D	BCAR3_ENST00000260502.6_Silent_p.D323D|BCAR3_ENST00000539242.1_5'UTR|BCAR3_ENST00000370247.3_Silent_p.D232D|BCAR3_ENST00000466632.1_5'UTR|BCAR3_ENST00000370243.1_Silent_p.D323D	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	323					lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		CCTGCATGTGATCCAGGCAGG	0.463																																					p.D323D		Atlas-SNP	.											.	BCAR3	62	.	0			c.T969C						PASS	.						104.0	100.0	102.0					1																	94049639		2203	4300	6503	SO:0001819	synonymous_variant	8412	exon6			CATGTGATCCAGG	U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.969T>C	chr1.hg19:g.94049639A>G		116.0	0.0	.		141.0	45.0	.	NM_001261409	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Silent	SNP	ENST00000370244.1	hg19	CCDS745.1																																																																																			.	.	.	none		0.463	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1		
IGSF3	3321	hgsc.bcm.edu	37	1	117156796	117156796	+	Splice_Site	SNP	C	C	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:117156796C>T	ENST00000369486.3	-	4	1188	c.423G>A	c.(421-423)gtG>gtA	p.V141V	IGSF3_ENST00000369483.1_Splice_Site_p.V141V|IGSF3_ENST00000318837.6_Splice_Site_p.V141V	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	141					lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		AGTCTGGGATCACTGCAACAC	0.582																																					p.V141V		Atlas-SNP	.											.	IGSF3	294	.	0			c.G423A						PASS	.						28.0	28.0	28.0					1																	117156796		2201	4293	6494	SO:0001630	splice_region_variant	3321	exon4			TGGGATCACTGCA	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.422-1G>A	chr1.hg19:g.117156796C>T		87.0	0.0	.		99.0	53.0	.	NM_001542	A6NJZ6|A6NMC7	Silent	SNP	ENST00000369486.3	hg19	CCDS30813.1																																																																																			.	.	.	none		0.582	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	Silent
LCE4A	199834	hgsc.bcm.edu	37	1	152681689	152681689	+	Silent	SNP	G	G	C	rs200223098	byFrequency	TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:152681689G>C	ENST00000368777.1	+	2	394	c.138G>C	c.(136-138)ggG>ggC	p.G46G	LCE4A_ENST00000335535.3_Silent_p.G46G			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	46	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			CCAGCTCTGGGGGCTGTGGTT	0.577													G|||	245	0.0489217	0.003	0.0821	5008	,	,		16464	0.129		0.0109	False		,,,				2504	0.044				p.G46G		Atlas-SNP	.											.,2	LCE4A	37	.	0			c.G138C						PASS	.						81.0	94.0	90.0					1																	152681689		2203	4300	6503	SO:0001819	synonymous_variant	199834	exon1			CTCTGGGGGCTGT	BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	ENST00000368777.1:c.138G>C	chr1.hg19:g.152681689G>C		78.0	0.0	.		97.0	31.0	.	NM_178356	Q14D97	Silent	SNP	ENST00000368777.1	hg19	CCDS1022.1																																																																																			.	G|0.999;C|0.001	0.001	weak		0.577	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040048.1	NM_178356	
RYR2	6262	hgsc.bcm.edu	37	1	237758908	237758908	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:237758908G>A	ENST00000366574.2	+	34	4864	c.4547G>A	c.(4546-4548)gGg>gAg	p.G1516E	RYR2_ENST00000542537.1_Missense_Mutation_p.G1500E|RYR2_ENST00000360064.6_Missense_Mutation_p.G1514E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1516	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTGCCAGCGGGCTGCTCACA	0.522																																					p.G1516E		Atlas-SNP	.											.	RYR2	1273	.	0			c.G4547A						PASS	.						71.0	80.0	77.0					1																	237758908		2103	4237	6340	SO:0001583	missense	6262	exon34			CCAGCGGGCTGCT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4547G>A	chr1.hg19:g.237758908G>A	ENSP00000355533:p.Gly1516Glu	56.0	0.0	.		92.0	48.0	.	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958439	0.92726	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.72051	-0.62;-0.62;-0.62	5.72	5.72	0.89469	SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000004	D	0.85881	0.5800	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86888	0.2046	10	0.87932	D	0	.	19.8805	0.96895	0.0:0.0:1.0:0.0	.	1516	Q92736	RYR2_HUMAN	E	1516;1514;1500	ENSP00000355533:G1516E;ENSP00000353174:G1514E;ENSP00000443798:G1500E	ENSP00000353174:G1514E	G	+	2	0	RYR2	235825531	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.822000	0.99363	2.704000	0.92352	0.655000	0.94253	GGG	.	.	.	none		0.522	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
DNAH6	1768	hgsc.bcm.edu	37	2	84774641	84774641	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr2:84774641G>A	ENST00000237449.6	+	6	1099	c.1091G>A	c.(1090-1092)cGa>cAa	p.R364Q	DNAH6_ENST00000389394.3_Missense_Mutation_p.R364Q|DNAH6_ENST00000398278.2_Missense_Mutation_p.R364Q			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	364	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GGAGAATTTCGAAATGAGGCA	0.393																																					p.R364Q		Atlas-SNP	.											.	DNAH6	194	.	0			c.G1091A						PASS	.						244.0	208.0	219.0					2																	84774641		692	1591	2283	SO:0001583	missense	1768	exon7			AATTTCGAAATGA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1091G>A	chr2.hg19:g.84774641G>A	ENSP00000237449:p.Arg364Gln	176.0	0.0	.		187.0	35.0	.	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969191	0.92855	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.25414	1.8;1.93;1.8	5.35	5.35	0.76521	.	.	.	.	.	T	0.31638	0.0803	M	0.76002	2.32	0.37615	D	0.921094	P	0.40083	0.702	B	0.34038	0.174	T	0.45454	-0.9260	9	0.62326	D	0.03	.	17.8272	0.88669	0.0:0.0:1.0:0.0	.	364	Q9C0G6	DYH6_HUMAN	Q	364	ENSP00000374045:R364Q;ENSP00000381326:R364Q;ENSP00000237449:R364Q	ENSP00000237449:R364Q	R	+	2	0	DNAH6	84628152	1.000000	0.71417	0.344000	0.25628	0.767000	0.43475	6.769000	0.74985	2.501000	0.84356	0.591000	0.81541	CGA	.	.	.	none		0.393	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
ITPR1	3708	hgsc.bcm.edu	37	3	4741539	4741539	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr3:4741539T>A	ENST00000443694.2	+	32	4405	c.4405T>A	c.(4405-4407)Ttg>Atg	p.L1469M	ITPR1_ENST00000423119.2_Missense_Mutation_p.L1475M|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.L1484M|ITPR1_ENST00000302640.8_Missense_Mutation_p.L1469M|ITPR1_ENST00000357086.4_Missense_Mutation_p.L1475M|ITPR1_ENST00000456211.2_Missense_Mutation_p.L1460M			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1484					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	AGACTCGATTTTGGAGAAGTA	0.413																																					p.L1475M		Atlas-SNP	.											.	ITPR1	659	.	0			c.T4423A						PASS	.						174.0	161.0	166.0					3																	4741539		1946	4134	6080	SO:0001583	missense	3708	exon35			TCGATTTTGGAGA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4405T>A	chr3.hg19:g.4741539T>A	ENSP00000401671:p.Leu1469Met	68.0	0.0	.		80.0	33.0	.	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	hg19	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.155209	0.57259	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22;-1.22	5.7	-3.64	0.04515	.	0.000000	0.64402	D	0.000001	D	0.87398	0.6167	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.86486	0.1794	10	0.51188	T	0.08	.	18.2794	0.90092	0.0:0.6888:0.0:0.3112	.	1484;1475	Q14643;G5E9P1	ITPR1_HUMAN;.	M	1484;1469;1484;1475;1475;1460;1469	ENSP00000306253:L1469M;ENSP00000346595:L1484M;ENSP00000405934:L1475M;ENSP00000349597:L1475M;ENSP00000397885:L1460M;ENSP00000401671:L1469M	ENSP00000306253:L1469M	L	+	1	2	ITPR1	4716539	0.002000	0.14202	0.003000	0.11579	0.784000	0.44337	0.017000	0.13399	-0.994000	0.03463	0.477000	0.44152	TTG	.	.	.	none		0.413	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
C3orf62	375341	hgsc.bcm.edu	37	3	49308828	49308828	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr3:49308828C>A	ENST00000343010.3	-	3	1625	c.589G>T	c.(589-591)Gaa>Taa	p.E197*	MIR4271_ENST00000582451.1_RNA|Y_RNA_ENST00000362676.1_RNA	NM_198562.2	NP_940964.1	Q6ZUJ4	CC062_HUMAN	chromosome 3 open reading frame 62	197										breast(1)|kidney(1)|large_intestine(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AATTCGTTTTCAAATTCTATT	0.423																																					p.E197X		Atlas-SNP	.											C3orf62,bladder,carcinoma,0,1	C3orf62	23	.	0			c.G589T						PASS	.						72.0	76.0	75.0					3																	49308828		2203	4300	6503	SO:0001587	stop_gained	375341	exon3			CGTTTTCAAATTC	AK125642	CCDS2792.1	3p21.31	2006-02-11			ENSG00000188315	ENSG00000188315			24771	protein-coding gene	gene with protein product						12477932	Standard	NM_198562		Approved	FLJ43654	uc003cwn.2	Q6ZUJ4	OTTHUMG00000156819	ENST00000343010.3:c.589G>T	chr3.hg19:g.49308828C>A	ENSP00000341139:p.Glu197*	189.0	1.0	.		208.0	76.0	.	NM_198562	Q6P7E9|Q7Z3X6	Nonsense_Mutation	SNP	ENST00000343010.3	hg19	CCDS2792.1	.	.	.	.	.	.	.	.	.	.	C	42	9.581914	0.99211	.	.	ENSG00000188315	ENST00000343010	.	.	.	5.3	5.3	0.74995	.	0.000000	0.50627	D	0.000115	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.8339	14.3179	0.66465	0.0:1.0:0.0:0.0	.	.	.	.	X	197	.	ENSP00000341139:E197X	E	-	1	0	C3orf62	49283832	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	2.613000	0.46351	2.745000	0.94114	0.585000	0.79938	GAA	.	.	.	none		0.423	C3orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345990.1	NM_198562	
GMPPB	29925	hgsc.bcm.edu	37	3	49756686	49756686	+	3'UTR	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr3:49756686G>A	ENST00000480687.1	-	0	3698				RNF123_ENST00000327697.6_Intron|RNF123_ENST00000433785.1_Intron|RNF123_ENST00000497099.1_Intron|AMIGO3_ENST00000535833.1_Silent_p.N71N|AMIGO3_ENST00000320431.7_Silent_p.N71N			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCTGGAGCGCGTTGTGGCTCA	0.677											OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N71N		Atlas-SNP	.											.	AMIGO3	40	.	0			c.C213T						PASS	.						41.0	47.0	45.0					3																	49756686		2203	4299	6502	SO:0001624	3_prime_UTR_variant	386724	exon1			GAGCGCGTTGTGG	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*2499C>T	chr3.hg19:g.49756686G>A		67.0	0.0	.	964	67.0	30.0	.	NM_198722	A8K6N5|Q9H7U3	Silent	SNP	ENST00000480687.1	hg19	CCDS2803.1																																																																																			.	.	.	none		0.677	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334	
PLA1A	51365	hgsc.bcm.edu	37	3	119347690	119347690	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr3:119347690G>C	ENST00000273371.4	+	10	1336	c.1264G>C	c.(1264-1266)Gcc>Ccc	p.A422P	PLA1A_ENST00000495992.1_Missense_Mutation_p.A406P|PLA1A_ENST00000488919.1_Missense_Mutation_p.A249P|PLA1A_ENST00000494440.1_Missense_Mutation_p.A406P	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	422	Involved in the recognition of diacyl- phospholipids.				lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GTTCTGCACTGCCCTTTTGCC	0.463																																					p.A422P		Atlas-SNP	.											.	PLA1A	65	.	0			c.G1264C						PASS	.						118.0	116.0	117.0					3																	119347690		2203	4300	6503	SO:0001583	missense	51365	exon10			TGCACTGCCCTTT	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.1264G>C	chr3.hg19:g.119347690G>C	ENSP00000273371:p.Ala422Pro	41.0	0.0	.		53.0	26.0	.	NM_015900	B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	hg19	CCDS2991.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856610	0.32791	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440	D;D;D;D	0.93763	-2.69;-3.28;-2.68;-2.78	5.39	2.05	0.26809	.	0.525301	0.20420	N	0.092687	D	0.89181	0.6642	L	0.34521	1.04	0.09310	N	1	D;P	0.53885	0.963;0.938	P;B	0.48270	0.572;0.368	T	0.81669	-0.0828	10	0.52906	T	0.07	-11.9479	6.4226	0.21752	0.1844:0.0:0.6528:0.1627	.	406;422	Q53H76-3;Q53H76	.;PLA1A_HUMAN	P	422;249;406;406	ENSP00000273371:A422P;ENSP00000420625:A249P;ENSP00000417326:A406P;ENSP00000418793:A406P	ENSP00000273371:A422P	A	+	1	0	PLA1A	120830380	0.025000	0.19082	0.399000	0.26333	0.198000	0.23893	1.027000	0.30115	0.599000	0.29845	0.561000	0.74099	GCC	.	.	.	none		0.463	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2		
PARP9	83666	hgsc.bcm.edu	37	3	122274833	122274833	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr3:122274833G>A	ENST00000360356.2	-	4	517	c.290C>T	c.(289-291)tCt>tTt	p.S97F	PARP9_ENST00000492382.1_Intron|PARP9_ENST00000471785.1_Missense_Mutation_p.S62F|PARP9_ENST00000477522.2_Missense_Mutation_p.S62F|PARP9_ENST00000462315.1_Missense_Mutation_p.S62F	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	97					cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CTGAACTGGAGAGACCAGGGT	0.413																																					p.S97F		Atlas-SNP	.											.	PARP9	72	.	0			c.C290T						PASS	.						72.0	67.0	69.0					3																	122274833		2203	4300	6503	SO:0001583	missense	83666	exon4			ACTGGAGAGACCA	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.290C>T	chr3.hg19:g.122274833G>A	ENSP00000353512:p.Ser97Phe	66.0	0.0	.		74.0	37.0	.	NM_031458	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	ENST00000360356.2	hg19	CCDS3014.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.11|10.11	1.261631|1.261631	0.23051|0.23051	.|.	.|.	ENSG00000138496|ENSG00000138496	ENST00000452457|ENST00000360356;ENST00000477522;ENST00000471785;ENST00000462315;ENST00000466126	.|T;T;T;T	.|0.19250	.|3.17;3.02;3.02;2.16	4.54|4.54	0.716|0.716	0.18191|0.18191	.|.	.|0.491451	.|0.17733	.|N	.|0.163823	T|T	0.10723|0.10723	0.0262|0.0262	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|P;B;P	.|0.45078	.|0.841;0.062;0.85	.|B;B;B	.|0.43445	.|0.253;0.039;0.42	T|T	0.11275|0.11275	-1.0594|-1.0594	5|10	.|0.10636	.|T	.|0.68	.|.	1.4955|1.4955	0.02465|0.02465	0.1893:0.167:0.4713:0.1724|0.1893:0.167:0.4713:0.1724	.|.	.|62;97;62	.|E9PFM7;Q8IXQ6;Q8IXQ6-2	.|.;PARP9_HUMAN;.	F|F	21|97;62;62;62;75	.|ENSP00000353512:S97F;ENSP00000419506:S62F;ENSP00000419001:S62F;ENSP00000418894:S62F	.|ENSP00000353512:S97F	L|S	-|-	1|2	0|0	PARP9|PARP9	123757523|123757523	0.449000|0.449000	0.25689|0.25689	0.245000|0.245000	0.24217|0.24217	0.362000|0.362000	0.29581|0.29581	-0.156000|-0.156000	0.10100|0.10100	0.119000|0.119000	0.18210|0.18210	0.655000|0.655000	0.94253|0.94253	CTC|TCT	.	.	.	none		0.413	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
STX18	53407	hgsc.bcm.edu	37	4	4436549	4436549	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr4:4436549G>C	ENST00000306200.2	-	7	713	c.650C>G	c.(649-651)aCg>aGg	p.T217R	STX18_ENST00000505286.1_Missense_Mutation_p.T217R	NM_016930.2	NP_058626.1	Q9P2W9	STX18_HUMAN	syntaxin 18	217					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)		ATCTCCCCACGTTCCCAATTC	0.333																																					p.T217R		Atlas-SNP	.											.	STX18	16	.	0			c.C650G						PASS	.						102.0	102.0	102.0					4																	4436549		2203	4300	6503	SO:0001583	missense	53407	exon7			CCCCACGTTCCCA	AB028741	CCDS3377.1	4p16.3-p16.2	2013-09-23			ENSG00000168818	ENSG00000168818			15942	protein-coding gene	gene with protein product		606046				10788491	Standard	NM_016930		Approved	Ufe1	uc003gic.3	Q9P2W9	OTTHUMG00000090331	ENST00000306200.2:c.650C>G	chr4.hg19:g.4436549G>C	ENSP00000305810:p.Thr217Arg	46.0	0.0	.		54.0	31.0	.	NM_016930	Q596L3|Q5TZP5	Missense_Mutation	SNP	ENST00000306200.2	hg19	CCDS3377.1	.	.	.	.	.	.	.	.	.	.	G	10.08	1.252631	0.22880	.	.	ENSG00000168818	ENST00000505286;ENST00000306200;ENST00000512195;ENST00000507908	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.19	-0.775	0.10988	.	0.508381	0.19111	N	0.122452	T	0.25938	0.0632	L	0.34521	1.04	0.09310	N	1	B	0.21753	0.06	B	0.23852	0.049	T	0.24548	-1.0157	10	0.16420	T	0.52	-1.8989	8.4572	0.32906	0.1241:0.6685:0.2073:0.0	.	217	Q9P2W9	STX18_HUMAN	R	217;217;136;136	ENSP00000426648:T217R;ENSP00000305810:T217R;ENSP00000425483:T136R;ENSP00000422376:T136R	ENSP00000305810:T217R	T	-	2	0	STX18	4487450	0.000000	0.05858	0.016000	0.15963	0.922000	0.55478	0.387000	0.20718	-0.061000	0.13110	0.655000	0.94253	ACG	.	.	.	none		0.333	STX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206696.1		
PKD2L2	27039	hgsc.bcm.edu	37	5	137244511	137244511	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr5:137244511C>T	ENST00000508883.1	+	8	1230	c.1204C>T	c.(1204-1206)Cgt>Tgt	p.R402C	PKD2L2_ENST00000508638.1_Intron|PKD2L2_ENST00000290431.5_Missense_Mutation_p.R402C|PKD2L2_ENST00000350250.4_Missense_Mutation_p.R368C|PKD2L2_ENST00000502810.1_Missense_Mutation_p.R380C			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	402					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AACCTTGTCCCGTTGTGTTAA	0.318																																					p.R402C		Atlas-SNP	.											.	PKD2L2	68	.	0			c.C1204T						PASS	.						103.0	92.0	96.0					5																	137244511		1828	4083	5911	SO:0001583	missense	27039	exon8			TTGTCCCGTTGTG	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1204C>T	chr5.hg19:g.137244511C>T	ENSP00000424725:p.Arg402Cys	189.0	0.0	.		254.0	103.0	.	NM_014386	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	ENST00000508883.1	hg19		.	.	.	.	.	.	.	.	.	.	C	13.90	2.374343	0.42105	.	.	ENSG00000078795	ENST00000350250;ENST00000502810;ENST00000508883;ENST00000290431	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.82	4.95	0.65309	Polycystin cation channel, PKD1/PKD2 (1);	0.091705	0.48767	N	0.000179	T	0.79009	0.4374	M	0.85373	2.75	0.80722	D	1	P;P	0.47841	0.834;0.901	P;B	0.47705	0.555;0.232	T	0.83180	-0.0089	10	0.87932	D	0	-0.9502	14.562	0.68148	0.0:0.9293:0.0:0.0707	.	402;402	Q9NZM6;Q9NZM6-5	PK2L2_HUMAN;.	C	368;380;402;402	ENSP00000344177:R368C;ENSP00000425513:R380C;ENSP00000424725:R402C;ENSP00000290431:R402C	ENSP00000290431:R402C	R	+	1	0	PKD2L2	137272410	0.994000	0.37717	0.983000	0.44433	0.515000	0.34225	2.672000	0.46850	1.468000	0.48064	0.561000	0.74099	CGT	.	.	.	none		0.318	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386	
COL9A1	1297	hgsc.bcm.edu	37	6	70970367	70970367	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr6:70970367C>T	ENST00000357250.6	-	20	1600	c.1442G>A	c.(1441-1443)gGg>gAg	p.G481E	COL9A1_ENST00000320755.7_Missense_Mutation_p.G238E|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.G238E	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	481	Collagen-like 5.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.G481V(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TACTTTTTCCCCTTTGTCCCC	0.333																																					p.G481E		Atlas-SNP	.											COL9A1,NS,carcinoma,0,1	COL9A1	228	.	1	Substitution - Missense(1)	ovary(1)	c.G1442A						PASS	.						62.0	62.0	62.0					6																	70970367		2203	4300	6503	SO:0001583	missense	1297	exon20			TTTTCCCCTTTGT		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1442G>A	chr6.hg19:g.70970367C>T	ENSP00000349790:p.Gly481Glu	128.0	0.0	.		145.0	51.0	.	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	hg19	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239425	0.58995	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.99488	-6.0;-6.0;-5.77	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.99837	0.9926	H	0.99415	4.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96750	0.9553	10	0.87932	D	0	.	17.1033	0.86655	0.0:1.0:0.0:0.0	.	481;238;54	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	E	481;238;238	ENSP00000349790:G481E;ENSP00000315252:G238E;ENSP00000359530:G238E	ENSP00000315252:G238E	G	-	2	0	COL9A1	71027088	0.998000	0.40836	0.967000	0.41034	0.935000	0.57460	5.054000	0.64275	2.775000	0.95449	0.655000	0.94253	GGG	.	.	.	none		0.333	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
ZNF398	57541	hgsc.bcm.edu	37	7	148851297	148851297	+	Silent	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr7:148851297G>A	ENST00000475153.1	+	2	552	c.285G>A	c.(283-285)aaG>aaA	p.K95K	ZNF398_ENST00000485111.1_3'UTR|ZNF398_ENST00000540950.1_Silent_p.K100K|ZNF398_ENST00000335901.4_5'UTR|ZNF398_ENST00000420008.2_5'UTR|ZNF398_ENST00000491174.1_5'UTR|ZNF398_ENST00000483892.1_5'UTR|ZNF398_ENST00000426851.2_5'UTR			Q8TD17	ZN398_HUMAN	zinc finger protein 398	95					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			TGGAGGGCAAGTGGGCCGTGC	0.597																																					p.K95K		Atlas-SNP	.											.	ZNF398	54	.	0			c.G285A						PASS	.						64.0	66.0	65.0					7																	148851297		2203	4300	6503	SO:0001819	synonymous_variant	57541	exon2			GGGCAAGTGGGCC	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.285G>A	chr7.hg19:g.148851297G>A		39.0	0.0	.		29.0	11.0	.	NM_170686	A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Silent	SNP	ENST00000475153.1	hg19	CCDS5894.1																																																																																			.	.	.	none		0.597	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352722.2		
CELF2	10659	hgsc.bcm.edu	37	10	11308581	11308581	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr10:11308581T>A	ENST00000379261.4	+	6	630	c.538T>A	c.(538-540)Tct>Act	p.S180T	CELF2_ENST00000608830.1_Missense_Mutation_p.S156T|CELF2_ENST00000354440.2_Missense_Mutation_p.S156T|CELF2_ENST00000416382.2_Missense_Mutation_p.S180T|CELF2_ENST00000427450.1_Missense_Mutation_p.S156T|CELF2_ENST00000315874.4_Missense_Mutation_p.S156T|CELF2_ENST00000609692.1_Missense_Mutation_p.S156T|CELF2_ENST00000354897.3_Missense_Mutation_p.S156T|CELF2_ENST00000417956.2_Missense_Mutation_p.S156T|CELF2_ENST00000399850.3_Missense_Mutation_p.S156T|CELF2_ENST00000542579.1_Missense_Mutation_p.S187T|CELF2_ENST00000537122.1_Missense_Mutation_p.S69T|CELF2_ENST00000450189.1_Missense_Mutation_p.S187T	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	180	Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						TGTCACATTTTCTACAAGGGC	0.448																																					p.S187T		Atlas-SNP	.											.	CELF2	78	.	0			c.T559A						PASS	.						173.0	159.0	164.0					10																	11308581		1983	4172	6155	SO:0001583	missense	10659	exon6			ACATTTTCTACAA	U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.538T>A	chr10.hg19:g.11308581T>A	ENSP00000368563:p.Ser180Thr	121.0	0.0	.		166.0	70.0	.	NM_006561	B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	ENST00000379261.4	hg19	CCDS44354.1	.	.	.	.	.	.	.	.	.	.	T	2.328	-0.354040	0.05173	.	.	ENSG00000048740	ENST00000379261;ENST00000416382;ENST00000450189;ENST00000542579;ENST00000399850;ENST00000417956;ENST00000315874;ENST00000354440;ENST00000354897;ENST00000427450;ENST00000537122	T;T;T;T;T;T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45;2.45;2.45;2.45;2.45;2.45	5.96	5.96	0.96718	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.049275	0.85682	D	0.000000	T	0.11750	0.0286	N	0.25031	0.7	0.80722	D	1	B;B;P;B;B;B	0.39576	0.002;0.006;0.679;0.081;0.028;0.003	B;B;B;B;B;B	0.35182	0.016;0.016;0.197;0.097;0.044;0.016	T	0.16958	-1.0385	10	0.12103	T	0.63	-14.4969	16.4338	0.83864	0.0:0.0:0.0:1.0	.	164;180;175;187;175;180	B4DDE7;B4DS31;B2RA86;E9PC62;O95319-3;O95319	.;.;.;.;.;CELF2_HUMAN	T	180;180;187;187;156;156;156;156;156;156;69	ENSP00000368563:S180T;ENSP00000406451:S180T;ENSP00000389951:S187T;ENSP00000443926:S187T;ENSP00000382743:S156T;ENSP00000404834:S156T;ENSP00000315328:S156T;ENSP00000346426:S156T;ENSP00000388530:S156T;ENSP00000438884:S69T	ENSP00000315328:S156T	S	+	1	0	CELF2	11348587	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.889000	0.56212	2.270000	0.75569	0.533000	0.62120	TCT	.	.	.	none		0.448	CELF2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
NUDT13	25961	hgsc.bcm.edu	37	10	74884008	74884008	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr10:74884008A>G	ENST00000357321.4	+	5	513	c.395A>G	c.(394-396)aAg>aGg	p.K132R	NUDT13_ENST00000537969.1_Intron|NUDT13_ENST00000544879.1_Missense_Mutation_p.K6R|NUDT13_ENST00000488223.1_3'UTR|NUDT13_ENST00000372997.3_Missense_Mutation_p.K132R|RP11-152N13.16_ENST00000608444.1_RNA|NUDT13_ENST00000349051.5_Missense_Mutation_p.K132R|SNORA11_ENST00000408237.1_RNA	NM_001283016.1|NM_015901.4	NP_001269945.1|NP_056985.3			nudix (nucleoside diphosphate linked moiety X)-type motif 13											large_intestine(2)|lung(5)	7	Prostate(51;0.0119)					ACAGAGCTCAAGGGGTCTTTC	0.423																																					p.K132R		Atlas-SNP	.											.	NUDT13	16	.	0			c.A395G						PASS	.						89.0	89.0	89.0					10																	74884008		2203	4300	6503	SO:0001583	missense	25961	exon5			AGCTCAAGGGGTC	AL050114	CCDS31220.1, CCDS60551.1, CCDS60552.1, CCDS60553.1, CCDS73148.1	10q22.3	2014-04-24			ENSG00000166321	ENSG00000166321		"""Nudix motif containing"""	18827	protein-coding gene	gene with protein product		609233				15164054	Standard	NM_001283019		Approved	DKFZp586P2219	uc001jtj.3	Q86X67	OTTHUMG00000018453	ENST00000357321.4:c.395A>G	chr10.hg19:g.74884008A>G	ENSP00000349874:p.Lys132Arg	35.0	0.0	.		38.0	17.0	.	NM_015901		Missense_Mutation	SNP	ENST00000357321.4	hg19	CCDS31220.1	.	.	.	.	.	.	.	.	.	.	A	12.91	2.080125	0.36662	.	.	ENSG00000166321	ENST00000357321;ENST00000349051;ENST00000544879;ENST00000372997	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.78	0.0152	0.14103	NADH pyrophosphatase-like, N-terminal (1);	1.129060	0.06171	N	0.677690	T	0.18635	0.0447	L	0.29908	0.895	0.31085	N	0.711441	B;B;B	0.27140	0.169;0.046;0.012	B;B;B	0.20767	0.031;0.029;0.011	T	0.35051	-0.9804	10	0.15952	T	0.53	.	5.0363	0.14436	0.5681:0.1459:0.286:0.0	.	132;132;132	Q86X67-2;Q5SQM6;Q86X67	.;.;NUD13_HUMAN	R	132;132;6;132	ENSP00000349874:K132R;ENSP00000335326:K132R;ENSP00000440760:K6R;ENSP00000362088:K132R	ENSP00000335326:K132R	K	+	2	0	NUDT13	74554014	0.553000	0.26513	0.515000	0.27774	0.985000	0.73830	1.094000	0.30951	-0.157000	0.11059	0.533000	0.62120	AAG	.	.	.	none		0.423	NUDT13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048614.1	NM_015901	
LRIT1	26103	hgsc.bcm.edu	37	10	85997255	85997255	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr10:85997255G>A	ENST00000372105.3	-	2	331	c.310C>T	c.(310-312)Cgg>Tgg	p.R104W		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	104						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						CGCAGGCCCCGCAGCATGAGG	0.731																																					p.R104W		Atlas-SNP	.											.	LRIT1	73	.	0			c.C310T						PASS	.						7.0	9.0	8.0					10																	85997255		2119	4164	6283	SO:0001583	missense	26103	exon2			GGCCCCGCAGCAT	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.310C>T	chr10.hg19:g.85997255G>A	ENSP00000361177:p.Arg104Trp	19.0	0.0	.		13.0	8.0	.	NM_015613	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	hg19	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199249	0.79015	.	.	ENSG00000148602	ENST00000372105	T	0.52983	0.64	4.93	1.89	0.25635	.	0.142637	0.46145	D	0.000317	T	0.56863	0.2014	M	0.76170	2.325	0.39900	D	0.973881	D	0.69078	0.997	P	0.52343	0.696	T	0.63274	-0.6674	10	0.72032	D	0.01	.	12.1	0.53778	0.0:0.0:0.3369:0.6631	.	104	Q9P2V4	LRIT1_HUMAN	W	104	ENSP00000361177:R104W	ENSP00000361177:R104W	R	-	1	2	LRIT1	85987235	0.612000	0.27000	0.796000	0.32109	0.989000	0.77384	1.233000	0.32648	0.202000	0.20498	0.655000	0.94253	CGG	.	.	.	none		0.731	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
SLC25A22	79751	hgsc.bcm.edu	37	11	799527	799527	+	5'Flank	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr11:799527G>C	ENST00000531214.1	-	0	0				PIDD_ENST00000347755.5_Missense_Mutation_p.S838C|PIDD_ENST00000411829.2_Missense_Mutation_p.S821C	NM_001191060.1	NP_001177989.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22						L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTCAGCCCAGGAGAAGAGCAT	0.672																																					p.S838C	Colon(93;848 1468 3270 23355 49636)	Atlas-SNP	.											.	PIDD	76	.	0			c.C2513G						PASS	.						32.0	30.0	31.0					11																	799527		2199	4290	6489	SO:0001631	upstream_gene_variant	55367	exon16			GCCCAGGAGAAGA	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310		chr11.hg19:g.799527G>C	Exception_encountered	31.0	0.0	.		33.0	13.0	.	NM_145886	A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000531214.1	hg19	CCDS7715.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.664457	0.67700	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	D;D	0.85702	-2.02;-2.02	4.74	4.74	0.60224	Death (3);DEATH-like (2);	0.143577	0.49305	D	0.000148	D	0.89832	0.6829	L	0.46157	1.445	0.37083	D	0.899066	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.988	D	0.90731	0.4642	10	0.39692	T	0.17	.	18.0695	0.89402	0.0:0.0:1.0:0.0	.	838;681;821	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	C	821;838	ENSP00000416801:S821C;ENSP00000337797:S838C	ENSP00000337797:S838C	S	-	2	0	PIDD	789527	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	5.070000	0.64376	2.338000	0.79540	0.448000	0.29417	TCC	.	.	.	none		0.672	SLC25A22-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384124.1		
OR51G2	81282	hgsc.bcm.edu	37	11	4936639	4936639	+	Silent	SNP	T	T	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr11:4936639T>A	ENST00000322013.3	-	1	283	c.255A>T	c.(253-255)acA>acT	p.T85T	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCCCAGGACTGTAGGGAGAG	0.483																																					p.T85T		Atlas-SNP	.											.	OR51G2	70	.	0			c.A255T						PASS	.						83.0	74.0	77.0					11																	4936639		2201	4298	6499	SO:0001819	synonymous_variant	81282	exon1			CAGGACTGTAGGG	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.255A>T	chr11.hg19:g.4936639T>A		45.0	0.0	.		66.0	31.0	.	NM_001005238	Q6IFH7	Silent	SNP	ENST00000322013.3	hg19	CCDS31365.1																																																																																			.	.	.	none		0.483	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
SLC5A12	159963	hgsc.bcm.edu	37	11	26743093	26743093	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr11:26743093G>C	ENST00000396005.3	-	1	478	c.169C>G	c.(169-171)Ctg>Gtg	p.L57V	SLC5A12_ENST00000280467.6_Missense_Mutation_p.L57V	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	57					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						CTGGCTGTCAGAGACAAGCCG	0.512																																					p.L57V		Atlas-SNP	.											.	SLC5A12	134	.	0			c.C169G						PASS	.						67.0	68.0	68.0					11																	26743093		2203	4299	6502	SO:0001583	missense	159963	exon1			CTGTCAGAGACAA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.169C>G	chr11.hg19:g.26743093G>C	ENSP00000379326:p.Leu57Val	101.0	0.0	.		129.0	61.0	.	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123364	0.77436	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.89343	-2.5;-2.5	5.59	4.49	0.54785	.	0.000000	0.64402	D	0.000011	D	0.94837	0.8332	M	0.86573	2.825	0.53005	D	0.999963	D;D	0.89917	0.997;1.0	D;D	0.97110	0.976;1.0	D	0.95388	0.8479	10	0.87932	D	0	.	15.3594	0.74460	0.0783:0.0:0.9217:0.0	.	57;57	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	V	57	ENSP00000379326:L57V;ENSP00000280467:L57V	ENSP00000280467:L57V	L	-	1	2	SLC5A12	26699669	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.698000	0.74608	2.643000	0.89663	0.585000	0.79938	CTG	.	.	.	none		0.512	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
OR8K3	219473	hgsc.bcm.edu	37	11	56086707	56086707	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr11:56086707A>T	ENST00000312711.1	+	1	925	c.925A>T	c.(925-927)Aat>Tat	p.N309Y		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TAACTTATGTAATATTTTTGT	0.318																																					p.N309Y		Atlas-SNP	.											.	OR8K3	92	.	0			c.A925T						PASS	.						29.0	29.0	29.0					11																	56086707		2200	4295	6495	SO:0001583	missense	219473	exon1			TTATGTAATATTT	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.925A>T	chr11.hg19:g.56086707A>T	ENSP00000323555:p.Asn309Tyr	67.0	0.0	.		75.0	38.0	.	NM_001005202	Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	hg19	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.513383	0.27123	.	.	ENSG00000181689	ENST00000312711	T	0.00004	9.8	3.9	2.76	0.32466	.	1.533820	0.03744	N	0.255508	T	0.00073	0.0002	N	0.08118	0	0.09310	N	1	P	0.37612	0.602	P	0.47744	0.556	T	0.17715	-1.0360	10	0.33141	T	0.24	.	5.9741	0.19369	0.8777:0.0:0.1223:0.0	.	309	Q8NH51	OR8K3_HUMAN	Y	309	ENSP00000323555:N309Y	ENSP00000323555:N309Y	N	+	1	0	OR8K3	55843283	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	1.242000	0.32755	0.659000	0.30945	0.386000	0.25728	AAT	.	.	.	none		0.318	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
HTR3A	3359	hgsc.bcm.edu	37	11	113860244	113860244	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr11:113860244G>C	ENST00000504030.2	+	9	1641	c.1196G>C	c.(1195-1197)aGg>aCg	p.R399T	HTR3A_ENST00000535865.1_Missense_Mutation_p.R143T|HTR3A_ENST00000355556.2_Missense_Mutation_p.R437T|HTR3A_ENST00000299961.5_Missense_Mutation_p.R384T|HTR3A_ENST00000375498.2_Missense_Mutation_p.R405T|HTR3A_ENST00000506841.2_Missense_Mutation_p.R431T			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	399					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	AAGAGCCCGAGGGACAGATGT	0.647																																					p.R437T		Atlas-SNP	.											.	HTR3A	93	.	0			c.G1310C						PASS	.						71.0	79.0	76.0					11																	113860244		2201	4296	6497	SO:0001583	missense	3359	exon8			GCCCGAGGGACAG	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.1196G>C	chr11.hg19:g.113860244G>C	ENSP00000424189:p.Arg399Thr	23.0	0.0	.		30.0	11.0	.	NM_213621	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	ENST00000504030.2	hg19		.	.	.	.	.	.	.	.	.	.	G	6.392	0.440481	0.12104	.	.	ENSG00000166736	ENST00000504030;ENST00000355556;ENST00000375498;ENST00000506841;ENST00000535865;ENST00000299961	T;T;T;T;T;T	0.70399	1.9;-0.48;1.9;-0.48;1.9;1.9	5.4	2.34	0.29019	.	0.571132	0.21049	N	0.081029	T	0.55097	0.1899	L	0.29908	0.895	0.09310	N	1	B;B;B	0.26602	0.093;0.129;0.154	B;B;B	0.31101	0.124;0.108;0.124	T	0.43228	-0.9404	10	0.30078	T	0.28	-10.4059	7.7112	0.28679	0.1523:0.1371:0.7106:0.0	.	384;437;405	B4DSY6;G5E986;Q7KZM7	.;.;.	T	399;437;405;431;143;384	ENSP00000424189:R399T;ENSP00000347754:R437T;ENSP00000364648:R405T;ENSP00000424776:R431T;ENSP00000437776:R143T;ENSP00000299961:R384T	ENSP00000299961:R384T	R	+	2	0	HTR3A	113365454	0.000000	0.05858	0.008000	0.14137	0.002000	0.02628	0.094000	0.15107	1.423000	0.47198	0.650000	0.86243	AGG	.	.	.	none		0.647	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869	
INHBE	83729	hgsc.bcm.edu	37	12	57850456	57850456	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr12:57850456C>G	ENST00000266646.2	+	2	1094	c.878C>G	c.(877-879)tCt>tGt	p.S293C	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	293					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						ATTGCTGCCTCTTTCCATTCT	0.612											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S293C	GBM(191;1808 2166 15720 36624 50371)	Atlas-SNP	.											.	INHBE	38	.	0			c.C878G						PASS	.						105.0	80.0	88.0					12																	57850456		2203	4300	6503	SO:0001583	missense	83729	exon2			CTGCCTCTTTCCA		CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.878C>G	chr12.hg19:g.57850456C>G	ENSP00000266646:p.Ser293Cys	39.0	0.0	.	1026	48.0	19.0	.	NM_031479		Missense_Mutation	SNP	ENST00000266646.2	hg19	CCDS8939.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.897332	0.72639	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	T;T	0.64803	-0.12;-0.12	4.79	4.79	0.61399	Transforming growth factor-beta, C-terminal (3);	0.061993	0.64402	D	0.000003	D	0.83848	0.5343	M	0.92970	3.365	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.87710	0.2566	10	0.72032	D	0.01	-7.2053	17.1522	0.86781	0.0:1.0:0.0:0.0	.	293	P58166	INHBE_HUMAN	C	238;293	ENSP00000450212:S238C;ENSP00000266646:S293C	ENSP00000266646:S293C	S	+	2	0	INHBE	56136723	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.563000	0.82314	2.653000	0.90120	0.655000	0.94253	TCT	.	.	.	none		0.612	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406773.1	NM_031479	
PLBD2	196463	hgsc.bcm.edu	37	12	113823023	113823023	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr12:113823023G>A	ENST00000280800.3	+	9	1252	c.1221G>A	c.(1219-1221)atG>atA	p.M407I	PLBD2_ENST00000545182.2_Missense_Mutation_p.M375I	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	407					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TCAGCGGCATGGTGGTGGTGG	0.627																																					p.M407I		Atlas-SNP	.											.	PLBD2	33	.	0			c.G1221A						PASS	.						169.0	122.0	138.0					12																	113823023		2203	4300	6503	SO:0001583	missense	196463	exon9			CGGCATGGTGGTG	BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.1221G>A	chr12.hg19:g.113823023G>A	ENSP00000280800:p.Met407Ile	101.0	0.0	.		98.0	36.0	.	NM_173542	F5H5E2	Missense_Mutation	SNP	ENST00000280800.3	hg19	CCDS9168.1	.	.	.	.	.	.	.	.	.	.	G	9.882	1.201822	0.22121	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.17370	2.28;2.28	4.52	4.52	0.55395	.	0.195034	0.51477	D	0.000092	T	0.17831	0.0428	L	0.45228	1.405	0.38915	D	0.957621	B;B	0.23128	0.08;0.007	B;B	0.23574	0.047;0.009	T	0.06006	-1.0851	10	0.29301	T	0.29	-29.7541	17.4488	0.87586	0.0:0.0:1.0:0.0	.	375;407	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	I	375;407	ENSP00000443463:M375I;ENSP00000280800:M407I	ENSP00000280800:M407I	M	+	3	0	PLBD2	112307406	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	4.751000	0.62169	2.341000	0.79615	0.555000	0.69702	ATG	.	.	.	none		0.627	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404835.1	NM_173542	
CUL4A	8451	hgsc.bcm.edu	37	13	113893814	113893814	+	Silent	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr13:113893814G>C	ENST00000375440.4	+	10	1068	c.984G>C	c.(982-984)cgG>cgC	p.R328R	CUL4A_ENST00000326335.4_Silent_p.R228R|CUL4A_ENST00000375441.3_Silent_p.R228R|CUL4A_ENST00000451881.1_Silent_p.R228R	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	328					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			TGTTCAGCCGGGTGAGGGGCG	0.622																																					p.R328R		Atlas-SNP	.											.	CUL4A	50	.	0			c.G984C						PASS	.						68.0	64.0	65.0					13																	113893814		2203	4300	6503	SO:0001819	synonymous_variant	8451	exon10			CAGCCGGGTGAGG	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.984G>C	chr13.hg19:g.113893814G>C		93.0	0.0	.		97.0	41.0	.	NM_001008895	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Silent	SNP	ENST00000375440.4	hg19	CCDS41908.1																																																																																			.	.	.	none		0.622	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589	
ZNF280D	54816	hgsc.bcm.edu	37	15	56968913	56968913	+	Silent	SNP	A	A	G			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr15:56968913A>G	ENST00000267807.7	-	13	1581	c.1365T>C	c.(1363-1365)gtT>gtC	p.V455V	ZNF280D_ENST00000559237.1_Silent_p.V442V|ZNF280D_ENST00000396245.1_Silent_p.V159V|ZNF280D_ENST00000559000.1_Silent_p.V442V	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		CAATTTTAATAACTTTGAGGC	0.303																																					p.V455V		Atlas-SNP	.											.	ZNF280D	82	.	0			c.T1365C						PASS	.						139.0	139.0	139.0					15																	56968913		2192	4291	6483	SO:0001819	synonymous_variant	54816	exon13			TTTAATAACTTTG	AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.1365T>C	chr15.hg19:g.56968913A>G		114.0	0.0	.		152.0	75.0	.	NM_017661	A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Silent	SNP	ENST00000267807.7	hg19	CCDS32245.1	.	.	.	.	.	.	.	.	.	.	A	9.834	1.189114	0.21954	.	.	ENSG00000137871	ENST00000260435	.	.	.	5.53	4.4	0.53042	.	.	.	.	.	T	0.67524	0.2902	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69379	-0.5161	5	0.87932	D	0	-13.6503	10.5058	0.44832	0.9239:0.0:0.0761:0.0	.	.	.	.	S	291	.	ENSP00000260435:L291S	L	-	2	0	ZNF280D	54756205	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.894000	0.28350	0.935000	0.37341	0.528000	0.53228	TTA	.	.	.	none		0.303	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418891.2	XM_370867	
ZNF609	23060	hgsc.bcm.edu	37	15	64967353	64967353	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr15:64967353G>C	ENST00000326648.3	+	4	2428	c.2300G>C	c.(2299-2301)gGg>gCg	p.G767A		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	767						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCAGGAGATGGGATGAAAATG	0.512																																					p.G767A		Atlas-SNP	.											ZNF609,colon,carcinoma,0,1	ZNF609	106	.	0			c.G2300C						PASS	.						69.0	77.0	75.0					15																	64967353		2203	4298	6501	SO:0001583	missense	23060	exon4			GAGATGGGATGAA	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.2300G>C	chr15.hg19:g.64967353G>C	ENSP00000316527:p.Gly767Ala	45.0	0.0	.		65.0	30.0	.	NM_015042	Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	hg19	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	G	4.931	0.172993	0.09391	.	.	ENSG00000180357	ENST00000326648	T	0.42131	0.98	5.88	4.97	0.65823	.	0.184234	0.47093	D	0.000243	T	0.36193	0.0958	L	0.34521	1.04	0.48632	D	0.99968	P	0.50156	0.932	P	0.47705	0.555	T	0.15065	-1.0450	10	0.05620	T	0.96	-11.1446	15.5658	0.76290	0.0:0.1368:0.8632:0.0	.	767	O15014	ZN609_HUMAN	A	767	ENSP00000316527:G767A	ENSP00000316527:G767A	G	+	2	0	ZNF609	62754406	1.000000	0.71417	0.990000	0.47175	0.905000	0.53344	4.377000	0.59562	1.483000	0.48342	0.655000	0.94253	GGG	.	.	.	none		0.512	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
ANPEP	290	hgsc.bcm.edu	37	15	90349600	90349600	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr15:90349600T>C	ENST00000300060.6	-	2	528	c.215A>G	c.(214-216)aAt>aGt	p.N72S		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	72	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GCGGTAACGATTCCACGCTTT	0.622																																					p.N72S	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.A215G						PASS	.						135.0	120.0	125.0					15																	90349600		2200	4299	6499	SO:0001583	missense	290	exon2			TAACGATTCCACG	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.215A>G	chr15.hg19:g.90349600T>C	ENSP00000300060:p.Asn72Ser	129.0	0.0	.		158.0	65.0	.	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	hg19	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.071000	0.36566	.	.	ENSG00000166825	ENST00000300060	T	0.03920	3.76	4.74	4.74	0.60224	.	0.203738	0.50627	D	0.000113	T	0.09818	0.0241	M	0.81239	2.535	0.36847	D	0.887699	B	0.30709	0.291	B	0.34038	0.174	T	0.07966	-1.0745	10	0.27785	T	0.31	.	12.1916	0.54275	0.0:0.0:0.0:1.0	.	72	P15144	AMPN_HUMAN	S	72	ENSP00000300060:N72S	ENSP00000300060:N72S	N	-	2	0	ANPEP	88150604	1.000000	0.71417	0.931000	0.37212	0.067000	0.16453	7.924000	0.87555	1.770000	0.52166	0.383000	0.25322	AAT	.	.	.	none		0.622	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
SEZ6L2	26470	hgsc.bcm.edu	37	16	29888690	29888690	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr16:29888690C>T	ENST00000308713.5	-	11	2338	c.1811G>A	c.(1810-1812)cGc>cAc	p.R604H	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R560H|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R490H|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.R534H	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	604	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGAGAGAAGGCGGCGGCGCGG	0.662																																					p.R604H		Atlas-SNP	.											.	SEZ6L2	137	.	0			c.G1811A						PASS	.						17.0	20.0	19.0					16																	29888690		2191	4292	6483	SO:0001583	missense	26470	exon11			AGAAGGCGGCGGC	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1811G>A	chr16.hg19:g.29888690C>T	ENSP00000312550:p.Arg604His	52.0	0.0	.		54.0	29.0	.	NM_001243332	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	hg19	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860218	0.91433	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.57	5.57	0.84162	CUB (5);	0.000000	0.53938	D	0.000048	T	0.28134	0.0694	L	0.37630	1.12	0.42529	D	0.993034	D;D;P;D;D;D	0.71674	0.996;0.996;0.529;0.994;0.995;0.998	D;P;B;P;P;P	0.63192	0.912;0.852;0.067;0.706;0.806;0.834	T	0.00885	-1.1527	10	0.59425	D	0.04	.	11.7566	0.51878	0.0:0.9183:0.0:0.0817	.	560;604;490;534;604;534	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	H	534;604;490;560	ENSP00000310206:R534H;ENSP00000312550:R604H;ENSP00000319215:R490H;ENSP00000439412:R560H	ENSP00000312550:R604H	R	-	2	0	SEZ6L2	29796191	0.999000	0.42202	1.000000	0.80357	0.961000	0.63080	1.699000	0.37804	2.618000	0.88619	0.655000	0.94253	CGC	.	.	.	none		0.662	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
PIK3R5	23533	hgsc.bcm.edu	37	17	8784018	8784018	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr17:8784018C>T	ENST00000447110.1	-	19	2705	c.2581G>A	c.(2581-2583)Gca>Aca	p.A861T	PIK3R5_ENST00000584803.1_Missense_Mutation_p.A860T|PIK3R5_ENST00000581552.1_Missense_Mutation_p.A861T	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	861					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						AGATCAGGTGCGGCCTGGGCC	0.637																																					p.A861T	NSCLC(18;589 615 7696 20311 50332)	Atlas-SNP	.											.	PIK3R5	79	.	0			c.G2581A						PASS	.						75.0	69.0	71.0					17																	8784018		2203	4300	6503	SO:0001583	missense	23533	exon19			CAGGTGCGGCCTG	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.2581G>A	chr17.hg19:g.8784018C>T	ENSP00000392812:p.Ala861Thr	52.0	0.0	.		66.0	26.0	.	NM_001142633	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	hg19	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	C	7.212	0.595670	0.13875	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.77229	-1.08	5.17	-10.3	0.00346	.	1.078560	0.07024	N	0.827233	T	0.41282	0.1152	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.32851	-0.9891	10	0.11485	T	0.65	0.3415	1.3976	0.02264	0.232:0.1263:0.2009:0.4408	.	861	Q8WYR1	PI3R5_HUMAN	T	861	ENSP00000392812:A861T	ENSP00000269300:A861T	A	-	1	0	PIK3R5	8724743	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-1.878000	0.01630	-3.029000	0.00267	-0.254000	0.11334	GCA	.	.	.	none		0.637	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308	
HEATR9	256957	hgsc.bcm.edu	37	17	34182703	34182703	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr17:34182703G>T	ENST00000311880.2	-	14	1478	c.1330C>A	c.(1330-1332)Cta>Ata	p.L444I	C17orf66_ENST00000592980.1_Missense_Mutation_p.L404I	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		444					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		TCTGCATCTAGTAAGTCCAGG	0.542																																					p.L444I		Atlas-SNP	.											.	C17orf66	57	.	0			c.C1330A						PASS	.						122.0	112.0	116.0					17																	34182703		2203	4300	6503	SO:0001583	missense	256957	exon14			CATCTAGTAAGTC																												ENST00000311880.2:c.1330C>A	chr17.hg19:g.34182703G>T	ENSP00000309560:p.Leu444Ile	56.0	0.0	.		66.0	25.0	.	NM_152781	B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Missense_Mutation	SNP	ENST00000311880.2	hg19	CCDS11299.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.221343	0.39300	.	.	ENSG00000172653	ENST00000311880	T	0.30714	1.52	4.29	2.23	0.28157	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.34223	N	0.004141	T	0.37265	0.0997	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.992;0.996	T	0.09997	-1.0649	10	0.45353	T	0.12	.	6.4579	0.21940	0.2311:0.0:0.7689:0.0	.	404;444	A2RTY3-3;A2RTY3	.;CQ066_HUMAN	I	444	ENSP00000309560:L444I	ENSP00000309560:L444I	L	-	1	2	C17orf66	31206816	1.000000	0.71417	0.998000	0.56505	0.180000	0.23129	0.630000	0.24553	1.007000	0.39238	0.563000	0.77884	CTA	.	.	.	none		0.542	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256487.1		
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39323904	39323904	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr17:39323904C>T	ENST00000391356.2	-	1	520	c.521G>A	c.(520-522)aGc>aAc	p.S174N		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	174	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GGTCGGGCAGCTGAAAGGGCA	0.607																																					p.S174N		Atlas-SNP	.											.	KRTAP4-3	40	.	0			c.G521A						PASS	.						24.0	27.0	26.0					17																	39323904		2107	4239	6346	SO:0001583	missense	85290	exon1			GGGCAGCTGAAAG	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.521G>A	chr17.hg19:g.39323904C>T	ENSP00000375151:p.Ser174Asn	157.0	0.0	.		148.0	64.0	.	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	hg19	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	14.96	2.692824	0.48202	.	.	ENSG00000196156	ENST00000391356	T	0.00622	6.16	5.15	4.16	0.48862	.	.	.	.	.	T	0.01222	0.0040	L	0.32530	0.975	0.09310	N	0.999997	P	0.42078	0.77	P	0.48368	0.575	T	0.54289	-0.8316	9	0.72032	D	0.01	.	13.6096	0.62068	0.0:0.8428:0.1572:0.0	.	174	Q9BYR4	KRA43_HUMAN	N	174	ENSP00000375151:S174N	ENSP00000375151:S174N	S	-	2	0	KRTAP4-3	36577430	0.259000	0.24043	0.006000	0.13384	0.005000	0.04900	1.066000	0.30604	1.240000	0.43803	0.655000	0.94253	AGC	.	.	.	none		0.607	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
RNF43	54894	hgsc.bcm.edu	37	17	56492851	56492851	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr17:56492851G>C	ENST00000584437.1	-	1	2043	c.88C>G	c.(88-90)Ctg>Gtg	p.L30V	RNF43_ENST00000500597.2_Missense_Mutation_p.L30V|RNF43_ENST00000583753.1_Missense_Mutation_p.L30V|RNF43_ENST00000577716.1_Missense_Mutation_p.L30V|RNF43_ENST00000407977.2_Missense_Mutation_p.L30V|RNF43_ENST00000580014.1_5'Flank|RNF43_ENST00000581868.1_Intron|BZRAP1-AS1_ENST00000583841.1_RNA			Q68DV7	RNF43_HUMAN	ring finger protein 43	30					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCCAGTACCAGTCCTGTGCGT	0.562																																					p.L30V		Atlas-SNP	.											.	RNF43	157	.	0			c.C88G						PASS	.						59.0	55.0	56.0					17																	56492851		2203	4300	6503	SO:0001583	missense	54894	exon2			GTACCAGTCCTGT		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.88C>G	chr17.hg19:g.56492851G>C	ENSP00000463069:p.Leu30Val	23.0	0.0	.		34.0	15.0	.	NM_017763	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	hg19	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.197704	0.58126	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.12879	3.01;2.64	5.49	5.49	0.81192	.	0.455866	0.18523	N	0.138716	T	0.11965	0.0291	N	0.14661	0.345	0.38350	D	0.944324	P;P	0.43633	0.675;0.813	B;B	0.41813	0.367;0.202	T	0.18304	-1.0341	10	0.40728	T	0.16	-7.7124	18.7282	0.91722	0.0:0.0:1.0:0.0	.	30;30	Q68DV7-2;Q68DV7	.;RNF43_HUMAN	V	30	ENSP00000385328:L30V;ENSP00000441969:L30V	ENSP00000385328:L30V	L	-	1	2	RNF43	53847850	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.910000	0.75741	2.734000	0.93682	0.655000	0.94253	CTG	.	.	.	none		0.562	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
TMC6	11322	hgsc.bcm.edu	37	17	76118811	76118811	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr17:76118811C>A	ENST00000590602.1	-	10	1261	c.1102G>T	c.(1102-1104)Gag>Tag	p.E368*	TMC6_ENST00000392467.3_Nonsense_Mutation_p.E368*|TMC6_ENST00000591436.1_Nonsense_Mutation_p.E7*|TMC6_ENST00000589553.1_Nonsense_Mutation_p.E141*|TMC6_ENST00000306591.7_Nonsense_Mutation_p.E368*|TMC6_ENST00000592076.1_5'UTR|TMC6_ENST00000322933.4_Nonsense_Mutation_p.E7*|TMC6_ENST00000322914.3_Nonsense_Mutation_p.E368*			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	368					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CGGTAGCTCTCCCCGAAAGAG	0.627																																					p.E368X		Atlas-SNP	.											.	TMC6	42	.	0			c.G1102T						PASS	.						48.0	44.0	45.0					17																	76118811		2200	4300	6500	SO:0001587	stop_gained	11322	exon10			AGCTCTCCCCGAA	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.1102G>T	chr17.hg19:g.76118811C>A	ENSP00000465261:p.Glu368*	24.0	0.0	.		25.0	11.0	.	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Nonsense_Mutation	SNP	ENST00000590602.1	hg19	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	C	39	7.353198	0.98231	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000306591;ENST00000322933	.	.	.	4.0	2.93	0.34026	.	0.611200	0.17763	N	0.162833	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-17.3755	7.2554	0.26173	0.0:0.8057:0.0:0.1943	.	.	.	.	X	368;368;368;7	.	ENSP00000306405:E368X	E	-	1	0	TMC6	73630406	0.975000	0.34042	1.000000	0.80357	0.937000	0.57800	2.464000	0.45067	2.032000	0.59987	0.462000	0.41574	GAG	.	.	.	none		0.627	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
ABCA7	10347	hgsc.bcm.edu	37	19	1043151	1043151	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr19:1043151A>C	ENST00000263094.6	+	8	922	c.691A>C	c.(691-693)Agc>Cgc	p.S231R	ABCA7_ENST00000433129.1_Missense_Mutation_p.S231R|ABCA7_ENST00000435683.2_Missense_Mutation_p.S93R	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	231					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGGGACCTAGCAGCACAGT	0.667																																					p.S231R		Atlas-SNP	.											.	ABCA7	174	.	0			c.A691C						PASS	.						45.0	48.0	47.0					19																	1043151		2203	4298	6501	SO:0001583	missense	10347	exon8			GGACCTAGCAGCA	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.691A>C	chr19.hg19:g.1043151A>C	ENSP00000263094:p.Ser231Arg	62.0	0.0	.		87.0	39.0	.	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	hg19	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	A	11.00	1.510090	0.27036	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.86432	-2.12;-2.12	3.57	-0.128	0.13506	.	.	.	.	.	T	0.78515	0.4295	L	0.44542	1.39	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.10450	0.005;0.004	T	0.62779	-0.6782	9	0.38643	T	0.18	.	3.1658	0.06535	0.506:0.2198:0.2742:0.0	.	93;231	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	R	231	ENSP00000263094:S231R;ENSP00000414062:S231R	ENSP00000263094:S231R	S	+	1	0	ABCA7	994151	0.000000	0.05858	0.001000	0.08648	0.055000	0.15305	0.299000	0.19138	-0.191000	0.10448	0.260000	0.18958	AGC	.	.	.	none		0.667	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
SUGP1	57794	hgsc.bcm.edu	37	19	19408123	19408123	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr19:19408123G>T	ENST00000247001.5	-	8	1265	c.918C>A	c.(916-918)taC>taA	p.Y306*	SUGP1_ENST00000585763.1_5'UTR	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	306					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						GGTAGTACTTGTACCCTTGGC	0.602																																					p.Y306X		Atlas-SNP	.											.	SUGP1	63	.	0			c.C918A						PASS	.						71.0	75.0	74.0					19																	19408123		2203	4300	6503	SO:0001587	stop_gained	57794	exon8			GTACTTGTACCCT	AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.918C>A	chr19.hg19:g.19408123G>T	ENSP00000247001:p.Tyr306*	50.0	0.0	.		65.0	24.0	.	NM_172231	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Nonsense_Mutation	SNP	ENST00000247001.5	hg19	CCDS12399.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494308	0.85069	.	.	ENSG00000105705	ENST00000247001	.	.	.	3.66	2.62	0.31277	.	0.202787	0.44097	D	0.000496	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.1097	0.25382	0.2133:0.0:0.7867:0.0	.	.	.	.	X	306	.	ENSP00000247001:Y306X	Y	-	3	2	SUGP1	19269123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.335000	0.43929	2.069000	0.61940	0.491000	0.48974	TAC	.	.	.	none		0.602	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460128.4	NM_021164	
ZNF681	148213	hgsc.bcm.edu	37	19	23938352	23938352	+	Splice_Site	SNP	T	T	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr19:23938352T>A	ENST00000402377.3	-	2	146	c.5A>T	c.(4-6)gAa>gTa	p.E2V	ZNF681_ENST00000395385.3_Intron	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTCAATGGTTCCTGAAAAac	0.393																																					p.E2V		Atlas-SNP	.											.	ZNF681	76	.	0			c.A5T						PASS	.						42.0	45.0	44.0					19																	23938352		2199	4300	6499	SO:0001630	splice_region_variant	148213	exon2			AATGGTTCCTGAA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.4-1A>T	chr19.hg19:g.23938352T>A		52.0	0.0	.		47.0	17.0	.	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	hg19	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	8.628	0.893033	0.17613	.	.	ENSG00000196172	ENST00000402377	T	0.00856	5.61	1.05	-0.649	0.11461	Krueppel-associated box (1);	.	.	.	.	T	0.01661	0.0053	M	0.72479	2.2	0.09310	N	1	P	0.46859	0.885	P	0.45794	0.493	T	0.40646	-0.9552	9	0.72032	D	0.01	.	3.2374	0.06770	0.0:0.3224:0.0:0.6776	.	2	Q96N22	ZN681_HUMAN	V	2	ENSP00000384000:E2V	ENSP00000384000:E2V	E	-	2	0	ZNF681	23730192	0.035000	0.19736	0.035000	0.18076	0.035000	0.12851	-0.294000	0.08309	-0.466000	0.06943	-0.467000	0.05162	GAA	.	.	.	none		0.393	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	Missense_Mutation
TMC2	117532	hgsc.bcm.edu	37	20	2517943	2517943	+	Silent	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr20:2517943G>A	ENST00000358864.1	+	2	78	c.63G>A	c.(61-63)aaG>aaA	p.K21K		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	21	Arg/Asp/Glu/Lys-rich (highly charged).				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GGCGGGTGAAGAGCGGCTCTC	0.632																																					p.K21K		Atlas-SNP	.											.	TMC2	121	.	0			c.G63A						PASS	.						57.0	49.0	51.0					20																	2517943		2201	4299	6500	SO:0001819	synonymous_variant	117532	exon2			GGTGAAGAGCGGC	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.63G>A	chr20.hg19:g.2517943G>A		26.0	0.0	.		38.0	12.0	.	NM_080751	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	ENST00000358864.1	hg19	CCDS13029.2																																																																																			.	.	.	none		0.632	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
RIPK4	54101	hgsc.bcm.edu	37	21	43176962	43176962	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr21:43176962A>G	ENST00000352483.2	-	2	261	c.197T>C	c.(196-198)cTt>cCt	p.L66P	RIPK4_ENST00000332512.3_Missense_Mutation_p.L66P|RIPK4_ENST00000542057.1_Missense_Mutation_p.L3P|RIPK4_ENST00000544709.1_Missense_Mutation_p.L3P			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	66	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTCTTCCAAAAGCTCCATGCG	0.522																																					p.L66P		Atlas-SNP	.											.	RIPK4	151	.	0			c.T197C						PASS	.						62.0	60.0	60.0					21																	43176962		2203	4300	6503	SO:0001583	missense	54101	exon2			TCCAAAAGCTCCA	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.197T>C	chr21.hg19:g.43176962A>G	ENSP00000330161:p.Leu66Pro	43.0	0.0	.		34.0	22.0	.	NM_020639	Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	hg19		.	.	.	.	.	.	.	.	.	.	A	21.1	4.094643	0.76870	.	.	ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	4.97	4.97	0.65823	.	0.000000	0.47852	D	0.000202	T	0.80099	0.4561	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83560	0.0106	10	0.87932	D	0	-18.798	14.1208	0.65186	1.0:0.0:0.0:0.0	.	66	P57078-2	.	P	66;66;3;3	ENSP00000332454:L66P;ENSP00000330161:L66P;ENSP00000441754:L3P;ENSP00000442901:L3P	ENSP00000332454:L66P	L	-	2	0	RIPK4	42050031	1.000000	0.71417	0.913000	0.36048	0.980000	0.70556	9.040000	0.93783	1.995000	0.58328	0.460000	0.39030	CTT	.	.	.	none		0.522	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
PLA2G6	8398	hgsc.bcm.edu	37	22	38565425	38565425	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr22:38565425G>T	ENST00000332509.3	-	2	192	c.9C>A	c.(7-9)ttC>ttA	p.F3L	PLA2G6_ENST00000402064.1_Missense_Mutation_p.F3L|PLA2G6_ENST00000335539.3_Missense_Mutation_p.F3L|PLA2G6_ENST00000435484.1_Missense_Mutation_p.F3L|PLA2G6_ENST00000436218.1_Missense_Mutation_p.F3L|PLA2G6_ENST00000447598.2_Missense_Mutation_p.F3L|PLA2G6_ENST00000417303.2_Missense_Mutation_p.F3L	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	3					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	GGCGGCCAAAGAACTGCATCT	0.597																																					p.F3L		Atlas-SNP	.											.	PLA2G6	54	.	0			c.C9A						PASS	.						65.0	52.0	57.0					22																	38565425		2203	4300	6503	SO:0001583	missense	8398	exon2			GCCAAAGAACTGC	AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.9C>A	chr22.hg19:g.38565425G>T	ENSP00000333142:p.Phe3Leu	36.0	0.0	.		37.0	14.0	.	NM_003560	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	ENST00000332509.3	hg19	CCDS13967.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116009	0.77323	.	.	ENSG00000184381	ENST00000332509;ENST00000419848;ENST00000335539;ENST00000402064;ENST00000335538;ENST00000396860;ENST00000451461;ENST00000430886;ENST00000455341	T;T;T;T;T	0.76448	0.03;0.11;0.11;1.12;-1.02	4.63	3.61	0.41365	.	0.050453	0.85682	D	0.000000	T	0.76535	0.4001	N	0.19112	0.55	0.26351	N	0.977208	B;P;B	0.52577	0.048;0.954;0.09	B;D;B	0.66351	0.039;0.943;0.063	T	0.67256	-0.5716	10	0.45353	T	0.12	-21.5614	9.9606	0.41693	0.0976:0.0:0.9024:0.0	.	3;3;3	B7Z6K3;O60733-2;O60733	.;.;PA2G6_HUMAN	L	3	ENSP00000333142:F3L;ENSP00000335149:F3L;ENSP00000386100:F3L;ENSP00000395464:F3L;ENSP00000393761:F3L	ENSP00000333142:F3L	F	-	3	2	PLA2G6	36895371	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.538000	0.36094	0.953000	0.37825	0.555000	0.69702	TTC	.	.	.	none		0.597	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1	NM_001004426	
MT-ATP8	4509	hgsc.bcm.edu	37	M	8390	8390	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chrM:8390T>C	ENST00000361851.1	+	1	25	c.25T>C	c.(25-27)Tgg>Cgg	p.W9R	MT-TG_ENST00000387429.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-CO3_ENST00000362079.2_5'Flank			P03928	ATP8_HUMAN	mitochondrially encoded ATP synthase 8	9					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)										ATACTACCGTATGGCCCACCA	0.403																																					p.W9R		Atlas-SNP	.											.	.	.	.	0			c.T25C						PASS	.																																			SO:0001583	missense	0	exon1			ACCGTATGGCCCA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000228253	ENSG00000228253		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7415	protein-coding gene	gene with protein product		516070	"""ATP synthase 8"""	MTATP8			Standard			Approved	ATP8, A6L		P03928		ENST00000361851.1:c.25T>C	chrM.hg19:g.8390T>C	ENSP00000355265:p.Trp9Arg	18.0	0.0	.		711.0	101.0	.	ENST00000361851	Q34771	Missense_Mutation	SNP	ENST00000361851.1	hg19																																																																																				.	.	.	none		0.403	MT-ATP8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024030	
MT-ND4	4538	hgsc.bcm.edu	37	M	10911	10911	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chrM:10911G>A	ENST00000361381.2	+	1	152	c.152G>A	c.(151-153)aGc>aAc	p.S51N	MT-TG_ENST00000387429.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	51					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CAACCTATTTAGCTGTTCCCC	0.438																																					p.S51N		Atlas-SNP	.											.	.	.	.	0			c.G152A						PASS	.																																			SO:0001583	missense	0	exon1			TATTTAGCTGTTC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.152G>A	chrM.hg19:g.10911G>A	ENSP00000354961:p.Ser51Asn	13.0	0.0	.		624.0	65.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.438	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
CCDC7	79741	hgsc.bcm.edu	37	10	33123784	33123786	+	In_Frame_Del	DEL	ATA	ATA	-			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	ATA	ATA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr10:33123784_33123786delATA	ENST00000375030.2	+	15	1618_1620	c.1000_1002delATA	c.(1000-1002)atadel	p.I335del	C10orf68_ENST00000375025.4_In_Frame_Del_p.I412del|C10orf68_ENST00000375028.3_In_Frame_Del_p.I352del			Q9H943	CJ068_HUMAN		376										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TGGAAAAGATATAATAAAGCATC	0.305																																					p.374_375del		Atlas-Indel,Pindel	.											.	C10orf68	75	.	0			c.1122_1124del						PASS	.																																			SO:0001651	inframe_deletion	79741	exon14			.																												ENST00000375030.2:c.1000_1002delATA	chr10.hg19:g.33123787_33123789delATA	ENSP00000364170:p.Ile335del	165.0	0.0	0		211.0	80.0	0.379147	NM_024688	B0QZ71|Q08AN7|Q8N7T7	In_Frame_Del	DEL	ENST00000375030.2	hg19																																																																																				.	.	.	none		0.305	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2		
URI1	8725	hgsc.bcm.edu	37	19	30505796	30505796	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr19:30505796delT	ENST00000542441.2	+	11	1725	c.1428delT	c.(1426-1428)gctfs	p.A476fs	URI1_ENST00000392271.1_Frame_Shift_Del_p.A400fs|URI1_ENST00000312051.6_Frame_Shift_Del_p.A436fs|URI1_ENST00000360605.4_Intron			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	476					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										TTTTCTAGGCTTTTTCTGGAA	0.378																																					p.A476fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1427delC						PASS	.						96.0	104.0	102.0					19																	30505796		2203	4299	6502	SO:0001589	frameshift_variant	8725	exon11			.	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1428delT	chr19.hg19:g.30505796delT	ENSP00000442436:p.Ala476fs	49.0	0.0	0		78.0	40.0	0.512821	NM_003796	A8K805|H7BY42|Q8TC23|Q9UNU3	Frame_Shift_Del	DEL	ENST00000542441.2	hg19	CCDS12420.1																																																																																			.	.	.	none		0.378	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
CASC5	57082	hgsc.bcm.edu	37	15	40916020	40916020	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr15:40916020delC	ENST00000346991.5	+	11	4026	c.3636delC	c.(3634-3636)aacfs	p.N1212fs	CASC5_ENST00000399668.2_Frame_Shift_Del_p.N1186fs			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1212					acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TTGAAGAAAACCCTAAATTTG	0.378																																					p.N1212fs		Atlas-Indel,Pindel	.											.	CASC5	269	.	0			c.3635delA						PASS	.						46.0	44.0	44.0					15																	40916020		1809	4077	5886	SO:0001589	frameshift_variant	57082	exon11			.	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.3636delC	chr15.hg19:g.40916020delC	ENSP00000335463:p.Asn1212fs	48.0	0.0	0		72.0	37.0	0.513889	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Frame_Shift_Del	DEL	ENST00000346991.5	hg19	CCDS42023.1																																																																																			.	.	.	none		0.378	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
HMCN1	83872	hgsc.bcm.edu	37	1	186026523	186026524	+	Frame_Shift_Ins	INS	-	-	ATTCTTTCAGGTA			TCGA-SX-A7SO-01A-11D-A34Z-10	TCGA-SX-A7SO-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	aa1c7a5a-c790-4454-a6b9-3e6510dd803a	f0bb345a-2e8b-4af6-8320-fc9be302a5ff	g.chr1:186026523_186026524insATTCTTTCAGGTA	ENST00000271588.4	+	46	7531_7532	c.7302_7303insATTCTTTCAGGTA	c.(7303-7305)attfs	p.-2435fs	HMCN1_ENST00000367492.2_Frame_Shift_Ins_p.-2435fs	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1						response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.R2434S(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATTCTGTGAGGATTCTTTCAGG	0.391																																					p.R2434fs		Pindel	.											HMCN1,NS,carcinoma,0,1	HMCN1	797	.	1	Substitution - Missense(1)	lung(1)	c.7302_7303insATTCTTTCAGGTA						PASS	.																																			SO:0001589	frameshift_variant	83872	exon46			.	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	Exception_encountered	chr1.hg19:g.186026523_186026524insATTCTTTCAGGTA	ENSP00000271588:p.Ile2435fs	58.0	0.0	.		60.0	14.0	0.233	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Frame_Shift_Ins	INS	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.	.	none		0.391	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
