#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	hgsc.bcm.edu	37	1	19526243	19526243	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr1:19526243G>C	ENST00000375254.3	-	3	307	c.280C>G	c.(280-282)Cgg>Ggg	p.R94G	UBR4_ENST00000375226.2_Missense_Mutation_p.R94G|UBR4_ENST00000375267.2_Missense_Mutation_p.R94G|UBR4_ENST00000375217.2_Missense_Mutation_p.R94G	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	94					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGTTGGTTCCGGGGAACTGAG	0.438																																					p.R94G		Atlas-SNP	.											UBR4,NS,carcinoma,0,1	UBR4	415	.	0			c.C280G						PASS	.						58.0	62.0	61.0					1																	19526243		2203	4300	6503	SO:0001583	missense	23352	exon3			GGTTCCGGGGAAC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.280C>G	chr1.hg19:g.19526243G>C	ENSP00000364403:p.Arg94Gly	32.0	0.0	.		30.0	10.0	.	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	hg19	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490277	0.64074	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.45	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.33294	0.0858	N	0.22421	0.69	0.80722	D	1	D	0.60160	0.987	D	0.65010	0.931	T	0.10064	-1.0646	10	0.54805	T	0.06	.	12.1758	0.54184	0.0:0.0:0.5839:0.4161	.	94	Q5T4S7	UBR4_HUMAN	G	94	ENSP00000364403:R94G;ENSP00000364416:R94G;ENSP00000364365:R94G;ENSP00000364374:R94G	ENSP00000364365:R94G	R	-	1	2	UBR4	19398830	1.000000	0.71417	0.998000	0.56505	0.932000	0.56968	4.442000	0.59988	1.407000	0.46875	-0.188000	0.12872	CGG	.	.	.	none		0.438	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
MATN1	4146	hgsc.bcm.edu	37	1	31191691	31191691	+	Silent	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr1:31191691C>T	ENST00000373765.4	-	3	590	c.555G>A	c.(553-555)aaG>aaA	p.K185K	MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000454613.1_RNA|MATN1_ENST00000477320.1_5'UTR|MATN1-AS1_ENST00000414763.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	185	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGCGTGGCCTTGTCCACGC	0.667																																					p.K185K		Atlas-SNP	.											.	MATN1	28	.	0			c.G555A						PASS	.						30.0	28.0	29.0					1																	31191691		2201	4300	6501	SO:0001819	synonymous_variant	4146	exon3			CGTGGCCTTGTCC	M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.555G>A	chr1.hg19:g.31191691C>T		50.0	0.0	.		43.0	14.0	.	NM_002379	B2R7E3|Q5TBB9	Silent	SNP	ENST00000373765.4	hg19	CCDS336.1																																																																																			.	.	.	none		0.667	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010458.1	NM_002379	
DNTTIP2	30836	hgsc.bcm.edu	37	1	94341933	94341933	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr1:94341933T>C	ENST00000436063.2	-	2	1615	c.1558A>G	c.(1558-1560)Aaa>Gaa	p.K520E	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		tcctcttctttttcttcctcA	0.368																																					p.K520E		Atlas-SNP	.											.	DNTTIP2	59	.	0			c.A1558G						PASS	.						123.0	106.0	111.0					1																	94341933		1860	4081	5941	SO:0001583	missense	30836	exon2			CTTCTTTTTCTTC	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.1558A>G	chr1.hg19:g.94341933T>C	ENSP00000411010:p.Lys520Glu	201.0	0.0	.		259.0	74.0	.	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	hg19	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	T	2.748	-0.260753	0.05791	.	.	ENSG00000067334	ENST00000436063	T	0.13538	2.58	4.78	-1.49	0.08718	.	0.927580	0.09139	N	0.843213	T	0.01189	0.0039	N	0.08118	0	0.18873	N	0.999989	B	0.06786	0.001	B	0.04013	0.001	T	0.47812	-0.9088	10	0.02654	T	1	.	6.8859	0.24199	0.0:0.2787:0.1252:0.5962	.	520	Q5QJE6	TDIF2_HUMAN	E	520	ENSP00000411010:K520E	ENSP00000352137:K520E	K	-	1	0	DNTTIP2	94114521	0.000000	0.05858	0.479000	0.27329	0.916000	0.54674	-0.269000	0.08596	-0.127000	0.11661	0.496000	0.49642	AAA	.	.	.	none		0.368	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
PDCL3	79031	hgsc.bcm.edu	37	2	101183077	101183077	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr2:101183077T>C	ENST00000264254.6	+	2	497	c.119T>C	c.(118-120)cTc>cCc	p.L40P		NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3	40					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)			endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						CAGCGCATCCTCCAGCAGTCA	0.532																																					p.L40P		Atlas-SNP	.											.	PDCL3	27	.	0			c.T119C						PASS	.						64.0	63.0	63.0					2																	101183077		2203	4300	6503	SO:0001583	missense	79031	exon2			GCATCCTCCAGCA	AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.119T>C	chr2.hg19:g.101183077T>C	ENSP00000264254:p.Leu40Pro	129.0	0.0	.		165.0	53.0	.	NM_024065	B2RA00|Q53S68	Missense_Mutation	SNP	ENST00000264254.6	hg19	CCDS33261.1	.	.	.	.	.	.	.	.	.	.	.	9.683	1.149916	0.21371	.	.	ENSG00000115539	ENST00000264254	T	0.41758	0.99	4.61	4.61	0.57282	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);	0.302798	0.29066	N	0.013248	T	0.33789	0.0875	L	0.37750	1.13	0.58432	D	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.09122	-1.0689	10	0.30854	T	0.27	-27.9473	14.0053	0.64459	0.0:0.0:0.0:1.0	.	40	Q9H2J4	PDCL3_HUMAN	P	40	ENSP00000264254:L40P	ENSP00000264254:L40P	L	+	2	0	PDCL3	100549509	0.214000	0.23563	0.845000	0.33349	0.207000	0.24258	1.019000	0.30014	1.728000	0.51552	0.363000	0.22086	CTC	.	.	.	none		0.532	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329734.1	NM_024065	
DYTN	391475	hgsc.bcm.edu	37	2	207527877	207527877	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr2:207527877G>C	ENST00000452335.2	-	11	1499	c.1383C>G	c.(1381-1383)caC>caG	p.H461Q		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	461						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CCCTGGTGCTGTGCAAAGTGG	0.483																																					p.H461Q		Atlas-SNP	.											.	DYTN	168	.	0			c.C1383G						PASS	.						180.0	171.0	174.0					2																	207527877		2039	4193	6232	SO:0001583	missense	391475	exon11			GGTGCTGTGCAAA	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1383C>G	chr2.hg19:g.207527877G>C	ENSP00000396593:p.His461Gln	312.0	0.0	.		353.0	108.0	.	NM_001093730		Missense_Mutation	SNP	ENST00000452335.2	hg19	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.544248	0.00934	.	.	ENSG00000232125	ENST00000452335	T	0.08193	3.12	5.12	0.0828	0.14430	.	.	.	.	.	T	0.02380	0.0073	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45687	-0.9244	9	0.02654	T	1	-1.1026	4.4038	0.11399	0.0:0.2781:0.2036:0.5183	.	461	A2CJ06	DYTN_HUMAN	Q	461	ENSP00000396593:H461Q	ENSP00000396593:H461Q	H	-	3	2	DYTN	207236122	0.151000	0.22747	0.057000	0.19452	0.036000	0.12997	0.011000	0.13264	0.126000	0.18424	-0.284000	0.09977	CAC	.	.	.	none		0.483	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		
TNS1	7145	hgsc.bcm.edu	37	2	218712647	218712647	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr2:218712647C>G	ENST00000171887.4	-	17	2670	c.2218G>C	c.(2218-2220)Ggg>Cgg	p.G740R	TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000430930.1_Missense_Mutation_p.G740R|TNS1_ENST00000419504.1_Missense_Mutation_p.G740R	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	740					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGAGAAGCCCCTGGCCAGGCC	0.607																																					p.G740R		Atlas-SNP	.											.	TNS1	251	.	0			c.G2218C						PASS	.						18.0	22.0	21.0					2																	218712647		2203	4300	6503	SO:0001583	missense	7145	exon17			AAGCCCCTGGCCA	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.2218G>C	chr2.hg19:g.218712647C>G	ENSP00000171887:p.Gly740Arg	42.0	0.0	.		57.0	15.0	.	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	hg19	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.567344	0.45694	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930	D;D;D	0.91237	-2.79;-2.81;-2.8	4.45	4.45	0.53987	.	0.733784	0.13287	N	0.399289	D	0.84174	0.5414	N	0.19112	0.55	0.80722	D	1	B;D;P;P;P	0.56035	0.244;0.974;0.93;0.868;0.93	B;P;B;B;P	0.45913	0.07;0.497;0.36;0.383;0.462	T	0.80063	-0.1539	10	0.29301	T	0.29	.	9.3101	0.37898	0.0:0.7696:0.1478:0.0825	.	740;794;740;740;740	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	R	740	ENSP00000171887:G740R;ENSP00000408724:G740R;ENSP00000406016:G740R	ENSP00000171887:G740R	G	-	1	0	TNS1	218420892	1.000000	0.71417	0.986000	0.45419	0.907000	0.53573	2.690000	0.47001	2.310000	0.77875	0.462000	0.41574	GGG	.	.	.	none		0.607	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
WNT7A	7476	hgsc.bcm.edu	37	3	13860881	13860881	+	Missense_Mutation	SNP	C	C	T	rs387907231		TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr3:13860881C>T	ENST00000285018.4	-	4	914	c.610G>A	c.(610-612)Ggc>Agc	p.G204S		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	204					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						CCTGACACGCCGTGGCACTTA	0.602																																					p.G204S		Atlas-SNP	.											.	WNT7A	70	.	0			c.G610A						PASS	.						109.0	100.0	103.0					3																	13860881		2203	4300	6503	SO:0001583	missense	7476	exon4			ACACGCCGTGGCA	D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.610G>A	chr3.hg19:g.13860881C>T	ENSP00000285018:p.Gly204Ser	56.0	0.0	.		66.0	31.0	.	NM_004625	Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	hg19	CCDS2616.1	.	.	.	.	.	.	.	.	.	.	c	19.41	3.822077	0.71028	.	.	ENSG00000154764	ENST00000285018	D	0.83837	-1.77	4.29	4.29	0.51040	Secreted growth factor Wnt protein, conserved site (1);	0.101745	0.64402	D	0.000003	D	0.94732	0.8300	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97237	0.9888	10	0.87932	D	0	.	17.1402	0.86750	0.0:1.0:0.0:0.0	.	204	O00755	WNT7A_HUMAN	S	204	ENSP00000285018:G204S	ENSP00000285018:G204S	G	-	1	0	WNT7A	13835882	1.000000	0.71417	0.819000	0.32651	0.253000	0.25986	7.810000	0.86072	2.121000	0.65114	0.558000	0.71614	GGC	.	.	.	none		0.602	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625	
ARIH2	10425	hgsc.bcm.edu	37	3	49005966	49005966	+	Splice_Site	SNP	G	G	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr3:49005966G>T	ENST00000356401.4	+	7	877		c.e7-1		ARIH2_ENST00000449376.1_Splice_Site|ARIH2_ENST00000490095.1_Splice_Site	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2						developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TTGTTCAACAGGAGTCTCTTG	0.517																																					.		Atlas-SNP	.											.	ARIH2	32	.	0			c.539-1G>T						PASS	.						129.0	119.0	122.0					3																	49005966		2203	4300	6503	SO:0001630	splice_region_variant	10425	exon7			TCAACAGGAGTCT	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.539-1G>T	chr3.hg19:g.49005966G>T		66.0	0.0	.		88.0	43.0	.	NM_006321	Q9HBZ6|Q9UEM9	Splice_Site	SNP	ENST00000356401.4	hg19	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470290	0.84533	.	.	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1346	0.98019	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARIH2	48980970	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.444000	0.97578	2.765000	0.95021	0.655000	0.94253	.	.	.	.	none		0.517	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257525.1	NM_006321	Intron
TMF1	7110	hgsc.bcm.edu	37	3	69092928	69092928	+	Silent	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr3:69092928G>A	ENST00000398559.2	-	4	1767	c.1551C>T	c.(1549-1551)gcC>gcT	p.A517A	CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|TMF1_ENST00000543976.1_Silent_p.A520A			P82094	TMF1_HUMAN	TATA element modulatory factor 1	517					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TCTCTTTGCAGGCTAGTTGAA	0.323																																					p.A517A		Atlas-SNP	.											.	TMF1	77	.	0			c.C1551T						PASS	.						76.0	68.0	70.0					3																	69092928		1799	4082	5881	SO:0001819	synonymous_variant	7110	exon4			TTTGCAGGCTAGT		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.1551C>T	chr3.hg19:g.69092928G>A		359.0	0.0	.		572.0	28.0	.	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Silent	SNP	ENST00000398559.2	hg19	CCDS43105.1																																																																																			.	.	.	none		0.323	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
KLB	152831	hgsc.bcm.edu	37	4	39449950	39449950	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr4:39449950G>C	ENST00000257408.4	+	5	2876	c.2779G>C	c.(2779-2781)Ggc>Cgc	p.G927R		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	927	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CAGAATCAAAGGCTATTATGC	0.299																																					p.G927R		Atlas-SNP	.											.	KLB	95	.	0			c.G2779C						PASS	.						34.0	37.0	36.0					4																	39449950		2199	4299	6498	SO:0001583	missense	152831	exon5			ATCAAAGGCTATT	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2779G>C	chr4.hg19:g.39449950G>C	ENSP00000257408:p.Gly927Arg	225.0	0.0	.		291.0	90.0	.	NM_175737	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	hg19	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785144	0.90282	.	.	ENSG00000134962	ENST00000257408	T	0.74737	-0.87	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.90150	0.6922	M	0.92833	3.35	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91708	0.5379	10	0.87932	D	0	-25.4111	20.0143	0.97474	0.0:0.0:1.0:0.0	.	918;927	B7ZL50;Q86Z14	.;KLOTB_HUMAN	R	927	ENSP00000257408:G927R	ENSP00000257408:G927R	G	+	1	0	KLB	39126345	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.061000	0.89467	2.740000	0.93945	0.313000	0.20887	GGC	.	.	.	none		0.299	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
SLC10A4	201780	hgsc.bcm.edu	37	4	48487117	48487117	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr4:48487117C>A	ENST00000273861.4	+	2	978	c.759C>A	c.(757-759)ttC>ttA	p.F253L		NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						TGGGCGTCTTCATTCGCTACA	0.547																																					p.F253L		Atlas-SNP	.											.	SLC10A4	23	.	0			c.C759A						PASS	.						129.0	123.0	125.0					4																	48487117		2203	4300	6503	SO:0001583	missense	201780	exon2			CGTCTTCATTCGC	BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.759C>A	chr4.hg19:g.48487117C>A	ENSP00000273861:p.Phe253Leu	148.0	0.0	.		165.0	56.0	.	NM_152679	Q8WUZ2	Missense_Mutation	SNP	ENST00000273861.4	hg19	CCDS3482.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951156	0.53186	.	.	ENSG00000145248	ENST00000273861	T	0.06528	3.29	5.03	5.03	0.67393	.	0.414564	0.29730	N	0.011353	T	0.03053	0.0090	N	0.01464	-0.85	0.45439	D	0.998413	B	0.06786	0.001	B	0.08055	0.003	T	0.54016	-0.8356	10	0.14252	T	0.57	-16.4047	18.9279	0.92552	0.0:1.0:0.0:0.0	.	253	Q96EP9	NTCP4_HUMAN	L	253	ENSP00000273861:F253L	ENSP00000273861:F253L	F	+	3	2	SLC10A4	48181874	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	2.030000	0.41108	2.771000	0.95319	0.563000	0.77884	TTC	.	.	.	none		0.547	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219926.3	NM_152679	
YTHDC1	91746	hgsc.bcm.edu	37	4	69197866	69197866	+	Silent	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr4:69197866G>A	ENST00000344157.4	-	7	1412	c.1077C>T	c.(1075-1077)ctC>ctT	p.L359L	YTHDC1_ENST00000579690.1_Silent_p.L359L|YTHDC1_ENST00000355665.3_Silent_p.L341L	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	359	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						TACTCTTTATGAGGAAAAATC	0.333																																					p.L359L		Atlas-SNP	.											.	YTHDC1	81	.	0			c.C1077T						PASS	.						115.0	108.0	110.0					4																	69197866		2203	4300	6503	SO:0001819	synonymous_variant	91746	exon7			CTTTATGAGGAAA	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1077C>T	chr4.hg19:g.69197866G>A		125.0	0.0	.		125.0	27.0	.	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	hg19	CCDS33992.1																																																																																			.	.	.	none		0.333	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
KIAA1109	84162	hgsc.bcm.edu	37	4	123160922	123160922	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr4:123160922T>G	ENST00000264501.4	+	29	4458	c.4085T>G	c.(4084-4086)tTt>tGt	p.F1362C	KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000388738.3_Missense_Mutation_p.F1362C|KIAA1109_ENST00000455637.1_Missense_Mutation_p.F1362C			Q2LD37	K1109_HUMAN	KIAA1109	1362					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGGAGAAGTTTTGGTTCATTC	0.423																																					p.F1362C		Atlas-SNP	.											.	KIAA1109	424	.	0			c.T4085G						PASS	.						112.0	105.0	107.0					4																	123160922		1937	4138	6075	SO:0001583	missense	84162	exon27			GAAGTTTTGGTTC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.4085T>G	chr4.hg19:g.123160922T>G	ENSP00000264501:p.Phe1362Cys	120.0	0.0	.		157.0	58.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.08|19.08	3.757454|3.757454	0.69648|0.69648	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	T;T;T|.	0.30182|.	2.14;2.14;1.54|.	5.98|5.98	5.98|5.98	0.97165|0.97165	.|.	0.152547|0.152547	0.28247|0.28247	U|U	0.016055|0.016055	T|T	0.49406|0.49406	0.1555|0.1555	N|N	0.14661|0.14661	0.345|0.345	0.41980|0.41980	D|D	0.990792|0.990792	D|.	0.63880|.	0.993|.	P|.	0.53185|.	0.72|.	T|T	0.47959|0.47959	-0.9076|-0.9076	10|6	0.62326|.	D|.	0.03|.	.|.	16.4731|16.4731	0.84124|0.84124	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1362|.	Q2LD37|.	K1109_HUMAN|.	C|L	1362|1193	ENSP00000264501:F1362C;ENSP00000373390:F1362C;ENSP00000389925:F1362C|.	ENSP00000264501:F1362C|.	F|F	+|+	2|3	0|2	KIAA1109|KIAA1109	123380372|123380372	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.907000|5.907000	0.69908|0.69908	2.293000|2.293000	0.77203|0.77203	0.528000|0.528000	0.53228|0.53228	TTT|TTT	.	.	.	none		0.423	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
KIAA1109	84162	hgsc.bcm.edu	37	4	123170744	123170744	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr4:123170744C>A	ENST00000264501.4	+	36	5990	c.5617C>A	c.(5617-5619)Caa>Aaa	p.Q1873K	KIAA1109_ENST00000388738.3_Missense_Mutation_p.Q1873K|KIAA1109_ENST00000455637.1_Missense_Mutation_p.Q1873K			Q2LD37	K1109_HUMAN	KIAA1109	1873					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AACTGATCAGCAAGCTGTTCC	0.383																																					p.Q1873K		Atlas-SNP	.											.	KIAA1109	424	.	0			c.C5617A						PASS	.						126.0	118.0	120.0					4																	123170744		1834	4096	5930	SO:0001583	missense	84162	exon34			GATCAGCAAGCTG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.5617C>A	chr4.hg19:g.123170744C>A	ENSP00000264501:p.Gln1873Lys	120.0	0.0	.		171.0	59.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.44|15.44	2.834437|2.834437	0.50951|0.50951	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000446180	T;T;T|.	0.23147|.	2.5;2.5;1.92|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.156761|.	0.27289|.	U|.	0.020053|.	T|T	0.54319|0.54319	0.1851|0.1851	N|N	0.19112|0.19112	0.55|0.55	0.44728|0.44728	D|D	0.997724|0.997724	B;B|.	0.18310|.	0.027;0.001|.	B;B|.	0.18561|.	0.022;0.004|.	T|T	0.49021|0.49021	-0.8982|-0.8982	10|5	0.40728|.	T|.	0.16|.	.|.	19.2917|19.2917	0.94102|0.94102	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1872;1873|.	Q2LD37-2;Q2LD37|.	.;K1109_HUMAN|.	K|R	1873|445	ENSP00000264501:Q1873K;ENSP00000373390:Q1873K;ENSP00000389925:Q1873K|.	ENSP00000264501:Q1873K|.	Q|S	+|+	1|3	0|2	KIAA1109|KIAA1109	123390194|123390194	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.931000|0.931000	0.56810|0.56810	4.621000|4.621000	0.61233|0.61233	2.557000|2.557000	0.86248|0.86248	0.455000|0.455000	0.32223|0.32223	CAA|AGC	.	.	.	none		0.383	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
GPR98	84059	hgsc.bcm.edu	37	5	90041606	90041606	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr5:90041606T>G	ENST00000405460.2	+	52	11064	c.10968T>G	c.(10966-10968)ttT>ttG	p.F3656L		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3656	Calx-beta 24. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGTTGCATTTGCTCAGGTAA	0.343																																					p.F3656L		Atlas-SNP	.											.	GPR98	605	.	0			c.T10968G						PASS	.						110.0	99.0	103.0					5																	90041606		1883	4110	5993	SO:0001583	missense	84059	exon52			TGCATTTGCTCAG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.10968T>G	chr5.hg19:g.90041606T>G	ENSP00000384582:p.Phe3656Leu	44.0	0.0	.		43.0	13.0	.	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.9|24.9	4.586652|4.586652	0.86851|0.86851	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.28255|.	1.62|.	5.59|5.59	4.43|4.43	0.53597|0.53597	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78227|0.78227	0.4250|0.4250	M|M	0.89534|0.89534	3.04|3.04	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.996|.	D;P|.	0.73380|.	0.98;0.836|.	T|T	0.79923|0.79923	-0.1598|-0.1598	10|5	0.72032|.	D|.	0.01|.	.|.	10.2968|10.2968	0.43629|0.43629	0.0:0.0815:0.0:0.9185|0.0:0.0815:0.0:0.9185	.|.	3656;3656|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	L|W	3656|1222	ENSP00000384582:F3656L|.	ENSP00000296619:F3656L|.	F|L	+|+	3|2	2|0	GPR98|GPR98	90077362|90077362	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	2.449000|2.449000	0.44935|0.44935	0.953000|0.953000	0.37825|0.37825	0.460000|0.460000	0.39030|0.39030	TTT|TTG	.	.	.	none		0.343	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GRM6	2916	hgsc.bcm.edu	37	5	178418914	178418914	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr5:178418914A>T	ENST00000517717.1	-	3	713	c.675T>A	c.(673-675)taT>taA	p.Y225*	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Nonsense_Mutation_p.Y225*			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	225					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CACTTTCGCCATAGTTGCCCT	0.642																																					p.Y225X		Atlas-SNP	.											.	GRM6	149	.	0			c.T675A						PASS	.						76.0	64.0	68.0					5																	178418914		2203	4300	6503	SO:0001587	stop_gained	2916	exon2			TTCGCCATAGTTG	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.675T>A	chr5.hg19:g.178418914A>T	ENSP00000430767:p.Tyr225*	43.0	0.0	.		57.0	23.0	.	NM_000843		Nonsense_Mutation	SNP	ENST00000517717.1	hg19	CCDS4442.1	.	.	.	.	.	.	.	.	.	.	A	38	6.795385	0.97845	.	.	ENSG00000113262	ENST00000319065;ENST00000231188;ENST00000517717	.	.	.	5.48	-1.16	0.09678	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4038	0.44246	0.5205:0.0:0.4795:0.0	.	.	.	.	X	173;225;225	.	ENSP00000231188:Y225X	Y	-	3	2	GRM6	178351520	0.859000	0.29813	0.992000	0.48379	0.846000	0.48090	0.051000	0.14141	-0.341000	0.08376	0.533000	0.62120	TAT	.	.	.	none		0.642	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2		
RRP36	88745	hgsc.bcm.edu	37	6	42995142	42995142	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr6:42995142G>C	ENST00000244496.5	+	6	580	c.570G>C	c.(568-570)gaG>gaC	p.E190D		NM_033112.2	NP_149103.1	Q96EU6	RRP36_HUMAN	ribosomal RNA processing 36 homolog (S. cerevisiae)	190					ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(5)|lung(1)|ovary(1)|prostate(1)	11						AACAGCAGGAGCTGCACCTGG	0.532																																					p.E190D		Atlas-SNP	.											.	RRP36	20	.	0			c.G570C						PASS	.						65.0	60.0	62.0					6																	42995142		2203	4300	6503	SO:0001583	missense	88745	exon6			GCAGGAGCTGCAC	BC011933	CCDS34453.1	6p21.1	2010-07-06	2010-07-06	2010-07-06	ENSG00000124541	ENSG00000124541			21374	protein-coding gene	gene with protein product		613475	"""chromosome 6 open reading frame 153"""	C6orf153		20038530	Standard	NM_033112		Approved	dJ20C7.4	uc003otp.1	Q96EU6	OTTHUMG00000014715	ENST00000244496.5:c.570G>C	chr6.hg19:g.42995142G>C	ENSP00000244496:p.Glu190Asp	84.0	0.0	.		85.0	33.0	.	NM_033112	Q9BRF6|Q9P0C8	Missense_Mutation	SNP	ENST00000244496.5	hg19	CCDS34453.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462215	0.26248	.	.	ENSG00000124541	ENST00000244496	T	0.52295	0.67	5.55	-0.557	0.11800	.	0.254509	0.29653	N	0.011549	T	0.21267	0.0512	L	0.53617	1.68	0.32097	N	0.591077	B	0.30482	0.281	B	0.34931	0.192	T	0.04635	-1.0937	10	0.51188	T	0.08	.	5.2928	0.15737	0.4791:0.1479:0.373:0.0	.	190	Q96EU6	RRP36_HUMAN	D	190	ENSP00000244496:E190D	ENSP00000244496:E190D	E	+	3	2	RRP36	43103120	1.000000	0.71417	0.849000	0.33467	0.153000	0.21895	1.358000	0.34102	0.030000	0.15379	0.462000	0.41574	GAG	.	.	.	none		0.532	RRP36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040572.1	NM_033112	
RRP36	88745	hgsc.bcm.edu	37	6	42995151	42995151	+	Silent	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr6:42995151G>C	ENST00000244496.5	+	6	589	c.579G>C	c.(577-579)ctG>ctC	p.L193L		NM_033112.2	NP_149103.1	Q96EU6	RRP36_HUMAN	ribosomal RNA processing 36 homolog (S. cerevisiae)	193					ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(5)|lung(1)|ovary(1)|prostate(1)	11						AGCTGCACCTGGCCCTGAAGC	0.552																																					p.L193L		Atlas-SNP	.											.	RRP36	20	.	0			c.G579C						PASS	.						64.0	60.0	62.0					6																	42995151		2203	4300	6503	SO:0001819	synonymous_variant	88745	exon6			GCACCTGGCCCTG	BC011933	CCDS34453.1	6p21.1	2010-07-06	2010-07-06	2010-07-06	ENSG00000124541	ENSG00000124541			21374	protein-coding gene	gene with protein product		613475	"""chromosome 6 open reading frame 153"""	C6orf153		20038530	Standard	NM_033112		Approved	dJ20C7.4	uc003otp.1	Q96EU6	OTTHUMG00000014715	ENST00000244496.5:c.579G>C	chr6.hg19:g.42995151G>C		88.0	0.0	.		84.0	31.0	.	NM_033112	Q9BRF6|Q9P0C8	Silent	SNP	ENST00000244496.5	hg19	CCDS34453.1																																																																																			.	.	.	none		0.552	RRP36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040572.1	NM_033112	
BMPER	168667	hgsc.bcm.edu	37	7	34125603	34125603	+	Silent	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr7:34125603G>A	ENST00000297161.2	+	14	2018	c.1644G>A	c.(1642-1644)ggG>ggA	p.G548G	BMPER_ENST00000426693.1_Silent_p.G548G	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	548	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TGTGTCAAGGGACAGTCAAGG	0.507																																					p.G548G		Atlas-SNP	.											.	BMPER	131	.	0			c.G1644A						PASS	.						143.0	136.0	138.0					7																	34125603		2203	4300	6503	SO:0001819	synonymous_variant	168667	exon14			TCAAGGGACAGTC		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1644G>A	chr7.hg19:g.34125603G>A		66.0	0.0	.		128.0	24.0	.	NM_133468	A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	hg19	CCDS5442.1																																																																																			.	.	.	none		0.507	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
MUC17	140453	hgsc.bcm.edu	37	7	100683299	100683299	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr7:100683299A>T	ENST00000306151.4	+	3	8666	c.8602A>T	c.(8602-8604)Agt>Tgt	p.S2868C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2868	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TAGTGAAGGAAGTACTCTATT	0.488																																					p.S2868C		Atlas-SNP	.											.	MUC17	804	.	0			c.A8602T						PASS	.						249.0	259.0	255.0					7																	100683299		2203	4300	6503	SO:0001583	missense	140453	exon3			GAAGGAAGTACTC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8602A>T	chr7.hg19:g.100683299A>T	ENSP00000302716:p.Ser2868Cys	51.0	0.0	.		82.0	38.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	6.149	0.395626	0.11638	.	.	ENSG00000169876	ENST00000306151	T	0.02682	4.2	0.911	-0.0914	0.13661	.	.	.	.	.	T	0.03651	0.0104	L	0.34521	1.04	0.09310	N	1	D	0.54964	0.969	P	0.49477	0.612	T	0.43653	-0.9378	9	0.62326	D	0.03	.	4.9824	0.14172	0.2504:0.0:0.7496:0.0	.	2868	Q685J3	MUC17_HUMAN	C	2868	ENSP00000302716:S2868C	ENSP00000302716:S2868C	S	+	1	0	MUC17	100470019	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.325000	0.07976	-0.037000	0.13646	0.113000	0.15668	AGT	.	.	.	none		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
ZNF862	643641	hgsc.bcm.edu	37	7	149545262	149545262	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr7:149545262T>A	ENST00000223210.4	+	4	925	c.680T>A	c.(679-681)gTt>gAt	p.V227D		NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						CCTGGAGATGTTCTGGCCAGC	0.607																																					p.V227D		Atlas-SNP	.											.	ZNF862	97	.	0			c.T680A						PASS	.						44.0	47.0	46.0					7																	149545262		1924	4142	6066	SO:0001583	missense	643641	exon4			GAGATGTTCTGGC	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.680T>A	chr7.hg19:g.149545262T>A	ENSP00000223210:p.Val227Asp	51.0	0.0	.		81.0	37.0	.	NM_001099220	A0AUL8	Missense_Mutation	SNP	ENST00000223210.4	hg19	CCDS47741.1	.	.	.	.	.	.	.	.	.	.	T	8.241	0.806878	0.16467	.	.	ENSG00000106479	ENST00000223210	T	0.01159	5.25	4.92	1.13	0.20643	.	1.177670	0.06440	N	0.725840	T	0.01320	0.0043	L	0.40543	1.245	0.09310	N	1	P	0.40476	0.718	B	0.36030	0.216	T	0.48692	-0.9013	10	0.87932	D	0	-22.1868	4.9891	0.14205	0.0:0.0975:0.3728:0.5297	.	227	O60290	ZN862_HUMAN	D	227	ENSP00000223210:V227D	ENSP00000223210:V227D	V	+	2	0	ZNF862	149176195	0.000000	0.05858	0.000000	0.03702	0.190000	0.23558	0.176000	0.16782	0.194000	0.20326	-0.313000	0.08912	GTT	.	.	.	none		0.607	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220	
NFX1	4799	hgsc.bcm.edu	37	9	33295177	33295177	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr9:33295177C>T	ENST00000379540.3	+	2	847	c.785C>T	c.(784-786)cCa>cTa	p.P262L	NFX1_ENST00000318524.6_Missense_Mutation_p.P262L|NFX1_ENST00000379521.4_Missense_Mutation_p.P262L	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	262					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		AGAAATCCACCAAAACAGGAG	0.532																																					p.P262L		Atlas-SNP	.											.	NFX1	85	.	0			c.C785T						PASS	.						107.0	103.0	104.0					9																	33295177		2203	4300	6503	SO:0001583	missense	4799	exon2			ATCCACCAAAACA	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.785C>T	chr9.hg19:g.33295177C>T	ENSP00000368856:p.Pro262Leu	29.0	0.0	.		40.0	5.0	.	NM_147134	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	hg19	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	C	9.924	1.213089	0.22289	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.42131	0.98;0.98;0.98	5.38	3.33	0.38152	.	0.490876	0.21846	N	0.068253	T	0.32285	0.0824	L	0.41236	1.265	0.36408	D	0.863562	P;P;P;P;P	0.50272	0.763;0.651;0.933;0.763;0.763	B;B;B;B;P	0.44897	0.361;0.153;0.386;0.293;0.463	T	0.28202	-1.0051	10	0.29301	T	0.29	.	5.9995	0.19513	0.1639:0.6577:0.0:0.1784	.	262;146;262;262;262	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	L	262	ENSP00000368856:P262L;ENSP00000368836:P262L;ENSP00000317695:P262L	ENSP00000317695:P262L	P	+	2	0	NFX1	33285177	0.613000	0.27009	0.998000	0.56505	0.550000	0.35303	1.142000	0.31540	1.265000	0.44215	0.551000	0.68910	CCA	.	.	.	none		0.532	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
PHF2	5253	hgsc.bcm.edu	37	9	96439004	96439004	+	Silent	SNP	C	C	A	rs75653373|rs149736720|rs368818072	byFrequency	TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr9:96439004C>A	ENST00000359246.4	+	21	3328	c.2961C>A	c.(2959-2961)acC>acA	p.T987T	PHF2_ENST00000375376.4_Silent_p.T218T	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	987	Ser/Thr-rich.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.T987_P988insPASTT(1)|p.T987T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		cctctaccaccccggcctcca	0.692																																					p.T987T		Atlas-SNP	.											PHF2,colon,carcinoma,0,1	PHF2	113	.	2	Insertion - In frame(1)|Substitution - coding silent(1)	large_intestine(1)|central_nervous_system(1)	c.C2961A						PASS	.						82.0	60.0	68.0					9																	96439004		2155	4247	6402	SO:0001819	synonymous_variant	5253	exon21			TACCACCCCGGCC	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2961C>A	chr9.hg19:g.96439004C>A		20.0	0.0	.		26.0	5.0	.	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	hg19	CCDS35069.1																																																																																			.	C|0.500;A|0.500	0.500	weak		0.692	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123313158	123313158	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr9:123313158T>C	ENST00000349780.4	-	4	397	c.218A>G	c.(217-219)gAa>gGa	p.E73G	CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.E73G|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.E73G|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.E73G	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	73					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						GTTAAAGTTTTCTTTCTTCAA	0.393																																					p.E73G		Atlas-SNP	.											.	CDK5RAP2	157	.	0			c.A218G						PASS	.						97.0	100.0	99.0					9																	123313158		2203	4300	6503	SO:0001583	missense	55755	exon4			AAGTTTTCTTTCT	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.218A>G	chr9.hg19:g.123313158T>C	ENSP00000343818:p.Glu73Gly	125.0	0.0	.		155.0	54.0	.	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	hg19	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.976257	0.92982	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000345313	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	6.08	6.08	0.98989	Spindle associated (1);	0.000000	0.64402	D	0.000011	T	0.74861	0.3772	M	0.89601	3.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.80484	-0.1362	10	0.87932	D	0	.	15.6338	0.76933	0.0:0.0:0.0:1.0	.	73;73;73	Q96SN8-2;Q96SN8-4;Q96SN8	.;.;CK5P2_HUMAN	G	73	ENSP00000354065:E73G;ENSP00000352258:E73G;ENSP00000343818:E73G;ENSP00000353317:E73G	ENSP00000341695:E73G	E	-	2	0	CDK5RAP2	122352979	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.545000	0.82128	2.333000	0.79357	0.482000	0.46254	GAA	.	.	.	none		0.393	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
PRRC2B	84726	hgsc.bcm.edu	37	9	134319670	134319670	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr9:134319670G>A	ENST00000357304.4	+	5	623	c.568G>A	c.(568-570)Gtc>Atc	p.V190I	PRRC2B_ENST00000458550.1_Missense_Mutation_p.V190I|PRRC2B_ENST00000405995.1_Missense_Mutation_p.V190I|PRRC2B_ENST00000372249.1_5'Flank	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	190							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						AGAAAAGGGCGTCTTAGATCT	0.552																																					p.V190I		Atlas-SNP	.											PRRC2B_ENST00000357304,NS,carcinoma,0,2	PRRC2B	266	.	0			c.G568A						PASS	.						49.0	51.0	50.0					9																	134319670		2038	4199	6237	SO:0001583	missense	84726	exon5			AAGGGCGTCTTAG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.568G>A	chr9.hg19:g.134319670G>A	ENSP00000349856:p.Val190Ile	28.0	0.0	.		34.0	11.0	.	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	hg19	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273583	0.80580	.	.	ENSG00000130723	ENST00000405995;ENST00000541684;ENST00000357304;ENST00000458550	T;T;T	0.21191	2.02;2.02;2.02	5.54	5.54	0.83059	BAT2, N-terminal (1);	0.410913	0.17223	U	0.182247	T	0.23846	0.0577	L	0.44542	1.39	0.80722	D	1	P	0.45428	0.858	B	0.40741	0.339	T	0.01977	-1.1236	10	0.49607	T	0.09	-25.7014	18.4643	0.90749	0.0:0.0:1.0:0.0	.	190	Q5JSZ5	PRC2B_HUMAN	I	190	ENSP00000384606:V190I;ENSP00000349856:V190I;ENSP00000398853:V190I	ENSP00000349856:V190I	V	+	1	0	PRRC2B	133309491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.436000	0.66538	2.618000	0.88619	0.462000	0.41574	GTC	.	.	.	none		0.552	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ZNF37A	7587	hgsc.bcm.edu	37	10	38406703	38406703	+	Silent	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr10:38406703T>C	ENST00000361085.5	+	7	969	c.624T>C	c.(622-624)aaT>aaC	p.N208N	ZNF37A_ENST00000351773.3_Silent_p.N208N	NM_001178101.1|NM_003421.2	NP_001171572.1|NP_003412.1	P17032	ZN37A_HUMAN	zinc finger protein 37A	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|prostate(1)	28						GTGGAGAAAATATCTTTGAGG	0.363																																					p.N208N		Atlas-SNP	.											.	ZNF37A	118	.	0			c.T624C						PASS	.						76.0	74.0	75.0					10																	38406703		2203	4300	6503	SO:0001819	synonymous_variant	7587	exon7			AGAAAATATCTTT	X69115	CCDS31183.1	10p11.2	2013-01-08	2006-05-11		ENSG00000075407	ENSG00000075407		"""Zinc fingers, C2H2-type"", ""-"""	13102	protein-coding gene	gene with protein product			"""zinc finger protein 37a (KOX 21)"""			2014798, 8464732	Standard	NM_001178101		Approved	KOX21, ZNF37	uc001izl.3	P17032	OTTHUMG00000017990	ENST00000361085.5:c.624T>C	chr10.hg19:g.38406703T>C		82.0	0.0	.		109.0	31.0	.	NM_003421	B3KRQ3|D3DRZ3|Q96B88	Silent	SNP	ENST00000361085.5	hg19	CCDS31183.1																																																																																			.	.	.	none		0.363	ZNF37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047624.2	NM_003421	
SYT15	83849	hgsc.bcm.edu	37	10	46968622	46968622	+	Missense_Mutation	SNP	G	G	A	rs577411839	byFrequency	TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr10:46968622G>A	ENST00000374321.4	-	3	380	c.314C>T	c.(313-315)cCg>cTg	p.P105L	SYT15_ENST00000503753.1_Missense_Mutation_p.P105L|SYT15_ENST00000374323.4_Missense_Mutation_p.P158L|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000374325.3_Missense_Mutation_p.P105L	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						CTCTGATGCCGGGCAGGGGTC	0.677													G|||	2	0.000399361	0.0	0.0014	5008	,	,		34493	0.0		0.0	False		,,,				2504	0.001				p.P105L	Ovarian(57;1152 1428 19651 37745)	Atlas-SNP	.											.	SYT15	165	.	0			c.C314T						PASS	.						32.0	41.0	38.0					10																	46968622		2079	4209	6288	SO:0001583	missense	83849	exon3			GATGCCGGGCAGG	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.314C>T	chr10.hg19:g.46968622G>A	ENSP00000363441:p.Pro105Leu	16.0	0.0	.		24.0	6.0	.	NM_031912	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	hg19	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.028849	0.00410	.	.	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374323;ENST00000374321	T;T;T;T	0.14022	2.54;2.54;2.84;2.78	4.59	-3.51	0.04696	.	0.916532	0.09209	N	0.833581	T	0.05364	0.0142	N	0.16066	0.365	0.09310	N	0.999991	B;B	0.14012	0.002;0.009	B;B	0.11329	0.001;0.006	T	0.44436	-0.9328	10	0.08179	T	0.78	.	4.409	0.11423	0.3898:0.0:0.3705:0.2397	.	105;105	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	L	105;105;105;158;105	ENSP00000363445:P105L;ENSP00000427607:P105L;ENSP00000363443:P158L;ENSP00000363441:P105L	ENSP00000363441:P105L	P	-	2	0	SYT15	46388628	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	-0.097000	0.11042	-0.539000	0.06273	-0.263000	0.10527	CCG	.	.	.	none		0.677	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912	
CNNM2	54805	hgsc.bcm.edu	37	10	104678459	104678459	+	Silent	SNP	C	C	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr10:104678459C>A	ENST00000369878.4	+	1	410	c.222C>A	c.(220-222)atC>atA	p.I74I	CNNM2_ENST00000369875.3_Silent_p.I74I|CNNM2_ENST00000433628.2_Silent_p.I74I	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	74					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		AGACGGTGATCATCGGGCTGC	0.706																																					p.I74I		Atlas-SNP	.											.	CNNM2	119	.	0			c.C222A						PASS	.						33.0	20.0	24.0					10																	104678459		2168	4270	6438	SO:0001819	synonymous_variant	54805	exon1			GGTGATCATCGGG	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.222C>A	chr10.hg19:g.104678459C>A		26.0	0.0	.		28.0	11.0	.	NM_199076	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	ENST00000369878.4	hg19	CCDS44474.1																																																																																			.	.	.	none		0.706	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
OR10A6	390093	hgsc.bcm.edu	37	11	7949415	7949415	+	Silent	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr11:7949415G>C	ENST00000309838.2	-	1	794	c.795C>G	c.(793-795)ggC>ggG	p.G265G		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCGGTGAGTAGCCAGATTTGG	0.453																																					p.G265G		Atlas-SNP	.											.	OR10A6	49	.	0			c.C795G						PASS	.						148.0	137.0	141.0					11																	7949415		2201	4296	6497	SO:0001819	synonymous_variant	390093	exon1			TGAGTAGCCAGAT	AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.795C>G	chr11.hg19:g.7949415G>C		134.0	0.0	.		140.0	53.0	.	NM_001004461	Q6IF59	Silent	SNP	ENST00000309838.2	hg19	CCDS31420.1																																																																																			.	.	.	none		0.453	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385703.1	NM_001004461	
OR10A6	390093	hgsc.bcm.edu	37	11	7949417	7949417	+	Missense_Mutation	SNP	C	C	T	rs374770684		TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr11:7949417C>T	ENST00000309838.2	-	1	792	c.793G>A	c.(793-795)Ggc>Agc	p.G265S		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGTGAGTAGCCAGATTTGGGT	0.453																																					p.G265S		Atlas-SNP	.											.	OR10A6	49	.	0			c.G793A						PASS	.	C	SER/GLY	1,4401	2.1+/-5.4	0,1,2200	148.0	137.0	140.0		793	0.8	1.0	11		140	0,8592		0,0,4296	no	missense	OR10A6	NM_001004461.1	56	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	benign	265/315	7949417	1,12993	2201	4296	6497	SO:0001583	missense	390093	exon1			AGTAGCCAGATTT	AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.793G>A	chr11.hg19:g.7949417C>T	ENSP00000312470:p.Gly265Ser	130.0	0.0	.		138.0	50.0	.	NM_001004461	Q6IF59	Missense_Mutation	SNP	ENST00000309838.2	hg19	CCDS31420.1	.	.	.	.	.	.	.	.	.	.	C	1.923	-0.447830	0.04572	2.27E-4	0.0	ENSG00000175393	ENST00000309838	T	0.00058	8.79	4.43	0.818	0.18778	GPCR, rhodopsin-like superfamily (1);	0.926234	0.08901	N	0.877249	T	0.00039	0.0001	N	0.00873	-1.125	0.09310	N	1	B	0.18013	0.025	B	0.24541	0.054	T	0.09862	-1.0655	10	0.02654	T	1	.	6.8267	0.23887	0.0:0.3001:0.0:0.6999	.	265	Q8NH74	O10A6_HUMAN	S	265	ENSP00000312470:G265S	ENSP00000312470:G265S	G	-	1	0	OR10A6	7905993	0.000000	0.05858	0.973000	0.42090	0.985000	0.73830	-0.216000	0.09266	0.316000	0.23135	0.655000	0.94253	GGC	.	.	.	weak		0.453	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385703.1	NM_001004461	
TMX2	51075	hgsc.bcm.edu	37	11	57506447	57506447	+	Splice_Site	SNP	T	T	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr11:57506447T>A	ENST00000278422.4	+	6	562	c.550T>A	c.(550-552)Tac>Aac	p.Y184N	C11orf31_ENST00000388857.4_5'Flank|C11orf31_ENST00000534355.1_5'Flank|TMX2_ENST00000378312.4_Splice_Site_p.Y146N|TMX2-CTNND1_ENST00000528395.1_Intron	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2	184	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						TCTTTTCAGATACAACTGTAC	0.398																																					p.Y184N		Atlas-SNP	.											.	TMX2	29	.	0			c.T550A						PASS	.						77.0	77.0	77.0					11																	57506447		2201	4296	6497	SO:0001630	splice_region_variant	51075	exon6			TTCAGATACAACT	AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.549-1T>A	chr11.hg19:g.57506447T>A		71.0	0.0	.		85.0	16.0	.	NM_015959	B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Missense_Mutation	SNP	ENST00000278422.4	hg19	CCDS7967.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.375394	0.82682	.	.	ENSG00000213593	ENST00000378312;ENST00000278422	T;T	0.26810	1.71;1.71	5.95	5.95	0.96441	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	U	0.000000	T	0.52041	0.1710	M	0.74389	2.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.55451	-0.8139	10	0.87932	D	0	-5.8569	14.6535	0.68814	0.0:0.0:0.0:1.0	.	146;184	Q9Y320-2;Q9Y320	.;TMX2_HUMAN	N	146;184	ENSP00000367562:Y146N;ENSP00000278422:Y184N	ENSP00000278422:Y184N	Y	+	1	0	TMX2	57263023	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.033000	0.76504	2.279000	0.76181	0.533000	0.62120	TAC	.	.	.	none		0.398	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393708.1	NM_015959	Missense_Mutation
CNTN5	53942	hgsc.bcm.edu	37	11	99690484	99690484	+	Missense_Mutation	SNP	T	T	A	rs199899455		TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr11:99690484T>A	ENST00000524871.1	+	4	555	c.265T>A	c.(265-267)Ttc>Atc	p.F89I	CNTN5_ENST00000528682.1_Missense_Mutation_p.F89I|CNTN5_ENST00000527185.1_Missense_Mutation_p.F89I|CNTN5_ENST00000279463.3_Missense_Mutation_p.F89I|CNTN5_ENST00000418526.2_Intron	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	89					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CTCAGATGCCTTCAAACAAGA	0.413																																					p.F89I		Atlas-SNP	.											.	CNTN5	324	.	0			c.T265A						PASS	.						27.0	26.0	26.0					11																	99690484		1829	4069	5898	SO:0001583	missense	53942	exon3			GATGCCTTCAAAC	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.265T>A	chr11.hg19:g.99690484T>A	ENSP00000435637:p.Phe89Ile	51.0	0.0	.		64.0	7.0	.	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.534345	0.64972	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000279463	T;T;T;T	0.55413	0.52;0.59;0.59;0.59	5.06	5.06	0.68205	.	0.238319	0.36234	N	0.002702	T	0.37376	0.1001	N	0.19112	0.55	0.44745	D	0.997741	B;B	0.27823	0.19;0.19	B;B	0.21151	0.02;0.033	T	0.20638	-1.0269	10	0.35671	T	0.21	.	14.699	0.69142	0.0:0.0:0.0:1.0	.	89;89	E9PKE8;O94779	.;CNTN5_HUMAN	I	89	ENSP00000433575:F89I;ENSP00000436185:F89I;ENSP00000435637:F89I;ENSP00000279463:F89I	ENSP00000279463:F89I	F	+	1	0	CNTN5	99195694	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.260000	0.65490	2.208000	0.71279	0.528000	0.53228	TTC	.	.	.	weak		0.413	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
DDX10	1662	hgsc.bcm.edu	37	11	108535923	108535923	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr11:108535923G>A	ENST00000322536.3	+	1	172	c.43G>A	c.(43-45)Gac>Aac	p.D15N	DDX10_ENST00000526794.1_Missense_Mutation_p.D15N	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	15					metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		AGCCCGACCCGACCCGGTGCG	0.582			T	NUP98	AML*																																p.D15N		Atlas-SNP	.		Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	.	DDX10	70	.	0			c.G43A						PASS	.						26.0	31.0	29.0					11																	108535923		2198	4297	6495	SO:0001583	missense	1662	exon1			CGACCCGACCCGG	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.43G>A	chr11.hg19:g.108535923G>A	ENSP00000314348:p.Asp15Asn	58.0	0.0	.		62.0	16.0	.	NM_004398	B2RCQ3|Q5BJD8	Missense_Mutation	SNP	ENST00000322536.3	hg19	CCDS8342.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.011847	0.93346	.	.	ENSG00000178105	ENST00000322536;ENST00000456020;ENST00000526794	T;T	0.44083	0.94;0.93	5.55	4.63	0.57726	.	0.240683	0.47852	D	0.000210	T	0.54935	0.1889	M	0.64997	1.995	0.34465	D	0.702219	D;D	0.89917	0.999;1.0	P;P	0.57911	0.734;0.829	T	0.66296	-0.5959	10	0.32370	T	0.25	-18.9435	14.3605	0.66768	0.0:0.1482:0.8518:0.0	.	15;15	Q13206;E9PIF2	DDX10_HUMAN;.	N	15	ENSP00000314348:D15N;ENSP00000432032:D15N	ENSP00000314348:D15N	D	+	1	0	DDX10	108041133	1.000000	0.71417	0.944000	0.38274	0.941000	0.58515	5.141000	0.64814	1.317000	0.45149	0.484000	0.47621	GAC	.	.	.	none		0.582	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390343.1	NM_004398	
PDE3A	5139	hgsc.bcm.edu	37	12	20774323	20774323	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr12:20774323G>C	ENST00000359062.3	+	5	1558	c.1518G>C	c.(1516-1518)aaG>aaC	p.K506N	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	506					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	ACCATGTAAAGGCTAAAAAGC	0.403																																					p.K506N		Atlas-SNP	.											.	PDE3A	184	.	0			c.G1518C						PASS	.						96.0	84.0	88.0					12																	20774323		2203	4300	6503	SO:0001583	missense	5139	exon5			TGTAAAGGCTAAA		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1518G>C	chr12.hg19:g.20774323G>C	ENSP00000351957:p.Lys506Asn	62.0	0.0	.		85.0	17.0	.	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	hg19	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351516	0.24512	.	.	ENSG00000172572	ENST00000359062	T	0.50813	0.73	5.57	1.34	0.21922	.	1.054050	0.07345	N	0.881400	T	0.26159	0.0638	N	0.14661	0.345	0.30219	N	0.796972	B	0.02656	0.0	B	0.01281	0.0	T	0.33523	-0.9865	10	0.21014	T	0.42	.	3.2508	0.06814	0.0937:0.3798:0.3107:0.2157	.	506	Q14432	PDE3A_HUMAN	N	506	ENSP00000351957:K506N	ENSP00000351957:K506N	K	+	3	2	PDE3A	20665590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.210000	0.32370	0.685000	0.31468	0.591000	0.81541	AAG	.	.	.	none		0.403	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
NCKAP5L	57701	hgsc.bcm.edu	37	12	50190029	50190029	+	Silent	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr12:50190029C>T	ENST00000335999.6	-	8	1815	c.1614G>A	c.(1612-1614)ccG>ccA	p.P538P		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	534	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						AGGCTGACTGCGGGGGTCTGA	0.637																																					p.P538P		Atlas-SNP	.											.	NCKAP5L	142	.	0			c.G1614A						PASS	.						19.0	22.0	21.0					12																	50190029		2135	4229	6364	SO:0001819	synonymous_variant	57701	exon8			TGACTGCGGGGGT	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.1614G>A	chr12.hg19:g.50190029C>T		44.0	0.0	.		56.0	21.0	.	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Silent	SNP	ENST00000335999.6	hg19	CCDS41781.2	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.248173	0.00271	.	.	ENSG00000167566	ENST00000433948	.	.	.	4.58	-8.12	0.01078	.	.	.	.	.	T	0.16041	0.0386	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20773	-1.0265	4	.	.	.	-10.2704	2.9345	0.05810	0.1616:0.1869:0.4482:0.2033	.	.	.	.	T	253	.	.	A	-	1	0	NCKAP5L	48476296	0.269000	0.24143	0.000000	0.03702	0.000000	0.00434	-0.739000	0.04866	-1.604000	0.01595	-2.076000	0.00381	GCA	.	.	.	none		0.637	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
MDM1	56890	hgsc.bcm.edu	37	12	68719340	68719340	+	Missense_Mutation	SNP	G	G	T	rs372443907		TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr12:68719340G>T	ENST00000303145.7	-	4	600	c.514C>A	c.(514-516)Cgt>Agt	p.R172S	MDM1_ENST00000411698.2_Intron|MDM1_ENST00000540418.1_5'UTR|MDM1_ENST00000430606.2_3'UTR|MDM1_ENST00000545724.1_5'UTR|MDM1_ENST00000393543.3_3'UTR	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	172					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		GCTTTCTTACGCAGAAGTCTA	0.318																																					p.R172S		Atlas-SNP	.											.	MDM1	74	.	0			c.C514A						PASS	.						130.0	141.0	137.0					12																	68719340		2203	4300	6503	SO:0001583	missense	56890	exon4			TCTTACGCAGAAG	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.514C>A	chr12.hg19:g.68719340G>T	ENSP00000302537:p.Arg172Ser	110.0	0.0	.		126.0	47.0	.	NM_017440	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Missense_Mutation	SNP	ENST00000303145.7	hg19	CCDS8983.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957474	0.53400	.	.	ENSG00000111554	ENST00000303145;ENST00000541686	T;T	0.20463	2.07;2.07	5.29	3.31	0.37934	.	0.501231	0.21482	N	0.073803	T	0.24661	0.0598	M	0.65975	2.015	0.21802	N	0.99953	P	0.39782	0.688	B	0.38985	0.287	T	0.10042	-1.0647	9	.	.	.	-0.4018	13.0634	0.59020	0.0:0.0:0.5863:0.4136	.	172	Q8TC05	MDM1_HUMAN	S	172;167	ENSP00000302537:R172S;ENSP00000446000:R167S	.	R	-	1	0	MDM1	67005607	0.827000	0.29292	0.019000	0.16419	0.967000	0.64934	4.952000	0.63618	1.357000	0.45904	0.561000	0.74099	CGT	.	.	.	alt		0.318	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128	
P2RX4	5025	hgsc.bcm.edu	37	12	121659899	121659899	+	Silent	SNP	T	T	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr12:121659899T>A	ENST00000337233.4	+	4	665	c.357T>A	c.(355-357)atT>atA	p.I119I	P2RX4_ENST00000359949.7_Silent_p.I135I|P2RX4_ENST00000540930.1_3'UTR|P2RX4_ENST00000543171.1_Silent_p.I18I|P2RX4_ENST00000541532.1_Silent_p.I119I	NM_001261397.1|NM_001261398.1|NM_002560.2	NP_001248326.1|NP_001248327.1|NP_002551.2	Q99571	P2RX4_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 4	119					apoptotic signaling pathway (GO:0097190)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular response to ATP (GO:0071318)|endothelial cell activation (GO:0042118)|ion transmembrane transport (GO:0034220)|membrane depolarization (GO:0051899)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|neuronal action potential (GO:0019228)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction (GO:0055117)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sodium ion transport (GO:0002028)|relaxation of cardiac muscle (GO:0055119)|response to ATP (GO:0033198)|response to fluid shear stress (GO:0034405)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|tissue homeostasis (GO:0001894)|transport (GO:0006810)|vasodilation (GO:0042311)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadherin binding (GO:0045296)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTTTCCAGATTCCAGATGCGA	0.627																																					p.I135I		Atlas-SNP	.											.	P2RX4	27	.	0			c.T405A						PASS	.						97.0	113.0	107.0					12																	121659899		2203	4300	6503	SO:0001819	synonymous_variant	5025	exon5			CCAGATTCCAGAT	Y07684	CCDS9214.1, CCDS58282.1	12q24.32	2012-01-17			ENSG00000135124	ENSG00000135124		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8535	protein-coding gene	gene with protein product		600846				9016352	Standard	NM_002560		Approved	P2X4	uc031qjt.1	Q99571	OTTHUMG00000169155	ENST00000337233.4:c.357T>A	chr12.hg19:g.121659899T>A		88.0	0.0	.		76.0	19.0	.	NM_001256796	E7EPF7|F6RU17|O00450|O14722|Q5U089|Q5U090|Q8N4N1|Q9UBG9	Silent	SNP	ENST00000337233.4	hg19	CCDS9214.1																																																																																			.	.	.	none		0.627	P2RX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402545.1	NM_175567	
RNF34	80196	hgsc.bcm.edu	37	12	121858061	121858061	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr12:121858061C>A	ENST00000392464.2	+	4	719	c.650C>A	c.(649-651)aCt>aAt	p.T217N	RNF34_ENST00000555076.1_Intron|RNF34_ENST00000361234.5_Missense_Mutation_p.T217N|RNF34_ENST00000392465.3_Missense_Mutation_p.T218N					ring finger protein 34, E3 ubiquitin protein ligase											breast(1)|large_intestine(1)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		AGTGAAATCACTTCAGCAAAC	0.398																																					p.T218N		Atlas-SNP	.											.	RNF34	54	.	0			c.C653A						PASS	.						80.0	67.0	71.0					12																	121858061		2203	4300	6503	SO:0001583	missense	80196	exon5			AAATCACTTCAGC	AF306709, AB084914	CCDS9221.1, CCDS31915.1, CCDS73538.1	12q24.31	2012-02-23	2012-02-23			ENSG00000170633		"""RING-type (C3HC4) zinc fingers"""	17297	protein-coding gene	gene with protein product		608299	"""ring finger protein 34"""			12118383	Standard	NM_025126		Approved	RIFF, FLJ21786, RIF	uc001ual.2	Q969K3		ENST00000392464.2:c.650C>A	chr12.hg19:g.121858061C>A	ENSP00000376257:p.Thr217Asn	66.0	0.0	.		56.0	7.0	.	NM_194271		Missense_Mutation	SNP	ENST00000392464.2	hg19		.	.	.	.	.	.	.	.	.	.	C	15.81	2.944440	0.53079	.	.	ENSG00000170633	ENST00000361234;ENST00000392465;ENST00000392464;ENST00000354795	T;T;T	0.31769	2.11;2.11;1.48	5.33	5.33	0.75918	.	0.586691	0.18222	N	0.147843	T	0.15609	0.0376	N	0.03608	-0.345	0.80722	D	1	B;B	0.19583	0.022;0.037	B;B	0.23018	0.019;0.043	T	0.15122	-1.0448	10	0.17832	T	0.49	0.0034	14.8537	0.70319	0.0:1.0:0.0:0.0	.	217;218	Q969K3;Q969K3-2	RNF34_HUMAN;.	N	217;218;217;218	ENSP00000355137:T217N;ENSP00000376258:T218N;ENSP00000376257:T217N	ENSP00000346850:T218N	T	+	2	0	RNF34	120342444	0.993000	0.37304	0.947000	0.38551	0.881000	0.50899	4.069000	0.57541	2.651000	0.90000	0.561000	0.74099	ACT	.	.	.	none		0.398	RNF34-005	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000413892.1	NM_194271	
PITPNM2	57605	hgsc.bcm.edu	37	12	123470897	123470897	+	Splice_Site	SNP	A	A	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr12:123470897A>C	ENST00000542749.1	-	24	3790	c.3727T>G	c.(3727-3729)Ttc>Gtc	p.F1243V	PITPNM2_ENST00000280562.5_Splice_Site_p.F1237V|PITPNM2_ENST00000392428.1_Splice_Site_p.F964V|PITPNM2_ENST00000320201.4_Splice_Site_p.F1243V			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1243					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TCCGTGATGAACTGCGGGGTC	0.716																																					p.F1243V		Atlas-SNP	.											.	PITPNM2	105	.	0			c.T3727G						PASS	.						12.0	13.0	12.0					12																	123470897		2182	4271	6453	SO:0001630	splice_region_variant	57605	exon25			TGATGAACTGCGG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3727-1T>G	chr12.hg19:g.123470897A>C		38.0	0.0	.		32.0	10.0	.	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	hg19	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.903220	0.33628	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.43294	1.27;1.28;0.95;1.28	4.8	4.8	0.61643	.	0.065993	0.64402	D	0.000007	T	0.42314	0.1197	L	0.43152	1.355	0.80722	D	1	P;D	0.54047	0.712;0.964	P;P	0.53146	0.55;0.719	T	0.17653	-1.0362	10	0.10636	T	0.68	-37.789	10.908	0.47092	0.9234:0.0:0.0766:0.0	.	1237;1243	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	V	1237;1243;964;1243	ENSP00000280562:F1237V;ENSP00000322218:F1243V;ENSP00000376223:F964V;ENSP00000437611:F1243V	ENSP00000280562:F1237V	F	-	1	0	PITPNM2	122036850	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	6.041000	0.70988	2.152000	0.67230	0.459000	0.35465	TTC	.	.	.	none		0.716	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	Missense_Mutation
KCNRG	283518	hgsc.bcm.edu	37	13	50590073	50590073	+	Silent	SNP	A	A	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr13:50590073A>T	ENST00000312942.1	+	1	684	c.444A>T	c.(442-444)tcA>tcT	p.S148S	TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_Silent_p.S148S|TRIM13_ENST00000378182.3_3'UTR	NM_173605.1	NP_775876.1	Q8N5I3	KCNRG_HUMAN	potassium channel regulator	148					protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		AACAACCTTCAGCGCCGACCT	0.463																																					p.S148S		Atlas-SNP	.											.	KCNRG	29	.	0			c.A444T						PASS	.						145.0	128.0	134.0					13																	50590073		2203	4300	6503	SO:0001819	synonymous_variant	283518	exon1			ACCTTCAGCGCCG		CCDS9424.1, CCDS41889.1	13q14.11	2008-05-02			ENSG00000198553	ENSG00000198553			18893	protein-coding gene	gene with protein product							Standard	NM_173605		Approved		uc001vdu.3	Q8N5I3	OTTHUMG00000140140	ENST00000312942.1:c.444A>T	chr13.hg19:g.50590073A>T		137.0	0.0	.		167.0	58.0	.	NM_173605	A2A2X9|Q0P6D0|Q8IU75|Q8N3Q9	Silent	SNP	ENST00000312942.1	hg19	CCDS9424.1																																																																																			.	.	.	none		0.463	KCNRG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276308.1		
PCID2	55795	hgsc.bcm.edu	37	13	113832522	113832522	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr13:113832522G>A	ENST00000337344.4	-	14	1266	c.1190C>T	c.(1189-1191)aCg>aTg	p.T397M	PCID2_ENST00000375459.1_Missense_Mutation_p.T395M|PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000246505.5_Missense_Mutation_p.T451M|PCID2_ENST00000375457.2_Missense_Mutation_p.T395M|PCID2_ENST00000375477.1_Missense_Mutation_p.T397M|PCID2_ENST00000375479.2_Missense_Mutation_p.T397M	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	397					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			TCAACACACCGTGGACAGGGG	0.557																																					p.T451M		Atlas-SNP	.											.	PCID2	30	.	0			c.C1352T						PASS	.						213.0	160.0	178.0					13																	113832522		2203	4300	6503	SO:0001583	missense	55795	exon14			CACACCGTGGACA	AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.1190C>T	chr13.hg19:g.113832522G>A	ENSP00000337405:p.Thr397Met	61.0	0.0	.		55.0	17.0	.	NM_001258212	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	ENST00000337344.4	hg19	CCDS9532.2	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435139	0.25813	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000375462;ENST00000246506;ENST00000351317	.	.	.	5.35	5.35	0.76521	.	0.362107	0.25833	N	0.028009	T	0.58750	0.2144	L	0.55990	1.75	0.09310	N	1	D;D	0.59357	0.96;0.985	P;B	0.54629	0.757;0.38	T	0.55685	-0.8102	9	0.59425	D	0.04	-27.4146	17.2683	0.87093	0.0:0.0:1.0:0.0	.	451;397	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	M	397;397;397;451;395;395;374;397;374	.	ENSP00000246505:T451M	T	-	2	0	PCID2	112880523	1.000000	0.71417	0.733000	0.30861	0.169000	0.22640	6.309000	0.72825	2.507000	0.84556	0.655000	0.94253	ACG	.	.	.	none		0.557	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045897.1	NM_018386	
CPNE6	9362	hgsc.bcm.edu	37	14	24545746	24545746	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr14:24545746C>T	ENST00000397016.2	+	14	1456	c.1145C>T	c.(1144-1146)cCg>cTg	p.P382L	CPNE6_ENST00000537691.1_Missense_Mutation_p.P437L|CPNE6_ENST00000216775.2_Missense_Mutation_p.P382L	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	382	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		AACTTTGACCCGGAAAATCCT	0.582																																					p.P382L		Atlas-SNP	.											.	CPNE6	40	.	0			c.C1145T						PASS	.						101.0	104.0	103.0					14																	24545746		2203	4300	6503	SO:0001583	missense	9362	exon13			TTGACCCGGAAAA	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1145C>T	chr14.hg19:g.24545746C>T	ENSP00000380211:p.Pro382Leu	31.0	0.0	.		31.0	11.0	.	NM_006032	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	hg19	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325572	0.81580	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.22336	1.96;1.96;1.96	5.06	5.06	0.68205	von Willebrand factor, type A (2);Copine (1);	0.000000	0.64402	D	0.000020	T	0.43366	0.1244	M	0.82923	2.615	0.54753	D	0.999988	D;D	0.63880	0.993;0.981	P;P	0.56514	0.8;0.707	T	0.46442	-0.9191	10	0.72032	D	0.01	-34.9278	13.7833	0.63094	0.0:1.0:0.0:0.0	.	437;382	F5GXN1;O95741	.;CPNE6_HUMAN	L	437;382;382	ENSP00000440077:P437L;ENSP00000380211:P382L;ENSP00000216775:P382L	ENSP00000216775:P382L	P	+	2	0	CPNE6	23615586	0.031000	0.19500	0.969000	0.41365	0.889000	0.51656	1.889000	0.39718	2.617000	0.88574	0.563000	0.77884	CCG	.	.	.	none		0.582	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
MIS18BP1	55320	hgsc.bcm.edu	37	14	45705110	45705110	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr14:45705110T>C	ENST00000310806.4	-	6	1713	c.1255A>G	c.(1255-1257)Ata>Gta	p.I419V		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	419					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						ATCCGCTCTATAATTACATTA	0.308																																					p.I419V		Atlas-SNP	.											.	MIS18BP1	92	.	0			c.A1255G						PASS	.						103.0	96.0	98.0					14																	45705110		2201	4299	6500	SO:0001583	missense	55320	exon6			GCTCTATAATTAC	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.1255A>G	chr14.hg19:g.45705110T>C	ENSP00000309790:p.Ile419Val	312.0	0.0	.		349.0	116.0	.	NM_018353	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	ENST00000310806.4	hg19	CCDS9684.1	.	.	.	.	.	.	.	.	.	.	T	3.759	-0.049993	0.07407	.	.	ENSG00000129534	ENST00000310806	T	0.14266	2.52	5.76	-0.741	0.11112	SANT associated (1);	0.646080	0.15216	N	0.274189	T	0.06325	0.0163	N	0.14661	0.345	0.25662	N	0.985991	B	0.17465	0.022	B	0.19946	0.027	T	0.44345	-0.9334	10	0.08837	T	0.75	-3.5739	9.0435	0.36331	0.0:0.5491:0.0:0.4509	.	419	Q6P0N0	M18BP_HUMAN	V	419	ENSP00000309790:I419V	ENSP00000309790:I419V	I	-	1	0	MIS18BP1	44774860	0.995000	0.38212	0.982000	0.44146	0.904000	0.53231	0.212000	0.17497	-0.089000	0.12484	-0.256000	0.11100	ATA	.	.	.	none		0.308	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
SIPA1L1	26037	hgsc.bcm.edu	37	14	72055984	72055984	+	Silent	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr14:72055984G>A	ENST00000555818.1	+	2	1743	c.1395G>A	c.(1393-1395)gtG>gtA	p.V465V	SIPA1L1_ENST00000358550.2_Silent_p.V465V|SIPA1L1_ENST00000381232.3_Silent_p.V465V	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	465					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TACTTGAAGTGCCCAAGGAGA	0.423																																					p.V465V		Atlas-SNP	.											.	SIPA1L1	219	.	0			c.G1395A						PASS	.						86.0	79.0	81.0					14																	72055984		2203	4300	6503	SO:0001819	synonymous_variant	26037	exon2			TGAAGTGCCCAAG	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1395G>A	chr14.hg19:g.72055984G>A		96.0	0.0	.		109.0	36.0	.	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	hg19	CCDS9807.1																																																																																			.	.	.	none		0.423	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
BUB1B	701	hgsc.bcm.edu	37	15	40505677	40505677	+	Splice_Site	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr15:40505677T>C	ENST00000287598.6	+	20	2873		c.e20+2		BUB1B_ENST00000412359.3_Splice_Site	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		CAGAAACAGGTTGGTCCTTTT	0.388			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																												.		Atlas-SNP	.	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	.	BUB1B	71	.	0			c.2678+2T>C						PASS	.						129.0	136.0	134.0					15																	40505677		2203	4300	6503	SO:0001630	splice_region_variant	701	exon20	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AACAGGTTGGTCC	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2678+2T>C	chr15.hg19:g.40505677T>C		68.0	0.0	.		74.0	28.0	.	NM_001211	B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Splice_Site	SNP	ENST00000287598.6	hg19	CCDS10053.1	.	.	.	.	.	.	.	.	.	.	T	19.27	3.794831	0.70452	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7037	0.69174	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	BUB1B	38292969	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	3.805000	0.55575	1.872000	0.54250	0.402000	0.26972	.	.	.	.	none		0.388	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4		Intron
RNF111	54778	hgsc.bcm.edu	37	15	59358971	59358971	+	Silent	SNP	A	A	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr15:59358971A>C	ENST00000557998.1	+	6	1662	c.1375A>C	c.(1375-1377)Agg>Cgg	p.R459R	RNF111_ENST00000434298.1_Silent_p.R459R|RNF111_ENST00000348370.4_Silent_p.R459R|RNF111_ENST00000559209.1_Silent_p.R459R|RNF111_ENST00000561186.1_Silent_p.R459R	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	459	Ser-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		AGATGACTCAAGGAGAACTAC	0.398																																					p.R459R	NSCLC(72;983 1365 10746 34387 47081)	Atlas-SNP	.											.	RNF111	179	.	0			c.A1375C						PASS	.						93.0	84.0	87.0					15																	59358971		2192	4291	6483	SO:0001819	synonymous_variant	54778	exon6			GACTCAAGGAGAA	AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1375A>C	chr15.hg19:g.59358971A>C		54.0	0.0	.		73.0	20.0	.	NM_017610	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Silent	SNP	ENST00000557998.1	hg19	CCDS58366.1																																																																																			.	.	.	none		0.398	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
CORO2B	10391	hgsc.bcm.edu	37	15	69003120	69003120	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr15:69003120A>T	ENST00000566799.1	+	4	412	c.383A>T	c.(382-384)gAg>gTg	p.E128V	CORO2B_ENST00000261861.5_Missense_Mutation_p.E123V|CORO2B_ENST00000540068.1_Missense_Mutation_p.E123V|CORO2B_ENST00000543950.1_Missense_Mutation_p.E123V			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	128				E -> A (in Ref. 1; BAA36341). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						AACATGACGGAGGCGCTCCTG	0.657																																					p.E128V		Atlas-SNP	.											.	CORO2B	68	.	0			c.A383T						PASS	.						38.0	34.0	35.0					15																	69003120		2198	4297	6495	SO:0001583	missense	10391	exon4			TGACGGAGGCGCT	AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.383A>T	chr15.hg19:g.69003120A>T	ENSP00000454783:p.Glu128Val	33.0	0.0	.		30.0	10.0	.	NM_006091	A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	hg19	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	A	13.52	2.260878	0.39995	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.05786	3.39;3.39	5.69	4.54	0.55810	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.12135	0.0295	M	0.84082	2.675	0.58432	D	0.999995	B	0.09022	0.002	B	0.09377	0.004	T	0.01409	-1.1362	10	0.62326	D	0.03	-23.0641	11.3009	0.49304	0.8635:0.0:0.0:0.1365	.	128	Q9UQ03	COR2B_HUMAN	V	128;123;123	ENSP00000446250:E123V;ENSP00000443819:E123V	ENSP00000261861:E128V	E	+	2	0	CORO2B	66790174	1.000000	0.71417	0.981000	0.43875	0.374000	0.29953	7.075000	0.76798	0.942000	0.37525	0.533000	0.62120	GAG	.	.	.	none		0.657	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
UBL7	84993	hgsc.bcm.edu	37	15	74742277	74742277	+	Splice_Site	SNP	C	C	G			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr15:74742277C>G	ENST00000567435.1	-	7	1127	c.664G>C	c.(664-666)Ggt>Cgt	p.G222R	UBL7_ENST00000361351.4_Splice_Site_p.G222R|UBL7_ENST00000564488.1_Splice_Site_p.G222R|UBL7_ENST00000395081.2_Splice_Site_p.G222R|UBL7_ENST00000565335.1_Splice_Site_p.G222R			Q96S82	UBL7_HUMAN	ubiquitin-like 7	222										endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						AGGCGCTCACCTGGCATATCC	0.582																																					p.G222R		Atlas-SNP	.											.	UBL7	24	.	0			c.G664C						PASS	.						35.0	32.0	33.0					15																	74742277		2197	4296	6493	SO:0001630	splice_region_variant	84993	exon7			GCTCACCTGGCAT	BC007913	CCDS10263.1	15q23	2014-03-06	2014-03-06		ENSG00000138629	ENSG00000138629			28221	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived ubiquitin-like"", "" ubiquitin-like protein SB132"""	609748	"""ubiquitin-like 7 (bone marrow stromal cell-derived)"""			12644319	Standard	NM_201265		Approved	BMSC-UbP, MGC14421	uc002axy.1	Q96S82	OTTHUMG00000139001	ENST00000567435.1:c.664+1G>C	chr15.hg19:g.74742277C>G		68.0	0.0	.		57.0	26.0	.	NM_201265	D3DW57|Q96I03	Missense_Mutation	SNP	ENST00000567435.1	hg19	CCDS10263.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737423	0.89482	.	.	ENSG00000138629	ENST00000361351;ENST00000395081	T;T	0.49139	0.79;0.79	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.66819	0.2828	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64533	-0.6385	9	.	.	.	-14.8599	17.469	0.87640	0.0:1.0:0.0:0.0	.	262;222	D3DW56;Q96S82	.;UBL7_HUMAN	R	222	ENSP00000354883:G222R;ENSP00000378518:G222R	.	G	-	1	0	UBL7	72529330	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	5.689000	0.68234	2.654000	0.90174	0.650000	0.86243	GGT	.	.	.	none		0.582	UBL7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419627.1	NM_032907, NM_201265	Missense_Mutation
SNX29	92017	hgsc.bcm.edu	37	16	12145718	12145718	+	Missense_Mutation	SNP	A	A	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr16:12145718A>C	ENST00000566228.1	+	8	832	c.763A>C	c.(763-765)Aag>Cag	p.K255Q	SNX29_ENST00000323433.4_5'Flank|SNX29_ENST00000306030.3_5'Flank|SNX29_ENST00000568359.1_3'UTR	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	255						extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CAAATGCAAAAAGGAGCGGAA	0.403																																					p.K255Q		Atlas-SNP	.											.	SNX29	60	.	0			c.A763C						PASS	.						48.0	53.0	51.0					16																	12145718		2186	4295	6481	SO:0001583	missense	92017	exon8			TGCAAAAAGGAGC	AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.763A>C	chr16.hg19:g.12145718A>C	ENSP00000456480:p.Lys255Gln	118.0	0.0	.		225.0	46.0	.	NM_032167	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	ENST00000566228.1	hg19	CCDS10553.2	.	.	.	.	.	.	.	.	.	.	A	9.936	1.216256	0.22373	.	.	ENSG00000140660	ENST00000268271	.	.	.	5.78	5.78	0.91487	.	0.236638	0.41712	D	0.000837	T	0.69958	0.3169	M	0.62723	1.935	0.80722	D	1	.	.	.	.	.	.	T	0.66893	-0.5808	7	0.27785	T	0.31	-24.1715	14.9367	0.70960	1.0:0.0:0.0:0.0	.	.	.	.	Q	255	.	ENSP00000268271:K255Q	K	+	1	0	RUNDC2A	12053219	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	5.712000	0.68407	2.212000	0.71576	0.260000	0.18958	AAG	.	.	.	none		0.403	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1		
MKL2	57496	hgsc.bcm.edu	37	16	14340738	14340738	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr16:14340738T>C	ENST00000341243.5	+	10	1588	c.1588T>C	c.(1588-1590)Tca>Cca	p.S530P	MKL2_ENST00000571589.1_Missense_Mutation_p.S541P|MKL2_ENST00000318282.5_Missense_Mutation_p.S541P|MKL2_ENST00000574045.1_Missense_Mutation_p.S541P			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	530					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTTCTTGAGTTCATCTCCTTT	0.473																																					p.S541P		Atlas-SNP	.											.	MKL2	103	.	0			c.T1621C						PASS	.						87.0	81.0	83.0					16																	14340738		2197	4300	6497	SO:0001583	missense	57496	exon12			TTGAGTTCATCTC	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1588T>C	chr16.hg19:g.14340738T>C	ENSP00000345841:p.Ser530Pro	65.0	0.0	.		88.0	36.0	.	NM_014048	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	ENST00000341243.5	hg19		.	.	.	.	.	.	.	.	.	.	T	16.14	3.039094	0.55003	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.83	5.83	0.93111	.	0.460090	0.23885	N	0.043606	T	0.33381	0.0861	N	0.21373	0.66	0.33071	D	0.535396	D;P	0.57899	0.981;0.937	P;P	0.52109	0.69;0.572	T	0.25641	-1.0126	9	0.05959	T	0.93	-18.8813	9.3958	0.38401	0.25:0.0:0.0:0.75	.	541;541	B4DGT8;Q9ULH7-4	.;.	P	541;530	.	ENSP00000339086:S541P	S	+	1	0	MKL2	14248239	0.235000	0.23794	0.156000	0.22583	0.822000	0.46500	1.036000	0.30228	2.225000	0.72522	0.533000	0.62120	TCA	.	.	.	none		0.473	MKL2-202	KNOWN	basic	protein_coding	protein_coding		NM_014048	
KNOP1	400506	hgsc.bcm.edu	37	16	19726133	19726133	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr16:19726133G>T	ENST00000219837.7	-	2	303	c.225C>A	c.(223-225)agC>agA	p.S75R	KNOP1_ENST00000568230.1_5'Flank|IQCK_ENST00000320394.6_5'Flank|AC002550.5_ENST00000565916.1_RNA	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	75	Lys-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CGCAAAGGGTGCTGACACCct	0.532																																					p.S75R		Atlas-SNP	.											.	C16orf88	41	.	0			c.C225A						PASS	.						64.0	63.0	64.0					16																	19726133		2015	4190	6205	SO:0001583	missense	400506	exon2			AAGGGTGCTGACA	BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.225C>A	chr16.hg19:g.19726133G>T	ENSP00000219837:p.Ser75Arg	68.0	0.0	.		74.0	16.0	.	NM_001012991	O43328|Q5FWF3	Missense_Mutation	SNP	ENST00000219837.7	hg19	CCDS42127.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144187	0.57044	.	.	ENSG00000103550	ENST00000219837	T	0.29142	1.58	4.61	0.587	0.17439	.	2.395750	0.01104	N	0.005453	T	0.45357	0.1338	M	0.61703	1.905	0.09310	N	1	D	0.55385	0.971	P	0.58454	0.839	T	0.11717	-1.0576	9	.	.	.	-2.034	2.1892	0.03894	0.1029:0.1574:0.4003:0.3394	.	75	Q1ED39	CP088_HUMAN	R	75	ENSP00000219837:S75R	.	S	-	3	2	C16orf88	19633634	0.004000	0.15560	0.001000	0.08648	0.019000	0.09904	0.086000	0.14935	0.217000	0.20800	0.561000	0.74099	AGC	.	.	.	none		0.532	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435993.2	NM_001012991	
GAS8	2622	hgsc.bcm.edu	37	16	90109648	90109648	+	Silent	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr16:90109648C>T	ENST00000268699.4	+	11	1454	c.1332C>T	c.(1330-1332)gcC>gcT	p.A444A	URAHP_ENST00000517889.1_RNA|GAS8_ENST00000536122.1_Silent_p.A419A	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8	444					cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		AGCTGCTGGCCTTCGGGATCC	0.647																																					p.A444A		Atlas-SNP	.											.	GAS8	29	.	0			c.C1332T						PASS	.						85.0	74.0	78.0					16																	90109648		2198	4300	6498	SO:0001819	synonymous_variant	2622	exon11			GCTGGCCTTCGGG	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.1332C>T	chr16.hg19:g.90109648C>T		16.0	0.0	.		29.0	8.0	.	NM_001481	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Silent	SNP	ENST00000268699.4	hg19	CCDS10992.1																																																																																			.	.	.	none		0.647	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
GLOD4	51031	hgsc.bcm.edu	37	17	686403	686403	+	5'Flank	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr17:686403C>T	ENST00000301328.5	-	0	0				GLOD4_ENST00000536578.1_5'Flank|RNMTL1_ENST00000304478.4_Missense_Mutation_p.S132L|GLOD4_ENST00000301329.6_5'Flank			Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|prostate(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		AGGCTCATTTCAGACGCTCTC	0.453																																					p.S132L		Atlas-SNP	.											.	RNMTL1	25	.	0			c.C395T						PASS	.						93.0	84.0	87.0					17																	686403		2203	4300	6503	SO:0001631	upstream_gene_variant	55178	exon2			TCATTTCAGACGC	AF177342	CCDS32520.1	17p13.3	2008-02-05	2007-03-14	2007-03-14		ENSG00000167699			14111	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 25"""	C17orf25		11642406, 12528892	Standard	NM_016080		Approved	CGI-150, HC71	uc002fru.3	Q9HC38			chr17.hg19:g.686403C>T	Exception_encountered	44.0	0.0	.		86.0	12.0	.	NM_018146	D3DTG9|D3DTH1|Q96B89|Q9H3J8|Q9HC37|Q9NVN1	Missense_Mutation	SNP	ENST00000301328.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.42|11.42	1.632684|1.632684	0.29068|0.29068	.|.	.|.	ENSG00000167699|ENSG00000171861	ENST00000397393|ENST00000304478	.|T	.|0.26957	.|1.7	5.41|5.41	3.42|3.42	0.39159|0.39159	.|RNA 2-O ribose methyltransferase, substrate binding (2);	.|0.595355	.|0.19011	.|N	.|0.125074	T|T	0.10508|0.10508	0.0257|0.0257	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.06405	.|0.002	T|T	0.15954|0.15954	-1.0419|-1.0419	6|10	0.87932|0.29301	D|T	0|0.29	-2.4585|-2.4585	3.4235|3.4235	0.07402|0.07402	0.1402:0.5684:0.136:0.1553|0.1402:0.5684:0.136:0.1553	.|.	.|132	.|Q9HC36	.|RMTL1_HUMAN	K|L	35|132	.|ENSP00000306080:S132L	ENSP00000380548:E35K|ENSP00000306080:S132L	E|S	-|+	1|2	0|0	GLOD4|RNMTL1	633153|633153	0.678000|0.678000	0.27586|0.27586	0.945000|0.945000	0.38365|0.38365	0.749000|0.749000	0.42624|0.42624	0.420000|0.420000	0.21263|0.21263	1.287000|1.287000	0.44583|0.44583	0.650000|0.650000	0.86243|0.86243	GAA|TCA	.	.	.	none		0.453	GLOD4-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000437190.1	NM_016080	
SMCR8	140775	hgsc.bcm.edu	37	17	18219977	18219977	+	Missense_Mutation	SNP	G	G	A	rs577884923		TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr17:18219977G>A	ENST00000406438.3	+	1	1354	c.874G>A	c.(874-876)Gac>Aac	p.D292N	TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	292						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TGAGTCTGCCGACACAGACCT	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		20724	0.0		0.0	False		,,,				2504	0.001				p.D292N		Atlas-SNP	.											.	SMCR8	62	.	0			c.G874A						PASS	.						83.0	77.0	79.0					17																	18219977		2203	4300	6503	SO:0001583	missense	140775	exon1			TCTGCCGACACAG	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.874G>A	chr17.hg19:g.18219977G>A	ENSP00000385025:p.Asp292Asn	70.0	0.0	.		100.0	26.0	.	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	hg19	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	G	1.498	-0.552877	0.03996	.	.	ENSG00000176994	ENST00000406438	T	0.22945	1.93	6.03	1.61	0.23674	.	0.259532	0.43747	N	0.000538	T	0.10465	0.0256	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37056	-0.9722	10	0.07644	T	0.81	-52.6362	7.3193	0.26517	0.2138:0.1197:0.6665:0.0	.	292	Q8TEV9	SMCR8_HUMAN	N	292	ENSP00000385025:D292N	ENSP00000385025:D292N	D	+	1	0	SMCR8	18160702	0.013000	0.17824	0.000000	0.03702	0.088000	0.18126	0.765000	0.26546	0.077000	0.16863	-0.345000	0.07892	GAC	.	.	.	none		0.507	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240805	39240805	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr17:39240805G>T	ENST00000391417.4	+	1	347	c.347G>T	c.(346-348)cGc>cTc	p.R116L		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	141	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						agctgctgccgcccctgctgc	0.672																																					p.R116L		Atlas-SNP	.											.	KRTAP4-7	49	.	0			c.G347T						PASS	.						18.0	18.0	18.0					17																	39240805		692	1587	2279	SO:0001583	missense	100132476	exon1			GCTGCCGCCCCTG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.347G>T	chr17.hg19:g.39240805G>T	ENSP00000375236:p.Arg116Leu	11.0	0.0	.		20.0	6.0	.	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	hg19	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	6.805	0.517638	0.13005	.	.	ENSG00000240871	ENST00000391417	T	0.00606	6.26	3.15	2.13	0.27403	.	0.163808	0.19966	U	0.102091	T	0.00496	0.0016	.	.	.	0.09310	N	1	B	0.18461	0.028	B	0.15052	0.012	T	0.45804	-0.9236	9	0.28530	T	0.3	.	9.2621	0.37619	0.0:0.0:0.7821:0.2179	.	171	Q9BYR0	KRA47_HUMAN	L	116	ENSP00000375236:R116L	ENSP00000375236:R116L	R	+	2	0	KRTAP4-7	36494331	0.000000	0.05858	0.028000	0.17463	0.502000	0.33828	-0.081000	0.11321	0.603000	0.29913	0.289000	0.19496	CGC	.	.	.	none		0.672	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
KIF2B	84643	hgsc.bcm.edu	37	17	51902187	51902187	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr17:51902187T>C	ENST00000268919.4	+	1	1949	c.1793T>C	c.(1792-1794)gTt>gCt	p.V598A		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	598					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATTGAAGAGGTTGAAACATTA	0.418																																					p.V598A		Atlas-SNP	.											.	KIF2B	254	.	0			c.T1793C						PASS	.						149.0	142.0	144.0					17																	51902187		2203	4300	6503	SO:0001583	missense	84643	exon1			AAGAGGTTGAAAC	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1793T>C	chr17.hg19:g.51902187T>C	ENSP00000268919:p.Val598Ala	38.0	0.0	.		73.0	16.0	.	NM_032559	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	hg19	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	T	2.281	-0.364760	0.05103	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.73469	-0.75	5.51	0.573	0.17363	.	2.001250	0.02726	N	0.114494	T	0.57799	0.2078	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.48811	-0.9002	10	0.49607	T	0.09	.	3.9988	0.09570	0.1503:0.2773:0.0:0.5724	.	598	Q8N4N8	KIF2B_HUMAN	A	598;486	ENSP00000268919:V598A	ENSP00000268919:V598A	V	+	2	0	KIF2B	49257186	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-1.122000	0.03267	0.447000	0.26695	0.533000	0.62120	GTT	.	.	.	none		0.418	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
ZNF407	55628	hgsc.bcm.edu	37	18	72775890	72775890	+	Silent	SNP	G	G	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr18:72775890G>A	ENST00000299687.5	+	8	6213	c.6213G>A	c.(6211-6213)cgG>cgA	p.R2071R		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2071					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CTCAGGAGCGGGCACAGGTGG	0.662																																					p.R2071R		Atlas-SNP	.											.	ZNF407	231	.	0			c.G6213A						PASS	.						38.0	46.0	44.0					18																	72775890		2113	4226	6339	SO:0001819	synonymous_variant	55628	exon8			GGAGCGGGCACAG	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6213G>A	chr18.hg19:g.72775890G>A		44.0	0.0	.		62.0	24.0	.	NM_017757	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	ENST00000299687.5	hg19	CCDS45885.1																																																																																			.	.	.	none		0.662	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
KCNG2	26251	hgsc.bcm.edu	37	18	77659475	77659475	+	Missense_Mutation	SNP	T	T	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr18:77659475T>A	ENST00000316249.3	+	2	1060	c.1060T>A	c.(1060-1062)Tcc>Acc	p.S354T	KCNG2_ENST00000590307.1_3'UTR	NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	354					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCGCGACTTCTCCAGCGTGCC	0.711																																					p.S354T		Atlas-SNP	.											.	KCNG2	48	.	0			c.T1060A						PASS	.						21.0	22.0	21.0					18																	77659475		2200	4298	6498	SO:0001583	missense	26251	exon2			GACTTCTCCAGCG	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.1060T>A	chr18.hg19:g.77659475T>A	ENSP00000315654:p.Ser354Thr	68.0	0.0	.		69.0	7.0	.	NM_012283		Missense_Mutation	SNP	ENST00000316249.3	hg19	CCDS12019.1	.	.	.	.	.	.	.	.	.	.	T	4.576	0.107034	0.08780	.	.	ENSG00000178342	ENST00000316249	D	0.97378	-4.36	3.35	-1.73	0.08081	Ion transport (1);	0.224075	0.36101	U	0.002787	D	0.86003	0.5829	N	0.04043	-0.29	0.29711	N	0.839401	B	0.12630	0.006	B	0.20955	0.032	T	0.79522	-0.1769	10	0.02654	T	1	.	4.7552	0.13080	0.6147:0.0:0.13:0.2553	.	354	Q9UJ96	KCNG2_HUMAN	T	354	ENSP00000315654:S354T	ENSP00000315654:S354T	S	+	1	0	KCNG2	75760463	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.723000	0.61965	-0.054000	0.13266	0.338000	0.21704	TCC	.	.	.	none		0.711	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283	
PRKCSH	5589	hgsc.bcm.edu	37	19	11560110	11560110	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr19:11560110G>T	ENST00000589838.1	+	16	1470	c.1470G>T	c.(1468-1470)atG>atT	p.M490I	PRKCSH_ENST00000252455.2_Missense_Mutation_p.M490I|PRKCSH_ENST00000412601.1_Missense_Mutation_p.M487I|PRKCSH_ENST00000592741.1_Missense_Mutation_p.M497I|PRKCSH_ENST00000587327.1_Missense_Mutation_p.M487I|PRKCSH_ENST00000591462.1_Missense_Mutation_p.M487I			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	490					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						AAGAGACCATGGTGACCAGCA	0.692																																					p.M490I		Atlas-SNP	.											.	PRKCSH	55	.	0			c.G1470T						PASS	.						60.0	55.0	57.0					19																	11560110		2203	4300	6503	SO:0001583	missense	5589	exon17			GACCATGGTGACC		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.1470G>T	chr19.hg19:g.11560110G>T	ENSP00000465461:p.Met490Ile	45.0	0.0	.		62.0	24.0	.	NM_002743	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	ENST00000589838.1	hg19	CCDS32911.1	.	.	.	.	.	.	.	.	.	.	G	4.969	0.180061	0.09443	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	D;D	0.82167	-1.58;-1.58	3.72	2.6	0.31112	Mannose-6-phosphate receptor, binding (1);	0.332477	0.28182	N	0.016285	T	0.66127	0.2758	N	0.12182	0.205	0.19945	N	0.999945	B;B;B;B	0.09022	0.002;0.002;0.0;0.001	B;B;B;B	0.08055	0.003;0.003;0.001;0.003	T	0.56456	-0.7976	10	0.35671	T	0.21	-13.6047	9.8819	0.41238	0.0:0.0:0.6528:0.3472	.	497;497;487;490	E7EQZ9;B4DJQ5;A8K318;P14314	.;.;.;GLU2B_HUMAN	I	490;487	ENSP00000252455:M490I;ENSP00000395616:M487I	ENSP00000252455:M490I	M	+	3	0	PRKCSH	11421110	0.719000	0.27986	0.851000	0.33527	0.320000	0.28249	0.689000	0.25437	1.895000	0.54865	0.563000	0.77884	ATG	.	.	.	none		0.692	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
SLC1A6	6511	hgsc.bcm.edu	37	19	15061136	15061136	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr19:15061136C>A	ENST00000221742.3	-	9	1573	c.1566G>T	c.(1564-1566)ttG>ttT	p.L522F	SLC1A6_ENST00000430939.2_Missense_Mutation_p.L458F|SLC1A6_ENST00000600144.1_Missense_Mutation_p.L444F	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	522					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CCCGCTGAGACAAGTGCTCGA	0.592																																					p.L522F		Atlas-SNP	.											.	SLC1A6	111	.	0			c.G1566T						PASS	.						61.0	57.0	58.0					19																	15061136		2203	4300	6503	SO:0001583	missense	6511	exon9			CTGAGACAAGTGC		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1566G>T	chr19.hg19:g.15061136C>A	ENSP00000221742:p.Leu522Phe	74.0	0.0	.		58.0	16.0	.	NM_005071	Q8N753	Missense_Mutation	SNP	ENST00000221742.3	hg19	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	c	18.63	3.664453	0.67700	.	.	ENSG00000105143	ENST00000430939;ENST00000221742	T;T	0.73363	-0.74;0.29	5.57	3.32	0.38043	.	0.000000	0.85682	D	0.000000	T	0.74230	0.3689	M	0.67953	2.075	0.80722	D	1	D;P	0.56035	0.974;0.87	P;P	0.48089	0.566;0.477	T	0.76366	-0.2985	10	0.66056	D	0.02	-14.2883	9.118	0.36769	0.0:0.7707:0.1471:0.0822	.	458;522	E7EV13;P48664	.;EAA4_HUMAN	F	458;522	ENSP00000409386:L458F;ENSP00000221742:L522F	ENSP00000221742:L522F	L	-	3	2	SLC1A6	14922136	1.000000	0.71417	0.945000	0.38365	0.916000	0.54674	0.886000	0.28241	1.356000	0.45884	0.544000	0.68410	TTG	.	.	.	none		0.592	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
ZNF616	90317	hgsc.bcm.edu	37	19	52618818	52618818	+	Silent	SNP	A	A	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr19:52618818A>T	ENST00000600228.1	-	4	1860	c.1599T>A	c.(1597-1599)cgT>cgA	p.R533R	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	533					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CAAAAGCTGAACGGTCACTGA	0.443																																					p.R533R		Atlas-SNP	.											.	ZNF616	109	.	0			c.T1599A						PASS	.						100.0	96.0	97.0					19																	52618818		2203	4300	6503	SO:0001819	synonymous_variant	90317	exon4			AGCTGAACGGTCA	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1599T>A	chr19.hg19:g.52618818A>T		101.0	0.0	.		82.0	23.0	.	NM_178523	B3KRV1|Q0P658|Q658V7	Silent	SNP	ENST00000600228.1	hg19	CCDS33090.1																																																																																			.	.	.	none		0.443	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892	
ISOC2	79763	hgsc.bcm.edu	37	19	55967191	55967191	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr19:55967191G>T	ENST00000425675.2	-	3	220	c.160C>A	c.(160-162)Cca>Aca	p.P54T	ISOC2_ENST00000085068.3_Missense_Mutation_p.P54T|ISOC2_ENST00000438389.2_Intron			Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2	54					protein destabilization (GO:0031648)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			endometrium(1)|lung(4)|ovary(1)|stomach(1)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		AGCATGACTGGCACCTCAAGC	0.667																																					p.P54T		Atlas-SNP	.											.	ISOC2	16	.	0			c.C160A						PASS	.						8.0	9.0	9.0					19																	55967191		2149	4217	6366	SO:0001583	missense	79763	exon3			TGACTGGCACCTC	AK027122	CCDS12925.1, CCDS46194.1, CCDS46195.1	19q13.42	2011-07-14			ENSG00000063241	ENSG00000063241			26278	protein-coding gene	gene with protein product		612928				17658461	Standard	NM_024710		Approved	FLJ23469	uc002qla.3	Q96AB3		ENST00000425675.2:c.160C>A	chr19.hg19:g.55967191G>T	ENSP00000401726:p.Pro54Thr	43.0	0.0	.		53.0	11.0	.	NM_001136201	Q6ZN91|Q9H5G0	Missense_Mutation	SNP	ENST00000425675.2	hg19	CCDS46195.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109664	0.56398	.	.	ENSG00000063241	ENST00000085068;ENST00000425675	.	.	.	4.39	3.27	0.37495	Isochorismatase-like (3);	0.000000	0.85682	D	0.000000	T	0.80352	0.4607	M	0.91717	3.235	0.58432	D	0.999997	P;D	0.76494	0.956;0.999	P;D	0.66602	0.768;0.945	D	0.84554	0.0646	9	0.72032	D	0.01	-22.6752	12.0338	0.53412	0.0:0.0:0.8278:0.1722	.	54;54	Q96AB3;Q96AB3-2	ISOC2_HUMAN;.	T	54	.	ENSP00000085068:P54T	P	-	1	0	ISOC2	60659003	1.000000	0.71417	0.096000	0.21009	0.418000	0.31294	6.666000	0.74446	2.168000	0.68352	0.491000	0.48974	CCA	.	.	.	none		0.667	ISOC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453179.1	NM_024710	
ZSCAN1	284312	hgsc.bcm.edu	37	19	58549300	58549300	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr19:58549300G>T	ENST00000282326.1	+	3	343	c.96G>T	c.(94-96)agG>agT	p.R32S	ZSCAN1_ENST00000391700.1_Missense_Mutation_p.R32S|ZSCAN1_ENST00000601162.1_Missense_Mutation_p.R32S	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	32					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CAAGCCCCAGGGACACCGAAG	0.701																																					p.R32S		Atlas-SNP	.											.	ZSCAN1	102	.	0			c.G96T						PASS	.						12.0	15.0	14.0					19																	58549300		2130	4230	6360	SO:0001583	missense	284312	exon3			CCCCAGGGACACC	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.96G>T	chr19.hg19:g.58549300G>T	ENSP00000282326:p.Arg32Ser	16.0	0.0	.		19.0	6.0	.	NM_182572	Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	hg19	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	G	3.301	-0.142840	0.06669	.	.	ENSG00000152467	ENST00000391700;ENST00000282326	T;T	0.05513	3.43;3.43	1.7	-0.919	0.10478	Retrovirus capsid, C-terminal (1);	.	.	.	.	T	0.04724	0.0128	L	0.34521	1.04	0.09310	N	1	B;B	0.26318	0.146;0.01	B;B	0.32533	0.147;0.002	T	0.47169	-0.9138	9	0.21540	T	0.41	.	2.8776	0.05636	0.2013:0.2973:0.5015:0.0	.	32;32	Q8NBB4;Q8NBB4-2	ZSCA1_HUMAN;.	S	32	ENSP00000375581:R32S;ENSP00000282326:R32S	ENSP00000282326:R32S	R	+	3	2	ZSCAN1	63241112	0.004000	0.15560	0.000000	0.03702	0.002000	0.02628	1.259000	0.32956	-0.144000	0.11314	-0.287000	0.09952	AGG	.	.	.	none		0.701	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	
HNF4A	3172	hgsc.bcm.edu	37	20	43036091	43036091	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr20:43036091T>C	ENST00000316099.4	+	3	450	c.361T>C	c.(361-363)Ttc>Ctc	p.F121L	HNF4A_ENST00000316673.4_Missense_Mutation_p.F99L|HNF4A_ENST00000415691.2_Missense_Mutation_p.F121L|HNF4A_ENST00000457232.1_Missense_Mutation_p.F99L|MIR3646_ENST00000578301.1_RNA|HNF4A_ENST00000609795.1_Missense_Mutation_p.F99L|HNF4A_ENST00000443598.2_Missense_Mutation_p.F121L	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	121					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CAAGAAATGCTTCCGGGCTGG	0.602																																					p.F121L	Colon(79;2 1269 8820 14841 52347)	Atlas-SNP	.											.	HNF4A	150	.	0			c.T361C						PASS	.						76.0	65.0	68.0					20																	43036091		2203	4300	6503	SO:0001583	missense	3172	exon3			AAATGCTTCCGGG	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.361T>C	chr20.hg19:g.43036091T>C	ENSP00000312987:p.Phe121Leu	23.0	0.0	.		31.0	15.0	.	NM_178849	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	hg19	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	T	19.35	3.810261	0.70797	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93;-3.93	5.69	5.69	0.88448	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.088735	0.85682	D	0.000000	D	0.92714	0.7684	N	0.02736	-0.51	0.80722	D	1	D;P;P;D;D;D;B	0.89917	1.0;0.526;0.526;1.0;0.993;0.991;0.146	D;P;P;D;D;D;B	0.97110	1.0;0.557;0.557;1.0;0.951;0.919;0.174	D	0.90207	0.4261	10	0.08837	T	0.75	.	15.9429	0.79771	0.0:0.0:0.0:1.0	.	114;121;121;121;99;99;99	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	L	99;99;121;121;151;121	ENSP00000315180:F99L;ENSP00000396216:F99L;ENSP00000312987:F121L;ENSP00000410911:F121L;ENSP00000412111:F121L	ENSP00000312987:F121L	F	+	1	0	HNF4A	42469505	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.032000	0.88838	2.164000	0.68074	0.523000	0.50628	TTC	.	.	.	none		0.602	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		
PCK1	5105	hgsc.bcm.edu	37	20	56137207	56137207	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr20:56137207C>T	ENST00000319441.4	+	3	469	c.305C>T	c.(304-306)aCa>aTa	p.T102I	PCK1_ENST00000535860.1_Intron|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	102					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CAAAGAGACACAGTGCCCATC	0.542																																					p.T102I		Atlas-SNP	.											.	PCK1	95	.	0			c.C305T						PASS	.						103.0	91.0	95.0					20																	56137207		2203	4300	6503	SO:0001583	missense	5105	exon3			GAGACACAGTGCC		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.305C>T	chr20.hg19:g.56137207C>T	ENSP00000319814:p.Thr102Ile	52.0	0.0	.		55.0	10.0	.	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	hg19	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401418	0.83120	.	.	ENSG00000124253	ENST00000319441	T	0.11712	2.75	5.45	5.45	0.79879	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.091457	0.85682	D	0.000000	T	0.32645	0.0836	M	0.62088	1.915	0.80722	D	1	P	0.41748	0.761	P	0.60886	0.88	T	0.00690	-1.1608	10	0.87932	D	0	-7.538	19.2944	0.94117	0.0:1.0:0.0:0.0	.	102	P35558	PCKGC_HUMAN	I	102	ENSP00000319814:T102I	ENSP00000319814:T102I	T	+	2	0	PCK1	55570613	1.000000	0.71417	0.832000	0.32986	0.637000	0.38172	7.380000	0.79704	2.561000	0.86390	0.655000	0.94253	ACA	.	.	.	none		0.542	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
ASCC2	84164	hgsc.bcm.edu	37	22	30188510	30188510	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr22:30188510G>C	ENST00000397771.2	-	19	2111	c.1934C>G	c.(1933-1935)cCt>cGt	p.P645R	ASCC2_ENST00000542393.1_Missense_Mutation_p.P569R|ASCC2_ENST00000307790.3_Missense_Mutation_p.P645R			Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit 2	645				P -> L (in Ref. 1; AAG45475). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					endometrium(3)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			CAGCACCTGAGGGATGGTGAA	0.562																																					p.P645R		Atlas-SNP	.											.	ASCC2	53	.	0			c.C1934G						PASS	.						318.0	278.0	292.0					22																	30188510		2203	4300	6503	SO:0001583	missense	84164	exon18			ACCTGAGGGATGG	AY013289	CCDS13869.1, CCDS56226.1	22q12.1	2004-07-27			ENSG00000100325	ENSG00000100325			24103	protein-coding gene	gene with protein product	"""ASC 1 complex subunit P100"""	614216				12077347, 9847074	Standard	NM_032204		Approved	ASC1p100, FLJ21588, DKFZp586O0223	uc003agr.3	Q9H1I8	OTTHUMG00000067658	ENST00000397771.2:c.1934C>G	chr22.hg19:g.30188510G>C	ENSP00000380877:p.Pro645Arg	87.0	0.0	.		123.0	51.0	.	NM_032204	B7Z8E0|F5H6J9|Q4TT54|Q8TAZ0|Q9H711|Q9H9D6	Missense_Mutation	SNP	ENST00000397771.2	hg19	CCDS13869.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519705	0.85495	.	.	ENSG00000100325	ENST00000307790;ENST00000397771;ENST00000542393	T;T;T	0.10288	2.89;2.89;2.89	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.30324	0.0761	L	0.60845	1.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00311	-1.1827	10	0.34782	T	0.22	-8.3081	17.9377	0.89018	0.0:0.0:1.0:0.0	.	569;645	F5H6J9;Q9H1I8	.;ASCC2_HUMAN	R	645;645;569	ENSP00000305502:P645R;ENSP00000380877:P645R;ENSP00000437570:P569R	ENSP00000305502:P645R	P	-	2	0	ASCC2	28518510	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.301000	0.89951	2.651000	0.90000	0.563000	0.77884	CCT	.	.	.	none		0.562	ASCC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322127.1	NM_032204	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382435	24382435	+	IGR	SNP	C	C	G			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chrX:24382435C>G								AC004552.1 (15412 upstream) : PDK3 (100902 downstream)																							tgctcctgctcctgctctagc	0.627																																					p.P520A		Atlas-SNP	.											.	.	.	.	0			c.C1558G						PASS	.						2.0	2.0	2.0					X																	24382435		1085	2493	3578	SO:0001628	intergenic_variant	100130302	exon1			CCTGCTCCTGCTC																													chrX.hg19:g.24382435C>G		85.0	0.0	.		151.0	21.0	.	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.627								
DMD	1756	hgsc.bcm.edu	37	X	32486636	32486636	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chrX:32486636C>G	ENST00000357033.4	-	23	3347	c.3141G>C	c.(3139-3141)atG>atC	p.M1047I	DMD_ENST00000378677.2_Missense_Mutation_p.M1043I	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1047					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGAGTTTATTCATTTGCTCCT	0.368																																					p.M1047I		Atlas-SNP	.											.	DMD	2127	.	0			c.G3141C						PASS	.						56.0	47.0	50.0					X																	32486636		2202	4299	6501	SO:0001583	missense	1756	exon23			TTTATTCATTTGC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3141G>C	chrX.hg19:g.32486636C>G	ENSP00000354923:p.Met1047Ile	354.0	0.0	.		547.0	31.0	.	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	0.051	-1.249776	0.01469	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.32988	1.43;1.43	5.12	4.26	0.50523	.	0.000000	0.40554	U	0.001066	T	0.18635	0.0447	L	0.31065	0.9	0.80722	D	1	B;B;B	0.11235	0.001;0.004;0.0	B;B;B	0.09377	0.004;0.003;0.002	T	0.06338	-1.0832	10	0.11485	T	0.65	.	8.0396	0.30513	0.0:0.746:0.0:0.254	.	1039;1047;1043	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	I	1039;1043;1047;1047;924	ENSP00000367948:M1043I;ENSP00000354923:M1047I	ENSP00000354923:M1047I	M	-	3	0	DMD	32396557	1.000000	0.71417	0.847000	0.33407	0.461000	0.32589	1.510000	0.35790	1.042000	0.40150	0.538000	0.68166	ATG	.	.	.	none		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
KDM6A	7403	hgsc.bcm.edu	37	X	44949073	44949073	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chrX:44949073C>T	ENST00000377967.4	+	25	3675	c.3634C>T	c.(3634-3636)Cag>Tag	p.Q1212*	KDM6A_ENST00000543216.1_Nonsense_Mutation_p.Q1133*|KDM6A_ENST00000536777.1_Nonsense_Mutation_p.Q1167*|KDM6A_ENST00000382899.4_Nonsense_Mutation_p.Q1219*	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1212	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TAGGTTTATTCAGCGACCTGG	0.398			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.Q1212X	Colon(129;1273 1667 15230 27352 52914)	Atlas-SNP	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)	c.C3634T						PASS	.						153.0	129.0	137.0					X																	44949073		2203	4300	6503	SO:0001587	stop_gained	7403	exon25			TTTATTCAGCGAC	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3634C>T	chrX.hg19:g.44949073C>T	ENSP00000367203:p.Gln1212*	344.0	0.0	.		553.0	263.0	.	NM_021140	Q52LL9|Q5JVQ7	Nonsense_Mutation	SNP	ENST00000377967.4	hg19	CCDS14265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.524194|8.524194	0.98848|0.98848	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216|ENST00000414389;ENST00000433797	.|.	.|.	.|.	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.74619	.|0.3740	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74009	.|-0.3802	.|3	0.87932|.	D|.	0|.	-7.8457|-7.8457	18.2517|18.2517	0.90006|0.90006	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	909;1212;1167;1219;1133|809;854	.|.	ENSP00000334340:Q909X|.	Q|S	+|+	1|2	0|0	KDM6A|KDM6A	44834017|44834017	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.396000|7.396000	0.79891|0.79891	2.249000|2.249000	0.74217|0.74217	0.468000|0.468000	0.43344|0.43344	CAG|TCA	.	.	.	none		0.398	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
RLIM	51132	hgsc.bcm.edu	37	X	73811367	73811367	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chrX:73811367G>T	ENST00000332687.6	-	4	2001	c.1783C>A	c.(1783-1785)Cac>Aac	p.H595N	RLIM_ENST00000349225.2_Missense_Mutation_p.H595N	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	595					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCGATGCAGTGGACATGGTAC	0.398																																					p.H595N	Esophageal Squamous(169;1899 1923 14997 18818 32118)	Atlas-SNP	.											.	RLIM	90	.	0			c.C1783A						PASS	.						138.0	110.0	119.0					X																	73811367		2203	4300	6503	SO:0001583	missense	51132	exon5			TGCAGTGGACATG	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1783C>A	chrX.hg19:g.73811367G>T	ENSP00000328059:p.His595Asn	205.0	0.0	.		364.0	167.0	.	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	hg19	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.846145	0.51164	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.67345	-0.26;-0.26	5.41	4.53	0.55603	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.047424	0.85682	D	0.000000	T	0.68403	0.2997	N	0.11927	0.2	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.74054	-0.3788	10	0.62326	D	0.03	-15.4496	15.294	0.73888	0.0:0.1368:0.8632:0.0	.	595	Q9NVW2	RNF12_HUMAN	N	595	ENSP00000328059:H595N;ENSP00000253571:H595N	ENSP00000328059:H595N	H	-	1	0	RLIM	73728092	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	9.416000	0.97383	1.038000	0.40049	0.600000	0.82982	CAC	.	.	.	none		0.398	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
SMARCA1	6594	hgsc.bcm.edu	37	X	128614706	128614706	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chrX:128614706A>G	ENST00000371122.4	-	19	2543	c.2414T>C	c.(2413-2415)cTt>cCt	p.L805P	SMARCA1_ENST00000371121.3_Missense_Mutation_p.L793P|SMARCA1_ENST00000371123.1_Missense_Mutation_p.L793P	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	805					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CCGATAATAAAGAATTTCCTT	0.323																																					p.L805P		Atlas-SNP	.											.	SMARCA1	126	.	0			c.T2414C						PASS	.						57.0	56.0	57.0					X																	128614706		2203	4300	6503	SO:0001583	missense	6594	exon19			TAATAAAGAATTT	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2414T>C	chrX.hg19:g.128614706A>G	ENSP00000360163:p.Leu805Pro	258.0	1.0	.		435.0	218.0	.	NM_003069	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	hg19	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.575258	0.65878	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9	4.96	4.96	0.65561	ATPase, nucleosome remodelling ISWI, HAND domain (2);	0.000000	0.53938	D	0.000048	D	0.94886	0.8347	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.71414	0.973;0.973;0.955;0.973	D	0.94695	0.7877	10	0.49607	T	0.09	-11.6576	13.7875	0.63119	1.0:0.0:0.0:0.0	.	784;805;793;805	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	P	793;793;805;784	ENSP00000360162:L793P;ENSP00000360164:L793P;ENSP00000360163:L805P;ENSP00000404275:L784P	ENSP00000360162:L793P	L	-	2	0	SMARCA1	128442387	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.278000	0.95766	1.630000	0.50440	0.430000	0.28490	CTT	.	.	.	none		0.323	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
SLC22A23	63027	hgsc.bcm.edu	37	6	3456326	3456326	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr6:3456326delG	ENST00000406686.3	-	1	467	c.468delC	c.(466-468)cccfs	p.P156fs	SLC22A23_ENST00000436008.2_Frame_Shift_Del_p.P156fs|SLC22A23_ENST00000380298.2_Frame_Shift_Del_p.P156fs	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	156					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				AGGGGGTGGTGGGGAGGCTGG	0.731																																					p.T157fs		Atlas-Indel,Pindel	.											.	SLC22A23	89	.	0			c.469delA						PASS	.						8.0	15.0	13.0					6																	3456326		690	1586	2276	SO:0001589	frameshift_variant	63027	exon1			.	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.468delC	chr6.hg19:g.3456326delG	ENSP00000385028:p.Pro156fs	67.0	0.0	0		76.0	21.0	0.276316	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Frame_Shift_Del	DEL	ENST00000406686.3	hg19	CCDS47363.1																																																																																			.	.	.	none		0.731	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
ZNF326	284695	hgsc.bcm.edu	37	1	90493075	90493075	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr1:90493075delG	ENST00000340281.4	+	12	1707	c.1564delG	c.(1564-1566)gagfs	p.E523fs	ZNF326_ENST00000370447.3_Frame_Shift_Del_p.E434fs|ZNF326_ENST00000455342.2_Frame_Shift_Del_p.E317fs	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	523	Glu-rich.				mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		ggaagaagtagaggaagtgag	0.498																																					p.V521fs		Atlas-Indel,Pindel	.											.	ZNF326	60	.	0			c.1563delA						PASS	.						70.0	64.0	66.0					1																	90493075		2203	4300	6503	SO:0001589	frameshift_variant	284695	exon12			.	BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1564delG	chr1.hg19:g.90493075delG	ENSP00000340796:p.Glu523fs	73.0	0.0	0		101.0	27.0	0.267327	NM_182976	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Frame_Shift_Del	DEL	ENST00000340281.4	hg19	CCDS727.1																																																																																			.	.	.	none		0.498	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029428.2	NM_181781	
SSC5D	284297	hgsc.bcm.edu	37	19	56011955	56011955	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr19:56011955delT	ENST00000389623.6	+	11	2424	c.2401delT	c.(2401-2403)tggfs	p.W801fs	SSC5D_ENST00000587166.1_Frame_Shift_Del_p.W801fs	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	801	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						TGATGACAACTGGGACCTGCG	0.652																																					p.N800fs		Atlas-Indel,Pindel	.											.	SSC5D	65	.	0			c.2400delC						PASS	.						66.0	67.0	67.0					19																	56011955		692	1591	2283	SO:0001589	frameshift_variant	284297	exon11			.		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2401delT	chr19.hg19:g.56011955delT	ENSP00000374274:p.Trp801fs	61.0	0.0	0		73.0	21.0	0.287671	NM_001195267	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Frame_Shift_Del	DEL	ENST00000389623.6	hg19	CCDS46196.1																																																																																			.	.	.	none		0.652	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
MYH15	22989	hgsc.bcm.edu	37	3	108229380	108229399	+	Frame_Shift_Del	DEL	TTATTAAAGCAATCCACCAA	TTATTAAAGCAATCCACCAA	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	TTATTAAAGCAATCCACCAA	TTATTAAAGCAATCCACCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr3:108229380_108229399delTTATTAAAGCAATCCACCAA	ENST00000273353.3	-	2	95_114	c.39_58delTTGGTGGATTGCTTTAATAA	c.(37-60)ttttggtggattgctttaataaagfs	p.FWWIALIK13fs		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	13						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AGATCCATCTTTATTAAAGCAATCCACCAAAAAAAGGCCC	0.427																																					p.14_20del		Atlas-INDEL	.											.	MYH15	223	.	0			c.40_59del						PASS	.																																			SO:0001589	frameshift_variant	22989	exon2			.	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.39_58delTTGGTGGATTGCTTTAATAA	chr3.hg19:g.108229380_108229399delTTATTAAAGCAATCCACCAA	ENSP00000273353:p.Phe13fs	137.0	0.0	0		196.0	15.0	0.0765306	NM_014981		Frame_Shift_Del	DEL	ENST00000273353.3	hg19	CCDS43127.1																																																																																			.	.	.	none		0.427	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
CASC3	22794	hgsc.bcm.edu	37	17	38318253	38318254	+	Splice_Site	INS	-	-	G	rs200097668		TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr17:38318253_38318254insG	ENST00000264645.7	+	5	682		c.e5-1			NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3						gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						TCTGTCCTCTAGGAGAGCACAG	0.47																																					.		Atlas-Indel,Pindel	.											.	CASC3	39	.	0			c.457-2->G						PASS	.																																			SO:0001630	splice_region_variant	22794	exon5			.	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.457-1->G	chr17.hg19:g.38318255_38318255dupG		61.0	0.0	0		75.0	24.0	0.32	NM_007359	A8K8R0	Splice_Site	INS	ENST00000264645.7	hg19	CCDS11362.1																																																																																			.	.	.	none		0.470	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3	NM_007359	Intron
AK4	205	hgsc.bcm.edu	37	1	65690462	65690463	+	In_Frame_Ins	INS	-	-	TAG			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr1:65690462_65690463insTAG	ENST00000327299.7	+	4	671_672	c.466_467insTAG	c.(466-468)tta>tTAGta	p.157_158insV	AK4_ENST00000545314.1_In_Frame_Ins_p.157_158insV|AK4_ENST00000546702.1_In_Frame_Ins_p.105_106insV|AK4_ENST00000470888.2_3'UTR|AK4_ENST00000395334.2_In_Frame_Ins_p.157_158insV	NM_013410.3	NP_037542.1			adenylate kinase 4											breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	9						TGGTGAACCGTTAGTCCAGCAG	0.421																																					p.L156delinsLV		Atlas-Indel,Pindel	.											.	AK4	22	.	0			c.466_467insTAG						PASS	.																																			SO:0001652	inframe_insertion	205	exon5			.	AK025926	CCDS629.1	1p31.3	2012-10-02	2010-06-15	2010-06-15	ENSG00000162433	ENSG00000162433	2.7.4.3	"""Adenylate kinases"""	363	protein-coding gene	gene with protein product		103030	"""adenylate kinase 3"", ""adenylate kinase 3-like 1"""	AK3, AK3L1		11485571	Standard	NM_203464		Approved		uc001dby.3	P27144	OTTHUMG00000009033	ENST00000327299.7:c.467_469dupTAG	chr1.hg19:g.65690463_65690465dupTAG	ENSP00000322175:p.Val157_Val157dup	98.0	0.0	0		153.0	40.0	0.261438	NM_203464		In_Frame_Ins	INS	ENST00000327299.7	hg19	CCDS629.1																																																																																			.	.	.	none		0.421	AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025040.2	NM_013410	
RPL37A	6168	hgsc.bcm.edu	37	2	217364702	217364709	+	Frame_Shift_Del	DEL	TGGCACTG	TGGCACTG	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	TGGCACTG	TGGCACTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr2:217364702_217364709delTGGCACTG	ENST00000491306.1	+	3	849_856	c.163_170delTGGCACTG	c.(163-171)tggcactgtfs	p.WHC55fs	RPL37A_ENST00000427280.2_Frame_Shift_Del_p.WHC31fs|RPL37A_ENST00000600880.1_Frame_Shift_Del_p.WHC55fs|AC098820.3_ENST00000453157.1_RNA|RPL37A_ENST00000456586.1_Frame_Shift_Del_p.WHC31fs|AC098820.3_ENST00000438978.1_RNA|RPL37A_ENST00000441179.2_Frame_Shift_Del_p.WHC31fs|RPL37A_ENST00000446558.1_Frame_Shift_Del_p.WHC55fs|RPL37A_ENST00000598925.1_Frame_Shift_Del_p.WHC31fs	NM_000998.4	NP_000989.1	P61513	RL37A_HUMAN	ribosomal protein L37a	55					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.H56H(1)		NS(1)|ovary(1)	2		Renal(323;0.0458)		Epithelial(149;3.51e-06)|all cancers(144;0.000249)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTGGGGATCTGGCACTGTGGTTCCTGC	0.452																																					p.54_57del		Atlas-Indel,Pindel	.											.	RPL37A	9	.	1	Substitution - coding silent(1)	ovary(1)	c.162_169del						PASS	.																																			SO:0001589	frameshift_variant	6168	exon3			.		CCDS2404.1	2q35	2011-04-06			ENSG00000197756	ENSG00000197756		"""L ribosomal proteins"""	10348	protein-coding gene	gene with protein product		613314				1437567	Standard	NM_000998		Approved	L37A	uc002vgf.3	P61513	OTTHUMG00000133052	ENST00000491306.1:c.163_170delTGGCACTG	chr2.hg19:g.217364702_217364709delTGGCACTG	ENSP00000418082:p.Trp55fs	101.0	0.0	0		104.0	21.0	0.201923	NM_000998	P12751|Q6FGF5	Frame_Shift_Del	DEL	ENST00000491306.1	hg19	CCDS2404.1																																																																																			.	.	.	none		0.452	RPL37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256665.2	NM_000998	
BANK1	55024	hgsc.bcm.edu	37	4	102965067	102965076	+	Intron	DEL	ACTAACACTA	ACTAACACTA	-	rs368009226		TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	ACTAACACTA	ACTAACACTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr4:102965067_102965076delACTAACACTA	ENST00000322953.4	+	11	2243				BANK1_ENST00000428908.1_Intron|BANK1_ENST00000504592.1_Intron|BANK1_ENST00000444316.2_Intron|BANK1_ENST00000508653.1_Intron	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1						B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GAAACAAGGTACTAACACTAACTTCAATCT	0.319																																					.		Atlas-Indel,Pindel	.											.	BANK1	95	.	0			.						PASS	.																																			SO:0001627	intron_variant	55024	.			.	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1969+3ACTAACACTA>-	chr4.hg19:g.102965067_102965076delACTAACACTA		62.0	0.0	0		78.0	11.0	0.141026	.	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Splice_Site	DEL	ENST00000322953.4	hg19	CCDS34038.1																																																																																			.	.	.	none		0.319	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
PSMA6	5687	hgsc.bcm.edu	37	14	35783593	35783596	+	Frame_Shift_Del	DEL	TCTA	TCTA	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	TCTA	TCTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr14:35783593_35783596delTCTA	ENST00000261479.4	+	6	735_738	c.615_618delTCTA	c.(613-618)gttctafs	p.VL205fs	PSMA6_ENST00000555764.1_Frame_Shift_Del_p.VL126fs|PSMA6_ENST00000540871.1_Frame_Shift_Del_p.VL186fs|PSMA6_ENST00000553809.1_Frame_Shift_Del_p.VL211fs|PSMA6_ENST00000556506.1_Intron|KIAA0391_ENST00000557565.1_3'UTR	NM_002791.1	NP_002782.1	P60900	PSA6_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 6	205					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of inflammatory response (GO:0050727)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|myofibril (GO:0030016)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)|sarcomere (GO:0030017)	endopeptidase activity (GO:0004175)|NF-kappaB binding (GO:0051059)|purine ribonucleoside triphosphate binding (GO:0035639)|RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			kidney(2)|large_intestine(1)|lung(5)|prostate(1)|urinary_tract(1)	10	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		TGTCTACTGTTCTATCAATTGATT	0.328																																					p.205_206del		Atlas-Indel,Pindel	.											.	PSMA6	18	.	0			c.614_617del						PASS	.																																			SO:0001589	frameshift_variant	5687	exon6			.	X59417	CCDS9655.1, CCDS61437.1, CCDS61438.1	14q13	2003-03-12			ENSG00000100902	ENSG00000100902		"""Proteasome (prosome, macropain) subunits"""	9535	protein-coding gene	gene with protein product		602855				1888762, 8811196	Standard	NM_002791		Approved	IOTA, PROS27, p27K, MGC22756, MGC2333, MGC23846	uc001wtd.3	P60900	OTTHUMG00000140221	ENST00000261479.4:c.615_618delTCTA	chr14.hg19:g.35783593_35783596delTCTA	ENSP00000261479:p.Val205fs	316.0	0.0	0		377.0	102.0	0.270557	NM_002791	B2R7J9|B4DQR4|B4DXJ9|P34062|Q6IB60	Frame_Shift_Del	DEL	ENST00000261479.4	hg19	CCDS9655.1																																																																																			.	.	.	none		0.328	PSMA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276684.1		
MPI	4351	hgsc.bcm.edu	37	15	75183852	75183852	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr15:75183852delA	ENST00000352410.4	+	3	344	c.277delA	c.(277-279)aacfs	p.N93fs	MPI_ENST00000564003.1_Frame_Shift_Del_p.N43fs|MPI_ENST00000566377.1_Frame_Shift_Del_p.N93fs|MPI_ENST00000535694.1_Frame_Shift_Del_p.N43fs|MPI_ENST00000323744.6_Frame_Shift_Del_p.N93fs|MPI_ENST00000562606.1_Frame_Shift_Del_p.N73fs|MPI_ENST00000563786.1_Frame_Shift_Del_p.N73fs|MPI_ENST00000565576.1_Frame_Shift_Del_p.N93fs|MPI_ENST00000563422.1_Frame_Shift_Del_p.N93fs			P34949	MPI_HUMAN	mannose phosphate isomerase	93					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	mannose-6-phosphate isomerase activity (GO:0004476)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						CTTTAATGGCAACCTGCCCTT	0.527																																					p.G92fs		Atlas-Indel,Pindel	.											.	MPI	32	.	0			c.276delC						PASS	.						209.0	173.0	185.0					15																	75183852		2197	4295	6492	SO:0001589	frameshift_variant	4351	exon3			.		CCDS10272.1, CCDS73756.1, CCDS73757.1, CCDS73758.1	15q24.1	2013-09-19			ENSG00000178802	ENSG00000178802	5.3.1.8		7216	protein-coding gene	gene with protein product	"""mannose-6-phosphate isomerase"""	154550					Standard	NM_002435		Approved		uc002azc.1	P34949	OTTHUMG00000142826	ENST00000352410.4:c.277delA	chr15.hg19:g.75183852delA	ENSP00000318318:p.Asn93fs	68.0	0.0	0		67.0	23.0	0.343284	NM_002435	A8K8K9|Q96AB0	Frame_Shift_Del	DEL	ENST00000352410.4	hg19	CCDS10272.1																																																																																			.	.	.	none		0.527	MPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286418.4		
PPP2R3A	5523	hgsc.bcm.edu	37	3	135797207	135797208	+	Splice_Site	DEL	AG	AG	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr3:135797207_135797208delAG	ENST00000264977.3	+	7	3161		c.e7-1		PPP2R3A_ENST00000334546.2_Splice_Site|PPP2R3A_ENST00000492624.2_Splice_Site|PPP2R3A_ENST00000490467.1_Splice_Site	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha						eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTTTGGAACCAGGTTATTCAGA	0.322																																					.		Atlas-Indel,Pindel	.											.	PPP2R3A	114	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	5523	.			.	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2545-1AG>-	chr3.hg19:g.135797207_135797208delAG		534.0	0.0	0		712.0	277.0	0.389045	.	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Splice_Site	DEL	ENST00000264977.3	hg19	CCDS3087.1																																																																																			.	.	.	none		0.322	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	Intron
STRAP	11171	hgsc.bcm.edu	37	12	16043580	16043580	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr12:16043580delA	ENST00000419869.2	+	4	693	c.380delA	c.(379-381)tatfs	p.Y127fs	STRAP_ENST00000538352.1_Frame_Shift_Del_p.Y33fs|STRAP_ENST00000025399.6_Frame_Shift_Del_p.Y140fs	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein	127					maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				TTACGCATATATGACTTGAAC	0.279																																					p.Y127fs		Atlas-Indel,Pindel	.											.	STRAP	33	.	0			c.379delT						PASS	.						76.0	79.0	78.0					12																	16043580		2203	4300	6503	SO:0001589	frameshift_variant	11171	exon4			.	AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.380delA	chr12.hg19:g.16043580delA	ENSP00000392270:p.Tyr127fs	187.0	0.0	0		171.0	57.0	0.333333	NM_007178	B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Frame_Shift_Del	DEL	ENST00000419869.2	hg19	CCDS8676.1																																																																																			.	.	.	none		0.279	STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401114.1	NM_007178	
CEP170	9859	hgsc.bcm.edu	37	1	243319673	243319675	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-SX-A7SP-01A-11D-A34Z-10	TCGA-SX-A7SP-10A-01D-A34Z-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6abb591-8bba-4022-b736-659828bb3947	68027171-3c57-48ce-b796-f96345b1c177	g.chr1:243319673_243319675delTGT	ENST00000366542.1	-	14	3810_3812	c.3759_3761delACA	c.(3757-3762)aaacat>aat	p.1253_1254KH>N	CEP170_ENST00000366543.1_Intron|CEP170_ENST00000490813.1_Intron|CEP170_ENST00000481987.1_5'UTR|CEP170_ENST00000366544.1_In_Frame_Del_p.1155_1156KH>N	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	1253	Targeting to centrosomes.|Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TAGACGGGTATGTTTAGGGGAAT	0.419																																					p.1254_1254del		Atlas-Indel,Pindel	.											.	CEP170	153	.	0			c.3760_3762del						PASS	.																																			SO:0001651	inframe_deletion	9859	exon14			.	AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.3759_3761delACA	chr1.hg19:g.243319673_243319675delTGT	ENSP00000355500:p.Lys1253_His1254delinsAsn	105.0	0.0	0		119.0	37.0	0.310924	NM_014812	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	In_Frame_Del	DEL	ENST00000366542.1	hg19	CCDS44339.1																																																																																			.	.	.	none		0.419	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
