#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM51	55092	hgsc.bcm.edu	37	1	15545967	15545967	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:15545967C>T	ENST00000428417.1	+	3	936	c.490C>T	c.(490-492)Ctg>Ttg	p.L164L	TMEM51_ENST00000434578.2_3'UTR|TMEM51_ENST00000376014.3_Silent_p.L164L|TMEM51_ENST00000400796.3_Silent_p.L164L|TMEM51_ENST00000376008.2_Silent_p.L164L	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	164						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		CTATGAGTCACTGACGGGGCT	0.587																																					p.L164L		Atlas-SNP	.											.	TMEM51	28	.	0			c.C490T						PASS	.						79.0	78.0	79.0					1																	15545967		2203	4300	6503	SO:0001819	synonymous_variant	55092	exon3			GAGTCACTGACGG	AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.490C>T	chr1.hg19:g.15545967C>T		319.0	0.0	.		286.0	116.0	.	NM_018022	A8K819	Silent	SNP	ENST00000428417.1	hg19	CCDS154.1																																																																																			.	.	.	none		0.587	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
PRPF38B	55119	hgsc.bcm.edu	37	1	109235289	109235289	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:109235289C>A	ENST00000370025.4	+	1	345	c.76C>A	c.(76-78)Cag>Aag	p.Q26K	PRPF38B_ENST00000370021.1_5'UTR|PRPF38B_ENST00000370022.5_Missense_Mutation_p.Q26K|PRPF38B_ENST00000467302.1_3'UTR	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	26					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		ggctcagcaacagcagcagtg	0.672																																					p.Q26K		Atlas-SNP	.											.	PRPF38B	55	.	0			c.C76A						PASS	.						18.0	17.0	18.0					1																	109235289		2019	4001	6020	SO:0001583	missense	55119	exon1			CAGCAACAGCAGC	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.76C>A	chr1.hg19:g.109235289C>A	ENSP00000359042:p.Gln26Lys	98.0	0.0	.		102.0	47.0	.	NM_018061	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Missense_Mutation	SNP	ENST00000370025.4	hg19	CCDS788.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.853346	0.51270	.	.	ENSG00000134186	ENST00000370025;ENST00000370022	.	.	.	5.46	3.54	0.40534	.	0.326350	0.26241	N	0.025513	T	0.17746	0.0426	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08889	-1.0700	9	0.11182	T	0.66	.	10.7726	0.46332	0.1297:0.8012:0.0:0.0691	.	26	Q5VTL8	PR38B_HUMAN	K	26	.	ENSP00000359039:Q26K	Q	+	1	0	PRPF38B	109036812	1.000000	0.71417	0.998000	0.56505	0.640000	0.38277	2.843000	0.48238	1.271000	0.44313	0.462000	0.41574	CAG	.	.	.	none		0.672	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030231.1	NM_018061	
TOMM40L	84134	hgsc.bcm.edu	37	1	161197092	161197092	+	Silent	SNP	T	T	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:161197092T>C	ENST00000367988.3	+	4	497	c.228T>C	c.(226-228)taT>taC	p.Y76Y	TOMM40L_ENST00000545897.1_Silent_p.Y76Y|TOMM40L_ENST00000367987.1_Silent_p.Y76Y|NR1I3_ENST00000479324.1_5'Flank|MIR5187_ENST00000583479.1_RNA|TOMM40L_ENST00000474486.1_Intron	NM_032174.4	NP_115550.2	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)-like	76					ion transport (GO:0006811)|protein transport (GO:0015031)	mitochondrial outer membrane (GO:0005741)|pore complex (GO:0046930)|protein complex (GO:0043234)	porin activity (GO:0015288)			large_intestine(2)|liver(4)|lung(4)	10	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TGCCGGGATATCACCTCCATG	0.557											OREG0013943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y76Y		Atlas-SNP	.											.	TOMM40L	19	.	0			c.T228C						PASS	.						86.0	80.0	82.0					1																	161197092		2203	4300	6503	SO:0001819	synonymous_variant	84134	exon4			GGGATATCACCTC		CCDS1227.1, CCDS65700.1	1q23.3	2008-02-05	2007-01-12		ENSG00000158882	ENSG00000158882			25756	protein-coding gene	gene with protein product			"""translocase of outer mitochondrial membrane 40 homolog-like (yeast)"""				Standard	NM_032174		Approved	FLJ12770, TOMM40B	uc001fzd.3	Q969M1	OTTHUMG00000034345	ENST00000367988.3:c.228T>C	chr1.hg19:g.161197092T>C		152.0	0.0	.	1814	160.0	79.0	.	NM_032174	B7Z4U0|D3DVG9	Silent	SNP	ENST00000367988.3	hg19	CCDS1227.1																																																																																			.	.	.	none		0.557	TOMM40L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083029.1	NM_032174	
FCRLB	127943	hgsc.bcm.edu	37	1	161695843	161695843	+	Silent	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:161695843C>A	ENST00000367948.2	+	6	755	c.540C>A	c.(538-540)ccC>ccA	p.P180P	FCRLB_ENST00000336830.5_Silent_p.P180P|FCRLB_ENST00000495397.1_3'UTR|FCRLB_ENST00000367944.3_Silent_p.P173P|FCRLB_ENST00000367946.3_Silent_p.P180P|FCRLB_ENST00000392158.1_Silent_p.P180P|FCRLB_ENST00000367945.1_Silent_p.P173P			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	180	Ig-like C2-type 2.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			AGAGCGCGCCCATGTTCTCCG	0.632											OREG0013944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P180P		Atlas-SNP	.											.	FCRLB	35	.	0			c.C540A						PASS	.						35.0	37.0	36.0					1																	161695843		2203	4300	6503	SO:0001819	synonymous_variant	127943	exon4			CGCGCCCATGTTC	AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.540C>A	chr1.hg19:g.161695843C>A		136.0	0.0	.	1818	145.0	70.0	.	NM_001002901	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Silent	SNP	ENST00000367948.2	hg19	CCDS30927.1																																																																																			.	.	.	none		0.632	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083585.1	NM_152378	
LHX4	89884	hgsc.bcm.edu	37	1	180243426	180243426	+	Silent	SNP	A	A	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:180243426A>G	ENST00000263726.2	+	6	1129	c.885A>G	c.(883-885)acA>acG	p.T295T	RP5-1180C10.2_ENST00000415414.1_RNA|RP5-1180C10.2_ENST00000440959.2_RNA	NM_033343.3	NP_203129.1	Q969G2	LHX4_HUMAN	LIM homeobox 4	295					medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)	16						TGGACGGGACAGGACAATCCT	0.527																																					p.T295T		Atlas-SNP	.											.	LHX4	36	.	0			c.A885G						PASS	.						128.0	114.0	119.0					1																	180243426		2203	4300	6503	SO:0001819	synonymous_variant	89884	exon6			CGGGACAGGACAA	AB037683	CCDS1338.1	1q25.3	2011-06-20			ENSG00000121454	ENSG00000121454		"""Homeoboxes / LIM class"""	21734	protein-coding gene	gene with protein product		602146				11844481, 11567216	Standard	NM_033343		Approved	Gsh4	uc001goe.2	Q969G2	OTTHUMG00000035115	ENST00000263726.2:c.885A>G	chr1.hg19:g.180243426A>G		643.0	0.0	.		615.0	35.0	.	NM_033343	Q8NHE0|Q8NHM1|Q8TCJ1|Q8WWX2|Q969W2	Silent	SNP	ENST00000263726.2	hg19	CCDS1338.1																																																																																			.	.	.	none		0.527	LHX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084995.2	NM_033343	
ABCB10	23456	hgsc.bcm.edu	37	1	229685017	229685017	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:229685017C>T	ENST00000344517.4	-	2	724	c.682G>A	c.(682-684)Gcc>Acc	p.A228T	RNA5SP78_ENST00000364622.1_RNA	NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	228	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				ATGGCATTGGCGGCAGCACCA	0.522																																					p.A228T		Atlas-SNP	.											.	ABCB10	71	.	0			c.G682A						PASS	.						99.0	89.0	92.0					1																	229685017		2203	4300	6503	SO:0001583	missense	23456	exon2			CATTGGCGGCAGC	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.682G>A	chr1.hg19:g.229685017C>T	ENSP00000355637:p.Ala228Thr	183.0	0.0	.		143.0	58.0	.	NM_012089	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	ENST00000344517.4	hg19	CCDS1580.1	.	.	.	.	.	.	.	.	.	.	C	34	5.382531	0.95967	.	.	ENSG00000135776	ENST00000344517	D	0.89050	-2.46	5.62	5.62	0.85841	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.92299	0.7557	M	0.71871	2.18	0.80722	D	1	D	0.60575	0.988	P	0.52823	0.71	D	0.92507	0.6013	10	0.59425	D	0.04	-22.1817	19.6592	0.95857	0.0:1.0:0.0:0.0	.	228	Q9NRK6	ABCBA_HUMAN	T	228	ENSP00000355637:A228T	ENSP00000355637:A228T	A	-	1	0	ABCB10	227751640	1.000000	0.71417	0.817000	0.32601	0.547000	0.35210	5.749000	0.68704	2.653000	0.90120	0.655000	0.94253	GCC	.	.	.	none		0.522	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089	
RGS7	6000	hgsc.bcm.edu	37	1	240978050	240978050	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:240978050T>C	ENST00000407727.1	-	11	810	c.811A>G	c.(811-813)Aga>Gga	p.R271G	RGS7_ENST00000348120.2_Missense_Mutation_p.R218G|RGS7_ENST00000331110.7_Missense_Mutation_p.R245G|RGS7_ENST00000446183.2_Missense_Mutation_p.R187G|RGS7_ENST00000366565.1_Missense_Mutation_p.R271G|RGS7_ENST00000401882.1_Missense_Mutation_p.R218G|RGS7_ENST00000366562.4_Missense_Mutation_p.R271G|RGS7_ENST00000366563.1_Missense_Mutation_p.R271G|RGS7_ENST00000366564.1_Missense_Mutation_p.R271G			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	271	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			AACCGATGTCTATCTAACTGT	0.289																																					p.R271G		Atlas-SNP	.											.	RGS7	308	.	0			c.A811G						PASS	.						107.0	112.0	110.0					1																	240978050		2202	4298	6500	SO:0001583	missense	6000	exon12			GATGTCTATCTAA	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.811A>G	chr1.hg19:g.240978050T>C	ENSP00000384428:p.Arg271Gly	68.0	0.0	.		47.0	19.0	.	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	hg19		.	.	.	.	.	.	.	.	.	.	T	19.36	3.812134	0.70797	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	6.06	4.87	0.63330	G-protein gamma domain (4);	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	M	0.80616	2.505	0.54753	D	0.999984	D;D;D;D;D;P;D	0.71674	0.998;0.993;0.996;0.998;0.991;0.859;0.993	D;D;D;D;D;P;D	0.73708	0.981;0.964;0.966;0.967;0.939;0.681;0.964	T	0.59920	-0.7363	10	0.72032	D	0.01	-4.1718	11.3806	0.49754	0.0:0.0:0.272:0.728	.	187;245;218;271;271;271;271	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	G	245;271;271;271;102;218;187;271;271;218	ENSP00000331485:R245G;ENSP00000355523:R271G;ENSP00000355522:R271G;ENSP00000355521:R271G;ENSP00000404399:R102G;ENSP00000341242:R218G;ENSP00000390138:R187G;ENSP00000355520:R271G;ENSP00000384428:R271G;ENSP00000385508:R218G	ENSP00000331485:R245G	R	-	1	2	RGS7	239044673	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.064000	0.41432	2.324000	0.78689	0.533000	0.62120	AGA	.	.	.	none		0.289	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
OR2C3	81472	hgsc.bcm.edu	37	1	247695079	247695079	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr1:247695079G>T	ENST00000366487.3	-	2	1096	c.735C>A	c.(733-735)caC>caA	p.H245Q	GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527084.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CCACAGCCACGTGGGAAGAAC	0.547																																					p.H245Q		Atlas-SNP	.											.	OR2C3	92	.	0			c.C735A						PASS	.						131.0	119.0	123.0					1																	247695079		2203	4300	6503	SO:0001583	missense	81472	exon2			AGCCACGTGGGAA	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.735C>A	chr1.hg19:g.247695079G>T	ENSP00000355443:p.His245Gln	194.0	0.0	.		192.0	97.0	.	NM_198074	Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	hg19	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846827	0.32606	.	.	ENSG00000196242	ENST00000366487	T	0.00307	8.17	3.75	-2.12	0.07165	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37483	U	0.002072	T	0.00845	0.0028	H	0.97023	3.925	0.18873	N	0.999989	D	0.89917	1.0	D	0.81914	0.995	T	0.20739	-1.0266	10	0.87932	D	0	.	9.1023	0.36676	0.6294:0.0:0.3706:0.0	.	245	Q8N628	OR2C3_HUMAN	Q	245	ENSP00000355443:H245Q	ENSP00000355443:H245Q	H	-	3	2	OR2C3	245761702	0.280000	0.24249	0.237000	0.24090	0.318000	0.28184	0.023000	0.13533	-0.600000	0.05790	0.650000	0.86243	CAC	.	.	.	none		0.547	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074	
TMEM178A	130733	hgsc.bcm.edu	37	2	39934204	39934204	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr2:39934204C>T	ENST00000281961.2	+	3	586	c.530C>T	c.(529-531)aCt>aTt	p.T177I	TMEM178A_ENST00000482239.1_3'UTR	NM_152390.2	NP_689603.2	Q8NBL3	T178A_HUMAN	transmembrane protein 178A	177						integral component of membrane (GO:0016021)											AGAAGAATCACTGCTGGCTTC	0.463																																					p.T177I		Atlas-SNP	.											.	.	.	.	0			c.C530T						PASS	.						81.0	74.0	77.0					2																	39934204		2203	4300	6503	SO:0001583	missense	130733	exon3			GAATCACTGCTGG	BC029530	CCDS1804.1	2p22.1	2012-06-29	2012-06-29	2012-06-29	ENSG00000152154	ENSG00000152154			28517	protein-coding gene	gene with protein product			"""transmembrane protein 178"""	TMEM178		12975309	Standard	NM_001167959		Approved	MGC33926	uc002rrt.3	Q8NBL3	OTTHUMG00000128591	ENST00000281961.2:c.530C>T	chr2.hg19:g.39934204C>T	ENSP00000281961:p.Thr177Ile	108.0	0.0	.		81.0	34.0	.	NM_152390	Q6UWI6|Q8N6N4	Missense_Mutation	SNP	ENST00000281961.2	hg19	CCDS1804.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713634	0.89112	.	.	ENSG00000152154	ENST00000281961	T	0.69926	-0.44	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.80529	0.4640	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.80621	-0.1301	9	.	.	.	-10.8653	16.2261	0.82293	0.0:1.0:0.0:0.0	.	177	Q8NBL3	TM178_HUMAN	I	177	ENSP00000281961:T177I	.	T	+	2	0	TMEM178	39787708	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	6.942000	0.75928	2.437000	0.82529	0.655000	0.94253	ACT	.	.	.	none		0.463	TMEM178A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250445.2	NM_152390	
MSH2	4436	hgsc.bcm.edu	37	2	47641475	47641475	+	Missense_Mutation	SNP	G	G	C	rs587782567		TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr2:47641475G>C	ENST00000233146.2	+	5	1083	c.860G>C	c.(859-861)gGa>gCa	p.G287A	MSH2_ENST00000543555.1_Missense_Mutation_p.G221A|MSH2_ENST00000406134.1_Missense_Mutation_p.G287A	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	287			Missing (in HNPCC1). {ECO:0000269|PubMed:9718327}.		ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCCAACTTTGGACAGTTTGAA	0.323			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.G287A		Atlas-SNP	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	.	MSH2	198	.	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	c.G860C						PASS	.						69.0	68.0	68.0					2																	47641475		2203	4298	6501	SO:0001583	missense	4436	exon5	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	ACTTTGGACAGTT	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.860G>C	chr2.hg19:g.47641475G>C	ENSP00000233146:p.Gly287Ala	216.0	0.0	.		196.0	69.0	.	NM_000251	B4E2Z2|O75488	Missense_Mutation	SNP	ENST00000233146.2	hg19	CCDS1834.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085776	0.76642	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000453755;ENST00000448533;ENST00000394792	D;D;D	0.92858	-3.12;-3.12;-3.12	5.14	4.27	0.50696	DNA mismatch repair protein MutS, connector (1);	0.135085	0.52532	D	0.000064	D	0.96439	0.8838	M	0.92555	3.32	0.58432	D	0.999999	D;D;D	0.65815	0.977;0.987;0.995	P;P;D	0.64321	0.565;0.86;0.924	D	0.96993	0.9723	10	0.87932	D	0	-11.4068	13.6716	0.62430	0.075:0.0:0.925:0.0	.	287;287;287	E7EQQ1;E9PHA6;P43246	.;.;MSH2_HUMAN	A	287;221;287;287;287;287;287;287	ENSP00000233146:G287A;ENSP00000442697:G221A;ENSP00000384199:G287A	ENSP00000233146:G287A	G	+	2	0	MSH2	47494979	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	4.225000	0.58600	1.179000	0.42884	0.591000	0.81541	GGA	.	.	.	none		0.323	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3		
ZNF638	27332	hgsc.bcm.edu	37	2	71661907	71661907	+	Silent	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr2:71661907G>A	ENST00000409544.1	+	28	6537	c.5907G>A	c.(5905-5907)caG>caA	p.Q1969Q	ZNF638_ENST00000355812.3_3'UTR|ZNF638_ENST00000264447.4_Silent_p.Q1969Q|ZNF638_ENST00000409407.1_Silent_p.Q909Q	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1969					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AAAAGGAGCAGAATGAGGCTG	0.338																																					p.Q1969Q		Atlas-SNP	.											.	ZNF638	179	.	0			c.G5907A						PASS	.						72.0	85.0	80.0					2																	71661907		2203	4300	6503	SO:0001819	synonymous_variant	27332	exon28			GGAGCAGAATGAG	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5907G>A	chr2.hg19:g.71661907G>A		507.0	0.0	.		436.0	192.0	.	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	ENST00000409544.1	hg19	CCDS1917.1																																																																																			.	.	.	none		0.338	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
IWS1	55677	hgsc.bcm.edu	37	2	128262338	128262338	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr2:128262338C>A	ENST00000295321.4	-	3	1400	c.1141G>T	c.(1141-1143)Gaa>Taa	p.E381*	IWS1_ENST00000455721.2_Nonsense_Mutation_p.E388*|AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000486662.1_5'Flank	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	381	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CCCTCTTTTTCATCTTCATCA	0.418																																					p.E381X		Atlas-SNP	.											.	IWS1	61	.	0			c.G1141T						PASS	.						319.0	320.0	319.0					2																	128262338		2203	4300	6503	SO:0001587	stop_gained	55677	exon3			CTTTTTCATCTTC	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1141G>T	chr2.hg19:g.128262338C>A	ENSP00000295321:p.Glu381*	116.0	0.0	.		92.0	8.0	.	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Nonsense_Mutation	SNP	ENST00000295321.4	hg19	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	C	33	5.266173	0.95399	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721	.	.	.	5.58	5.58	0.84498	.	0.258394	0.39687	N	0.001284	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-16.8485	14.4121	0.67121	0.1475:0.8525:0.0:0.0	.	.	.	.	X	381;334;388	.	ENSP00000295321:E381X	E	-	1	0	IWS1	127978808	0.953000	0.32496	0.997000	0.53966	0.091000	0.18340	2.826000	0.48104	2.617000	0.88574	0.563000	0.77884	GAA	.	.	.	none		0.418	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
MZT2A	653784	hgsc.bcm.edu	37	2	132249824	132249824	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr2:132249824C>T	ENST00000309451.6	-	1	171	c.126G>A	c.(124-126)gaG>gaA	p.E42E	MZT2A_ENST00000410036.2_Intron|MIR4784_ENST00000579560.1_RNA|AC093838.4_ENST00000438378.2_RNA	NM_001085365.1	NP_001078834.1	Q6P582	MZT2A_HUMAN	mitotic spindle organizing protein 2A	42				EEMELYELAQAAGGGIDPDVFK -> LQGGGRAGRRGLTGP ASVPAR (in Ref. 2; AAI04651). {ECO:0000305}.		centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				breast(1)|lung(1)	2						CCTGAGCCAGCTCGTACAGCT	0.741																																					p.E42E		Atlas-SNP	.											.	MZT2A	6	.	0			c.G126A						PASS	.						8.0	13.0	11.0					2																	132249824		2150	4263	6413	SO:0001819	synonymous_variant	653784	exon1			AGCCAGCTCGTAC	BC018206	CCDS42758.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000173272	ENSG00000173272			33187	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A"""	613449	"""family with sequence similarity 128, member A"""	FAM128A		20360068	Standard	NM_001085365		Approved	MOZART2A	uc002tsw.4	Q6P582	OTTHUMG00000153606	ENST00000309451.6:c.126G>A	chr2.hg19:g.132249824C>T		47.0	0.0	.		43.0	11.0	.	NM_001085365	Q3SWV8|Q8WVB2	Silent	SNP	ENST00000309451.6	hg19	CCDS42758.1																																																																																			.	.	.	none		0.741	MZT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331811.2		
FZD5	7855	hgsc.bcm.edu	37	2	208633223	208633223	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr2:208633223C>T	ENST00000295417.3	-	2	794	c.241G>A	c.(241-243)Gac>Aac	p.D81N		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	81	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		AAGCGCAGGTCCGGCGAGCAT	0.652																																					p.D81N		Atlas-SNP	.											.	FZD5	22	.	0			c.G241A						PASS	.						81.0	69.0	73.0					2																	208633223		2203	4300	6503	SO:0001583	missense	7855	exon2			GCAGGTCCGGCGA	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.241G>A	chr2.hg19:g.208633223C>T	ENSP00000354607:p.Asp81Asn	54.0	0.0	.		74.0	35.0	.	NM_003468	A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	ENST00000295417.3	hg19	CCDS33366.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612375	0.87258	.	.	ENSG00000163251	ENST00000295417	T	0.75938	-0.98	4.61	4.61	0.57282	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.86339	0.5909	M	0.82517	2.595	0.80722	D	1	D	0.61697	0.99	D	0.65323	0.934	D	0.89078	0.3474	10	0.87932	D	0	.	17.0784	0.86592	0.0:1.0:0.0:0.0	.	81	Q13467	FZD5_HUMAN	N	81	ENSP00000354607:D81N	ENSP00000354607:D81N	D	-	1	0	FZD5	208341468	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	4.046000	0.57376	2.126000	0.65437	0.561000	0.74099	GAC	.	.	.	none		0.652	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1	NM_003468	
CLASP2	23122	hgsc.bcm.edu	37	3	33557518	33557518	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr3:33557518C>A	ENST00000468888.2	-	36	4177	c.4131G>T	c.(4129-4131)aaG>aaT	p.K1377N	CLASP2_ENST00000480013.1_Missense_Mutation_p.K1156N|CLASP2_ENST00000461133.3_Missense_Mutation_p.K1136N|CLASP2_ENST00000359576.5_Missense_Mutation_p.K1368N|CLASP2_ENST00000307312.7_Missense_Mutation_p.K858N|CLASP2_ENST00000539981.1_3'UTR|CLASP2_ENST00000399362.4_Missense_Mutation_p.K1376N			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1157					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						AACTTACCTCCTTATGAGGAT	0.323																																					p.K1378N		Atlas-SNP	.											.	CLASP2	138	.	0			c.G4134T						PASS	.						104.0	98.0	100.0					3																	33557518		1834	4083	5917	SO:0001583	missense	23122	exon36			TACCTCCTTATGA	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.4131G>T	chr3.hg19:g.33557518C>A	ENSP00000419974:p.Lys1377Asn	76.0	0.0	.		115.0	50.0	.	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.28|17.28	3.350574|3.350574	0.61183|0.61183	.|.	.|.	ENSG00000163539|ENSG00000163539	ENST00000487553|ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000480013;ENST00000461133	.|T;T;T;T;T;T	.|0.65732	.|-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.56|5.56	0.42|0.42	0.16444|0.16444	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.74496	.|0.3724	M|M	0.77616|0.77616	2.38|2.38	0.58432|0.58432	D|D	0.999991|0.999991	.|D;D	.|0.89917	.|1.0;0.976	.|D;D	.|0.83275	.|0.996;0.93	.|T	.|0.71593	.|-0.4546	.|10	.|0.37606	.|T	.|0.19	-10.8924|-10.8924	10.4753|10.4753	0.44661|0.44661	0.0:0.5725:0.0:0.4275|0.0:0.5725:0.0:0.4275	.|.	.|1368;1376	.|F5H604;E7ERI8	.|.;.	X|N	152|1377;1376;1368;858;1156;1136	.|ENSP00000419974:K1377N;ENSP00000382297:K1376N;ENSP00000352581:K1368N;ENSP00000304743:K858N;ENSP00000417518:K1156N;ENSP00000419305:K1136N	.|ENSP00000304743:K858N	G|K	-|-	1|3	0|2	CLASP2|CLASP2	33532522|33532522	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	0.692000|0.692000	0.25482|0.25482	0.130000|0.130000	0.18549|0.18549	-0.251000|-0.251000	0.11542|0.11542	GGA|AAG	.	.	.	none		0.323	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
GLYCTK	132158	hgsc.bcm.edu	37	3	52325107	52325107	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr3:52325107T>C	ENST00000436784.2	+	3	569	c.509T>C	c.(508-510)cTg>cCg	p.L170P	GLYCTK_ENST00000471180.1_Missense_Mutation_p.L43P|GLYCTK_ENST00000354773.4_Missense_Mutation_p.L170P|GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000461183.1_Missense_Mutation_p.L86P|GLYCTK_ENST00000477382.1_Missense_Mutation_p.L170P|GLYCTK_ENST00000473032.1_Missense_Mutation_p.L170P|GLYCTK_ENST00000305690.8_Missense_Mutation_p.L170P			Q8IVS8	GLCTK_HUMAN	glycerate kinase	170			L -> V (in dbSNP:rs35130772).		protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		GCTGATGACCTGCTGCTCGTG	0.607																																					p.L170P		Atlas-SNP	.											.	GLYCTK	30	.	0			c.T509C						PASS	.						75.0	55.0	62.0					3																	52325107		2203	4300	6503	SO:0001583	missense	132158	exon3			ATGACCTGCTGCT		CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.509T>C	chr3.hg19:g.52325107T>C	ENSP00000389175:p.Leu170Pro	25.0	0.0	.		37.0	10.0	.	NM_001144951	Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Missense_Mutation	SNP	ENST00000436784.2	hg19	CCDS2852.1	.	.	.	.	.	.	.	.	.	.	T	18.53	3.643459	0.67244	.	.	ENSG00000168237	ENST00000461183;ENST00000473032;ENST00000305690;ENST00000354773;ENST00000471180;ENST00000436784;ENST00000477382	T;T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59;0.59	5.29	4.1	0.47936	.	0.082341	0.52532	D	0.000075	T	0.70150	0.3191	M	0.74467	2.265	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.993	D;D;P	0.80764	0.994;0.991;0.906	T	0.71941	-0.4440	10	0.62326	D	0.03	-7.0727	12.2235	0.54447	0.0:0.0:0.1428:0.8572	.	170;170;170	Q8IVS8-2;Q8IVS8-4;Q8IVS8	.;.;GLCTK_HUMAN	P	86;170;170;170;43;170;170	ENSP00000417264:L86P;ENSP00000418951:L170P;ENSP00000301965:L170P;ENSP00000346825:L170P;ENSP00000417526:L43P;ENSP00000389175:L170P;ENSP00000419008:L170P	ENSP00000301965:L170P	L	+	2	0	GLYCTK	52300147	1.000000	0.71417	0.989000	0.46669	0.848000	0.48234	7.489000	0.81451	0.813000	0.34350	0.533000	0.62120	CTG	.	.	.	none		0.607	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350835.1	NM_145262	
ZIC1	7545	hgsc.bcm.edu	37	3	147128271	147128272	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr3:147128271_147128272GG>TT	ENST00000282928.4	+	1	1101_1102	c.372_373GG>TT	c.(370-375)tcGGcc>tcTTcc	p.A125S		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	125					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S124S(1)		central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						TTGCTGCATCGGCCGGGGGCTT	0.713																																					p.S124S|p.A125S		Atlas-SNP	.											ZIC1,NS,carcinoma,0,1|.	ZIC1	141	.	1	Substitution - coding silent(1)	lung(1)	c.G372T|c.G373T						PASS	.																																			SO:0001583	missense	7545	exon1			TGCATCGGCCGGG|GCATCGGCCGGGG	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	Exception_encountered	chr3.hg19:g.147128271_147128272delinsTT	ENSP00000282928:p.Ala125Ser	112.0	0.0	.		148.0|151.0	92.0|95.0	.	NM_003412	Q2M3N1	Silent|Missense_Mutation	SNP	ENST00000282928.4	hg19	CCDS3136.1																																																																																			.	.	.	none		0.713	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
ECT2	1894	hgsc.bcm.edu	37	3	172533501	172533501	+	Splice_Site	SNP	G	G	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr3:172533501G>C	ENST00000392692.3	+	23	2684	c.2508G>C	c.(2506-2508)aaG>aaC	p.K836N	ECT2_ENST00000417960.1_Splice_Site_p.K804N|ECT2_ENST00000232458.5_Splice_Site_p.K805N|ECT2_ENST00000427830.1_Splice_Site_p.K805N|ECT2_ENST00000441497.2_Splice_Site_p.K805N|ECT2_ENST00000540509.1_Splice_Site_p.K836N	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	836					activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			CTTCAAAAAAGGTGAGTTTTA	0.289																																					p.K836N		Atlas-SNP	.											.	ECT2	79	.	0			c.G2508C						PASS	.						58.0	64.0	62.0					3																	172533501		2199	4284	6483	SO:0001630	splice_region_variant	1894	exon23			AAAAAAGGTGAGT	AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.2508+1G>C	chr3.hg19:g.172533501G>C		460.0	0.0	.		467.0	269.0	.	NM_001258315	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	hg19	CCDS58860.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.053607|4.053607	0.75960|0.75960	.|.	.|.	ENSG00000114346|ENSG00000114346	ENST00000437296|ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	.|T;T;T;T;T;T	.|0.72615	.|-0.6;-0.66;-0.67;-0.6;-0.6;-0.66	5.54|5.54	4.66|4.66	0.58398|0.58398	.|.	.|0.174934	.|0.64402	.|D	.|0.000010	T|T	0.77471|0.77471	0.4135|0.4135	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|P;P;D;D;P	.|0.61697	.|0.929;0.875;0.99;0.99;0.923	.|P;P;D;D;P	.|0.66602	.|0.77;0.77;0.945;0.945;0.885	T|T	0.78809|0.78809	-0.2058|-0.2058	5|10	.|0.87932	.|D	.|0	-3.9212|-3.9212	10.3168|10.3168	0.43743|0.43743	0.1502:0.0:0.8498:0.0|0.1502:0.0:0.8498:0.0	.|.	.|836;281;836;805;804	.|Q9H8V3;Q96SJ9;Q9H8V3-3;G5E9L8;Q9H8V3-2	.|ECT2_HUMAN;.;.;.;.	R|N	176|805;836;805;804;805;836	.|ENSP00000232458:K805N;ENSP00000376457:K836N;ENSP00000401910:K805N;ENSP00000415876:K804N;ENSP00000412259:K805N;ENSP00000443160:K836N	.|ENSP00000232458:K805N	G|K	+|+	1|3	0|2	ECT2|ECT2	174016195|174016195	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.863000|0.863000	0.49368|0.49368	5.829000|5.829000	0.69316|0.69316	1.323000|1.323000	0.45263|0.45263	0.591000|0.591000	0.81541|0.81541	GGT|AAG	.	.	.	none		0.289	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098	Missense_Mutation
SHISA3	152573	hgsc.bcm.edu	37	4	42400234	42400234	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:42400234C>A	ENST00000319234.4	+	1	379	c.161C>A	c.(160-162)aCc>aAc	p.T54N		NM_001080505.1	NP_001073974.1	A0PJX4	SHSA3_HUMAN	shisa family member 3	54					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	12						CTGGACGCTACCATCTGCTGC	0.692																																					p.T54N		Atlas-SNP	.											.	SHISA3	27	.	0			c.C161A						PASS	.						21.0	20.0	21.0					4																	42400234		2199	4297	6496	SO:0001583	missense	152573	exon1			ACGCTACCATCTG	BC012029	CCDS33979.1	4p13	2013-07-31	2013-07-31		ENSG00000178343	ENSG00000178343		"""Shisa homologs"""	25159	protein-coding gene	gene with protein product			"""shisa homolog 3 (Xenopus laevis)"""				Standard	NM_001080505		Approved	hShisa3	uc003gwp.3	A0PJX4	OTTHUMG00000161043	ENST00000319234.4:c.161C>A	chr4.hg19:g.42400234C>A	ENSP00000326445:p.Thr54Asn	120.0	0.0	.		160.0	8.0	.	NM_001080505	A0PJX3|Q96EQ5	Missense_Mutation	SNP	ENST00000319234.4	hg19	CCDS33979.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615227	0.28801	.	.	ENSG00000178343	ENST00000319234	T	0.42900	0.96	4.22	3.36	0.38483	.	0.156200	0.40144	N	0.001169	T	0.32941	0.0846	L	0.39898	1.24	0.47621	D	0.999473	B	0.17667	0.023	B	0.21708	0.036	T	0.07908	-1.0748	10	0.16896	T	0.51	-9.6593	12.9256	0.58258	0.164:0.8359:0.0:0.0	.	54	A0PJX4	SHSA3_HUMAN	N	54	ENSP00000326445:T54N	ENSP00000326445:T54N	T	+	2	0	SHISA3	42094991	0.998000	0.40836	1.000000	0.80357	0.290000	0.27261	3.071000	0.50041	0.943000	0.37553	0.467000	0.42956	ACC	.	.	.	none		0.692	SHISA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363539.1	NM_001080505	
DDX60	55601	hgsc.bcm.edu	37	4	169204723	169204723	+	Silent	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:169204723C>A	ENST00000393743.3	-	13	1887	c.1596G>T	c.(1594-1596)gtG>gtT	p.V532V		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	532					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GATACTTTTGCACAGATCTAA	0.308																																					p.V532V		Atlas-SNP	.											.	DDX60	304	.	0			c.G1596T						PASS	.						58.0	61.0	60.0					4																	169204723		2203	4300	6503	SO:0001819	synonymous_variant	55601	exon13			CTTTTGCACAGAT	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1596G>T	chr4.hg19:g.169204723C>A		120.0	0.0	.		106.0	34.0	.	NM_017631	Q6PK35|Q9NVE3	Silent	SNP	ENST00000393743.3	hg19	CCDS34097.1																																																																																			.	.	.	none		0.308	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
DDX60	55601	hgsc.bcm.edu	37	4	169204739	169204739	+	Missense_Mutation	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:169204739C>T	ENST00000393743.3	-	13	1871	c.1580G>A	c.(1579-1581)cGt>cAt	p.R527H		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	527					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TCTAAGAACACGAGGGTCTCT	0.313																																					p.R527H		Atlas-SNP	.											.	DDX60	304	.	0			c.G1580A						PASS	.						52.0	54.0	53.0					4																	169204739		2203	4300	6503	SO:0001583	missense	55601	exon13			AGAACACGAGGGT	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1580G>A	chr4.hg19:g.169204739C>T	ENSP00000377344:p.Arg527His	108.0	0.0	.		87.0	28.0	.	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	hg19	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	4.070	0.010749	0.07912	.	.	ENSG00000137628	ENST00000393743	T	0.18174	2.23	3.89	-6.27	0.02026	.	1.776030	0.03004	N	0.148595	T	0.07818	0.0196	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.32745	-0.9895	10	0.11182	T	0.66	.	10.0525	0.42225	0.1034:0.2118:0.0:0.6847	.	527	Q8IY21	DDX60_HUMAN	H	527	ENSP00000377344:R527H	ENSP00000377344:R527H	R	-	2	0	DDX60	169441314	0.000000	0.05858	0.000000	0.03702	0.119000	0.20118	-2.385000	0.01062	-1.814000	0.01224	-0.261000	0.10672	CGT	.	.	.	none		0.313	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
GPX8	493869	hgsc.bcm.edu	37	5	54456223	54456223	+	Splice_Site	SNP	A	A	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr5:54456223A>G	ENST00000503787.1	+	1	278	c.203A>G	c.(202-204)aAa>aGa	p.K68R	GPX8_ENST00000296734.6_Splice_Site_p.K68R|CDC20B_ENST00000296733.1_Intron|CDC20B_ENST00000334206.5_Intron|CDC20B_ENST00000322374.6_Intron|GPX8_ENST00000515370.1_Intron|GPX8_ENST00000506123.1_3'UTR|CDC20B_ENST00000381375.2_Intron|CDC20B_ENST00000331730.3_Intron	NM_001008397.2	NP_001008398.2	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8 (putative)	68					response to oxidative stress (GO:0006979)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	glutathione peroxidase activity (GO:0004602)|peroxidase activity (GO:0004601)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)	11					Glutathione(DB00143)	TATAAAGGCAAAGTAAGTTGC	0.308																																					p.K68R		Atlas-SNP	.											.	GPX8	20	.	0			c.A203G						PASS	.						66.0	66.0	66.0					5																	54456223		2203	4300	6503	SO:0001630	splice_region_variant	493869	exon1			AAGGCAAAGTAAG	BC029424	CCDS34156.1	5q11.2	2008-09-29				ENSG00000164294			33100	protein-coding gene	gene with protein product							Standard	NM_001008397		Approved	UNQ847, EPLA847	uc003jpq.2	Q8TED1		ENST00000503787.1:c.204+1A>G	chr5.hg19:g.54456223A>G		142.0	0.0	.		158.0	93.0	.	NM_001008397		Missense_Mutation	SNP	ENST00000503787.1	hg19	CCDS34156.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.213873	0.79352	.	.	ENSG00000164294	ENST00000503787;ENST00000296734	T	0.06933	3.24	5.93	4.68	0.58851	Thioredoxin-like fold (2);	0.041745	0.85682	N	0.000000	T	0.14442	0.0349	M	0.80746	2.51	0.80722	D	1	B	0.16603	0.018	B	0.23716	0.048	T	0.01367	-1.1373	10	0.62326	D	0.03	.	10.1162	0.42591	0.9045:0.0:0.0955:0.0	.	68	Q8TED1	GPX8_HUMAN	R	68	ENSP00000423822:K68R	ENSP00000296734:K68R	K	+	2	0	GPX8	54491980	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.069000	0.57541	0.926000	0.37118	0.533000	0.62120	AAA	.	.	.	none		0.308	GPX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369717.1	NM_001008397	Missense_Mutation
THBS4	7060	hgsc.bcm.edu	37	5	79374755	79374755	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr5:79374755T>G	ENST00000350881.2	+	18	2467	c.2277T>G	c.(2275-2277)atT>atG	p.I759M	THBS4_ENST00000504720.1_3'UTR|THBS4_ENST00000511733.1_Missense_Mutation_p.I668M|CTD-2201I18.1_ENST00000503007.1_RNA|CTD-2201I18.1_ENST00000514042.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	759	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GCATGGAGATTGTACAGACCA	0.498																																					p.I759M		Atlas-SNP	.											.	THBS4	82	.	0			c.T2277G						PASS	.						115.0	103.0	107.0					5																	79374755		2203	4300	6503	SO:0001583	missense	7060	exon18			GGAGATTGTACAG		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.2277T>G	chr5.hg19:g.79374755T>G	ENSP00000339730:p.Ile759Met	95.0	0.0	.		83.0	21.0	.	NM_003248	B2R909|Q86TG2	Missense_Mutation	SNP	ENST00000350881.2	hg19	CCDS4049.1	.	.	.	.	.	.	.	.	.	.	T	18.52	3.641809	0.67244	.	.	ENSG00000113296	ENST00000350881;ENST00000511733	D;D	0.96522	-4.04;-4.04	5.06	-3.5	0.04710	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97617	0.9219	M	0.88450	2.955	0.58432	D	0.999993	D	0.76494	0.999	D	0.91635	0.999	D	0.96356	0.9262	10	0.87932	D	0	-21.232	11.3397	0.49525	0.0:0.3915:0.0:0.6085	.	759	P35443	TSP4_HUMAN	M	759;668	ENSP00000339730:I759M;ENSP00000422298:I668M	ENSP00000339730:I759M	I	+	3	3	THBS4	79410511	0.687000	0.27671	0.973000	0.42090	0.993000	0.82548	-0.279000	0.08479	-0.685000	0.05177	-0.256000	0.11100	ATT	.	.	.	none		0.498	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1		
PCDHGB2	56103	hgsc.bcm.edu	37	5	140742098	140742098	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr5:140742098C>A	ENST00000522605.1	+	1	2396	c.2396C>A	c.(2395-2397)cCt>cAt	p.P799H	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	799					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGGGTCCCTTTTGCCTCA	0.413																																					p.P799H		Atlas-SNP	.											.	PCDHGB2	196	.	0			c.C2396A						PASS	.						61.0	61.0	61.0					5																	140742098		1820	4083	5903	SO:0001583	missense	56103	exon1			GGGTCCCTTTTGC	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2396C>A	chr5.hg19:g.140742098C>A	ENSP00000429018:p.Pro799His	126.0	0.0	.		143.0	41.0	.	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	hg19	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	10.02	1.236268	0.22626	.	.	ENSG00000253910	ENST00000522605	T	0.50001	0.76	4.99	3.02	0.34903	.	.	.	.	.	T	0.35913	0.0948	N	0.14661	0.345	0.09310	N	1	D;P	0.54964	0.969;0.883	P;B	0.50970	0.655;0.346	T	0.08472	-1.0720	9	0.42905	T	0.14	.	5.6077	0.17389	0.1625:0.668:0.0:0.1694	.	799;799	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	H	799	ENSP00000429018:P799H	ENSP00000429018:P799H	P	+	2	0	PCDHGB2	140722282	0.000000	0.05858	0.008000	0.14137	0.084000	0.17831	0.900000	0.28431	2.301000	0.77427	0.467000	0.42956	CCT	.	.	.	none		0.413	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
EXOC2	55770	hgsc.bcm.edu	37	6	532588	532588	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr6:532588T>G	ENST00000230449.4	-	23	2396	c.2261A>C	c.(2260-2262)gAa>gCa	p.E754A	EXOC2_ENST00000448181.3_Missense_Mutation_p.E349A	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	754					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TTGATCTAGTTCTTTCAATGA	0.348																																					p.E754A		Atlas-SNP	.											.	EXOC2	81	.	0			c.A2261C						PASS	.						107.0	105.0	105.0					6																	532588		2203	4300	6503	SO:0001583	missense	55770	exon23			TCTAGTTCTTTCA	AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.2261A>C	chr6.hg19:g.532588T>G	ENSP00000230449:p.Glu754Ala	126.0	0.0	.		102.0	51.0	.	NM_018303	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	ENST00000230449.4	hg19	CCDS34327.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690808	0.48097	.	.	ENSG00000112685	ENST00000230449;ENST00000448181	T;T	0.24151	1.87;1.87	5.77	5.77	0.91146	.	0.147993	0.64402	D	0.000014	T	0.09905	0.0243	L	0.29908	0.895	0.58432	D	0.999993	B	0.11235	0.004	B	0.12837	0.008	T	0.11203	-1.0597	10	0.17832	T	0.49	-5.4577	16.383	0.83481	0.0:0.0:0.0:1.0	.	754	Q96KP1	EXOC2_HUMAN	A	754;349	ENSP00000230449:E754A;ENSP00000398113:E349A	ENSP00000230449:E754A	E	-	2	0	EXOC2	477588	1.000000	0.71417	0.992000	0.48379	0.979000	0.70002	4.771000	0.62318	2.326000	0.78906	0.533000	0.62120	GAA	.	.	.	none		0.348	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303	
DSP	1832	hgsc.bcm.edu	37	6	7578720	7578720	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr6:7578720C>T	ENST00000379802.3	+	22	3350	c.3009C>T	c.(3007-3009)taC>taT	p.Y1003Y	DSP_ENST00000418664.2_Silent_p.Y1003Y	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1003	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATGCTCGGTACATTGAACTAC	0.343																																					p.Y1003Y		Atlas-SNP	.											.	DSP	306	.	0			c.C3009T						PASS	.						140.0	143.0	142.0					6																	7578720		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon22			TCGGTACATTGAA	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3009C>T	chr6.hg19:g.7578720C>T		129.0	0.0	.		98.0	45.0	.	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.	.	none		0.343	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
PGC	5225	hgsc.bcm.edu	37	6	41712422	41712423	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr6:41712422_41712423TC>AG	ENST00000373025.3	-	2	245_246	c.183_184GA>CT	c.(181-186)gtGAcc>gtCTcc	p.T62S	PGC_ENST00000425343.2_Missense_Mutation_p.T62S	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	62					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GGCTCGTAGGTCACGCTGAGGT	0.579																																					p.T62S|p.V61V		Atlas-SNP	.											.	PGC	56	.	0			c.A184T|c.G183C						PASS	.																																			SO:0001583	missense	5225	exon2			CGTAGGTCACGCT|GTAGGTCACGCTG		CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.183_184delinsAG	chr6.hg19:g.41712422_41712423delinsAG	ENSP00000362116:p.Thr62Ser	103.0|104.0	0.0	.		97.0|98.0	54.0	.	NM_002630	B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation|Silent	SNP	ENST00000373025.3	hg19	CCDS4859.1																																																																																			.	.	.	none		0.579	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2		
EFHC1	114327	hgsc.bcm.edu	37	6	52357086	52357086	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr6:52357086C>G	ENST00000371068.5	+	11	1973	c.1870C>G	c.(1870-1872)Cat>Gat	p.H624D	EFHC1_ENST00000433625.2_Intron|EFHC1_ENST00000538167.1_Missense_Mutation_p.H605D	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	624						axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					GATGTGCTCTCATGGAGAAGG	0.423																																					p.H624D		Atlas-SNP	.											.	EFHC1	68	.	0			c.C1870G						PASS	.						120.0	102.0	108.0					6																	52357086		2203	4300	6503	SO:0001583	missense	114327	exon11			TGCTCTCATGGAG	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1870C>G	chr6.hg19:g.52357086C>G	ENSP00000360107:p.His624Asp	98.0	0.0	.		87.0	38.0	.	NM_018100	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	hg19	CCDS4942.1	.	.	.	.	.	.	.	.	.	.	C	9.168	1.020303	0.19433	.	.	ENSG00000096093	ENST00000371068;ENST00000538167	T;T	0.32023	1.47;1.47	4.72	3.84	0.44239	EF-hand-like domain (1);	0.490245	0.21349	N	0.075995	T	0.03608	0.0103	N	0.03000	-0.44	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.34030	-0.9845	10	0.07644	T	0.81	-10.9017	8.7093	0.34374	0.0:0.8961:0.0:0.1039	.	605;624	F5GZD8;Q5JVL4	.;EFHC1_HUMAN	D	624;605	ENSP00000360107:H624D;ENSP00000444521:H605D	ENSP00000360107:H624D	H	+	1	0	EFHC1	52465045	0.516000	0.26218	0.975000	0.42487	0.966000	0.64601	1.335000	0.33839	1.338000	0.45544	0.591000	0.81541	CAT	.	.	.	none		0.423	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100	
TINAG	27283	hgsc.bcm.edu	37	6	54216153	54216153	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr6:54216153A>T	ENST00000259782.4	+	8	1180	c.1084A>T	c.(1084-1086)Act>Tct	p.T362S		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	362					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			CATCCAGGAAACTGAGATAAT	0.313																																					p.T362S		Atlas-SNP	.											.	TINAG	102	.	0			c.A1084T						PASS	.						93.0	92.0	92.0					6																	54216153		2201	4297	6498	SO:0001583	missense	27283	exon8			CAGGAAACTGAGA	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1084A>T	chr6.hg19:g.54216153A>T	ENSP00000259782:p.Thr362Ser	111.0	0.0	.		75.0	37.0	.	NM_014464	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	hg19	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	A	14.71	2.617727	0.46736	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	D	0.83673	-1.75	5.08	5.08	0.68730	Peptidase C1A, papain C-terminal (2);	0.000000	0.64402	D	0.000003	T	0.63570	0.2522	L	0.28400	0.85	0.80722	D	1	P	0.36683	0.565	B	0.37015	0.239	T	0.65751	-0.6092	10	0.22706	T	0.39	.	13.9813	0.64306	1.0:0.0:0.0:0.0	.	362	Q9UJW2	TINAG_HUMAN	S	221;362;41	ENSP00000259782:T362S	ENSP00000259782:T362S	T	+	1	0	TINAG	54324112	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	6.953000	0.75995	2.021000	0.59480	0.533000	0.62120	ACT	.	.	.	none		0.313	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
USP42	84132	hgsc.bcm.edu	37	7	6196544	6196544	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr7:6196544C>T	ENST00000306177.5	+	16	3959	c.3801C>T	c.(3799-3801)gtC>gtT	p.V1267V		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	1267					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TGGAGACTGTCGCCCAGTTCC	0.498																																					p.V1267V		Atlas-SNP	.											.	USP42	138	.	0			c.C3801T						PASS	.						40.0	43.0	42.0					7																	6196544		1896	4116	6012	SO:0001819	synonymous_variant	84132	exon16			GACTGTCGCCCAG	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.3801C>T	chr7.hg19:g.6196544C>T		100.0	0.0	.		158.0	42.0	.	NM_032172	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	hg19	CCDS47535.1																																																																																			.	.	.	none		0.498	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
THSD7A	221981	hgsc.bcm.edu	37	7	11446609	11446609	+	Missense_Mutation	SNP	G	G	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr7:11446609G>C	ENST00000423059.4	-	21	4241	c.3990C>G	c.(3988-3990)gaC>gaG	p.D1330E	AC004160.4_ENST00000425837.1_RNA|AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1330	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GTTTGGACTGGTCCATCAGGG	0.493										HNSCC(18;0.044)																											p.D1330E		Atlas-SNP	.											.	THSD7A	219	.	0			c.C3990G						PASS	.						98.0	99.0	98.0					7																	11446609		1978	4160	6138	SO:0001583	missense	221981	exon20			GGACTGGTCCATC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3990C>G	chr7.hg19:g.11446609G>C	ENSP00000406482:p.Asp1330Glu	151.0	0.0	.		185.0	43.0	.	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	hg19	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493990	0.44352	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.50277	0.75	6.14	0.196	0.15159	.	0.140343	0.64402	N	0.000005	T	0.10766	0.0263	N	0.00456	-1.48	0.24800	N	0.992709	B	0.02656	0.0	B	0.01281	0.0	T	0.39603	-0.9606	10	0.02654	T	1	.	7.2032	0.25893	0.0:0.3728:0.191:0.4362	.	1330	Q9UPZ6	THS7A_HUMAN	E	1330	ENSP00000406482:D1330E	ENSP00000262042:D1330E	D	-	3	2	THSD7A	11413134	0.994000	0.37717	0.998000	0.56505	0.998000	0.95712	0.353000	0.20130	0.019000	0.15079	0.650000	0.86243	GAC	.	.	.	none		0.493	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
NFE2L3	9603	hgsc.bcm.edu	37	7	26224563	26224563	+	Silent	SNP	A	A	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr7:26224563A>T	ENST00000056233.3	+	4	1504	c.1245A>T	c.(1243-1245)ccA>ccT	p.P415P		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	415					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TTGATGAACCAGATTCTGATT	0.363																																					p.P415P		Atlas-SNP	.											.	NFE2L3	77	.	0			c.A1245T						PASS	.						95.0	101.0	99.0					7																	26224563		2203	4300	6503	SO:0001819	synonymous_variant	9603	exon4			TGAACCAGATTCT	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1245A>T	chr7.hg19:g.26224563A>T		71.0	0.0	.		102.0	28.0	.	NM_004289	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	ENST00000056233.3	hg19	CCDS5396.1																																																																																			.	.	.	none		0.363	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
CCDC146	57639	hgsc.bcm.edu	37	7	76922400	76922400	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr7:76922400C>T	ENST00000285871.4	+	18	2674	c.2547C>T	c.(2545-2547)ttC>ttT	p.F849F	CCDC146_ENST00000415740.2_3'UTR|CCDC146_ENST00000431197.1_Silent_p.F563F	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	849										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				ACTTCATCTTCACTTGCAATT	0.428																																					p.F849F		Atlas-SNP	.											.	CCDC146	87	.	0			c.C2547T						PASS	.						112.0	109.0	110.0					7																	76922400		2203	4300	6503	SO:0001819	synonymous_variant	57639	exon18			CATCTTCACTTGC	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.2547C>T	chr7.hg19:g.76922400C>T		98.0	0.0	.		131.0	41.0	.	NM_020879	A8K8X6|Q9P223	Silent	SNP	ENST00000285871.4	hg19	CCDS34671.1																																																																																			.	.	.	none		0.428	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
MET	4233	hgsc.bcm.edu	37	7	116417463	116417463	+	Missense_Mutation	SNP	C	C	T	rs121913244		TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr7:116417463C>T	ENST00000318493.6	+	16	3521	c.3334C>T	c.(3334-3336)Cat>Tat	p.H1112Y	MET_ENST00000397752.3_Missense_Mutation_p.H1094Y|MET_ENST00000539704.1_5'UTR			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H1112Y(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTGTGTATATCATGGGACTTT	0.343			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.H1112Y		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,colon,carcinoma,0,2	MET	412	.	1	Substitution - Missense(1)	kidney(1)	c.C3334T	GRCh37	CM993668	MET	M	rs121913244	PASS	.						188.0	175.0	179.0					7																	116417463		1832	4086	5918	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GTATATCATGGGA	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3334C>T	chr7.hg19:g.116417463C>T	ENSP00000317272:p.His1112Tyr	97.0	0.0	.		109.0	64.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615896	0.87359	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.33654	1.4;1.4	5.29	5.29	0.74685	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	N	0.11364	0.135	0.80722	D	1	P;D	0.89917	0.937;1.0	P;D	0.91635	0.854;0.999	T	0.52711	-0.8539	10	0.51188	T	0.08	-16.8984	19.2953	0.94119	0.0:1.0:0.0:0.0	.	1112;1094	P08581-2;P08581	.;MET_HUMAN	Y	1094;1112	ENSP00000380860:H1094Y;ENSP00000317272:H1112Y	ENSP00000317272:H1112Y	H	+	1	0	MET	116204699	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.628000	0.89032	0.655000	0.94253	CAT	.	.	.	weak		0.343	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
TTC39B	158219	hgsc.bcm.edu	37	9	15225959	15225959	+	Silent	SNP	A	A	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr9:15225959A>G	ENST00000512701.2	-	3	363	c.327T>C	c.(325-327)gaT>gaC	p.D109D	TTC39B_ENST00000355694.2_Silent_p.D43D|TTC39B_ENST00000582994.1_5'UTR|TTC39B_ENST00000507285.1_5'UTR|TTC39B_ENST00000380850.4_Silent_p.D109D|TTC39B_ENST00000541445.1_Silent_p.D43D|TTC39B_ENST00000297615.5_Intron|TTC39B_ENST00000507993.1_Intron			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	109										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						CCTGTTGTGTATCACATGATG	0.502																																					p.D109D		Atlas-SNP	.											.	TTC39B	83	.	0			c.T327C						PASS	.						125.0	114.0	118.0					9																	15225959		2203	4300	6503	SO:0001819	synonymous_variant	158219	exon3			TTGTGTATCACAT	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.327T>C	chr9.hg19:g.15225959A>G		64.0	0.0	.		60.0	25.0	.	NM_001168340	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Silent	SNP	ENST00000512701.2	hg19	CCDS6477.2																																																																																			.	.	.	none		0.502	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051758.3	NM_152574	
SLC31A1	1317	hgsc.bcm.edu	37	9	116021053	116021053	+	Silent	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr9:116021053G>A	ENST00000374212.4	+	4	434	c.282G>A	c.(280-282)ctG>ctA	p.L94L	CDC26_ENST00000490408.1_Intron|SLC31A1_ENST00000374210.6_Silent_p.L94L	NM_001859.3	NP_001850.1	O15431	COPT1_HUMAN	solute carrier family 31 (copper transporter), member 1	94					cellular copper ion homeostasis (GO:0006878)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)|copper uptake transmembrane transporter activity (GO:0015088)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7					Bortezomib(DB00188)|Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AGAGCCTGCTGCGTAAGTCAC	0.443																																					p.L94L	Ovarian(135;1049 1799 4519 17564 28677)	Atlas-SNP	.											.	SLC31A1	12	.	0			c.G282A						PASS	.						156.0	138.0	144.0					9																	116021053		2203	4300	6503	SO:0001819	synonymous_variant	1317	exon4			CCTGCTGCGTAAG	U83460	CCDS6789.1	9q32	2013-07-17	2013-07-17		ENSG00000136868	ENSG00000136868		"""Solute carriers"""	11016	protein-coding gene	gene with protein product	copper transport 1 homolog (S. cerevisiae)	603085		COPT1		9207117	Standard	NM_001859		Approved	hCTR1, CTR1	uc004bgu.3	O15431	OTTHUMG00000020519	ENST00000374212.4:c.282G>A	chr9.hg19:g.116021053G>A		87.0	0.0	.		89.0	34.0	.	NM_001859	A8K8Z6|Q53GR5|Q5T1M4	Silent	SNP	ENST00000374212.4	hg19	CCDS6789.1																																																																																			.	.	.	none		0.443	SLC31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053715.1	NM_001859	
SDCCAG3	10807	hgsc.bcm.edu	37	9	139304610	139304610	+	Missense_Mutation	SNP	A	A	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr9:139304610A>T	ENST00000357365.3	-	2	281	c.152T>A	c.(151-153)tTc>tAc	p.F51Y	SDCCAG3_ENST00000298537.7_Missense_Mutation_p.F51Y|PMPCA_ENST00000399219.3_5'Flank|PMPCA_ENST00000371720.1_5'Flank|SDCCAG3_ENST00000371725.3_Intron|PMPCA_ENST00000371717.3_5'Flank	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	51						cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		AATGCcgaagaagggggagtc	0.647																																					p.F51Y		Atlas-SNP	.											.	SDCCAG3	41	.	0			c.T152A						PASS	.						19.0	26.0	24.0					9																	139304610		1922	4116	6038	SO:0001583	missense	10807	exon2			CCGAAGAAGGGGG	AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.152T>A	chr9.hg19:g.139304610A>T	ENSP00000349929:p.Phe51Tyr	161.0	0.0	.		117.0	57.0	.	NM_001039707	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Missense_Mutation	SNP	ENST00000357365.3	hg19	CCDS43904.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.784140	0.49997	.	.	ENSG00000165689	ENST00000357365;ENST00000298537	T;T	0.16196	2.45;2.36	3.11	1.93	0.25924	.	.	.	.	.	T	0.11537	0.0281	L	0.44542	1.39	0.80722	D	1	B;B	0.33238	0.403;0.378	B;B	0.32465	0.06;0.146	T	0.13522	-1.0506	9	0.15066	T	0.55	-12.2273	5.5118	0.16884	0.7535:0.0:0.0:0.2465	.	51;51	Q96C92-2;Q96C92	.;SDCG3_HUMAN	Y	51	ENSP00000349929:F51Y;ENSP00000298537:F51Y	ENSP00000298537:F51Y	F	-	2	0	SDCCAG3	138424431	0.955000	0.32602	0.989000	0.46669	0.963000	0.63663	1.092000	0.30927	0.543000	0.28864	0.533000	0.62120	TTC	.	.	.	none		0.647	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055060.2	NM_006643	
ABCA2	20	hgsc.bcm.edu	37	9	139905075	139905075	+	Silent	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr9:139905075G>A	ENST00000371605.3	-	39	6315	c.6168C>T	c.(6166-6168)acC>acT	p.T2056T	ABCA2_ENST00000341511.6_Silent_p.T2057T|ABCA2_ENST00000265662.5_Silent_p.T2057T			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	2056	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGCCCACCTTGGTCAGGTTCT	0.667																																					p.T2087T		Atlas-SNP	.											.	ABCA2	113	.	0			c.C6261T						PASS	.						99.0	102.0	101.0					9																	139905075		2039	4181	6220	SO:0001819	synonymous_variant	20	exon40			CACCTTGGTCAGG	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.6168C>T	chr9.hg19:g.139905075G>A		211.0	0.0	.		193.0	85.0	.	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	ENST00000371605.3	hg19																																																																																				.	.	.	none		0.667	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E343E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		Atlas-SNP	.											C10orf140_ENST00000449193,rectum,carcinoma,0,4	.	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						PASS	.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	chr10.hg19:g.21805486C>T		50.0	0.0	.		79.0	6.0	.	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	hg19	CCDS44363.1																																																																																			.	.	.	none		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
SUFU	51684	hgsc.bcm.edu	37	10	104356961	104356961	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr10:104356961C>A	ENST00000369902.3	+	7	987	c.821C>A	c.(820-822)gCc>gAc	p.A274D	SUFU_ENST00000423559.2_Missense_Mutation_p.A274D|SUFU_ENST00000369899.2_Missense_Mutation_p.A274D|SUFU_ENST00000471000.1_3'UTR	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	274					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		GCCAAGTGTGCCTGGGATGAC	0.582			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation		OREG0020482	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A274D		Atlas-SNP	.	yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	SUFU	44	.	0			c.C821A						PASS	.						115.0	105.0	108.0					10																	104356961		2203	4300	6503	SO:0001583	missense	51684	exon7	Familial Cancer Database		AGTGTGCCTGGGA	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.821C>A	chr10.hg19:g.104356961C>A	ENSP00000358918:p.Ala274Asp	75.0	0.0	.	1381	95.0	42.0	.	NM_001178133	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	hg19	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721863	0.68959	.	.	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	T;T;T	0.48836	0.8;0.8;0.8	6.03	6.03	0.97812	Suppressor of fused C-terminal (1);	0.048667	0.85682	D	0.000000	T	0.41581	0.1165	L	0.36672	1.1	0.58432	D	0.999997	B;B;B	0.34015	0.022;0.435;0.083	B;B;B	0.29353	0.009;0.101;0.017	T	0.16158	-1.0412	10	0.35671	T	0.21	-19.8645	20.5568	0.99304	0.0:1.0:0.0:0.0	.	274;274;274	Q9UMX1;Q9UMX1-2;Q9UMX1-3	SUFU_HUMAN;.;.	D	274	ENSP00000358918:A274D;ENSP00000358915:A274D;ENSP00000411597:A274D	ENSP00000358915:A274D	A	+	2	0	SUFU	104346951	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.617000	0.67716	2.861000	0.98227	0.655000	0.94253	GCC	.	.	.	none		0.582	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
TDRD1	56165	hgsc.bcm.edu	37	10	115947804	115947804	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr10:115947804C>T	ENST00000369280.1	+	2	674	c.214C>T	c.(214-216)Caa>Taa	p.Q72*	TDRD1_ENST00000251864.2_Nonsense_Mutation_p.Q72*|TDRD1_ENST00000369282.1_Nonsense_Mutation_p.Q72*|TDRD1_ENST00000369281.2_Nonsense_Mutation_p.Q72*|TDRD1_ENST00000422662.1_5'UTR			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	72					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GCTTTGTGAGCAAACCAAACA	0.393																																					p.Q72X		Atlas-SNP	.											.	TDRD1	126	.	0			c.C214T						PASS	.						98.0	105.0	103.0					10																	115947804		2203	4300	6503	SO:0001587	stop_gained	56165	exon2			TGTGAGCAAACCA	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.214C>T	chr10.hg19:g.115947804C>T	ENSP00000358286:p.Gln72*	238.0	0.0	.		204.0	94.0	.	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Nonsense_Mutation	SNP	ENST00000369280.1	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.622831	0.96660	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000369280	.	.	.	5.44	3.53	0.40419	.	0.113505	0.39909	N	0.001228	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.6592	10.9788	0.47482	0.3394:0.6606:0.0:0.0	.	.	.	.	X	72	.	ENSP00000251864:Q72X	Q	+	1	0	TDRD1	115937794	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.525000	0.35953	0.632000	0.30432	0.563000	0.77884	CAA	.	.	.	none		0.393	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
FAM160A2	84067	hgsc.bcm.edu	37	11	6245688	6245688	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:6245688G>T	ENST00000449352.2	-	2	322	c.59C>A	c.(58-60)cCt>cAt	p.P20H	FAM160A2_ENST00000524416.1_Missense_Mutation_p.P20H|FAM160A2_ENST00000265978.4_Missense_Mutation_p.P20H			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	20					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGCCCCTTGAGGTATACGGTG	0.592																																					p.P20H		Atlas-SNP	.											.	FAM160A2	100	.	0			c.C59A						PASS	.						95.0	87.0	90.0					11																	6245688		2201	4296	6497	SO:0001583	missense	84067	exon2			CCTTGAGGTATAC		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.59C>A	chr11.hg19:g.6245688G>T	ENSP00000416918:p.Pro20His	125.0	0.0	.		123.0	45.0	.	NM_032127	Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	ENST00000449352.2	hg19	CCDS44530.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261846	0.59431	.	.	ENSG00000051009	ENST00000449352;ENST00000265978;ENST00000524416	T;T;T	0.14766	3.1;3.1;2.48	5.74	5.74	0.90152	.	0.349704	0.25156	N	0.032716	T	0.18759	0.0450	L	0.29908	0.895	0.36059	D	0.841331	B;B;D	0.69078	0.146;0.065;0.997	B;B;P	0.57468	0.024;0.016;0.821	T	0.06844	-1.0804	10	0.11485	T	0.65	-12.051	14.5134	0.67804	0.0:0.1464:0.8536:0.0	.	20;20;20	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	H	20	ENSP00000416918:P20H;ENSP00000265978:P20H;ENSP00000431773:P20H	ENSP00000265978:P20H	P	-	2	0	FAM160A2	6202264	0.999000	0.42202	1.000000	0.80357	0.967000	0.64934	3.803000	0.55560	2.700000	0.92200	0.650000	0.86243	CCT	.	.	.	none		0.592	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127	
PRKCDBP	112464	hgsc.bcm.edu	37	11	6341515	6341515	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:6341515C>T	ENST00000303927.3	-	1	362	c.192G>A	c.(190-192)ctG>ctA	p.L64L	PRKCDBP_ENST00000530979.1_Silent_p.L64L	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	64					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCAGAGCGCCCAGGCCGCTCT	0.711																																					p.L64L		Atlas-SNP	.											.	PRKCDBP	19	.	0			c.G192A						PASS	.						6.0	6.0	6.0					11																	6341515		2108	4157	6265	SO:0001819	synonymous_variant	112464	exon1			AGCGCCCAGGCCG	AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.192G>A	chr11.hg19:g.6341515C>T		50.0	0.0	.		40.0	17.0	.	NM_145040		Silent	SNP	ENST00000303927.3	hg19	CCDS7762.1																																																																																			.	.	.	none		0.711	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257228.2	NM_145040	
OR10A5	144124	hgsc.bcm.edu	37	11	6867588	6867588	+	Silent	SNP	T	T	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:6867588T>C	ENST00000299454.4	+	1	706	c.675T>C	c.(673-675)gcT>gcC	p.A225A	OR10A5_ENST00000379831.2_Silent_p.A229A			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	225					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTGCTGCTGCTATCCTCAAGA	0.473																																					p.A225A	Pancreas(44;21 1072 25662 28041 45559)	Atlas-SNP	.											.	OR10A5	48	.	0			c.T675C						PASS	.						286.0	234.0	252.0					11																	6867588		2201	4296	6497	SO:0001819	synonymous_variant	144124	exon1			TGCTGCTATCCTC	AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.675T>C	chr11.hg19:g.6867588T>C		123.0	0.0	.		118.0	6.0	.	NM_178168	O95223|Q52M66|Q96R21|Q96R22	Silent	SNP	ENST00000299454.4	hg19	CCDS7773.1																																																																																			.	.	.	none		0.473	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168	
ARAP1	116985	hgsc.bcm.edu	37	11	72423565	72423565	+	Silent	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:72423565G>A	ENST00000393609.3	-	6	998	c.796C>T	c.(796-798)Ctg>Ttg	p.L266L	ARAP1_ENST00000334211.8_Silent_p.L21L|ARAP1_ENST00000426523.1_Silent_p.L21L|ARAP1_ENST00000393605.3_Silent_p.L26L|ARAP1_ENST00000429686.1_Silent_p.L21L|ARAP1_ENST00000359373.5_Silent_p.L266L|ARAP1_ENST00000455638.2_Silent_p.L266L	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	266					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TCGCTCAGCAGACTGGCCACG	0.657																																					p.L266L	Ovarian(102;1198 1520 13195 17913 37529)	Atlas-SNP	.											.	ARAP1	168	.	0			c.C796T						PASS	.						170.0	133.0	145.0					11																	72423565		2200	4293	6493	SO:0001819	synonymous_variant	116985	exon6			TCAGCAGACTGGC	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.796C>T	chr11.hg19:g.72423565G>A		65.0	0.0	.		69.0	32.0	.	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	ENST00000393609.3	hg19	CCDS41687.1																																																																																			.	.	.	none		0.657	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
DLG2	1740	hgsc.bcm.edu	37	11	83770507	83770507	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:83770507C>G	ENST00000532653.1	-	6	757	c.455G>C	c.(454-456)cGg>cCg	p.R152P	DLG2_ENST00000524982.1_Missense_Mutation_p.R152P|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000418306.2_Missense_Mutation_p.R101P|DLG2_ENST00000537455.1_5'UTR|DLG2_ENST00000376104.2_Missense_Mutation_p.R257P|DLG2_ENST00000280241.8_Missense_Mutation_p.R191P|DLG2_ENST00000543673.1_Missense_Mutation_p.R257P|DLG2_ENST00000398301.2_Missense_Mutation_p.R191P|DLG2_ENST00000531015.1_Missense_Mutation_p.R119P|DLG2_ENST00000398309.2_Missense_Mutation_p.R152P|DLG2_ENST00000330014.6_Missense_Mutation_p.R91P			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CTCATTCACCCGCAAGATACA	0.443																																					p.R257P		Atlas-SNP	.											.	DLG2	448	.	0			c.G770C						PASS	.						67.0	60.0	63.0					11																	83770507		1894	4139	6033	SO:0001583	missense	1740	exon11			TTCACCCGCAAGA	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.455G>C	chr11.hg19:g.83770507C>G	ENSP00000435849:p.Arg152Pro	137.0	0.0	.		129.0	55.0	.	NM_001142699	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	hg19		.	.	.	.	.	.	.	.	.	.	C	28.2	4.899836	0.91962	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000330014;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000398301;ENST00000398299	T;T;T;T;T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.17	5.17	0.71159	PDZ/DHR/GLGF (4);	0.095438	0.43416	D	0.000561	T	0.54431	0.1858	M	0.64170	1.965	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.998;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.966;0.932;0.977;0.991;0.999;0.99;1.0	T	0.51568	-0.8689	9	.	.	.	.	18.6643	0.91483	0.0:1.0:0.0:0.0	.	119;152;152;91;191;257;152;101	E9PIW2;B7Z2T4;E9PN83;B7Z264;Q6ZSU2;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	P	152;257;101;257;191;91;152;152;257;119;191;69	ENSP00000381355:R152P;ENSP00000365272:R257P;ENSP00000402275:R101P;ENSP00000441994:R257P;ENSP00000280241:R191P;ENSP00000381353:R91P;ENSP00000432894:R152P;ENSP00000435849:R152P;ENSP00000433848:R119P;ENSP00000381346:R191P;ENSP00000381344:R69P	.	R	-	2	0	DLG2	83448155	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.762000	0.68809	2.420000	0.82092	0.460000	0.39030	CGG	.	.	.	none		0.443	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000259253.2	NM_001364	
KBTBD3	143879	hgsc.bcm.edu	37	11	105923709	105923709	+	Silent	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:105923709C>A	ENST00000526793.1	-	3	1866	c.1707G>T	c.(1705-1707)gtG>gtT	p.V569V	KBTBD3_ENST00000531837.1_Silent_p.V569V|KBTBD3_ENST00000534815.1_Silent_p.V490V	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	565										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		GGTAGACCTGCACTTCATCTG	0.383																																					p.V569V		Atlas-SNP	.											.	KBTBD3	59	.	0			c.G1707T						PASS	.						130.0	129.0	129.0					11																	105923709		2201	4298	6499	SO:0001819	synonymous_variant	143879	exon3			GACCTGCACTTCA	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.1707G>T	chr11.hg19:g.105923709C>A		141.0	0.0	.		131.0	54.0	.	NM_152433	Q6N066|Q86X38|Q96NK5	Silent	SNP	ENST00000526793.1	hg19	CCDS8334.1																																																																																			.	.	.	none		0.383	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
TECTA	7007	hgsc.bcm.edu	37	11	120976623	120976623	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:120976623A>G	ENST00000392793.1	+	3	419	c.148A>G	c.(148-150)Aag>Gag	p.K50E	TECTA_ENST00000264037.2_Missense_Mutation_p.K50E			O75443	TECTA_HUMAN	tectorin alpha	50					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ATCTGAGATTAAGTTGGCCAT	0.468																																					p.K50E		Atlas-SNP	.											.	TECTA	329	.	0			c.A148G						PASS	.						258.0	246.0	250.0					11																	120976623		2203	4299	6502	SO:0001583	missense	7007	exon2			GAGATTAAGTTGG	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.148A>G	chr11.hg19:g.120976623A>G	ENSP00000376543:p.Lys50Glu	76.0	0.0	.		45.0	16.0	.	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	hg19	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.291183	0.40494	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.76186	-1.0;-1.0	5.78	4.59	0.56863	.	0.112533	0.64402	D	0.000009	T	0.60945	0.2308	N	0.25286	0.73	0.31391	N	0.677863	B	0.22003	0.063	B	0.19666	0.026	T	0.63959	-0.6519	10	0.42905	T	0.14	.	12.6491	0.56751	0.8622:0.1378:0.0:0.0	.	50	O75443	TECTA_HUMAN	E	50	ENSP00000376543:K50E;ENSP00000264037:K50E	ENSP00000264037:K50E	K	+	1	0	TECTA	120481833	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.732000	0.47352	2.204000	0.70986	0.528000	0.53228	AAG	.	.	.	none		0.468	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
AGAP2	116986	hgsc.bcm.edu	37	12	58131312	58131312	+	Missense_Mutation	SNP	C	C	T	rs561812307		TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr12:58131312C>T	ENST00000547588.1	-	1	717	c.718G>A	c.(718-720)Gcc>Acc	p.A240T	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	240					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						gcggcggcggcggtggcggcg	0.706																																					p.A240T		Atlas-SNP	.											AGAP2_ENST00000547588,NS,carcinoma,0,1	AGAP2	167	.	0			c.G718A						PASS	.						4.0	6.0	5.0					12																	58131312		1428	3301	4729	SO:0001583	missense	116986	exon1			CGGCGGCGGTGGC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.718G>A	chr12.hg19:g.58131312C>T	ENSP00000449241:p.Ala240Thr	94.0	0.0	.		126.0	7.0	.	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	ENST00000547588.1	hg19	CCDS44932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.24|10.24	1.294811|1.294811	0.23564|0.23564	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000547588|ENST00000328568	T|.	0.39997|.	1.05|.	3.81|3.81	-1.14|-1.14	0.09741|0.09741	.|.	1.354790|.	0.05448|.	N|.	0.548952|.	T|T	0.10508|0.10508	0.0257|0.0257	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.14012|.	0.009;0.005|.	B;B|.	0.06405|.	0.002;0.001|.	T|T	0.24548|0.24548	-1.0157|-1.0157	10|5	0.56958|.	D|.	0.05|.	.|.	0.5619|0.5619	0.00680|0.00680	0.1874:0.3561:0.184:0.2724|0.1874:0.3561:0.184:0.2724	.|.	240;240|.	F8VVT9;Q99490|.	.;AGAP2_HUMAN|.	T|H	240|103	ENSP00000449241:A240T|.	ENSP00000449241:A240T|.	A|R	-|-	1|2	0|0	AGAP2|AGAP2	56417579|56417579	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	0.086000|0.086000	0.14935|0.14935	-0.555000|-0.555000	0.06142|0.06142	0.455000|0.455000	0.32223|0.32223	GCC|CGC	.	.	.	none		0.706	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
PHLDA1	22822	hgsc.bcm.edu	37	12	76424940	76424940	+	Silent	SNP	C	C	T	rs549868413|rs57875368|rs111754051|rs71716769|rs80344196|rs398020175	byFrequency	TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr12:76424940C>T	ENST00000266671.5	-	1	2772	c.582G>A	c.(580-582)caG>caA	p.Q194Q	PHLDA1_ENST00000602540.1_Silent_p.Q53Q|RP11-290L1.3_ENST00000552367.1_RNA|RP11-290L1.2_ENST00000547721.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	194	PH.|Poly-Gln.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gctgctgttgctgctgctgct	0.652																																					p.Q194Q		Atlas-SNP	.											.	PHLDA1	39	.	0			c.G582A						PASS	.						4.0	4.0	4.0					12																	76424940		2019	3942	5961	SO:0001819	synonymous_variant	22822	exon1			CTGTTGCTGCTGC	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.582G>A	chr12.hg19:g.76424940C>T		5.0	0.0	.		28.0	16.0	.	NM_007350	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Silent	SNP	ENST00000266671.5	hg19	CCDS31861.1																																																																																			.	.	.	weak		0.652	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
CLLU1OS	574016	hgsc.bcm.edu	37	12	92814817	92814817	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr12:92814817T>C	ENST00000378487.2	-	3	276	c.275A>G	c.(274-276)gAt>gGt	p.D92G	RP11-693J15.4_ENST00000508671.1_RNA|CLLU1_ENST00000378485.1_5'Flank|CLLU1OS_ENST00000538965.1_Missense_Mutation_p.D92G	NM_001025232.1	NP_001020403.1	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1 opposite strand	92										large_intestine(1)|lung(7)	8						CTTCTTCCCATCATCATTGCC	0.438																																					p.D92G		Atlas-SNP	.											.	CLLU1OS	14	.	0			c.A275G						PASS	.						504.0	468.0	480.0					12																	92814817		2203	4300	6503	SO:0001583	missense	574016	exon3			TTCCCATCATCAT	AJ845168	CCDS31871.1	12q22	2006-03-30	2006-03-30		ENSG00000205057	ENSG00000205057			24070	protein-coding gene	gene with protein product			"""chronic lymphocytic leukemia up-regulated 1 overlapping strand"""				Standard	NM_001025232		Approved		uc001tcb.1	Q5K130	OTTHUMG00000161990	ENST00000378487.2:c.275A>G	chr12.hg19:g.92814817T>C	ENSP00000367748:p.Asp92Gly	79.0	0.0	.		106.0	67.0	.	NM_001025232		Missense_Mutation	SNP	ENST00000378487.2	hg19	CCDS31871.1	.	.	.	.	.	.	.	.	.	.	T	3.155	-0.173406	0.06421	.	.	ENSG00000205057	ENST00000378487;ENST00000538965	.	.	.	3.22	-1.87	0.07737	.	.	.	.	.	T	0.16128	0.0388	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19976	-1.0289	8	0.87932	D	0	.	4.2494	0.10688	0.0:0.2396:0.4148:0.3456	.	92	Q5K130	CLU1O_HUMAN	G	92	.	ENSP00000367748:D92G	D	-	2	0	CLLU1OS	91338948	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.668000	0.05268	-0.372000	0.07992	-0.517000	0.04412	GAT	.	.	.	none		0.438	CLLU1OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366646.1		
STAB2	55576	hgsc.bcm.edu	37	12	104160113	104160113	+	Nonstop_Mutation	SNP	G	G	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr12:104160113G>T	ENST00000388887.2	+	69	7859	c.7655G>T	c.(7654-7656)tGa>tTa	p.*2552L	RP11-341G23.4_ENST00000551299.1_RNA|RP11-341G23.4_ENST00000550029.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						AGGACACTGTGAGGGCCTGGA	0.537																																					p.X2552L		Atlas-SNP	.											.	STAB2	370	.	0			c.G7655T						PASS	.						101.0	84.0	90.0					12																	104160113		2203	4300	6503	SO:0001578	stop_lost	55576	exon69			CACTGTGAGGGCC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7655G>T	chr12.hg19:g.104160113G>T	ENSP00000373539:p.*2552Leuext*19	127.0	0.0	.		179.0	110.0	.	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	hg19	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458045	0.43634	.	.	ENSG00000136011	ENST00000388887	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9111	0.47110	0.0851:0.0:0.9149:0.0	.	.	.	.	L	2552	.	.	X	+	2	2	STAB2	102684243	0.985000	0.35326	0.802000	0.32245	0.013000	0.08279	1.448000	0.35112	2.710000	0.92621	0.542000	0.68232	TGA	.	.	.	none		0.537	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
FREM2	341640	hgsc.bcm.edu	37	13	39450509	39450509	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr13:39450509G>T	ENST00000280481.7	+	20	8750	c.8534G>T	c.(8533-8535)cGa>cTa	p.R2845L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2845					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTTGACATCCGATTCCAACAG	0.433																																					p.R2845L		Atlas-SNP	.											.	FREM2	385	.	0			c.G8534T						PASS	.						110.0	92.0	98.0					13																	39450509		2203	4300	6503	SO:0001583	missense	341640	exon20			ACATCCGATTCCA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8534G>T	chr13.hg19:g.39450509G>T	ENSP00000280481:p.Arg2845Leu	72.0	0.0	.		84.0	56.0	.	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	32	5.136846	0.94517	.	.	ENSG00000150893	ENST00000280481	T	0.63913	-0.07	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.82351	0.5018	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.83912	0.0296	10	0.62326	D	0.03	.	19.8108	0.96545	0.0:0.0:1.0:0.0	.	2845	Q5SZK8	FREM2_HUMAN	L	2845	ENSP00000280481:R2845L	ENSP00000280481:R2845L	R	+	2	0	FREM2	38348509	1.000000	0.71417	0.998000	0.56505	0.915000	0.54546	9.776000	0.99001	2.698000	0.92095	0.563000	0.77884	CGA	.	.	.	none		0.433	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
ARHGEF7	8874	hgsc.bcm.edu	37	13	111926181	111926181	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr13:111926181T>G	ENST00000375741.2	+	11	1407	c.1157T>G	c.(1156-1158)aTg>aGg	p.M386R	ARHGEF7_ENST00000317133.5_Missense_Mutation_p.M365R|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.M293R|ARHGEF7_ENST00000544132.1_Intron|ARHGEF7_ENST00000375736.4_Missense_Mutation_p.M208R|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.M130R|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.M283R|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.M208R|ARHGEF7_ENST00000218789.5_Missense_Mutation_p.M208R|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.M336R|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.M208R|ARHGEF7_ENST00000483189.1_3'UTR	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	386	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGGGAGTTCATGGAGACCAAA	0.552																																					p.M386R		Atlas-SNP	.											.	ARHGEF7	157	.	0			c.T1157G						PASS	.						109.0	100.0	103.0					13																	111926181		2203	4300	6503	SO:0001583	missense	8874	exon11			AGTTCATGGAGAC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1157T>G	chr13.hg19:g.111926181T>G	ENSP00000364893:p.Met386Arg	94.0	0.0	.		128.0	61.0	.	NM_001113511	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	ENST00000375741.2	hg19	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.468353	0.84533	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000466143;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	T;T;T;T;T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	4.87	4.87	0.63330	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.81307	0.4795	M	0.87827	2.91	0.80722	D	1	D;D;D;D;D;D	0.89917	0.993;1.0;0.993;0.998;1.0;1.0	D;D;D;D;D;D	0.97110	0.993;1.0;0.993;0.997;1.0;0.999	D	0.85178	0.1002	10	0.87932	D	0	.	14.498	0.67702	0.0:0.0:0.0:1.0	.	130;283;130;336;386;365	E9PDQ5;B7Z6G2;B7Z344;Q14155-2;Q14155;Q14155-3	.;.;.;.;ARHG7_HUMAN;.	R	365;386;336;293;363;208;208;208;208;283;208;130	ENSP00000325994:M365R;ENSP00000364893:M386R;ENSP00000364891:M336R;ENSP00000359657:M293R;ENSP00000418067:M208R;ENSP00000218789:M208R;ENSP00000364888:M208R;ENSP00000397068:M208R;ENSP00000364889:M283R;ENSP00000364875:M208R;ENSP00000417596:M130R	ENSP00000218789:M208R	M	+	2	0	ARHGEF7	110724182	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.549000	0.82163	1.823000	0.53134	0.477000	0.44152	ATG	.	.	.	none		0.552	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
TGM1	7051	hgsc.bcm.edu	37	14	24718615	24718615	+	Silent	SNP	C	C	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr14:24718615C>G	ENST00000206765.6	-	15	2481	c.2358G>C	c.(2356-2358)gtG>gtC	p.V786V	TGM1_ENST00000544573.1_Silent_p.V344V	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	786					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GGGCTGGGGCCACATCCACCT	0.632																																					p.V786V		Atlas-SNP	.											.	TGM1	73	.	0			c.G2358C						PASS	.						68.0	63.0	65.0					14																	24718615		2203	4300	6503	SO:0001819	synonymous_variant	7051	exon15			TGGGGCCACATCC	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.2358G>C	chr14.hg19:g.24718615C>G		55.0	0.0	.		60.0	19.0	.	NM_000359	B4DWR7|Q197M4	Silent	SNP	ENST00000206765.6	hg19	CCDS9622.1																																																																																			.	.	.	none		0.632	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
ZBTB42	100128927	hgsc.bcm.edu	37	14	105268770	105268770	+	Missense_Mutation	SNP	T	T	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr14:105268770T>G	ENST00000342537.7	+	1	1521	c.1236T>G	c.(1234-1236)ttT>ttG	p.F412L	ZBTB42_ENST00000555360.1_Missense_Mutation_p.F412L	NM_001137601.1	NP_001131073.1	B2RXF5	ZBT42_HUMAN	zinc finger and BTB domain containing 42	412					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TCCGCAAGTTTCACTGTGGCC	0.642																																					p.F412L		Atlas-SNP	.											.	ZBTB42	10	.	0			c.T1236G						PASS	.						17.0	20.0	19.0					14																	105268770		688	1584	2272	SO:0001583	missense	100128927	exon2			CAAGTTTCACTGT	AX721091	CCDS45174.1	14q32.33	2013-01-09				ENSG00000179627		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	32550	protein-coding gene	gene with protein product		613915					Standard	NM_001137601		Approved	ZNF925	uc001ypp.3	B2RXF5		ENST00000342537.7:c.1236T>G	chr14.hg19:g.105268770T>G	ENSP00000409107:p.Phe412Leu	64.0	0.0	.		61.0	23.0	.	NM_001137601	B7ZW21	Missense_Mutation	SNP	ENST00000342537.7	hg19	CCDS45174.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.911053	0.72983	.	.	ENSG00000179627	ENST00000555360;ENST00000342537	T;T	0.12672	2.66;2.66	3.91	1.68	0.24146	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	.	.	.	.	T	0.18676	0.0448	L	0.28458	0.855	0.43740	D	0.996237	D	0.76494	0.999	D	0.78314	0.991	T	0.08269	-1.0730	9	0.16420	T	0.52	.	8.2008	0.31424	0.0:0.6028:0.0:0.3972	.	412	B2RXF5	ZBT42_HUMAN	L	412	ENSP00000450673:F412L;ENSP00000409107:F412L	ENSP00000409107:F412L	F	+	3	2	ZBTB42	104339815	0.991000	0.36638	1.000000	0.80357	0.898000	0.52572	0.277000	0.18734	0.638000	0.30545	-0.376000	0.06991	TTT	.	.	.	none		0.642	ZBTB42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410372.1		
ANPEP	290	hgsc.bcm.edu	37	15	90349503	90349503	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr15:90349503C>T	ENST00000300060.6	-	2	625	c.312G>A	c.(310-312)aaG>aaA	p.K104K		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	104	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TGCTGGAGCCCTTAAAAACGT	0.587																																					p.K104K	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.G312A						PASS	.						96.0	76.0	83.0					15																	90349503		2200	4299	6499	SO:0001819	synonymous_variant	290	exon2			GGAGCCCTTAAAA	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.312G>A	chr15.hg19:g.90349503C>T		91.0	0.0	.		87.0	46.0	.	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	hg19	CCDS10356.1																																																																																			.	.	.	none		0.587	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
MAN2A2	4122	hgsc.bcm.edu	37	15	91453418	91453418	+	Silent	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr15:91453418G>A	ENST00000559717.1	+	10	1932	c.1473G>A	c.(1471-1473)ggG>ggA	p.G491G	MAN2A2_ENST00000431652.2_Intron|MAN2A2_ENST00000430376.2_5'Flank|MAN2A2_ENST00000360468.3_Silent_p.G491G			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	491					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TGCTGAGCGGGGATTTCTTCT	0.572																																					p.G491G		Atlas-SNP	.											.	MAN2A2	99	.	0			c.G1473A						PASS	.						86.0	89.0	88.0					15																	91453418		2198	4298	6496	SO:0001819	synonymous_variant	4122	exon9			GAGCGGGGATTTC	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1473G>A	chr15.hg19:g.91453418G>A		85.0	0.0	.		91.0	31.0	.	NM_006122	A6NH12|A8K1E8|Q13754	Silent	SNP	ENST00000559717.1	hg19	CCDS32332.1																																																																																			.	.	.	none		0.572	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
CAPN15	6650	hgsc.bcm.edu	37	16	603351	603352	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr16:603351_603352GA>AT	ENST00000219611.2	+	14	3459_3460	c.3096_3097GA>AT	c.(3094-3099)gtGAtc>gtATtc	p.I1033F	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	1033					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										AGGTCCTGGTGATCTTGTCCCA	0.663																																					p.V1032V|p.I1033F		Atlas-SNP	.											.	SOLH	47	.	0			c.G3096A|c.A3097T						PASS	.																																			SO:0001583	missense	6650	exon14			CCTGGTGATCTTG|CTGGTGATCTTGT	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	Exception_encountered	chr16.hg19:g.603351_603352delinsAT	ENSP00000219611:p.Ile1033Phe	228.0|226.0	0.0	.		262.0|268.0	61.0|64.0	.	NM_005632	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Silent|Missense_Mutation	SNP	ENST00000219611.2	hg19	CCDS10410.1																																																																																			.	.	.	none		0.663	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
UNKL	64718	hgsc.bcm.edu	37	16	1464001	1464001	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr16:1464001C>G	ENST00000389221.4	-	2	132	c.133G>C	c.(133-135)Gcg>Ccg	p.A45P	UNKL_ENST00000301712.5_Missense_Mutation_p.A45P|UNKL_ENST00000503648.1_5'UTR|UNKL_ENST00000397462.1_Missense_Mutation_p.A45P|LA16c-312E8.2_ENST00000568554.1_RNA|UNKL_ENST00000508903.2_Missense_Mutation_p.A45P	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	45					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				CGGTGCTGCGCGCACTTGTGC	0.657											OREG0023546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A45P		Atlas-SNP	.											.	UNKL	46	.	0			c.G133C						PASS	.						23.0	20.0	21.0					16																	1464001		2088	4094	6182	SO:0001583	missense	64718	exon2			GCTGCGCGCACTT	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.133G>C	chr16.hg19:g.1464001C>G	ENSP00000373873:p.Ala45Pro	187.0	0.0	.	596	327.0	102.0	.	NM_001193388	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	ENST00000389221.4	hg19	CCDS53981.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096929	0.56075	.	.	ENSG00000059145	ENST00000389221;ENST00000508903;ENST00000397462;ENST00000301712	T	0.64085	-0.08	3.98	-3.9	0.04181	.	0.482216	0.19853	N	0.104584	T	0.47563	0.1452	N	0.24115	0.695	0.80722	D	1	P	0.45634	0.863	P	0.47470	0.548	T	0.45585	-0.9251	10	0.30078	T	0.28	.	11.3882	0.49798	0.0:0.2219:0.0:0.7781	.	45	Q9H9P5-5	.	P	45	ENSP00000373873:A45P	ENSP00000301712:A45P	A	-	1	0	UNKL	1404002	1.000000	0.71417	0.469000	0.27204	0.948000	0.59901	1.162000	0.31786	-0.653000	0.05401	-0.253000	0.11424	GCG	.	.	.	none		0.657	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
SCNN1B	6338	hgsc.bcm.edu	37	16	23387172	23387172	+	Missense_Mutation	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr16:23387172C>A	ENST00000343070.2	+	8	1442	c.1266C>A	c.(1264-1266)gaC>gaA	p.D422E	SCNN1B_ENST00000307331.5_Missense_Mutation_p.D467E|SCNN1B_ENST00000568085.1_Missense_Mutation_p.D386E|SCNN1B_ENST00000568923.1_Missense_Mutation_p.D395E	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	422					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	ACTTCCCAGACTGGGGTGAGC	0.617																																					p.D422E		Atlas-SNP	.											SCNN1B,right_lower_lobe,carcinoma,0,1	SCNN1B	81	.	0			c.C1266A						PASS	.						78.0	72.0	74.0					16																	23387172		2197	4300	6497	SO:0001583	missense	6338	exon8			CCCAGACTGGGGT	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1266C>A	chr16.hg19:g.23387172C>A	ENSP00000345751:p.Asp422Glu	105.0	1.0	.		144.0	59.0	.	NM_000336	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	hg19	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.899251	0.72754	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.69175	-0.36;-0.38	4.65	4.65	0.58169	.	0.078108	0.52532	D	0.000074	T	0.64271	0.2583	L	0.41236	1.265	0.46044	D	0.998833	B	0.25048	0.117	B	0.35655	0.207	T	0.63466	-0.6631	10	0.42905	T	0.14	-18.6204	16.8451	0.85978	0.0:1.0:0.0:0.0	.	422	P51168	SCNNB_HUMAN	E	422;467	ENSP00000345751:D422E;ENSP00000302874:D467E	ENSP00000302874:D467E	D	+	3	2	SCNN1B	23294673	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.267000	0.43329	2.277000	0.76020	0.651000	0.88453	GAC	.	.	.	none		0.617	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
NUP93	9688	hgsc.bcm.edu	37	16	56864565	56864565	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr16:56864565G>T	ENST00000308159.5	+	10	1174	c.1053G>T	c.(1051-1053)tgG>tgT	p.W351C	NUP93_ENST00000569842.1_Missense_Mutation_p.W351C|NUP93_ENST00000564887.1_Missense_Mutation_p.W228C|NUP93_ENST00000542526.1_Missense_Mutation_p.W228C	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	351					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TTAAAACCTGGTTCCAGGAGT	0.532																																					p.W351C	Colon(33;610 796 1305 1705 38917)	Atlas-SNP	.											.	NUP93	75	.	0			c.G1053T						PASS	.						96.0	92.0	93.0					16																	56864565		2198	4300	6498	SO:0001583	missense	9688	exon10			AACCTGGTTCCAG	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1053G>T	chr16.hg19:g.56864565G>T	ENSP00000310668:p.Trp351Cys	72.0	0.0	.		80.0	25.0	.	NM_014669	B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	hg19	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208959	0.39003	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.41065	1.01;1.01	5.11	5.11	0.69529	.	0.052513	0.85682	D	0.000000	T	0.26195	0.0639	N	0.11560	0.145	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.05550	-1.0878	10	0.41790	T	0.15	-9.7303	13.8537	0.63513	0.0:0.0:0.8473:0.1527	.	351	Q8N1F7	NUP93_HUMAN	C	351;228	ENSP00000310668:W351C;ENSP00000440235:W228C	ENSP00000310668:W351C	W	+	3	0	NUP93	55422066	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.583000	0.74053	2.525000	0.85131	0.650000	0.86243	TGG	.	.	.	none		0.532	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669	
C17orf100	388327	hgsc.bcm.edu	37	17	6555545	6555545	+	Silent	SNP	G	G	C	rs74923988		TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:6555545G>C	ENST00000391428.2	+	1	575	c.312G>C	c.(310-312)ccG>ccC	p.P104P	MED31_ENST00000574128.1_5'Flank|MED31_ENST00000225728.3_5'Flank|MED31_ENST00000575197.1_5'Flank|CTC-281F24.1_ENST00000576138.1_RNA	NM_001105520.1	NP_001098990.1	A8MU93	CQ100_HUMAN	chromosome 17 open reading frame 100	104																	GCCCGACCCCGCGGCCAAGCC	0.672																																					p.P104P		Atlas-SNP	.											.	C17orf100	4	.	0			c.G312C						PASS	.						12.0	15.0	14.0					17																	6555545		1832	3972	5804	SO:0001819	synonymous_variant	388327	exon1			GACCCCGCGGCCA	BC028174, BC038956, BC052606	CCDS73952.1	17p13.2	2014-04-10			ENSG00000212734	ENSG00000256806			34494	protein-coding gene	gene with protein product							Standard	NM_001105520		Approved	LOC388327	uc010clp.1	A8MU93	OTTHUMG00000188340	ENST00000391428.2:c.312G>C	chr17.hg19:g.6555545G>C		76.0	0.0	.		126.0	6.0	.	NM_001105520		Silent	SNP	ENST00000391428.2	hg19																																																																																				.	G|0.500;C|0.500	0.500	weak		0.672	C17orf100-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255575.2	NM_001105520	
PRPSAP2	5636	hgsc.bcm.edu	37	17	18770619	18770619	+	Silent	SNP	A	A	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:18770619A>G	ENST00000268835.2	+	4	427	c.144A>G	c.(142-144)aaA>aaG	p.K48K	PRPSAP2_ENST00000542013.1_Silent_p.K48K|PRPSAP2_ENST00000419071.2_Intron|PRPSAP2_ENST00000536323.1_Intron	NM_002767.3	NP_002758.1	O60256	KPRB_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 2	48					bone development (GO:0060348)|negative regulation of catalytic activity (GO:0043086)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11						AGATGGGCAAAGTGCAGGTTT	0.453																																					p.K48K		Atlas-SNP	.											.	PRPSAP2	23	.	0			c.A144G						PASS	.						156.0	153.0	154.0					17																	18770619		2203	4300	6503	SO:0001819	synonymous_variant	5636	exon3			GGGCAAAGTGCAG	AB007851	CCDS11200.1, CCDS58525.1, CCDS58526.1, CCDS58527.1	17p12-p11.2	2008-05-14			ENSG00000141127	ENSG00000141127			9467	protein-coding gene	gene with protein product		603762				9806849	Standard	NM_002767		Approved	PAP41	uc002gup.2	O60256	OTTHUMG00000059406	ENST00000268835.2:c.144A>G	chr17.hg19:g.18770619A>G		83.0	0.0	.		83.0	46.0	.	NM_001243940	B4E1M8|B4E329|B7ZKZ1|E7EMY2|Q6IAS2	Silent	SNP	ENST00000268835.2	hg19	CCDS11200.1																																																																																			.	.	.	none		0.453	PRPSAP2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132112.3	NM_002767	
SRCIN1	80725	hgsc.bcm.edu	37	17	36714573	36714573	+	Silent	SNP	C	C	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:36714573C>A	ENST00000264659.7	-	11	2315	c.2091G>T	c.(2089-2091)gtG>gtT	p.V697V	SRCIN1_ENST00000578925.1_Silent_p.V731V|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	569					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						CCGCCTCCGACACGCGCATGC	0.692											OREG0024362	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V697V		Atlas-SNP	.											.	SRCIN1	66	.	0			c.G2091T						PASS	.						24.0	27.0	26.0					17																	36714573		2099	4219	6318	SO:0001819	synonymous_variant	80725	exon11			CTCCGACACGCGC		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.2091G>T	chr17.hg19:g.36714573C>A		95.0	0.0	.	865	124.0	78.0	.	NM_025248	Q75T46|Q8N4W8	Silent	SNP	ENST00000264659.7	hg19	CCDS45660.1																																																																																			.	.	.	none		0.692	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441878.4	NM_025248	
HAP1	9001	hgsc.bcm.edu	37	17	39887810	39887810	+	Splice_Site	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:39887810G>A	ENST00000310778.5	-	6	1013	c.1004C>T	c.(1003-1005)gCc>gTc	p.A335V	HAP1_ENST00000341193.5_Splice_Site_p.A343V|RN7SL399P_ENST00000471648.2_RNA|HAP1_ENST00000347901.4_Splice_Site_p.A335V|HAP1_ENST00000393939.2_Splice_Site_p.A335V|JUP_ENST00000540235.1_Intron			P54257	HAP1_HUMAN	huntingtin-associated protein 1	335	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			GAGTTGAGAGGCCTGGAGGGA	0.547																																					p.A343V		Atlas-SNP	.											.	HAP1	48	.	0			c.C1028T						PASS	.						137.0	112.0	120.0					17																	39887810		2203	4300	6503	SO:0001630	splice_region_variant	9001	exon6			TGAGAGGCCTGGA	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1003-1C>T	chr17.hg19:g.39887810G>A		210.0	0.0	.		224.0	75.0	.	NM_001079870	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	hg19		.	.	.	.	.	.	.	.	.	.	G	14.47	2.546491	0.45383	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	4.14	3.09	0.35607	.	0.219300	0.23282	N	0.049895	T	0.43122	0.1233	L	0.46947	1.48	0.42390	D	0.992525	D;D;P;P	0.71674	0.998;0.998;0.709;0.601	D;D;P;P	0.80764	0.994;0.994;0.528;0.659	T	0.29640	-1.0005	10	0.62326	D	0.03	-10.2963	7.3085	0.26461	0.1301:0.0:0.8699:0.0	.	335;343;335;335	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	V	335;335;335;343	ENSP00000377513:A335V;ENSP00000309392:A335V;ENSP00000334002:A335V;ENSP00000343170:A343V	ENSP00000309392:A335V	A	-	2	0	HAP1	37141336	1.000000	0.71417	0.973000	0.42090	0.889000	0.51656	3.914000	0.56401	0.844000	0.35094	0.655000	0.94253	GCC	.	.	.	none		0.547	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949	Missense_Mutation
EZH1	2145	hgsc.bcm.edu	37	17	40864332	40864332	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:40864332A>G	ENST00000428826.2	-	12	1497	c.1376T>C	c.(1375-1377)cTt>cCt	p.L459P	EZH1_ENST00000585893.1_Missense_Mutation_p.L419P|EZH1_ENST00000590078.1_Missense_Mutation_p.L389P|EZH1_ENST00000415827.2_Missense_Mutation_p.L450P|EZH1_ENST00000590783.1_5'Flank|EZH1_ENST00000592743.1_Missense_Mutation_p.L459P|EZH1_ENST00000435174.1_Missense_Mutation_p.L320P			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	459					anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		GGTCCCCAGAAGCCTGGCTAT	0.527																																					p.L459P		Atlas-SNP	.											.	EZH1	62	.	0			c.T1376C						PASS	.						128.0	115.0	119.0					17																	40864332		2203	4300	6503	SO:0001583	missense	2145	exon12			CCCAGAAGCCTGG		CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.1376T>C	chr17.hg19:g.40864332A>G	ENSP00000404658:p.Leu459Pro	104.0	0.0	.		118.0	67.0	.	NM_001991	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	ENST00000428826.2	hg19	CCDS32659.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.529451	0.85706	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	T;T	0.80909	-1.43;-1.43	5.42	5.42	0.78866	SANT domain, DNA binding (1);	0.000000	0.85682	D	0.000000	D	0.88815	0.6539	M	0.78637	2.42	0.80722	D	1	D;P;P;P;P	0.62365	0.991;0.841;0.841;0.507;0.868	D;P;P;P;P	0.67382	0.951;0.776;0.776;0.599;0.602	D	0.88699	0.3214	10	0.42905	T	0.14	.	15.6252	0.76851	1.0:0.0:0.0:0.0	.	320;419;465;389;459	Q92800-5;Q92800-3;Q92800-2;Q92800-4;Q92800	.;.;.;.;EZH1_HUMAN	P	462;459;419;320	ENSP00000404658:L459P;ENSP00000404071:L320P	ENSP00000264646:L462P	L	-	2	0	EZH1	38117858	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.103000	0.94232	2.275000	0.75901	0.528000	0.53228	CTT	.	.	.	none		0.527	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991	
MPP2	4355	hgsc.bcm.edu	37	17	41975630	41975630	+	Splice_Site	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:41975630C>T	ENST00000461854.1	-	3	235	c.150G>A	c.(148-150)aaG>aaA	p.K50K	MPP2_ENST00000473246.1_5'UTR|MPP2_ENST00000518766.1_Splice_Site_p.K95K|MPP2_ENST00000269095.4_Splice_Site_p.K50K|MPP2_ENST00000520305.1_Intron|MPP2_ENST00000377184.3_Splice_Site_p.K67K|MPP2_ENST00000536246.1_Splice_Site_p.K39K|MPP2_ENST00000523501.1_Splice_Site_p.K39K			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	50	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		AGCACTGTACCTTGGCCAGGG	0.572																																					p.K50K		Atlas-SNP	.											.	MPP2	67	.	0			c.G150A						PASS	.						122.0	108.0	113.0					17																	41975630		2203	4300	6503	SO:0001630	splice_region_variant	4355	exon3			CTGTACCTTGGCC		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.150+1G>A	chr17.hg19:g.41975630C>T		76.0	0.0	.		110.0	38.0	.	NM_005374	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Silent	SNP	ENST00000461854.1	hg19																																																																																				.	.	.	none		0.572	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	protein_coding	OTTHUMT00000258388.2	NM_005374	Silent
TANC2	26115	hgsc.bcm.edu	37	17	61497660	61497660	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:61497660C>T	ENST00000424789.2	+	25	4321	c.4317C>T	c.(4315-4317)gtC>gtT	p.V1439V	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Silent_p.V1449V	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1439					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						GGCTCCCGGTCATCCAGAGCC	0.567																																					p.V1439V		Atlas-SNP	.											.	TANC2	266	.	0			c.C4317T						PASS	.						54.0	55.0	55.0					17																	61497660		1934	4150	6084	SO:0001819	synonymous_variant	26115	exon25			CCCGGTCATCCAG	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.4317C>T	chr17.hg19:g.61497660C>T		86.0	0.0	.		103.0	33.0	.	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Silent	SNP	ENST00000424789.2	hg19	CCDS45754.1																																																																																			.	.	.	none		0.567	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
DDX5	1655	hgsc.bcm.edu	37	17	62496291	62496291	+	Missense_Mutation	SNP	T	T	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:62496291T>C	ENST00000225792.5	-	13	1996	c.1595A>G	c.(1594-1596)aAt>aGt	p.N532S	DDX5_ENST00000450599.2_Missense_Mutation_p.N453S|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Missense_Mutation_p.N532S|MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000580026.1_5'UTR	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	532	Transactivation domain.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			GTAAACACCATTCTGAGTTTT	0.423			T	ETV4	prostate																																p.N532S	NSCLC(22;406 813 4871 19580 40307)	Atlas-SNP	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5	101	.	0			c.A1595G						PASS	.						138.0	142.0	141.0					17																	62496291		2203	4300	6503	SO:0001583	missense	1655	exon13			ACACCATTCTGAG	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1595A>G	chr17.hg19:g.62496291T>C	ENSP00000225792:p.Asn532Ser	139.0	0.0	.		151.0	42.0	.	NM_004396	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	ENST00000225792.5	hg19	CCDS11659.1	.	.	.	.	.	.	.	.	.	.	T	7.653	0.683306	0.14907	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.56	4.46	0.54185	.	0.443060	0.27478	N	0.019189	T	0.37732	0.1014	N	0.12182	0.205	0.80722	D	1	B;B;B	0.17465	0.016;0.022;0.022	B;B;B	0.21151	0.011;0.033;0.033	T	0.11518	-1.0584	9	0.14656	T	0.56	-18.6472	13.0086	0.58720	0.0:0.0:0.1349:0.8651	.	453;532;532	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	S	532;462;521	.	ENSP00000225792:N521S	N	-	2	0	DDX5	59926753	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.816000	0.69222	1.030000	0.39839	0.477000	0.44152	AAT	.	.	.	none		0.423	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
RNF213	57674	hgsc.bcm.edu	37	17	78332113	78332113	+	Missense_Mutation	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:78332113G>A	ENST00000582970.1	+	37	11031	c.10888G>A	c.(10888-10890)Ggt>Agt	p.G3630S	CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.G3679S|RNF213_ENST00000336301.6_Missense_Mutation_p.G1703S	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3630					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCGGGTCCAAGGTGCTGTCAC	0.572																																					p.G3630S		Atlas-SNP	.											.	RNF213	766	.	0			c.G10888A						PASS	.						72.0	63.0	66.0					17																	78332113		2203	4300	6503	SO:0001583	missense	57674	exon37			GTCCAAGGTGCTG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10888G>A	chr17.hg19:g.78332113G>A	ENSP00000464087:p.Gly3630Ser	100.0	0.0	.		133.0	71.0	.	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	hg19	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	6.321	0.427276	0.11987	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.19532	2.14	5.58	0.672	0.17935	.	0.974902	0.08475	N	0.940385	T	0.09468	0.0233	N	0.19112	0.55	0.09310	N	1	B;B	0.24823	0.112;0.006	B;B	0.17722	0.019;0.005	T	0.34104	-0.9842	10	0.02654	T	1	.	4.1346	0.10164	0.5287:0.1834:0.2879:0.0	.	3679;1703	C9JCP4;Q63HN8	.;RN213_HUMAN	S	3630;3679;1703	ENSP00000338218:G1703S	ENSP00000338218:G1703S	G	+	1	0	RNF213	75946708	0.964000	0.33143	0.001000	0.08648	0.041000	0.13682	1.847000	0.39299	0.010000	0.14839	-0.185000	0.12909	GGT	.	.	.	none		0.572	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
MTCL1	23255	hgsc.bcm.edu	37	18	8819148	8819148	+	Missense_Mutation	SNP	G	G	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr18:8819148G>T	ENST00000306329.11	+	11	4004	c.4004G>T	c.(4003-4005)aGg>aTg	p.R1335M	SOGA2_ENST00000306285.7_Missense_Mutation_p.R341M|SOGA2_ENST00000518815.1_Missense_Mutation_p.R341M|SOGA2_ENST00000400050.3_Missense_Mutation_p.R975M|SOGA2_ENST00000517570.1_Missense_Mutation_p.R975M|SOGA2_ENST00000359865.3_Missense_Mutation_p.R1016M																							GAGTCGGACAGGTGCTCGGCC	0.622																																					p.R1016M		Atlas-SNP	.											.	.	.	.	0			c.G3047T						PASS	.						52.0	49.0	50.0					18																	8819148		2203	4300	6503	SO:0001583	missense	23255	exon13			CGGACAGGTGCTC																												ENST00000306329.11:c.4004G>T	chr18.hg19:g.8819148G>T	ENSP00000305027:p.Arg1335Met	109.0	0.0	.		93.0	38.0	.	NM_015210		Missense_Mutation	SNP	ENST00000306329.11	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.642986|4.642986	0.87859|0.87859	.|.	.|.	ENSG00000168502|ENSG00000168502	ENST00000519823|ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	.|T;T;T;T	.|0.50813	.|0.73;0.73;0.73;0.73	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|0.000000	.|0.53938	.|D	.|0.000058	T|T	0.65668|0.65668	0.2713|0.2713	L|L	0.49640|0.49640	1.575|1.575	0.40122|0.40122	D|D	0.976615|0.976615	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.996;0.999	T|T	0.60747|0.60747	-0.7202|-0.7202	5|10	.|0.39692	.|T	.|0.17	-41.8804|-41.8804	20.3473|20.3473	0.98799|0.98799	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1326;1016	.|Q9Y4B5;Q9Y4B5-3	.|CC165_HUMAN;.	H|M	121|1037;975;1016;975;341	.|ENSP00000429556:R975M;ENSP00000352927:R1016M;ENSP00000382924:R975M;ENSP00000303670:R341M	.|ENSP00000303670:R341M	Q|R	+|+	3|2	2|0	CCDC165|CCDC165	8809148|8809148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.417000|6.417000	0.73337|0.73337	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	CAG|AGG	.	.	.	none		0.622	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
ZNF14	7561	hgsc.bcm.edu	37	19	19823847	19823847	+	Silent	SNP	T	T	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr19:19823847T>A	ENST00000344099.3	-	4	381	c.243A>T	c.(241-243)ggA>ggT	p.G81G		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	81					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				TAGTGGTTTCTCCACATTTGC	0.353																																					p.G81G		Atlas-SNP	.											.	ZNF14	89	.	0			c.A243T						PASS	.						118.0	111.0	113.0					19																	19823847		2203	4300	6503	SO:0001819	synonymous_variant	7561	exon4			GGTTTCTCCACAT	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.243A>T	chr19.hg19:g.19823847T>A		93.0	0.0	.		107.0	47.0	.	NM_021030	B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	hg19	CCDS12409.1																																																																																			.	.	.	none		0.353	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
SYNE4	163183	hgsc.bcm.edu	37	19	36497828	36497828	+	Silent	SNP	G	G	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr19:36497828G>T	ENST00000324444.3	-	4	553	c.442C>A	c.(442-444)Cga>Aga	p.R148R	SYNE4_ENST00000340477.5_Intron|ALKBH6_ENST00000495116.2_5'Flank|AC002116.8_ENST00000473572.2_RNA	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	148					establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)											GCTGCCCCTCGTAGGTCCACC	0.647																																					p.R148R		Atlas-SNP	.											.	.	.	.	0			c.C442A						PASS	.						13.0	20.0	18.0					19																	36497828		2001	4045	6046	SO:0001819	synonymous_variant	163183	exon4			CCCCTCGTAGGTC	BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.442C>A	chr19.hg19:g.36497828G>T		60.0	0.0	.		70.0	30.0	.	NM_001039876	A8MRS0|A8MYE3|Q7Z7L3	Silent	SNP	ENST00000324444.3	hg19	CCDS42553.1																																																																																			.	.	.	none		0.647	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109525.3	NM_001039876	
GPCPD1	56261	hgsc.bcm.edu	37	20	5574056	5574056	+	Splice_Site	SNP	T	T	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr20:5574056T>C	ENST00000379019.4	-	4	360	c.148A>G	c.(148-150)Atg>Gtg	p.M50V		NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	50	CBM20. {ECO:0000255|PROSITE- ProRule:PRU00594}.				glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						TTCCATAGCATGCTGTGAAGA	0.348																																					p.M50V		Atlas-SNP	.											.	GPCPD1	52	.	0			c.A148G						PASS	.						106.0	106.0	106.0					20																	5574056		2203	4300	6503	SO:0001630	splice_region_variant	56261	exon4			ATAGCATGCTGTG		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.147-1A>G	chr20.hg19:g.5574056T>C		65.0	0.0	.		87.0	25.0	.	NM_019593	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	hg19	CCDS13090.1	.	.	.	.	.	.	.	.	.	.	T	5.033	0.191778	0.09547	.	.	ENSG00000125772	ENST00000379019	D	0.93076	-3.16	5.35	1.93	0.25924	Carbohydrate-binding-like fold (1);Glycoside hydrolase, carbohydrate-binding (2);Immunoglobulin-like fold (1);	0.886744	0.10053	N	0.721935	T	0.81842	0.4908	N	0.04508	-0.205	0.19945	N	0.999944	B	0.02656	0.0	B	0.01281	0.0	T	0.70483	-0.4859	10	0.28530	T	0.3	-3.2258	5.3794	0.16183	0.0:0.2796:0.2234:0.497	.	50	Q9NPB8	GPCP1_HUMAN	V	50	ENSP00000368305:M50V	ENSP00000368305:M50V	M	-	1	0	GPCPD1	5522056	0.000000	0.05858	0.991000	0.47740	0.901000	0.52897	-0.520000	0.06252	0.879000	0.35944	0.454000	0.30748	ATG	.	.	.	none		0.348	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593	Missense_Mutation
RBM39	9584	hgsc.bcm.edu	37	20	34313043	34313043	+	Missense_Mutation	SNP	C	C	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr20:34313043C>G	ENST00000253363.6	-	7	474	c.451G>C	c.(451-453)Gat>Cat	p.D151H	RBM39_ENST00000407261.4_5'UTR|RBM39_ENST00000528062.3_Missense_Mutation_p.D129H|RBM39_ENST00000361162.6_Missense_Mutation_p.D151H			Q14498	RBM39_HUMAN	RNA binding motif protein 39	151					mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					GTCCTTGCATCTCTTTCCTCA	0.318																																					p.D151H		Atlas-SNP	.											.	RBM39	68	.	0			c.G451C						PASS	.						95.0	94.0	94.0					20																	34313043		2202	4300	6502	SO:0001583	missense	9584	exon7			TTGCATCTCTTTC	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.451G>C	chr20.hg19:g.34313043C>G	ENSP00000253363:p.Asp151His	245.0	0.0	.		286.0	175.0	.	NM_184234	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Missense_Mutation	SNP	ENST00000253363.6	hg19	CCDS13266.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.6|28.6	4.937994|4.937994	0.92526|0.92526	.|.	.|.	ENSG00000131051|ENSG00000131051	ENST00000253363;ENST00000361162;ENST00000528062;ENST00000374038;ENST00000427743;ENST00000434927|ENST00000448303	T;T;T;T;T;T|T	0.52057|0.06142	0.68;0.68;0.68;0.9;0.9;0.68|3.34	5.0|5.0	5.0|5.0	0.66597|0.66597	Nucleotide-binding, alpha-beta plait (1);|.	0.046134|.	0.85682|.	D|.	0.000000|.	T|T	0.30324|0.30324	0.0761|0.0761	M|M	0.86651|0.86651	2.83|2.83	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;0.999;0.999;0.997|.	T|T	0.13415|0.13415	-1.0510|-1.0510	10|7	0.51188|0.87932	T|D	0.08|0	.|.	18.4905|18.4905	0.90844|0.90844	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	129;129;151;151;127|.	B4DRA0;A2RRD3;Q14498-2;Q14498;B3KWX7|.	.;.;.;RBM39_HUMAN;.|.	H|T	151;151;129;150;129;151|23	ENSP00000253363:D151H;ENSP00000354437:D151H;ENSP00000436747:D129H;ENSP00000363150:D150H;ENSP00000406801:D129H;ENSP00000393493:D151H|ENSP00000394824:R23T	ENSP00000253363:D151H|ENSP00000394824:R23T	D|R	-|-	1|2	0|0	RBM39|RBM39	33776457|33776457	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.567000|7.567000	0.82357|0.82357	2.599000|2.599000	0.87857|0.87857	0.655000|0.655000	0.94253|0.94253	GAT|AGA	.	.	.	none		0.318	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2	NM_184237	
SRSF6	6431	hgsc.bcm.edu	37	20	42089554	42089554	+	Missense_Mutation	SNP	A	A	G			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr20:42089554A>G	ENST00000244020.3	+	6	992	c.886A>G	c.(886-888)Agg>Ggg	p.R296G		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	296	Arg/Ser-rich (RS domain).				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						ATCCAGATCAAGGAGCCAGTC	0.488																																					p.R296G		Atlas-SNP	.											.	SRSF6	37	.	0			c.A886G						PASS	.						77.0	77.0	77.0					20																	42089554		2203	4300	6503	SO:0001583	missense	6431	exon6			AGATCAAGGAGCC	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.886A>G	chr20.hg19:g.42089554A>G	ENSP00000244020:p.Arg296Gly	219.0	0.0	.		226.0	130.0	.	NM_006275	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	hg19	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	A	13.55	2.270378	0.40194	.	.	ENSG00000124193	ENST00000244020	T	0.16196	2.36	5.93	4.82	0.62117	.	0.195808	0.53938	D	0.000057	T	0.29093	0.0723	L	0.45051	1.395	0.32963	D	0.521249	D	0.54601	0.967	P	0.60789	0.879	T	0.39461	-0.9613	10	0.66056	D	0.02	.	10.9196	0.47156	0.8363:0.1637:0.0:0.0	.	296	Q13247	SRSF6_HUMAN	G	296	ENSP00000244020:R296G	ENSP00000244020:R296G	R	+	1	2	SRSF6	41522968	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.355000	0.52262	1.043000	0.40175	0.477000	0.44152	AGG	.	.	.	none		0.488	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
SRSF6	6431	hgsc.bcm.edu	37	20	42089559	42089559	+	Silent	SNP	C	C	T			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr20:42089559C>T	ENST00000244020.3	+	6	997	c.891C>T	c.(889-891)agC>agT	p.S297S		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	297	Arg/Ser-rich (RS domain).				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						GATCAAGGAGCCAGTCCCGTT	0.488																																					p.S297S		Atlas-SNP	.											.	SRSF6	37	.	0			c.C891T						PASS	.						80.0	79.0	80.0					20																	42089559		2203	4300	6503	SO:0001819	synonymous_variant	6431	exon6			AAGGAGCCAGTCC	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.891C>T	chr20.hg19:g.42089559C>T		207.0	0.0	.		230.0	132.0	.	NM_006275	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Silent	SNP	ENST00000244020.3	hg19	CCDS13318.1																																																																																			.	.	.	none		0.488	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
MYO18B	84700	hgsc.bcm.edu	37	22	26286842	26286842	+	Splice_Site	SNP	G	G	A			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr22:26286842G>A	ENST00000407587.2	+	26	4606	c.4437G>A	c.(4435-4437)aaG>aaA	p.K1479K	CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|MYO18B_ENST00000335473.7_Splice_Site_p.K1478K|CTA-125H2.2_ENST00000600211.1_RNA|MYO18B_ENST00000536101.1_Splice_Site_p.K1478K|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1478	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGGAGCTCAAGGTGAGTGGTC	0.597																																					p.K1478K		Atlas-SNP	.											.	MYO18B	322	.	0			c.G4434A						PASS	.						39.0	47.0	44.0					22																	26286842		2046	4193	6239	SO:0001630	splice_region_variant	84700	exon26			GCTCAAGGTGAGT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4437+1G>A	chr22.hg19:g.26286842G>A		74.0	0.0	.		66.0	34.0	.	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	hg19																																																																																				.	.	.	none		0.597	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	Silent
ABCA5	23461	hgsc.bcm.edu	37	17	67286078	67286078	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr17:67286078delA	ENST00000392676.3	-	13	1771	c.1707delT	c.(1705-1707)gatfs	p.D569fs	ABCA5_ENST00000392677.2_Frame_Shift_Del_p.D569fs|ABCA5_ENST00000588877.1_Frame_Shift_Del_p.D569fs			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	569	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	CTGTCAAAACATCAAAGTGTA	0.313																																					p.V570fs		Atlas-Indel,Pindel	.											.	ABCA5	162	.	0			c.1708delG						PASS	.						104.0	100.0	101.0					17																	67286078		2202	4291	6493	SO:0001589	frameshift_variant	23461	exon13			.	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.1707delT	chr17.hg19:g.67286078delA	ENSP00000376443:p.Asp569fs	69.0	0.0	0		71.0	44.0	0.619718	NM_172232	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Frame_Shift_Del	DEL	ENST00000392676.3	hg19	CCDS11685.1																																																																																			.	.	.	none		0.313	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
SPCS3	60559	hgsc.bcm.edu	37	4	177249348	177249348	+	Splice_Site	DEL	G	G	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:177249348delG	ENST00000503362.1	+	5	523		c.e5-1		SPCS3_ENST00000507001.1_Splice_Site	NM_021928.3	NP_068747.1	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			ovary(2)	2		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		TCTTTTTATAGGGGAAACAGG	0.358																																					.		Atlas-INDEL	.											.	SPCS3	15	.	0			c.411-2G>-						PASS	.						122.0	107.0	112.0					4																	177249348		1838	4081	5919	SO:0001630	splice_region_variant	60559	exon5			.	AK092634	CCDS54823.1	4q34.2	2008-02-05				ENSG00000129128			26212	protein-coding gene	gene with protein product						12477932	Standard	NM_021928		Approved	FLJ22649, SPC22/23, SPC3, YLR066W, PRO3567	uc003iur.4	P61009		ENST00000503362.1:c.411-1G>-	chr4.hg19:g.177249348delG		87.0	0.0	0		54.0	16.0	0.296296	NM_021928	P12280|Q9H0S7	Splice_Site	DEL	ENST00000503362.1	hg19	CCDS54823.1																																																																																			.	.	.	none		0.358	SPCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362329.1	NM_021928	Intron
FAM160A1	729830	hgsc.bcm.edu	37	4	152570836	152570836	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:152570836delC	ENST00000505231.1	+	9	1802	c.1643delC	c.(1642-1644)gccfs	p.A548fs	FAM160A1_ENST00000435205.1_Frame_Shift_Del_p.A548fs			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	548										endometrium(2)|kidney(1)	3						GTGAGCTCGGCCTGCCCTGTG	0.612																																					p.A548fs		Atlas-Indel,Pindel	.											.	FAM160A1	60	.	0			c.1642delG						PASS	.						44.0	43.0	43.0					4																	152570836		692	1591	2283	SO:0001589	frameshift_variant	729830	exon11			.		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.1643delC	chr4.hg19:g.152570836delC	ENSP00000421580:p.Ala548fs	117.0	0.0	0		82.0	39.0	0.47561	NM_001109977	Q6ZUS2	Frame_Shift_Del	DEL	ENST00000505231.1	hg19	CCDS47146.1																																																																																			.	.	.	none		0.612	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365691.1	NM_001109977	
ATP8A2	51761	hgsc.bcm.edu	37	13	26542768	26542768	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr13:26542768delA	ENST00000381655.2	+	35	3470	c.3328delA	c.(3328-3330)aagfs	p.K1110fs	ATP8A2_ENST00000255283.8_Frame_Shift_Del_p.K1045fs	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	1070					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GCTGGAAACCAAGTCTCGAGT	0.537																																					p.T1109fs		Atlas-Indel,Pindel	.											.	ATP8A2	181	.	0			c.3327delC						PASS	.						73.0	81.0	79.0					13																	26542768		1974	4165	6139	SO:0001589	frameshift_variant	51761	exon35			.	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3328delA	chr13.hg19:g.26542768delA	ENSP00000371070:p.Lys1110fs	176.0	0.0	0		243.0	79.0	0.325103	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Frame_Shift_Del	DEL	ENST00000381655.2	hg19	CCDS41873.1																																																																																			.	.	.	none		0.537	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
C19orf44	84167	hgsc.bcm.edu	37	19	16617533	16617539	+	Frame_Shift_Del	DEL	CGCTTGA	CGCTTGA	-	rs201618251|rs537357343		TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	CGCTTGA	CGCTTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr19:16617533_16617539delCGCTTGA	ENST00000221671.3	+	4	1253_1259	c.1097_1103delCGCTTGA	c.(1096-1104)tcgcttgacfs	p.SLD366fs	C19orf44_ENST00000594035.1_Frame_Shift_Del_p.SLD366fs|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	366										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						AATATTTTATCGCTTGACGGTCTGGCT	0.324																																					p.366_368del		Atlas-Indel,Pindel	.											.	C19orf44	47	.	0			c.1096_1102del						PASS	.																																			SO:0001589	frameshift_variant	84167	exon4			.	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1097_1103delCGCTTGA	chr19.hg19:g.16617533_16617539delCGCTTGA	ENSP00000221671:p.Ser366fs	257.0	0.0	0		222.0	69.0	0.310811	NM_032207	Q8N6Y7	Frame_Shift_Del	DEL	ENST00000221671.3	hg19	CCDS12345.1																																																																																			.	.	.	none		0.324	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207	
EFTUD1	79631	hgsc.bcm.edu	37	15	82545087	82545087	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr15:82545087delT	ENST00000268206.7	-	4	357	c.189delA	c.(187-189)gaafs	p.E63fs	EFTUD1_ENST00000359445.3_Intron	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	63	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						CTCGGATCTGTTCATCTTCTC	0.358																																					p.Q64fs		Atlas-Indel,Pindel	.											.	EFTUD1	74	.	0			c.190delC						PASS	.						121.0	105.0	110.0					15																	82545087		1851	4085	5936	SO:0001589	frameshift_variant	79631	exon4			.	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.189delA	chr15.hg19:g.82545087delT	ENSP00000268206:p.Glu63fs	229.0	0.0	0		199.0	88.0	0.442211	NM_024580	A6NKY5|B7Z6I0|Q9H8Z6	Frame_Shift_Del	DEL	ENST00000268206.7	hg19	CCDS42071.1																																																																																			.	.	.	none		0.358	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1	NM_024580	
BOD1L1	259282	hgsc.bcm.edu	37	4	13605423	13605423	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:13605423delT	ENST00000040738.5	-	10	3236	c.3101delA	c.(3100-3102)aagfs	p.K1035fs		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1035	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										TTCGTCCTTCTTTTTTATGTC	0.368																																					p.K1034fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.3102delG						PASS	.						161.0	171.0	167.0					4																	13605423		2203	4300	6503	SO:0001589	frameshift_variant	259282	exon10			.	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3101delA	chr4.hg19:g.13605423delT	ENSP00000040738:p.Lys1035fs	95.0	0.0	0		92.0	37.0	0.402174	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Frame_Shift_Del	DEL	ENST00000040738.5	hg19	CCDS3411.2																																																																																			.	.	.	none		0.368	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
HIRA	7290	hgsc.bcm.edu	37	22	19344495	19344496	+	Frame_Shift_Ins	INS	-	-	AT	rs374953578		TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr22:19344495_19344496insAT	ENST00000263208.5	-	19	2569_2570	c.2313_2314insAT	c.(2311-2316)atcctcfs	p.L772fs	HIRA_ENST00000546308.1_Frame_Shift_Ins_p.L728fs|HIRA_ENST00000541063.1_Frame_Shift_Ins_p.L728fs|HIRA_ENST00000340170.4_Intron	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	772	Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.|Interaction with histone H4.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GATGGCAGGAGGATGGGAGAGA	0.589																																					p.L772fs		Atlas-Indel,Pindel	.											.	HIRA	100	.	0			c.2314_2315insAT						PASS	.																																			SO:0001589	frameshift_variant	7290	exon19			.	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.2313_2314insAT	chr22.hg19:g.19344495_19344496insAT	ENSP00000263208:p.Leu772fs	98.0	0.0	0		126.0	33.0	0.261905	NM_003325	Q05BU9|Q8IXN2	Frame_Shift_Ins	INS	ENST00000263208.5	hg19	CCDS13759.1																																																																																			.	.	.	none		0.589	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325	
CBS	875	hgsc.bcm.edu	37	21	44479371	44479371	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr21:44479371delA	ENST00000398165.3	-	13	1447	c.1188delT	c.(1186-1188)tttfs	p.F396fs	CBS_ENST00000398158.1_Frame_Shift_Del_p.F396fs|CBS_ENST00000359624.3_Frame_Shift_Del_p.F396fs|CBS_ENST00000352178.5_Frame_Shift_Del_p.F396fs|CBS_ENST00000398168.1_Frame_Shift_Del_p.F396fs|CBS_ENST00000544202.1_Frame_Shift_Del_p.F308fs	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	396					cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	CCTCCTTCAGAAAGCCCTTCT	0.682																																					p.L397X		Atlas-Indel,Pindel	.											.	CBS	85	.	0			c.1189delC						PASS	.						74.0	73.0	73.0					21																	44479371		2203	4300	6503	SO:0001589	frameshift_variant	875	exon13			.	L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.1188delT	chr21.hg19:g.44479371delA	ENSP00000381231:p.Phe396fs	59.0	0.0	0		32.0	15.0	0.46875	NM_000071	B2R993|D3DSK4|Q99425|Q9BWC5	Frame_Shift_Del	DEL	ENST00000398165.3	hg19	CCDS13693.1																																																																																			.	.	.	none		0.682	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195525.1	NM_000071	
LRPAP1	4043	hgsc.bcm.edu	37	4	3519844	3519845	+	Frame_Shift_Ins	INS	-	-	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:3519844_3519845insC	ENST00000500728.2	-	5	813_814	c.667_668insG	c.(667-669)gagfs	p.E223fs	LRPAP1_ENST00000296325.5_5'UTR	NM_002337.3	NP_002328.1	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein associated protein 1	223					extracellular negative regulation of signal transduction (GO:1900116)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of protein binding (GO:0032091)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|protein folding (GO:0006457)|receptor-mediated endocytosis (GO:0006898)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum lumen (GO:0048237)|vesicle (GO:0031982)	asialoglycoprotein receptor activity (GO:0004873)|heparin binding (GO:0008201)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|unfolded protein binding (GO:0051082)|very-low-density lipoprotein particle receptor binding (GO:0070326)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		CTCCTTCAGCTCCGTGTGCCTG	0.634																																					p.E223fs		Atlas-Indel,Pindel	.											.	LRPAP1	29	.	0			c.668_669insG						PASS	.																																			SO:0001589	frameshift_variant	4043	exon5			.		CCDS3371.1	4p16.3	2008-05-02	2003-03-17		ENSG00000163956	ENSG00000163956			6701	protein-coding gene	gene with protein product		104225	"""low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)"""	A2MRAP		1712782	Standard	NM_002337		Approved	HBP44	uc003ghh.4	P30533	OTTHUMG00000090299	ENST00000500728.2:c.668dupG	chr4.hg19:g.3519846_3519846dupC	ENSP00000421922:p.Glu223fs	50.0	0.0	0		50.0	30.0	0.6	NM_002337	D3DVR9|Q2M310|Q53HQ3|Q53HS6	Frame_Shift_Ins	INS	ENST00000500728.2	hg19	CCDS3371.1																																																																																			.	.	.	none		0.634	LRPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206659.4		
HIRA	7290	hgsc.bcm.edu	37	22	19344494	19344495	+	Frame_Shift_Ins	INS	-	-	C			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr22:19344494_19344495insC	ENST00000263208.5	-	19	2570_2571	c.2314_2315insG	c.(2314-2316)ctcfs	p.L772fs	HIRA_ENST00000546308.1_Frame_Shift_Ins_p.L728fs|HIRA_ENST00000541063.1_Frame_Shift_Ins_p.L728fs|HIRA_ENST00000340170.4_Intron	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	772	Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.|Interaction with histone H4.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GGATGGCAGGAGGATGGGAGAG	0.594																																					p.L772fs		Atlas-INDEL	.											.	HIRA	100	.	0			c.2315_2316insG						PASS	.																																			SO:0001589	frameshift_variant	7290	exon19			.	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.2314_2315insG	chr22.hg19:g.19344494_19344495insC	ENSP00000263208:p.Leu772fs	96.0	0.0	0		125.0	34.0	0.272	NM_003325	Q05BU9|Q8IXN2	Frame_Shift_Ins	INS	ENST00000263208.5	hg19	CCDS13759.1																																																																																			.	.	.	none		0.594	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325	
TRIM49	57093	hgsc.bcm.edu	37	11	89531578	89531579	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr11:89531578_89531579delAT	ENST00000329758.1	-	8	1406_1407	c.1078_1079delAT	c.(1078-1080)atgfs	p.M360fs	TRIM49_ENST00000532501.2_Frame_Shift_Del_p.M283fs	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	360	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TTTCCGATACATATTACAGACA	0.436																																					p.360_360del		Atlas-Indel,Pindel	.											.	TRIM49	45	.	0			c.1079_1080del						PASS	.																																			SO:0001589	frameshift_variant	57093	exon8			.	AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.1078_1079delAT	chr11.hg19:g.89531580_89531581delAT	ENSP00000327604:p.Met360fs	265.0	0.0	0		254.0	85.0	0.334646	NM_020358	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Frame_Shift_Del	DEL	ENST00000329758.1	hg19	CCDS8287.1																																																																																			.	.	.	none		0.436	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358	
SPCS3	60559	hgsc.bcm.edu	37	4	177249348	177249349	+	Splice_Site	DEL	GG	GG	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr4:177249348_177249349delGG	ENST00000503362.1	+	5	523_524	c.410_411delGG	c.(409-411)agg>a	p.R137fs	SPCS3_ENST00000507001.1_3'UTR	NM_021928.3	NP_068747.1	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3 homolog (S. cerevisiae)	137					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			ovary(2)	2		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		TCTTTTTATAGGGGAAACAGGA	0.361																																					.		Pindel	.											.	SPCS3	15	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	60559	.			.	AK092634	CCDS54823.1	4q34.2	2008-02-05				ENSG00000129128			26212	protein-coding gene	gene with protein product						12477932	Standard	NM_021928		Approved	FLJ22649, SPC22/23, SPC3, YLR066W, PRO3567	uc003iur.4	P61009		ENST00000503362.1:c.411-1GG>-	chr4.hg19:g.177249350_177249351delGG		86.0	0.0	.		56.0	14.0	0.250	.	P12280|Q9H0S7	Splice_Site	DEL	ENST00000503362.1	hg19	CCDS54823.1																																																																																			.	.	.	none		0.361	SPCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362329.1	NM_021928	Frame_Shift_Del
RPN1	6184	hgsc.bcm.edu	37	3	128356918	128356918	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SX-A7SQ-01A-12D-A35Z-10	TCGA-SX-A7SQ-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2aa8e8d1-bc6d-4efa-82ef-120034ca6bcc	8ccf0feb-ec04-4877-b269-2a824a396344	g.chr3:128356918delA	ENST00000296255.3	-	3	405	c.357delT	c.(355-357)gttfs	p.V119fs	RPN1_ENST00000497289.1_5'UTR	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	119					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		GATCAAGAGCAACTGGGAGCT	0.458			T	EVI1	AML																																p.A120fs		Pindel	.		Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	.	RPN1	39	.	0			c.358delG						PASS	.						88.0	78.0	81.0					3																	128356918		2203	4300	6503	SO:0001589	frameshift_variant	6184	exon3			.		CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.357delT	chr3.hg19:g.128356918delA	ENSP00000296255:p.Val119fs	122.0	0.0	.		167.0	31.0	0.186	NM_002950	B2R5Z0|D3DNB6|Q68DT1	Frame_Shift_Del	DEL	ENST00000296255.3	hg19	CCDS3051.1																																																																																			.	.	.	none		0.458	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356934.2	NM_002950	
